Datasets:

clinicalnlplab

/

PubmedSumm_train

like 0

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ( dahuang in chinese ) is an endangered perennial herbaceous plant endemic to china , with a distribution mainly in qinghai , gansu provinces and west tibetan autonomous region at altitudes of 2,3004,200 m above sea level ; this plant is found along forest edges and in valleys ( yang , 1991 ; liu , 1997 ; li , 2003 ; wang and ren , 2009 ) . the roots and rhizomes of this plant officially listed in the chinese pharmacopoeia have been used in traditional medicine for over 2,000 years to treat various syndromes caused by circulatory problems ( e.g. , dysmenorrhoea , hypermenorrhea , hematemesis , lower abdominal pain , etc ) , jaundice , diarrhea and constipation ( yang , 1991 ; komatsu et al . , 2006 ; li et al . , 2006 ; chinese pharmacopoeia commission , 2010 ) . as a result of over - harvesting and destruction of its habitat by humans in recent decades , natural populations of r. tanguticum have declined dramatically ( hu et al . , 2010 ; wang , 2010 ) . this led to r. tanguticum being listed as a key protected plant of qinghai province by the government in 2009 ( the people s government of qinghai province , 2009 ) . the breeding system of r. tanguticum is outcrossing , with pollination probably involving wind and insects ( chen et al . , 2009 ) . the seed set and germination rates of r. tanguticum are very high ( xie x ( 2009 ) phd thesis , graduate university of the chinese academy of sciences , xining ) . since the 1960s , r. tanguticum has been extensively cultivated in its original area of production ( qinghai province ) . farmers usually randomly collect mature seeds directly from wild populations in local or distant areas , mix them together , and plant them in the fields . sometimes , the seeds are exchanged with relatives or friends , an activity that disperses the germplasm to other places . to date , most studies of r. tanguticum have focused on cultivation , tissue culture and analysis of the plant s chemical constituents ( zhang , 2004 ; che et al . , 2006 ; vanmen et al . , although previous reports have provided preliminary assessments of the genetic diversity of wild r. tanguticum ( chen et al . , 2009 ; hu et al . , 2010 ; wang et al , 2012b ) , there has been no report on the genetic diversity of cultivated populations . inter - simple sequence repeats ( issr ) are molecular markers with primers designed based on repeat motifs ( microsatellites ) of eukaryotic genomes that require no prior knowledge of dna sequence ( zietkiewicz et al . , 1994 ) . , issr has been successfully used to investigate the genetic diversity and relationships at species , population and cultivar levels in many plants , including some medicinal species ( tacuatia et al . , 2012 ; chen et al . , 2013 ; kumchai et al . , 2013 ; thriveni et al . , 2013 ; verma and rana , 2013 ) . in this study , we used issr markers to : ( 1 ) detect the level of genetic diversity and structure in five cultivated populations and ( 2 ) evaluate the possible impact of cultivation practices on the genetic diversity of r. tanguticum . the results obtained should be useful in developing strategies for efficient management of the genetic resources of r. tanguticum and for future breeding programs . fifty - eight individuals of r. tanguticum were sampled from five cultivated populations in qinghai province , china ( figure 1 ) . each population was positioned by gps , with the location details listed in table 1 . young leaf tissues were collected from individual plants located at least 10 m apart and then dried in silica gel . xuefeng lu and voucher specimens were deposited in the qinghai - tibetan plateau museum of biology , northwest institute of plateau biology , chinese academy of sciences . genomic dna was extracted using the modified cetyltrimethylammonium bromide ( ctab ) method described by doyle and doyle ( 1987 ) . the dna concentration was determined by comparing the sample with known standards of lambda dna in 0.8 % ( w / v ) agarose gels . the isolated genomic dna was diluted to 30 ng / l and stored at 20 c until issr amplification .9 ) were initially screened for pcr amplification and 13 primers that produced clear , reproducible banding patterns were chosen for final analysis ( table 2 ) . pcr amplifications were done in a 20 l reaction volume consisting of 30 ng of genomic dna , 3.0 mm mgcl2 , 0.1 mm dntp , 10 pmol of primer , 0.75 u of taq dna polymerase ( takara biotech co. , ltd . ) and 2.0 l of 10 pcr buffer . issr - pcr amplifications were done in a ptc - 221 thermocycler ( mj research , bio - rad , usa ) using the following program : an initial step of 5 min at 94 c followed by 20 s at 94 c , 60 s at the appropriate annealing temperature ( see table 2 for details ) and 80 s at 72 c for 38 cycles , with a final extension of 6 min at 72 c . the amplification products were separated in 1.5 % agarose gels stained with ethidium bromide and photographed with a gdp - 8000 system ( uvp inc . molecular weights were estimated using a 200 bp dna ladder ( takara biotech co. , ltd . ) . y = ( c , t ) ; b = ( c , g , t ) ; d = ( a , g , t ) ; h = ( a , g , t ) ; v = ( a , c , g ) . only unambiguously and reproducibly amplified issr bands were scored as present ( 1 ) or absent ( 0 ) . smeared and weak bands were excluded . the resulting binary data matrix was analyzed using popgene version 1.32 ( yeh et al . , 1999 ) to estimate the level of genetic diversity under the assumption of hardy - weinberg equilibrium . genetic diversity parameters , including the percentage of polymorphic bands ( ppb ) , the gene diversity index h ( nei , 1973 ) and shannon s information index ( i ) , were obtained at the species and population levels . gene differentiation between populations was estimated by the coefficient of gene differentiation ( gst ) and gene flow ( nm , the numbers of migrants per generation ) was calculated from gst according to mcdermott and mcdonald ( 1993 ) , where nm = 0.5 ( 1 gst ) / gst . to examine the genetic relationship among populations , unbiased genetic distance and genetic identity ( nei , 1978 ) were also calculated for all pairwise combinations of populations by popgene and a dendrogram was constructed from nei s genetic distance with the unweighted pair - group method of averages ( upgma ) using ntsyspc software ( rohlf , 2000 ) . to correct for possible bias introduced by the assumption of hardy - weinberg equilibrium , bayesian gene diversity ( hb ) and population differentiation ( b ) the bayesian method does not assume hardy - weinberg equilibrium within populations and does not treat multilocus issr phenotypes as haplotypes , but takes full advantage of the information provided by dominant markers . this allows the incorporation of uncertainty regarding the magnitude of the within - population inbreeding coefficient into estimates of fst ( holsinger and wallace , 2004 ; zhang et al . , 2007 ) . several runs were done with default sample parameters ( burn - in = 5000 , sample = 100000 , thin = 20 ) to ensure consistency of the results ( tero et al . , 2003 ) . model selection was based on the deviance information criterion ( dic ) ( spiegelhalter et al . , 2002 ) in which models with smaller dics are preferred ( holsinger and lewis , 2003 ) . an additional measurement for partitioning genetic variation was obtained with the hierarchical analysis of molecular variance analysis ( amova ) , using amova 1.55 ( excoffier et al . , the mantel test was used in conjunction with tfpga software to examine the correlation between genetic and geographic distances ( in kilometers ) among populations ( miller , 1997 ) . a bayesian analysis of issr population structure was run on the data set using the program structure ( pritchard et al . , 2000 ) to estimate the number of genetic clusters and to evaluate the degree of admixture among them . this method uses a markov chain monte carlo ( mcmc ) algorithm to cluster individuals into populations on the basis of multilocus genotype data ( falush et al . , 2003 ) . structure was run with a burn - in setting of 10,000 followed by 10,000 mcmc iterations using the admixture model with allele frequencies independent among populations . the most likely value for k was calculated with structure harvester ( earl and vonholdt , 2012 ) by predicting from plots of ad hoc posterior probability models of k . the k statistic was more appropriate than the highest lnpr ( x / k ) method for inferring the population number ( evanno et al . , 2005 ) . once the number of clusters was determined , individuals were assigned to respective populations based on proportional membership ( q ) for which an arbitrary threshold value of q = 0.90 was used . individuals with q 0.90 were regarded as members of this cluster , or otherwise as an admixture . fifty - eight individuals of r. tanguticum were sampled from five cultivated populations in qinghai province , china ( figure 1 ) . each population was positioned by gps , with the location details listed in table 1 . young leaf tissues were collected from individual plants located at least 10 m apart and then dried in silica gel . xuefeng lu and voucher specimens were deposited in the qinghai - tibetan plateau museum of biology , northwest institute of plateau biology , chinese academy of sciences . genomic dna was extracted using the modified cetyltrimethylammonium bromide ( ctab ) method described by doyle and doyle ( 1987 ) . the dna concentration was determined by comparing the sample with known standards of lambda dna in 0.8 % ( w / v ) agarose gels . the isolated genomic dna was diluted to 30 ng / l and stored at 20 c until issr amplification .9 ) were initially screened for pcr amplification and 13 primers that produced clear , reproducible banding patterns were chosen for final analysis ( table 2 ) . pcr amplifications were done in a 20 l reaction volume consisting of 30 ng of genomic dna , 3.0 mm mgcl2 , 0.1 mm dntp , 10 pmol of primer , 0.75 u of taq dna polymerase ( takara biotech co. , ltd . ) and 2.0 l of 10 pcr buffer . issr - pcr amplifications were done in a ptc - 221 thermocycler ( mj research , bio - rad , usa ) using the following program : an initial step of 5 min at 94 c followed by 20 s at 94 c , 60 s at the appropriate annealing temperature ( see table 2 for details ) and 80 s at 72 c for 38 cycles , with a final extension of 6 min at 72 c . the negative control consisted of replacing template dna with ddh2o to test for contamination . the amplification products were separated in 1.5 % agarose gels stained with ethidium bromide and photographed with a gdp - 8000 system ( uvp inc . molecular weights were estimated using a 200 bp dna ladder ( takara biotech co. , ltd . ) . y = ( c , t ) ; b = ( c , g , t ) ; d = ( a , g , t ) ; h = ( a , g , t ) ; v = ( a , c , g ) . only unambiguously and reproducibly amplified issr bands were scored as present ( 1 ) or absent ( 0 ) . smeared and weak bands were excluded . the resulting binary data matrix was analyzed using popgene version 1.32 ( yeh et al . , 1999 ) to estimate the level of genetic diversity under the assumption of hardy - weinberg equilibrium . genetic diversity parameters , including the percentage of polymorphic bands ( ppb ) , the gene diversity index h ( nei , 1973 ) and shannon s information index ( i ) , were obtained at the species and population levels . gene differentiation between populations was estimated by the coefficient of gene differentiation ( gst ) and gene flow ( nm , the numbers of migrants per generation ) was calculated from gst according to mcdermott and mcdonald ( 1993 ) , where nm = 0.5 ( 1 gst ) / gst . to examine the genetic relationship among populations , unbiased genetic distance and genetic identity ( nei , 1978 ) were also calculated for all pairwise combinations of populations by popgene and a dendrogram was constructed from nei s genetic distance with the unweighted pair - group method of averages ( upgma ) using ntsyspc software ( rohlf , 2000 ) . to correct for possible bias introduced by the assumption of hardy - weinberg equilibrium , bayesian gene diversity ( hb ) and population differentiation ( b ) the bayesian method does not assume hardy - weinberg equilibrium within populations and does not treat multilocus issr phenotypes as haplotypes , but takes full advantage of the information provided by dominant markers . this allows the incorporation of uncertainty regarding the magnitude of the within - population inbreeding coefficient into estimates of fst ( holsinger and wallace , 2004 ; zhang et al . , 2007 ) . several runs were done with default sample parameters ( burn - in = 5000 , sample = 100000 , thin = 20 ) to ensure consistency of the results ( tero et al . , 2003 ) . model selection was based on the deviance information criterion ( dic ) ( spiegelhalter et al . , 2002 ) in which models with smaller dics are preferred ( holsinger and lewis , 2003 ) . an additional measurement for partitioning genetic variation was obtained with the hierarchical analysis of molecular variance analysis ( amova ) , using amova 1.55 ( excoffier et al . , 1992 ) . the mantel test was used in conjunction with tfpga software to examine the correlation between genetic and geographic distances ( in kilometers ) among populations ( miller , 1997 ) . a bayesian analysis of issr population structure was run on the data set using the program structure ( pritchard et al . , 2000 ) to estimate the number of genetic clusters and to evaluate the degree of admixture among them . this method uses a markov chain monte carlo ( mcmc ) algorithm to cluster individuals into populations on the basis of multilocus genotype data ( falush et al . , structure was run with a burn - in setting of 10,000 followed by 10,000 mcmc iterations using the admixture model with allele frequencies independent among populations . the most likely value for k was calculated with structure harvester ( earl and vonholdt , 2012 ) by predicting from plots of ad hoc posterior probability models of k . the k statistic was more appropriate than the highest lnpr ( x / k ) method for inferring the population number ( evanno et al . , 2005 ) . once the number of clusters was determined , individuals were assigned to respective populations based on proportional membership ( q ) for which an arbitrary threshold value of q = 0.90 was used . individuals with q 0.90 were regarded as members of this cluster , or otherwise as an admixture . the 13 selected primers generated 320 issr bands in 58 individuals from five populations of r. tanguticum , 263 ( 82.2 % ) of which were polymorphic ( table 3 ) . the total number of bands varied from 22 ( ubc836 ) to 29 ( ubc834 ) , with an average of 24.6 fragments per primer . the percentage of polymorphic bands ( ppb ) ranged from 42.8 % in the zm population to 51.8 % in the dhg population ( table 3 ) . in terms of the presence of alleles within the 320 alleles detected , there were 57 common alleles in the five populations but no unique allele was found for any of the five populations studied . h - nei s gene diversity ( assuming hardy - weinberg equilibrium ) , hb - expected bayesian heterozygosity ( without assuming hardy - weinberg equilibrium ) ; i - shannon s diversity index ; ppb - percentage of polymorphic bands , se - standard error and sd - standard deviation . the value of nei s gene diversity ( h ) was 0.2498 and shannon s information index ( i ) was 0.3812 at the species level while at the populations level the corresponding values were 0.1813 and 0.2677 , respectively . the estimates of heterozygosity ( hb ) in the full model ( which had the lowest dic , table 4 ) based on the bayesian procedure were generally higher than nei s gene diversity ( h ) . the expected bayesian heterozygosity ( hb ) was 0.3231 at the species level and 0.2712 at the population level . among all the populationsinvestigated , the highest and lowest levels of genetic variability occurred in populations dhg ( h = 0.1949 , i = 0.2878 ) and zm ( h = 0.1671 , i = 0.2445 ) , respectively . genetic differentiation calculated among populations of r. tanguticum using different bayesian approaches . b - analogous to wright s fst , f - analogous to wright s fis , dic - deviance information criterion and sd - standard deviation . the genetic differentiation among populations ( gst ) , estimated by nei s method , was 0.2742 , which indicated that 27.4 % of the total genetic diversity was distributed among populations , whereas 72.6 % occurred within populations . furthermore , the level of gene flow ( nm ) was estimated to be 1.3236 individuals per generation between populations , suggesting that gene exchange between populations was high . amova analysis further revealed a similar pattern of genetic differentiation among and within the populations ( table 5 ) . of the total variation , 23.9 % was attributed to among - population differences , a value much lower than the within - population proportion ( 76.1 % ) . amova also showed that differentiation among populations and within populations was significant ( p 0.0010 ) . analysis of molecular variance ( amova ) for wild , cultivated and all populations of r. tanguticum examined in this work . significance tests after 1,000 permutations . the results for b ( analogous to wright s fst ) estimated by the bayesian analysis are shown in table 4 . the best model , which had the smallest dic ( 3876.31 ) , was the full model , with b = 0.1963 and f = 0.0886 . the upgma dendrogram , based on nei s ( 1978 ) unbiased genetic distance , is shown in figure 2 . the populations were separated into three groups : hm and qj formed group i , dhg formed group ii and group iii contained nx and zm . the mantel test revealed no significant correlation between genetic and geographic distances among populations ( r = 0.1176 , p = 0.3686 ) . the highest peak in k revealed the best value for k = 3 indicated that three clusters were detected ( k = 9.10 , figure 3a ) . these clusters were entirely consistent with those of the upgma clustering results ( figure 3b ) . ( a ) k was estimated from plots of ad hoc posterior probability models of k . ( b ) bayesian admixture proportions ( q ) of individuals of cultivated r. tanguticum for k = 3 . each individual is represented by a single line broken into k colored segments , with lengths proportional to each of the k - inferred clusters . in this study , the genetic diversity parameter for cultivated populations of r. tanguticm ( h = 0.1813 , table 3 ) was similar to that of wild populations ( h = 0.1724 ) ( hu et al . , 2010 ) , as assessed with issr markers . however , the genetic diversity was lower than with ssr markers ( h = 0.5150 ) in wild r. tanguticum ( chen et al . , 2009 ) . when compared to those of allied species of polygonaceae , such as rheum officinale ( h = 0.1008 ) ( wang et al . , 2012a ) , polygonum viviparum ( h = 0.1227 ) ( lu et al . , 2008 ) and eriogonum shockleyi var . shockleyi ( h = 0.1620 ) ( smith and bateman , 2002 ) , the genetic diversity in cultivated populations of r. tanguticum was high . the genetic diversity of plant populations is largely influenced by factors such as breeding system , seed dispersal , genetic drift and evolutionary history , as well as life form . life form and breeding system have highly significant influences on genetic diversity . in general , long - lived and outcrossing species have higher levels of genetic diversity than selfing and clonal plants ( hamrick and godt , 1996 ) . bayesian analysis revealed that the inbreeding coefficient ( f = 0.0886 ) in r. tanguticum was small , a finding that confirmed the outcrossing breeding system of this species . outcrossing and elevated longevity contribute to the moderately high level of genetic diversity in r. tanguticum . notably , the current high level of genetic diversity in cultivated r. tanguticum may be markedly influenced by the traditional , irregular and sparse agricultural practices of this plant . traditionally , growers collect and preserve r. tanguticum seeds randomly without deliberate selection and mix them together before planting . the domestication history is short , there is no artificial selection and cultivation apparently does not influence genetic diversity . in cultivated populations , genetic diversityis partly determined by the way genetic material is passed from one cultivated generation to the next ( miller and schaal , 2006 ; yao et al . , 2012 ) . for r. tanguticum , seeds are the main genetic material used to establish the cultivated population . cultivated r. tanguticum may have been established from the seeds of a large number of wild progenitors . according to local growers , r. tanguticumthe value of q in 10 individuals was 0.90 ( figure 3b ) , indicating that the origins of these 10 individuals differed from that of other individuals in the same population . the seeds of this population were collected from different places in golog prefecture and mixed together . the frequent exchange of seeds further improves the maintenance of genetic diversity ( guo et al . , 2007 ; yao et al . , 2012 ) . consequently , traditional agricultural practice applied to this plant was another important factor that influenced the abundant genetic diversity of cultivated r. tanguticum . compared to annual plants , cultivated populations of some perennial plantsmay harbor a relatively higher percentage of genetic diversity than their wild ancestors ( otero - arnaiz et al . , 2005 ; miller and schaal , 2006 ; he et al . , 2009 ) . our findings were similar to several other long - lived cultivated plants in which genetic diversity is as high as in the wild relatives ( he et al . , 2007 ; shi et al . , 2008 ) . cultivated r. tanguticum had moderate levels of genetic diversity compared with cultivated populations of other endangered chinese medicinal plants ( table 6 ) ( wu et al . , 2006 ; guo et al . , 2007 ; qiu et al . , 2009 ; yao et al . , 2012 ) , i.e. , there was no evidence that a cultivation bottleneck or founder effect affected the genetic diversity . comparison of genetic diversity of cultivated r. tanguticum with other important herbs in cultivated populations . hp - nei s gene diversity at the population level , hs - nei s gene diversity at the species level , ppbp - percentage of polymorphic loci at the population level and ppbs - percentage of polymorphic loci at the species level . in contrast , annual and selfing species allocate most of their genetic variability among populations ( hamrick and godt , 1996 ; nybom , 2004 ) . amova results revealed that in cultivated r. tanguticum 76.1 % of the genetic variance was retained within populations while 23.9 % was among populations ( table 5 ) . in the long - lived tree spondias purpurea , the proportion of genetic variation distributed among populations was greater in cultivated populations than in wild populations , a reflection of the relative amounts of vegetative propagation ( miller and schaal , 2006 ) . cultivated populations ( gst = 0.2742 , st = 0.239 ) had a lower proportion of their genetic variability distributed among populations than wild populations ( gst = 0.3585 , st = 0.290 ) ( hu et al . , 2010 ) . bayesian analysis revealed that the inbreeding coefficient ( f = 0.0886 ) in r. tanguticum was small . based on the records of local growers , these cultivated r. tanguticum were grown from seeds rather than being propagated vegetatively . thus , the mating system was outcrossing in cultivated populations , the same as in wild populations . structure analysis showed that 10 individuals were admixtures with q 0.90 ( figure 3b ) , indicating that cultivated r. tangutium had been introduced to cultivation from the seeds of a large number of wild progenitors . the planting records revealed that the germplasm had been dispersed to other places by the growers , with mixing and exchanging of seeds before planting . the frequent exchange of seeds enhanced the gene flow from wild populations into cultivated populations . subsequently , the genetic variation within populations increased while that among populations decreased in cultivated populations . the findings of this study indicate that r. tanguticum has maintained a relatively high level of genetic diversity in cultivated populations that may play a crucial role in conserving this species in the face of declining wild populations . a short cultivation history and no artificial selection do not decrease the genetic diversity of r. tanguticum and no special cultivar is formed . the primitive agricultural practices , i.e. , random collecting , preserving and planting of seeds without deliberate selection may be an effective way of maintaining and conserving the gene pools of wild plants ( guo et al . , 2007 ; 2010 ) . furthermore , given that the genetic diversity of the qj cultivated populations of r. tanguticum was relatively higher than that of wild populations at the population level , the current planting at this site can be seen as a preliminary step for ex situ conservation . additionally , other effective approaches , such as good agricultural practice ( gap ) , also need be adopted to meet the market demand and achieve future sustainable use of this medicinal plant .\noutput:\n" }, { "from": "agent", "value": "to examine whether cultivation reduced genetic variation in the important chinese medicinal plant rheum tanguticum , the levels and distribution of genetic variation were investigated using issr markers . fifty - eight r. tanguticum individuals from five cultivated populations were studied . thirteen primers were used and a total of 320 dna bands were scored . high levels of genetic diversity were detected in cultivated r. tanguticum ( ppb = 82.19 , h = 0.2498 , hb = 0.3231 , i = 0.3812 ) and could be explained by the outcrossing system , as well as long - lived and human - mediated seed exchanges . analysis of molecular variance ( amova ) showed that more genetic variation was found within populations ( 76.1 % ) than among them ( 23.9 % ) . this was supported by the coefficient of gene differentiation ( gst = 0.2742 ) and bayesian analysis ( b = 0.1963 ) . the mantel test revealed no significant correlation between genetic and geographic distances among populations ( r = 0.1176 , p = 0.3686 ) . upgma showed that the five cultivated populations were separated into three clusters , which was in good accordance with the results provided by the bayesian software structure ( k = 3 ) . a short domestication history and no artificial selection may be an effective way of maintaining and conserving the gene pools of wild r. tanguticum ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is well known that patients with chronic pancreatitis may develop massive ascites , termedpancreatic ascites , as a complication , and this disease also occurs in patients with acute pancreatitis or pancreatic trauma . however , since the first report by davis and kelsy in 1951 , this disease has been recognized widely and many cases have been reported in the literature . pancreatic ascites occurs due to leakage of pancreatic juices from a ruptured pseudocyst or directly from ductal disruption , and is associated with a high morbidity and mortality . the diagnosis of pancreatic ascites is made by medical examination , diagnostic imaging and analysis of the ingredients of ascites . to make an accurate diagnosis is thought to be comparatively easy when a high level of amylase is proven in ascites . the treatment of this disease depends on the cause , and conservative therapies , endoscopic therapies and surgical therapies are adopted . the prognosis of this disease is good if appropriate treatments are performed and if the cause of this disease , such as pancreatic trauma as well as chronic and acute pancreatitis , is well controlled . herein we report our rare case of pancreatic ascites , who was treated successfully but in whom we failed to make an accurate diagnosis , with a review of the literature . a 39 - year - old man was referred to our hospital for the investigation of abdominal fluid collection . he had no symptoms before this admission , but he was pointed out to have alcoholic chronic pancreatitis with calcification and multiple pseudocysts by medical checkup . laboratory data on admission showed high levels of c - reactive protein at 12.4 mg / dl ( normal 0.3 ) , a white blood cell count at 2010 / mm ( normal 3.99.310 ) , direct bilirubin at 2.2 mg / dl ( normal 0.21.0 ) , amylase at 185 iu / l ( normal 36120 ) , low levels of red blood cells at 17610 / mm ( normal 40054010 ) and hemoglobin at 6.7 g / dl ( normal 1216 ) . abdominal computed tomography demonstrated huge fluid collection pressing on the visceral organs , multiple pancreatic pseudocysts and pancreatic calcification ( fig .1 ) . the fluid showed a high level of amylase at 4,490 iu / l . under the diagnosis of pancreatic ascites , at first conservative therapy and continuous fluid drainage was done , but reduction of discharge was not observed . endoscopic pancreatic stent insertion was attempted but was unsuccessful . under the diagnosis of pancreatic ascites caused by disruption of the pancreatic duct and rupture of a pancreatic pseudocyst , surgical treatment was attempted . at laparotomy , a huge amount of fluid containing bile acid ( amylase at 1,474 iu / l and bilirubin at 13.5 mg / dl ) was found to exist in the extraperitoneal space ( over the peritoneum ) ( fig . extraperitoneal fluid collection due to chronic pancreatitis was diagnosed , and frey procedure , cystojejunostomy , cholecystectomy and t tube placement in the common bile duct were performed . his postoperative course was uneventful and he has shown no recurrence of the fluid for 2 years . pancreatic ascites often occurs in alcoholic patients who have chronic pancreatitis , although it has also been observed after acute pancreatitis or pancreatic trauma . men are affected twice as frequently as women and most patients are between 20 and 50 years old . as described above , patients with pancreatic ascites sometimes lack specific complaints , which makes an accurate diagnosis difficult . pancreatic ascites must be distinguished from the ascites of liver cirrhosis , tuberculosis and metastatic carcinoma . elevated protein and amylase levels in the ascitic fluid lead to the accurate diagnosis . an amylase level above 1,000 iu / l along with a protein measurement 3 g / dl is diagnostic of pancreatic ascites . in our case , we diagnosed the patient as having pancreatic ascites because of the high amylase level of ascites , his past history and the computed tomography findings with chronic pancreatitis and pseudocysts . until now , the causes of pancreatic ascites are not fully understood . it is thought to result from disruption of the main pancreatic duct , rupture of a pancreatic pseudocyst or possibly leakage from an unknown site . the disruption or rupture is caused by increased pressure within the pancreatic duct or pseudocyst , with an acute inflammatory reaction of the chronic pancreatitis . other proposed etiologies include blockage of the pancreatic lymphatics in the retroperitoneal space , portal venous obstruction from extrinsic pancreatic pressure , chemical effects of released pancreatic secretions on the peritoneal cavity membranes and local release of vasoactive peptides . in our case , we found many pancreatic stones and pseudocysts , so the disruption or rupture occurred because of the increased pressure within the pancreatic duct or pseudocyst . the treatment of pancreatic ascites depends on the cause . for patients with pancreatic ascites secondary to trauma , early surgical repair is recommended . in cases of alcoholic pancreatitisconservative therapies such as elemental diet , parenteral nutrition , paracentesis , continuous percutaneous drainage and somatostatin analogues are selected . when these therapies end in failure , endoscopic or surgical procedure is adopted . in our case , . reported a case of extraperitoneal fluid collection and liver displacement , but its mechanism and the origin of the fluid was not reported clearly . thinking about the mechanism of our case , at first , a pancreatic pseudocyst penetrated into the hepatoduodenal ligament . at the same time , increased pressure within the common bile duct by pancreas head inflammation or direct chemical stimulation of the pancreatic juice caused perforation of the common bile duct , and at last , the fluid flowed into the round ligament of the liver and next into the extraperitoneal space . the perirenal space communicates with the bare area of the liver , so this route is the next candidate , but our case must have been different because of the location of the pseudocysts and the presence of bile in the fluid . herein we report a rare case of extraperitoneal pancreatic fluid collection caused by the chronic pancreatitis . this complication is rare , but we believe that our experience will be helpful when physicians see patients with pancreatic ascites .\noutput:\n" }, { "from": "agent", "value": "a 39 - year - old man was referred to our hospital for the investigation of abdominal fluid collection . he was pointed out to have alcoholic chronic pancreatitis . laboratory data showed inflammation and slightly elevated serum direct bilirubin and amylase . an abdominal computed tomography demonstrated huge fluid collection , multiple pancreatic pseudocysts and pancreatic calcification . the fluid showed a high level of amylase at 4,490 iu / l . under the diagnosis of pancreatic ascites , endoscopic pancreatic stent insertion was attempted but was unsuccessful , so surgical treatment ( frey procedure and cystojejunostomy ) was performed . during the operation , a huge amount of fluid containing bile acid ( amylase at 1,474 iu / l and bilirubin at 13.5 mg / dl ) was found to exist in the extraperitoneal space ( over the peritoneum ) , but no ascites was found . his postoperative course was uneventful and he shows no recurrence of the fluid . pancreatic ascites is thought to result from the disruption of the main pancreatic duct , the rupture of a pancreatic pseudocyst , or possibly leakage from an unknown site . in our extremely rare case , the pancreatic pseudocyst penetrated into the hepatoduodenal ligament with communication to the common bile duct , and the fluid flowed into the round ligament of the liver and next into the extraperitoneal space ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: these molecules are implicated in several processes , including adult hippocampal neurogenesis , neuronal firing activity , the formation of the synaptic cleft , the enhancement of neuronal plasticity , and the regulation of mitochondrial dynamics . in this context , the ligand wnt5a has been described as an important regulator of several neuronal processes , including protection against amyloid aggregation , dendritic spine formation , expression of micrornas , and regulation of synaptic currents . together , these results highlight the importance of wnt5a in neuronal function . deregulation of wnt signaling by either loss or gain of function is associated with the progression of various diseases , including cancer , diabetes mellitus type ii , and neurodegenerative diseases , such as parkinson 's and alzheimer 's disease ( ad ) . in recent years , several reports have suggested a new role for wnt signaling as a regulator of metabolic pathways . this idea has been proposed based on the indirect effects of wnt signaling on other regulators / sensors of glucose metabolism , including phosphoinositide 3 - kinase ( pi3k ) and amp - activated protein kinase ( ampk ) , which are both involved in sensing the general metabolic state . in brain tissue , glucose is oxidized through glycolysis / oxidative phosphorylation to produce atp , most of which is consumed by neurons during the restoration of ion gradients that are disrupted by synaptic transmission . decreased glucose utilization by brain cells has been directly correlated with several brain pathologies , including ad . by contrast , enhancing glucose utilization in vivo induces significant improvements in cognitive functions , including memory and learning . despite the importance of glucose metabolism in brain function , no studies have described the effect of the wnt5a pathway on glucose metabolism in cortical neurons . in the present study , we demonstrate that wnt5a stimulates glucose uptake , increases glycolytic rate , and stimulates the pentose phosphate pathway ( ppp ) in neurons . additionally , wnt5a treatment increases the activity of regulatory enzymes , such as hexokinase ( hk ) and glucose -6-phosphate dehydrogenase ( g6pdh ) . the effect of wnt5a was dependent on the production of nitric oxide ( no ) . these results suggest that the activation of wnt signaling plays a central role in the regulation of neuronal metabolism and that this effect could be important for the correct function of the neuronal network . the dissection was performed on samples immersed in dissection buffer containing 10 mm hepes ( ph 7.4 , 320 mosm / l ) . the tissues were incubated with 0.25 % trypsin - 0.2 % edta ( w / v ) for 15 min at 37c and then triturated to homogeneity with a fire - polished pasteur pipette . the cells were seeded in poly - d - lysine - coated culture dishes at a density of 510 cells / cm and cultured in dulbecco 's modified eagle 's medium ( dmem ) ( invitrogen , usa ) containing 10 % ( v / v ) fetal bovine serum ( thermo fisher scientific inc . after 30 min , the culture medium was changed to neurobasal ( neub ) medium supplemented with b27 ( invitrogen , usa ) , 2 mm l - glutamine , 100 u / ml penicillin , 100 mg / ml streptomycin , and 2.5 mg / ml fungizone ( thermo fisher scientific inc . for all the experiments , the cells were used after 7 days in vitro . control and wnt5a - conditioned mediawere prepared from control l cells ( american type culture collection ( atcc ) : crl - 2648 ) and l - wnt5a cells ( atcc : crl2814 ) , respectively ; the cells were cultured according to the protocol described by atcc . briefly , the cells were grown to 70 % confluence in mem supplemented with 10 % fbs . the medium containing the wnt ligand was recovered ( batch 1 ) , and this process was repeated with the same cells after an additional 4 days in culture ( batch 2 ) . then , batches 1 and 2 of the conditioned media were combined . the neurons were cultured in neub supplemented with b27 until the day of the experiments . before the treatment with the wnt ligand , the cells were maintained in neub without b27 for 1 h ( to avoid the possible effects of the growth factors present in b27 ) . then , the cells were incubated with control or wnt5a media ( 1 - 2 h ) . the neurons were also treated with inhibitors of wnt signaling ; the inhibitors were coincubated with the control media or wnt5a media . the inhibitors used were fzcrd - 2 ( 5 ng / ml , antagonist of wnt ligands ) , kn - 93 ( 10 m , inhibitor of cam kinase ii ) , g6976 ( 200 nm , inhibitor of pkc ) , and 7 - nitroindazole ( 7 - ni ; 5 m , inhibitor of nitric oxide synthases ) . all the wnt inhibitors were obtained from sigma - aldrich , usa . the neurons were also treated with inhibitors of glucose metabolism , such as cytochalasin b ( cyt b , 20 m , inhibitor of glucose transporters ( gluts ) ) , cytochalasin e ( cyt e , 20 m , control of the action of cyt b ) , 2 - deoxy - d - glucose ( 2 - dg , 7 mm , competitive inhibitor of hk ) , and dichloroacetate ( dca , 5 mm , inhibitor of glycolysis that blocks the activity of the pyruvate dehydrogenase complex ) . moreover , we treated the neurons with sodium nitroprusside ( snp , 0800 nm ) , a no donor . in all cases , the neurons were treated with the inhibitors for 30 min prior to the experiment with or without the wnt5a media . after the treatment with wnt5a in the presence or absence of wnt inhibitors , the neurons were carefully selected using a microscope to ensure that only plates containing cultures of uniformly growing neurons were used . following incubation with the wnt ligand , the cells were washed with incubation buffer ( 15 mm hepes , 135 mm nacl , 5 mm kcl , 1.8 mm cacl2 , and 0.8 mm mgcl2 ) supplemented with 0.5 mm glucose . uptake was measured at room temperature by the addition of 11.2 ci of 2 - deoxy - d - [ 1,2 - ( n ) h ] glucose ( [ 2 - h ] - dg ) at a final specific activity of 13 disintegrations / min / pmol ( approximately 1 mci / mmol ) . uptake was stopped by washing the cells with ice - cold pbs supplemented with 1 mm hgcl2 . the cells were incubated with the glucose metabolism inhibitors for 30 min in the presence of a radioactive substrate . for the slice experiments , the slices were incubated with ( [ 2 - h ] - dg ) for a specific period , and then a standard methodology was used . the kinetic parameters were determined using a single rectangular hyperbola of the form vmax [ glc ] / ( km + [ glc ] ) , which was adjusted to the data by nonlinear regression using sigmaplot 12 . the ( [ 2 - h ] - dg ) was purchased from perkinelmer , usa . after treatment with the wnt ligand , the neurons were washed with pbs , treated with trypsin / edta , and centrifuged at 500 g for 5 min at 4c . then , the cells were resuspended at a 1 : 3 dilution in isolation medium ( 250 mm sucrose , 20 mm hepes , 10 mm kcl , 1.5 mm mgcl2 , 1 mm edta , 1 mm dtt , 2 mg / ml aprotinin , 1 mg / ml pepstatin a , and 2 mg / ml leupeptin ) , sonicated at 4c , and then centrifuged at 1,500 g for 5 min at 4c . the purified fraction was mixed with the reaction medium ( 25 mm tris - hcl , 1 mm dtt , 0.5 mm nadp / na , 2 mm mgcl2 , 1 mm atp , 2 u / ml g6pdh , and 10 mm glucose ) and incubated for 30 min at 37c . the reaction was stopped by the addition of 10 % trichloroacetic acid ( tca ) , and nadph production was measured at 340 nm . after treatment with wnt5a , the cells were detached from the culture plates using trypsin / edta ( sigma - aldrich , usa ) . next , the neurons were placed in tubes containing 5 mm glucose and then washed twice in krebs henseleit solution ( 11 mm na2hpo4 , 122 mm nacl , 3.1 mm kcl , 0.4 mm kh2po4 , 1.2 mm mgso4 , and 1.3 mm cacl2 , ph 7.4 ) , containing the appropriate concentration of glucose . after equilibration in 0.5 ml of hank 's balanced salt solution / glucose at 37c for 10 min , 0.5 ml of hank 's balanced salt solution containing various concentrations of [ 3 - h ] glucose was added , with a final specific activity of 13 disintegrations / min / pmol ( approximately 1 mci / mmol ) . aliquots of 100 l were then transferred to another tube , placed inside a capped scintillation vial containing 0.5 ml of water , and incubated at 45c for 48 h. after this vapor - phase equilibration step , the tube was removed from the vial , a scintillation mixture was added , and the h2o content was measured by scintillation counting over a 5 min period . the [ 3 - h ] glucose was obtained from perkinelmer , usa . the cell viability after the experiment was approximately 90 % . after treatment with the respective compound , the cells were washed with pbs , collected by scraping in 0.25 % trypsin - 0.2 % edta ( w / v ) , and pelleted . subsequently , the pellet was discarded , and the supernatant was further separated by centrifugation at 13,000 g for 30 min at 4c . finally , the supernatant was used to quantify the g6pdh activity in a reaction buffer consisting of 1 mm atp and 10 mm glucose -6-phosphate ( g6p ) after a 30 - min incubation at 37c . the reaction was stopped by the addition of 10 % tca , and the nadph production was measured at 340 nm . glucose oxidation via the ppp was measured using a previously described method , which is based on the difference in co2 production from [ 1 - c ] glucose ( decarboxylated in the 6 - phosphogluconate dehydrogenase - catalyzed reaction and in the krebs cycle ) and [ 6 - c ] glucose ( only decarboxylated in the krebs cycle ) . after the treatment with wnt5a in the presence or absence of inhibitors , the medium was removed , and the neurons were washed with ice - cold pbs and collected by trypsinization . the cell pellets were resuspended in o2 - saturated krebs henseleit buffer ( 11 mm na2hpo4 , 122 mm nacl , 3.1 mm kcl , 0.4 mm kh2po4 , 1.2 mm mgso4 , and 1.3 mm cacl2 , ph 7.4 ) , and 500 l of this suspension ( ~ 10 cells ) was placed in erlenmeyer flasks with 0.5 ml of the krebs henseleit solution containing 0.5 ci d - [ 1 - c ] glucose or 2 ci d - [ 6 - c ] glucose and 5.5 mm d - glucose ( final concentration ) . the erlenmeyer flasks were equipped with a central well containing an eppendorf tube with 500 l of benzethonium hydroxide . the flasks were flushed with o2 for 20 s , sealed with rubber caps , and incubated for 60 min in a 37c water bath with shaking . the incubations were stopped by the injection of 0.2 ml of 1.75 m hclo4 into the main well , although shaking was continued for an additional 20 min to facilitate co2 trapping by benzethonium hydroxide . both [ 1 - c ] glucose and [ 6 - c ] glucose were purchased from perkinelmer , usa . after the treatment with wnt5a , we measured the atp levels in whole - cell lysates of primary neurons using an atp determination kit ( invitrogen / molecular probes ) . the animals were housed at the animal house facility of the facultad de ciencias biolgicas , pontificia universidad catlica de chile , in accordance with the guide for the care and use of laboratory animals ( nih - usa publication 86 - 23 ) . transverse slices ( 350 m ) from the dorsal hippocampus were cut in cold artificial cerebrospinal fluid ( acsf , 119 mm nacl , 26.2 mm nahco3 , 2.5 mm kcl , 1 mm nah2po4 , 1.3 mm mgcl2 , and 10 mm glucose ) using a vibroslice microtome ( world precision instruments ) and incubated in acsf for 1 h at room temperature . the experiments were performed in a recording chamber at room temperature ( 2022c ) . all the experiments were performed with an n of 5 ; we used triplicates for each condition of each experiment . the data were analyzed by one - way or two - way analysis of variance ( anova ) followed by bonferroni 's post hoc test ; p 0.05 and p 0.01 were considered significant . the activation of the noncanonical wnt pathway was determined by monitoring the p - pkc levels . we observed a 1.5-fold increase in the p - pkc / pkc ratio after 2 h of wnt5a treatment , and this increase was blocked by the wnt scavenger fzcrd - 2 ( data not shown ) . the first step of glucose metabolism is the uptake of glucose from the extracellular media into the cell . we used 2 - deoxyglucose ( 2 - dg ) , a radioactive analog of glucose , to study glucose uptake . in the brain , glucose is taken up by glucose transporters ( gluts ) and phosphorylated by the enzyme hk , but it is not further metabolized . under control conditions , we observed a time - dependent uptake of 2 - dg , with a maximum of 19.23.5 nmol 10 cells at 90 sec . after the wnt5a treatment , the 2 - dg uptake increased , with a maximum of 39.45.3 nmol 10 cells at 90 sec . wnt pathway activation triggered a 2-fold increase in 2 - dg uptake , with a significant difference at 15 sec . treatment with the glut inhibitor cyt b ( 20 m ) decreased 2 - dg uptake to 1.560.4 nmol 10 cells at 90 sec ( figure 1 ( a ) ) . incubation with wnt5a during the initial phase of monitoring induced an increase in uptake from 9.91.5 nmol 10 cells to 20.82.0 nmol 10 cells ; this increase was blocked by the coincubation with fzcrd - 2 . interestingly , we observed that 7 - ni , an inhibitor of neuronal no synthase ( nnos ) , blocked the effect of wnt5a , suggesting that the effect of this ligand was mediated by the intracellular release of ca followed by the downstream generation of no . we treated the cells with inhibitors of several downstream targets of noncanonical wnt signaling to further investigate this effect . neither kn - 93 ( inhibitor of calcium / calmodulin - dependent protein kinase ii ( camkii ) ) nor g6976 ( inhibitor of pkc ) blocked the effect of wnt5a . by contrast , treatment with the no donor snp alone increased the 2 - dg uptake to 17.84.3 nmol 10 cells ( figure 1 ( b ) ) . the kinetic parameters of glucose uptake were estimated for a more comprehensive analysis of the effect of wnt signaling . under control conditions , we observed a km value of 7.10.8 mm and a vmax of 9.40.4 pmol10 cells / min ( figure 1 ( c ) ) . in the wnt5a - treated cells , the km and vmax values were 2.50.1 mm and 8.70.2 pmol10 cells / min , respectively ( figure 1 ( d ) ) . figure 1 ( e ) illustrates how exposure to the wnt5a ligand increased the apparent affinity of glucose in the neuronal transport pathway . after being transported into the cell , glucose is converted to g6p by hk , the first regulatory enzyme of glycolysis . we observed that the wnt5a treatment induced a robust increase in activity from 2.20.17 units / mg to 4.40.8 units / mg after 2 h of treatment ( figure 2 ( a ) , ( i ) ) . the effect of wnt5a was prevented by the coincubation with fzcrd - 2 and 7 - ni ( figure 2 ( a ) , ( ii ) ) . our results thus far show that treating neurons with wnt5a stimulates the uptake of 2 - dg and hk activity . the next step was to determine whether this increased uptake was correlated with an increase in the glucose utilization through glycolysis . first , we measured the glycolytic rate at several time points after treatment with wnt5a . under control conditions , we observed rates of 1.10.15 pmol / mg protein . wnt5a increased the glycolytic rate in a time - dependent manner , with a maximum rate of 2.90.3 pmol / mg protein at 2 h versus a control rate of 1.30.19 pmol / mg protein . this effect was partially blocked by the coincubation with fzcrd - 2 ( figure 2 ( b ) , ( i ) ) . using a pharmacological approach , we studied the effects of several inhibitors at 2 h and observed that the effect of wnt5a was blocked by the coincubation with fzcrd - 2 and 7 - ni ( figure 2 ( b ) , ( ii ) ) . our previous results suggest that the downstream generation of no following the activation of noncanonical wnt signaling may be important for the effect of wnt5a on the glycolytic rate . therefore , we analyzed the effect of snp , a no donor , by treating cells with several concentrations of snp for 2 h ; we observed a strong increase in the glycolytic rate , with a maximum of 15012 pmol / mg protein in the cells that were treated with 700 nm snp . the effect of snp was partially abolished by the coincubation with 7 - ni . as a control , the cyt b treatment markedly decreased the glycolytic rate in neurons ( figure 2 ( b ) , ( iii ) ) . our results indicate that the activation of wnt signaling stimulates glucose uptake and the utilization of this molecule by glycolysis , suggesting an increase in the levels of atp . we measured the neuronal atp levels following a 2 h treatment with wnt5a to confirm this prediction . under control conditions , we measured a value of 36.0210.03 nmol atp / mg of protein . after the treatment with wnt5a , the atp levels increased to 61.786.11 nmol atp / mg of protein ; this increase in the atp levels was blocked when cells were coincubated with wnt5a and the antagonist fzdcrd - 2 ( figure 2 ( c ) ) . as described above , several metabolic pathways could use the g6p generated by hk , including the ppp . we measured the effect of wnt5a on g6pdh activity and observed an increase in the enzymatic activity after 1 h of wnt5a treatment ( figure 3 ( a ) , ( i ) ) . the effect of wnt5a on g6pdh activity was blocked by the coincubation with fzcrd - 2 and 7 - ni ( figure 3 ( a ) , ( ii ) ) . then , we measured the ppp activity using radioactive glucose and observed that the wnt5a treatment increased the ppp activity from 0.330.02 nmol / min mg protein in the control condition to 0.770.07 nmol / min mg protein . the effect of wnt5a on the ppp activity was blocked by the coincubation with fzdcrd - 2 ( figure 3 ( b ) ) . we studied whether the effects of the wnt5a ligand could be recapitulated in a more complex model to further analyze the effect of wnt pathway activation on glucose metabolism . for this experiment , we used cortical - hippocampal slices from mouse brains ( figure 4 ( a ) ) . after a 30 min treatment , we observed significant time - dependent differences in the accumulation of 2 - dg , with a maximum of 6.90.9 nmol 10 after 2 h of wnt5a treatment compared with 3.40.4 nmol 10 for the control condition ( figure 4 ( b ) , ( i ) ) . the effect of a 1 h wnt5a treatment was blocked by treatments with fzdcrd - 2 and 7 - ni in a similar manner to that observed in neuronal cultures ( figure 4 ( b ) , ( ii ) ) . after the 1 h incubation with wnt5a , we observed an increase in the glycolytic rate in the slices from 1.070.11 pmol / mg protein to 2.120.08 pmol / mg protein ; this effect was blocked by the coincubation with 2 - dg and fzdcrd - 2 ( figure 4 ( c ) ) . finally , we measured the ppp activity in slices and observed an activity of 0.320.01 nmol / min mg protein in the controls . the wnt5a treatment induced an increase in the ppp activity to 0.780.0201 nmol / min mg protein ; this effect was blocked by the coincubation with fzdcrd - 2 and 7 - ni ( figure 4 ( d ) ) . in the present work , we studied the effect of wnt5a on glucose metabolism in cortical neurons . we report that wnt5a treatment stimulates glucose uptake in a time - dependent manner ; this increase was correlated with an increase in both the hk activity and the glycolytic rate . moreover , the treatment with wnt5a increased the activity of the g6pdh enzyme and the ppp . together , these results suggest that the activation of wnt signaling by wnt5a regulates cellular glucose metabolism in neurons . wnt signaling can basically be divided into two pathways : the canonical pathway ( wnt / - catenin ) and the noncanonical pathway . wnt5a has been described as a noncanonical wnt ligand , and the noncanonical pathway includes the planar cell polarity ( wnt / pcp ) and wnt / ca pathways . in the wnt / pcp pathway , the wnt ligand binds to the fzd receptor and activates small gtpases that subsequently induce the expression of genes related to the reorganization of the cytoskeleton . in the wnt / ca pathway , ligand binding to the fzd receptor activates the enzyme phospholipase c ( plc ) , which increases the production of inositol triphosphate ( ip3 ) , generating an increase in the intracellular ca concentration that leads to the activation of calcium - dependent proteins . subsequently , wnt5a signaling increases the intracellular levels of several second messengers , including ca and no , which are both considered regulators of glucose metabolism , a critical process required for brain function . the importance of the wnt pathway in regulating glucose metabolism has been increasingly recognized in recent years due to studies in humans , where several components of the wnt pathway have been identified as risk factors for metabolic diseases , including age - related dementia ; however , the final effect depends on whether the canonical or noncanonical wnt pathway is affected . activation of the wnt / - catenin pathway promotes a decrease in the plasma glucose levels in vivo , and this decrease modulates the localization and expression of glut4 in adipocytes and increases glucose uptake in these cells . similarly , patients with diabetes mellitus type ii have been shown to exhibit increased expression of sfrp5 , a wnt inhibitor , which has been correlated with a decrease in wnt5a levels . furthermore , activation of the wnt / ca pathway has been reported to modulate mitochondrial dynamics , which may affect atp generation . approximately 20 % of the oxygen and 25 % of the glucose consumed by the human body are dedicated to cerebral functions , even though the brain only accounts for 2 % of the total body mass . the atp generated by glucose oxidation is used to maintain and restore the ion gradients dissipated by signaling processes , such as postsynaptic stimulation and action potentials , and for neurotransmitter uptake and recycling . glucose is the main energy substrate of the adult brain , and its metabolism is mainly divided into two stages : glucose uptake and intracellular oxidative metabolism . our data also showed that wnt5a increases the apparent affinity of the glut3 transporter , the main glut isoform expressed in neurons . because we did not observe changes in the vmax value , we can disregard the expression of other glut isoforms in our experiments . the effect of wnt5a on glucose uptake will increase the bioavailability of intracellular glucose , with a subsequent increase in the g6p levels generated by hk , another target of the wnt5a pathway . the generated g6p is mainly used by three different metabolic pathways : glycolysis , the ppp , and the glycogen synthesis pathway . glycolysis is coupled to the krebs cycle and oxidative phosphorylation to generate substrates for atp production in mitochondria through oxidative phosphorylation . by contrast , the ppp is required to protect neurons from oxidative stress through the generation of nadph . however , the neuronal utilization of glucose for glycogen synthesis has been accepted for years ; neurons have recently been shown to use glucose for glycogen synthesis , a function that is typically attributed to astrocytes . however , this glycogen synthesis could induce neuronal cell death through the formation of glycogen aggregates called lafora bodies . neuronal glycogen may be important for promoting neuronal survival under pathological conditions , such as oxidative stress and hypoxia . in the present work , we did not evaluate the effect of wnt5a on glycogen synthesis , but we can not discard this possibility because the importance of glycogen in neurons has recently been reported . we observed that wnt5a increases the glycolytic rate and ppp activity , thus promoting atp generation and increasing the levels of the nadph cofactor . the increase in the nadph levels resulting from ppp activity could be a protective mechanism against oxidative stress ( generated by the increased ros levels produced in the mitochondria ) , because this molecule is critical for the recycling of antioxidant agents , such as ascorbic acid and glutathione . additionally , we observed that the effects of wnt5a on 2 - dg uptake and the glycolytic rate were blocked by an inhibitor of nnos . this finding suggests a role for intracellular no , a molecule generated downstream of the wnt / ca pathway , because ca release activates calcineurin , a phosphatase that leads to nnos activation and no production ( figure 5 ) . no has been previously shown to stimulate glucose metabolism in neurons ; however , the specific mechanism underlying this effect remains unknown . because the brain includes other cells , such as astrocytes , which play critical roles in the regulation of neuronal metabolism , we tested the effects of wnt5a on the more complex system of hippocampal slices . here , we observed results similar to those of the in vitro studies , suggesting that the effects of wnt5a are mainly localized to neurons ; however , further studies are required to confirm this hypothesis . our results suggest a novel function for wnt signaling as an activator of glucose metabolism in neurons . this novel role of wnt signaling in neuronal physiology might be an interesting topic in the search for new treatments for neurological disorders .\noutput:\n" }, { "from": "agent", "value": "in the last few years , several reports have proposed that wnt signaling is a general metabolic regulator , suggesting a role for this pathway in the control of metabolic flux . wnt signaling is critical for several neuronal functions , but little is known about the correlation between this pathway and energy metabolism . the brain has a high demand for glucose , which is mainly used for energy production . neurons use energy for highly specific processes that require a high energy level , such as maintaining the electrical potential and synthesizing neurotransmitters . moreover , an important metabolic impairment has been described in all neurodegenerative disorders . despite the key role of glucose metabolism in the brain , little is known about the cellular pathways involved in regulating this process . we report here that wnt5a induces an increase in glucose uptake and glycolytic rate and an increase in the activity of the pentose phosphate pathway ; the effects of wnt5a require the intracellular generation of nitric oxide . our data suggest that wnt signaling stimulates neuronal glucose metabolism , an effect that could be important for the reported neuroprotective role of wnt signaling in neurodegenerative disorders ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sudden cardiac death is a major cause of mortality in the industrialized world , and ventricular fibrillation ( vf ) is the leading cause of sudden cardiac death . an electrical wavebreak in the heart tissue may lead to vf . according to the so - called restitution hypothesis , rate - dependent alteration of action potential duration ( apd ) and refractoriness ( r ) the changes in apd that accompany the changes in rate , reflect the dependence of apd on the preceding diastolic interval ( di ) , a relationship characterized by the electrical restitution curve . all of these mean that the modeling and simulating of restitution property in the cardiac cell is very important . cellular automata ( ca ) may be considered as a method for modeling discrete dynamic systems . a ca consists of a discrete system of lattice sites ( cells ) having various initial values . these cells evolve in discrete time steps , as each cell assumes a new state based on the rules , that is , the states of its local neighborhood and a finite number of previous time steps . the neighborhood is described by specifying the set of cells that are the neighbors of a given cell . ( a ) von neumann ; ( b ) moore a ca lattice may be 1 - d or multidimensional . for 2 - d ca , if a cell which is still in the refractory state is re - stimulated by an adequate large stimulus ( s2 in figure 2 ) , the generated apd ; apdn +1 will be shorter than that in the normal case , apdn , that is , when the cell is stimulated after complete refractory . illustration of the restitution property , apd and di the action potential duration restitution property refers to the relationship between apdn +1 and the previous diastolic interval din , as shown in figure 2 . di is defined by the duration between the end of the cell 's re - polarization and the next applied stimulation [ figure 2 ] . the plot of apdn +1 versus din is called the restitution curve [ figure 3 ] . a sample restitution curve restitution curve may be explained as a function f : apdn +1 = f ( din ) ( 1 ) experimental measurements and observations confirmed that the restitution curve may be fitted by a sigmoid function like : there are different methods for experimental plotting of the restitution curve , like the s1 - s2 standard and the dynamical restitution method . action potential duration is usually explained as apd95 or apd90 , apd95 is defined as the time distance between the s2 stimulus ( beginning of ap ) and 95 % of the cell 's full repolarization . in thisregarding figure 2 , di is defined as follows : di = ( s1 - s2 interval ) - ( apd95 caused by last s1 ) ( 3 ) figure 1 illustrates two types of neighborhoods that are generally used in literature . in this article a model based on cathis article is organized as follows : section 2 reviews the restitution property . in section 3the proposed automata model is introduced , as also the method of implementation of the restitution property in the proposed model . two state variables are assigned to each cell ; one for the action potential variable ( apmn ) and the other for the refractory variable ( rmn ) , where m , n , and t denote the column number , row number , and the time step , respectively . the variable smn stands for the stimulus applied to the cell , which is in the coordinate ( m , n ) in time t. table 1 summarizes the description of the other parameters . definition of parameters used in the proposed model the transition rule ( automata rule ) in the proposed model is defined as follows : i.if smn is greater than the excitation threshold ; and apmn = rmn = 0 , the cell in position mn ; cellmn will be excited in the next time step ; t +1 and apmn = apup and rmn = 0ii . if smn and rmn = apmn = 0 , the cell will not be stimulated and stays in its previous ( rest ) stateiii.if rmn , + apmn 0 , the cellmn will take the path in the state space , as shown in figure 4 . notice that rmn starts decreasing when the apmn reaches its maximum value after a complete evolution in the state space the rmn and apmn will return to their rest states again if smn is greater than the excitation threshold ; and apmn = rmn = 0 , the cell in position mn ; cellmn will be excited in the next time step ; t +1 and apmn = apup and rmn = 0 if smn and rmn = apmn = 0 , the cell will not be stimulated and stays in its previous ( rest ) state if rmn , + apmn 0 , the cellmn will take the path in the state space , as shown in figure 4 . noticethat rmn starts decreasing when the apmn reaches its maximum value after a complete evolution in the state space the rmn and apmn will return to their rest states again evolution of the cellmn state variables ; apmn and rmn in the state space . see the text for transition rules the parameter values in the model are set so that the time course of ap and r in a single cell are as depicted in figure 5 . herethe continued and dashed lines show ap and r , respectively . referring to figure 5 , it is clear that the general morphology of action potential and refractory in a heart cell are preserved . ( a ) time course of ap and r as implemented in the model ; ( b ) a real ap time course for the r state variable , five phases ( 0 , 1 , 2 , 3 , 4 ) are assumed . in phase 0phase 1 stands for r when the cell has just entered the rest state . in this phase , r continues decreasing and a strong enough stimulus can re - excite the cell . in phase 4 , r reaches its minimum value ; 0 . here , the cell is in rest and normal stimulus can excite it and generate an ap with normal duration , that is , a normal apd . if a cell is excited during phases 2 or 3 , the restitution property will require that the apd is shorter than normal . the main aim of this research was the simulation of restitution in a single cell , so a lattice of a single cell without any neighbor was considered . the parameter rdown was considered as a time - dependent parameter , as : in eq .4 , t denotes time and is an adjustable coefficient . the model was implemented by matlabthe model parameters were adjusted so that by stimulating a single cell , the outcome of the ap and r morphology was generally similar to a ventricular cell . the outcome is depicted on the left side of figure 6 . referring to figure 6 , ap and r morphology are reserved as well as the restitution property in figure 6 , three stimuli are applied to a cell , at times 0 , 40 , and 70 milliseconds . the time interval between the first and second stimulus is long enough . in other words ; di1 is normal and the cell has enough time for full recovery , and this leads to a normal apd2 . the right hand side of figure 6 indicates that the proposed model can simulate the restitution property , that is , the third apd ( apd3 ) is shorter than the first and second one . after assurance about the installation of the restitution property in the model , its validity should be justified . if the proposed model is precise , it should simulate each of these curves by the adjustment of its parameters . three experimental restitution curves in this research the adjustment of the model was done via the regulation of n , , and apdmax . the normalized mean square error ( nmse ) criterion was used for fitness comparison of the restitution curves . at first , the guinea pig restitution curve of figure 7 was tested . comparison of the guinea pig restitution curve with the simulated curve created by the model . the proposed model can simulate the guinea pig restitution curve second , as an attempt for the model validity justification , the rabbit 1 restitution curve of figure 7 was examined . comparison of the rabbit 1 restitution curve with the simulated curve created by the model . it is clear that the proposed model can simulate the rabbit 1 restitution curve and finally , the rabbit 2 restitution curve of figure 7 was investigated . the outcome is illustrated in figure 10 . here also , it is clear that the proposed model can simulate the restitution curve of rabbit 2 , when its parameters are adjusted as shown in the table of figure 10 . comparison of the rabbit 2 restitution curve with the simulated curve created by the model . a cellular automata - based model was proposed for simulating restitution . for the validation test of the model , the restitution curves that were simulated by the model were evaluated against the experimental results of the validated sources . in this research , the parameters , n , and apdmax were used for model regulation . the results showed that the proposed model could not only simulate restitution properly , but could also be regulated for simulating restitution curves of different kinds of cardiac cells . on account of the low computational load of the automata - based cell models , the model would be very useful for simulating propagation of electrical waves in the ventricular tissue and investigation of the wave break and fibrillation , which would form the matter of the authors future researches . he is with the department of biomedical engineering and the research laboratory of biomedical signals and sensors , iran university of science and technology ( i.u.s.t . ) , tehran , iran . fateme pourhasanzade is a phd student in biomedical engineering department ; iran university of science and technology ( i.u.s.t . ) , tehran , iran .\noutput:\n" }, { "from": "agent", "value": "ventricular fibrillation is the cause of the most sudden mortalities . restitution is one of the specific properties of ventricular cell . the recent findings have clearly proved the correlation between the slope of restitution curve with ventricular fibrillation . this ; therefore , mandates the modeling of cellular restitution to gain high importance . a cellular automaton is a powerful tool for simulating complex phenomena in a simple language . a cellular automaton is a lattice of cells where the behavior of each cell is determined by the behavior of its neighboring cells as well as the automata rule . in this paper , a simple model is depicted for the simulation of the property of restitution in a single cardiac cell using cellular automata . at first , two state variables ; action potential and recovery are introduced in the automata model . in second , automata rule is determined and then recovery variable is defined in such a way so that the restitution is developed . in order to evaluate the proposed model , the generated restitution curve in our study is compared with the restitution curves from the experimental findings of valid sources . our findings indicate that the presented model is not only capable of simulating restitution in cardiac cell , but also possesses the capability of regulating the restitution curve ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the usher syndrome is an autosomal recessive disease characterized by varying degrees of sensorineural hearing loss and progressive visual impairment , caused by retinitis pigmentosa ( rp ) .1 the syndrome 's incidence is estimated as 36/100 .000 persons in the general population . among the deaf population , the prevalence of the syndrome is 3 to 6 % . studies underestimate the true prevalence of the disease due to lack of early diagnosis or for being misdiagnosed . the average age at diagnosis is 10 years and some children are implanted before vision loss and even before the diagnosis of usher 's disease .1 three distinct subtypes of the syndrome have been described . usher type i ( ushi ) is characterized by profound sensorineural hearing loss at birth or during the first year of life , abnormal vestibular function , and delayed motor development . children with usher type ii ( ushii ) have hearing loss from birth moderate to severe and normal vestibular function . affected children with usher type iii ( ushiii ) are usually born with normal hearing and undergo progressive hearing loss . their vestibular function may be affected . the vision loss is gradual and usually begins in adolescence or adulthood .2 the severity of hearing loss and blindness is higher in usher syndrome type i. several studies of patients with usher syndrome concluded that cochlear implant ( ci ) is an effective treatment for such patients , since there is a deterioration of a duplicate sensory . benefits vary from a better quality of life , observed in questionnaires ,3 to superior performance in oral communication .2456 this variability of the results is seen as being dependent on factors such as age of implantation , duration of deafness , and type communication prior to implantation .67 families have sought the solution for children with usher syndrome who did not have the opportunity to receive cochlear implants in early childhood , since the visual loss is progressive , starting in adolescence . we seek to investigate whether late implant patients presenting usher syndrome type i with pre - lingual hearing loss can benefit the cochlear implant . among the 1.350 patients implanted in our service , 13 ( 0.9 % ) have usher syndrome , 10 are ushi , and three are ushii . we conducted a retrospective study of data collection . we selected all patients with ushi and excluded patients with ushii plus those who had not been yet implanted . we collected patients ' age at the time of surgery , type of communication before and after surgery , hearing thresholds ( pta ) pre ( with hearing aid ) and post implant ( 1 year of ci use ) , and the performance of speech perception pre and post implant . the protocol used to conduct the testing was according to goffi gomez et al. 8 the subjects were classified according to mode of communication . in the case of bilinguals , we set up the first way of communication as the mother language or that of greater fluency . we selected 10 patients implanted ( 7 men , 3 women ) diagnosed with ushi . abbreviations : ci , cochlear implants ; ha , individual sound amplification device ; rp , retinitis pigmentosa . average pre auditory threshold ( pta ha ) was 103 db hl ( fig . it was possible to measure speech perception in four patients preoperatively ( 1 , 2 , 4 , and 6 ) , who could only detect speech . abbreviations : ci , cochlear implants ; ha , individual sound amplification device ; nt , not tested ; nu , non user ci patient ; pta ci , pure tone threshold of cochlear implant ; pta ha , pure tone threshold of hearing aid . one year after the implantation , the average auditory threshold ( pta ci ) was 35 db ( fig . only three patients improved their performance in speech perception to 40 % , 30 % , and 10 % for recognition of sentences in closed set , respectively ( 1 , 2 and 3 ) ; five patients had only speech detection , and two were not able to carry out tests ( table 2 ) . three patients abandoned the use of ci ( 8 , 9 , and 10 ) . for proper indication and to establish a prognosis of the cochlear implantation beyond the knowledge of the etiology of deafness patients , it is important to survey the use of hearing aids and residual hearing that allows us to infer the development of the auditory pathway .9 this will allow us to manage the expectations of the patient and family after cochlear implantation . several factors can influence the outcome of cochlear implants as age of occurrence / diagnosis of hearing loss ( pre versus post - lingual ) age at implant , residual hearing , systematic use of hearing aids , communication mode , support from family , and educational environment , as well as rehabilitation and personal motivation to join to the world of sound and learn to listen . indeed , studies on usher syndrome reported outcomes of patients implanted with different ages and conclude that patients implanted late have good sound detection thresholds ,246 but the worst speech perception performance . the fact that usher syndrome patients are deprived of another sensory pathway does not necessarily mean that the patients will benefit from this type of rehabilitation . the clinical team should evaluate patients with usher syndrome carefully and discuss the prognosis both in team and with the family . the history of the systematic use of hearing aids , residual hearing , and the mode of communication allow us to infer the value that the patient places on oral communication and listening in their life . patients who had no prior central auditory skills because they never had access to sounds when implanted can hardly adapt , leading to treatment failure .10 the development of oral language skills from birth is essential to the patient subsequently acquire the new language sound of the cochlear implant . they need to use systematically bilateral hearing aids ( even with little benefit ) to keep the peripheral and central pathways as preserved as possible and learning one or more languages from birth .1112 it is possible to the baby with congenital deafness to acquire the natural neurobiological development when the auditory stimulation is restored before 3.5 years of age ( sharma et al . , 2009 ) ,13 on the other hand , patients implanted late show changes in the number of projections or synaptic density at various levels of the auditory pathway .1011121314 detecting the sounds achieved by the majority of our patients show that cochlear implants can provide access to sounds ( peripheral input ) , however , when the implant is delayed , maybe , there are not enough central connections between the auditory area and the association areas . that means that detection is not enough for these people to give meaning to the sounds that they hear and may not be able to achieve the representation of the sounds . many teens already fluent in sign language also are disappointed with the ci because they might have expected something that had not happened , because the family might have imposed it or that his expectation was beyond that treatment could offer . the cochlear implant teams based on their own experience should judge each case individually to ensure realistic expectations of the outcome . this suggests that traditional measures of speech perception may not be sufficient to accurately reflect the real benefit of ci and alternative assessment tools , including educational , social and psychological areas are needed .1516171819 patients with usher syndrome who were lately implanted have good hearing thresholds , but speech recognition and use of the device will depend mainly of previous stimulation , since they are directly related to the development of the auditory pathway and the central auditory skills .\noutput:\n" }, { "from": "agent", "value": "introduction usher syndrome ( us ) is an autosomal recessive disorder characterized by hearing loss and progressive visual impairment . some deaf usher syndrome patients learn to communicate using sign language . during adolescence , as they start losing vision , they are usually referred to cochlear implantation as a salvage for their new condition . is a late implantation beneficial to these children ? objective the objective of this study is to describe the outcomes of us patients who received cochlear implants at a later age . methods this is a retrospective study of ten patients diagnosed with us1 . we collected pure - tone thresholds and speech perception tests from pre and one - year post implant . results average age at implantation was 18.9 years ( 549 ) . aided average thresholds were 103 db hl and 35 db hl pre and one - year post implant , respectively . speech perception was only possible to be measured in four patients preoperatively , who scored 13.3 ; 26.67 ; 46 % vowels and 56 % 4 - choice . all patients except one had some kind of communication . two were bilingual . after one year of using the device , seven patients were able to perform the speech tests ( from four - choice to close set sentences ) and three patients abandoned the use of the implant . conclusion we observed that detection of sounds can be achieved with late implantation , but speech recognition is only possible in patients with previous hearing stimulation , since it depends on the development of hearing skills and the maturation of the auditory pathways ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: preoperative chemoradiotherapy ( crt ) followed by radical surgery is widely accepted as the standard treatment for locally advanced rectal cancer . the theoretical advantages of preoperative crt include improved compliance with the crt regimen , if it is administered prior to radical surgery , a well - defined tumor target with an intact tumor oxygen supply that can maximize tumor response , the absence of postoperative surgical changes that can minimize radiation - induced normal tissue toxicity , and crt - induced tumor down - staging which may enhance sphincter preservation in patients with low - lying tumors . in addition , preoperative crt provides an early endpoint for treatment results with prognostic value . however , preoperative crt also has disadvantages including a possible increase in postoperative complications . the large number of studies regarding preoperative crt for locally advanced rectal cancer that have been published in the last several years have demonstrated the efficacy of this treatment for complete pathologic response , tumor down - staging , and enhanced sphincter preservation . encouraging results have also been achieved in terms of recurrence rate , and survival . however , the reported rates of sphincter preservation after preoperative crt vary widely , and the impact of treatment response on survival is highly controversial . a number of previous studies have attempted to identify clinical and pathological factors associated with survival and the risk of recurrence after preoperative crt . these studies produced contradicting results for the identification of independent prognostic factors . in order to contribute to the resolution of these contradictions , we report the long - term oncologic outcomes for patients with locally advanced rectal cancer after preoperative concurrent crt followed by total mesorectal excision ( tme ) at our institution , and identify prognostic factors affecting survival and pathologic response . the patients eligibility criteria included : 1 ) histologically confirmed rectal adenocarcinoma , 2 ) clinically diagnosed t3 - 4 or node - positive disease , 3 ) no distant metastasis , 4 ) no prior chemotherapy , 5 ) no prior radiotherapy ( rt ) in pelvic cavity , 6 ) preoperative concurrent crt , 7 ) tme of curative aim after concurrent crt , 8 ) follow - up period greater than 6 months after curative tme , 9 ) no other simultaneous malignancies . at kyunghee university hospital , 135 rectal cancer patients met the eligibility criteria between june 1996 and june 2009 , and were enrolled in this study . data collected retrospectively for each patient included : age , gender , tumor distance from anal verge , pretreatment tumor size , histologic grade , tumor circumference extent , pretreatment clinical tumor , node and metastasis ( tnm ) stage , rt dose , chemotherapy regimen , type of surgery ( sphincter preservation surgery or abdominoperineal resection ) , interval of time between crt and surgery , pathologic tnm stage , date and site of tumor recurrence , date and status at last follow - up visit . the tumor distance from anal verge was defined as the distance from the caudal tumor edge to the anal verge , and was assessed by digital examination and sigmoidoscopy . pretreatment tumor size was defined as the longest diameter in any dimension , and pretreatment clinical staging was performed using a combination of physical examination , computed tomography , magnetic resonance imaging and endorectal ultrasonography . the clinical and pathologic tnm stages were determined according to the american joint committee on cancer tnm staging system ( 7th edition ) , and the histologic grade of adenocarcinoma was described according to the world health organization classification . forty one patients received continuous 5 - fu infusion and 94 patients received bolus 5 - fu with leucovorin . rt began on the first day of chemotherapy and was administered 5 times per week with a daily fraction of 180 cgy . initially , the entire pelvis was treated with 3 - or 4 - field techniques to 4,500 cgy in a supine position . the anterior border of the lateral fields was ~ 3 cm anterior to the gross tumor and shaped to include the internal iliac lymph nodes if t3 , and external iliac lymph nodes if t4 . the posterior border of the lateral fields was extended to encompass the bony sacrum . most patients received a boost to the primary tumor bed for a median total dose of 5,040 cgy . a two - dimensional conventional technique or three - dimensional conformal technique was used according to the attending physician 's discretion . the most common concurrent chemotherapy regimen was bolus dosing 5 - fu ( 325 mg / m / day ) with leucovorin ( 20 mg / m / day ) for two cycles of five consecutive days at weeks one and five of rt . the second most common concurrent chemotherapy regimen was continuous 5 - fu ( 225 mg / m / day ) infusion for 6 week continuous cycle . tme was routinely performed in all patients . in cases requiring sphincter preservation surgery , reversal of colostomy or ileostomythe follow - up duration was calculated as the time from the date of surgery to the date of last review or death . down - staging was defined as lowering the t or n stage between the pretreatment clinical stage and the post - crt pathologic stage . loco - regional recurrence was defined as the presence of tumor in the pelvis or perineum or at the anastomosis site as diagnosed by clinical , radiologic , or pathologic examination . survival rate was calculated as the time from surgery to the date of death , or in the case of survivors , to the date of the last follow - up visit . survival rates were estimated by the kaplan - meier method and compared using a log - rank test . parameters evaluated as potential prognostic factors for survival were : tumor response to preoperative crt , age , gender , tumor distance from anal verge , pretreatment tumor size , tumor circumference extent , rt dose , concurrent chemotherapy regimen , interval between crt and surgery , and pretreatment clinical stage . parameters with a p - value of less than 0.10 in a univariate analysis were further assessed in a multivariate analysis , using a cox regression hazard model . in order to find potential predictive factors for pcr , the following parameters were evaluated using a chi - square test : age , gender , tumor distance from anal verge , pretreatment tumor size , tumor circumference extent , rt dose , concurrent chemotherapy regimen , interval between crt and surgery , and pretreatment clinical stage . parameters with a p - value of less than 0.10 in a univariate analysis were further assessed in a multivariate analysis , using a multivariate logistic regression model . for all analyses , the patients eligibility criteria included : 1 ) histologically confirmed rectal adenocarcinoma , 2 ) clinically diagnosed t3 - 4 or node - positive disease , 3 ) no distant metastasis , 4 ) no prior chemotherapy , 5 ) no prior radiotherapy ( rt ) in pelvic cavity , 6 ) preoperative concurrent crt , 7 ) tme of curative aim after concurrent crt , 8 ) follow - up period greater than 6 months after curative tme , 9 ) no other simultaneous malignancies . at kyunghee university hospital , 135 rectal cancer patients met the eligibility criteria between june 1996 and june 2009 , and were enrolled in this study . data collected retrospectively for each patient included : age , gender , tumor distance from anal verge , pretreatment tumor size , histologic grade , tumor circumference extent , pretreatment clinical tumor , node and metastasis ( tnm ) stage , rt dose , chemotherapy regimen , type of surgery ( sphincter preservation surgery or abdominoperineal resection ) , interval of time between crt and surgery , pathologic tnm stage , date and site of tumor recurrence , date and status at last follow - up visit . the tumor distance from anal verge was defined as the distance from the caudal tumor edge to the anal verge , and was assessed by digital examination and sigmoidoscopy . pretreatment tumor size was defined as the longest diameter in any dimension , and pretreatment clinical staging was performed using a combination of physical examination , computed tomography , magnetic resonance imaging and endorectal ultrasonography . the clinical and pathologic tnm stages were determined according to the american joint committee on cancer tnm staging system ( 7th edition ) , and the histologic grade of adenocarcinoma was described according to the world health organization classification . forty one patients received continuous 5 - fu infusion and 94 patients received bolus 5 - fu with leucovorin . rt began on the first day of chemotherapy and was administered 5 times per week with a daily fraction of 180 cgy . initially , the entire pelvis was treated with 3 - or 4 - field techniques to 4,500 cgy in a supine position . the anterior border of the lateral fields was ~ 3 cm anterior to the gross tumor and shaped to include the internal iliac lymph nodes if t3 , and external iliac lymph nodes if t4 . the posterior border of the lateral fields was extended to encompass the bony sacrum . most patients received a boost to the primary tumor bed for a median total dose of 5,040 cgy . a two - dimensional conventional technique or three - dimensional conformal technique was used according to the attending physician 's discretion . the most common concurrent chemotherapy regimen was bolus dosing 5 - fu ( 325 mg / m / day ) with leucovorin ( 20 mg / m / day ) for two cycles of five consecutive days at weeks one and five of rt . the second most common concurrent chemotherapy regimen was continuous 5 - fu ( 225 mg / m / day ) infusion for 6 week continuous cycle . tme was routinely performed in all patients . in cases requiring sphincter preservation surgery , reversal of colostomy or ileostomythe follow - up duration was calculated as the time from the date of surgery to the date of last review or death . down - staging was defined as lowering the t or n stage between the pretreatment clinical stage and the post - crt pathologic stage . loco - regional recurrence was defined as the presence of tumor in the pelvis or perineum or at the anastomosis site as diagnosed by clinical , radiologic , or pathologic examination . survival rate was calculated as the time from surgery to the date of death , or in the case of survivors , to the date of the last follow - up visit . survival rates were estimated by the kaplan - meier method and compared using a log - rank test . parameters evaluated as potential prognostic factors for survival were : tumor response to preoperative crt , age , gender , tumor distance from anal verge , pretreatment tumor size , tumor circumference extent , rt dose , concurrent chemotherapy regimen , interval between crt and surgery , and pretreatment clinical stage . parameters with a p - value of less than 0.10 in a univariate analysis were further assessed in a multivariate analysis , using a cox regression hazard model . in order to find potential predictive factors for pcr , the following parameters were evaluated using a chi - square test : age , gender , tumor distance from anal verge , pretreatment tumor size , tumor circumference extent , rt dose , concurrent chemotherapy regimen , interval between crt and surgery , and pretreatment clinical stage . parameters with a p - value of less than 0.10 in a univariate analysis were further assessed in a multivariate analysis , using a multivariate logistic regression model . for all analyses , the median patient age was 57 years ( range , 26 to 86 years ) , and the tumor sizes ranged from 1.5 cm to 11 cm ( median , 5 cm ) . the median distance from the anal verge to the caudal tumor edge was 5 cm ( range , 1 to 13 cm ) , and the most common pretreatment clinical stage was iiib ( 73.5 % ) . the median rt dose was 50.4 gy ( range , 36 to 59.4 gy ) , and the median interval between crt and surgery was 4.4 weeks ( range , 0.5 to 26 weeks ) . in 2 patients , the resection margin was positive , and 67 patients ( 49.6 % ) received adjuvant chemotherapy . the pt status was pt0 in 23 patients ( 17.0 % ) , pt1 in 4 patients ( 3.0 % ) , pt2 in 28 patients ( 20.7 % ) , pt3 in 64 patients ( 47.4 % ) , and pt4 in 16 patients ( 11.9 % ) . the pn status was pn0 in 102 patients ( 75.6 % ) , pn1 in 19 patients ( 14.1 % ) , and pn2 in 14 patients ( 10.3 % ) . in one patient , although the primary tumor had completely regressed , a residual metastatic tumor presented in the perirectal lymph nodes ( pt0n + ) . after crt , the percentage of t down - staging was 44.4 % ( 60/135 ) and n down - staging was 68.2 % ( 92/135 ) . the percentage of down - staging ( t or n ) after crt was 82.2 % ( 111/135 ) . the pathologic findings are summarized in table 2 . the median follow - up time was 50.0 months ( range , 4.5 to 157.8 months ) for whole patients and 53.3 months ( range , 6 to 157.8 months ) for surviving patients . of the whole patients , sphincter preservation surgery was accomplished in 91 patients ( 67.4 % ) , and of the 81 patients whose distal tumor edge was 5 cm or less , sphincter preservation surgery was accomplished in 44 patients ( 54.3 % ) . of those patients who received sphincter preservation surgery ,4 patients received a diverting stoma again due to surgical complications during the follow - up period . permanent fistula formation developed in two patients , and anastomosis site stenosis occurred in one patient . one other patient received a diverting stoma because of poor healing of recurrent inflammation at the anastomosis site . the median overall survival was 49.0 months for whole patients and 70.7 months for patients who had a pcr . the estimated 5 - and 8 - year overall survival rates for whole patients were 82.7 % and 75.7 % , and for pcr patients , the 5 - and 8 - year rates were both 100 % ( fig . the median loco - regional recurrence - free survival was 41.8 months for whole patients and 70.5 months for pcr patients . loco - regional recurrence developed in 30 ( 22.1 % ) of the whole patients and 2 ( 9.1 % ) of the pcr patients . of the 30 patients who developed local recurrence , 10 had local recurrence only , and 20 had both local and distant recurrence . locations of loco - regional recurrence included the anastomosis site ( n = 18 ) , pelvic wall ( n = 6 ) , pelvic lymph nodes ( n = 3 ) , and other areas ( n = 3 ) . in 2 patients , local recurrences developed 10 years after tme . one patient developed local recurrence in the anastomosis site at 120 months , and the other patient developed in the left pelvic wall at 139.5 months after tme . the estimated 5 - and 8 - year loco - regional recurrence - free survival rates were 76.8 % and 71.9 % for whole patients , and 100 % and 88.9 % for pcr patients2 ) . the median distant metastasis - free survival was 41.0 months for whole patients and 70.5 months for pcr patients . distant metastasis developed in 39 ( 28.7 % ) and 1 ( 4.5 % ) of the whole patients and pcr patients , respectively . of 39 patients who developed distant metastasis ,19 had a distant metastasis only , and 20 had both local and distant recurrence . sites of distant metastasis included the liver ( n = 20 ) , lung ( n = 12 ) , retroperitoneum ( n = 2 ) , spine ( n = 2 ) , and other areas ( n = 3 ) . the estimated 5 - and 8 - year distant metastasis - free survival rates were 67.9 % and 63.3 % for whole patients , and 95.5 % and 95.5 % for pcr patientsprognostic factors were analyzed for effect on overall survival , locoregional recurrence - free survival , and distant metastasis - free survival . in the univariate analysis , pcr , t down - staging , down - staging ( t or n ) , and pretreatment clinical stage were significantly associated with overall survival . in the multivariate analysisin the univariate analysis for loco - regional recurrence - free survival , pcr , t down - staging , and down - staging ( t or n ) were significant prognostic factors . in the multivariate analysis , t down - staging and down - staging ( t or n ) remained significant factors ( table 4 ) . many parameters were associated with distant metastasis - free survival . in the univariate analysis , pcr , t down - staging , n down - staging , down - staging ( t or n ) , tumor distance from the anal verge , pretreatment tumor size , and rt dose were significantly associated with distant metastasis - free survival . in the multivariate analysis , pcr , down - staging ( t or n ) , pretreatment tumor size , and rt dose remained statistically significant , and pretreatment clinical stage was also found to be significant ( table 5 ) . the median patient age was 57 years ( range , 26 to 86 years ) , and the tumor sizes ranged from 1.5 cm to 11 cm ( median , 5 cm ) . the median distance from the anal verge to the caudal tumor edge was 5 cm ( range , 1 to 13 cm ) , and the most common pretreatment clinical stage was iiib ( 73.5 % ) . the median rt dose was 50.4 gy ( range , 36 to 59.4 gy ) , and the median interval between crt and surgery was 4.4 weeks ( range , 0.5 to 26 weeks ) . in 2 patients , the resection margin was positive , and 67 patients ( 49.6 % ) received adjuvant chemotherapy . the pt status was pt0 in 23 patients ( 17.0 % ) , pt1 in 4 patients ( 3.0 % ) , pt2 in 28 patients ( 20.7 % ) , pt3 in 64 patients ( 47.4 % ) , and pt4 in 16 patients ( 11.9 % ) . the pn status was pn0 in 102 patients ( 75.6 % ) , pn1 in 19 patients ( 14.1 % ) , and pn2 in 14 patients ( 10.3 % ) . a total of 22 patients ( 16.3 % ) achieved a pcr ( pt0n0 ) . in one patient , although the primary tumor had completely regressed , a residual metastatic tumor presented in the perirectal lymph nodes ( pt0n + ) . after crt , the percentage of t down - staging was 44.4 % ( 60/135 ) and n down - staging was 68.2 % ( 92/135 ) . the percentage of down - staging ( t or n ) after crt was 82.2 % ( 111/135 ) . the pathologic findings are summarized in table 2 . the median follow - up time was 50.0 months ( range , 4.5 to 157.8 months ) for whole patients and 53.3 months ( range , 6 to 157.8 months ) for surviving patients . of the whole patients , sphincter preservation surgery was accomplished in 91 patients ( 67.4 % ) , and of the 81 patients whose distal tumor edge was 5 cm or less , sphincter preservation surgery was accomplished in 44 patients ( 54.3 % ) . of those patients who received sphincter preservation surgery ,4 patients received a diverting stoma again due to surgical complications during the follow - up period . permanent fistula formation developed in two patients , and anastomosis site stenosis occurred in one patient . one other patient received a diverting stoma because of poor healing of recurrent inflammation at the anastomosis site . the median overall survival was 49.0 months for whole patients and 70.7 months for patients who had a pcr . the estimated 5 - and 8 - year overall survival rates for whole patients were 82.7 % and 75.7 % , and for pcr patients , the 5 - and 8 - year rates were both 100 % ( fig . the median loco - regional recurrence - free survival was 41.8 months for whole patients and 70.5 months for pcr patients . loco - regional recurrence developed in 30 ( 22.1 % ) of the whole patients and 2 ( 9.1 % ) of the pcr patients . of the 30 patients who developed local recurrence , locations of loco - regional recurrence included the anastomosis site ( n = 18 ) , pelvic wall ( n = 6 ) , pelvic lymph nodes ( n = 3 ) , and other areas ( n = 3 ) . in 2 patients , local recurrences developed 10 years after tme . one patient developed local recurrence in the anastomosis site at 120 months , and the other patient developed in the left pelvic wall at 139.5 months after tme . the estimated 5 - and 8 - year loco - regional recurrence - free survival rates2 ) . the median distant metastasis - free survival was 41.0 months for whole patients and 70.5 months for pcr patients . distant metastasis developed in 39 ( 28.7 % ) and 1 ( 4.5 % ) of the whole patients and pcr patients , respectively . of 39 patients who developed distant metastasis ,19 had a distant metastasis only , and 20 had both local and distant recurrence . sites of distant metastasis included the liver ( n = 20 ) , lung ( n = 12 ) , retroperitoneum ( n = 2 ) , spine ( n = 2 ) , and other areas ( n = 3 ) . the estimated 5 - and 8 - year distant metastasis - free survival rates were 67.9 % and 63.3 % for whole patients , and 95.5 % and 95.5 % for pcr patientsprognostic factors were analyzed for effect on overall survival , locoregional recurrence - free survival , and distant metastasis - free survival . in the univariate analysis , pcr , t down - staging , down - staging ( t or n ) , and pretreatment clinical stage were significantly associated with overall survival . in the multivariate analysis , pcr associations remained significant ( table 3 ) . in the univariate analysis for loco - regional recurrence - free survival , pcr , t down - staging , and down - staging ( t or n ) were significant prognostic factors . in the multivariate analysis , t down - staging and down - staging ( t or n ) remained significant factors ( table 4 ) . many parameters were associated with distant metastasis - free survival . in the univariate analysis , pcr , t down - staging , n down - staging , down - staging ( t or n ) , tumor distance from the anal verge , pretreatment tumor size , and rt dose were significantly associated with distant metastasis - free survival . in the multivariate analysis , pcr , down - staging ( t or n ) , pretreatment tumor size , and rt dose remained statistically significant , and pretreatment clinical stage was also found to be significant ( table 5 ) . several reports have found that preoperative crt or rt alone for patients with locally advanced rectal cancer can decrease local recurrence of rectal cancer . however , results regarding the influence of preoperative crt or rt on overall survival have conflicted . the medical research council rectal cancer working party carried out a prospective randomized trial of preoperative rt followed by tme vs. tme alone . they reported an estimated 21 % reduction in the risk of death for patients with preoperative rt followed by tme . however , the overall survival rate was not significantly different between the two groups ( p = 0.10 ) . therefore , in that study , preoperative rt did not influence on overall survival . however , kao et al . reported a 5 - year overall survival rate of 88.4 % in a group treated by preoperative crt followed by tme , and 65.7 % in a group treated by tme alone . in that study , patients with preoperative crt had a significantly higher overall survival rate . in addition to these studies , several studies reported inconsistent results regarding the influence of preoperative crt or rt alone on overall survival . in addition , reported rates of overall survival after preoperative crt varied widely . in our study , 5 - and 8 - yearoverall survival rates were 82.7 % and 75.7 % , respectively . however , numerous studies [ 1,8,9,14 - 17 ] have reported inconsistent overall survival rates ( table 7 ) . possible reasons for these inconsistent results include different preoperative crt regimens , different indications and regimens for postoperative chemotherapy , and inconsistent interpretation of radiologic imaging studies by different radiologists . the reported rate of sphincter preservation surgery after preoperative crt has also varied widely , ranging from 28 % to 89 % . however , regardless of the sphincter preservation surgery rate , several studies have reported that preoperative crt significantly increases the rate of sphincter preservation surgery as compared to patients not receiving preoperative crt or rt . the reported rate of sphincter preservation surgery in our study was relatively high , with 67.4 % of the whole patients and 54.3 % of the patients whose distal tumor edge was 5 cm or less . however , kao et al . have argued that in order to confirm the influence of preoperative crt on sphincter preservation , one should compare the rates of preserved anorectal function after long - term follow - up rather than the rates of sphincter preservation surgery . in that study , patients with preoperative crt followed by tme had a significantly higher rate of sphincter preservation surgery as compared to patients receiving tme only ( 75.4 % vs. 50.7 % , p = 0.005 ) . however , the rate of surgical complications , such as anastomosis stenosis and fistula formation was relatively higher in the preoperative crt group after long - term follow - up . as some patients received a diverting stoma again due to surgical complications , in the final results , 62.3 % of the patients with preoperative crt followed by tme and 47.8 % of patients with tme alone maintained preserved anorectal function ( p = 0.125 ) . therefore , although the rate of sphincter preservation surgery was significantly higher in patients with preoperative crt followed by tme , there was no statistical difference between the two groups with respect to preservation of anorectal function at the time of the last follow - up . in our study , 4 patients received a diverting stoma again due to surgical complications including poor healing of recurrent inflammation at the anastomosis site ( 1 patient ) , permanent fistula formation ( 2 patients ) , and anostomosis stenosis ( 1 patient ) . because our study was not a randomized comparative studythe definition of pcr after preoperative crt varies between 95 % or more primary tumor response , pt0 only , or pt0n0 . however , tumor regression after preoperative crt may be observed not only in the primary tumor , but also in the perirectal metastatic lymph nodes , and the observation of complete primary tumor regression ( pt0 ) does not guarantee complete nodal sterilization . actually , the rate of nodal disease ( pn + ) in patients with complete primary tumor regression ( pt0 ) has been reported be as high as 17 % . in addition , several studies have reported that pn status is a significant prognostic factor for long - term outcome in locally advanced rectal cancer patients . coco et al . reported a 10 - year overall survival rate of 66 % in pn0 patients and 42 % in pn + patients ( p = 0.003 ) , and shivnani et al . reported 5 - year disease - free survival rates of 79 % in pn0 - 1 patients and 25 % in pn2 patients ( p = 0.002 ) . yeo et al . investigated the long - term outcomes of rectal cancer patients with pt0 following preoperative crt and determined the prognostic significance of pn status . in that study , the 5 - year disease - free survival and overall survival rates in pt0n0 were 88.5 % and 94.8 % , and in pt0n + patients were 45.2 % and 72.8 % , respectively ( p 0.001 ) . these findings indicated that a pcr group defined only by primary tumor response ( pt0 ) may contain pt0n + patients , and these pt0n + patients have significantly different long - term outcomes . therefore , we believe the definition of pcr after preoperative crt should be pt0n0 . in our study , 's study , the 5 - and 8 - year overall survival rates , loco - regional recurrence - free survival rates , and distant metastasis - free survival rates for pcr patients were 100 % and 100 % , 100 % and 88.9 % , 95.5 % and 95.5 % , respectively . although many physicians follow an intensive surveillance program for at least 5 years in cases of rectal cancer , recommendations for the postoperative surveillance period after preoperative crt followed by tme remain unclear . coco et al . reported that 28 % of local recurrence and 9.5 % of distant metastasis developed 5 years after tme in rectal cancer patients receiving preoperative crt , and guillem et al . reported that all local recurrence developed 5 years after tme . in our study , 16.7 % ( 5/30 ) of local recurrence and 12.8 % ( 5/39 ) of distant metastasis developed 5 years after curative tme . these findings suggest that preoperative crt is capable of delaying recurrence in rectal cancer patients , and a surveillance period longer than 5 years is warranted for a complete assessment of the outcome of rectal cancer treated by preoperative crt followed by curative rectal resection . in order to confirm the effectiveness of specific postoperative surveillance programs , multicenter trials with large sample sizes and long - term follow - up periods will be required to better define the patterns of loco - regional and distant recurrence for rectal cancer patients treated with preoperative crt followed by tme . in the management of patients with locally advanced rectal cancer , perhaps no topic is as controversial as the prognostic factors for survival after preoperative crt . numerous studies have reported prognostic factors significantly associated with survival , but most were retrospective or small phase ii studies , and their results were inconsistent . there have been no large , prospective phase iii clinical trials which evaluate prognostic factors until now . however , from among the various prognostic factors , pcr after preoperative crt has been accepted in several studies as significant prognostic factor for survival . likewise , in our study , pcr was a significant prognostic factor for overall survival , loco - regional recurrence - free survival , and distant metastasis - free survival in univariate analysis . after multivariate analysis , pcr remained a significant factor for overall survival and distant metastasis - free survival . several studies reported highly favorable results for rectal cancer patients showing pcr after preoperative crt . furthermore , habr - gama and perez reported that post - crt clinical complete responders who were managed by observation alone , with no surgical resection , had oncologic outcomes similar to those managed by preoperative crt followed by radical surgery . so , habr - gama and perez proposed that clinical complete responders after crt should receive no surgery but be subjected to close observation instead . with these findings in mind , identification of predictive factors for pcr is important for predicting treatment outcomes and developing risk - adapted treatment . a low pretreatment carcinoembryonic antigen level , use of 5 - fu in a continuous venous infusion fashion , delivery of rt dose higher than 45 gy , use of a second drug in addition to 5 - fu , and longer intervals between crt and surgery were reported to be significant predictive factors for pcr . in our study , pretreatment clinical stage was a significant predictive factor for pcr . in patients who received rt doses higher than 50.4 gy and who received concurrent chemotherapy using 5 - fu plus additional agents , the pcr rate after preoperative crt was higher , but not statistically significantfor example , postoperative chemotherapy was provided according to the attending physician 's discretion rather than a predetermined protocol . third , the duration of the follow - up period was not sufficiently long in some cases , and consequently , this study may underestimate the cancer recurrence rate . despite these limitations , we believe that our study contributes to resolving several controversial issues in rectal cancer management . in our study , preoperative crt for locally advanced rectal cancer resulted in a high rate of overall survival , sphincter preservation , downstaging , and pcr . we defined pcr as pt0n0 , and the patients achieving pcr after preoperative crt had very favorable outcomes ( 5 - and 8 - year overall survival rates were both 100 % ) . pcr was found to be a significant prognostic factor for both overall and distant metastasis - free survival .\noutput:\n" }, { "from": "agent", "value": "purposethis study was designed to investigate the long - term oncologic outcomes for locally advanced rectal cancer patients after treatment with preoperative concurrent chemoradiotherapy followed by total mesorectal excision , and to identify prognostic factors that affect survival and pathologic response.materials and methodsfrom june 1996 to june 2009 , 135 patients with locally advanced rectal cancer were treated with preoperative concurrent chemoradiotherapy followed by total mesorectal excision at kyung hee university hospital . patient data was retrospectively collected and analyzed in order to determine the treatment outcomes and identify prognostic factors for survival.resultsthe median follow - up time was 50 months ( range , 4.5 to 157.8 months ) . after preoperative chemoradiotherapy , sphincter preservation surgery was accomplished in 67.4 % of whole patients . a complete pathologic response was achieved in 16 % of patients . the estimated 5 - and 8 - year overall survival , loco - regional recurrence - free survival , and distant metastasis - free survival rate for all patients was 82.7 % and 75.7 % , 76.8 % and 71.9 % , 67.9 % and 63.3 % , respectively . the estimated 5 - and 8 - year overall survival , loco - regional recurrence - free survival , and distant metastasis - free survival rate for pathologic complete responders was 100 % and 100 % , 100 % and 88.9 % , 95.5 % and 95.5 % , respectively . in the multivariate analysis , pathologic complete response was significantly associated with overall survival . the predictive factor for pathologic complete response was pretreatment clinical stage.conclusionpreoperative chemoradiotherapy for locally advanced rectal cancer resulted in a high rate of overall survival , sphincter preservation , down - staging , and pathologic complete response . the patients achieving pathologic complete response had very favorable outcomes . pathologic complete response was a significant prognostic factor for overall survival and the significant predictive factor for a pathologic complete response was pretreatment clinical stage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: muscle damage and delayed onset muscle soreness ( doms ) may occur at different levels depending on the type of contraction ( concentric or eccentric ) , type of exercise ( plyometric jumps , resistance training , downhill runs , long - term runs , etc . ) , movement speed ( high or low angular velocity ) , time interval between sets , and trainability of the individual ( sedentary , physically active , or trained ) 1 . for a given muscle power , it is known that there is less recruitment of motor units for eccentric contraction than for concentric contraction2 . this higher strength / activation ratio exerts high stress on the tissues involved , and is considered the main factor in structural damage of muscle fibers . additionally , the connective tissue is stretched , causing greater passive strain on the cytoskeleton . these two factors together are responsible for a higher incidence of muscle damage and consequent reduction in contractile capacity , also known as fatigue3 . it has recently been postulated that muscle damage caused by eccentric or any other physical activity may be minimized by performing the same type of exercise a few weeks after the initial training . the protective mechanism of the repeated bout effect appears to be due to an increase in the recruitment of slow contraction motor units , activation of a large number of motor units ( neural adaptation ) , increased dynamic and passive muscular endurance ( mechanical adaptation ) , longitudinal addition of sarcomeres , adaptation to the inflammatory response , and adaptation to maintain muscle excitation - contraction coupling ( cellular adaptation ) 5 . however , most studies that investigated the repeated bout effect observed a decrease in the ability of muscle to generate strength and power . few studies have verified the repeated bout effect or the effect of repetition of eccentric exercise on subsequent aerobic performance . previous articles reported that both oxygen consumption kinetics and running economy are negatively affected when a prior eccentric exercise is performed6 , 7 . therefore , the present study aimed to evaluate the influence of repeated bouts of eccentric exercise on subsequent high - intensity aerobic performance . it is believed that severe neuromuscular fatigue develops after eccentric high - intensity exercise . however , an analysis of the literature suggests that the harmful effects may be minimized by performing the same activity several weeks later , which could induce favorable adjustments to offset these effects on subsequent aerobic performance . the subject population was a convenience sample comprised of 7 healthy male volunteers , sedentary for at least 3 months , and with no experience in resistance training . demographic data for the sample were as follows ( mean standard deviation [ sd ] ) : age ( 21.73.4 years ) ; body mass ( 67.29.9 kg ) ; height ( 171.50.0 cm ) ; fat percentage ( 15.47.1 % ) and maximum oxygen consumption ( 44.12.8 mlkgmin ) . each volunteer was informed about the investigational procedures and their implications , and provided signed informed consent to take part in the study . the study was approved by the human research ethics committee of unisalesiano , protocol number : 292/09 . anthropometric data included body mass ( bm ) , height ( h ) , and the percentage of body fat from skinfold measurements8 . subjects performed incremental treadmill testing until volitional exhaustion to determine vo2max and the intensity associated with the achievement of vo2max ( vvo2max ) . this test started at 8 kmh , with increases of 1 kmh at each stage . using a metabolic analyzer ( cortex metalyser 3b , leipzig , germany ) , each subject was encouraged to give maximum effort . the test completion was determined by volitional exhaustion or when one of the following criteria was reached9 : ( 1 ) peak heart rate ( hr ) at least equal to 90 % of the age - predicted maximum ; ( 2 ) respiratory exchange ratio ( rer ) greater than 1.1 ; and ( 3 ) increased intensity with stable oxygen consumption . the vo2max was defined by the higher average value of oxygen consumption ( vo2 ) found during the last 30 s of each stage . the subjects returned to the laboratory the following week to determine the time limit to vvo2max ( tlim control ) , which was characterized by treadmill running at vvo2max until voluntary exhaustion ; the hr and lactate concentration ( yellow springs 1500 sport , ohio , usa ) were measured before and after tlim . a plyometric activity was performed in the third week , consisting of 10 sets of 10 depth jumps , with a 1 - min interval between each set , in which subjects jumped from a high level ( 0.6 m ) . after landing , the subjects were asked to perform the strongest possible vertical jump , to land on another higher plane placed 1 m in front of the first . after 15 min , they performed another time limit activity ( tlim 1 ) . after 6 weeks of limited physical activity , volunteers returned to the laboratory to perform the same procedures as in the third week , with a plyometric activity followed by treadmill running at vvo2max ( tlim 2 ) . for at least 24 h before the experiments , volunteers were advised to avoid any strenuous physical activity and alcoholic or caffeinated drinks , with a night of proper rest and the last meal at least 2 h prior to the test . to avoid any effects of a circadian cycle , all procedures were performed during the same period and time of day for each subject . statistical analysis was performed using spss version 20.0 ( chicago , il , usa ) prior to any analysis , a shapiro - wilk normality test was applied . before the confirmation of normality , one - way analysis of variance ( anova ) was applied with a post - hoc tukey test to compare data for tlim ( control , 1 , and 2 ) and physiological variables related to performance times ( blood lactate and hr ) . student s t - test was used for paired data for the same physiological variables before and after the plyometric activity . in all analyses , a significance level of p0 .05 was adopted . table 1table 1 . characteristics of volunteersmeansdage ( years ) 21.73.4 body weight ( kg ) 67.29.9 height ( cm ) 171.50.0 fat percentage ( % ) 15.47.1 vo2max ( mlkgmin ) 44.12.8 vvo2max ( kmh ) 12.71.7 vo2max : maximum oxygen uptake ; vvo2max : speed associated with maximum oxygen uptake shows the initial data of the sample , including the cardiorespiratory variables ( vo2max and vvo2max ) related to the initial level of physical fitness , as an inclusion criterion . vo2max : maximum oxygen uptake ; vvo2max : speed associated with maximum oxygen uptake table 2table 2 . permanence time at vvo2max in control situations ( tlim control ) and after the first and second session of depth jumps ( tlim 1 and tlim 2 ) tlim control ( s. ) tlim 1 ( s. ) tlim 2 ( s. ) mean283 .4125.2192.7 sd47 .764.171.9 significant difference from tlim control ; p 0.05 shows tlim ( control , 1 , and 2 ) . there was a significant difference between tlim 1 and tlim control , suggesting the deleterious effect of previous eccentric exercise . however , after 6 weeks of limited activity , tlim control and tlim 2 showed no statistically significant differences , demonstrating the repeated bout effect on subsequent aerobic performance . significant difference from tlim control ; p 0.05 tables 3 and 4table 3 . mean values and standard deviation ( sd ) of physiological responses ( blood lactate concentrations [ lac ] , and maximum heart rate hrmax ) after tlimmeansd [ lac ] tlim control ( mmol / l ) 11.684.43 [ lac ] tlim 1 ( mmol / l ) 9.083.75 [ lac ] tlim 2 ( mmol / l ) 9.843.38 hrmax tlim control ( bpm ) 198.410.6 hrmax tlim 1 ( bpm ) 192.212.6 hrmax tlim 2 ( bpm ) 198.110.6 show the hr and concentrations of lactate after tlim and following the depth jumps , respectively . table 3 shows no statistically significant differences for the 2 variables after 3 time limits . table 4table 4 . mean values and standard deviation ( sd ) of physiological responses ( blood lactate concentrations [ lac ] , and maximum heart rate hrmax ) after the depth jump ( dj ) meansd [ lac ] jd 1 ( mmol / l ) 7.573.21 [ lac ] jd 2 ( mmol / l ) 5.912.36 hrmax jd 1 ( bpm ) 177.87.1 hrmax jd 2 ( bpm ) 178.010.3 shows the same results after depth jumps . the purpose of this research was to investigate the influence of the repeated bout effect of eccentric exercise on subsequent high - intensity aerobic performance . the primary finding was that eccentric exercise decreases aerobic performance after the first time limit , but deleterious effects are minimized after performing the same exercises ( jumps ) a few weeks later . this adaptation is called the repeated bout effect11 , 12 . in the current study , thus , one of the criteria used to determine the cardiorespiratory level of subjects was obtained in an incremental ergometry test . thus , the volunteers were considered sedentary , because of their average values for vo2max ( 44 ml / kg / min ) . according to the present investigation and previous studies that also used depth jump exercises to generate muscle damage , low ( 10 jumps ) and high volumes ( 4550 jumps ) , provided the same protective effect against muscle damage induced by the first exposure . however , a larger volume of eccentric movements induces muscle damage as compared to a lower volume5 , 14 . muscle damage is closely related to decreased muscle contractile capacity ; in physiological terms , the greater the damage , the greater the muscle fatigue15 . the protective mechanism of the repeated bout effect appears to be due to an increase in the recruitment of slow contraction motor units , activation of a large number of motor units ( neural adaptation ) , increased dynamic and passive muscular endurance ( mechanical adjustments ) , longitudinal addition of sarcomeres , adaptation to the inflammatory response , and adaptation to maintain muscle excitation - contraction coupling ( cellular adaptation ) 5 , 14 . however , there is little information about the repeated bout effect of eccentric exercise on subsequent aerobic performance . the effect of repeated bouts of eccentric exercise on running economy16 , 17 and vo2 kinetics during cycloergometric exercise performance7 was verified by some authors . the effect of eccentric exercise on running economy seems to be intensity dependent ; at moderate intensities ( 5575 % of vo2max ) , running economy is not affected , but is only influenced at high intensities ( up to 90 % of vo2max ) . this is due to prior fatigue of type ii fibers that are additionally recruited at high aerobic exercise intensities18 . moreover , byrne , twist , and eston19 reported that the performance of eccentric exercise at high intensity prior to aerobic activities can lead to reduction in contractile ability of the quadriceps muscles and reduced muscle force development ratio ( fatigue ) , thus increasing the contact time with the ground during running and decreasing efficiency of the exercise . according to billat et al. 20 , the determination of vvo2max is dependent on factors that are not related solely to anaerobic participation in the aerobic component , especially with regard to the slow component of oxygen uptake kinetics . eccentric exercise performed prior to aerobic exercise decreases the recruitment level of type ii fibers , thus decreasing the amplitude of the slow component in determining vo2max , and interfering with the time to exhaustion at vvo2max20 , 21 . thus , the adaptations to the repetition of exercise cited by miyama and nosaka5 can improve the level of muscle fiber recruitment after the performance of the second eccentric exercise , which could explain the statistically similar times between tlim control and tlim 2 . for the limit time exercise at vvo2max ( tlim control , tlim 1 and tlim 2 ) , and the depth jump performed by the volunteers , physiologic stress apparently was no different between the moments before and after six weeks without exercise , since the hr values and lactate concentrations were statistically similar . however , the lactate concentrations after tlim 1 and tlim 2 tended to be lower than in tlim control . this lower concentration can be explained by lower lactate removal capacity after exercises with high - intensity eccentric contractions22 . thus , it can be concluded that the repeated bout effect exerts a positive influence on vvo2max , possibly resulting in less deleterious effects on the permanence time after 6 weeks of limited physical activity . however , methodological limitations of this study suggest the need for further research . due to the great variability of the tlim , a larger sample would increase the statistical power . in addition , the kinetic measurement of oxygen uptake , and even electromyographic evaluation of the muscles involved , could help explain the repeated bout effect on subsequent high - intensity aerobic activity , as well as variables related to muscle damage ; these findings could help explain the damage caused by eccentric high - intensity activities .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] it is believed that eccentric high - intensity exercise can decrease performance in subsequent exercise . however , with repetition , the deleterious effects can be minimized . thus , this study evaluated the influence of repeated bouts of eccentric exercise on subsequent high - intensity aerobic performance . [ subjects and methods ] seven healthy and sedentary male volunteers were recruited . a ) visit 1 : determination of maximum oxygen uptake ( vo2max ) and speed associated with maximum oxygen uptake ( vvo2max ) in incremental treadmill testing ; b ) visit 2 : run to exhaustion at vvo2max ( tlim control ) ; c ) visit 3 : 10 sets of 10 depth jumps , followed by a run to exhaustion at vvo2max ( tlim 1 ) ; d ) visit 4 : after 6 weeks without any physical training , the volunteers carried out the same procedures as on the third visit ( tlim 2 ) . data were analyzed using one - way analysis of variance ( anova ) with the post - hoc tukey test . [ results ] significant differences were found between tlim control and tlim 1 ( 283.4 47.7 s vs. 125.2 64.1 s , respectively ) , these were not different from tlim 2 . [ conclusion ] eccentric exercise showed deleterious effects on subsequent high - intensity aerobic performance . these effects were minimized after the exercise protocol was repeated 6 weeks after the first event ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: by 2020 , the cost to treat diabetes mellitus , its complications , and its associated loss of productivity and life will exceed can $ 19 billion a year . compelling evidence supports the benefits of intensive glycemic , lipid , and blood pressure control in the prevention and management of diabetes complications . however , diabetes self - management is a challenge for many people as it involves learning and adopting self - care and self - monitoring practices . for instance , medical nutrition therapy , a cornerstone in diabetes management , is one of the most challenging aspects of management , encompassing not only healthy eating , but also insulin dose adjustment to carbohydrate consumed , as well as prevention and treatment of hypoglycaemia . household food insecurity is significantly more common among canadians with diabetes ( 9.3 % ) compared to canadians without diabetes ( 6.8 % ) , which is similar to that of other countries . food security exists when all people , at all times , have physical and economic access to sufficient , safe , and nutritious food to meet their dietary needs and food preferences for an active and healthy life . notably rooted in poverty , food insecurity for people with diabetes poses additional challenges , principally , the lack of adequate and appropriate food and the effect on diabetes management . studies of adults who are food insecure show that they are more likely to have poorer health , inferior social support , and more comorbid conditions ( e.g. , obesity , high blood pressure , heart disease , and allergies ) as well as greater psychological distress and unhealthy behaviours , including smoking , physical inactivity , and low consumption of fruits and vegetables . specifically , food insecure adults with diabetes are more likely to have poor glycemic control , long - term complications , and severe and frequent hypoglycaemia . while it is clear that those that are living with diabetes and are food insecure experience more health problems and poorer overall health , knowledge on how they cope and manage with this health intersection and information on their lived experiences to datethis type of knowledge can provide insight on how to better support and care for this population . using in - depth interviews with adults living with diabetes and food insecurity , our research paper explores these lived experiences and tries to understand how food insecurity affects people 's ability to manage their diabetes . the semistructured interview guide was based on the social determinants of health framework , given the significant influence of material deprivation and financial constraints on diabetes management decisions . the findings will be novel as there is very limited qualitative research in this area . there is little contextual research on how and why individuals with diabetes coping with food insecurity are more likely to practice unhealthy behaviours and endure greater psychological distress . using six phases of analysis , we chose qualitative , deductive thematic analysis , as it is flexible in its approach to extract themes from participants ' accounts . with the help of diabetes educators and flyers promoting the study , we conducted one - on - one interviews with clients from the local community , three community health centres , and a community - based diabetes education centre serving a low - income population in the greater toronto area , ontario , canada . eligibility criteria included a diagnosis of type 1 or 2 diabetes , english speaking , and having experienced food insecurity in the past year . three questions were adapted from the household food security survey module ( hfssm ) to identify participants : ( 1 ) in the past year , were you ever not able to buy your basic foods , such as fruits and vegetables ? ( 2 ) in the past year , were you ever not able to buy your favourite foods ? ( 3 ) in the past year , did you ever have to eat less than you felt you should have because of a limited budget ? homeless individuals were excluded , as the complexity of psychosocial vulnerabilities and mental health issues would extend far beyond the scope of our research question . ethics approval for this research study was obtained from ryerson university 's research ethics board in ontario , canada ( reb 2008 - 294 ) . the four - member research team are comprised of one academic expert in diabetes ( enza gucciardi ) , one expert in qualitative research ( jacqui gingras ) , and two practice experts in diabetes ( justine chan , margaret demelo ) . eligibility , demographic information , and verbal informed consent were confirmed by the lead author prior to the interview . in total , 21 individual face - to - face interviews were conducted , lasting 30 to 90 minutes . introduction can you remember when you were first diagnosed with diabetes ? what was it like ? can you remember when you were first diagnosed with diabetes ? what was it like ? health services think back to when you first learned about what you would need to do to manage your diabetes . what did the doctor / nurse / and so forth tell you about what you had to do to manage your diabetes ? what was it like learning about what you needed to do in terms of food , physical activity , and medication ? what challenges did you face in trying to follow the recommendations of your physician or the diabetes health care team ? can you tell me when you first found it difficult to buy or find food ? was this before or after you found out you had diabetes ? think back to when you first learned about what you would need to do to manage your diabetes . what did the doctor / nurse / and so forth tell you about what you had to do to manage your diabetes ? what was it like learning about what you needed to do in terms of food , physical activity , and medication ? what challenges did you face in trying to follow the recommendations of your physician or the diabetes health care team ? can you tell me when you first found it difficult to buy or find food ? was this before or after you found out you had diabetes ? income and social status how did you manage through the times when you found it hard to buy or find food ? how has this affected you in the past year ? if they have kids or living with family : when providing meals for other people in the household , what were your major concerns ? how did you manage through the times when you found it hard to buy or find food ? how has this affected you in the past year ? if they have kids or living with family : when providing meals for other people in the household , what were your major concerns ? social environments / social support networks were you able to get the help / assistance / understanding / support you felt you needed during these times ? what support was available to you at this time ( formal support from health / social care providers , family , friends , church group , etc . ) ? what supports really made a difference for you ; what was most helpful to you ? what more can they ( heath care providers , government , etc . ) do to better help you ? how have concerns around food affected your daily life ? were you able to get the help / assistance / understanding / support you felt you needed during these times ? what support was available to you at this time ( formal support from health / social care providers , family , friends , church group , etc . ) ? would you tell a bit me about these experiences ? what supports really made a difference for you ; what was most helpful to you ? what more can they ( heath care providers , government , etc . ) do to better help you ? how have concerns around food affected your daily life ? personal health practices and coping skills some of the things we 've been talking about soundhow confident are you now in your ability to manage your diabetes ? some of the things we 've been talking about sound like they may have been very difficult / challenging for you . cool - down / wrap - up looking back on your own experiences , what would have made this whole journey easier for you ? if you could send a message to other people in your situation , what would it be ? what would you like them to know ? is there anything else about this experience that was important to you that we have n't talked about ? the responses you have provided may lead to some more questions . if so , can we contact you for a follow - up interview?probes were used to encourage participants to elaborate on their experiences . looking back on your own experiences , what would have made this whole journey easier for you ? if you could send a message to other people in your situation , what would it be ? is there anything else about this experience that was important to you that we have n't talked about ? our analysis process required six phases , beginning with the research team reviewing interview transcripts , while making notes for potential codes to return to at a later stage in analysis . the second phase involved developing preliminary codes , 50 in total , to capture as many potential themes as possible . we grouped transcript excerpts under these codes both manually and by nvivo data management software . following phase two , we created clusters of codes and grouped them into ten major themes using the repetition technique where recurring topics generated the most relevant ideas . in the third phase , we used thematic networks to systematically present the study findings by listing our themes from specific to broad , that is , basic , organizing , and global themes , respectively . in the fourth phasethe basic themes were then grouped under three overarching themes . in the fifth phase , we refined theme wording to capture the meaning of what was said . the sixth phase involved writing and revising the manuscript report , while the research team carefully considered the most meaningful extracts . our data analysis produced three main themes that captured the experiences of people with diabetes who are food insecure : ( 1 ) barriers to preparing and accessing appropriate food , ( 2 ) social isolation , and ( 3 ) enhancing agency and resilience ( see figure 1 ) . most participants could not afford foods appropriate for their diabetes management . always buying healthy foods , counting carbohydrates , or tracking serving amounts were unrealistic approaches to meal planning because food supplies were often erratic due to an inconsistent and unpredictable source of income . when grocery shopping , their goal was to buy whatever cost the least ( see interviewee 1 ) . participants also worried about not having enough food to eat and described the additional challenges brought on by a limited budget ( see interviewee 2 ) . meal planning was difficult and many depended on other resources , such as food banks and community kitchens . inappropriate foods available at food banks ( i.e. , high in starch , salt , and sugar ) were voiced ( see interviewees 4 and 5 ) . unfortunately , participants still struggled with access to these food sources ( see interviewee 3 ) . for example , a single mother modified her work hours with the food bank 's operating hours . access to food was often better at the beginning of the month , resulting in more erratic blood sugars by month 's end.housing environments presented barriers to food preparation . many did not own a stove , resorting to microwaveable foods ( see interviewee 6 ) . a lack of proper cooking facilities resulted in greater use of higher sodium foods such as processed and canned foods.misperception of the type of foods recommended for diabetes management was widely common . participants discussed how specialty foods , such as those containing artificial sweeteners or labeled diabetic , were perceived asbetter , expensive , and , contrary to current nutrition recommendation , understood to be necessary for the management of diabetes ( see interviewees 7 and 9 ) . the barriers resulting from the intersection of diabetes and food insecurity were especially evident for those who had to cope with debilitating comorbidities . retinopathy and neuropathy , in particular , greatly reduced their access and selection of both fresh and appropriate foods ( see interviewee 8 ) . for example , many voiced the challenge of no longer being able to travel to food banks or grocery stores and had difficulty selecting and preparing food ( see interviewee 2 ) . most participants could not afford foods appropriate for their diabetes management . always buying healthy foods , counting carbohydrates , or tracking serving amounts were unrealistic approaches to meal planning because food supplies were often erratic due to an inconsistent and unpredictable source of income . when grocery shopping , their goal was to buy whatever cost the least ( see interviewee 1 ) . participants also worried about not having enough food to eat and described the additional challenges brought on by a limited budget ( see interviewee 2 ) . meal planning was difficult and many depended on other resources , such as food banks and community kitchens . inappropriate foods available at food banks ( i.e. , high in starch , salt , and sugar ) were voiced ( see interviewees 4 and 5 ) . unfortunately , participants still struggled with access to these food sources ( see interviewee 3 ) . for example , a single mother modified her work hours with the food bank 's operating hours . access to food was often better at the beginning of the month , resulting in more erratic blood sugars by month 's end . many did not own a stove , resorting to microwaveable foods ( see interviewee 6 ) . a lack of proper cooking facilities resulted in greater use of higher sodium foods such as processed and canned foods . participants discussed how specialty foods , such as those containing artificial sweeteners or labeled diabetic , were perceived asbetter , expensive , and , contrary to current nutrition recommendation , understood to be necessary for the management of diabetes ( see interviewees 7 and 9 ) . the barriers resulting from the intersection of diabetes and food insecurity were especially evident for those who had to cope with debilitating comorbidities . retinopathy and neuropathy , in particular , greatly reduced their access and selection of both fresh and appropriate foods ( see interviewee 8 ) . for example , many voiced the challenge of no longer being able to travel to food banks or grocery stores and had difficulty selecting and preparing food ( see interviewee 2 ) . so i 'll buy junk food , instead of real food because the junk food is cheaper . interviewee 2 : i 'm on [ disability benefits ] at the moment , so sometimes i find it 's a bit hardi have to be very conscious of and trying to think of not just buying food but planning meals and planning food throughout the month that will last throughout the monthsometimes i worry about running out of food and , because i 'm diabetic , i ca n't just skip mealsi find i have to be more conscious of what i eat and when i eat i find that a bit troubling . interviewee 3 : it 's all controlled by how much money you make how much you pay rent . most places [ food banks ] say you can come once every two weeks and they give you one shopping bag of groceries and that 's supposed to last you two weeks . so you have to go to the food kitchens you have your days kept busy running back and forth to find places to eat some days you might not make it there so you do n't eat properly . they only give you certain types of foods that do n't really help you with diabetes , more or less go against your diabetes a lot of sugar , cookies , stuff like that . interviewee 4 : it 's mostly pastas , heavy in starch , pasta , rice , pasta sauce and cereals , stuff that 's got sugar in it . they have fruit roll ups , they have junk food which i do n't eat , so i give back most of the stuff . but i never use it because the person before [ was ] i found this little thing and it 'd blow up on mei mean it looks nice , it 's kept clean and it 's spotless inside , but so is a hand grenade before you pull the pin toointerviewee 7 : i have to get artificial sweetener now , too , and that 's expensive compared to other stuff i get the diet soft drinks , and i get juices . but then there 's a lot of sugar in the juices , so i try and mix it with water , and then i find that not a lot of grocery stores have just a specific section . i 've noticed that some of them , like the drug stores have a certain section . some of the items that are in the diabetic aislesinterviewee 9 : it 'd be easier for me if i could just buy regular food , i do n't have to buy special stuff that 's low sugar and stuff . interviewee 8 : for the past 4 , 5 years all the eye problems and everything else it made it difficult to do things . you ca n't see to cook the finger gets numb because of the diabetes . the nerves and the fingers , you can not hold things and even when you 're buying stuffyou 're holding it , but you ca n't really tell whether it 's good or [ if ] it 's not good i just use the canned goods . interviewee 2 : i hate going [ to ] the grocery store and getting loads and loads of groceries . i 'd much prefer to shop every two or three days , but that 's not really practical in terms of getting enough food and making sure it keeps freshit 's hard when i 've got some physical problems and hauling it around is difficult . most participants were single and described the impact of food and eating alone on their well - being . socializing incurred more cost on travel and clothes ( see interviewee 5 ) . because lack of funds limited social interactions , many felt isolated and depressed ( see interviewee 6 ) . while some considered eating out a special treat , especially for those who felt lonely and isolated , the impact of limited finances and having diabetes further restricted social interactions . feelingthe need to justify their food and beverage choices and to eat and drink differently from their friends were apparent barriers ( see interviewee 9 ) . community food initiatives such as community kitchens and gardens , volunteering at food distribution centres , connecting to a church group , and attending drop - in meal programs were all means of connecting with others and were considered a valuable resource that helped to ameliorate both food insecurity and social isolation ( see interviewees 10 and 11 ) . most participants were single and described the impact of food and eating alone on their well - being . socializing incurred more cost on travel and clothes ( see interviewee 5 ) . because lack of funds limited social interactions , many felt isolated and depressed ( see interviewee 6 ) . while some considered eating out a special treat , especially for those who felt lonely and isolated , the impact of limited finances and having diabetes further restricted social interactions . feelingthe need to justify their food and beverage choices and to eat and drink differently from their friends were apparent barriers ( see interviewee 9 ) . community food initiatives such as community kitchens and gardens , volunteering at food distribution centres , connecting to a church group , and attending drop - in meal programs were all means of connecting with others and were considered a valuable resource that helped to ameliorate both food insecurity and social isolation ( see interviewees 10 and 11 ) . interviewee 5 : i 've been inverting myself more to a cocoon ? i 've stopped socializingdo n't feel like it cost of going , even if it 's just subway or gas , it 's money . i finally went to [ an event ] last week , because i really had the feeling that if i did n't show up this time , they were n't going to invite me again but people do n't know yes , i 'm in between , going through a hard time , but that 's about it . interviewee 6 : since i ca n't always get what i really want , it adds to the depressioni ca n't go to the restaurant with my friends , cause the guys are , like , cmon let me just take you for a cup of coffee or something outside i do n't have the money to do that . a lot of times you have to go off your diet because , one , you ca n't afford it or , two , you have your meds . thank god it 's [ diabetes medication ] been covered , to compensate for what you do n't have . i might go to get a taco or something that i have n't had in a long while , or go into the local grocery store . it 's also a treat i 've got a can opener that works , but how ofteni 'd like to go out more , and i really ca n't , you know ? i 'm tired of saying well , we ca n't really go out can we do this instead ? which does n't cost any moneyoh i 'm diabetic , and i ca n't do this , this , and this , without making myself look like i 'm really , really sick and i 'm not really that sick , it just means that i 've got to limit myselflet 's go to a club or somewhere i ca n't drink because you know when you drink even beer , it 's got sugar in it . if i have one beer , it 's going to affect me the next dayif i go to a club and order a diet coke , you know they 're just going to say what 's wrong with him ? i 'm not going to really want to get into a big explanation about how sugar affects me . so there 's a community dinner that i go to , my [ church group ] i 've gone there for yearsi go to drop - ins with my friends for two reasons : one , because i like to eat with other people , and two , because i ca n't afford to buy food anymoresome of them have food that 's very high in carbohydrates , which is n't good for diabetics plus it puts weight on you . most sundays i go home with somebody that is the next supportive group , my church they take me home and i 'm fed for the day . one or more major life events , such as financial loss , job loss , marital separation , or divorce coincided with the onset of food insecurity . for example , participants used positive self - talk , such as believe in your heart that it will be alright , my life will get back on track , you just live one day at a time , andit 's got ta be over one way or the other.the role of healthcare providers is pivotal in enhancing agency and resilience . participants drew on the heartfelt help and practical diabetes management strategies received from healthcare providers who they found to be genuinely caring , gentle , and loving ( see interviewee 14 ) . feeling cared for was referred to as the human factor and resonated in the examples participants gave , serving as empowerment to better manage their diabetes . other participants appreciated when their healthcare providers inquired about issues not related to diabetes ( see interviewee 15 ) . participants offered suggestions to care providers on what was helpful to them : keep information simple for people to understand , listen to patients , be positive , and encouraging and supportive , and do not be judgmental . practical advice and counselling helped them regain their agency in managing diabetes and coping with food insecurity . more specifically , participants suggested specific inexpensive menus , more lists , more recipes , and low - cost ideas of meals , creative ways to share food , and alternatives to food choices ( see interviewee 9 ) . in these ways , healthcare professionals can tailor their advice specifically to the needs of food insecure clients.participants demonstrated resilience by implementing various strategies to better manage their diabetes , given their circumstances . for example , several participants spoke about including protein with meals , saving time and costs by batch cooking and buying starchy foods in bulk , comparison - shopping for sale items , and buying nonbrand items from discount grocery stores . participants acknowledged that taking their medications regularly helped to compensate for their limited control over food intake and compromised food choices ( see interviewee 6 and interviewee 2 ) . one or more major life events , such as financial loss , job loss , marital separation , or divorce coincided with the onset of food insecurity . for example , participants used positive self - talk , such as believe in your heart that it will be alright , my life will get back on track , you just live one day at a time , andparticipants drew on the heartfelt help and practical diabetes management strategies received from healthcare providers who they found to be genuinely caring , gentle , and loving ( see interviewee 14 ) . feeling cared for was referred to as the human factor and resonated in the examples participants gave , serving as empowerment to better manage their diabetes . other participants appreciated when their healthcare providers inquired about issues not related to diabetes ( see interviewee 15 ) . , listen to patients , be positive , and encouraging and supportive , and do not be judgmental . practical advice and counselling helped them regain their agency in managing diabetes and coping with food insecurity . more specifically , participants suggested specific inexpensive menus , more lists , more recipes , and low - cost ideas of meals , creative ways to share food , and alternatives to food choices ( see interviewee 9 ) . in these ways , healthcare professionals can tailor their advice specifically to the needs of food insecure clients . participants demonstrated resilience by implementing various strategies to better manage their diabetes , given their circumstances . for example , several participants spoke about including protein with meals , saving time and costs by batch cooking and buying starchy foods in bulk , comparison - shopping for sale items , and buying nonbrand items from discount grocery stores . participants acknowledged that taking their medications regularly helped to compensate for their limited control over food intake and compromised food choices ( see interviewee 6 and interviewee 2 ) . interviewee 14 : i know from what i 've seen with you and your staff , you people do genuinely care about us . i mean since i was here last week till now , i 've felt better about the whole situation because i know there [ are ] people out there that do actually care that i 'm a diabetic it really does make you feel better . it makes you wan na stay on track even more and the way i see it , this is only human nature . because everyone wants to feel loved somewhere , somehow , and when you know you have a group like that behind you , it , it makes you stronger . interviewee 15 : every time i go see [ my family doctor ] he 's not just like , are you taking too much salt in ? so i listen to himinterviewee 9 : i 'd say the most help i get is through this dietitian . you knowwhy do n't you try this or you know , mix that with that ? and , you know , i tell her my budget is limited and she 'll say , okay , this is cheaper , try that , and it 'd be things i would never think of . interviewee 6 : where the food is cheap if you take your medication , it will counteract the stuff that you 're not supposed to have you eat what you can get , when you can get it . a lot of times you have to go off your diet because , one , you ca n't afford it or , two , you have your meds . thank god [ they 're ] covered , to compensate for what you do n't have . interviewee 2 : i think just keeping a positive outlook and just making sure i take my medicationsi guess i figure that the medication will make up for some of the lapses that i 've done , because i know that some people are able to perfectly manage diabetes . individuals living with diabetes who are food insecure face many challenges that greatly impact their ability to self - care . our findings demonstrate that these individuals have a limited ability to acquire , select , and prepare appropriate foods , in addition to maintaining consistent carbohydrate intake and meal spacing throughout the day . barriers to observing an appropriate diet for diabetes management include financial constraints , a knowledge deficit for healthy meal planning on a limited budget , housing environments unconducive to food preparation and storage , inadequate community resources , and physical disabilities associated with comorbidities . the literature in canada and australia confirms that many have insufficient income left after paying rent to purchase appropriate food . this was further compounded by the misperception that a proper diabetes diet requires dietgiven the rising cost of healthy food , the circumstances of those who are food insecure can only get worse . many study participants relied heavily on canned and convenient , high sodium , high carbohydrate foods . they stressed the inadequacy of food banks and community kitchens in meeting their special diet needs , a finding consistent with tarasuk 's research on community - based responses to food insecurity . lpez and seligman suggest that the reliance on low - cost , energy dense foods and the inability to afford nutritious food can have a cascading effect not only on glycemic control , but also on depression , distress , and fatigue , all of which can negatively impact self - management behaviours . clinicians should therefore focus their recommendations on reducing portion size of foods that are available and accessible to them rather than focusing on food and beverage substitutions that may not be attainable . individuals with diabetes are more likely to have comorbidities than those without diabetes ; it is estimated that all individuals with diabetes in canada have some form of diabetic retinopathy , a frequent cause of legal blindness , and 40 to 50 % of canadians with type 1 or type 2 diabetes will manifest painful neuropathy within 10 years of diagnosis . several of our participants reported these complications and consequently had difficulty traveling to grocery stores , selecting fresh produce , and cooking nonprocessed foods due to sight and mobility impairments , creating a food insecure state in and of itself . clinicians should therefore keep an inventory of meal or food delivery resources such as meals on wheels , grocery gateway , orheart to home meals , all of which can assist an individual with physical disabilities to access , budget for , and prepare healthy foods without leaving the home and this has been supported by other research . based on our findings , we recommend that clinicians systematically screen for food insecurity , refer to the registered dietitian as needed , tailor the care plan , and identify increased health risks , particularly for hypoglycemia that often results from missed meals or inadequate carbohydrate intake . treatment regimens should incorporate medications that have a lower risk of hypoglycemia and that can be adapted to unpredictable or inadequate food intake as a result of food insecurity . trying to manage diabetes in conjunction with a low income led to social isolation for many ; most of them lived in single - person households , a common characteristic of food insecure individuals . our participants had no one to share and prepare meals with ; they also limited social interactions to save costs , increasing their risk of depressive symptoms . they used resources such as community kitchens , church groups , and food coops to cope with their food insecurity and social isolation . canadian research has shown decreased psychosocial distress and increased food security among community kitchen participants . we also recommend that clinicians incorporate more group - based learning opportunities such as workshops that focus on food budgeting , low - cost meals , and , as other authors have suggested , strategies for more affordable healthier substitutions ( e.g. , buying frozen instead of fresh vegetables ) . including a hands - on component such as a food skills demo is essential in engaging and motivating clients to try these strategies on their own . research suggests that food insecurity is cyclical , shifting between periods of food scarcity and food adequacy and that food insecurity can be either chronic or temporary . similar to research among low - income canadians , most participants in our study viewed their food insecurity as a temporary setback and employed various survival strategies to endure this setback . genuine care and support received from health care providers . valued relationships with healthcare providerscan be the key for patients to regain their agency to manage their diabetes during bouts of food insecurity . norwegian research suggests that healthcare providers can encourage diabetes self - management by employing an empathetic , individualized approach . it also has been suggested to move beyond the patient - centered approach to one that is empowering and partnering and that builds an emotional relationship between the healthcare professional and the client . furthermore , a recent study reported that food insecure clients respond well to diabetes self - management support programs as evidenced by a decrease in hemoglobin a1c and an increase in self - efficacy and fruit intake . the study has the following limitations . while we acknowledge that the experience between those with type 1 and type 2 diabetes differs , the goal of our paper was not to compare but to obtain the general challenges that these people experience . also , there currently is a lack of research available to distinguish the major differences in experience between the two groups . we interviewed participants in a large urban centre and , therefore , our findings may not be transferable to people in small towns and rural areas . future research should examine the benefits of physician screening for food insecurity and diabetes self - management programs tailored to food insecure clients as this has the potential to save significant medical costs and influence the future of diabetes care . food insecurity presents a great challenge to diabetes self - management , an already complex chronic illness . in our study , participants faced multiple barriers to accessing appropriate foods : insufficient income , misperceptions about healthy food choices , multiple comorbidities , and inadequate cooking facilities that cumulatively impact food acquisition , selection , and preparation . social isolation compounded these barriers , although it was somewhat buffered by the coping strategies they used and by the community food initiatives and social support networks they were able to access . without access to healthy food , the identified barriers can potentially result in fatigue , decreased social well - being , and increased health problems , ultimately discouraging an individual to practice self - care behaviours ( e.g. , blood glucose monitoring , physical activity , and healthy coping ) . healthcare providers should be aware of the challenges that food insecurity poses for people with diabetes , as well as the potential they have to optimize their encounters with patients . our findings underpin the importance of understanding diabetes through the perspectives of patients ' lives and tailoring diabetes management plans and community programs within the context of food insecurity .\noutput:\n" }, { "from": "agent", "value": "objective . to explore how food insecurity affects individuals ' ability to manage their diabetes , as narrated by participants living in a large , culturally diverse urban centre . design . qualitative study comprising of in - depth interviews , using a semistructured interview guide . setting . participants were recruited from the local community , three community health centres , and a community - based diabetes education centre servicing a low - income population in toronto , ontario , canada . participants . twenty - one english - speaking adults with a diagnosis of diabetes and having experienced food insecurity in the past year ( based on three screening questions ) . method . using six phases of analysis , we used qualitative , deductive thematic analysis to transcribe , code , and analyze participant interviews . main findings . three themes emerged from our analysis of participants ' experiences of living with food insecurity and diabetes : ( 1 ) barriers to accessing and preparing food , ( 2 ) social isolation , and ( 3 ) enhancing agency and resilience . conclusion . food insecurity appears to negatively impact diabetes self - management . healthcare professionals need to be cognizant of resources , skills , and supports appropriate for people with diabetes affected by food insecurity . study findings suggest foci for enhancing diabetes self - management support ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: inspite of multihypertensive drug treatment , significant proportion of poorly controlled hypertensives exist . greater incidences of stroke , heart failure , and end stage renal disease are reported in these patients ; rigorous blood pressure ( bp ) lowering treatment targets are recommended for these patient population . this has been clearly shown by elevated plasma levels of endothelin - 1 ( et - 1 ) and plasma renin activity in such subjects . it is now well established that increased et - 1 activity is one of the contributors for increased incidence of hypertension in diabetics with insulin resistance . similarly , association of increased body mass index with enhanced - eta - receptor - dependent vasoconstrictor activity in hypertensive subjects has been demonstrated . a substantial part of the poor responders to current antihypertensive therapy is characterized by salt sensitivity and increased - eta - receptor - dependent vasoconstrictor tone . such evidence suggests that abnormality in the endothelin system ( in addition to ras ) plays a role in the pathophysiology of poorly controlled / difficult to treat ( obesity - and diabetic - related ) hypertension and that targeting endothelin system in addition to the ras is a useful treatment for hypertension in these patients . diabetic nephropathy , characterized by progressive rise in bp , persistent albuminuria , and declining glomerular filtration rate , remains the leading cause of end stage renal disease requiring renal replacement therapy . clinical evidence suggests that there is a large unmet need to develop strategies for prevention of diabetic nephropathy and its progression to end stage renal disease . role of ras in development of glomerular hypertension and nephropathy is well established . targeting ras through angiotensin receptor blockade is now a strategy of choice to treat hypertension . in addition , et - 1 stimulates hypertrophy , proliferation , and extracellular matrix accumulation in the kidney , which are prevented by eta receptors blockers . similarly , eta receptor blockade has shown antiproteinuric effects in proteinuric chronic kidney disease patients . emerging experimental evidence from various studiessuggests that angiotensin ii ( ang ii ) and endothelin participate in a manner involving closely interwoven pathways ( crosstalk ) in increasing bp and inducing end organ damage . the pharmacological benefits of dual ang ii and et - 1 blockade have been demonstrated in form of their anti - hypertensive and anti - proteinuric effects both in rodents and humans . hence , concomitant blockade of both angiotensin and endothelin endocrine / paracrine pathways may lead not only to enhanced bp reductions but also retard end organ damage directly or indirectly . molecules with dual activity ( dual receptor blockers ) are like fixed - dose combination of two drugs which generally has the limitation of inability for physicians to titrate the individual dose of the combination for differential individual activity . at the same time , adopting dual receptor blockers strategy offers unique advantages especially when both the actives are contributing to overall similar therapeutic effect . better patient compliance and lower production cost further add utility of such approach in appropriate scenarios . these studies thus provided a rationale for a therapeutic strategy to develop compounds with dual receptor blocker action against at1 and eta receptors . candesartan cilexetil ( candesartan ) , a potent , long - acting , unsurmountable at1 receptor blocker used in clinic , with once - a - day dosing was selected to be studied as the comparator to trc120038 . this study was thus performed to compare the therapeutic potential of trc120038 and candesartan in reducing bp and end organ damage ( diabetic nephropathy and cardiomyopathy ) in obese zucker spontaneously hypertensive fatty rats ( ob - zsf1 ) , an animal model with a severe form of diabetes associated with clinically relevant comorbidities eventually leading to progressive renal and cardiac dysfunction . the chemical name of trc120038 is n - ( 4,5 - dimethyl -1,2-oxazol-3-yl ) - 3 - [ 4 - { [ 4,6 - dimethyl - 3 - ( thiophen -2-yl ) - 1h - pyrazolo [ 4,3 - c ] pyridin -1-yl ] methyl } - 2 - ( ethoxymethyl ) phenyl ] -5-methylthiophene-2-sulfonamide , and its chemical structure is presented in figure 1 . candesartan were formulated as suspensions in 3 % w / v hydroxyl propyl cellulose in water . trc120038 , a novel dual at1 / eta receptor blocker has an in vitro ec50 of 3 nm and 158 nm for hat1 and heta receptor blockade , respectively , along with reasonable selectivity ( 50x ) against hat2 and hetb receptors . trc120038 has no significant binding to any other receptors nor does it alter the activity of any enzymes out of a wide battery of receptors and enzymes tested on the panlabs battery of assays . male ob - zsf1 rats ( charles river laboratories , usa ) were used in the study . all animals were maintained in the pre - clinical and safety evaluation department , torrent research centre , housed in individually ventilated cages ( ivc ) system , maintained on a 12 - hour light - dark cycle , and had access to purina 5008 rat chow and water ad libitum . the ivcs were maintained under controlled environment temperature ( 223c ) , relative humidity ( 3070 % ) , and air exchange rate ( 4050 air changes per hour ) . all animal experiments were conducted in accordance with the cpcsea guidelines , and the studies were approved by the institutional animal ethics committee . rats ( 180250 gm b.wt ; 68 weeks of age ) were implanted with radio - telemetry transmitters ( ta11pa - c40 , data sciences , st . paul , minn , usa ) under 1.5 % isoflurane anesthesia , and the abdominal aorta was cannulated to place the tip of the gel - filled transmitter catheter , caudal to the renal arteries for arterial bp recording . bp data were collected with a computer - driven data acquisition system ( dataquest a.r.t . 3.01 , data sciences ) ; the acquisition software was appropriately configured to record parameters for 10 seconds every 10 minutes , continuously for 21 hours . the mean of 019 - hour data of bp recording of each day was calculated as the average bp for the day . the bp of the rats was recorded once weekly for 21 hours from 10 weeks of age till study termination at around 41 weeks of age . rats at around 10 weeks of age were given 0.25 % sodium chloride ( salt ) dissolved in drinking water for a week and then salt load increased to 0.5 % ( 85.5 mmol / l ) for the rest of the study , to accelerate the vasculopathy and cardiomyopathy . to establish the optimal treatment dose of trc120038 and candesartan for the chronic efficacy study , rats at around 12 weeks of age were randomized into six treatment groups ( n = 6 in each group ) , with matching baseline mean blood pressure ( mbp ) . on the first day of treatment , all rats in the six treatment groups were administered vehicle ( 1 ml / kg ) by oral route ; on the subsequent two days , three treatment groups were administered trc120038 ( 1.26 , 11.8 , 45.5 mg / kg p.o . , bid . ) and the other three groups received candesartan ( 0.03 , 0.3 and 1 mg / kg p.o . , od . ) in the morning and vehicle 12 hours later in the evening . these doses of trc120038 and candesartan were derived from efficacy studies done earlier in our laboratory . at the age of around 15 weeks , the rats were randomly distributed into three treatment groups ; ( n = 811 per group ) on the basis of baseline mbp . group1 : control group was administered vehicle ( 1 ml / kg p.o . , bid . ) ; group 2 : trc120038 group was administered 11.8 mg / kg , p.o . , bid . and group 3 : candesartan group was administered 0.3 mg / kg , p.o . , od . until study termination at around 41 weeks of age ( 25 weeks of treatment ) . the urine albumin , creatinine , and total protein were monitored , before treatment initiation ( treatment month 0 , i.e. , 15 week of age ) and were repeated monthly thereafter . urine samples were collected every 2 hours and stored at 24c before pooling 24 - hour samples . total protein and creatininewere estimated using fully automated clinical chemistry analyzer olympus au400 ( olympus corporation , japan ) . urinary albumin estimation was performed in accordance with in - house method developed for estimating albumin content in urine sample by hplc . terminal measurement of left ventricular ( lv ) function was performed using millar pressure volume ( pv ) system ( millar instruments , houston , tex , usa ) . a microtip pv catheter ( spr - 838 ) after stabilization for 1020 minutes , lv - pv signals were recorded continuously at a sampling rate of 1000 / second using an mpvs - 300 conductance system ( millar instruments ) coupled to a powerlab 8/30 ( adinstruments , australia ) .50 l of 20 % saline was injected intravenously so as to establish parallel conductance volume from shift of pv relations , and this was used for correction of the cardiac mass volume . lv parameters were computed using cardiac pv analysis software ( pvan3 .2 , millar instruments ) as described previously . volume calibrations were performed with millar volume calibration cuvette which consists of a 1 cm deep cylindrical block with cylindrical holes of known diameters ranging from 2 to 11 mm filled with fresh heparinised whole rat blood . the linear volume - conductance regression of the absolute volume in each cylinder versus the raw signal acquired by the conductance catheter was used for the volume calibration using pvan 3.2 . the total peripheral resistance index ( tpri ) was calculated by the following equation : tpri = mbp / ci . augmentation index ( ai ) was calculated by method suggested by westerhof et al . . after measurement of cardiac performance , the rats were sacrificed for detailed necropsy and the kidneys were collected and stored for histopathological examination . approximately , 2 - 3 mm thick kidney transverse and longitudinal sections were dehydrated in graded isopropyl alcohol , cleared in xylene , and infiltrated in paraffin . three serial sections of tissue ( 4 m ) embedded in paraffin were taken on the glass slides . sections were stained with routine hematoxylin and eosin stain , with masson 's trichrome stain for connective tissue , and with periodic acid schiff stain ( pas ) to study glomerulosclerosis . kidney pathology was evaluated under subheading of glomerulosclerotic index ( gsi ) , tubulopathy , interstitial fibrosis , and media to lumen ratio in intra renal artery . for gsi ,100 glomeruli from each animal were scored from one end to another ; care was taken to avoid the duplication of glomeruli . all the microscopic changes were evaluated in blinded fashion in grade scale of 04 under the light microscopy ( leica dm2500 ) , where grade 0 defines no change in tissue , grade 1 - minimal ( 1125 % ) ; grade 2 - mild ( 2650 % ) ; grade 3 moderate ( 5175 % ) and grade 4 severe ( 75 % ) pathological changes in the tissues . for thickness of basement membrane of parietal layer of bowman 's capsule : 25 glomeruli ( complete midline exposure ) were photographed under 400x ( leica dm2500 ) from each kidney , and parietal layer of bowman 's capsule width ( m ) was measured at 4 random positions in each glomerulus by calibrated las software . cross - section of intrarenal artery ( arcurate and intralobular ) at corticomedullary junction of transverse section of kidney ( near - to - middle area ) was photographed using leica dm2500 microscope with attached ccd camera dfc295 ( ~ 3040 % rats in each group ) . care was taken to select the near - to - circular cross - section of artery . cross - sectional area of arterial lumen and medial wall thickness was measured by image analysis software ( image - pro plus version 6.0 ) . oral pharmacokinetic ( pk ) profiling of trc120038 and candesartan was performed in a satellite group of nontelemetry transmitter implanted male ob - zsf1 rats ( n = 4 in each group ) , being treated similarly to those implanted with telemetry transmitters . pk profiling was performed on day 1 of treatment and again at end of 4 months ( 18 weeks ) of treatment . on the day of pk study , the second evening dose of trc120038 was not administered to capture the 24 - hours pk profile . statistical comparisons between and within groups were conducted using analysis of variance by repeated measures ( rmanova ) . one - way anova with multiple comparisons using tukey as post hoc test was used for comparisons amongst groups . values exceeding 95 % critical limits ( p 0.05 ) are considered to be statistically significant . statistical analysis has been performed using statistical analysis system ( sas , version - 9.1 ) and graphpad prism ( version 3.0 ) . a dose - dependent fall in mbp was observed with three incremental doses of trc120038 , whereas maximum fall in mbp with candesartan was observed with its second dose ( 0.3 mg / kg ) itself ( figure 2 ( a ) ) . dose response revealed that auc ( 019 hr ) for net mbp change ( 691.540.9 mmhghr ) seen with dose 2 of trc120038 ( 11.8 mg / kg ) was similar to that observed with maximal effective dose 2 of candesartan ( 0.3 mg / kg ) ( 662.813.1 mmhghr ) . ob - zsf1 rats followed up for 25 weeks of treatment and maintained on 0.5 % salt in drinking water displayed a modest increase in mbp . at 25 weeks of treatment with vehicle , a rise of 16.4 mmhg and 3 mmhg in systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) , respectively , was observed . the rise in mbp was prevented by candesartan , whereas trc120038 was successful in further lowering the mbp across time in comparison to levels before initiation of treatment ( figure 2 ( b ) ) . trc120038 within seven days of treatment produced significantly greater fall in mbp in comparison to vehicle and candesartan ( figure 2 ( b ) ) , and this trend continued throughout the study duration , of 25 weeks . though both trc120038 and candesartan were able to prevent rise and maintain lower sbp and dbp , the magnitude of fall in sbp and dbp brought about by trc120038 treatment was greater in comparison to candesartan treatment ( 23.6 versus 16.1 mmhg for sbp and 13.1 versus 7.5 mmhg for dbp , resp . ) . representative lv - pv loops and effect of treatment on lv functional parameters are shown in figure 3 and table 1 , respectively . evaluation of cardiac function revealed ability of trc120038 to significantly prevent rise in indices of preload ( end diastolic pressure ( edp ) and end diastolic volume ( edv ) ) and afterload ( end systolic volume ( esv ) , arterial elastance , and tpri ) ; prevent deterioration in diastolic function as evident from better preserved time constant of lv pressure decay ( tau ) , lesser edp ; additionally , the minimum pressure during cardiac cycle in diastole was significantly less in comparison to vehicle - treated group . further , the reduced ai in trc120038 - treatment group indicates ability of trc120038 to prevent rise in arterial stiffness in comparison to vehicle treated ob - zsf1 rats . also , trc120038 treated group was found significantly better to candesartan treated group in preventing rise in preload ( edv ) , cardiac performance [ ejection fraction ( ef ) ] and a trend towards better preserved afterload [ end systolic pressure ( esp ) ] and ai . percent increases from baseline ( before treatment initiation ) for urinary protein and rise in albumin to creatinine ratio , over the treatment duration , were significantly prevented in the trc120038 treated group as compared to vehicle control as shown in figures 4 ( a ) and 4 ( b ) . though similar functional improvement in percent change in urinary protein excretion was observed with candesartan treatment a better trend was still evident with trc120038 treatment reaching significance at some points ( figure 4 ( a ) ) . histopathological examination of kidney from ob - zsf1 rats revealed signs of moderate - degree nephropathy . focal - to - global sclerosis of glomeruli , characterized by expansion of mesangial matrix , thickened basement membrane , hypercellularity , hypertrophied podocytes with / without pseudo cyst formation , foam cells infiltration , and obliteration of bowman 's space resulting in sclerosed or obsolesce glomeruli were observed in all the rats . tubulopathy included dilated tubules with loss of brush border , desquamation of tubular epithelium , hyperplastic / hypertrophic tubular epithelium or flattened epithelial lining and hyaline cast in tubular lumen . in more severe cases , atrophic and degenerating tubules along with regenerating tubules were also observed . interstitium showed increase in the interstitial space , fibrous tissue proliferation , and infiltration of mono nuclear cells . treatment with trc120038 significantly prevented the deterioration in gsi as evident from greater percentages of normal glomeruli and glomeruli with minimal sclerotic changes in comparison to glomeruli of vehicle and candesartan - treated rats ( figures 5 and 6 ) . similarly , both the treatment groups ( trc120038 : 4.070.49 m and candesartan : 4.060.98 m ) significantly prevented increase in the width of parietal layer of bowman 's capsule as compared to vehicle - treated rats ( 5.081.31 m ) . further , a clear trend indicating less severe grade of tubules with cast and better maintained normal structure of tubules were observed in trc120038 - ( 1.650.15 and 2.040.18 , resp . ) and candesartan - ( 1.790.12 and 2.210.16 , resp . ) treated rats as compared to the vehicle - treated ( 2.180.26 and 1.910.25 , resp . ) masson trichome stained kidney section showed the presence of interstitial fibrosis in all ob - zsf1 rats . trc120038 - treated ob - zsf1 rats had lesser severity ( 1.230.12 ) of renal interstitial fibrosis in comparison to the vehicle - treated rats ( 1.550.17 ) and candesartan - treated rats ( 1.500.19 ) . though not significant , a positive trend towards trc120038 treatment - related improvement was observed in the media - to - lumen ratio of intrarenal artery with respect to other two treatment groups . auc0 was 131891859 and 92661028 hrng / ml , with c max 2610275 and 2500858 ng / ml on day 1 and after 4 - month repeated administration , respectively , showing no accumulation of trc120038 on repeated dosing . similarly , exposure to candesartan , determined on first day of treatment and determined again after multiple dosing for 4 months , was similar with auc0386 .340.9 , 335.29.4 hrng / ml and c max 55.35 and 56.88.4 ng / ml , respectively . in this study , trc120038 , a novel dual at1 / eta receptor blocker , on repeated administration , has clearly prevented increase in bp , attenuated progression in the severity of renal dysfunction , and preserved cardiac function in ob - zsf1 , an animal model of metabolic syndrome . in present study , the anti - hypertensive and cardiorenal protective effects of our dual at1 / eta receptor blocker trc120038 and a well - established angiotensin receptor blocker candesartan used clinically as an anti - hypertensive at a dose which produces almost similar fall in bp were studied . dose response generated upon two days of treatment with trc120038 orcandesartan revealed that candesartan produced its maximal anti - hypertensive effect in salt - loaded ob - zsf1 rats at a dose of 0.3 mg / kg , p.o . , od . , and trc120038 produced almost similar fall in bp at a dose of 11.8 mg / kg , p.o . these doses were thus selected for subsequent comparison of efficacy ( bp and cardiorenal damage ) upon chronic administration of trc120038 and candesartan in ob - zsf1 rats . decision to administer trc120038 twice a day was based on its pk profile . the dose - response study shows greater fall in bp with higher doses of trc120038 as compared to candesartan . at the studied doses , saturation in candesartan 's efficacythe greater fall in bp is probably due to the additional contribution from the eta receptor blockade component of trc120038 . here , trc120038 upon 25 weeks chronic treatment clearly proved to be a better anti - hypertensive and in addition , preserved cardiac function and reduced the severity of renal dysfunction in ob - zsf1 rats . this additional bp lowering seen on chronic treatment by trc120038 in comparison to candesartan could be related to its eta - receptor - blocking component which addresses the activated endothelin system in salt loaded ob - zsf1 rats . this is also in line with the observations that diabetic and obese patients have higher et - 1 activity . the possibility of additional improvement observed with trc120038 due to its probable increased systemic exposure with time was ruled out by the observation where exposure to trc120038 and candesartan , determined on first day of treatment , was similar to that observed at the end of 18 weeks of repeated dosing . diabetic nephropathy is likely to manifest with comorbidities like hypertension , cardiomyopathy , and other microvascular complications , and these patients would be on multiple drug therapy which is high likely to include an angiotensin - converting enzyme ( ace ) inhibitor / at1 receptor blocker . though used as a first - line therapy , intervening ras at the level of ace or at1 receptors in renal patients is shown not to consistently reduce proteinuria , which is not only a powerful predictor but also a promoter of renal dysfunction ; this is true for the dosages recommended for hypertension control and even for supramaximal dosages . high levels of endothelin are reported in diabetic nephropathy and diabetic cardiomyopathies and also showed the beneficial effect of endothelin receptor blocker in cardio - renal syndrome . similarly , as expected theoretically , combination of selective eta receptor blocker and ace inhibitor has produced impressive benefit , including regression of lesions in model of diabetic nephropathy . these findings fully justify the notion that endothelin receptor blocker holds much promise for the management of diabetic nephropathy . dual inhibition of ras and endothelin system holds promise in diabetic nephropathy as pharmacologic blockade of ras and endothelin independently has been shown to ameliorate the abnormality in glomerular permeability selectivity . studies have shown bp - independent effect of pharmacological blockade of ras and endothelin system in reducing indices of renal injury as compared to the respective monotherapies . in addition , protein loading of proximal tubular cells is suggested to provoke tubular expression of et - 1 and secretion of et - 1 . this hypothesis is in good agreement with the finding of studies on the expression of et - 1 and endothelin receptors in human renal biopsy specimens , which demonstrated more pronounced expression in individuals with marked proteinuria . ob - zsf1 rats display all characteristics of diabetic nephropathy , which becomes even more severe as model progresses in age and ultimately animals are reported to die of nephropathy by age of around one year . similar were our observations where severity of diabetic nephropathy was clearly evident by the extent and rate of increase of proteinuria and terminal histopathological examination of kidney . at the start of study , overthyperglycemia and proteinurea were seen in these animals ( 12 wks of age ) though hypertension was mild , which leads to the fact that hypertension has minimal role in development of nephropathy in this model . in our study , treatment with trc120038 resulted into better reduction in urinary - albumin - to - creatinine ratio and protein excretion in comparison to candesartan - treated ob - zsf1 rats . these functional benefits are expected to translate into histopathological findings as well , since excretion of proteins has been suggested to have toxic effect on tubular epithelial cells and may be responsible for the initiation of interstitial inflammation and scarring . this correlates well in our case as trc120038 treatment was found superior to even candesartan in having less severe gsi and tubulo - interstitial pathology . thus , in our study , functional improvement in the ability of kidney to prevent excessive urinary protein excretion with treatment is well correlated with histopathological findings of better preserved microscopic structures of kidney . major clinical trials with ace inhibitors have shown fewer cardiovascular events and a lower rate of macrovascular complications in high - risk diabetic patients , suggesting cardioprotective potential of intervening ras in such patient population . evidence is also accumulating which supports possible importance of the overactive endothelin system in the pathogenesis of diabetic cardiovascular complications . in hearts from experimental animals with chemically induced diabetes , mrna and protein for et - 1 and endothelin receptorsthe increased expression of mrna encoding for et - 1 and endothelin receptors was associated with myocardial cell death , focal scarring of the myocardium , and increased expression of several extracellular matrix proteins . similarly , in diabetic animals , endothelin receptor blockade limited the rise in bp and antagonized myocardial contractile depression , macrovascular endothelial dysfunction , and renal target organ damage . the hallmark of diabetic cardiomyopathy which includes diastolic and systolic dysfunctions is also related to change in cardiac preload and afterload . trc120038 successfully retarded rise in preload and afterload parameters and also prevented rise in peripheral resistance and stiffness of conduit arteries which is reflected well in parameters as tpri and ai , respectively . though not always significant , trc120038 proved superior to candesartan in preservation of the lv parameters studied . however , no differences were observed in any of the lv parameters captured after transient occlusion of inferior vena cava which reflects preload - independent functioning of lv . it is possible that by the end of treatment duration of 25 weeks significant structural changes in myocardium were yet to set in . this is also supported by no significant difference observed in the heart weight and other morphometric analysis which includes length and width of heart . a direct correlation between high bp and end organ damage ( heart , kidney , and brain ) has been long established and also proven is the fact that lowering bp directly correlates with lesser damage to end organs . the better cardio - renal protective effects seen with trc120038 have significant contributions from their superior bp control compared to candesartan , and an additional contribution from blockade of tissue et in addition to tissue ras can not be ruled out . in conclusion , trc120038 , a dual at1 / eta receptor blocker , has clearly shown its multifaceted potential in controlling hypertension and attenuating diabetic end organ damage in a way similar , or even better ( in several aspects ) than candesartan . evidence , like these , provides strong background for the exploration for dual ras and endothelin system blockade for treatment of poorly controlled hypertension and diabetic end organ damage . our study with novel dual at1 / eta receptor blocker trc120038 provides experimental evidence for the benefits of such an approach . however , outcome of further detailed safety and toxicity studies would be required to shape the future exploration of this molecule in target human population .\noutput:\n" }, { "from": "agent", "value": "in hypertensive subjects , angiotensin ii and endothelin participate in a manner involving closely interwoven pathways in increasing blood pressure ( bp ) and inducing end organ damage . the primary objective of this study was to determine the effect of trc120038 , a novel dual at1 / eta receptor blocker on bp , in obese zucker spontaneously hypertensive fatty rats ( ob - zsf1 ) , an animal model of moderate hypertension , diabetes with progressive renal and cardiac dysfunction . ob - zsf1 rats loaded with 0.5 % salt were treated with trc120038 ( 11.8 mg / kg bid . ) or candesartan cilexetil ( 0.3 mg / kg od . ) or vehicle control . blood pressure ( by radio - telemetry ) and renal functional markers were monitored throughout the study . cardiac function was assessed terminally by pressure volume catheter . markers for renal dysfunction were measured and changes were evaluated histopathologically . trc120038 showed greater fall in both systolic and diastolic bp in comparison to candesartan at its maximum antihypertensive dose . trc120038 also reduced the severity of renal dysfunction and preserved cardiac function in ob - zsf1 rat ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: he was admitted for an elective left typanomastoidectomy and removal of the incus and malleus with tympanoplasty . his medical history included hypertension , dyslipidemia , gout , polycystic kidney disease and gastroesophageal reflux disease . his medications at the time of admission were rosuvastatin , domperidone , esomeprazole , allopurinol , irbesartan / hydrochlorothiazide and labetalol . on the first daypostoperatively the patient experienced a sudden drop in his level of consciousness accompanied by marked agitation , and required intubation . his glasgow coma scale score was 9 ( eyes 3 , verbal 3 , motor 3 ) . there were no focal neurological signs , his pupils were symmetrical but sluggish to react and the fundi appeared normal . a computed tomography scan of the patient s head showed no structural abnormalities , no masses and no hematoma . lumbar puncture was performed and revealed cloudy cerebrospinal fluid ( csf ) with an elevated protein level ( 5.78 g / l ) , low glucose level ( 1.0 mmol / l ) and a leukocyte count of 11,97410 / l , with 95 % neutrophils . based on these findings , the patient was treated empirically for bacterial meningitis with intravenous ( iv ) vancomycin , ceftriaxone and dexamethasone pending culture results and sensitivities . further blood work revealed a blood leukocyte count of 13.810 / l , hemoglobin level of 123 g / l and platelet count of 15410 / l . mmol / l , potassium level 3.6 mmol / l , chloride level 106 mmol / l , urea level 12.6 mmol / l and creatinine level 190 mol / l . initial gram stain of the csf using the cytospin technique revealed abundant polymorphonuclear leukocytes and no organisms . preliminary reports revealed growth of gram - negative coccobacilli , and at this point metronidazole was also added to the treatment regime until an anaerobic cause was ruled out . ultimately , the organism was identified from aerobic cultures as p multocida using the vitek 2 identification system ( biomrieux , usa ) . interestingly , a swab of the left ear performed on postoperative day 2 grew the same organism as that cultured from the csf ( growth on chocolate and blood agar ; no growth on macconkey s or inhibitory mold agar ) . the empirical antibiotics and dexamethasone were discontinued , and the patient was started on a 14 - day course of iv penicillin g at a dose of 2,000,000 units every 4 h. the patient made a rapid recovery from his meningitis , and he was discharged on postoperative day 10 to continue treatment as an outpatient . on further questioning , it was revealed that the patient was the primary caregiver of several pet cats and a dog , although he reported no history of bites . the pets were allowed on the furniture , including his bed , and would occasionally lick his face . meningitis is an uncommon outcome of p multocida infection ( 3 ) , making p multocida a rare cause of adult bacterial meningitis . two reviews spanning 1950 to 1999 report only 29 cases published in the english literature during that time period ( 4,5 ) . animal contact was a major risk factor , present in 89 % of cases , and a history of a bite was much less common , occurring only 15 % of the time ( 4 ) . previous cranial / facial surgery or skull fracture has been reported as a cause of p multocida meningitis ( 513 ) . table 1 summarizes adult cases of p multocida meningitis published in the english literature after 1999 ( 1322 ) . animal contact was present in all cases , while only two ( 20 % ) reported a history of a bite . the current report presents one of only a handful of cases of p multocida meningitis ever documented in the literature from a canadian site ( 5,6,9,21,23 ) . the patient had the typical csf findings of bacterial meningitis ( low glucose , high protein , high leukocytes ) . penicillin is the most commonly used antibiotic to treat p multocida meningitis ( 4,15 ) , and our patient recovered fully with a course of iv penicillin g. many of the more recent cases describe treating with third generation cephalosporins ( table 1 ) . p multocida meningitis has been reported following mastoidectomy ( 11,12 ) , and the pathogenesis of infection is hypothesized to involve contiguous spread of the organism from a colonized ear canal . supporting this theory , local spread from an adjacent infected site has been proposed as an etiology ( 4 ) because chronic otitis media and otorrhea have been found in association with p multocida meningitis ( 4,19,2427 ) . our patient showed no signs of clinical meningitis preoperatively ; therefore , extension to the surgical site is the likely mechanism in this case . a preoperative ear swab has been proposed for patients having a mastoidectomy that have a history of exposure to animals ( 12 ) , and may be supported by the present case .\noutput:\n" }, { "from": "agent", "value": "pasteurella multocida is a gram - negative anaerobe that is known to colonize household pets ; in fact , it has been reported to be present in a majority of cats and dogs . p multocida can cause a variety of infections in humans , of which skin infections are the most common . this article describes a case involving a 56 - year - old man who developed meningitis caused by p multocida following tympanomastoidectomy . the authors discuss the treatment course and most likely route of infection in this case , and summarize the cases of p multocida - associated meningitis presented in the literature ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: hepatopulmonary syndrome ( hps ) is characterized by a defect in the arterial oxygenation , induced by pulmonary vascular dilatation in end - stage liver disease ( esld ) . triads of this syndrome are liver cirrhosis , intrapulmonary vascular dilatation , and altered gas exchange , resulting in hypoxemia .1 liver transplantation ( lt ) is the only treatment to cure hps in a patient with esld . the mortality rate after liver transplantation for the hps is still high , which depends on the preoperative severity of liver disease and hps , i.e. partial pressure of arterial oxygen . although some authors suggested that severe hps was a contraindication to transplantation ,2 nowadays , lt is considered as the only curative treatment modality for severe hps .3,4 we performed a lt for a 16 years - old female patient , who had severe hps with an end stage liver disease caused by biliary atresia since neonate . the aim of this case report is to share our successful treatment experience with lt for an adolescent who had severe hps with typical physical findings and contrast - enhanced echocardiography that was treated successfully by lt . a 16 years - old female was born with biliary atresia , and she underwent porto - enterostomy ( kasai 's procedure ) on the 55th day after birth . although she had hepatosplenomegaly , there was no overt symptom . however , she had progressed liver failure aggressively for 6 months before lt . in addition , she was on a bed ridden status because of dyspnea for last 2 months before lt .1 ) , ankles were swollen and lips were cyanotic , those were suspected as secondary changes of chronic respiratory insufficiency . her chest x - ray showed no abnormal findings , except elevated left diaphragm due to splenomegaly . however , her partial pressure of arterial oxygen and arterial oxygen saturation was markedly decreased ( pao254 .5 mmhg , o2sat 84.2 % ) . her hepatic and renal profiles were as follows : total bilirubin 42.3 mg / dl , albumin 2.5 g / dl , ast 241 u / l , alt 93 u / l , inr 2.39 , ammonia 2.54 g / ml and creatinine 0.5 mg / dl . her child - turcotte - pugh classification was c and meld ( model of end - stage liver disease ) score was 30 . the transesophageal echocardiography ( tee ) with agitated saline bubble showed an extracardiac right to left shunt , which suggested intrapulmonary arterio - venous shunt ( fig . she underwent orthotopic lt donated from a 13 - year old deceased donor , in february 2010 . for the liver transplant procedure , there shows marked adhesion of entire perihepatic area , and 1.5 cm sized two gallstones in the roux - limb of jejunal loop , just above the jejunal stenosis , which was removed by jejunotomy . otherwise , there was no notable event during a routine orthotopic lt procedure . the first pao2 / o2sat level of postoperative 2nd day was 51.3 mmhg / 88.0 % ; however , she was free from ventilator on the morning of that day . in spite of supplying oxygen with a mask , the lower partial pressure of arterial oxygen was persisted , ranging from 36.2 to 53.9 mmhg during the 48 hours after extubation . although her pao2 and o2sat level were shown to be very low , her breathing and physical activity with consciousness was rapidly recovered and very stable . she was transferred from the icu to the isolation ward , on postoperative day 17 . bile leakage was developed from the enterotomy site to remove the gallstones , which was detected by disida scan ; it was healed spontaneously by percutaneous drainage and conservative management . her partial pressure of arterial oxygen remained as low as 55 - 60 mmhg during a month after surgery . steroid and simulect ( basiliximab ) were administered during anhepatic period , and prograf ( tacrolimus ) and cellcept ( mycophenolate mofetil ) were added on postoperative day 2 and was followed by a routine protocol of our institution . the steroid was tapered until postoperative month 3 and mycophenolate mofetil was used for postoperative 6 months . the partial pressure of arterial oxygen improved progressively during the postoperative follow up period and on postoperative month 11 , the level was normalized ( pao2118 mmhg ) . follow - up transthoracic echocardiography ( tte ) with agitated saline bubble on postoperative 11th months did not show pulmonary arteriovenous shunt any more ( fig .3 ) . clubbing of both fingers also recovered to normal shape in postoperative month 11 ( fig . the patient recovered successfully , not only physically , but also pychosocial activity , including school performance during the 48 - months follow - up period . the prevalence of hps in children with liver disease is about 8 % .5 a study showed that proportion of biliary atresia is 44 % ( n = 8 ) in 18 children with hps .6 the unique pathological feature of hps is gross dilatation of the pulmonary precapillary and capillary vessels . these dilated capillaries induce un - uniform blood flow , and ventilation - perfusion mismatch emerges as the predominant mechanism of hypoxemia . in most advanced stages , restricted oxygen diffusion into the center of the dilated capillaries also contribute to a part of hypoxemia .1 therefore , identifying intrapulmonary shunt is important to diagnose hps . the intrapulmonary vascular shunts are identified by contrast - enhanced transthoracic or esophageal echocardiography ( qualitative ) or radionuclide lung perfusion scanning , using tc - macroaggregated albumin with brain uptake to measure the shunt fraction ( quantitative ) .6,7 although radioactive lung - scan is able to stratify the severity of hps ,6,8 contrast - enhanced echocardiogram is a more sensitive and noninvasive method for diagnosis of hps . in addition , physical examination , clubbing fingers , is important to diagnosis hps . although clubbing fingers have lower sensitivity , they have higher specificity , 98 % in hps .9 therefore , hps is highly suspected if there is an existence of clubbing fingers in esld patients with lower pao2 . in the present study , hps could be diagnosed preoperatively , based on typical finding of clubbing fingers and extracardiac right to left shunt presumed by contrast - enhanced echocardiogram with agitated saline bubble . the severity of hps can be stratified into 4 different grades : mild , aao2 gradient 15mmhg , pao280 mmhg ; moderate , aao2 gradient 15 mmhg , pao260 to 80 mmhg ; severe , aao2 gradient 15 mmhg , pao250 to 60 mmhg ; and very severe , aao2 gradient 15 mmhg , pao250 mmhg ( 300 mmhg while the patient is breathing 100 % oxygen ) .1 the patient 's median pao2 in this case was 50 to 60 mmhg , categorized to severe hps . she was combined with severe esld ( ctp classification c , meld score 30 ) , but previous studies showed that no relationship between the severity of hps and the severity of hepatic dysfunction as assessed on the basis of the ctp classifications or the meld score .2,6 currently , there are no effective medical therapies for hps , and lt is the only reliable treatment to cure the patient . prognosis of hps patients who did not undergo lt showed significantly poor , median survival for 24 months with a 5 - year survival of 23 % .2 many transplant centers have considered hps as a contraindication to lt in the early to mid - 1980s .7 however , it is now considered as an indication for lt because of improvement in surgical techniques , perioperative care , organ preservation and immunosuppression . the 5 - year survival of hps patients who received lt was 76 % ,2 which was similar to those without hps who received lt . although previous studies showed that the overall mortality rate was relatively high of 16 - 30 % ,1,10,11 recent studies showed less overall mortality rate of 5 % .3,12 it is known that high postoperative mortality was reported in case of preoperative pao250 mmhg alone or with a shunt fraction of more than 20 % .1 recovery time of lower pao2 and intrapulmonary shunt after lt are variable , depending on the severity of preoperative lower pao2 . although lower preoperative pao2 is related to longer recovery period of hps resolution after lt ,6 in most cases , hps can be resolved within a year .2 contrast - enhanced echocardiogram and improvement of clubbing finger are helpful for identifying resolution of hps during postoperative follow - up .9 the partial pressure of arterial oxygen of our patient was 54.5 mmhg , categorized into severe hps ,1 and resolution of hps was achieved in 11th months after lt . we could identify the resolution of hps by disappearance of extracardiac right to left shunt in follow - up contrast - enhanced tte with agitated saline bubble and improved clubbing of both fingers . in spite of combining severe esld presented by ctp classification c and meld score 30 , she recovered completely after lt . in this report , we presented a patient of hps , who had typical findings of intrapulmonary arterio - venous shunt detected by contrast - enhanced echocardiography and clubbing fingers with low pao2 , which was successfully treated by lt .\noutput:\n" }, { "from": "agent", "value": "hepatopulmonary syndrome ( hps ) is a serious complication of end - stage liver disease , which is characterized by hypoxia , intrapulmonary vascular dilatation , and liver cirrhosis . liver transplantation ( lt ) is the only curative treatment modality for patients with hps . however , morbidity and mortality after lt , especially in cases of severe hps , remain high . this case report describes a patient with typical findings of an extracardiac pulmonary arteriovenous shunt on contrast - enhanced transesophageal echocardiography ( tee ) , and clubbing fingers , who had complete correction of hps by deceased donor lt . the patient was a 16 - year - old female who was born with biliary atresia and underwent porto - enterostomy on the 55th day after birth . she had been suffered from progressive liver failure with dyspnea , clubbing fingers , and cyanosis . preoperative arterial blood gas analysis revealed severe hypoxia ( arterial o2 tension of 54.5 mmhg and o2 saturation of 84.2 % ) . contrast - enhanced tee revealed an extracardiac right - to - left shunt , which suggested an intrapulmonary arteriovenous shunt . the patient recovered successfully after lt , not only with respect to physical parameters but also for pychosocial activity , including school performance , during the 30 - month follow - up period ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: abdominal injuries rank third as a cause of traumatic death just after head and chest injuries . unrecognized abdominal injuries are frequently the cause of preventable death , which constitutes a significant diagnostic challenge to emergency physicians ( ep ) . in the past , we relied on clinical signs that have relatively low diagnostic accuracy ( 47 % to 87 % ) , especially when the patient had a decreased consciousness level , neurological deficit , other associated injuries , or was under the influence of drugs or medications . in case of doubt , we might proceed to diagnostic peritoneal lavage ( dpl ) , which is an invasive procedure . the introduction of bedside ultrasonography provides another non - invasive , readily available , and time - saving option for patients with blunt abdominal trauma . in fact , there was an over 30 - year history of using ultrasound in the evaluation of abdominal trauma . as early as 1971 , kristensen described the use of ultrasound scanning in the diagnosis of abdominal trauma . after that , the use of ultrasound in abdominal trauma grew gradually , and the term focused abdominal sonography for trauma ( fast ) scan has been used since the early 1990s . in hong kong , the use of fast for blunt abdominal trauma ( bat ) became popular after the first case was reported in 1995 . nowadays , fast is the standard practice for bat in most emergency departments in hong kong . with the introduction of fast scan in bat , there were many studies concerning the sensitivity and specificity . however , there were minimal studies in hong kong for the performance of fast scans in bat . the objective of this article is to study the performance of fast scan in bat patients by the emergency physicians in a regional hospital in hong kong . this was a retrospective cohort study including all the trauma team cases in a 36 - month period ( january 2004 to december 2006 ) in a local emergency department ( ed ) in hong kong . patients with penetrating abdominal injury were excluded from the study . in all other cases , fast scans were performed by the attending emergency physician using the same ultrasound machine ( toshiba capasee ii model ssa - 220a ) with a 3.75 - mhz curvilinear probe . four standard views were performed in each case , namely , ( 1 ) right upper quadrant view to include morrison s pouch ; ( 2 ) left upper quadrant view to include the splenorenal recess ; ( 3 ) transverse pelvis view ; ( 4 ) longitudinal pelvis view to visualize the cul - de - sac . in some instances , the main focus of the fast scan was to detect free intra - peritoneal fluid secondary to injury of abdominal organs . positive scan was defined as the presence of free intra - peritoneal fluid , regardless of the fluid volume and location . no further investigations ( e.g. , dpl or ct scan ) would be warranted for negative scan , unless the patient clinical condition deteriorated or experienced persistent abdominal pain . methods used to confirm the ultrasound results included laparotomy , ct scans , and clinical progress . there were totally 273 trauma team cases in this 36 - month period ; 14 cases of penetrating abdominal injury were excluded from the study . the 17 cases without fast scan performed were isolated injuries from the head , neck , and / or limbs . the age range of these 242 cases was from 16 to 82 years old . in these 242 cases , 33 ( 13.6 ) of them showed intra - abdominal free fluid ; 27 patients with unstable hemodynamics were immediately transferred to the operation room for emergency laparotomy without undergoing other investigations such as ct scan or dpl . after ct scans , two cases were found to be false - positive fast scans . for those cases with negative fast scans , five were ultimately found to have hemoperitoneum by subsequent ct scans after admission . ct scans were done in these cases either because of change in clinical conditions or the patients were experiencing persistent abdominal pain . one case of liver laceration was treated conservatively , while the other four patients required laparotomies for hemostasis ( fig . 1 ) .1 flow chart of the subject flow chart of the subject in this study , the sensitivity and specificity of the fast scan were 86 % and 99 % , respectively , with the accuracy of 97 % ( table 1 ) . table 1the result of fast scans in bat intra - abdominal injury + veintra - abdominal injury - vetotalfast + ve31233fast - ve5204209total36206242 the result of fast scans in bat the negative predictive value was 0.98 , while the positive predictive value was 0.94 . the likelihood ratio was 86 for a positive scan and 0.14 for a negative scan . in bat , rapid determination of which patients should require emergency laparotomy is crucial for life saving , especially for those with unstable haemodynamics . on the other hand , avoidance of unnecessary laparotomy , which is an invasive procedure with inherent complications , is also important . the fast scan provides a useful initial diagnostic tool for this kind of patient . in this study , the high specificity ( 99 % ) , positive predictive value ( 0.94 ) , and likelihood ratio for positive test ( lr + ve 86 ) made the fast scan a good rule in tool for bat patients . other international studies also showed similar specificity with a range of 83 % 100 % . the sensitivity was 86 % , corresponding to many similar studies ( table 2 ) . literature review showed that the sensitivity of fast scan performed by ep for bat patients ranged from 42 % to 95 % . the fast scan is also valuable as a screening tool considering its high negative predictive value of 0.98 . table 2comparison of results with similar international studiesstudyno . of subjectssensitivity ( % ) specificity ( % ) npv ( % ) our study242869998nural ( 2005 ) 45486.595.498.7 holmes ( 2004 ) 447799593miller ( 2003 ) 359429893mattew ( 2001 ) 2,576869898 mckenney ( 2001 ) 996889998coley ( 2000 ) 107558350boulanger ( 1999 ) 400819796shackford ( 1999 ) 234699898chiu ( 1997 ) 7727110078 comparison of results with similar international studies there are many factors that could influence the result of fast scans . although the technique of fast scan could easily be acquired , physicians did need some training and practice to become familiarized with the skill . there is no universal agreement about how long and how many fast scans an emergency physician should perform to be accredited to do the scan . an international consensus conference in 1999 recommended a 4 - h didactic component , a 4 - h practical component , and 200 supervised examinations , while the american college of emergency physicians ultrasound guideline recommendations published in 2001 only recommended 2540 supervised examinations . moreover , a study from shackford et al . suggested that the error rate was stabilized after only ten scans . as reflected by this discrepancy , the true required number for proficiency remains ill - defined . in our study , the emergency physicians performing the fast scan ranged from resident to senior medical officers , all of whom had undergone at least a basic emergency ultrasonography course held by the department or by the hong kong college of emergency medicine . the result of this study showed that there was no statistically significant difference for the sensitivity or specificity of fast scans performed by different ranks of emergency physicians . the aim of fast scan is to detect free intra - peritoneal fluid secondary to bleeding from abdominal organ injury ; however , there is a time lag for the accumulation of a significant amount of blood in the peritoneal cavity to be detectable by the scan . studies suggest that the average volume of fluid detectable by the fast scan ranges from 250 ml to 620 ml , although goldberg demonstrated that ultrasound could detect as little as 100 ml of free intra - peritoneal fluid . in order to eliminate this drawback , patients with negative scansshould be observed for at least 46 h , and if indicated , serial fast scan or ct scan should be considered . the patients either experienced change in clinical condition or complained of persistent abdominal pain during observation . ct of the abdomen was performed in these cases , all showing small amounts of free intra - peritoneal fluid . one case of liver laceration was treated conservatively , while the other four cases required laparotomies for hemostasis . in fact , many studies showed that fast scan was limited or unable to detect certain types of injuries , such as bowel / mesenteric injury , diaphragmatic injury , solid organ / retroperitoneal organ injury ( e.g. , pancreatic , renal , and adrenal ) , vascular injury , and spinal / pelvic fracture . in case of doubt , physicians should proceed to further investigations , such as ct scan . other causes of false - negative scan include emptying the urinary bladder too early or without an adequately filled urinary bladder for ultrasonic window , failure to recognize intra - peritoneal blood clot , patient obesity , and surgical emphysema in the chest and / or abdominal wall . study showed that without a full urinary bladder as an ultrasonic window , free fluid in the pelvis region is easily missed . it is not uncommon that a foley catheter is inserted in trauma patients to look for hematuria and monitor urinary output . however , if it is performed before the fast scan , it would decrease the sensitivity of the scan . to overcome this , we could either perform the scan before foley insertion or re - fill the urinary bladder with saline through the foley catheter . as discussed before , abdominal trauma is a dynamic event ; scanning too early might miss a significant abdominal injury as free intra - peritoneal fluid needs time to accumulate . however , scanning too late could also affect the result as the blood could become clotted . intra - peritoneal blood clot usually appears hyperechoic and sometimes isoechoic , which makes it difficult to recognize . despite the timing of scanning , being familiar with the typical appearance of the peritoneal reflections and of the normal configuration of the solid organ could improve recognition of the intra - peritoneal blood clot , too . obesity and overlying surgical emphysema are the common reasons for technically inadequate examination causing false - negative scans . other minor causes include excessive room lighting , limited patient maneuverability , and limited sonographic window due to dressings , wounds , and chest tubes . fluid in the stomach or bowel might be mistaken as free intra - peritoneal fluid also . other causes of false - positive result include pre - existing ascites , intra - peritoneal fluid collection due to ruptured ovarian cyst , or pelvic inflammatory disease . many scoring systems have been proposed for fast scans . in the huang scoring system ( 1994 ) , one point was given to each of the positive fast scan regions of morrison s pouch , douglas s pouch , perisplenic space , paracolic gutter , and floating intestinal loops ; 96 % of patient with score 3 required exploratory laparotomy . however , 38 % of patient with score 3 still required surgery .2001 ) also had a similar proposal for which five regions were assessed : right subphrenic space , subhepatic space , left subphrenic space , perisplenic area , and pelvis . one point was granted to each positive area , and the final score was the summation of total positive areas plus the depth of largest collection in centimeters . the score was compared with initial systolic blood pressure and base deficit to assess the ability of sonography to predict a therapeutic laparotomy . the conclusion was that 87 % with a score 3 required a therapeutic laparotomy , and it was a better predictor of a therapeutic laparotomy than the initial systolic blood pressure and base deficit . however , as they relied solely on the fast scan finding , we should also consider the clinical condition of the patient when applying the scoring system so as to avoid unnecessary invasive procedures like laparotomy . a study by boulanger showed that fast in bat reduced the mean time from ed arrival to hospital ( 151 min to 53 min ) . in the study , patients undergoing fast scan also had a 60 % reduced relative risk of delayed recognition of intra - abdominal trauma . another study , the soap - 1 trial , also showed that the time from ed arrival to operation room was significantly shorter in the ultrasound group ( median interval 60 min versus 157 min ) . with advanced skill and technology , the use of emergency ultrasonography is extended from blunt abdominal trauma to include chest trauma also . the term focused assessment with sonography for trauma ( fast ) was coined by rozycki et al . in 1996 . in such fast scans , in addition to detecting free intra - peritoneal fluid , they also attempted to detect any fluid collection in the pericardium and lung bases through the subxiphoid , right upper quadrant , and left upper quadrant views . fast scan , therefore , also played a significant role in early detection of cardiac temponade and hemothorax in trauma patients . in 2002 , dulchavsky further extended the use of fast scan to involve extremity and respiratory evaluation and named it the faster examination . such faster examination may play an important role in remote locations , such as military and aerospace applications . it is easy to learn , readily available , repeatable , and non - invasive . the performance of eps in using fast scans in bat patients was very encouraging . the high specificity ( 99 % ) , positive predictive value ( 0.98 ) , and likelihood ratio for positive tests ( lr +86 ) the high negative predictive value also causes fast scan to be a useful screening tool . however , ultrasound examination is operator dependent , and fast scan has its own limitations . therefore , for negative fast scan cases , we recommend a period of monitoring , serial fast scans , or further investigations , such as ct scan or peritoneal lavage .\noutput:\n" }, { "from": "agent", "value": "backgroundblunt abdominal trauma ( bat ) is a diagnostic challenge to the emergency physician ( ep ) . the introduction of bedside ultrasound provides another diagnostic tool for the ep to detect intra - abdominal injuries.aimsto evaluate the performance of ep in a local emergency department in hong kong to perform the focused abdominal sonography for trauma ( fast ) in bat patients.methodsthis was a retrospective cohort study including all the trauma team cases in a 36 - month period in the emergency department of a public hospital in hong kong . the results of fast scans were analyzed and compared with ct scans when the fast was positive or followed by a period of clinical observation when the fast was negative . descriptive statistics and sensitivity , specificity , and predictive values were calculated.resultsthere was a total of 273 cases , and fast scans were performed in 242 cases . the sensitivity and specificity were 86 % and 99 % , respectively . the negative predictive value was 0.98 , while the positive predictive value was 0.94 . the overall accuracy was 97 % . conclusionsthe performance of the ep in using fast scans in bat patients was encouraging . the high specificity ( 99 % ) , positive predictive value ( 0.98 ) , and likelihood ratio for positive tests ( 86 ) make it a good rule in tool for bat patients . the high negative predictive value also makes the fast scan a useful screening tool . however , ultrasound examination is operator dependent , and fast scan has its own limitations . for negative fast scan cases , we recommend a period of monitoring , serial fast scans , or further investigations , such as ct scan or peritoneal lavage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ethics education is often based on knowledge and application of traditional ethical theories such as utilitarianism and deontology ( 6 ) . genetics classes for medical students are mostly organized around discussions about genetic phenomena on the basis of individuals affected with the genetic disorder . a special approach in teaching ethics in the context of geneticstopics taught to medical students should be carefully evaluated in terms of both content and moral aspect . ethically - sensitive topics require a particular attitude and moral maturity on the part of the lecturer . it is vital that educators make conscious ethical decisions to ensure that their professional practice meets the highest possible ethical standards of conduct and responsibility ( 4 ) . students might feel uncomfortable or embarrassed due to the terminology used in genetics , especially shy students , students from different cultural environments , or those whose native language is not the language of instruction . a balance between the use of scientific terms and colloquial speechmust be found to make the topic accessible to all students , and students should learn how to convey complex information to patients . many human genetic studies are aimed at identifying genes that determine a predisposition to genetic disease . a diagnosis of the disease or a finding of inherited predisposition in a family member has implications for other family members ( 8 ) . the lecturer should indicate that a medical doctor has to feel confident about the disclosure of such information to other family members , especially non - biological family members . it is also critical to note that not all ethical dilemmas that arise during genetics teaching will be solved . in many cases , unpredictable situations and questionsmight arise , and the lecturer must be confident about being able to prevent embarrassing situations . there are concerns about ethical issues associated with several topics included in the genetics study programs for medical students at the riga stradin university . examples of such topics will be discussed in the following sections of this article . from a diagnostic perspective , the following aspects should be pointed out : what kind of genetic information can be disclosed , to whom and how this information should be disclosed , who has the right to be informed , and how genetic information might be used , perceived , or missed ( 3 ) . genetic diseases could be diagnosed at the postnatal or prenatal period of an individual s development . prenatal diagnosis of genetic diseases has been a focus of ethical debates for years . for medical students , prenatal diagnosis can result in the identification of genetic pathology , and these diagnoses present specific ethical dimensions . it is not helpful for a counselee to be informed only about the diagnosed genetic disease , as the counselee s main concern might be how severely the child will be affected just after birth or as an adult , and what particular possibilities exist to treat the condition . excluding the option of pregnancy termination , accurate diagnosis of fetal health statusallows the delivery of a child with special needs to be planned , with special neonatal therapy . the task of a genetic counselor is not only to convey information on risk in an understandable way , but also to do it in a manner that enables those counseled to make their own informed choices ( 13 ) . the notion of disorder , that is , what counts as a disorder , is an important issue that deserves to be discussed . for instance , in the case of late onset diseases ( e.g. , huntington s disease ) individuals who carry the mutant gene will develop the disease , but should the individual be considered affected before the onset of the disease ( 2 ) ? carrier status is also very sensitive in the case of autosomal recessive diseases , especially in case these diseases are widespread within a population . the possibility for two carriers to mate could be rather high , and carriers in turn are at high risk ( 25 % ) of producing an affected child . all these confusing problems should be discussed with students , who should be encouraged to give their own opinion . at the end of the topic , the lecturer should clearly identify the problem , clarify solutions to the problem , and demonstrate ways of developing future treatment strategies . there are millions of people worldwide whose conception was achieved by in vitro fertilization . in vitro fertilization offers new promises for couples who are infertile due to genetic problems . in this case , however , a solution requires careful evaluation of the benefits and possible psychological harm that infertile couples might face . nevertheless , the fact that many infertile couples are willing to spend thousands of dollars and face the physical and mental challenges of ivf rather than adopt a child suggests a strong emotional need for biological offspring that is not influenced by social pressures ( 7 ) . firstly , the couple s attitude to the embryo and , consequently , to the expected offspring should be considered . if one or both parents are not able to produce sex cells , the embryo is not fully genetically related to the parents . the question is whether the destroyed embryos are considered to be harmed in this process . the answer depends on another question , namely , whether an eight - cell - stage embryo should be regarded as a human being , and whether arresting its development should be considered a wrong . students should be encouraged to give their opinion about the stage at which human life begins . if an embryo is considered as a group of totipotent cells , than destroying these cells could not be regarded as destroying a human being . for many individuals , the generally accepted view is that a human organism becomes a person at the moment of birth ; the early embryo does not at this stage of its development have the moral status that is later acquired , as it develops capacities such as sentience , consciousness , and agency ( 1 ) . however , the pre - embryo will eventually develop into an individual who is a human being . the medical doctor / counselor must be able to customize and to explain these issues from the standpoint of those being counseled . the chance of survival of a single embryo is rather small ; therefore , multiple embryos are often implanted to increase the chance of pregnancy . however , this also significantly increases the likelihood of multiple pregnancies , especially in comparison with traditional conceptions ( 7 ) . multiple pregnancies could influence the physical and mental health of the mother , and also present a threat to the well - being of the expected offspring . medical students must be introduced to these problems and should be encouraged to work out how to find answers to these ethical issues . a medical doctor must be able to explain to future parents all the dilemmas based on scientific facts and should be able to help future parents realize that despite the disadvantages of this method , without it , these children would not be born at all . completion of the human genome project has enabled the study of the genetics of common complex disorders such as cardiovascular diseases , cancers , and diabetes ( 9 ) . several human genetic studies are aimed at discovering genetic susceptibility to common diseases that can provide early diagnosis and better treatment strategies for the diseases , and even their prevention ( 1 , 9 , 10 ) . genetic tests are increasingly accessible to physicians , companies , and the general public ( 17 ) . however , individuals often perceive susceptibility genes as being more fateful than other risk factors such as excessive use of medication , smoking , alcohol abuse , or diet abnormalities . in these cases , the role of the medical doctor is important . before a doctor gives genetic advice , medical students must realize that physicians should explain in a delicate manner that genes are not the only factors to predict the development of a disease , and that it is very important to follow a healthy lifestyle . for example , if an individual is determined to have highly - penetrant breast cancer gene brca 1 , the physician should not convey this information without context . the physician must explain the concept of lifetime risk , present the possibilities of preventive surgery used in cases of high risk , and discuss efficient treatment methods . the physician s task is to assist in developing a plan for a healthy lifestyle in a friendly atmosphere ( e.g. , by suggesting restricting the use of hormonal contraceptives , quitting smoking , or having a physically active lifestyle ) . in such cases , evidence about families with individuals who have the gene and did not develop cancer , even late in life , could be very reassuring . the ethical issues described above highlight the importance of genetic literacy for both the counselor and counselee ( 5 ) . another aspect is the degree to which the counselee can apply the information given by the counselor . the more complex the inheritance of the disease , the greater the ethical responsibility that lies with the medical doctor who gives genetic advice . investigation of the prevalence of minor physical anomalies in mentally healthy individuals using the waldrop physical anomaly scale shows a low mean score of minor physical anomalies ( 12 ) . several studies ( 14 , 16 ) have shown higher frequencies of mpas in patients with neurodevelopmental disorders . this enables mpas to be used as indicators of some neurodegenerative developmental genetic disorders ( e.g. , autism , tourette syndrome ) . it is also well known that some mpas , such as the epicanthal fold and curved fifth finger , are rather common in the general population ( 11 ) . therefore if mpas are used to demonstrate the phenotype of an affected person , the lecturer should stress that mpas are detected in healthy individuals too , and only a specific set of mpas along with other phenotypic markers could be considered a phenotypic marker for genetic disease . a medical doctor should know and be able to explain in which cases a minor anomaly is a sign of a major health problem , and together with the patient or patient s relatives decide about further investigation . consent to use a patient s story should be obtained prior to publishing the report whenever possible ( 15 ) . clinical cases serve to advance students understanding of genetic diseases , as well as to bridge the gap between theoretical and clinical subjects . key elements for successful use of clinical cases in teaching genetics include demonstration of a respectful attitude toward the patient and his / her family on the part of the medical doctor . the lecturer must remind the students that the picture is not simply an illustration of the disease , but that the person with a particular condition portrayed in the picture is real and deserves respect . frequently integrated case reports in the lecture may help prepare students to face a real clinical environment , and their use expands students knowledge in genetics . for example , the lecturer presents a case about a 40 - year - old female , mrs . x , who tells the physician that her sister has been diagnosed with breast cancer at the age of 38 due to a mutation in the brca 1 gene . family history reveals that her mother , aged 65 , is healthy and never had a cancer diagnosis , whereas the father s sister died from ovarian cancer at the age of 52 , and the father s mother died at the age 54 from breast cancer . if mrs . x would like to know whether she should be concerned about the sister s diagnosis , medical students must be able to give information on this mutation . the lecturer has to point out that a genetic counselor should inform the patient in a delicate manner about lifetime risk for breast cancer , which ranges from 40 to 85 percent , while for ovarian cancer it is lower , namely , 16 to 60 percent ( 18 ) . the patient should be informed about the possibility of molecular diagnosis to learn whether she has this mutation , and the medical doctor should explain that the gene comes from her father s side of the family . it should also be made clear that even if the mutation is detected , it does not mean that cancer will develop . in such situations , the medical doctor has to give detailed information on promoting a healthy lifestyle to avoid the development of cancer to the maximum extent possible . in such delicate situations , the medical doctor faces some ethical dilemmas , such as whether it is ethical , if mrs . x has female cousins on her father s side , to inform them about the possible increased risk of having mutation of this gene . x should be encouraged to share this information with her husband and her two daughters . due to increasing information in the field of genetics , the lecturer must take into account that some students might not have come across genetic terminology during their previous studies . therefore , the lecturer should convey information in a way that is accessible to all students . in these situationsthe majority of textbooks contain information that there is an increased risk for nondisjunction of chromosomes at this age , which leads to trisomy in the fetus . such information should not be provided without explanations on various testing methods during pregnancy , and possible solutions in case of detection of trisomy.lifetime risk is defined as the risk of developing a disease over the course of a lifetime . the lecturer should stress that risk is almost never 100 % and even a person with increased susceptibility can prevent development of the disease.carrier is a person who has a mutant allele of a gene in their genotype . several variants of carrier status should be discussed . in the case of a recessive mutation , the carrier is not at higher risk of developing the disease . on the other hand , if a female is a carrier of a mutant gene located on the x chromosome , she will most likely not develop symptoms of the disease , but she is at high risk ( 50 % ) of passing on this mutant gene to male off - spring , who will be affected . if an individual has a dominant mutant gene , then different possibilities should be considered . if a gene with incomplete penetrance is detected , then only those with a gene expressed in the phenotype should be considered as affected . if a gene shows late onset , the probability of being affected depends on the age of the person . advanced maternal age is defined as over 34 ( age of 35 at delivery ) . the majority of textbooks contain information that there is an increased risk for nondisjunction of chromosomes at this age , which leads to trisomy in the fetus . such information should not be provided without explanations on various testing methods during pregnancy , and possible solutions in case of detection of trisomy . lifetime risk is defined as the risk of developing a disease over the course of a lifetime . the lecturer should stress that risk is almost never 100 % and even a person with increased susceptibility can prevent development of the disease . carrier is a person who has a mutant allele of a gene in their genotype . several variants of carrier status should be discussed . in the case of a recessive mutation , the carrier is not at higher risk of developing the disease . on the other hand , if a female is a carrier of a mutant gene located on the x chromosome , she will most likely not develop symptoms of the disease , but she is at high risk ( 50 % ) of passing on this mutant gene to male off - spring , who will be affected . if an individual has a dominant mutant gene , then different possibilities should be considered . if a gene with incomplete penetrance is detected , then only those with a gene expressed in the phenotype should be considered as affected . if a gene shows late onset , the probability of being affected depends on the age of the person . there are a many examples , and in each case the lecturer should consider the use of terms with caution and create a safe emotional environment for students . as lecturers , we should remind our students that a medical doctor s task is to educate the general public and , with our attitude , demonstrate that the affected person is not a burden , but an object of love , affection , and , most importantly , respect . from a diagnostic perspective , the following aspects should be pointed out : what kind of genetic information can be disclosed , to whom and how this information should be disclosed , who has the right to be informed , and how genetic information might be used , perceived , or missed ( 3 ) . genetic diseases could be diagnosed at the postnatal or prenatal period of an individual s development . prenatal diagnosis of genetic diseases has been a focus of ethical debates for years . for medical students , prenatal diagnosis can result in the identification of genetic pathology , and these diagnoses present specific ethical dimensions . it is not helpful for a counselee to be informed only about the diagnosed genetic disease , as the counselee s main concern might be how severely the child will be affected just after birth or as an adult , and what particular possibilities exist to treat the condition . excluding the option of pregnancy termination , accurate diagnosis of fetal health status allows the delivery of a child with special needs to be planned , with special neonatal therapy . the task of a genetic counselor is not only to convey information on risk in an understandable way , but also to do it in a manner that enables those counseled to make their own informed choices ( 13 ) . the notion of disorder , that is , what counts as a disorder , is an important issue that deserves to be discussed . for instance , in the case of late onset diseases ( e.g. , huntington s disease ) individuals who carry the mutant gene will develop the disease , but should the individual be considered affected before the onset of the disease ( 2 ) ? carrier status is also very sensitive in the case of autosomal recessive diseases , especially in case these diseases are widespread within a population . the possibility for two carriers to mate could be rather high , and carriers in turn are at high risk ( 25 % ) of producing an affected child . all these confusing problems should be discussed with students , who should be encouraged to give their own opinion . at the end of the topic , the lecturer should clearly identify the problem , clarify solutions to the problem , and demonstrate ways of developing future treatment strategies . there are millions of people worldwide whose conception was achieved by in vitro fertilization . in vitro fertilization offers new promises for couples who are infertile due to genetic problems . in this case , however , a solution requires careful evaluation of the benefits and possible psychological harm that infertile couples might face . nevertheless , the fact that many infertile couples are willing to spend thousands of dollars and face the physical and mental challenges of ivf rather than adopt a child suggests a strong emotional need for biological offspring that is not influenced by social pressures ( 7 ) . firstly , the couple s attitude to the embryo and , consequently , to the expected offspring should be considered . if one or both parents are not able to produce sex cells , the embryo is not fully genetically related to the parents . the question is whether the destroyed embryos are considered to be harmed in this process . the answer depends on another question , namely , whether an eight - cell - stage embryo should be regarded as a human being , and whether arresting its development should be considered a wrong . students should be encouraged to give their opinion about the stage at which human life begins . if an embryo is considered as a group of totipotent cells , than destroying these cells could not be regarded as destroying a human being . for many individuals , the generally accepted view is that a human organism becomes a person at the moment of birth ; the early embryo does not at this stage of its development have the moral status that is later acquired , as it develops capacities such as sentience , consciousness , and agency ( 1 ) . however , the pre - embryo will eventually develop into an individual who is a human being . the medical doctor / counselor must be able to customize and to explain these issues from the standpoint of those being counseled . the chance of survival of a single embryo is rather small ; therefore , multiple embryos are often implanted to increase the chance of pregnancy . however , this also significantly increases the likelihood of multiple pregnancies , especially in comparison with traditional conceptions ( 7 ) . multiple pregnancies could influence the physical and mental health of the mother , and also present a threat to the well - being of the expected offspring . medical students must be introduced to these problems and should be encouraged to work out how to find answers to these ethical issues . a medical doctor must be able to explain to future parents all the dilemmas based on scientific facts and should be able to help future parents realize that despite the disadvantages of this method , without it , these children would not be born at all . there are millions of people worldwide whose conception was achieved by in vitro fertilization . in vitro fertilization offers new promises for couples who are infertile due to genetic problems . in this case , however , a solution requires careful evaluation of the benefits and possible psychological harm that infertile couples might face . nevertheless , the fact that many infertile couples are willing to spend thousands of dollars and face the physical and mental challenges of ivf rather than adopt a child suggests a strong emotional need for biological offspring that is not influenced by social pressures ( 7 ) . firstly , the couple s attitude to the embryo and , consequently , to the expected offspring should be considered . if one or both parents are not able to produce sex cells , the embryo is not fully genetically related to the parents . the question is whether the destroyed embryos are considered to be harmed in this process . the answer depends on another question , namely , whether an eight - cell - stage embryo should be regarded as a human being , and whether arresting its development should be considered a wrong . students should be encouraged to give their opinion about the stage at which human life begins . if an embryo is considered as a group of totipotent cells , than destroying these cells could not be regarded as destroying a human being . for many individuals , the generally accepted view is that a human organism becomes a person at the moment of birth ; the early embryo does not at this stage of its development have the moral status that is later acquired , as it develops capacities such as sentience , consciousness , and agency ( 1 ) . however , the pre - embryo will eventually develop into an individual who is a human being . the medical doctor / counselor must be able to customize and to explain these issues from the standpoint of those being counseled . the chance of survival of a single embryo is rather small ; therefore , multiple embryos are often implanted to increase the chance of pregnancy . however , this also significantly increases the likelihood of multiple pregnancies , especially in comparison with traditional conceptions ( 7 ) . multiple pregnancies could influence the physical and mental health of the mother , and also present a threat to the well - being of the expected offspring . medical students must be introduced to these problems and should be encouraged to work out how to find answers to these ethical issues . a medical doctor must be able to explain to future parents all the dilemmas based on scientific facts and should be able to help future parents realize that despite the disadvantages of this method , without it , these children would not be born at all . completion of the human genome project has enabled the study of the genetics of common complex disorders such as cardiovascular diseases , cancers , and diabetes ( 9 ) . several human genetic studies are aimed at discovering genetic susceptibility to common diseases that can provide early diagnosis and better treatment strategies for the diseases , and even their prevention ( 1 , 9 , 10 ) . genetic tests are increasingly accessible to physicians , companies , and the general public ( 17 ) . however , individuals often perceive susceptibility genes as being more fateful than other risk factors such as excessive use of medication , smoking , alcohol abuse , or diet abnormalities . in these cases , the role of the medical doctor is important . before a doctor gives genetic advice , medical students must realize that physicians should explain in a delicate manner that genes are not the only factors to predict the development of a disease , and that it is very important to follow a healthy lifestyle . for example , if an individual is determined to have highly - penetrant breast cancer gene brca 1 , the physician should not convey this information without context . the physician must explain the concept of lifetime risk , present the possibilities of preventive surgery used in cases of high risk , and discuss efficient treatment methods . the physician s task is to assist in developing a plan for a healthy lifestyle in a friendly atmosphere ( e.g. , by suggesting restricting the use of hormonal contraceptives , quitting smoking , or having a physically active lifestyle ) . in such cases , evidence about families with individuals who have the gene andanother aspect is the degree to which the counselee can apply the information given by the counselor . the more complex the inheritance of the disease , the greater the ethical responsibility that lies with the medical doctor who gives genetic advice . investigation of the prevalence of minor physical anomalies in mentally healthy individuals using the waldrop physical anomaly scale shows a low mean score of minor physical anomalies ( 12 ) . several studies ( 14 , 16 ) have shown higher frequencies of mpas in patients with neurodevelopmental disorders . this enables mpas to be used as indicators of some neurodegenerative developmental genetic disorders ( e.g. , autism , tourette syndrome ) . it is also well known that some mpas , such as the epicanthal fold and curved fifth finger , are rather common in the general population ( 11 ) . therefore if mpas are used to demonstrate the phenotype of an affected person , the lecturer should stress that mpas are detected in healthy individuals too , and only a specific set of mpas along with other phenotypic markers could be considered a phenotypic marker for genetic disease . a medical doctor should know and be able to explain in which cases a minor anomaly is a sign of a major health problem , and together with the patient or patient s relatives decide about further investigation . only previously published cases are used in lectures . consent to use a patient s story should be obtained prior to publishing the report whenever possible ( 15 ) . clinical cases serve to advance students understanding of genetic diseases , as well as to bridge the gap between theoretical and clinical subjects . key elements for successful use of clinical cases in teaching genetics include demonstration of a respectful attitude toward the patient and his / her family on the part of the medical doctor . usually , clinical cases involve pictures of affected individuals . the lecturer must remind the students that the picture is not simply an illustration of the disease , but that the person with a particular condition portrayed in the picture is real and deserves respect . frequently integrated case reports in the lecture may help prepare students to face a real clinical environment , and their use expands students knowledge in genetics . for example , the lecturer presents a case about a 40 - year - old female , mrs . x , who tells the physician that her sister has been diagnosed with breast cancer at the age of 38 due to a mutation in the brca 1 gene . family history reveals that her mother , aged 65 , is healthy and never had a cancer diagnosis , whereas the father s sister died from ovarian cancer at the age of 52 , and the father s mother died at the age 54 from breast cancer . if mrs . x would like to know whether she should be concerned about the sister s diagnosis , medical students must be able to give information on this mutation . the lecturer has to point out that a genetic counselor should inform the patient in a delicate manner about lifetime risk for breast cancer , which ranges from 40 to 85 percent , while for ovarian cancer it is lower , namely , 16 to 60 percent ( 18 ) . the patient should be informed about the possibility of molecular diagnosis to learn whether she has this mutation , and the medical doctor should explain that the gene comes from her father s side of the family . it should also be made clear that even if the mutation is detected , it does not mean that cancer will develop . in such situations , the medical doctor has to give detailed information on promoting a healthy lifestyle to avoid the development of cancer to the maximum extent possible . in such delicate situations , the medical doctor faces some ethical dilemmas , such as whether it is ethical , if mrs . x has female cousins on her father s side , to inform them about the possible increased risk of having mutation of this gene . x should be encouraged to share this information with her husband and her two daughters . due to increasing information in the field of genetics , scientific terminology is essential for proper presentation of information during lectures in genetics . the lecturer must take into account that some students might not have come across genetic terminology during their previous studies . therefore , the lecturer should convey information in a way that is accessible to all students . in these situationsthe majority of textbooks contain information that there is an increased risk for nondisjunction of chromosomes at this age , which leads to trisomy in the fetus . such information should not be provided without explanations on various testing methods during pregnancy , and possible solutions in case of detection of trisomy.lifetime risk is defined as the risk of developing a disease over the course of a lifetime . the lecturer should stress that risk is almost never 100 % and even a person with increased susceptibility can prevent development of the disease.carrier is a person who has a mutant allele of a gene in their genotype . several variants of carrier status should be discussed . in the case of a recessive mutation , the carrier is not at higher risk of developing the disease . on the other hand , if a female is a carrier of a mutant gene located on the x chromosome , she will most likely not develop symptoms of the disease , but she is at high risk ( 50 % ) of passing on this mutant gene to male off - spring , who will be affected . if an individual has a dominant mutant gene , then different possibilities should be considered . if a gene with incomplete penetrance is detected , then only those with a gene expressed in the phenotype should be considered as affected . if a gene shows late onset , the probability of being affected depends on the age of the person . advanced maternal age is defined as over 34 ( age of 35 at delivery ) . the majority of textbooks contain information that there is an increased risk for nondisjunction of chromosomes at this age , which leads to trisomy in the fetus . such information should not be provided without explanations on various testing methods during pregnancy , and possible solutions in case of detection of trisomy . lifetime risk is defined as the risk of developing a disease over the course of a lifetime . the lecturer should stress that risk is almost never 100 % and even a person with increased susceptibility can prevent development of the disease . carrier is a person who has a mutant allele of a gene in their genotype . several variants of carrier status should be discussed . in the case of a recessive mutation , the carrier is not at higher risk of developing the disease . on the other hand , if a female is a carrier of a mutant gene located on the x chromosome , she will most likely not develop symptoms of the disease , but she is at high risk ( 50 % ) of passing on this mutant gene to male off - spring , who will be affected . if an individual has a dominant mutant gene , then different possibilities should be considered . if a gene with incomplete penetrance is detected , then only those with a gene expressed in the phenotype should be considered as affected . if a gene shows late onset , the probability of being affected depends on the age of the person . there are a many examples , and in each case the lecturer should consider the use of terms with caution and create a safe emotional environment for students . as lecturers , we should remind our students that a medical doctor s task is to educate the general public and , with our attitude , demonstrate that the affected person is not a burden , but an object of love , affection , and , most importantly , respect .\noutput:\n" }, { "from": "agent", "value": "although inclusion of ethics as a study course in medical students curricula is a common practice , special approaches in teaching ethics in the context of genetics should be considered . in the realm of genomics , there are several ethically sensitive topics such as diagnosis of genetic diseases , in vitro fertilization , and identification of genetic susceptibility to common diseases . in addition , in communication with the general public , genetic terms should be used with caution . demonstration of the phenotypes of affected individuals should be regarded as a particular aspect of teaching genetics . in a description of a patient s phenotype , not only is it necessary to provide scientifically precise characteristics of a patient ; voice timbre , facial expression , and body language should also be carefully controlled . furthermore , in medicine , the theory practice gap is a problematic aspect , and students often find it difficult to apply knowledge on ethical issues to real situations in clinics . for this purpose , clinical cases are presented during classes and their analysis requires a very respectful attitude on the part of both students and lecturers . for many genetic diseases , evaluation of minor anomalies such as a curved fifth finger , low situated ears , or missing of some teeth is required . some minor anomalies are found in healthy individuals too , and interpretation of such features must therefore be considered carefully . this article describes our experiences in teaching genetics at riga stradin university , ethical problems faced while teaching genetics , and their solutions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: antimicrobial peptides ( amps ) are found in the animal and plant kingdoms and provide the first line of defense against invading pathogens . these peptides are a major component of the immune system of vertebrates and invertebrates and are especially critical for invertebrates , such as insects , that lack lymphocytes and antibodies . in fact , the first amps to be isolated and purified were insect cecropins from silk moth hyalophora cecropia . since this initial discovery from silk moth , one of the most well - studied amps is the 37 - residue peptide cecropin a , which exhibits broad - spectrum activity against certain bacteria yet remains relatively inactive against staphylococcus aureus . as with other amps , cecropinboth melittin and cecropin a adopt amphipathic - helical structures in organic solvents and in the presence of lipid membranes . one difference in structure is that melittin possesses hydrophobic n - terminal and basic c - terminal domains , whereas cecropin a exhibits the opposite motif and has basic n - terminal and hydrophobic c - terminal domains . the single tryptophan residue of both peptides has been found to be critical for activity . removal or substitution of the tryptophan residue in melittin causes a decrease in antimicrobial and hemolytic activity . substitution of the tryptophan residue in cecropin a also causes a significant decrease in antimicrobial activity ; however , replacement with a phenylalanine residue restores the activity . another striking similarity is that both melittin and cecropin a possess a single proline residue that gives rise to a flexible hinge region in the folded peptide . these flexible hinge regions have been reported to be important to the peptide activity . despite the commonalities in secondary structure , net charge , and key residues that contribute to peptide potency , these peptides possess remarkably different activities toward bacterial and eukaryotic cell types . for example , the potency against sheep red cells was found to be 100-fold greater for melittin than for cecropin a. cecropin a and melittin often serve as templates in the construction of chimeric peptides that incorporate the best of both worlds : hybrid peptides are designed to retain the potency of toxins while exhibiting the selectivity and nonhemolytic behavior of amps . in contrast with cecropinone such cecropin - melittin hybrid peptide consists of 15 residues from the n - terminal portions of cecropin a and melittin . this peptide , called cm15 , is one of the shortest hybrids that exhibits improved antimicrobial activity relative to cecropin a. cm15 is structurally similar to parent peptides in that it exhibits - helical structure in solvents , micelles , and vesicles , but it lacks a proline necessary for the flexible hinge region . cm15 preserves the high net positive charge of the parent peptides and retains the single tryptophan residue from cecropin a. primary sequence and net charge of melittin , cecropin a , and cm15 are summarized in table 1 . cm15 provides a unique opportunity to investigate a synthetic peptide known for its potent antimicrobial activity and to also compare its biophysical properties to those of the parent peptides cecropin a and melittin . underlined portions of parent peptides constitute the sequence of amino acids present in the hybrid peptide cm15 . we utilize electronic and vibrational spectroscopy combined with molecular dynamics ( md ) simulations to probe melittin , cecropin a , and cm15 in different lipid environments . the local environment of the single tryptophan residue and secondary structures of the peptides were interrogated using uv resonance raman ( uvrr ) spectroscopy and steady - state fluorescence . peptide potency was evaluated using a leakage assay based on fluorescence of extrinsic dye molecules . the synthetic lipid bilayers are simple mimics of the membranes of eukaryotes ( 100 % zwitterionic lipids ) and prokaryotes ( 2:1 zwitterionic : anionic lipids ) . md simulations of cm15 on the same lipid systems were also performed to complement these spectroscopic studies . melittin , cecropin a , and cm15 were purchased from axxora , anaspec , and american peptide company , respectively . all peptides possess amidated c - termini in their native forms and were used as received . anionic lipid 1 - palmitoyl -2-oleoyl - sn - glycero -3-phospho - ( 1 - rac - glycerol ) ( sodium salt , popg ) and neutral lipid 1 - palmitoyl -2-oleoyl - sn - glycero -3-phosphocholine ( popc ) were purchased from avanti lipids in chloroform . peptide concentrations for all experiments were 10100 m in 20 mm potassium phosphate buffer at ph 7.3 . leakage assays were performed using the fluorophore 8 - aminonaphthalene -1,3,6-trisulfonate ( ants ) and the quencher p - xylene - bis - pyridiniumbromide ( dpx ) from invitrogen . anionic lipid vesicles were prepared by combining aliquots of popc ( 10 mg ) and popg ( 5 mg ) and drying the mixture under a stream of nitrogen . / quencher containing vesicles , the buffer contained 50 mm ants and 50 mm dpx . vesicles were prepared by extruding the lipid suspension thirteen times through a polycarbonate filter with pore size 200 nm using an extruder ( eastsci ) . vesicle solutions were filtered ( 0.45 m membrane ) and passed through a desalting column ( 10dg , biorad ) . the first 3 ml elution was discarded , and the second 3 ml elution containing vesicles was collected and allowed to equilibrate at 37 c . the final lipid concentration used in experiments was 1 mg / ml . all samples were incubated for 1 to 2 h at 37 c prior to measurement . the excitation wavelength for tryptophan fluorescence was 290 nm , and the entrance and exit bandpass were 3.0 nm . spectra of buffer with or without vesicles were subtracted from all raw peptide spectra . steady - state anisotropy was measured by introducing vertical ( v ) and horizontal ( h ) polarizers in the excitation and emission paths . fluorescence intensities ivv , ivh , ihh , and ihv , where the first and second subscripts refer to excitation and emission polarizations , respectively , were used to calculate the anisotropy . the entrance bandpass and exit bandpass were 2.5 and 6.0 nm , respectively , for anisotropy experiments . for leakage assay experiments , the excitation wavelength was 386 nm and the entrance bandpass and exit bandpass were 5.0 nm . tritonx detergent was added to ants / dpx - containing vesicle solutions to determine the maximum fluorescence intensity corresponding to 100 % dye leakage . vibrational spectra were obtained by setting the fundamental laser wavelength to 840 or 920 nm to generate 210 or 230 nm excitation beams , respectively . a typical sample volume of 2.0 ml was pumped through a vertically mounted fused silica capillary at a rate of 0.16 ml / min . uvrr spectra of appropriate blank solutions were also collected and subtracted from the corresponding raw peptide spectra . uvrr spectra presented here have been normalized to the most intense peak at 760 cm . accuracy and precision were determined using ethanol peaks and were found to be 2 cm . the cm15 peptide was simulated in a water box for 1 ns starting with a linear conformation . ten representative structures of the peptide during the second half of this simulation were selected and used as initial structures in the peptide lipid simulations . the peptide was placed in a box with two pre - equilibrated lipid bilayers , one containing 78 popc molecules and the other containing 52 popc and 26 popg molecules . cm15 was added to one side of the lipid bilayer , 30 above the phosphorus atoms in the upper leaflet . to neutralize the net charge of the systems , we added 7 sodium and 13 chloride ions to the cm15 - popc system and 20 sodium ions to the cm15 - popc / popg system . ten 100 ns simulations were performed for each peptide lipid system described above . the simulations were performed under the constant temperature , pressure , and surface area ( npat ) conditions with the program namd , release 2.7 b1 . the simulation temperature was maintained at 300 k using langevin dynamics , and the pressure was kept at 1 atm using a nosthe charmm force field for proteins and the latest update for lipids were utilized . to improve the sampling efficiency , a soft boundary condition was applied to keep the peptide within 20 of the bilayer . when the peptide attempted to exit this 20 buffer zone , a weak restraining potential ( spring constant 3 kcal / mol / ) was applied to the center - of - mass of the peptide to prevent it from exiting the buffer zone . when the peptide was inside the buffer zone , however , no external force was applied , and the peptide diffused freely in bulk water or interacted with the lipid bilayer . therefore , the effect of the soft boundary condition was an increase in sampling efficiency , which was achieved by keeping the peptide within the proximity of the bilayer without interfering with its inherent dynamics . in - depthsimulation details and the effect of simulation ensembles are presented in a separate report . steady - state tryptophan fluorescence spectra were collected for each peptide in phosphate buffer , 100 % popc ( zwitterionic ) lipid vesicles , and 2:1 popc : popg ( anionic ) lipid vesicles . a tryptophan fluorescence spectrum of melittin in 2 m nacl was also collected because it is known that melittin forms a folded - helical soluble tetramer in a high salt environment . the wavelength of maximum fluorescence emission ( max ) and steady - state anisotropy at max ( rmax ) for each peptide in the different environments are summarized in table 2 . the melittin tryptophan emission is blue - shifted 12 , 19 , and 16 nm in the presence of zwitterionic lipid vesicles , anionic lipid vesicles , and in 2 m nacl , respectively , relative to its emission in phosphate buffer . the emission maximum of melittin in anionic lipid vesicles is the most blue - shifted fluorescence wavelength compared with the other peptide + lipid systems in this study . for cecropin a , the emission maximum blue - shifted only in the presence of anionic lipid vesicles . in contrast , the tryptophan emission of cm15 blue - shifted in both anionic lipid vesicles ( 15 nm ) and in zwitterionic lipid vesicles ( 4 nm ) relative to unfolded peptide . italicized folded ( % ) values of 0 and 100 % indicate selected basis spectra to represent unfolded and folded peptide for the uvrr fitting analysis . the steady - state anisotropy of the tryptophan residue for each peptide correlates with the fluorescence results : the anisotropy , rmax , increased in environments that also caused blue shifts in emission . the anisotropy value of the tryptophan residue of cm15 also increased in zwitterionic lipid vesicles despite the relatively small shift in emission maximum . disruption of the synthetic lipid vesicle was measured using a fluorescence leakage assay . the increase in ants fluorescence was monitored 1 h after the addition of peptides to vesicles with encapsulated ants / dpx mixture . the results of this assay are shown in figure 1 as a percentage of leakage relative to the signal induced by the detergent tritonx . for ants / dpx - containing anionic lipid vesicles , cecropin a caused significant leakage at the lowest peptide concentration of 10 m . the fluorescence signal quickly saturated at cecropin a and melittin concentrations of 20 m . cm15 did not cause significant leakage of anionic lipid vesicles at low peptide concentrations but was effective at peptide concentrations similar to those used in uvrr experiments ( 40 m ) . leakage from anionic ( top panel ) and zwitterionic lipid vesicles ( bottom panel ) caused by melittin ( circles ) , cecropin a ( squares ) , and cm15 ( triangles ) . melittin and cm15 were potent against zwitterionic lipid vesicles and caused substantial leakage of the encapsulated ants / dpx . this leakage appeared to plateau after 10 m peptide . as expected , cecropin a caused minimal leakage ; in fact , the extent of leakage caused by cecropin a was similar to the leakage change observed when a tryptophan model compound , n - acetyl - l - tryptophanamide ( nata ) , was added to the vesicles ( data not shown ) . uvrr spectra with 230 nm excitation exhibit vibrational bands from the single tryptophan residue in each peptide . figure 2 presents the w10 and w7 fermi doublet region of the 230 nm uvrr spectra of cecropin a and cm15 in phosphate buffer and in the presence of zwitterionic and anionic lipid vesicles . expanded 230 nm uvrr spectra of cecropin a and cm15uvrr spectra of melittin in phosphate buffer , 2 m nacl , and anionic and zwitterionic lipid vesicles were presented and discussed in a previous publication . the uvrr fermi doublet intensity ratio ( rfd = i1362 / i1346 ) and the w10 intensity ratio ( rw10 = iw10 / iw9 = i1231 / i1260 ) are reported in table 2 for all peptides . rfd and rw10 values were determined from the intensities of the bands at the indicated frequencies . the w10 and w7 fermi doublet ( fd ) regions in 230 nm uvrr spectra of cecropin a ( top panel ) and cm15 ( bottom panel ) . in each panel , the spectra are of peptide in the presence of phosphate buffer ( top ) , zwitterionic vesicles ( middle ) , and anionic lipid vesicles ( bottom ) . rfd values for melittin increased in lipid and nacl environments relative to in phosphate buffer . however , for cecropin a , the rfd value increased only in the presence of anionic lipid vesicles . the rfd value for cm15 increased significantly in the presence of anionic lipid vesicles and modestly in the presence of zwitterionic vesicles . for melittin , rw10 decreased in all lipid and salt environments relative to in buffer , with the lowest value in 2 m nacl . conversely , the rw10 value increased for cecropin a and cm15 bound to anionic lipid vesicles . figure 3 presents 210 nm uvrr spectra in the region of amide iii vibrations for melittin , cecropin a , and cm15 in the different lipid and salt environments . significant changes in the amide iii region are observed for melittin in 2 m nacl and in the presence of lipid vesicles relative to melittin in phosphate buffer . peaks near 1243 and 1389 cm decrease in intensity , whereas the band near 1292 cm increases in intensity when the peptide is bound to lipid or in 2 m nacl . analogous shifts in the amide iii band are observed for cecropin a and cm15 in the presence of anionic lipid vesicles , but only minor or no uvrr changes are evident for these peptides in the presence of zwitterionic vesicles . uvrr spectra with 210 nm excitation of melittin ( top panel ) , cecropin a ( middle panel ) , and cm15 ( bottom panel ) . dotted lines are resulting fits when basis spectra are composed of unfolded peptide in buffer and folded peptide in 2 m nacl ( melittin ) or anionic lipids ( cecropin a and cm15 ) . the amide iip band ( 14401470 cm ) is prominent in spectra of peptides containing proline , such as melittin and cecropin a. a small band is also present in this region for cm15 , which does not contain a proline residue . this band is attributed to the trifluoroacetate counterion present in the cm15 sample obtained from the manufacturer . for melittin , the amide iip band downshifts from 1466 cm and transforms into a doublet in the presence of lipid vesicles and 2 m nacl . a similar shift is also observed in the spectrum of cecropin a in anionic lipid vesicles compared with the spectrum in phosphate buffer ; however , it is unclear if the band evolves into a doublet based on the signal - to - noise ratio of this spectrum . the percentage of secondary structure was determined by utilizing the fully folded and unfolded spectra as basis spectra ; these basis spectra were summed to reproduce the observed spectrum . for melittin , the spectra of peptide in 2 m nacl and in phosphate buffer served as the folded and unfolded basis spectra , respectively . the choice of the folded basis spectrum was based on previous experiments that established the soluble tetrameric form of melittin as a highly - helical structure . for cecropin a and cm15 , the spectra in anionic lipid vesicles and in phosphate buffer were utilized as the folded and unfolded basis spectra , respectively . these basis spectra were selected based on similarity with the melittin folded basis spectrum and on circular dichroism experiments that indicated folded - helical structures of cecropin a and cm15 in the presence of anionic lipid vesicles ( figure s2 of the supporting information ) . the observed data were simulated with a sum of the basis spectra with variable coefficients via a least - squares fitting routine and are represented as dotted lines in figure 3 . the values are 89 and 97 % folded for melittin in zwitterionic and anionic lipid vesicles , respectively . cecropin a is 2 % folded and cm15 is 23 % folded in the presence of zwitterionic lipid vesicles . percent folded values are summarized in table 2 . table 3 presents statistical analysis of key md simulation results , including occurrences of cm15 insertion into the bilayer ( bilayer ) or localization at the interfacial region ( interface ) and average secondary structure content when the peptide inserted into the bilayer ( ss bilayer ) or localized at the interface ( ss interface ) . values in the table for bilayer and interface indicate the number of simulations ( out of 10 ) that resulted in an occurrence of the specified event during the last 33 ns of the 100 ns simulation ; an occurrence is given a value of 1 if the event persists beyond a threshold of 10 % of the 33 ns window and a value of 0 if the event does not persist longer than the threshold period . the peptide was considered to be inserted in the bilayer if the center of mass of the peptide remained between the average levels of the upper and lower phosphorus atoms of the bilayer and was considered at the interface if it remained within 10 above or below the average levels of the upper and lower phosphorus atoms , respectively . the average levels of the upper ( pupper ) and lower ( plower ) leaflet phosphorus atoms take into account the fluctuations in terms of the standard deviations of the phosphorus atoms ( upper and lower ) . therefore , bilayer is defined by the following condition , where zcom is the location of the center of mass of the peptide : ploweranalogously , a peptide is considered to be at the lower leaflet interface when plower10 zcom plower lower and in the upper leaflet interface when pupper + upper zcom pupper + upper + 10 . occurrences of cm15 insertion into the hydrocarbon bilayer ( bilayer ) or localization at the interfacial region ( interface ) and average secondary structure content within the bilayer ( ss bilayer ) or at the interface ( ss interface ) . the extent of secondary structure , ss bilayer and ss interface , reflects the average content of secondary structure when the peptide is inserted in the bilayer or localized at the interface . a value of 0 indicates that on average the peptide exhibited no - helical structure . it should be noted that the results obtained from md simulations reflect early events in peptide lipid binding , and may vary from results obtained with longer simulation times . nonetheless , differences are observed for cm15 in zwitterionic and anionic lipids , which allow comparison of peptide lipid interactions in these two bilayers . as expected , based on electrostatics , the cationic cm15 peptide interacted less frequently with the zwitterionic lipid bilayer relative to anionic lipids . for example , out of 10 total simulations , cm15 inserted into the zwitterionic bilayer ( bilayer ) in one simulation and localized at the interfacial region ( interface ) in five simulations . in contrast , cm15 inserted into the anionic bilayer in three simulations and localized at the interfacial region in all 10 simulations . given the potential significance of the tryptophan residue , we also analyzed tryptophan burial in terms of the tryptophan center of mass and applied the same condition for insertion , as described for the peptide above . tryptophan insertion in the zwitterionic lipid bilayer occurred in only one simulation , whereas this event occurred six times in the anionic lipid bilayer . tryptophan trajectories of cm15 in the presence of zwitterionic and anionic lipid vesicles are presented in figure s3 of the supporting information . in our expanded study that extended the md simulations to 180 ns , it was shown that the tryptophan residue of cm15 is in contact with anionic and zwitterionic lipid environments more frequently than any other residue of the peptide . in both lipid environments , there was a reduction in the fluctuations of the side - chain dihedral angle of the tryptophan residue ( figure s4 of the supporting information ) . as expected , the average number of salt bridges between lysine residues and lipids increased dramatically in the case of anionic lipids compared with the zwitterionic lipids , which is consistent with the presence of the negatively charged lipid popg ( data not shown ) . in simulations that resulted in folding and insertion into the bilayer , the peptide assumed an orientation that is parallel to the bilayer ; perpendicular orientations or bilayer traversal was not observed during the 100 ns simulation . in all peptidelipid simulations , cm15 never folded into a perfectly helical structure ( 100 % ) . one interesting , but unexpected , finding is that the peptide remained largely unfolded when it inserted into the zwitterionic bilayer . snapshots of representative md simulations of cm15 in the presence of zwitterionic and anionic lipid vesicles ( t = 100 ns ) are depicted in figure 4 . electron density profiles generated from the lipid bilayer used for md simulations are also presented with these snapshots . results from md simulations . left : electron densities of the bilayers composed of zwitterionic lipids ( top ) and anionic lipids ( bottom ) . right : snapshots of cm15 in the presence of zwitterionic ( top ) and anionic ( bottom ) lipids . colored regions of the peptide indicate - helical structure ( purple ) , turns ( green ) , and random coil ( black ) . leakage assays are simple in vitro experiments that help reveal relative potencies of amps against different lipid compositions . melittin causes leakage of both zwitterionic and anionic vesicles , supporting the previously reported nonspecific and potent activity toward bacterial and eukaryotic cells . the leakage assay results for cecropin a are also consistent with prior reports that this peptide is potent against bacterial , but not eukaryotic , cells . cm15 gave a surprising result in that it disrupted zwitterionic lipid vesicles despite the known low level of hemolytic activity of this peptide . this finding that cm15 affects the integrity of zwitterionic vesicles is consistent with leakage results previously reported for a similar cecropin - melittin hybrid peptide constructed from a longer section of melittin . this prior study reported peptide concentration - dependent leakages for pure anionic and zwitterionic lipid vesicles that are similar to our results and showed that at low peptide concentrations , zwitterionic lipid vesicles leaked more than anionic lipid vesicles . these and our results indicate that cecropinthe single tryptophan residue in melittin and cecropin is crucial for potency ; omission of this residue significantly reduces peptide activity . this tryptophan - associated potency may partially reflect the strong thermodynamic driving force of this residue for the bilayer . tryptophan fluorescence provides general insight , but the emission properties do not typically distinguish solvent polarity and hydrogen bonding of tryptophan residues . in contrast , we previously reported that uvrr intensity ratios for different peaks are sensitive to local polarity ( rfd ) or hydrogen bonding ( rw10 ) of tryptophan model compounds . for example , large rfd values indicate a hydrophobic environment regardless of hydrogen bonding environment , and large rw10 values indicate strong hydrogen bonding of the nthe low rfd values and red - shifted fluorescence max for the peptides unfolded in phosphate buffer indicate that the tryptophan residues are solvent - exposed ( table 2 ) . the combined uvrr and fluorescence results reveal that the tryptophan residue of melittin inserts into both types of lipid vesicles studied here . previously , we reported that the large fluorescence shift and high rfd value in the case of melittin in the presence of anionic lipid vesicles is indicative of deep burial of tryptophan into the hydrocarbon core of the lipid bilayer . this localization of the tryptophan residue is supported by low uvrr rw10 values that indicate minimal hydrogen bonding to lipid headgroups or water . the extent of burial into zwitterionic lipid vesicles is less than that into anionic lipid vesicles , evidenced by the systematic differences in fluorescence max , anisotropy , and rfd values for these two lipid systems . the single tryptophan residue in cm15 originates from the cecropin a parent peptide , but the spectroscopic properties differ for cm15 and cecropin a. the fluorescence max , anisotropy , and uvrr results for cecropin a in zwitterionic lipid vesicles are similar to those for the peptide in phosphate buffer ; therefore , we conclude that the tryptophan residue in cecropin a does not interact with zwitterionic lipid vesicles . this lack of interaction is consistent with leakage assay results that indicate that cecropin a does not disrupt zwitterionic vesicles ( figure 1 ) . the tryptophan residue of cm15 in the presence of zwitterionic lipid vesicles exhibits a more complex response . the subtle , but reproducible , shifts in fluorescence max and uvrr intensity ratios indicate that this residue is not fully inserted into the lipid bilayer . however , these small spectral shifts indicate that there is measurable interaction between the tryptophan residue and the lipids . a similarly modest blue shift of tryptophan fluorescence for a longer cecropinmelittin hybrid peptide in the presence of zwitterionic lipid vesicles was also reported , further supporting our finding that the cecropinmelittin hybrid peptides interact with zwitterionic lipid vesicles in a subtle , but significant , manner . md simulations corroborate these experimental findings ; in simulations where w2 inserted into the bilayer , the tryptophan residue formed hydrogen bonds with the zwitterionic lipid head groups and was localized to 2 within the bilayer ( data not shown ) . furthermore , the simulations indicate that when tryptophan inserts into the bilayer , the orientation of the residue is motionally restricted ( figure s4 of the supporting information ) , and this finding is consistent with the experimentally observed increase in anisotropy in zwitterionic lipid vesicles . this tryptophan lipid interaction may be partially responsible for the increased leakage observed for cm15 in the presence of zwitterionic lipid vesicles . the enhanced rfd values , blue - shifted max , and increases in anisotropy for cecropin a and cm15 in the presence of anionic lipids support the insertion of tryptophan residues into these lipid vesicles . the tryptophan residue in cm15 and cecropin a also forms hydrogen bonds in anionic lipids ; this interaction was not observed for melittin based on rw10 values in the uvrr spectrum ( table 2 ) . these data suggest that tryptophan residues of cecropin and cm15 may not be buried as deeply in anionic lipid vesicles compared with melittin . we propose that cm15 and cecropin tryptophan residues are located close to the hydrogen - bond - accepting heteroatoms of the lipid headgroups because of the similarity of the intensity ratios ( rfd and rw10 ) with previously reported values for tryptophan octyl ester ( toe ) , a model compound with a single interfacial tryptophan residue . md simulations support the proposed location of the tryptophan residue of cm15 in anionic lipid bilayers . rather , it remained near the surface of the membrane in both zwitterionic and anionic lipid environments , as shown by their trajectories during the 100 ns simulation ( figure s3 of the supporting information ) . furthermore , the indole n h group formed hydrogen bonds with primarily the carbonyl and phosphate groups of the lipids . on average , the tryptophan residue of cm15 participated in hydrogen bonds more frequently in the case of anionic lipids than the zwitterionic lipids ( data not shown ) ; this finding is confirmed by the uvrr results , which indicated a greater rw10 intensity ratio in the presence of anionic lipid vesicles ( table 2 ) . one reason for this enhanced hydrogen bonding in anionic lipids is because the anionic lipid possesses more hydrogen bond acceptors ( two additional alcohol groups ) than zwitterionic lipids . md simulations also indicate that the cm15 tryptophan residue in anionic lipid vesicles is motionally restricted relative to in zwitterionic lipid vesicles , a finding that is consistent with experimental tryptophan anisotropy results ( figure s4 of the supporting information , table 2 ) . overall , the combined spectroscopic and md simulation results suggest that deeply buried tryptophan residues may be characteristic of toxin membrane interactions , whereas tryptophan residues that are localized and hydrogen - bonded to the interfacial region may reflect amp membrane interactions . melittin is more hydrophobic than cecropin a , evidenced by gravy ( grand average hydropathicity ) values based on the kyte and doolittle hydropathy scale of 0.273 for melittin and 0.073 for cecropin a. gravy values are calculated by summing hydropathy values for each amino acid and dividing by the number of residues in the sequence . the larger value calculated for melittin is consistent with the deep insertion of the tryptophan residue in lipid bilayers . however , a gravy value of 0.540 was calculated for cm15 , indicating that overall peptide hydropathicity may play only a partial role in the tryptophan depth in lipid bilayers . in this case , the relatively short length of cm15 combined with its enhanced hydropathicity may allow it to adopt unfolded structures at the interface ( see below ) . the preference of tryptophan and other aromatic amino acids for the interfacial region of bilayers is observed in different types of membrane proteins and peptides and suggests that tryptophan has functional relevance . it has been postulated that tryptophan behaves as an anchor and orients the protein within the bilayer . it has also been shown that tryptophan residues located in the interfacial region of the bilayer contribute to the overall thermodynamic stability of a membrane protein and play important functional roles in antibiotic channel peptides . it has yet to be determined whether the tryptophan residue of cm15 is important for peptide activity . however , the spectroscopic and md results discussed above suggest that the tryptophan residue of cm15 may play an important role in initiating peptide folding and insertion into the lipid bilayer . this conclusion is supported by the observation that the tryptophan residue interacts with both sets of lipids more often than any other cm15 residue according to the extended md simulations . omission analogues or mutagenesis studies may provide additional insight into the importance of aromatic residues such as tryptophan in the primary sequence of engineered amps . the uvrr and cd spectra ( figure s2 of the supporting information ) reveal secondary structure . the data indicate that all three peptides adopt random coil structure in buffer solution , evidenced by intense bands at 1243 and 1389 cm and an upshifted amide iip band at 1466 cm . the peptides adopt - helical structure in the presence of anionic lipid vesicles ( peaks at 1292 and 1337 cm and absence of a band at 1389 cm ) . in the presence of zwitterionic vesicles , the peptidesdisplay variable structures : melittin is - helical , cecropin a remains a random coil , and cm15 appears to retain partial secondary structure , discussed below . spectral fitting of the 210 nm uvrr spectrum of cm15 in zwitterionic lipid vesicles reveals that there is a minor contribution of folded signal ( 23 % ) . we are unable to discern whether this contribution reflects a minor population of folded peptide or a dominant population of partially folded peptide . there is experimental evidence of the latter interpretation from a cd study that reported partial folding of cm15 in zwitterionic dmpc lipid vesicles . regardless of the origin of this minority signal of folded peptide , we conclude that cm15 interacts with and disrupts zwitterionic lipid vesicles in a primarily unfolded conformation . analysis of the 210 nm uvrr spectra includes investigation of the amide iip doublet at 14401460 cm . it has been suggested that this band is sensitive to protein conformation and hydrogen bonding , much like the bands that comprise the amide iii region . we previously quantified the doublet feature in melittin using the intensity ratio rp , which is the ratio of intensities of the 1460 and 1440 cm bands . this analysis was based on the suggestion that the amide iip band frequency is sensitive to hydrogen bonding of the leu - pro ( melittin ) carbonyl group . according to uvrr studies of dipeptides , frequencies near 1460 cm are indicative of a strongly hydrogen bonded carbonyl , whereas frequencies near 1445 cm represent minimal or no hydrogen bonding of the carbonyl group . this interpretation is unlikely to be complete ; a recent study reported that the amide iip band frequency is not sensitive to hydrogen bonding but rather is a sensitive reporter of changes in the angle of the proline amide backbone . herewe invoke both interpretations , with emphasis on the latter structure - based contribution . conformational analysis of the single proline residue and associated hinge region of melittin and cecropin a is important because the flexible hinge region has been found to be critical for peptide activity . the amide iip band in the spectrum of melittin downshifts in environments that induce folding , suggesting that the angle near the proline residue undergoes changes when the peptide assumes - helical structure . in addition to this general downshift , the melittin amide iip region becomes a doublet , indicating that the backbone near the proline residue may adopt two distinct orientations . these orientations may reflect two populations and are consistent with the crystal structure of tetrameric melittin , in which the proline angle takes on two different values for the four peptides . the amide iip band for cecropin a in the presence of anionic lipid vesicles is more difficult to interpret because of the low signal - to - noise ratio . nonetheless , it is clear that the amide iip band also shifts to lower frequency for the folded peptide relative to unfolded cecropin a , consistent with structural changes associated with secondary structure formation . in summary , the 210 nm uvrr results indicate that the secondary structure of melittin is not dependent on the type of lipid environment utilized in this study . the structure of cecropin a and cm15 , however , is dependent on the lipid environment . we also appreciate that the peptide structure may vary in the presence of natural eukaryotic or prokaryotic membranes . the thermodynamics of partitioning is a critical factor in the structure of membrane - associated peptides . according to the white and wimley hydrophobicity scale , the free energy of partitioning cm15 from water to phosphatidylcholine lipids as an unfolded peptide is favorable , with a value of 1.87 kcal / mol . in contrast , 52 % helix formation is required for cecropin a to have a total partitioning free energy of zero ( 7.65 kcal / mol for 0 % helix formation and 7.15 kcal / mol for 100 % helix formation ) , and the free energy for insertion of melittin in the unfolded state is around zero ( 0.07 kcal / mol ) . this calculation suggests that cm15 insertion into the phosphatidylcholine lipid bilayer may not require the formation of an - helix and supports the experimental finding of a partially folded structure in zwitterionic lipids . disruption of membrane integrity in the presence of partially unfolded cm15 peptide may be caused by intermolecular hydrogen bonds . for example , groups within the amide backbone that would typically be hydrogen - bonded in the folded state may instead form favorable hydrogen bonds with lipid moieties . these interactions may disturb the integrity of the bilayer , causing the vesicle to leak . the presence of such hydrogen bonds is supported by the modest shift in rw10 in the appropriate direction ( table 2 ) . it should be noted that cm15 does not exhibit hemolytic activity in in vivo assays , indicating that the leakage assay utilized here does not provide a direct measure of peptide activity in red blood cells . the observation that an unfolded peptide may be a potent membrane disruptor is not unprecedented . previous studies on membrane - associated peptides reveal that secondary structure formation is not required for activity . experiments incorporating d - amino acids into the primary sequence of peptides disrupted the - helical secondary structure , but bactericidal activity was preserved . additionally , the single tryptophan residue of melittin diastereomers inserted into lipid vesicles despite the unfolded structure observed in helix - inducing solvents . the results of experiments performed with membrane - active diastereomer peptides and cm15 in this work indicate that secondary structure may not be a prerequisite for the lytic activity of amps . this finding suggests that we should revisit and modify the commonly held belief that bilayer - disrupting peptides form secondary structure to be toxic . engineering robust and potent amps requires an in - depth understanding of molecular interactions between the peptide and lipid bilayer . herewe compare three membrane - associating peptides that have similar structure and net charge but display different selectivity and potency toward cells . our findings indicate that a variety of molecular interactions are important to guide specificity and to improve potency in antimicrobial and toxic peptide membrane interactions . in the case of cm15 , for example , salt bridge formation between the cationic lysine residues and the negatively charged headgroups in anionic lipids occurs more often than with negative groups in zwitterionic lipids . we hypothesize that electrostatic interactions are responsible for initial peptide membrane binding . however , the formation of salt bridges does not adequately explain the differences in peptide structure and potency reported here and elsewhere . additional factors contribute to the specificity and potency of membrane - disruptive peptides , such as the position and insertion level of tryptophan or other aromatic residues , and overall peptide hydrophobicity . lastly , secondary structure formation does not appear to be a necessary condition for peptide insertion into the bilayer or for bilayer disruption . this is an intriguing result that broadens our understanding of the mechanisms of action of these important peptides .\noutput:\n" }, { "from": "agent", "value": "antimicrobial peptides ( amps ) , such as cecropin a from silk moth , are key components of the innate immune system . they are effective defensive weapons against invading pathogens , yet they do not target host eukaryotic cells . in contrast , peptide toxins , such as honeybee melittin , are nondiscriminating and target both eukaryotic and prokaryotic cells . an amp - toxin hybrid peptide that is composed of cecropin a and melittin ( cm15 ) improves upon the antimicrobial activity of cecropin a without displaying the nonspecific , hemolytic properties of melittin . here we report fluorescence and uv resonance raman spectra of melittin , cecropin a , and cm15 with the goal of elucidating peptide - membrane interactions that help guide specificity . we have probed the potency for membrane disruption , local environment and structure of the single tryptophan residue , backbone conformation near the peptide hinge , and amide backbone structure of the peptides in lipid environments that mimic eukaryotic and prokaryotic membranes . these experimental results suggest that melittin inserts deeply into the bilayer , whereas cecropin a remains localized to the lipid headgroup region . a surprising finding is that cm15 is a potent membrane - disruptor despite its largely unfolded conformation . a molecular dynamics analysis complements these data and demonstrates the ability of cm15 to associate favorably with membranes as an unfolded peptide . this combined experimental computational study suggests that new models for peptide membrane interactions should be considered ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: acute kidney injury in a patient with known malignancy can occur due to pre - renal causes ( gastrointestinal losses or capillary leak ) , immunologic ( membranous glomerulopathy , amyloidosis or vasculitis ) , infiltrative process ( lymphoma , metastasis or renal cell carcinoma ) , toxic ( chemotherapy , radiation therapy or nephrotoxic agents ) , metabolic ( tumour lysis syndrome or hypercalcaemia ) , tubular or extra - renal obstruction ( intratubular uric acid deposits or lymphadenopathy ) . we present an interesting case of a young female with extensive infiltration of both kidneys due to metastasis from primary lung adenocarcinoma that caused progressive renal failure . a 51 - year - old female was hospitalized for shortness of breath on exertion for 2 days . she had no prior history or risk factors for kidney disease but was taking daily ibuprofen ( 16002400 mg p.r.n . ) over the past 7 months for chronic neck pain . four weeks prior to admission , she developed fever and a cough productive of mucoid sputum . at that time , a chest radiograph revealed a 7 - cm right middle lobar and hilar mass with right pleural effusion , and her serum creatinine ( scr ) was 1.7 mg / dl . after completing a course of cefuroxime , a transbronchial biopsy of the lung mass and mediastinal lymph nodes revealed primary poorly differentiated lung adenocarcinoma with positive immunohistochemical staining for thyroid transcription factor - 1 ( ttf - 1 ) and presence of the k - ras mutation . on admission , her physical exam was normal except for decreased breath sounds at the right lung base with dullness to percussion and bilateral pedal oedema . laboratory work revealed microcytic anaemia ( haemoglobin = 8.3 g / dl ) , a further elevation in scr ( = 2.8 mg / dl ) and unremarkable urinalysis ( 1 + dipstick albumin , 1 red blood cell / high power field , no casts and spot urine protein : creatinine ratio = 0.88 other laboratory results were unremarkable ( serum calcium = 8.8 mg / dl , serum uric acid = 7.6 mg / dl , absolute eosinophil count = 800 / mm , normal complement c3 and c4 levels , urine sodium = 17 meq / l , anti - nuclear antibody 1:400 speckled , and negative serum immunofixation ) . she had a renal ultrasound ( figure 1 ) that showed enlarged kidneys ( right 15.1 cm and left 15.4 cm ) , lack of corticomedullary differentiation with no pelvicalyceal dilatation or hydronephrosis . a positron emission tomography scan ( pet , figure 2 ) done for staging showed increased tracer uptake in the right middle lobe of the lung ( peak standard uptake value , suv = 8.4 ) , lymphadenopathy ( left supraclavicular , paratracheal , mediastinal , subcarinal , retrocrural , paracaval , para - aortic and peripancreatic ) and bilateral enlarged kidneys with heterogeneous uptake in the cortices ( peak suv = 8.5 ) . an ultrasound - guided renal biopsy was performed to determine if the renal mass was due to renal cell carcinoma or metastases . we found sheets of tumour cells replacing ~ 70 % of the renal interstitium ( figure 3 ) with positive ttf - 1 staining and presence of intracellular lumina morphology similar to the lung adenocarcinoma . three glomeruli with atrophic tubules were negative for all immunoreactants ( igg , iga , igm , c3 , c1q , fibrinogen , albumin , and ) . diffuse metastatic infiltration of both kidneys from primary lung adenocarcinoma ( stage iv ) was confirmed . she received one cycle of palliative non - nephrotoxic chemotherapy with paclitaxel 175 mg / m and gemcitabine 1000 mg / m ( both administered on day 1 and 8 ) . two weeks later , she had progression of renal failure ( scr = 4.5 mg / dl ) and developed uraemic encephalopathy and pruritus ( blood urea nitrogen = 129 mg / dl ) , and the family requested home hospice care . light microscopy ( 40 magnification ) of renal tissue showing extensive infiltration with tumour cells from primary lung adenocarcinoma . malignant neoplasms of the kidney are more likely to be due to metastatic tumour from another site rather than primary renal cell carcinoma , with autopsy studies showing the former in up to 12 % of cancer patients . the most common primary sites of malignancy metastasizing to the kidneys include haematologic malignancies ( lymphoma or leukaemia ) ; lung , breast or gastrointestinal cancers ; or malignant melanoma . renal metastases usually manifest as bilateral , small , multifocal parenchymal nodules , though single exophytic lesions have also been described . metastatic disease in the kidneys is frequently seen in the setting of widespread disseminated disease and thus has a poor prognosis . clinically , these tumours may be asymptomatic , though some cause flank pain , haematuria or proteinuria . diffuse infiltration of both kidneys with metastatic primary tumour cells causing impairment of renal function is very unusual and rare . this histopathological presentation has been seen in up to 10 % of patients with lymphoma with good response to chemotherapy . however , only three earlier case reports in the medical literature describe a similar presentation of renal metastases from primary lung cancer ( small cell , squamous cell or adenocarcinoma ) manifested as bilateral kidney infiltration , progressive renal failure , poor response to chemotherapy and death . our case is unusual due to the presence of severe degree of diffuse metastases of the lung carcinoma to both kidneys in the absence of extra - pulmonary metastasis to any other solid organ ( other than lymphadenopathy ) . thus , we considered other causes for diffuse bilateral renal infiltration such as lymphoma , bilateral renal - cell carcinoma , renal sarcoma or benign causes such as acute glomerulonephritis , acute interstitial nephritis , bilateral pyelonephritis , multiple myeloma or amyloidosis . radiation therapy to the kidneys in this setting would require markedly higher doses ( 8090 gy ) than that typically required to treat renal lymphoma ( 2030 gy ) which would cause radiation nephritis . unlike lymphoma , chemotherapy is usually not effective in this stage of lung cancer as in our patient and in other case reports , and this portends a poor prognosis . in our case , progressive renal failure from lung metastases occurred primarily by parenchymal distortion and tubular destruction by tumour cells , though obstruction from sloughed parenchyma or tumour , vascular invasion and injury with thrombosis , or lymphatic obstruction is also possible . finally , tubulointerstitial nephritis due to chronic non - steroidal anti - inflammatory drug use may have contributed to her renal injury but was possibly mild or masked by the infiltrative tumour process . our case highlights an extremely rare presentation of lung adenocarcinoma with metastasis and invasion of the kidneys causing irreversible renal failure . renal metastases should be suspected in a patient found to have multiple renal lesions and a history of non - renal primary carcinoma . diffuse metastatic infiltration is unusual and can be identified by pet scan , while renal biopsy provides pathological confirmation of this process . chemotherapy or radiation therapy should be considered , as it may reverse the renal injury if the tumour responds to these treatment strategies .\noutput:\n" }, { "from": "agent", "value": "we present an interesting case of a young female smoker who was hospitalized for shortness of breath and acute renal insufficiency ( serum creatinine = 2.8 mg / dl ) . few weeks prior to admission , she was discovered to have a right lung mass , and a biopsy confirmed lung adenocarcinoma . her work - up revealed an unremarkable urinalysis quantitatively and on microscopic analysis . renal ultrasound demonstrated enlarged bilateral unobstructed kidneys , while a nuclear scan showed increased activity in both kidneys . renal biopsy established the diagnosis of diffuse metastatic infiltration of both kidneys from primary lung adenocarcinoma . her renal function worsened despite initiation of chemotherapy . carcinomatous infiltration of the kidneys is an extremely rare and unusual cause of renal injury that must be suspected in a patient with cancer and large kidneys ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in the united states , prostate cancer is the second cause of cancer death after lung and bronchus in all ages of men ( 1 ) . in iran , prostate cancer is reportedly the third most commonly diagnosed visceral cancer , accounting for almost 7.75 % of new cancer cases , and is the seventh result of cancer death . according to iran cancer report , the incidence rate of prostate cancer in tehran is more than other provinces , about 16.65 % - 26.35 % ( 3 ) . for high resistance of apoptosis in the androgen - independence of prostate cancerthe current therapy ( radiotherapy or cytotoxic chemotherapies ) may have influence on patient condition , but these cures have significant side effects . over 7,000 species of plants grow in iran among which 1000 are estimated to have medicinal effects . the presence of various climatic conditions and ecological factors provide an environment in which numerous varieties of plants grow in different regions of the country ( 5 ) . the psitacia atlantica sub kurdica from anacardiaceae family , with the local name of bane grows in iran ( 6 ) . cytotoxic effect on breast cancer cell line and inhibition growth in leukemia cell line have been seen in nuts of semecarpusanacardium ( 7 ) . the studies indicated , same genuses of bane have death properties and antiproliferative effect on some tumors . despite many reports that are about chemo - preventive effect of the same genus of bane , there are not any reports about the effects of atlantica sub kurdica on prostate cancer cell line , so we decided to evaluate the cytotoxic effect of ethanol bane skin extract on prostate cancer cell line . fresh unripe fruit from p. atlanticakurdica was collected from ilam province , iran . the fruits skin were dried and powdered by using the mechanical grinder .10 g of dried plant was saturated in mixture of 50 ml h2o and 50 ml ethanol 100 % for 48 hours in the absence of heat . the mixture was shaken to gain the extract and filtered through filter paper and finally the filtrate was evaporated in vacuum evaporator and stored at 4c . the 1 g powder of the bane was dissolved in 2 ml pbs and then filter sterilized . for preparing different concentrationthis stock was diluted with rpmi 1640 complete culture medium pc3 ( human prostate cancer cell lines ) and l929 ( mouse fibroblast cell line ) were acquired from pasture institute ( tehran , iran ) and cells were grown in rpmi 1640 supplemented with 5 ml of penicillin - streptomycin and 10 % fetal bovine serum and in a humidified incubator containing 5 % co2 . cytotoxic effects of the ethanol bane skin extract on pc3 cells were analyzed by colorimetric mtt assay . mosmann introduced the colorimetric mtt assay and then this method was modified . a total 5000pc - 3 ( human prostate cancer cell lines ) and5000l929 ( mouse fibroblast cell line ) from cell lines were cultured in 96 - well plates . to 180 l aliquots in four replicates of the cells seeded in 96 - well , 20 l aliquots of different concentrationswere added to each of the wells to makeup the final bane extract concentrations of 0.78 , 1.5 , 3.13 , 6.25 , 12.5 mg / ml . plates were incubated in a humidified 5 % co2 atmosphere , and after 24 hours , the growth medium was removed and washed with phosphate buffered solution ( pbs ) . after that , 180 l growths medium and 20 l of 3 - ( 4,5 - dimethyl thiazol -2-yl ) - 2,5 diphenyl tetrazolium bromide ( mtt ) solution were added for each well , then incubated for 4 hours . after removing the growth medium and shaking microplates for 2 to 3 minutes , dissolvation of crystals in 200 l of pbs was achieved . the absorbance of formosan dye was recorded by an elisa plate reader at 570 nm . pc3 cells were cultured and incubated in 6 well plates at the situation described as noted before . the cells were faced with the ethanol bane skin extract , then they were stained with 10 % giemsa and finally washed with phosphate buffered solution ( pbs ) . statistical processing of the data was performed by spss v. 20 , using two - way anova . for detecting the point of difference , the post hoc testfresh unripe fruit from p. atlanticakurdica was collected from ilam province , iran . the fruits skin were dried and powdered by using the mechanical grinder .10 g of dried plant was saturated in mixture of 50 ml h2o and 50 ml ethanol 100 % for 48 hours in the absence of heat . the mixture was shaken to gain the extract and filtered through filter paper and finally the filtrate was evaporated in vacuum evaporator and stored at 4c . the 1 g powder of the bane was dissolved in 2 ml pbs and then filter sterilized . for preparing different concentrationpc3 ( human prostate cancer cell lines ) and l929 ( mouse fibroblast cell line ) were acquired from pasture institute ( tehran , iran ) and cells were grown in rpmi 1640 supplemented with 5 ml of penicillin - streptomycin and 10 % fetal bovine serum and in a humidified incubator containing 5 % co2 . cytotoxic effects of the ethanol bane skin extract on pc3 cells were analyzed by colorimetric mtt assay . mosmann introduced the colorimetric mtt assay and then this method was modified . a total 5000pc - 3 ( human prostate cancer cell lines ) and5000l929 ( mouse fibroblast cell line ) from cell lines were cultured in 96 - well plates . to 180 l aliquots in four replicates of the cells seeded in 96 - well , 20 l aliquots of different concentrationswere added to each of the wells to makeup the final bane extract concentrations of 0.78 , 1.5 , 3.13 , 6.25 , 12.5 mg / ml . plates were incubated in a humidified 5 % co2 atmosphere , and after 24 hours , the growth medium was removed and washed with phosphate buffered solution ( pbs ) . after that , 180 l growths medium and 20 l of 3 - ( 4,5 - dimethyl thiazol -2-yl ) - 2,5 diphenyl tetrazolium bromide ( mtt ) solution were added for each well , then incubated for 4 hours . after removing the growth medium and shaking microplates for 2 to 3 minutes , dissolvation of crystals in 200 l of pbs was achieved . the absorbance of formosan dye was recorded by an elisa plate reader at 570 nm . pc3 cells were cultured and incubated in 6 well plates at the situation described as noted before . the cells were faced with the ethanol bane skin extract , then they were stained with 10 % giemsa and finally washed with phosphate buffered solution ( pbs ) . statistical processing of the data was performed by spss v. 20 , using two - way anova . for detecting the point of difference , the post hoc testthe efficacy of the ethanol bane skin extract on the viability of cells ( pc3 and l929 ) were measured by mtt assay after 24 , 48 , 72 hours with the ethanol bane skin extract concretions 0.78 , 1.5 , 3.13 , 6.25 , 12.5 mg / ml . data analysis showed there is a good correlation among the ethanol bane skin extract concentration and the time of exposing pc3 cells to the ethanol bane skin extract and cell viability on pc3cells during this study ( p 0.001 ) . as shown in figure 1 , by increasing concentration of the ethanol bane skin extract and time of exposing pc3 cells to the ethanol bane skin extract , the cell viability reduced . the ic50 ( half inhibitory concentration ) for the ethanol bane skin extract on pc3 cells was 2.8 mg / ml after 48 , but a different manner was seen on l929 cells . after 24 hours , no significant difference was seen in cell population between the control group and l929 cells exposed to the ethanol bane skin extract in 0.78 , 1.5 , 3.13 mg / ml concentrations . the ic50 of the ethanol bane skin extract on l929 cells after 48 hours was 6.1 mg / ml . it means that cytotoxic of ethanol bane skin extract on pc3 cells is more than l929 cells ( figure 2 ) , and also the researchers did not see a significant difference between cytotoxic effect of the ethanol bane skin extract on l929 cells after 48 and 72 hours . the pc3 cells were exposed to the bane extract ( 0.78 , 1.5 , 3.13 , 6.25 , 12.5 mg / ml ) for 24 , 48 , 72 and cytotoxicity was determined using mtt assay . detecting delete the bane extract induction of apoptosis , morphological changes of the pc3 cells were examined . after staying pc3 cells whit giemsa , examined morphological changes of the pc3 cells under a microscope and compared whit control group . considerable morphological changes were observed in contrast with the morphology of the control cells ( such as apoptotic bodies and condensed dna ) ( figure 3 ) . a , normal control pc3 cells ; b , pc3 cells treated with 3.13 mg / ml bane extract ; c , pc3 cells treated with 6.25 mg / ml bane extract . for detecting delete the bane extract induction of apoptosis , morphological changes of the pc3 cells were examined . after staying pc3 cells whit giemsa , examined morphological changes of the pc3 cells under a microscope and compared whit control group . considerable morphological changes were observed in contrast with the morphology of the control cells ( such as apoptotic bodies and condensed dna ) ( figure 3 ) . a , normal control pc3 cells ; b , pc3 cells treated with 3.13 mg / ml bane extract ; c , pc3 cells treated with 6.25 mg / ml bane extract . according to world health organization ( who ) , 65 % - 80 % of the world population take traditional medicine to cure various diseases ( 8 ) . it is estimated increasing androgen - independent prostate cancer may be for resisting apoptosis . this issue is along with survival of cells within metastatic or primary tumors and increased proliferation ( 9 ) . researchers revealed that a major problem with cancer therapy was lack of specificity of the treatments for this kind of cells ( 10 ) . nowadays natural products and secondary metabolites act as good sources for treating coronary heart diseases , cancer , diabetes and infectious diseases in human ( 11 ) . many studies and experimentsshow that consumption of vegetables and fruits can reduce the risk of human cancer ( 12 ) . natural product can act as apoptosis inducer , so these products whit deleting precancerous cells can reduce cancer incidence ( 13 ) . mixture of phytochemicals can be more effective than single constituents because of synergistic interactions ( 15 ) . the pistacia have 15 species but only three species including pistaciavera l. , pistacia khinjuk stocks and pistacia atlantica desf have been seen in iran . these species have many applications in the field of folk medicine and also have been used in the therapy of throat infection , eczema , asthma and renal stone . likewise , these have many uses as anti - inflammatory , antibacterial , stimulant , antiviral , astringent , antipyretic and pectoral ( 16 ) . the efficacy of gum mastic of p. lentiscus in lncap prostate cancer cells has powerful inhibitory effect on expression and function of androgen receptor ( 7 ) . death inducing and anti - proliferative properties have been seen in human colon carcinoma when the cancer cells are exposed to p. lentiscus l. balan ( 17 ) repressed nf - kb activity , blocked cell cycle in the g1 phase , reduced expression of cyclin d1 in androgen - independent prostate cancer cells have reported as gum mastic of p. lentiscus properties ( 18 ) . iin prostate cancer cells , gum mastic of p. lentiscus has a rise in adjustment of mrna and protein levels of tumor suppressor ( 19 ) . studies showed that skin extract of bane is powerful than doxorubicin in some molecular ways and also induce apoptosis in in t47d cells ( 20 ) . it is supposed that anticancer activity of bane extract can have considerable amounts of polyphenolic compounds , flavonoids and anthocyanins ( 20 ) . another study shows that polyphenol rich extract of bane in ht29 cells has apoptosis induction , growth inhibition , and cell cycle arrest properties ( 21 ) . in the present study , for the first time , the researchers examined the cytotoxic effects of the ethanol bane skin extract on pc3 cell line . the study reported that the ethanol bane skin extract induced cytotoxicity in pc - 3 cells and reduction of cell viability showed a time - and dose - dependent pattern and has less cytotoxic effect on l929 cells as normal cells than pc3 cells . based on the morphological changes from our study , it was shown that the ethanol bane skin extract induced the apoptosis in pc3 cells . bane skin maybe a good candidate for the management of prostate cancer . for definitive conclusion , in vivo studies are required .\noutput:\n" }, { "from": "agent", "value": "background : it is extensively supposed that vegetarian diet could affect cancer progress and increase the influence of formal chemotherapy.objectives : the present study was designed to determine the effect of the ethanol bane skin extract against chemo resistant prostate cancer pc3 cells.materials and methods : pc3 and l929 cells were cultivated and then incubated in the ethanol bane skin extract with various concentrations of 0.78 , 1.5 , 3.13 , 6.25 , 12.5 mg / ml in 3 times 24 , 48 , 72 hours . cytotoxic effect of the ethanol bane skin extract on pc3 and l929 cells was examined by mtt assay after 24 , 48 , and 72 hours . morphology of pc3 cells was evaluated by gimsa staining.results : the ethanol bane skin extract inhibited proliferation and caused cell death with ic50 values of 2.8 mg / ml on pc3 cells and the ic50 was 6.1 mg / ml on l929 cells . morphological changes and apoptotic bodies were observed in pc3 cells faced with the ethanol bane skin extract by staining with gimsa.conclusions : the ethanol bane skin extract could repress the growth of pc3 cell line . this inhibitory effect of the bane extract depended on the dose and the time on pc3 . the result of this study shows that the ethanol bane skin extract includes photochemical and inhibitory function against proliferation and inducer of apoptosis in human prostate cancer pc3 cells and also has less cytotoxic effect on l929 than pc3 cells . the ethanol bane skin extract might be a good candidate for the new herbal anticancer drug ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: each eukaryotic mrna encoding a protein is usually associated with only one open reading frame ( herein called reference orf ) or coding sequence ( cds ) delineated by a start codon ( most of the time aug ) and a stop codon , required to initiate and end translation , respectively . this simplistic view is however being challenged by the existence of at least two mechanisms resulting in increased protein diversity . in - frame alternative translation initiation ( ati ) at downstream aug codons allows the production of truncated protein isoforms with new functions or localization and is a well - characterized mechanism in eukaryotes ( 1,2 ) . out - of - frame ati at the start codon of alternative orfs ( altorfs ) in the two other reading frames is a second mechanism producing proteins with an amino acid equence completely different from the reference protein . the + 1 reading frame is determined by the coding sequence of the reference orf for each transcript ( independently of the gene or transcript ) . hence , the annotated reference orf is defined as frame + 1 , and there are two possible frames for altorfs : frame + 2 and frame + 3 . the presence of overlapping orfs and the use of out - of - frame ati are well described in viruses ( 46 ) and provide small viral genomes with an increased coding capacity . in addition , a database referencing putative alternative orfs in many prokaryotic genomes already exists ( 7 ) . the role of out - of - frame ati in eukaryotes has been overlooked . yet , there is some evidence that proteins derived from altorfs can affect physiological as well as pathological aspects of gene function . this is the case for the alternative protein alex encoded in the gnas gene ( 8,9 ) . in addition , we recently discovered the endogenous expression in human of an alternative protein product termed altprp which orf ( +3 reading frame ) partially overlaps with the prion protein cds ( figure 1 ) ( 10 ) . four other examples exist in human ( 1114 ) , which correspond to peptides that are targeted by anti - tumor responses in several types of cancers , and may thus serve as biomarkers or therapeutic targets ( 15 ) . interestingly , these altorfs are all but one included within the reference orf ( 11 ) . this observation is critical since the expression of cdnas composed solely of the cds in experimental systems such as cultured cells may actually result in the expression of more than one protein ( 10 ) . consequently , co - expression of an alternative protein together with the reference protein in functional studies likely result in unnoticed confounding results . a database containing a list of all human mrnas containing altorfs overlapping with the reference orf is important to identify potential genes with multiple cds . figure 1altprp , a typical example of altorfs in the haltorf database . all mrnas produced from the prnp gene have the same reference orf ( nt 1762 , gray box ) which encodes the prion protein ( prp ) in the + 1 reading frame . an altorf ( white box ) is present in the + 3 reading frame ( nt 90309 ) . similar to all altorfs present in the database , the alternative prion protein ( altprp ) encoding altorf is entirely included in the cds of the reference protein , and encodes a protein longer than 24 amino acids ( minimum size threshold ) . additionally , its aug codon is in a different reading frame than the reference protein , and is located in an optimal kozak context ( shown in bold ; consensus : a / gnnaugg ) . altprp , a typical example of altorfs in the haltorf database . all mrnas produced from the prnp gene have the same reference orf ( nt 1762 , gray box ) which encodes the prion protein ( prp ) in the + 1 reading frame . an altorf ( white box ) is present in the + 3 reading frame ( nt 90309 ) . similar to all altorfs present in the database , the alternative prion protein ( altprp ) encoding altorf is entirely included in the cds of the reference protein , and encodes a protein longer than 24 amino acids ( minimum size threshold ) . additionally , its aug codon is in a different reading frame than the reference protein , and is located in an optimal kozak context ( shown in bold ; consensus : a / gnnaugg ) . to our knowledge , three bioinformatics genome - wide studies aiming at the identification of altorfs in mammals have been performed previously ( 1618 ) . however , none of them provided an online searchable option with links to genbank and ncbi databases for further investigation . in one study , criteria such as conservation among species and a minimum length of 500 bp for the predicted altorfs were used and only 40 putatively expressed altorfs were referenced ( 16 ) . in a more recent study , 138 potential dual coding transcripts were identified in human ( 18 ) . in another study , a filter of a minimal length of 150 bp was applied and 1793 altorfs were found to be conserved among rat , mouse and human ( 17 ) . when the 1793 human altorfs were filtered for the presence of an optimal kozak context around the initiator aug codon , known to be extremely important for efficient initiation of translation ( 19 ) , this number dropped to 217 putative altorfs . one objective of these three studies was to predict high confidence candidate altorfs , and the highly stringent criteria used were extremely pertinent in this matter . however , they were unsuccessful in predicting the expression of two experimentally proven altorfs , altprp and alex . for all these reasons , it is obvious that a less stringent and potentially more comprehensive large scale bioinformatics analysis of altorfs in the human transcriptome and a publicly available and searchable online database of predicted altorfs are lacking . human alternative open reading frames ( haltorf ; http://haltorf.roucoulab.com/ ) is the first web - based searchable database that allows thorough investigation in the human transcriptome of altorfs overlapping with annotated cds , and putatively expressed by out - of - frame ati . it is also the first large scale study on the human transcriptome to successfully predict the expression of altprp and alex , two experimentally discovered out - of - frame ati protein products . haltorf will be a useful tool for the identification of genes containing multiple cds in human , and will help to better define and understand the complexity of the human proteome . the haltorf database was built using a pipeline of perl scripts that populate a mysql database . all genbank human mrna and protein entries ( release 37 ) were downloaded from the ncbi website ( http://www.ncbi.nlm.nih.gov/ ) , and each mrna was associated with its reference protein . for each mrna , in silico translation of the full sequence was performed using the transeq software ( 20 ) , and subsequent comparison of the results with the amino acid sequence of the reference protein allowed to map the translation start and stop sites coordinates of the reference orf on its corresponding mrna . the sequence 5 of the translation start site of the reference orf was then deleted . this action set the reading frame associated with the reference orf in each mrna to + 1 . all translation results equal to or above 24 amino acids , regardless of the reading frame , were stored in the database along with their start and stop sites coordinates . the arbitrary threshold of 24 amino acids was selected to reduce the database to an acceptable size , since we ( data not shown ) and other groups ( 16,17 ) noticed that the numbers of predicted altorfs increases as the size threshold decreases . additionally , the validation of the expression of smaller peptides by standard techniques , such as sds page and western blots , would be technically too challenging . next , based on a simplified consensus kozak sequence ( a / gnnatgg ) known to be favorable for efficient translation initiation ( 19 ) , we determined for each predicted orf start site if it was located in a strong ( perfect fit to the consensus ) or weak ( any other sequence ) kozak context . the last step was to select , in the cds of each mrna , the putative altorfs that are the most likely to be expressed . to do so , we filtered the database using the following criteria : ( i ) orfs had to be in the + 2 or + 3 reading frames to be selected , thus storing altorfs , which are currently absent from existing protein databases ; ( ii ) the predicted altorfs had to possess a strong kozak context around their aug codon , to increase the chance of efficient translation initiation ; ( iii ) the stop site of the altorfs had to be located prior to the stop site of the reference orfs , thus removing orfs that are not entirely contained within the cds of the reference protein . more details on the construction of the database are available on the haltorf website . for a typical example of altorfs found in this new database ( figure 1 ) . we identified 17096 distinct predicted altorfs in the cds of 31422 mrnas ( 41.2 % of total human mrnas ) transcribed from 8744 genes ( 42.5 % of total human genes ) . a total of 14195 ( 83 % ) are located in the + 2 reading frame and 2901 ( 17 % ) are located in the + 3 reading frame . for each altorf , the gene name and accession number of the mrna in which it is encoded are provided . other information can also be found , including the reference protein produced from the corresponding mrna , the coordinates of the start and stop codon of both the reference orf and the alternative orf in the mrna , and the predicted length and amino acid sequence of the alternative protein . the haltorf database ( http://haltorf.roucoulab.com/ ) can be searched by gene name or symbol , by mrna or protein genbank accession number , and by protein sequence ( with a minimum of 5 amino acids ) . detailed explanations on how to perform a search and how results are displayed are available on the website under the documentation tab . the search results are summarized in a table containing information for each retrieved altorf , including the gene symbol , mrna and reference protein accession numbers , reading frames , the location of the reference and alternative orfs on the mrna sequence , and the alternative protein length ( figure 2 ) . the nucleotide numbers indicating the location of the orfs are the first nucleotide of the start codon , and the first nucleotide of the stop codon , respectively . if multiple transcript variants exist for a given gene , all variants containing an alternative orf are listed . if a search by protein sequence is performed , the table includes a supplementary column displaying part of the alternative protein sequence matching the query sequence . for each retrieved alternative orf , a detailed result page is accessible through a link and provides the user with basic information concerning the reference mrna and protein . links to the ncbi website are also provided to help the user retrieve supplementary information on the gene , mrna and reference protein associated with the altorf . the detailed result page also contains an alignment section where the reference and alternative protein sequences are aligned on the reference mrna sequence ( figure 2 ) . the complete haltorf database can be freely downloaded in microsoft excel or fasta format under the download tab . the complete mysql data dump is also available in this section , thus providing developers with the possibility to predict other altorfs using different parameters such as the length of altorfs for example . ( 1 ) search by gene ( defb104a , which encodes the - defensin 104 protein ) . ( 2 ) the number of corresponding altorfs is indicated , and details on each altorf are summarized in a table . although this is not the case for this particular example , note that for a single gene , all altorfs present in each transcript variants would be listed . the reference orf is by definition in the + 1 frame , and the alternative orfs is in the + 2 frame in this example . the nucleotide numbers indicating the location of the orfs are the first nucleotide of the start codon , and the first nucleotide of the stop codon , respectively . ( 3 ) a detailed result page is available for each altorf through the view link . ( 4 ) in the detailed result page , basic information on the gene and mrna of origin as well as the associated reference protein are displayed along with links to genbank for each of these items ( not shown ) . an alignment of the reference ( blue letters ) and alternative ( green letters ) protein sequences on the reference mrna sequence ( black letters ) is provided . ( 1 ) search by gene ( defb104a , which encodes the - defensin 104 protein ) . ( 2 ) the number of corresponding altorfs is indicated , and details on each altorf are summarized in a table . although this is not the case for this particular example , note that for a single gene , all altorfs present in each transcript variants would be listed . the reference orf is by definition in the + 1 frame , and the alternative orfs is in the + 2 frame in this example . the nucleotide numbers indicating the location of the orfs are the first nucleotide of the start codon , and the first nucleotide of the stop codon , respectively . ( 3 ) a detailed result page is available for each altorf through the view link . ( 4 ) in the detailed result page , basic information on the gene and mrna of origin as well as the associated reference protein are displayed along with links to genbank for each of these items ( not shown ) . an alignment of the reference ( blue letters ) and alternative ( green letters ) protein sequences on the reference mrna sequence ( black letters ) is provided . the number of predicted altorfs present in haltorf is much greater when compared to other studies ( 1618 ) . , we used a lower cut - off for the size of altorfs , and chose not to consider criteria such as conservation among species and specific codon usage . however , in our approach , we have established several limits , including aug initiation codons located in an optimal kozak context . expression from aug codons in the absence of an optimal kozak sequence or from non - traditional cug sites ( 21,22 ) is also possible and may be included in further studies . nevertheless , the reduced stringency of our approach resulted in the successful prediction of altprp and alex , two experimentally well - characterized out - of - frame ati products . it is likely that at least one of the several functions previously attributed to the prion protein is actually catalyzed by altprp ( 10 ) , and we expect that some paradoxical experimental results regarding the function of other genes might be explained by multiple coding as well . this example highlights the fact that conservation along evolution of an alternative orf is not necessary to be biologically relevant since the initiation codon for altprp is present in higher order mammals but not in lower mammals , including rodents ( 10 ) . in addition , the presence of alex in haltorf , for which polymorphisms have been associated with inherited neurological problems and increased trauma - related bleeding tendency ( 9 ) , indicates that haltorf could be valuable for the identification of biologically important altorfs in human genes with multiple cds . last but not least , the complete database may help mass spectrometry services to identify the great proportion of unknown peptides in their data sets which can not be currently matched to any protein in existing databases . altogether , haltorf will help in the meticulous exploration of this potential alternative proteome which has been largely overlooked to date . x.r . is a senior research scholar from the fonds de la recherche en sant du qubec . funding for open access charge : the canadian institutes for health research [ grant number mop - 89881 ] .\noutput:\n" }, { "from": "agent", "value": "human alternative open reading frames ( haltorf ) is a publicly available and searchable online database referencing putative products of out - of - frame alternative translation initiation ( ati ) in human mrnas . out - of - frame ati is a process by which a single mrna encodes independent proteins , when distinct initiation codons located in different reading frames are recognized by a ribosome to initiate translation . this mechanism is largely used in viruses to increase the coding potential of small viral genomes . there is increasing evidence that out - of - frame ati is also used in eukaryotes , including human , and may contribute to the diversity of the human proteome . haltorf is the first web - based searchable database that allows thorough investigation in the human transcriptome of out - of - frame alternative open reading frames with a start codon located in a strong kozak context , and are thus the more likely to be expressed . it is also the first large scale study on the human transcriptome to successfully predict the expression of out - of - frame ati protein products that were previously discovered experimentally . haltorf will be a useful tool for the identification of human genes with multiple coding sequences , and will help to better define and understand the complexity of the human proteome.database url : http://haltorf.roucoulab.com/ ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: , it has become one of the most common diseases not only in the western world . diabetes comes along with an increase of diabetes complications , which lead to a loss of quality of life and finally to premature mortality . therefore , regular screening intervals for diabetic complications are essential . screening on a regular , usually yearly basis for diabetic neuro - and nephropathyconcerning diabetic changes of the ocular fundus , patients are often referred to an ophthalmologist , which requires a good network for exchange of relevant findings as well as possible arising consequences for adaption of diabetes therapy and control of other risk factors . the international diabetes federation ( idf ) guidelines recommend annual screenings for diabetic retinopathy ( dr ) and screening within 3 to 6 months in case of a deterioration of the eye fundus since the last examination . screening for drpersons who missed one or more years of retinopathy screening represent a high - risk group with a greater probability of having developed retinopathy in the meantime . the barriers to receive regular eye examinations are multifactorial and vary in different studies . lack of awareness of the effects of dr on visual acuity , the absence of an ophtalmologist , no possibility of transportation , long waiting time , and physical disability are some commonly reported barriers for not receiving regular eye care . since the increasing number of patients with diabetes worldwide will exceed ophthalmologists ' capacities , this problem is likely to worsen in the following years . diabetes is diagnosed more and more in people that are younger and still involved in working life processes with chronic lack of time , lack of long - term planning , and resistance to lifestyle changes . therefore , other screening requirements , for example , screening for dr through the general practitioner or the diabetologist , might improve patient care . in this study , we analyzed whether screening for dr in a specialized diabetes center might improve early diagnosis of dr . therefore , a nonmydriatic fundus camera was implemented in the diabetes outpatient clinic at the university hospital of heidelberg . nonmydriatic stereoscopic retinal imaging has been demonstrated to be a reliable , cost - effective , highly sensitive , and specific method for dr , which can be carried out safely by adequately trained nonophthalmologists . further nonmydriatic screening comes along with a higher level of comfort and is less time consuming , with a photography session taking no longer than 2 minutes , compared to mydriatic fundus screening , for which pupillary dilation alone takes additional 20 to 30 minutes . furthermore , after pupillary dilation patients are also decreased in visual function for several hours and consequently limited in means of transport . a total of 502 patients with type 1 or type 2 diabetes were included in this study over a time period of six months . patients were recruited from the outpatient clinic of the department of endocrinology at the university hospital of heidelberg , germany . eligibility criteria included patients with established diabetes mellitus type 1 or type 2 , age of 18 years or older , and the ability to cooperate . the following data were collected from each patient : age , duration of diabetes , type of treatment , associated systemic risk factors , and history of eye treatment or examinations in the past . this database was built up of utilizable evaluation scores , and preexisting medical reports from internal and external sources were used as source data . all 502 patients underwent single - field 45 - degree ( in smaller pupil diameter mode : 37 ) retinal photography with a nonmydriatic auto fundus camera ( nidek / oculus afc - 230/210 , nidek co. , ltd . , japan ) linked to a high resolution digital slr ( single lens reflex ) camera ( 21.8 megapixel full frame sensor , canon eos 5d mark ii , canon deutschland gmbh , krefeld , germany ) . the images were captured with central focus on the macula including the optic disk . they were stored and sorted through an incorporated data filing system , called navis - lite . , all images were taken by the same trained technician throughout the study . before commencing the study , the medical technician was instructed in using the camera and interpreting the retinal photographs , until he felt safe on carrying out the examination . studies verify that this way of screening correlates with a high level of accuracy . if the original image was judged unsatisfactory by the photographer , the image acquisition process was repeated . the maximum number of attempts in order to achieve a satisfactory picture was set to three . in totalthe trained technician and an ophthalmologist evaluated the fundus photographs separately by using a self - developed questionnaire as published previously . the severity of diabetic retinopathy was assessed after taking at least one meaningful retinal image of each eye with a nonmydriatic fundus camera . the presence or absence of diabetic retinopathy was determined at the end of every screening day . feedback on images and validation of the diagnosis drs was performed once weekly by an ophthalmologist with special interest in diabetic retinal disease . depending on the results , patients were differentiated into the two groups no retinopathy and retinopathy . within the retinopathy group , two categories preexisting retinopathy and new retinopathy were established . patients were then stratified according to the severity of retinopathy into mild , moderate , and severe nonproliferative retinopathy ( figures 1 ( a ) and 1 ( b ) ) , as well as into proliferative diabetic retinopathy and hypertensive retinopathy ( figures 1 ( c ) and 1 ( d ) ) . all patients were screened at the department within the last 12 months for diabetic neuro - or nephropathy . mg / l in two of three samples of morning urine obtained within twelve consecutive months . laboratory albumin concentration in spot urine was measured at the central laboratory of the university hospital of heidelberg . absence or presence of neuropathy was assessed using neuropathy symptom score ( nss ) and neuropathy disability score ( nds ) . hypertension was defined as present if systolic blood pressure was 140 mmhg and diastolic blood pressure was 90 mmhg or if the participant was taking antihypertensive drugs . blood pressure was measured in a sitting position from the left arm , using an electronic blood pressure cuff . plasma glucose , fasting serum total cholesterol , and ldl and hdl cholesterol , as well as triglycerides , urinary albumin , and creatinine were determined by enzymatic methods by the clinical laboratory of the university of heidelberg , which is fully accredited . comparisons of categorical baseline characteristics between the patients with dr and without dr were conducted by chi - square test analysis . all potential risk factors were analyzed as either binary ( e.g. , nicotine abuse yes / no ) or linear traits for continuous variables ( e.g. , age ) . logistic regression models were used to estimate odds ratios ( ors ) and 95 % confidence intervals ( cis ) for mean last eye screening within 12 months or longer than one year . the normally distributed data for descriptive analysis was declared as mean standard deviation , unless stated otherwise . since microvascular complications differ with respect to prevalence and incidence rates , the ratio of new to preexisting complications was built . it was assumed that the rates for dn and dp represent more or less the rate of natural progress , since both complications are screened on a regular basis in the study center . statistical significance level was considered at a two - side probability level of 0.05 or less . statistical analyses were performed using excel 2003 and spss ( pasw statistics 18 , ibm deutschland gmbh , ehningen , germany ) . the study was conducted as a cross - sectional , nonrandomized , noncontrolled , prospective study . overall , 502 nonrelated caucasian patients with type 1 ( n = 112 , 22.0 % ) and type 2 diabetes ( n = 390 , 78.0 % ) were included . when all patients with diabetes were analyzed , prevalence of dr was 25.0 % ( n = 126 ) . dr was present in 35.7 % ( n = 40 ) of type 1 diabetics and in 22.1 % ( n = 86 ) of participants with type 2 diabetes . the incidence rate for both types of diabetes was 6.4 % ( n = 32 ) with similar results for patients with type 1 ( 5.4 % , n = 6 ) and type 2 diabetes ( 6.7 % , n = 26 ) . therefore , 25.4 % ( n = 32 ) of all 126 drs were newly diagnosed and unknown before . in detail , of the 6 patients with type 1 diabetes and new dr , all ( 100.0 % , of the 26 patients with type 2 diabetes and new dr , 96.1 % ( n = 25 ) had nonproliferative diabetic retinopathy ( npdr ) , of which 84.6 % ( n = 22 ) had a mild form of npdr and 11.5 % ( n = 3 ) had a moderate form of npdr . furthermore , one patient ( 3.8 % ) with type 2 diabetes had proliferative diabetic retinopathy ( pdr ) . additionally , signs for associated hypertensive retinopathy were found in 43.4 % ( n = 218 ) of all patients being present in 22.3 % ( n = 25 ) of the patients with type 1 diabetes and 49.5 % ( n = 193 ) of the patients with type 2 diabetes . in both types of diabetesthe presence of hypertensive retinopathy correlated with blood pressure and the taking of blood pressure lowering medications ( p 0.001 ) . next , patients with newly detected dr were characterized : patients with type 1 diabetes and new onset dr had significantly higher systolic and diastolic blood pressure , positive history of cerebrovascular disease , and significantly higher total and ldl cholesterol levels and were more likely to have microalbuminuria ( table 2 ) in comparison to patients without dr . patients with type 2 diabetes and new onset of dr had a significant longer duration of diabetes , positive history of preexisting neuropathy , diabetic foot syndrome , and significantly higher hemoglobin a1c levels ( table 3 ) . prevalence of nephropathy was 32.5 % ( n = 163 ) in all diabetics . in patients with type 1 diabetes 17.9 % ( n = 20 ) were affected , whereas 36.7 % ( n = 143 ) of patients with type 2 diabetes had dn . in total , 17.8 % ( n = 29 ) of all nephropathies ( n = 163 ) were newly diagnosed revealing an incidence rate of 3.6 % ( n = 4 ) in participants with type 1 diabetes and 6.4 % ( n = 25 ) in participants with type 2 diabetes . the prevalence of any dp in both types of diabetes combined was 63.5 % with 37.5 % ( n = 42 ) in participants with type 1 and 71.0 % ( n = 277 ) in participants with type 2 diabetes .16.6 % ( n = 53 ) of all neuropathies ( n = 319 ) were newly diagnosed . the incidence rate was 2.7 % ( n = 3 ) in participants with type 1 diabetes and 12.8 % ( n = 50 ) in participants with type 2 diabetes . as described above , 32 drs were newly detected by using a nonmydriatic fundus camera with onsite screening . since prevalence of all three microvascular complications is different due to underlying pathogenesis , progression rates were calculated ( table 4 ) . however , since the time point of the last evaluation of the complications was not standardized and not comparable in the analysed patients , progression rates used here do not refer to a distinct time period but to new onset since the last examination . while progression rates for dn and dp were 21.6 % and 19.9 % , respectively , rate was higher for dr ( dn versus dr : 21.6 % versus 34.0 % ; p = 0.12 ; dp versus dr : 19.9 % versus 34.0 % ; p = 0.03 ) , suggesting that more drs were detected than expected due to progress of disease . finally factors contributing to the diagnosis of new dr were analyzed . since the number of patients with type 1 diabetes was rather small and characteristics for patients with type 1 and type 2 diabetes were different , only patients with type 2 diabetesinterestingly , younger age was found to be a risk factor for nonattendance of regular retinopathy screening intervals ( p = 0.01 , table 5 ) . however , the time period since last eye screening was only significantly longer in type 2 diabetics with newly described dr compared to those with preexistent dr ( tables 2 and 3 ) , although the proportion of patients with no yearly screening was significantly higher in patients with newly diagnosed dr ( established dr versus new diagnosed dr : 4.3 % versus 15.6 % ; p = 0.03 ) . overall , 67 ( 13.3 % ) participants did not attend eye screening within the last 12 months . while younger age and shorter diabetes duration were associated with a higher probability for missing regular screening visits , gender had no influence ( table 5 ) . when comparing patients at the age of 50 years or younger with patients older than 50 years , the younger age group had a higher proportion with missed yearly screenings ( age 50 years versus age 50 years : 28.9 % versus 13.6 % ; p = 0.008 ) . since preexisting dr could have influenced attendance rates especially in the older age group , rates of missed yearly eye screenings with and without preexisting retinopathy were analyzed . however , the results remain unchanged ( age 50 years versus age 50 years : 32.6 % versus 16.9 % ; p = 0.02 ) . the results of the study show that onsite screening for dr with a nonmydriatic , digital fundus camera can contribute to early diagnosis of diabetic retinopathy in a diabetes outpatient clinic . in 32 of the analyzed patients , diabetic changes of the retinawere newly described , which represents a proportion of 25 % of all retinopathies detected in this study . one part of those can be seen as natural progress since the last screening visit . nevertheless , the other proportion represents so far missed complications , which have been detected due to the changed screening process with onsite fundus screening . in order to separate these two proportions , progression rates for dr , dn , and dpsince dn and dp were screened on a regular basis at the study center , one can assume that all newly detected dns and dps represent the natural progress of the disease . since 94 drs were preexistent before the study one would expect 19 newly detected drs due to the natural progress . since32 drs were described which were unknown before , at least 13 are likely to be detected due to the new onsite retinopathy screening procedure . this number is rather underestimated due to the fact that underlying progression rate derives from dn and dp which have been shown to progress faster than dr does . the prevalence of dr presented here is in line with current literature . in a recent meta - analysis of population - based studies worldwide , an overall estimate for dr of 35 % was reported . however , this analysis comprises also rather rural areas and countries with lower developed health care systems , which might explain the slightly higher prevalence compared to our results . in contrast , a lower prevalence of 10.6 % for dr has been previously reported from german data , which could be explained by a shorter diabetes duration in that study population compared to the study presented . one might argue that for diabetic retinopathy screening an ophthalmologist is essential and digital fundus imaging alone might not be sufficient . however , recent studies comparing nonophthalmologists with ophthalmologists for the diagnosis of dr have shown similar accuracy in the detection of changes of the fundus even with paramedical staff performing the screening procedure . evaluation of the fundus photography by a reference ophthalmologist revealed that no change of diagnoses of dr categories was necessary ( data not shown ) . furthermore , several studies have evaluated the sensitivity and specificity of digital fundus screening , showing that instant fundus screening by trained nonophthalmologists was accurate and safe in the detection of dr . however , since the number of detected drs in this study is clearly higher than preexistent drs , it seems unlikely that a remarkable proportion of patients with dr might have been missed in the study although this can not be fully excluded , since stereoscopic colour fundus photographs as gold standard were not used in this evaluation . when analysing factors contributing to the detection of new dr , younger patients ' age and shorter diabetes duration were associated with nonattendance of regular screenings and with higher incidence of dr . this is in line with previously reported data showing lower screening attendance rates in younger patients with diabetes . therefore , we speculate that especially younger patients might benefit from an onsite complications screening including dr since this is time saving and convenient for quickly updating the state of disease and its microvascular complications . however , there are also some limitations to this study . first , since only outpatients were included at a university hospital clinic , participants might not reflect the general diabetes population , which might differ in age and diabetes duration . therefore , the rate of missed dr might differ , making generalization of the results difficult . additionally the study was performed in an area with a higher density of ophthalmologists than the mean of the country . one can speculate that the results observed here might even be more pronounced when density of ophthalmologists is lower , potentially making this screening procedure even more important in other regions , especially in rural areas . as hypertension is a major systemic risk factor for diabetic retinopathy a certain influence on our results can not be fully excluded and the results might not be so prominent in populations with a lower rate of hypertension . however , rates for arterial hypertension found in our study are comparable to those found in other studies from different regions of the world with hypertension rates up to 95 % in patients with diabetes . furthermore , as data on screening intervals was collected via patient 's self - reports and medical data records , a bias of social desirability is possible . little is known concerning the effect of onsite screening with a nonmydriatic fundus camera in specialized diabetes outpatient clinics on early diagnosis of dr . the data presented imply that on the one hand this might result in an earlier diagnosis of complications . on the other hand one might speculate that it vice versa might also affect treatment quality and therapy goals , which have been shown to lower the progression of disease . in this study , mean hba1c levels of patients with newly detected retinopathy were off guideline - implemented target with 8.0 % ( 64 mmol / mol ) in patients with diabetes type 1 and 8.4 % ( 68 mmol / mol ) in patients with diabetes type 2 . therefore , further studies have to evaluate the effect of onsite screening on subsequent quality of diabetes treatment when state of complications is immediately known . in conclusion , the results of this study suggest that onsite screening for diabetic retinopathy with a nonmydriatic digital fundus camera in a diabetes outpatient clinic detects missed diabetic retinopathies in a higher degree than by progression of the disease alone . due to the epidemic burden of diabetes early identification of patients at risk might help to save time and resources and channel patients with a strong need for specialized eye care especially in younger patients who might profit from time saving diabetes care .\noutput:\n" }, { "from": "agent", "value": "objective . to evaluate the effect of onsite screening with a nonmydriatic , digital fundus camera for diabetic retinopathy ( dr ) at a diabetes outpatient clinic . research design and methods . this cross - sectional study included 502 patients , 112 with type 1 and 390 with type 2 diabetes . patients attended screenings for microvascular complications , including diabetic nephropathy ( dn ) , diabetic polyneuropathy ( dp ) , and dr . single - field retinal imaging with a digital , nonmydriatic fundus camera was used to assess dr . prevalence and incidence of microvascular complications were analyzed and the ratio of newly diagnosed to preexisting complications for all entities was calculated in order to differentiate natural progress from missed drs . results . for both types of diabetes , prevalence of dr was 25.0 % ( n = 126 ) and incidence 6.4 % ( n = 32 ) ( t1 dm versus t2 dm : prevalence : 35.7 % versus 22.1 % , incidence 5.4 % versus 6.7 % ) . 25.4 % of all drs were newly diagnosed . furthermore , the ratio of newly diagnosed to preexisting dr was higher than those for dn ( p = 0.12 ) and dp ( p = 0.03 ) representing at least 13 patients with missed dr . conclusions . the results indicate that implementing nonmydriatic , digital fundus imaging in a diabetes outpatient clinic can contribute to improved early diagnosis of diabetic retinopathy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: dental caries is the single most common biofilm dependent oral infectious disease worldwide that results from the interaction of specific bacterial and salivary constituents with dietary carbohydrates in a biofilm tightly adherent on the tooth surface . dental caries is most likely the result of a polymicrobial infection caused by one or more of the over 500 bacterial species that have been identified from the human oral cavity . it is apparent that as in many natural microbial communities , a large proportion of the microbes present in the mouth have not yet been cultured . advanced molecular methods such as polymerase chain reaction ( pcr ) and 16s rrna gene sequencing analysis have revealed that the bacterial involvement in the development of dental caries is more complex than previously believed . streptococcus mutans is known as the principal dental pathogen associated with caries ; with an ability to synthesize glucan from sucrose as its most important virulent factor . glucan synthesis allows the bacteria to firmly attach to the tooth surface and form a biofilm ; whereas the gelatinous nature of glucan retards diffusion of acid produced by the bacteria from fermentable sugars in the dental plaque . cell to surface interactions play an enormous role in initial cell colonization , and cell to cell protein interactions largely mediate the growth and continued existence of biofilm . the bacterial communities within a biofilm are of particular medical importance due to their increased tolerance to antibiotics . novel strategies based on detailed understanding of the biofilm formation mechanisms are therefore an important issue . atomic force microscopy ( afm ) is an advanced technology that offers great advantages in mapping of biological samples such as bacterial biofilms and observation of biofilm growth in their natural complex environment . the aim of present study is to characterize the surface topography of the biofilm formed by a new bacterial isolate obtained from dental caries lesion , using afm . ethical approval for the study was granted by the internal research and review board ( irb ) , ethical clearance ( ec ) , biosafety and animal welfare committee at madurai kamaraj university , madurai . five adult patients elected to have extractions for unrestored teeth ( due to chronic periodontitis ) that presented with large coronal dentine caries lesions which , by macroscopic examination , had not penetrated to the underlying vital pulp tissue ; participated with their informed consent . the samples were excavated with sterile , spoon excavator and collected at a level that represented the middle of the dentine lesion . five dentinal caries samples were taken and transported to the laboratory and subjected to further analysis . lesion samples were serially diluted in sterile milliq water and inoculated on brain heart infusion ( bhi ) agar medium ( himedia ) supplemented with 5 % sucrose , incubated at 37c in 5 % co2 for 18 - 36 h. ten clinical isolates were obtained from five dentinal caries samples and were designated as jkas - cd1 to jkas - cd10 [ cd : culture dependent ] . the isolates were differentiated based on their colony morphology , hemolysis on blood agar medium with and without 5 % sucrose and biochemical characteristics . the clinical isolates were grown on bhi broth with and without 5 % sucrose , incubated overnight in microtiter plates at 37c under 5 % co2 . experiments were performed in triplicates and the heat - killed escherichia coli cells were used as control . the clinical isolate showing maximum biofilm formationprotocol with minor modifications ; integrity of the isolated dna was analysed on 0.8 % agarose gel . using a universal primer set [ 27f 5 - aga gtt tga tcc tgg ctc ag - 3 and 1492r 5 - ggt tac ctt gtt acg act t - 3 ] synthesized commercially [ sigma genosys , india ] ; pcr amplification of 16srrna gene was performed in a total volume of 50 l reaction mixture containing 1x reaction buffer ( 10 mm tris [ ph 8.3 ] , 50 mm kcl , 1.5 mm mgcl2 ) , 200 m dntps , 0.05 units taq dna polymerase [ sigma , usa ] , 0.5 m of each primer and 1 ng template dna . the thermal cycling conditions were : 5 min at 94c for initial denaturation ; 31 cycles of 30 s at 95c , 1 min 30 s at 54c , 2 min at 72c , and a final extension for 5 min at 72c . the amplification reaction was performed with a thermal cycler ( mycycler , bio - rad , usa ) and the pcr amplicons were resolved by electrophoresis in 1 % ( w / v ) agarose gel to confirm the expected size ( 1500 bp ) of the product . the pcr product was purified by qiaquick pcr purification kit ( qiagen , usa ) and cloned into pgem - t easy vector ( promega , usa ) . the recombinant plasmid was isolated from positive clones , purified with qiaprep plasmid purification kit ( qiagen , usa ) and sequenced with applied biosystems 3730xl dna analyzer using bigdye terminator v3 .1 cycle sequencing kit ( applied biosystems , usa ) . phylogenetic analysis was performed by rdp - ii database , clustalw , by the neighbor - joining method . the phylogenetic tree was analyzed using phylip 3.68 , with dnadist , neighbor using bootstrapping over 1000 replicates , and maximum - likelihood analysis was performed with dnaml of phylip 3.68 . the 16s rrna gene sequence of the selected isolate was deposited in the genbank nucleotide database under the accession number ( jx548342 ) . enamel was powdered by polishing action from caries unaffected region of extracted teeth using sterile , fine diamond bur . enamel powder was dissolved in 500 l milliq water and sterilized by autoclaving . to visualize the biofilm formation of the selected isolate by afm ; the glass cover slips were cleaned by sonication and immersed in piranha solution ( conc . h2so4 and 30 % h2o2 in a ratio of 3:1 ) for 15 min followed by washing thrice with sterile milliq water and drying in the vacuum desiccator . cover slips were uniformly coated with 20 l sterile enamel powder solution with necessary nutrients supplied as 20 l bhi broth . the experimental samples were designed as follow : enamel + bhi broth + selected isolate bacterial cells , incubated at 37c for 6 , 12 and 24 henamel + bhi broth + selected isolate bacterial cells supplemented with 5 % sucrose , incubated at 37c for 6 , 12 and 24 h. enamel + bhi broth + selected isolate bacterial cells , incubated at 37c for 6 , 12 and 24 h enamel + bhi broth + selected isolate bacterial cells supplemented with 5 % sucrose , incubated at 37c for 6 , 12 and 24 h. bacterial cells at logarithmic growth phase , grown in bhi broth were centrifuged at 5000 rpm for 10 min at 4c and the cell pellets were washed thrice with distilled water and re - suspended up to 10 dilution in sterile distilled water . the experimental samples were inoculated with 5 l of 10 diluted bacterial cells and incubated at 37c . after incubation , the cover slips were gently washed thrice with sterile distilled water to remove the unbound cells from the surface and air - dried for 12 h. to observe bacterial cells of selected isolate by afm , 5 l of 10 diluted bacterial cells were deposited onto a freshly cleaned glass cover slips and air dried for 12 h. afm analysis of the bacterial cells and its biofilm topography on the enamel powder coated glass surface was performed using an a100 - sgs atomic force microscope ( a.p.e research , italy ) . the silicon etched ultrasharp cantilever ( mikromasch , usa ) with a spring constant of 40 nm and 10 nm radius was used to obtain non - contact images at 1 hz scan rate . ethical approval for the study was granted by the internal research and review board ( irb ) , ethical clearance ( ec ) , biosafety and animal welfare committee at madurai kamaraj university , madurai . five adult patients elected to have extractions for unrestored teeth ( due to chronic periodontitis ) that presented with large coronal dentine caries lesions which , by macroscopic examination , had not penetrated to the underlying vital pulp tissue ; participated with their informed consent . the samples were excavated with sterile , spoon excavator and collected at a level that represented the middle of the dentine lesion . five dentinal caries samples were taken and transported to the laboratory and subjected to further analysis . lesion samples were serially diluted in sterile milliq water and inoculated on brain heart infusion ( bhi ) agar medium ( himedia ) supplemented with 5 % sucrose , incubated at 37c in 5 % co2 for 18 - 36 h. ten clinical isolates were obtained from five dentinal caries samples and were designated as jkas - cd1 to jkas - cd10 [ cd : culture dependent ] . the isolates were differentiated based on their colony morphology , hemolysis on blood agar medium with and without 5 % sucrose and biochemical characteristics . the clinical isolates were grown on bhi broth with and without 5 % sucrose , incubated overnight in microtiter plates at 37c under 5 % co2 . the biofilm development was determined spectrophotometrically by measuring the absorbance at 590 nm . experiments were performed in triplicates and the heat - killed escherichia coli cells were used as control . the clinical isolate showing maximum biofilm formationprotocol with minor modifications ; integrity of the isolated dna was analysed on 0.8 % agarose gel . using a universal primer set [ 27f 5 - aga gtt tga tcc tgg ctc ag - 3 and 1492r 5 - ggt tac ctt gtt acg act t - 3 ] synthesized commercially [ sigma genosys , india ] ; pcr amplification of 16srrna gene was performed in a total volume of 50 l reaction mixture containing 1x reaction buffer ( 10 mm tris [ ph 8.3 ] , 50 mm kcl , 1.5 mm mgcl2 ) , 200 m dntps , 0.05 units taq dna polymerase [ sigma , usa ] , 0.5 m of each primer and 1 ng template dna . the thermal cycling conditions were : 5 min at 94c for initial denaturation ; 31 cycles of 30 s at 95c , 1 min 30 s at 54c , 2 min at 72c , and a final extension for 5 min at 72c . the amplification reaction was performed with a thermal cycler ( mycycler , bio - rad , usa ) and the pcr amplicons were resolved by electrophoresis in 1 % ( w / v ) agarose gel to confirm the expected size ( 1500 bp ) of the product . the pcr product was purified by qiaquick pcr purification kit ( qiagen , usa ) and cloned into pgem - t easy vector ( promega , usa ) . the recombinant plasmid was isolated from positive clones , purified with qiaprep plasmid purification kit ( qiagen , usa ) and sequenced with applied biosystems 3730xl dna analyzer using bigdye terminator v3 .1 cycle sequencing kit ( applied biosystems , usa ) . phylogenetic analysis was performed by rdp - ii database , clustalw , by the neighbor - joining method . the phylogenetic tree was analyzed using phylip 3.68 , with dnadist , neighbor using bootstrapping over 1000 replicates , and maximum - likelihood analysis was performed with dnaml of phylip 3.68 . the 16s rrna gene sequence of the selected isolate was deposited in the genbank nucleotide database under the accession number ( jx548342 ) . enamel was powdered by polishing action from caries unaffected region of extracted teeth using sterile , fine diamond bur . enamel powder was dissolved in 500 l milliq water and sterilized by autoclaving . to visualize the biofilm formation of the selected isolate by afm ; the glass cover slips were cleaned by sonication and immersed in piranha solution ( conc . h2so4 and 30 % h2o2 in a ratio of 3:1 ) for 15 min followed by washing thrice with sterile milliq water and drying in the vacuum desiccator . cover slips were uniformly coated with 20 l sterile enamel powder solution with necessary nutrients supplied as 20 l bhi broth . the experimental samples were designed as follow : enamel + bhi broth + selected isolate bacterial cells , incubated at 37c for 6 , 12 and 24 henamel + bhi broth + selected isolate bacterial cells supplemented with 5 % sucrose , incubated at 37c for 6 , 12 and 24 h. enamel + bhi broth + selected isolate bacterial cells , incubated at 37c for 6 , 12 and 24 h enamel + bhi broth + selected isolate bacterial cells supplemented with 5 % sucrose , incubated at 37c for 6 , 12 and 24 h. bacterial cells at logarithmic growth phase , grown in bhi broth were centrifuged at 5000 rpm for 10 min at 4c and the cell pellets were washed thrice with distilled water and re - suspended up to 10 dilution in sterile distilled water . the experimental samples were inoculated with 5 l of 10 diluted bacterial cells and incubated at 37c . after incubation , the cover slips were gently washed thrice with sterile distilled water to remove the unbound cells from the surface and air - dried for 12 h. to observe bacterial cells of selected isolate by afm , 5 l of 10 diluted bacterial cells were deposited onto a freshly cleaned glass cover slips and air dried for 12 h. afm analysis of the bacterial cells and its biofilm topography on the enamel powder coated glass surface was performed using an a100 - sgs atomic force microscope ( a.p.e research , italy ) . the silicon etched ultrasharp cantilever ( mikromasch , usa ) with a spring constant of 40 nm and 10 nm radius was used to obtain non - contact images at 1 hz scan rate . the clinical isolates inoculated on bhi agar medium exhibited different colony morphological features . the results of hemolysis revealed that jkas - cd1 jkas - cd3 to cd6 , jkas - cd9 and jkas - cd10 exhibited gamma hemolysis both on blood agar medium with and without sucrose . jkas - cd2 and jkas - cd8 exhibited alpha - hemolysis both on blood agar medium with and without sucrose ; while jkas - cd7 exhibited alpha - hemolysis on blood agar medium with sucrose and gamma hemolysis on blood agar without sucrose . jkas - cd2 , cd7 , cd8 and cd6 displayed more biofilm forming ability when compared to others in the decreasing order [ figure 1 ] . based on these results , the clinical isolate jkas - cd2 was selected for the phylogenetic analysis and subjected to afm for the topographic analysis of the biofilm formed by the same . [ the absorbance of the eluted stain measured at 590 nm up to 30 h at 3 h interval . the values were depicted as mean values of independent triplicate experiments and the error bars represent the standard error of the mean for each absorbance value ] the size of the 16s rrna gene sequence of carious lesion derived bacterial isolate jkas - cd2 was 1508 bp with the g + c content of 52.38 % . nucleotide similarity searches revealed that the bacterial isolate belongs to the phylum firmicutes and also displayed the highest similarity to 16s rrna gene sequences of members of the family streptococcaceae . phylogenetic analysis of 16s rrna gene sequences of jkas - cd2 showed that it shared 95.3 % to 99.3 % similarity to the type strains of recognized species of the genus streptococcus and its closely related type strain was streptococcus infantarius with 99.9 % sequence similarity [ figure 2 ] . phylogenetic tree view of 16s rrna gene of bacterial isolate jkas - cd2 based on neighbor - joining method . bootstrap values 50 % were shown at each node and expressed as percentages of 1000 replications . [ scale bar represents 0.01 substitutions per nucleotide ] afm image analysis indicated that the enamel coating was almost uniform over the glass surface [ figure 3a and b ] and jkas - cd2 cells exhibited colony morphology as individual and small chains in cocci form ( 0.25 - 0.4 m diameter ) [ figure 4a and b ] . ( a ) 2 - dimensional atomic force microscopy images depicting the surface characteristics of enamel powder suspension coated glass cover slip . ( b ) 3 - dimensional afm images depicting the surface characteristics of enamel powder suspension coated glass cover slip ( a ) 2 - dimensional atomic force microscopy images depicting colony morphological characteristics of jkas - cd2 ( bacterial cells seen as individual and small chains in cocci form ) . ( b ) 3 - dimensional afm images depicting colony morphological characteristics of jkas - cd2 ( bacterial cells seen as individual and small chains in cocci form ) after 6 h incubation , sucrose dependent biofilm formation on the glass cover slip coated with enamel was observed as initial small clusters of colonies ; in comparison to scarcely distributed cells on the surface of the enamel under sucrose independent conditions . the number of colony forming units was more in case of sucrose mediated biofilm with significant distribution of larger clusters of cells . under sucrose dependent conditions , the microbial colonies adhered and were seen embedded in the glucan , as the biofilm attained 12 h growth [ figure 5a and b ] . while , more number of bacterial colonies appeared to be exposed outside in sucrose independent biofilm . further , the shape of jkas - cd2 cells did not undergo any significant difference as the biofilm attained maturity under both sucrose dependent and sucrose independent conditions . following 24 h incubation , the texture and roughness of the biofilm formed by jkas - cd2 under sucrose dependent condition ( biofilm topography height 104 nm ) [ figure 6a and b ] was ~ 3 fold higher than that formed under sucrose independent condition ( biofilm topography height 37 nm ) [ figure 7a and b ] . ( a ) 2 - dimensional atomic force microscopy images of sucrose dependent biofilm formed by jkas - cd2 cells . following 12 h incubation , the microbial colonies adhered and seen embedded in the glucan produced . ( b ) 3 - dimensional afm images of sucrose dependent biofilm formed by jkas - cd2 cells . following 12 h incubation , the microbial colonies adhered and seen embedded in the glucan produced ( a ) 2 - dimensional atomic force microscopy images showing sucrose - dependent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 104 nm ] ( b ) 3 - dimensional afm images showing sucrose - dependent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 104 nm ] ( a ) 2 - dimensional atomic force microscopy images showing sucrose - independent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 37 nm ] . ( b ) 3 - dimensional afm images showing sucrose - independent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 37 nm ] the size of the 16s rrna gene sequence of carious lesion derived bacterial isolate jkas - cd2 was 1508 bp with the g + c content of 52.38 % . nucleotide similarity searches revealed that the bacterial isolate belongs to the phylum firmicutes and also displayed the highest similarity to 16s rrna gene sequences of members of the family streptococcaceae . phylogenetic analysis of 16s rrna gene sequences of jkas - cd2 showed that it shared 95.3 % to 99.3 % similarity to the type strains of recognized species of the genus streptococcus and its closely related type strain was streptococcus infantarius with 99.9 % sequence similarity [ figure 2 ] . phylogenetic tree view of 16s rrna gene of bacterial isolate jkas - cd2 based on neighbor - joining method . bootstrap values 50 % were shown at each node and expressed as percentages of 1000 replications . afm image analysis indicated that the enamel coating was almost uniform over the glass surface [ figure 3a and b ] and jkas - cd2 cells exhibited colony morphology as individual and small chains in cocci form ( 0.25 - 0.4 m diameter ) [ figure 4a and b ] . ( a ) 2 - dimensional atomic force microscopy images depicting the surface characteristics of enamel powder suspension coated glass cover slip . ( b ) 3 - dimensional afm images depicting the surface characteristics of enamel powder suspension coated glass cover slip ( a ) 2 - dimensional atomic force microscopy images depicting colony morphological characteristics of jkas - cd2 ( bacterial cells seen as individual and small chains in cocci form ) . ( b ) 3 - dimensional afm images depicting colony morphological characteristics of jkas - cd2 ( bacterial cells seen as individual and small chains in cocci form ) after 6 h incubation , sucrose dependent biofilm formation on the glass cover slip coated with enamel was observed as initial small clusters of colonies ; in comparison to scarcely distributed cells on the surface of the enamel under sucrose independent conditions . the number of colony forming units was more in case of sucrose mediated biofilm with significant distribution of larger clusters of cells . under sucrose dependent conditions , the microbial colonies adhered and were seen embedded in the glucan , as the biofilm attained 12 h growth [ figure 5a and b ] . while , more number of bacterial colonies appeared to be exposed outside in sucrose independent biofilm . further , the shape of jkas - cd2 cells did not undergo any significant difference as the biofilm attained maturity under both sucrose dependent and sucrose independent conditions . following 24 h incubation , the texture and roughness of the biofilm formed by jkas - cd2 under sucrose dependent condition ( biofilm topography height 104 nm ) [ figure 6a and b ] was ~ 3 fold higher than that formed under sucrose independent condition ( biofilm topography height 37 nm ) [ figure 7a and b ] . ( a ) 2 - dimensional atomic force microscopy images of sucrose dependent biofilm formed by jkas - cd2 cells . following 12 h incubation , the microbial colonies adhered and seen embedded in the glucan produced . ( b ) 3 - dimensional afm images of sucrose dependent biofilm formed by jkas - cd2 cells . following 12 h incubation , the microbial colonies adhered and seen embedded in the glucan produced ( a ) 2 - dimensional atomic force microscopy images showing sucrose - dependent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 104 nm ] ( b ) 3 - dimensional afm images showing sucrose - dependent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 104 nm ] ( a ) 2 - dimensional atomic force microscopy images showing sucrose - independent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 37 nm ] . ( b ) 3 - dimensional afm images showing sucrose - independent - biofilm formed by jkas - cd2 cells following 24 h incubation [ biofilm topography height : 37 nm ] with the advent of molecular methods based on the recent well established technique of pcr , cloning , and sequencing of 16s rrna genes , many hitherto unknown aspects of the oral microbiome have been revealed . another aspect of this pioneering method is that , as the 16s rrna gene is approximately 1550 bases in length , it could be surmised that more sensitive and specific information on taxonomical lineage and bacterial diversity might be obtained through analyzing longer lengths of sequences in comparison to the bacterial identification based on the sequence data of relatively shorter segments of 300 - 400 bases . molecular methods involving sequencing have proved invaluable in the taxonomy to determine phylogenetic relationship between the known and the newly recognized microorganisms aiding in taxonomic rearrangement and the creation of new species , thus further increasing the microbial diversity .16 s rrna gene sequence analysis revealed that jkas - cd2 formed a distinct subclade closer to the streptococcus infantarius , indicating that this isolate is closely related at the 16s rrna gene sequence level but not to any previously described taxa of other species of streptococcus represented in the phylogenetic tree . the other closely related lineages of streptococcus clustered in the phylogenetic tree were reported from dairy products , human blood and endocarditis , suggesting that the closely related lineages of jkas - cd2 are present in different environment . infantarius exhibits no exopolysaccharide ( eps ) production on 5 % sucrose medium ; shows acid production from lactose , maltose and sucrose and is urease negative . in spite of the 16s rrna gene sequence identity to the nearest type strain s. infantarius subsp . infantarius , the jkas - cd2 exhibited phenotypic differences such as eps production on 5 % sucrose medium , but lack acid production from lactose and maltose . therefore , the isolate jkas - cd2 obtained from the dentinal caries lesion seems to be distinct and diverged significantly from the members of the s. infantarius , and thus could represent a new species of the genus streptococcus . s. mutans can metabolize the major form of cariogenic food sucrose to produce ( 13 ) and ( 16 ) glucosidic polymers and forms a plaque on the surfaces such as glass , plastic and tooth enamel . the selected bacterial isolate jkas - cd2 also utilized sucrose to synthesize the eps to form glucan aided enhanced biofilm slime layer . as in the case for many other streptococci bacteria inhabiting the oral cavity such as s. gordonii , s. mitis , s. mutans and s. sanguis , the isolate jkas - cd2 emerged as an obligate plaque forming microbe under sucrose - dependent condition . biofilm formation leads to increased tolerance to antibiotics and antimicrobial peptides and more persistent infections due to their special physiology and physical matrix barrier . the microtiter plate assay , being a rapid and simple method , can be used to screen difference in biofilm formation between bacterial strains . in view of this advantagethe advantage of imaging dry samples is a better resolution than for bacteria examined in aqueous media . in the present study , the bacterial morphology and surface topography of the formed biofilm was imaged under dry conditions . afm images were collected at a very slow scan rate of 1 hz , in order to obtain the details and to avoid damaging the tip . tapping mode imagingwas selected for the procedure , as it is a more sophisticated type of measurement . such imaging is recommended for more sensitive samples , which could be damaged during the tip - rastering process . another advantage of tapping mode imaging is the possibility to collect height , amplitude , and phase type data . in the present study , the topography of slime layer exhibited fully embedded bacterial colonies and suggests that such a biofilm prevents antimicrobials and xenobiotics from gaining access to the cells inside the biofilm , thus protecting the bacterial cells . further , the results observed by spectroscopic absorbance of bound crystal violet to the bacterial cells on polystyrene surface over the time course experiment was in close agreement with biofilm topography observed by afm imaging . as adherence is a key ecological determinant for oral bacteria to survive and persist , microorganisms that can not form a biofilm are unable to adhere to a surface and washed out easily by the salivary flow . the biofilm forming ability of the isolate jkas - cd2 , as per the results of microtiter plate assay and afm analysis holds the mechanism for its adherence to glass surface coated with tooth enamel even after washing . however , although mutans streptococci are strongly implicated with caries , the association is not unique . indeed in such circumstances , some acidogenic , non - mutans streptococci are implicated with the disease , as seen in the present studyan understanding of the basis of bacterial community behavior points to therapeutic targets that may provide a means for the control of biofilm infections .\noutput:\n" }, { "from": "agent", "value": "background : dental plaque being one of the most - studied biofilm communities , is particularly complex because it consists of thousands of bacterial species , and new species are still being isolated and characterized . the aim of the present study is to characterize surface topography of the biofilm formed by a new bacterial isolate , obtained from the dental caries lesion using atomic force microscopy.materials and methods : ten clinical isolates were obtained from five teeth with carious lesions involving dentine . quantification of the biofilm forming ability of the clinical isolates was performed using microtiter plate assay . bacterial isolate exhibiting maximum biofilm formation was subjected to phylogenetic analysis based on 16s rrna gene sequencing and atomic force microscopic analysis.results : the bacterial strain jkas - cd2 displayed the highest similarity to 16s rrna gene sequences of members of the family streptococcaceae . it shared 95.3 - 99.3 % similarity to the type strains of genus streptococcus and 99.9 % sequence similarity to the type strain streptococcus infantarius . atomic force microscopic analysis confirmed that the sucrose dependent bacterial adhesion for stable biofilm development has increased over a time - span on the thin film of enamel . major structural components of plaque such as clumping of colonies and slime layer were clearly visualized by surface image of jkas - cd2 cells grown on the enamel powder coated glass surface.conclusion : jkas - cd2 emerged as an obligate biofilm forming microbe under sucrose - dependent condition ; a mechanism for adherence that determines the survival and persistence of the bacteria in the oral cavity and thus implicated with the dental caries ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: juxta - articular myxoma ( jam ) is a rare , benign , soft tissue tumour with accumulation of mucinous material usually in the vicinity of large joints ( 1 ) . we report a case of juxta - articular myxoma of the palm of the hand with imaging and histology for reference . a 63 - year - old right hand dominant male fire fighter presented to our outpatient clinic with a painless enlarging mass on the radial aspect of the base of his left index finger . physical examination showed a firm multi - loculated mass on the radial aspect of the index finger metacarpophalangeal joint extending towards the palmar surface . it was not fixed to the flexor or extensor tendons and was non - tender . axial t1 weighted mri image of the mass and overlying marker ( volar white circle ) coronal fat suppressed image of the mass depicted by the white arrow ultrasound scan prior to referral suggested a complex mass with solid and cystic components . mri scan demonstrated ( figure 1 and 2 ) the mass to be mixed fibrous and cystic components reported by a radiologist to be either fibromatosis or a desmoid tumour . a firm fibrous mass was found with pale coloured tissue with cystic spaces containing ganglion like jelly . the mass easily reflected off the subcutaneous dermis but deep was intimately related to the palmar fascia . histopathological analysis showed an irregular mass of fibrous tissue and pale mucoid material measuring 34 x 25 x 15 mm . stain , 20x magnification involvement of a tendon ( lower right corner ) by the myxoma . stain , 40x magnification sections of the lesion showed dense fibrous tissue with nodules of extracellular myxoid material containing scattered histiocytes and stellate to spindled fibroblastic cells . there was no evidence of necrosis , atypia or malignancy ; this was consistent with juxta - articular myxoma . there are 5 entities commonly accepted as myxomas : intramuscular myxoma , juxta articular myxoma , superficial angiomyxoma ( or cutaneous myxoma ) , aggressive angiomyxoma ( usually pelvic and perineal regions ) and myxoma of nerve sheath ( myxoid neurothekeoma ) . previously intramuscular , cutaneous and juxta - articular myxomas have been regarded as one entity occurring in different locations . in a comprehensive review allen believes , due to the differing age and sex incidence , behaviour and pathological features myxoma is not a single entity ( 2 ) . it occurs more commonly in men in their 3 to 5 decades and is usually found around the knee ( 3,4 ) but cases have been reported around the shoulder ( 5 ) , elbow ( 6 ) , foot ( 7 ) and ankle ( 4 ) . it is not thought to be associated with any syndromes ( 2 ) . there is some debate as to whether they are reactive or neoplastic ( 4 ) . an association with trauma and osteoarthritis has been suggested but not proven ( 1 ) . clonal chromosomal changes have been described suggesting that at least some are neoplastic ( 8 ) . the most common presentation is of swelling or mass ( 57 % ) which may be painful ( 32 % ) ( 4 ) . initially they tend to occur in the subcutaneous adipose tissue and can be locally invasive into the joint capsule , tendons and skin ( 4 ) . there is a high recurrence rate ( 34 % ) with recurrences usually occurring within 18 months ( 4 ) . the tumour macroscopically is gelatinous or slimy , soft or friable and silvery / pearly white to yellow - tan in colour ( 4 ) . histologically jam are characterised by a richly myxoid matrix , a small number of spindle - shaped to plump fibroblast type cells and a poorly developed hypovascular pattern ( 2 ) . they are histologically almost identical to intramuscular myxomasbut typically have more cystic change ( 2,4 ) . intramuscular myxoma ( i m ) is a different clinical entity to jam in several ways . they are more common in women and tend to occur in the large muscles around the thigh and shoulder . they rarely demonstrate cystic change and have a very low recurrence rate ( 2,4 ) . multiple intramuscular myxomas are associated with mazabraud s syndrome and mccure - albright syndrome as well as mutations in arg201 in the gs gene ( 8 ) . keoshian ( 1964 ) described a case in a 62 yr old male labourer ( 10 ) . a 4 x 5.5 cm mass was found in the mid - palmar space surrounding but separate from the flexor tendons . the significance of the case was of the high recurrence rate with 7 attempts at excision before amputation was undertaken due to involvement of neurovascular and tendinous structures . fletcher described a recurrent myxoma in a 66 year old man involving the intermetacarpal space of the hand with minor recurrences over 15 years ( 9 ) . these cases are not clearly jam having no mention of close apposition to a joint and histologically not containing cystic or ganglionic components typical of jam . al - quattan in 1996 described a 1 cm myxoma arising from the dorsum of the little finger in a 40 year old woman that was adherent to skin ( 10 ) . he subsequently described an intramuscular myxoma of the adductor pollicis muscle in a 7 year old boy ( 10 ) . ozcanli in 2005 reported a case of jam of the wrist adjacent to flexor carpi radialis insertion mimicking a ganglion cyst in a 16 year old boy . the myxoma we describe most closely matches a juxta - articular myxoma near the index finger metacarpophalangeal joint . we believe this to be the first reported case of juxta - articular myxoma in the hand . at 12 month follow up there has been no local recurrence following marginal excision .\noutput:\n" }, { "from": "agent", "value": "we present a case of juxta - articular myxoma of the hand in a 63 - year - old man with an enlarging mass over the palmar radial aspect of the index metacarpophalangeal joint . usually seen in men , this benign soft tissue tumour is normally found around large joints . to our knowledge this is the first reported case in the hand ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: vibrio phage valkk3 was isolated from marine sediment of kota kinabalu , malaysia that was capable to lyse fish and human pathogen , vibrio alginolyticus atcc 17749 . the genome was extracted and purified using dneasy blood and tissue kit ( qiagen ) . the paired of 250 bp reads ( 2250,000 samples ) were generated and demultiplexed corresponding to the barcodes . the sequence assembly was performed using de novo assembly using velvet assembly software version 1.1 ( zerbino , european bioinformatics institute , uk ) . the assembly producing the lowest number of contigs with the largest n50 value was chosen for further assembly with a 30-fold sequence coverage into single contig . the complete contig sequence was subjected to blastn and the sequence was annotated using blast2go .1 ) showed that it belongs to the family of myoviridae . to the best of our knowledge , among the giant t4 - like phagesreported so far ( table 1 ) , the vibrio phage valkk3 is the only strain that can infect v. alginolyticus . the genome annotation analysis predicted 390 open reading frames which are numbered consecutively from orf1 to orf390 which represented 92.4 % of the total genome . the putative genes varied from 111 bp ( orf268 ) to 4200 bp ( orf349 ) . the protein function analysis showed that some cdss involve in repression of host gene synthesis ( orf197 , orf202 ) , defense system of own gene synthesis ( orf170 , orf176 , orf207 ) and quality control ( orf255 ) , dna synthesis ( orf61 , orf199 , orf367 , orf370 , orf241 , orf256 , orf381 ) , dna replication and recombination ( orf371 , orf372 , orf320 , orf178 , orf204 , orf106 , orf242 , orf257 ) , structural protein : the head ( orf281286 ) , tail ( orf287319 ) and tail fiber ( orf346349 ) , dna packaging protein ( orf289 , orf290 ) and host lysis protein ( orf304 ) . in this study , the putative functions of valkk3 genome only represent 15.6 % of the genes in the valkk3 . the other 84.4 % in the valkk3 are consisted of the genes which encoded proteins with unknown function or hypothetical proteins . the valkk3 is similar to the vibrio phage vh7d , bacteriophage kvp40 , vibrio phage phi - pp2 and vibrio phage nt - 1 ( table 1 ) . this assigns the valkk3 to the t4 - like phage genus of the myoviridae family which belongs to the giant vibriophage group , with even larger genome size . the blast search revealed that valkk3 was homologous to vibriophage that is known to infect some members of harveyi clade bacteria . it is also revealed that t4 - like phage is widely spread in the marine environment infecting different vibrio species . finally , an additional genome information of valkk3 is hoped to provide positive contributions to the study of vibrio bacteriophage . this complete genome sequence has been deposited at ddbj / embl / genbank under accession no . kp671755 .\noutput:\n" }, { "from": "agent", "value": "this paper describes the complete sequence of a giant lytic marine myophage , vibrio phage valkk3 that is specific to vibrio alginolyticus atcc 17749 . vibrio phage valkk3 was subjected to whole genome sequencing on miseq sequencing platform and annotated using blast2go . the complete sequence of valkk3 genome was deposited in dbbj / embl / genbank under accession number kp671755 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: work - related accidents with exposure to biological material among health professionals are a cause for concern in view of the harm they may cause to institutions and workers . although the risk of occupational contamination by infectious agents has been known since 1940 , the adoption of preventive measures against this contamination only gained strength after 1980 , due to the discovery of the existence of the hiv virus and the acquired immune deficiency syndrome epidemic . the restricted working space of the oral cavity , the possibility of unexpected movement of the patient , the routine use of sharp instruments , added to the direct manipulation of blood , saliva and secretions make the clinical dental care an unhealthy moment and propitious to the occurrence of percutaneous injuries , facilitating the transmission of pathogens by cross - infection such as hepatitis and hiv viruses . a study carried out in taiwan revealed that 23 % of dentists reported more than one injury with sharp instruments per week , mainly during clinical procedures ( 31 % ) or with needles ( 28 % ) . in brazil , the prevalence of accidents with needlestick and sharp instruments among dentistry students is 25.3 % . thus , this high prevalence , together with the fact that 52.4 % of dentists do not know the existence of occupational postexposure protocols , highlights the need to educate these professionals about the risks to which they are exposed , making occupational accidents less frequent . therefore , knowing the profile of work - related accidents with biological material can be the starting point for the elaboration and planning of measures to improve working conditions . in view of the above , the aim of this study was to describe the epidemiological profile of dentistry students of a public university , victims of accidents with needlestick and sharp instruments . data were collected at the university center for health biosafety ( uchb ) , department of dentistry , state university of paraba . uchb is a referral service for victims of accidents with sharp instruments , providing rapid testing , psychological support , and referral for prophylactic treatment , if necessary . a total of 137 medical records from january 2012 to november 2016 were analyzed , and information on the year of the accident , sex and age of the victim , time and place of occurrence ( clinic , laboratory , or purge ) , and the time interval between accident and search for care were collected . as inclusion criterion , the victim of accident should be undergraduate dentistry students and should have suffered an accident with sharp instruments during activities developed in the course . protocols of dentistry students who sought service for other types of accidents were excluded as were those involving students from other health - care courses , teachers , and other professionals . data were tabulated and descriptively analyzed ( absolute and percentage frequencies ) using the spss - statistical package for the social sciences - version 18.0 , ibm corp . , this study followed recommendations of resolution 466/12 of the national health council that regulates research with human beings in brazil and was approved by the university of paraba ethics research committee under protocol no . the occurrence of injuries with needlestick and sharp instruments involving students was 43.1 % ( n = 59 ) , with half in 2016 ( 50.9 % ) . the age of victims was ranged from 19 to 37 years , with a median of 23 years . there was a predominance of women ( 66.1 % ) and accidents were occurred mostly in the afternoon ( 54.4 % ) and in the internal environment of dental clinics ( 70.7 % ) [ table 1 ] . distribution of accidents with needlestick and sharp instruments according to year , sex , age , shift , and location of the accident . campina grande , paraiba , 2016 for 75 % of the victims , the time interval between the accident and the search for specialized care was up to 2 h [ table 2 ] . in the presence of some blood pathogens , injuries with sharp instruments can cause life - threatening infections and are therefore an important issue regarding the occupational safety of health - care workers . dentists are a part of a group at high risk of exposure to this type of accident , which is even more pronounced among dentistry students due to their few work experiences . even using basic precautions , dentists can be exposed to pathogens in the course of their work activities . to avoid transmission of cross - infection , some safety precautions should be taken , in addition to the vaccination and adequate compliance with postexposure protocols . dentists need caution both in patient management and in the handling of work instruments , especially in dealing with sharp instruments since injuries with needles and sharp instruments represent the highest occupational risk for contamination by pathogens transmissible by blood . although the underreporting of accidents with biological risk is a universal phenomenon among health professionals , this study showed an increase in the number of reports , with peak observed in the year 2016 ( 50.9 % ) . this fact can be explained by the adoption of a policy of awareness of risks during dental care and by educational and preventive actions developed by the specialized assistance service . therefore , this evolution in accident report may reflect a greater perception of future professionals regarding the need for basic and immediate care required after exposure , leading them to search for the service . the dentistry literature shows that the occurrence of accidents with needlestick and sharp instruments increases with advancing age . older ( experienced ) dentists are more easily injured , either due to the greater overload of activities or to the oversight with infection control procedures . in this study , educational institutions play a key role in student attitudes about the adoption of correct habits for the control of cross infection . therefore , there is a great need for more incisive biosafety awareness by students to acquire the perception of risk and build the capacity of protection , making them understand the need for care and caution in performing dental procedures , shaping them into safe clinical day - to - day behavior . a predominance of females ( 66.1 % ) among victims was observed , corroborating previous findings . however , there may have been underreporting of accidents by male students since as women are more cautious about their health and tend to have greater preventive self - care , they are possibly more attentive to the need to follow postexposure protocols and therefore cause a greater demand for the service . most of the accidents were reported to occur in the afternoon ( 54.4 % ) . when analyzing the curricular structure of the dentistry course , it was found that the afternoon period concentrates the greatest number of clinical disciplines , especially those whose procedures are more invasive , such as the practical activities of surgery . in addition , since the activities of the dentistry course are developed in two shifts , fatigue may have been an aggravating factor for the occurrence of accidents . the analysis of the environment in which accidents with needlestick and sharp instruments occurred showed that most ( 70.7 % ) were recorded in dental clinics . the risk for the occurrence of accidents during dental practice changes according to the work process , the specific care characteristics , the infrastructure , and the available resources . it is assumed that little practical experience and reduced clinical skills of students , added to the psycho - emotional factors , nervousness , anxiety , and pressure for being constantly evaluated , may have influenced the high number of case in this population . in addition , most curricula in dentistry schools involve clinical activities increasing the likelihood of accidents in this environment . a relevant finding of the present study was the high number of accidents recorded in the purge environment , a place where students perform the cleaning of instruments ( 29.3 % ) . it is assumed that the rush to complete this activity due to the high student demand associated with inattention or negligence in the use of appropriate personal protective equipment is responsible for the occurrence of accidents . therefore , this activity should be supervised by professionals , raising awareness , and training students . to achieve maximum efficacy , postexposure chemoprophylactic interventions need to be initiated as soon as possible after the accident , preferably within 2 h.when analyzing the time elapsed between the time of the accident and the demand for assistance , it was found that in most cases , the time ideally recommended was respected . nevertheless , the prevalence of individuals who delayed seeking postexposure care was still high . this condition is worrying since the results of preventive protocols become poorly effective as the time elapsed for its initiation extends . neglecting safety procedures by dentistry professionals and students are still common since over time they tend to forget and ignore protocols . dental professionals are unaware of the procedure that must be followed in the occurrence of a biohazard accident . studies with dentistry students in brazil have shown that a low number of students who reported of having suffered accidents with sharp instruments sought guidance from teachers or the accident department of the institution . thus , it was observed that the understanding of dentistry professionals about accidents with biological risk and their preventive measures is inadequate . the knowledge about the pathogenesis of microorganisms , personal experience with accidents in the workplace , and the level of knowledge about their prevention can lead to changes in attitudes and practices , with greater precaution and less risk , thus influencing the reduction of these events . accidents with needlestick and sharp instruments can be avoided by cautious manipulation of these instruments , protection of drills and needles , and proper disposal of needles , which should not be bent , broken , or handled without the use of gloves . when they occur , accidents should be treated as a medical emergency , and prophylactic interventions should be initiated within 2 h from the occurrence to obtain greater preventive success . prevention is the main and most effective measure to avoid the occupational transmission of diseases in dental practice . considering that the preventive practices of dentistry students need to be improved . periodic training and the presence of a permanent educational project with emphasis on prevention , awareness , and follow - up of occupational accident cases should be a part of the routine of dentistry schools . in addition , focusing on means to instigate positive preventive practices among dentistry students should be considered as one of the main goals to be achieved by educational institutions , which is a subject that needs to be approached with priority . accidents with needlestick and sharp instruments had a high frequency and occurred mainly with female students and in the afternoon in the clinical setting , and the time interval between exposure and the search for care complied with brazilian recommendations .\noutput:\n" }, { "from": "agent", "value": "background : the occurrence of occupational accidents is common among students and dentists . the present study is aimed to evaluate the prevalence and characteristics of needlestick and sharp instrument injuries among dentistry students.materials and methods : a documentary research was carried out with data being obtained from the analysis of 137 medical records of injuries caused by needlestick and sharp instruments occurring in the period from 2012 to 2016 and were analyzed regarding the characteristics of the victim ( gender and age ) and the accident ( year , time , environment , and time interval between exposure and search for care ) . data were organized in the statistical package for social sciences software version 18 and were presented through descriptive statistics.results : the occurrence of accidents was high ( 43.1 % ) , with the predominance of female victims ( 66.1 % ) and aged up to 23 years ( 55.9 % ) . the majority of events occurred in the afternoon ( 54.4 % ) , in the clinical setting ( 70.7 % ) , and in 75 % of the cases , the search for care occurred within 2 h after exposure.conclusion : accidents with needlestick and sharp instruments have high frequency and involve mainly female students . they are more common in the afternoon and in the clinical setting and the time interval was between exposure and the search for care complied with recommendations of the brazilian legislation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the role of the thoracic surgeon in managing pulmonary tuberculosis has decreased remarkably since the advent of effective antimicrobial agents and better socioeconomic status . however , pneumonectomy or pleuropneumonectomy is still often required to treat complications of pulmonary tuberculosis such as destroyed lung , empyema , bronchopleural fistula ( bpf ) , or multidrug resistant ( mdr ) tuberculosis . solid pleural symphysis and dense fibro - vascular adhesion around the hilum result in intraoperative difficulties in pneumonectomy for inflammatory lung disease . also , the underlying disease of destroyed lung and a poor health status further worsen a patient 's outcome in the postoperative period . for these reasons , some surgeons have advised to be cautious when deciding whether to perform pneumonectomy [ 2 - 4 ] . however , recent studies have reported acceptably low mortality rates after pneumonectomy for chronic infections [ 5 - 9 ] . we retrospectively evaluated the patients who underwent pneumonectomy or pleuropneumonectomy for treating sequelae of pulmonary tuberculosis to determine the risk factors for early and long - term unfaroble outcomes . between january 1980 and december 2008 , 73 consecutive patients who underwent pneumonectomy due to destroyed lung caused by tuberculosis were retrospectively reviewed . preoperative data collection involved patient demographic data , medical and surgical histories , preoperative medications , presenting symptoms , chest roentgenogram , computed tomography , sputum smear and culture test for acid - fast bacilli , fiberoptic bronchoscopy , preoperative treatment modality , pulmonary function tests , and a quantitative pulmonary perfusion scan . predicted postoperative ( ppo ) forced expiratory volume in one second ( fev1 ) was calculated as follows : ppo fev1 = preoperative fev1contribution of contralateral lung . the patients were intubated with a double lumen endotracheal tube and placed in lateral decubitus position . in most casesan extrapleural approach ( pleuropneumonectomy ) was used when the pleural space was completely obliterated due to previous inflammation or empyema . a bronchial stump was stapled and reinforced with pericardial fat or parietal pleura . in some cases , however , reinforcement was omitted based on the choice of the surgeons . in case of spillage to some extent taking place despite careful dissection , copious saline or antiseptic solution irrigation was performed during operation . due to the chronic nature of the underlying diseases , in many instancestherefore , postoperative complications were included on either a 60 - day or in - hospital basis . the occurrence of complications requiring treatment ( postpneumonectomy empyema [ ppe ] , bpf , bleeding , vocal cord palsy , wound infection or wound deheiscence ) was investigated . the follow - up data were obtained from the outpatient clinic chart reviews or by telephone calls to the patients or their families . statistical analyses for any correlation between the risk factors and the occurrence of complications were performed with the chi - square test or fisher 's exact test . parametric variables were expressed as meanstandard deviation and non - parametric variables were expressed as frequency . a p - value less than 0.05 was considered to be statistically significant . the patients were intubated with a double lumen endotracheal tube and placed in lateral decubitus position . in most cases , surgery was performed through a posterolateral thoracotomy incision . an extrapleural approach ( pleuropneumonectomy ) was used when the pleural space was completely obliterated due to previous inflammation or empyema . a bronchial stump was stapled and reinforced with pericardial fat or parietal pleura . in some cases , however , reinforcement was omitted based on the choice of the surgeons . in case of spillage to some extent taking place despite careful dissection , copious saline or antiseptic solution irrigation was performed during operation . due to the chronic nature of the underlying diseases , in many instancestherefore , postoperative complications were included on either a 60 - day or in - hospital basis . the occurrence of complications requiring treatment ( postpneumonectomy empyema [ ppe ] , bpf , bleeding , vocal cord palsy , wound infection or wound deheiscence ) was investigated . the follow - up data were obtained from the outpatient clinic chart reviews or by telephone calls to the patients or their families . statistical analyses for any correlation between the risk factors and the occurrence of complications were performed with the chi - square test or fisher 's exact test . for survival analysis , parametric variables were expressed as meanstandard deviation and non - parametric variables were expressed as frequency . a p - value less than 0.05 was considered to be statistically significant . all statistical analyses were performed with the spss ver . 12.0 ( spss inc . , chicago , il , usa ) . due to the chronic nature of the underlying diseases , in many instances postoperative complications occurred later than 30 days . therefore , postoperative complications were included on either a 60 - day or in - hospital basis . the occurrence of complications requiring treatment ( postpneumonectomy empyema [ ppe ] , bpf , bleeding , vocal cord palsy , wound infection or wound deheiscence ) was investigated . the follow - up data were obtained from the outpatient clinic chart reviews or by telephone calls to the patients or their families . statistical analyses for any correlation between the risk factors and the occurrence of complications were performed with the chi - square test or fisher 's exact test . for survival analysis , parametric variables were expressed as meanstandard deviation and non - parametric variables were expressed as frequency . a p - value less than 0.05 was considered to be statistically significant . all statistical analyses were performed with the spss ver . 12.0 ( spss inc . , chicago , il , usa ) . out of 73 patients there were 25 women and 48 men with a mean age of 45.9 years ( range , 19 to 70 years ) . the patients usually presented with the clinical signs of chronic infection and destroyed lung including cough with sputum , a mild to moderate degree of exertional dyspnea , chest discomfort , fever , or hemoptysis . there were 46 patients with empyema ( 12 with bpf ) , 11 with aspergilloma , and 7 with mdr tuberculosis . sixty - one patients had a history of pulmonary tuberculosis , 28 patients were treated with anti - tuberculous drugs preoperatively , and 9 patients were treated with second line anti - tuberculous medication for pulmonary tuberculosis . the mean operation time was 282.688.2 minutes ( range , 135 to 590 minutes ) . twenty - four patients underwent right - side operation and 49 underwent left - side resection . the preoperative mean fev1 was 1.680.54 l / min ( range , 0.66 to 3.50 l / min ) and the mean ppo fev1 was 1.430.39 l / min ( range , 0.66 to 2.50 l / min ) ( table 1 ) . intraoperative spillage took place in 17 patients during operation in 51 cases ( 33.3 % ) . one patient had excessive bleeding due to a subclavian vessel injury and developed ventricular fibrillation that could not be corrected . one patient had intraoperative ventricular fibrillation and expired due to arrhythmia during the postoperative course . postoperative pneumonia and subsequent respiratory failure occurred in 3 patients . among 72 patients , excluding one intraoperative death , a total of 29 patients ( 40.3 % ) suffered from postoperative complications : 12 ( 16.7 % ) patients had ppe , 4 ( 5.6 % ) wound infections , 4 ( 5.6 % ) wound deheiscence , 7 ( 9.7 % ) postoperative bleeding requiring re - exploration , and 2 ( 2.8 % ) vocal cord palsy requiring arytenoid reduction . the prevalence of ppe increased in patients with preoperative empyema ( p = 0.04 ) ( table 3 ) . among 7 patients with ppe without bpf , 4 patients proceeded to undergo the clagett procedure successfully and 3 patients were discharged with open - tube drainage . sixty - eight patients were followed for a median of 96.7 months ( range , 6 to 353 months ) . the 5 - and 10 - year survival rates were 88.9 % and 76.2 % , respectively . the causes of late death were pneumonia or respiratory failure in 8 and cor pulmonale in 2 . the risk factors for late death were old age ( 50 years , p = 0.02 ) and low predicted postoperative fev1 ( 1.2 l , p = 0.02 ) ( fig . the present study shows that the mortality rate after pneumonectomy for pulmonary tuberculosis was acceptable considering the difficulties with the surgical technique and patients with poor health status . however , the postoperative complication rate ( 40.3 % ) was still high , the prevalence of ppe was higher in patients with preoperative empyema , and bpf was more common in right - side operation . compared with the high complication rate , pneumonectomy for a benign inflammatory lung disease has been considered a high - risk procedure [ 2 - 4 ] . in particular , pneumonectomy for pulmonary tuberculosis is riskier than for other inflammatory disease [ 5,10 - 12 ] . there are three main reasons why the complication rate increases after pneumonectomy in patients with tuberculosis . first , tuberculosis commonly occurs in individuals with poor general health status and the progression to destroyed lung worsens the general status of tuberculosis patients . second , preoperative empyema is much more commonly associated with tuberculosis than with other underlying diseases of destroyed lung . third , most patients with tuberculosis have an infected cavity in the parenchyma that attaches strictly to the upper part of the thoracic wall , and it is sometimes impossible to separate it without perforation . although pneumonectomy for tuberculosis has been considered a high - risk procedure , there are situations when pneumonectomy or pleuropneumonectomy remains the only curative treatment modality . those cases include destroyed lung , uncontrolled hemoptysis , main bronchial stenosis , mdr strain , and significant symptoms such as productive cough , or repetitive hospitalization . several authors have reported a 1.1 - 8.5 % operative mortality from pneumonectomy for inflammatory lung disease [ 2,6 - 9,13 ] . we experienced a 6.8 % early mortality , which was not statistically significant compared with the mortality ( 4.5 % ) of pneumonectomy for lung cancer during the same period at our institution ( p = 0.841 ) . the risk factors reported for these undesirable complications reported in the literature were the presence of preoperative empyema , aspergilloma , excessive blood loss , right - side operation , intraoperative spillage during operation , and re - exploration for hemorrhage . the current study revealed that the presence of preoperative empyema was a risk factor for the development of ppe . odell and henderson reported a ppe rate of 45.7 % when pneumonectomy through an empyema was performed . on the other hand , shiraishi et al . recommended pleuropneumonectomy for the treatment of empyema with destroyed lung and reported operative mortality rates of 8.5 % and ppe at 9.6 % with this procedure . however , our data shows a high ppe rate of 21.6 % in 51 pleuropneumonectomy patients . this result is thought to be due to an unrecognized intraoperative spillage due to the presence of preoperative empyema . due to the anatomical differences between the right and left main bronchi , destroyed lung occurs more frequently on the left side . in this series , 49 out of 73 ( 67.1 % ) however , bpf followed by pneumonectomy occured less frequently in left - side operations due to anatomical peculiarities . the right bronchial stump is more exposed in the pleural space and less likely to be naturally buttressed by mediastinal tissues than the left bronchial stump . this study also showed that there were 5 patients with bpf and 4 of these bpf occurred during right - side operation with statistical significance ( p = 0.023 ) . although there are a few papers that have reported long term survival rates after pneumonectomy for chronic inflammatory lung disease , the long - term survival rates in our series would seem to be satisfactory . reported a 5 - year survival rate of 83 % and kim et al . reported 5 - and 10 - year survival rates of 94 % and 88 % , respectivelypostoperative fev1 is known as a risk factor for early and long - term survival after pneumonectomy and predicted postoperative fev1 is correlated with actual postoperative fev1 . this study revealed that low predicted postoperative fev1 is the risk factor for long - term survival after pneumonectomy for tuberculosis and most patients died of pulmonary complications although some patients were lost to follow - up eventually . these results suggest that pulmonary complications related to impaired pulmonary function may lead to late death . therefore , continued surveillance should focus on prevention and early detection during the follow - up care of patients with low predicted postoperative fev1 , even if there are no early complications . second , we could not follow - up with some patients completely because we were short of regular surveillance 2 years after operation in the case of patients without postoperative complications . third , preoperative fev1 does not reflect the accurate postoperative fev1 , so a patient 's prognosis can be predicted more reliably by measuring postoperative fev1 . although postoperative empyema increases in patients with preoperative empyema and postoperative bpf increases in right - side operation , the mortality rates and long - term survival rates seem to be satisfactory . however , the follow - up care of patients with low postoperative predicted fev1 should continue for prevention and early detection of pulmonary complications related to impaired pulmonary function .\noutput:\n" }, { "from": "agent", "value": "backgroundpneumonectomy remains the ultimate curative treatment modality for destroyed lung caused by tuberculosis despite multiple risks involved in the procedure . we retrospectively evaluated patients who underwent pneumonectomy for treatment of sequelae of pulmonary tuberculosis to determine the risk factors of early and long - term outcomes.materials and methodsbetween january 1980 and december 2008 , pneumonectomy or pleuropneumonectomy was performed in 73 consecutive patients with destroyed lung caused by tuberculosis . there were 48 patients with empyema ( 12 with bronchopleural fistula [ bpf ] ) , 11 with aspergilloma and 7 with multidrug resistant tuberculosis.resultsthere were 5 operative mortalities ( 6.8 % ) . one patient had intraoperative uncontrolled arrhythmia , one had a postoperative cardiac arrest , and three had postoperative respiratory failure . a total of 29 patients ( 39.7 % ) suffered from postoperative complications . twelve patients ( 16.7 % ) were found to have postpneumonectomy empyema ( ppe ) , 4 patients had wound infections ( 5.6 % ) , and 7 patients required re - exploration due to postoperative bleeding ( 9.7 % ) . the prevalence of ppe increased in patients with preoperative empyema ( p = 0.019 ) . there were five patients with postoperative bpf , four of which occurred in right - side operation . the only risk factor for bpf was the right - side operation ( p = 0.023 ) . the 5 - and 10 - year survival rates were 88.9 % and 76.2 % , respectively . the risk factors for late deaths were old age ( 50 years , p = 0.02 ) and low predicted postoperative forced expiratory volume in one second ( fev1 ) ( < 1.2 l , p = 0.02 ) . conclusionalthough ppe increases in patients with preoperative empyema and postoperative bpf increases in right - side operation , the mortality rates and long - term survival rates were found to be satisfactory . however , the follow - up care for patients with low predicted postoperative fev1 should continue for prevention and early detection of pulmonary complication related to impaired pulmonary function ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: down syndrome ( ds ) , affecting one in 700 live births , is the most common genetic cause of mental retardation . the phenotype of ds is complex and variable in severity among individuals ; it includes mental retardation and cognitive deficits , heart defects , hypotonia , motor dysfunction , immune system deficiencies , an increased risk of leukemia , and development of the pathology of alzheimer 's disease . most commonly , ds is due to the presence of an extra copy of a complete chromosome 21 and it is assumed that the ds phenotypic features are a direct consequence of the overexpression of some number of genes contained within 21q ( 21p is largely made up of ribosomal rna genes and other repeat sequences ) . recently , the essentially complete sequence of 21q - 33.5 mb - was finished , and 225 genes were identified by the application of a variety of experimental and computer - based approaches . the availability of this massive amount of new data has immediate importance to ds research . this review discusses the following issues : the reliability of gene identification ; what is known or can be inferred about the biological function of the 225 identified genes ; expression patterns of the novel genes ; evolutionary conservation of , in particular , those genes lacking functional associations ; inferences about the gene content of the major mouse models of ds and therefore the causes of the phenotypic differences among them ; and reasonable next steps towards the goal of understanding the gene - phenotype relationships in ds . throughout the following discussions , references to numbers and kinds of genes and additional analyses of 21q gene contenttwo hundred and twenty - five is a surprisingly small number for the complete gene content of approximately 1 % of the human genome . it is significantly less than 1 % of the 50,000 - 100,000 genes previously estimated in total for the human genome ( see also ) and it is significantly less than the 545 genes identified on chromosome 22 in approximately the same amount of dna . previous data from the mapping of expressed sequence tags ( ests ) and genes , and efforts at cdna selection , have consistently suggested that chromosome 21 was relatively gene - poor overall , and extremely so in some regions . it could also be predicted that chromosome 21 would have fewer genes than chromosome 22 . approximately half of chromosome 21 is a large dark band when stained with giemsa , and such bands are known to be gene - poor , while chromosome 22 is almost entirely comprised of gene - rich r bands . in addition , trisomy 21 is compatible with life , while trisomy 22 is not . , are there consistent errors or weaknesses in gene - finding techniques that could have missed a significant proportion of genes ? to see where errors may have accumulated , it is worth reviewing the gene identification methods . genes were identified on the basis of the following types of data : identities or similarities to known proteins ; identities to spliced ests ; and patterns of consistent coding - exon prediction . first , protein matches identified genes that were identical or similar to known genes , and also found pseudogenes . with some minor corrections , all 107 genes associated with complete cdnas that had been mapped previously to chromosome 21 ( listed by swiss - prot in march 2000 ) were found . in addition , within 21q , 52 protein matches were classed as pseudogenes on the basis of a lack of introns and , most importantly , on the presence of multiple in - frame stop codons . given the inability of transcripts from these genes to produce a complete protein , it is unlikely that any pseudogenes were incorrectly classified . secondly , for est matches , only those that showed evidence of splicing were used - that is , those that were non - contiguous with genomic sequence , showed consensus splice sites , and represented essentially perfect matches ( 95 % identity ) to the genomic sequence . a survey of the est database for fifty of the known chromosome 21 genes found that forty - three were present as spliced ests , six were present only as unspliced ests ( five of these were intronless genes ) , and one was not present in dbest . finally , the criterion of consistent exon prediction required that two of the three coding - exon prediction programs ( grail , genscan and mzef ) agreed on the location of an exon , and that a minimum of three consistent exons were found within 60 kb , with introns 30 kb . it is noteworthy that the coding regions of intronless genes were well predicted but only as single exons . such exons tend to be very large - greater than a kilobase ( kb ) in length - in contrast to typical coding exons that average 100 - 150 base pairs ( bp ) . after making exceptions for , and including , large single - coding - exon genes , by these criteria , all but one of the 107 known genes could be identified by exon prediction . this included very large genes , such as dscam , which spans 800 kb , and grik1 , which spans 400 kb , both of which were well predicted through at least some of their coding regions . the important conclusion here is that each of the 107 genes previously known to map to chromosome 21 would have been identified , in the absence of protein similarities , by the criteria of est matches plus exon prediction . these criteria do not , in most cases , define a complete gene structure , but they do successfully indicate the presence of a gene . thus , unless novel genes have very different characteristics , it is reasonable to expect a similarly high level of success in their identification . using these criteriathey are few ( three ) and small ( 50 kb each ) , however , and therefore can not harbor large numbers of genes . second , genes that would not be identified would have to possess the following features : no similarity to any known protein ; consistently very large introns ( 30 - 60 kb ) , so that patterns of predicted exons would not be scored ; and long intronless 3 ' untranslated regions ( utrs ) or restricted and / or low expression levels , so that no spliced est is present in dbest . it is certainly possible that some number of genes with such characteristics exist ; that they represent a significant proportion of chromosome 21 genes is unlikely , however . the distal one third of 21q is the most gene - rich ( and gc - rich ) ; but intergenic distances here are not large enough to accommodate additional genes with uniformly large introns . so , unless coding exons in these genes are for some reason not recognized , such genes would be scored on the basis of patterns of predicted exons . the proximal two thirds , in contrast , is uniformly at - rich and does have large segments lacking gene features ; indeed , there is one segment of approximately 7 mb that harbors only seven genes . here there is room for numerous genes that have large introns and restricted expression . one argument against this is a biological one : an individual who is monosomic for this region has only mild phenotypic abnormalities . a second argument is a general scarcity of any consistent exon prediction in the region , regardless of ' intron ' size . if there are many coding exons within this region , they must also be largely unrecognized by prediction programs . together , these data suggest that the total of 225 genes is likely to be reliable : false negatives should be few . ? genes with complete protein or cdna sequences identical or highly similar to known genes ( these are the class 1 and class 2 genes in ) are unambiguous . gene models ( classes 3 and 4 ) , however , are still open to further investigation and interpretation . for example , some investigators will choose to disregard a specific match to a protein domain if the similarity is weak . how many exons to include in a model , and whether an est should be included will also sometimes be debatable . investigators should review the basis for specific gene predictions of interest ( available at ) . ds can be considered as a contiguous gene syndrome , with almost the entirety of 21q the relevant region . the segment of 21q22 .2 that is referred to as the down syndrome chromosomal region ( dscr ) was defined to contain genes relevant to aspects of the ds phenotype on the basis of the phenotypes of several cases of partial trisomy 21 . data using a larger number of partial trisomy cases showed that only the most centromeric region of 21q could be excluded from containing relevant genes , in particular for mental retardation . it is assumed that overexpression of chromosome 21 genes , as a result of their presence in an extra copy , causes the ds phenotype . how many genes are overexpressed and relevant ? currently , there are no answers to these questions . it is , however , worth considering what is known about the function of chromosome 21 genes . functional inferences are based on partial or complete similarities of the chromosome 21 genes or gene models to proteins or protein domains for which experimental data has demonstrated a specific function . for example , znf295 is a gene model with an open reading frame that contains zinc finger domains . some zinc finger proteins have been shown to be transcription factors , so zbf295 is classed as such . in general , genes are classified as broadly as possible . for example itgb2 , is classed only as a cell adhesion molecule , although because it has been studied essentially only in lymphocytes , it is regarded as an immune system gene . future studies may well reveal functions other than those that have been observed , so it is as well to speculate about the functions of genes as broadly as possible . every biologist will bring their own expertise to bear in deciding which of the genes in table 1 are of greatest potential relevance to the ds phenotype . transcription factors are attractive candidates because imbalance of one component of a transcription factor complex may alter the effectiveness of the activation or repression of transcription of target genes . cell adhesion was long ago postulated , with intriguing preliminary data , to play a role in altering rates and extents of cell migration during development . overexpression of one potassium channel gene has been shown to disregulate expression of other channel genes , affecting neuronal network excitability . if mental retardation and cognitive deficits are the primary focus of study , almost any of the categories in table 1 could be relevant , such is the extent of our current understanding of the complex developmental processes leading to these conditions . only about half the 225 chromosome 21 genes have any functional association , and some of these are particularly weak - for example , the presence of a transmembrane domain is not very definitive . in some cases , the lack of protein or functional domain data may be due to the lack of complete coding sequence information . while awaiting the generation of complete cdna sequences ( which may be laborious to obtain ) , and even for further analysis of complete cdnas lacking functional associations , expression patterns may help in prioritizing genes for further study . of the novel genes with incomplete cdnas , thirty - eightof these , only seven would be classed as ubiquitous in expression - that is , present in dbest with more than 30 entries from numerous tissues . five of these ests are seen only in testes / prostate and three are seen only in fetal sources . while there are features of dbest construction that can produce artifactual pictures of expression patterns , these data suggest that the novel genes within 21q may be largely of limited expression . in some cases at least , for relevance to mental retardation and cognitive deficits , genes with brain - specific expression , such as pcp4 , are of interest . equally interesting are examples of brain - specific alternative processing , as is seen with intersectin and dscam . in an analysis of a number of novel gene models , alternative processing , some of it brain - specific , was observed in the majority of cases . it is unlikely that even most known genes have been examined thoroughly for instances of multiple transcripts . because these may alter protein sequences and therefore functionmodel organisms will provide the basis for functional studies of the known and novel chromosome 21 genes . the genomes of saccharomyces cerevisiae , caenorhabditis elegans and drosophila have been completely sequenced , and thus the complete set of proteins of each of these organisms is known . comparison of the translations of all annotated chromosome 21 genes with the drosophila set identified 23 chromosome 21 gene products with similarity to a drosophila protein over the complete length . many of these similarities involve basic biochemical / biological functions and include such proteins as sod1 ( superoxide dismutase ) , gart ( a purine biosynthesis enzyme ) , cbs ( cys - tathionine beta - synthetase ) , and those involved in rna splicing and the ubiquitin pathway . a further set of 31 genes showed excellent informative matches but only over a domain or subregion of the human protein . previously known homologs include mnb ( minibrain ) and sim2 ( single - minded ) . perhaps most interesting in both sets are those genes for which there is little or no functional data . table 2 lists some of the known and novel chromosome 21 genes with partial and complete similarities in drosophila . among the novel genes , identities at the amino - acid level range as high as 64 % ( c21orf19 ) and over as many as 1,600 residues ( c21orf5 ) . additional details remain to be resolved ; for example , in several cases the lengths of the human and drosophila proteins are significantly different . correcting these differences , in addition , defining complete cdnas may reveal new homologies not discernible with partial gene models . determining the phenotypes of mutants in the drosophila genes is likely to shed light on the function of the homologous human genes . the centromere - proximal region of chromosome 21 through the mx genes is homologous with the telomeric region of mouse chromosome 16 ( figure 1 ) . the next approximately 2 mb segment of chromosome 21 is homologous with the centromere - proximal region of mouse chromosome 17 , and the telomeric 2 mb of chromosome 21 is homologous with an internal segment of mouse chromosome 10 . on the basis of current data , the order of chromosome 21 homologues in the mouse chromosome 16 and 10 segments appears to be completely conserved , although the boundaries of these regions are still approximate . for example , the most centromere - proximal gene on chromosome 21 verified to map to mouse chromosome 16 is stch . similarly , although it is known that mx maps to mouse chromosome 16 and tff3 , cbs and crya map to mouse chromosome 17 , there are 11 genes between and among these that are of unknown map location in mouse . lastly , pdxk is the most proximal chromosome 21 gene mapped to mouse chromosome 10 . genes in this region are relatively small , however , and additional chromosome 21 genes may be located on mouse chromosome 10 between pdxk and the adjacent region homologous with human chromosome 19 . defining the endpoints of these homologous regions is critical for evaluating gene - phenotype correlations within existing mouse models and for designing new ones . currently , the best mouse models of ds are the mouse chromosome 16 segmental trisomies , ts65dn and ts1cje . ts65dn is trisomic for the region spanning an undefined distance proximal to app through mx to presumably the telomere of chromosome 16 . the phenotype of ts65dn includes working memory impairment and long term memory deficits ; delayed development and lower body weight ; motor dysfunction ; decreased responsiveness to pain ; hyperactivity ; and decreased ability to inhibit behavior ( reviewed in ; see also ) . particularly interesting are observations of age - related loss of cholinergic neurons , decreased numbers of asymmetric synapses in the temporal cortex , abnormalities in neuron number in hippocampal regions , and deficiencies of beta - noradrenergic transmission within the hippocampus and cerebral cortex . some of these deficits have been observed in ds ; others suggest new avenues of investigation . knowing which genes can not be responsible for the phenotype can be helpful . table 3a lists the 32 genes found centromeric to the alzheimer 's - associated gene app on chromosome 21 . on the basis of current comparative mapping data , most of these may be present in only two copies in ts65dn and therefore would not contribute to its phenotypic features . the ts1cje mouse is a more recent model , and is trisomic for the region of mouse chromosome 16 from sod1 through mx ( and again presumably to the telomere ) . while it has not yet been studied so thoroughly as ts65dn , there are phenotypic differences between the two mice . in contrast to ts65dn , ts1cje shows hypoactivity , no loss of cholinergic neurons , and no deficits in the visible platform part of the water maze tests ( which tests only memory and not the ability to make spatial correlations ) . table 3b lists 27 genes that are expected to be trisomic in the ts65dn but only disomic in the ts1cje , based on the genetic map . it is tempting to conclude that these genes must account for the phenotypic differences , but it must be kept in mind that the two mouse strains have been produced on different genetic backgrounds , which may have phenotypic consequences . segmental trisomies for the regions of chromosome 21 homologous with mouse chromosomes 17 and 10 do not exist . if mx is the most telomeric gene on mouse chromosome 16 and pdxk is the most centromeric on mouse chromosome 10 , there are 33 genes within the approximately 2.2 mb of the mouse chromosome 17 region ( table 4 ) and 50 genes within the approximately 2.9 mb of the mouse chromosome 10 region . adding the maximum of 32 genes not trisomic in the ts65dn , half of the chromosome 21 homologous genes are not trisomic in ts65dn . the phenotypic consequences of these genes must be assessed in some fashion , because the ts65dn lacks some features of ds . constructing single - gene transgenic mice expressing each of these and then combining each with the ts65dn by breeding would be laborious and probably of limited success . analysis of the complete sequence of chromosome 21 has provided the first look at all candidate ds genes . the next steps require verifying and refining the predicted , incomplete gene models , defining new models as necessary , and isolating complete cdnas for each gene . with complete coding sequences , protein sequences can be examined for motifs , domains , and biochemical characteristics that may suggest function . the most challenging problem will then be determining the functions of these genes and the other ' known ' genes . while it is tempting to focus on genes whose protein characteristics suggest a hypothesis for relevance to some aspect of ds , the more than 100 genes distributed throughout the chromosome that have no functional association are too large a dataset to ignore . demonstration that a gene shows increased expression in the trisomic state by northern blot or rt - pcr analysis , followed by rna tissue in situ hybridization to define specific cell types , brain regions and developmental stages of expression , may help in selecting genes of greater or lesser interest . the most direct assessment of function will require mutation or overexpression of individual genes or sets of genes . for these experiments , the ' complete ' protein databases for s. cerevisiae , c. elegans and drosophila will provide homologous genes that can be analyzed in more tractable systems . the increasing complexity of the zebrafish est database will add another model organism system of increasing utility . issues remain with all model organisms , however , of verifying correct gene structures , identifying orthologous genes versus merely homologous genes , and interpreting mutation and knockout data in one system versus overexpression in anothermultiple genes can be ' added ' to the ts65dn using transgenics carrying bacterial chromosomes ( bacs ) , to look for enhanced ds - relevant phenotypes . the human sequence will be useful here in ensuring that clones are extensive enough to contain appropriate regulatory regions . single - gene knockouts can also be ' subtracted ' from the ts65dn mouse model , to search for amelioration of phenotype . with good biological intuition and luck , it may not be necessary to understand all of the genes within chromosome 21 before promising candidates are identified and the design of potential therapeutics can begin . the regions of human chromosome 21 that are syntenic with mouse chromosomes are indicated on the left ; those that are trisomic in the major mouse models are indicated on the right . functional assignments have been based either on literature reports of direct experiment or on inferences from similarities to other proteins . functional categories were chosen to be broadly descriptive ; each gene appears in only one category . similarities between selected human and drosophila gene products the number of amino acids over which the % identity ( % i d ) and the % similarity ( % sim ) was calculated . the e value is the expectation value , an indication of the probability of finding this level of similarity by chance . human chromosome 21 centromere - proximal genes ( a ) mouse homologs possibly disomic in both ts65dn and ts1cje . ( b ) mouse homologs expected to be trisomic in ts65dn but disomic in ts1cje . human genes with homologues mapping within the 2.2 mb maximum mouse chromosome 17 homologous region genes are listed in order from centromere to telomere on chromosome 21 .\noutput:\n" }, { "from": "agent", "value": "the recent completion of the dna sequence of human chromosome 21 has provided the first look at the 225 genes that are candidates for involvement in down syndrome ( trisomy 21 ) . a broad functional classification of these genes , their expression data and evolutionary conservation , and comparison with the gene content of the major mouse models of down syndrome , suggest how the chromosome sequence may help in understanding the complex down syndrome phenotype ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this study was approved by seoul national university hospital institutional review board ( no . 1103 - 035 - 354 ) and informed consent was obtained from all patients . among the 28 patients who had undergone lower limb amputation surgery ( below knee amputation or above knee amputation ) due to cli from march 2010 to september 2011 , 10 specimens from 10 patients were included in this study . subcutaneous adipose tissue ( 13 g ) was obtained aseptically from each amputated specimen and transported to our laboratory in aseptic bottles with phosphate buffered saline ( pbs ) . medical records were not profiled in accordance with irb instructions as they could be used for the identification of tissue donors . samples from three patients were allocated to immunofluorescence staining of fresh fat tissue and fluorescence - activated cell sorter ( facs ) analysis of fresh svf and remaining 7 samples were used after expansion to obtain enough amount of cells for extensive facs analysis ( triple samples for each analysis ) . the svf of adipose tissue was isolated as described in previous studies .192021 ) fresh fat tissues were washed at least three times with pbs to remove blood , and then digested at 37 for 1 hour with 0.075 % collagenase type 1 ( sigma - aldrich , st . louis , mo , usa ) in dulbecco 's modified eagle medium ( dmem ; gibco , new york , ny , usa ) . mature adipocyte fractions were separated from stromal fractions by centrifuging at 1,200 g for 10 minutes . the remained fractions were treated with red blood cell lysis buffer for 10 minutes at room temperature ( rt ) and then filtered through 100 - m nylon mesh to exclude remaining erythrocyte debris , and then centrifuged at 1,200 g for 10 minutes . pieces of harvested adipose tissues were washed in pbs , 10 % formalin ( sigma - aldrich ) , and held for at least 24 hours at 4 , before being embedded in paraffin . sections ( 6 to 8 m ) were cut on a rotary microtome ( leica rm2145 , leica microsystems , nussloch , germany ) fixed for 1 hour at 56 , and then stored at rt . before stainingtissue rehydration and all subsequent washes were performed by 25 - minute incubations in a zytomed wash buffer ( zytomed systems gmbh , berlin , germany ) . immuno - staining , rehydrated tissue sections were pretreated with protein blocking in serum - free protein blocks ( dako , glostrup , denmark ) and incubated with antibodies for 2 hours . nuclear staining was attained through 10 - minute incubation with hoechst 33258 ( invitrogen , carlsbad , ca , usa ) . slides were mounted in histomount ( national diagnostics , atlanta , ga , usa ) , and observed under a fluorescence microscopy ( bx61 ; olympus , tokyo , japan ) and a digital imaging system ( dcf 500 ; leica microsystems ) . antibodies used in these studies were anti - cd140b ( pdgfr , 1:50 ; bd biosciences , san jose , ca , usa ) , anti - cd146 ( 1:50 ; r & d systems , minneapolis , mn , usa ) , anti - cd90 ( 1:100 ; bd biosciences ) , and anti - cd31 ( 1:100 ; bd biosciences ) . all antibodies were diluted in an antibody diluent with background reducing components ( dako ) . cell surface antigen profiles of freshly isolated svf cells were quantified by flow cytometry with a facs .132223 ) fat tissue was thoroughly minced with scissors and digested for 30 minutes in dmem and 0.075 % collagenase type i ( sigma aldrich ) on a rotator at 37 . mature adipocytes were eliminated by centrifugation ( 1,200 g , ambient temperature , 10 minutes ) and cell pellets were resuspended in blood cell lysis buffer , incubated for 10 minutes at rt and washed in pbs . freshly isolated cells from the svf were maintained on ice , and stained for analytical flow cytometry and cell sorting experiments as previously described .24 ) cell suspensions were centrifuged ( 1,200 g , 10 minutes ) and the cells were simultaneously stained with monoclonal mouse anti - human fluorochrome - conjugated antibodies : cd31 - fluorescein isothiocyanate ( fitc ) , cd34 - fitc , cd90 - fitc , cd140b - phycoerythrin ( pe ) , cd146 - pe , cd54 - allophycocyanin ( apc ) ( bd biosciences ) , cd146 - fitc , neuron - glial antigen 2 ( ng2 ) - fitc , - smooth muscle actin ( sma ) - pe , vascular endothelial growth factor receptor 2 ( vegfr2 ) - pe , c - x - c chemokine receptor type 4 ( cxcr4 ) - pe , cd140b - apc ( r & d systems ) , cd105 - fitc , cd44 - fitc ( abd serotec , kidlington , oxford , uk ) , cd14 - pe , cd45 - pe ( dako ) , cd13 - fitc ( novus biological , littleton , co , usa ) , cd133 - apc ( miltenyi biotec , auburn , ca , usa ) , and unconjugated antibodies ( desmin ; abcam , cambridge , ma , usa ) . analytical samples were fixed with 1 % paraformaldehyde ( pfa ) for 10 minutes at rt . four - color , 6 - parameter data files were acquired on a 2 - laser facscalibur flow cytometer ( bd biosciences ) at a maximum of 10,000 events per second . cell sorting was performed using a 3 - laser facsaria ii cell sorter ( bd biosciences ) . unfixed cd140b - pe stained samples were suspended in pbs , and 0.5 % bovine serum albumin ( bsa ) . samples were continuously cooled to 4 and single cell sorting was performed at 70,000 events per second . samples were collected into bd falcon round - bottom polypropylene tubes ( bd biosciences ) containing 1 ml of dmem / nutrient mixture f - 12 ( dmem / f12 ; gibco ) and plated in tissue culture dish ( tpp ; techno plastic products , trasadingen , switzerland ) at a density of 10,000 to 20,000 cell / cm . adherent sorted and unsorted cells were expanded in equal volumes of dmem / f12 and supplemented with 10 % fbs , and 100 u / ml penicillin ( sigma - aldrich ) . we evaluated the pericytic function of pdgfr + cells that were collected from cultured adscs using facs . we seeded human umbilical vein endothelial cells ( huvecs ) and pdgfr + adscs on the surface of a 100 % matrigel ( bd biosciences ) in endothelial cell growth medium 2 ( egm2 ; sigma - aldrich ) as previously reported .25 ) briefly , matrigel was added to a 24 - well plate followed by incubation for 30 minutes at 37 . pdgfr + cells ( passage 2 ) and huvec were labeled with anti - von willebrand factor ( vwf ; abcam ) and anti - cd140b ( pdgfr , bd biosciences ) . they were then detached from the culture plate by trypsin and seeded onto the matrigel in dmem / f12 culture medium at a ratio of 1:1 . in total , 110 cells were seeded in each well of 24 - well plates . capillary tube formation was investigated after five hours by fluorescence microscopy ( ix51 ; olympus ) , inverted microscopy ( ix50 ; olympus ) and confocal laser scanning microscope ( tcs sp8 ; leica microsystems ) microscopy . for osteogenesis , cells at 70 % confluence were cultivated in dmem , 10 % fbs , 0.1 mm dexamethasone , 50 mg / ml l - ascorbic acid , and 10 mm b - glycerophosphate . after 14 days , cells were fixed in citrate fixative ( citrate solution - acetone - 37 % formaldehyde ) for 1 minute . for detection of alkaline phosphatase ( alp ) activity , the fixed cells were incubated for 15 minutes in a mixture of naphthol as - bi alkaline solution ( sigma - aldrich ) . cells were then rinsed with deionized water and mounted in gva aqueous mounting solution ( genemed , san francisco , ca , usa ) . for chondrogenesis , pellets were prepared by spinning down 310 cultured cells and grown in serum - free dmem containing an insulin - transferrin selenious acid mix ( sigma - aldrich ) , 50 mg / ml l - ascorbic acid 2 - phosphate ( sigma - aldrich ) , 100 mg / ml sodium pyruvate , 40 mg / ml l - proline ( sigma - aldrich ) , 0.1 mm dexamethasone ( sigma - aldrich ) , and 10 ng / ml transforming growth factor beta 1 ( tgf - 1 ; r & d systems ) . after 21 days , pellets were fixed in 10 % formalin , dehydrated in ethanol , and embedded in paraffin . for the safranin o staining , specimen sections ( thickness , 6 m ) were deparaffinized with xylene and ethanol and safranin o solution ( sigma - aldrich ) was applied for 510 minutes . for adipogenic differentiation , cultured cells at 70 % confluence were switched to dmem , 10 % fbs , 1 mm dexamethasone , 0.5 mm isobutylmethylxanthine , 60 mm indomethacin , and 170 mm insulin ( sigma - aldrich ) . after 21 days , cells were fixed in 5 % pfa at rt , washed in pbs , and incubated with oil red o for 10 minutes at rt for the detection of lipids . mann - whitney u - test was used to compare branch points and tube numbers in matrigel assay .22.0 ( ibm co. , armonk , ny , usa ) was used for the statistical analysis , and probability values of less than 0.05 were considered statistically significant . this study was approved by seoul national university hospital institutional review board ( no . 1103 - 035 - 354 ) and informed consent was obtained from all patients . among the 28 patients who had undergone lower limb amputation surgery ( below knee amputation or above knee amputation ) due to cli from march 2010 to september 2011 , 10 specimens from 10 patients were included in this study . subcutaneous adipose tissue ( 13 g ) was obtained aseptically from each amputated specimen and transported to our laboratory in aseptic bottles with phosphate buffered saline ( pbs ) . medical records were not profiled in accordance with irb instructions as they could be used for the identification of tissue donors . samples from three patients were allocated to immunofluorescence staining of fresh fat tissue and fluorescence - activated cell sorter ( facs ) analysis of fresh svf and remaining 7 samples were used after expansion to obtain enough amount of cells for extensive facs analysis ( triple samples for each analysis ) . the svf of adipose tissue was isolated as described in previous studies .192021 ) fresh fat tissues were washed at least three times with pbs to remove blood , and then digested at 37 for 1 hour with 0.075 % collagenase type 1 ( sigma - aldrich , st . louis , mo , usa ) in dulbecco 's modified eagle medium ( dmem ; gibco , new york , ny , usa ) . mature adipocyte fractions were separated from stromal fractions by centrifuging at 1,200 g for 10 minutes . the remained fractions were treated with red blood cell lysis buffer for 10 minutes at room temperature ( rt ) and then filtered through 100 - m nylon mesh to exclude remaining erythrocyte debris , and then centrifuged at 1,200 g for 10 minutes . pieces of harvested adipose tissues were washed in pbs , 10 % formalin ( sigma - aldrich ) , and held for at least 24 hours at 4 , before being embedded in paraffin . sections ( 6 to 8 m ) were cut on a rotary microtome ( leica rm2145 , leica microsystems , nussloch , germany ) fixed for 1 hour at 56 , and then stored at rt . before stainingtissue rehydration and all subsequent washes were performed by 25 - minute incubations in a zytomed wash buffer ( zytomed systems gmbh , berlin , germany ) . immuno - staining , rehydrated tissue sections were pretreated with protein blocking in serum - free protein blocks ( dako , glostrup , denmark ) and incubated with antibodies for 2 hours . nuclear staining was attained through 10 - minute incubation with hoechst 33258 ( invitrogen , carlsbad , ca , usa ) . slides were mounted in histomount ( national diagnostics , atlanta , ga , usa ) , and observed under a fluorescence microscopy ( bx61 ; olympus , tokyo , japan ) and a digital imaging system ( dcf 500 ; leica microsystems ) . antibodies used in these studies were anti - cd140b ( pdgfr , 1:50 ; bd biosciences , san jose , ca , usa ) , anti - cd146 ( 1:50 ; r & d systems , minneapolis , mn , usa ) , anti - cd90 ( 1:100 ; bd biosciences ) , and anti - cd31 ( 1:100 ; bd biosciences ) . all antibodies were diluted in an antibody diluent with background reducing components ( dako ) . cell surface antigen profiles of freshly isolated svf cells were quantified by flow cytometry with a facs .132223 ) fat tissue was thoroughly minced with scissors and digested for 30 minutes in dmem and 0.075 % collagenase type i ( sigma aldrich ) on a rotator at 37 . mature adipocytes were eliminated by centrifugation ( 1,200 g , ambient temperature , 10 minutes ) and cell pellets were resuspended in blood cell lysis buffer , incubated for 10 minutes at rt and washed in pbs . freshly isolated cells from the svf were maintained on ice , and stained for analytical flow cytometry and cell sorting experiments as previously described .24 ) cell suspensions were centrifuged ( 1,200 g , 10 minutes ) and the cells were simultaneously stained with monoclonal mouse anti - human fluorochrome - conjugated antibodies : cd31 - fluorescein isothiocyanate ( fitc ) , cd34 - fitc , cd90 - fitc , cd140b - phycoerythrin ( pe ) , cd146 - pe , cd54 - allophycocyanin ( apc ) ( bd biosciences ) , cd146 - fitc , neuron - glial antigen 2 ( ng2 ) - fitc , - smooth muscle actin ( sma ) - pe , vascular endothelial growth factor receptor 2 ( vegfr2 ) - pe , c - x - c chemokine receptor type 4 ( cxcr4 ) - pe , cd140b - apc ( r & d systems ) , cd105 - fitc , cd44 - fitc ( abd serotec , kidlington , oxford , uk ) , cd14 - pe , cd45 - pe ( dako ) , cd13 - fitc ( novus biological , littleton , co , usa ) , cd133 - apc ( miltenyi biotec , auburn , ca , usa ) , and unconjugated antibodies ( desmin ; abcam , cambridge , ma , usa ) . analytical samples were fixed with 1 % paraformaldehyde ( pfa ) for 10 minutes at rt . four - color , 6 - parameter data files were acquired on a 2 - laser facscalibur flow cytometer ( bd biosciences ) at a maximum of 10,000 events per second . cell sorting was performed using a 3 - laser facsaria ii cell sorter ( bd biosciences ) . unfixed cd140b - pe stained samples were suspended in pbs , and 0.5 % bovine serum albumin ( bsa ) . samples were continuously cooled to 4 and single cell sorting was performed at 70,000 events per second . samples were collected into bd falcon round - bottom polypropylene tubes ( bd biosciences ) containing 1 ml of dmem / nutrient mixture f - 12 ( dmem / f12 ; gibco ) and plated in tissue culture dish ( tpp ; techno plastic products , trasadingen , switzerland ) at a density of 10,000 to 20,000 cell / cm . adherent sorted and unsorted cells were expanded in equal volumes of dmem / f12 and supplemented with 10 % fbs , and 100 u / ml penicillin ( sigma - aldrich ) . we evaluated the pericytic function of pdgfr + cells that were collected from cultured adscs using facs . we seeded human umbilical vein endothelial cells ( huvecs ) and pdgfr + adscs on the surface of a 100 % matrigel ( bd biosciences ) in endothelial cell growth medium 2 ( egm2 ; sigma - aldrich ) as previously reported .25 ) briefly , matrigel was added to a 24 - well plate followed by incubation for 30 minutes at 37 . pdgfr + cells ( passage 2 ) and huvec were labeled with anti - von willebrand factor ( vwf ; abcam ) and anti - cd140b ( pdgfr , bd biosciences ) . they were then detached from the culture plate by trypsin and seeded onto the matrigel in dmem / f12 culture medium at a ratio of 1:1 . in total , 110 cells were seeded in each well of 24 - well plates . capillary tube formation was investigated after five hours by fluorescence microscopy ( ix51 ; olympus ) , inverted microscopy ( ix50 ; olympus ) and confocal laser scanning microscope ( tcs sp8 ; leica microsystems ) microscopy . for osteogenesis , cells at 70 % confluence were cultivated in dmem , 10 % fbs , 0.1 mm dexamethasone , 50 mg / ml l - ascorbic acid , and 10 mm b - glycerophosphate . after 14 days , cells were fixed in citrate fixative ( citrate solution - acetone - 37 % formaldehyde ) for 1 minute . for detection of alkaline phosphatase ( alp ) activity , the fixed cells were incubated for 15 minutes in a mixture of naphthol as - bi alkaline solution ( sigma - aldrich ) . cells were then rinsed with deionized water and mounted in gva aqueous mounting solution ( genemed , san francisco , ca , usa ) . for chondrogenesis , pellets were prepared by spinning down 310 cultured cells and grown in serum - free dmem containing an insulin - transferrin selenious acid mix ( sigma - aldrich ) , 50 mg / ml l - ascorbic acid 2 - phosphate ( sigma - aldrich ) , 100 mg / ml sodium pyruvate , 40 mg / ml l - proline ( sigma - aldrich ) , 0.1 mm dexamethasone ( sigma - aldrich ) , and 10 ng / ml transforming growth factor beta 1 ( tgf - 1 ; r & d systems ) . after 21 days , pellets were fixed in 10 % formalin , dehydrated in ethanol , and embedded in paraffin . for the safranin o staining , specimen sections ( thickness , 6 m ) were deparaffinized with xylene and ethanol and safranin o solution ( sigma - aldrich ) was applied for 510 minutes . for adipogenic differentiation , cultured cells at 70 % confluence were switched to dmem , 10 % fbs , 1 mm dexamethasone , 0.5 mm isobutylmethylxanthine , 60 mm indomethacin , and 170 mm insulin ( sigma - aldrich ) . after 21 days , cells were fixed in 5 % pfa at rt , washed in pbs , and incubated with oil red o for 10 minutes at rt for the detection of lipids . mann - whitney u - test was used to compare branch points and tube numbers in matrigel assay .22.0 ( ibm co. , armonk , ny , usa ) was used for the statistical analysis , and probability values of less than 0.05 were considered statistically significant . white adipose tissue from the subcutaneous fat of the human lower leg is a richly vascularized tissue ( fig . 1a ) . immunofluorescence staining using endothelial ( cd31 ) and pericyte markers ( pdgfr and cd146 ) showed the exclusively perivascular location of pdgfr + cells in various sizes of the blood vessels ( small artery , arteriole , and capillary ) ( fig . d ) . co - staining with a mesenchymal marker ( cd90 ) showed that perivascular pdgfr + cells also expressed mesenchymal markers in small arterioles ( fig .1 c and d ) , while cd90 - positive cells and pdgfr + cells were mutually exclusive in larger arteries ( fig . multilabel flow cytometric analysis revealed that pdgfr + cells from fresh svf of human adipose tissue expressed a higher level of a pericyte marker ( sma ) , stem cell markers ( cd34 and cxcr4 ) , and mesenchymal markers ( cd13 , cd44 , cd54 , and cd90 ) than pdgfr cells . pdgfr + cells also expressed a slightly higher level of endothelial markers ( cd31 and cd144 ) than pdgfr cells ( fig .2 ) .24 ) the cd45 - positive cells are thought to include a mixture of leukocytes contained within the vasculature as well as cells resident in the adipose tissue .24 ) staining of freshly isolated cells for pdgfr and other markers showed that there was a substantial number of perivascular mesenchymal stem - like ( pdgfr + / cd90 + / cd44 + / cd45 ) cell fractions in fresh svf of human adipose tissue . plating of isolated cells from svf on an uncoated tissue culture plastic resulted in selective adherence of cell population . multilabel flow cytometric analysis of culture - expanded adscs revealed that facs analysis from fresh svf of human adipose tissue showed that a population of endothelial ( cd31 and cd144 ) and leukocytic ( cd45 ) marker - positive cells was greatly reduced ( fig .3 ) . cultured pdgfr + cells maintained the properties of pdgfr + cells from fresh svf except that they had a lower level of stem cell marker ( cd34 and cxcr4 ) - positive cells . cultured pdgfr + cells expressed high levels of mesenchymal markers ( cd13 , cd44 , cd54 , and cd90 ) , and a pericyte marker ( sma ) . however , they expressed neither the endothelial markers ( cd31 and cd144 ) nor the leukocytic marker ( cd45 ) .24 ) when pdgfr + adscs were cocultured with huvec , they demonstrated the formation of a tubular network ( fig . tube number was higher ( 124.513.2 per plate , p 0.05 ) than that formed by huvec ( 97.55.5 ) or adsc ( 62.85.6 ) only . at a higher magnification , they showed a pericytic location , where pdgfr + adscs adhered to huvec ( fig . these results suggested that pdgfr + adscs indeed possess a pericytic phenotype and stabilize the vascular tube - like network formed by huvec . to examine whether these cells have a multilineage differentiation ability , pdgfr + cells were induced to differentiate into the osteogenic , chondrogenic , and adipogenic lineages . during the analysis for osteogenic differentiation assayed by alp staining , the pdgfr + cells showed greater alp staining ( fig .5 a ) . on the chondrogenic differentiation potential , verified by safranin o staining , the pdgfr + cells showed greater chondrogenic differentiation ( fig . after adipogenic induction for 3 days , the cell morphology changed from long spindle - shaped into a round or polygonal shape ( data not shown ) . one week later , small bubble - shaped oil red o - staining lipid droplets appeared in some parts of the cells . the size of lipid droplets increased after 2 weeks , and most of the differentiated cells showed red lipid droplets throughout the cytoplasm ( fig . white adipose tissue from the subcutaneous fat of the human lower leg is a richly vascularized tissue ( fig . 1a ) . immunofluorescence staining using endothelial ( cd31 ) and pericyte markers ( pdgfr and cd146 ) showed the exclusively perivascular location of pdgfr + cells in various sizes of the blood vessels ( small artery , arteriole , and capillary ) ( fig . d ) . co - staining with a mesenchymal marker ( cd90 ) showed that perivascular pdgfr + cells also expressed mesenchymal markers in small arterioles ( fig .1 c and d ) , while cd90 - positive cells and pdgfr + cells were mutually exclusive in larger arteries ( fig . multilabel flow cytometric analysis revealed that pdgfr + cells from fresh svf of human adipose tissue expressed a higher level of a pericyte marker ( sma ) , stem cell markers ( cd34 and cxcr4 ) , and mesenchymal markers ( cd13 , cd44 , cd54 , and cd90 ) than pdgfr cells . pdgfr + cells also expressed a slightly higher level of endothelial markers ( cd31 and cd144 ) than pdgfr cells ( fig .2 ) .24 ) the cd45 - positive cells are thought to include a mixture of leukocytes contained within the vasculature as well as cells resident in the adipose tissue .24 ) staining of freshly isolated cells for pdgfr and other markers showed that there was a substantial number of perivascular mesenchymal stem - like ( pdgfr + / cd90 + / cd44 + / cd45 ) cell fractions in fresh svf of human adipose tissue . plating of isolated cells from svf on an uncoated tissue culture plastic resulted in selective adherence of cell population . multilabel flow cytometric analysis of culture - expanded adscs revealed that facs analysis from fresh svf of human adipose tissue showed that a population of endothelial ( cd31 and cd144 ) and leukocytic ( cd45 ) marker - positive cells was greatly reduced ( fig .3 ) . cultured pdgfr + cells maintained the properties of pdgfr + cells from fresh svf except that they had a lower level of stem cell marker ( cd34 and cxcr4 ) - positive cells . cultured pdgfr + cells expressed high levels of mesenchymal markers ( cd13 , cd44 , cd54 , and cd90 ) , and a pericyte marker ( sma ) . however , they expressed neither the endothelial markers ( cd31 and cd144 ) nor the leukocytic marker ( cd45 ) .24 ) when pdgfr + adscs were cocultured with huvec , they demonstrated the formation of a tubular network ( fig . tube number was higher ( 124.513.2 per plate , p 0.05 ) than that formed by huvec ( 97.55.5 ) or adsc ( 62.85.6 ) only . at a higher magnification , they showed a pericytic location , where pdgfr + adscs adhered to huvec ( fig . these results suggested that pdgfr + adscs indeed possess a pericytic phenotype and stabilize the vascular tube - like network formed by huvec . to examine whether these cells have a multilineage differentiation ability , pdgfr + cells were induced to differentiate into the osteogenic , chondrogenic , and adipogenic lineages . during the analysis for osteogenic differentiation assayed by alp staining , the pdgfr + cells showed greater alp staining ( fig .5 a ) . on the chondrogenic differentiation potential , verified by safranin o staining , the pdgfr + cells showed greater chondrogenic differentiation ( fig . the cell morphology changed from long spindle - shaped into a round or polygonal shape ( data not shown ) . one week later , small bubble - shaped oil red o - staining lipid droplets appeared in some parts of the cells . the size of lipid droplets increased after 2 weeks , and most of the differentiated cells showed red lipid droplets throughout the cytoplasm ( fig . in this study , we demonstrated that pdgfr + cells are located in the perivascular area in fresh white adipose tissues of cli patients and they coexpressed the msc - like markers . we also showed that pdgfr + cells from the stromal vascular fraction of human white adipose tissue had msc - like characteristics and could differentiate into the multilineage mesenchymal tissues . cli , an end stage of lower limb ischemia due to pad is considered as one of the main targets for cell therapy using stem cells and progenitor cells based on promising experiences with bm - mncs ,34567 ) pb - mncs ,89 ) and adscs .110 ) recently , the perivascular niche was discovered to be an important reservoir of mscs in multiple developed organs ( brain , spleen , liver , kidney , kidney glomeruli , lung , bone marrow , muscle , thymus , and pancreas ) , irrespective of their embryonic origin .14152627 ) several studies have shown that cell populations obtained from the perivascular tissue exhibited the capacity of prolonged self - renewal and differentiated along mesenchymal cell lineages , making them defined as mscs .24282930 ) although perivascular progenitor cells are ubiquitous multipotent progenitors , isolation of perivascular progenitor cells for clinical application is not feasible from all human organs .18 ) adipose tissue represents an attractive source of autologous adult stem cells for regenerative therapy owing to its abundance , surgical accessibility , and high content of multipotent mscs .11 ) however , the development of an in vivo progenitor for culture - expanded msc - like adscs remains elusive because of the complex organization of stromal cells surrounding the small vessels .13 ) coexpression of msc - like markers in perivascular pdgfr + cells suggests that perivascular niche could be an important reservoir of mscs in white fat tissue , even in cli patients . traktuev et al. 24 ) have shown that multipotent adipose - derived stromal cells ( ascs ) also have a perivascular location and express pericyte markers . they showed that ascs express the pericyte markers including cd140a , cd140b , ng2 , and sma , and occasionally express cd146 . the highly defined asc population ( cd34 + / cd140a + / cd140b + / cd31 / cd45 / cd117 / cd144 ) is the subset of adipose - derived cells , which possesses a majority of pericytic properties in the quiescent adipose tissue while harboring the ability to differentiate into multiple distinct lineages . this study also demonstrates that pdgfr + perivascular cells from ischemic adipose tissue have a good multilineage ( osteogenic , chondrogenic and adipogenic ) differentiation potential . however , the reason that neovascularization was inhibited in an ischemic condition in cli patients with abundant pdgfr + adsc reservoirs is not clear . further research needs to be performed to discover the signal that can awaken the pdgfr + adsc reservoir in cli patients . we carefully postulate that pdgfr + cells from the svf of adipose tissue can be used as a source of stem cells for autologous cell based treatment in cli patients because ( 1 ) pdgfr + cells in the svf of adipose tissues are abundant and proliferative even in chronic cli patients ; ( 2 ) the pericytic localization of the pdgfr + adscs and their direct contact with endothelial cells can be helpful to increase neovascularization in the ischemic limb ; and ( 3 ) msc - like characteristics of pdgfr + adscs can be maintained during subsequent cell expansion in vitro . however , collecting svf from other fat sites such as abdominal fat tissue might be better in clinical situation of cli patients for saving ischemic limbs before major amputation . in conclusion , we demonstrated that pericyte - like pdgfr - positive cells from the svf of adipose tissue from cli patients might have the potential to enhance vascularization . we also found that they could be amplified and cells characteristics could be preserved in in vitro culture . considering the pericytic localization of pdgfr + adscs and their direct contact with endothelial cells , pdgfr + cells in the svf of adipose tissue can be used as a source of stem cells for autologous cell - based treatment in cli patients .\noutput:\n" }, { "from": "agent", "value": "backgroundthe pericytes in the blood vessel wall have recently been identified to be important in regulating vascular formation , stabilization , remodeling , and function . we isolated and identified pericyte - like platelet - derived growth factor receptor beta - positive ( pdgfr + ) cells from the stromal vascular fraction ( svf ) of adipose tissue from critical limb ischemia ( cli ) patients and investigated their potential as a reliable source of stem cells for cell - based therapy.methodsde - identified subcutaneous fat tissues were harvested after amputation in cli patients . freshly isolated svf cells and culture - expanded adipose - derived stem cells ( adscs ) were quantified using flow cytometry . a matrigel tube formation assay and multi - lineage differentiation were performed to assess pericytic and mesenchymal stem cell ( msc ) - like characteristics of pdgfr + adscs.resultspdgfr + cells were located in the pericytic area of various sizes of blood vessels and coexpressed mesenchymal stem cell markers . pdgfr + cells in freshly isolated svf cells expressed a higher level of stem cell markers ( cd34 and cxcr4 ) and mesenchymal markers ( cd13 , cd44 , cd54 , and cd90 ) than pdgfr cells . in vitro expansion of pdgfr + cells resulted in enrichment of the perivascular mesenchymal stem - like ( pdgfr + / cd90 + / cd45 / cd31 ) cell fractions . the matrigel tube formation assay revealed that pdgfr + cells were located in the peritubular area.conclusionspdgfr + adscs cells demonstrated a good multilineage differentiation potential . pericyte - like pdgfr + cells from the svf of adipose tissue from cli patients had msc - like characteristics and could be amplified by in vitro culture with preservation of their cell characteristics . we believe pdgfr + cells in the svf of adipose tissue can be used as a reliable source of stem cells even in cli patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is postulated that there is a functional imbalance between the endogenous vasodilators ( prostacyclins pg i2 ) and vasoconstrictors ( thromboxane a2 ) leading to arteriolar vasospasm . various cardiovascular ( cvs ) effects like labile blood pressure ( bp ) , decreased colloid oncotic pressure , intravascular volume depletion , increased systemic vascular resistance , hypertension , and hypercoagulable states can coexist . the deleterious effects on central nervous system include cortical blindness , cerebral edema , seizures and cerebrovascular accidents . renal system involvement can manifest as proteinuria , decrease in renal blood flow with decreased glomerular filtration rate , increased blood urea nitrogen and creatinine . airway edema , pulmonary edema , and ventilation perfusion mismatch may be associated as a result of respiratory system involvement . fetal compromise results as a consequence of uteroplacental insufficiency , placental abruption , chronic fetal hypoxia , intrauterine growth retardation ( iugr ) , and premature labor and delivery . termination of pregnancy may be required in the form of induction of labor or caesarean section ( cs ) , which may be a planned or an emergent procedure . the maternal indications may be uncontrolled bp , unfavorable cervix , failed induction of labor , or ante partum hemorrhage . a thorough search of literature was done on the google search engine , embase , and pubmed . the articles comparing different techniques of anesthesia for cs in parturients with severe preeclampsia till the year 2010 were included in the study . recent guidelines on the use of regional anesthesia in patients on anticoagulant therapy were also studied . either of the two techniques general anesthesia ( ga ) or central neuraxial blockade ( cnb ) may be employed for anesthesia . ga is often considered unsafe in obstetric practice as such , more so in patients with pih , because of potentially difficult airway or risk of failed intubation , hypertensive response to laryngoscopy and intubation , risk of aspiration pneumonitis , drug interactions between magnesium and nondepolarizing muscle relaxants ( ndmrs ) leading to enhanced sensitivity to ndmrs , and impaired villous blood supply . regional anesthesia is often considered to be a safer option in such situations as the hazards of difficult airway associated with weight gain and edema can be avoided . often the concern of severe hypotension following subarachnoid block ( sab ) deters the anesthesiologist from choosing this technique in patients with severe preeclampsia . a number of studies have been conducted to find the hemodynamic effects of regional anesthesia in patients with preeclampsia . observed that the risk of hypotension was almost six times less in patients with severe preeclampsia than in healthy parturients . another study , conducted in 2005 , attributed the hypotension following sab to preeclampsia - associated factors , rather than a small uterine mass . a review by dyer et al . found that preeclampsia patients had a lower susceptibility to hypotension and probably less impairment of cardiac output than healthy parturients after sab for cs . ga , as well as regional anesthesia , has been shown to be acceptable and safe method for conducting caesarean deliveries in preeclampsia , if steps are taken to ensure a careful approach to either technique . comparable hemodynamics were observed with use of sab , ga , or epidural anesthesia ( ea ) , in patients with severe pih . ea has been found to be superior to ga as it is associated with a smaller maternal hemodynamic and neuroendocrine stress response . it reduces the mean arterial pressure ( map ) without altering cardiac index ( ci ) , peripheral vascular resistance ( pvr ) , central venous pressure ( cvp ) , or pulmonary capillary wedge pressure ( pcwp ) . it also offers the advantage of increasing intervillous blood flow provided that adequate preloading is done and supine hypotension is avoided . ea has been traditionally regarded as safer in patients with preeclampsia as compared to sab as it does not produce sudden hypotension . recent studies have , however , shown that the reduction in bp is comparable with either of the two techniques . besides maintaining comparable hemodynamics , sab has the additional advantage of simplicity , faster onset , reliability , and it saves a lot of time . recently in a prospective observational study on 15 parturients with severe preeclampsia , even sab has been shown to produce clinically insignificant changes in cardiac output . the hemodynamic alterations produced by sab are comparable with that in ga in severe preeclampsia and hence the uteroplacental blood flow is not altered in parturients receiving sab . opioids have been used by several workers as an additive to local anesthetic for regional anesthesia , thereby reducing the dose of local anesthetic for cs . better hemodynamic stability with adequate anesthesia has been found with the use of low - dose hyperbaric bupivacaine ( 7.512 mg and as low as 6 mg , 0.5 % ) and opioid such as fentanyl or sufentanyl as compared to conventional doses of hyperbaric bupivacaine ( 12.513.5 mg , 0.5 % ) . parturients with severe preeclampsia have been successfully managed using an ultra - low dose of intrathecal hyperbaric bupivacaine ( 3.75 mg , 0.5 % ) with fentanyl ( 25 g ) or morphine ( 100 g ) and diluting with normal saline to make the volume up to 3 ml and 3 ml lidocaine 1.5 % given via epidural space . stable hemodynamics have been reported , obviating the need for vasopressors and large volume preload , minimizing the risk of pulmonary edema due to excessive hydration . preloading with crystalloid or colloid in normal parturients undergoing sab for elective cs has not always been found to be effective . preloading and coloadingasa task force recommends intravenous fluid preloading to decrease the frequency of maternal hypotension in patients undergoing cs under sab . preloading is all the more important in pih patients as hypovolemia and vasospasm are present . such patients do not require more volume preloads than normotensive controls to prevent catastrophic hypotension under sab although individual patient variations may be there . about 10 ml / kg fluid should be used to preload the pih parturients over a period of 1015 min at the time of sab . ephedrine has been used safely for maintaining bp because it does not adversely affect the uterine blood flow . have concluded that the use of prophylactic ephedrine is a safe and effective method for prevention and treatment of hypotension after cse technique . in a recent study , the degree of hypotension and requirement of vasopressors was found to be similar in two groups of patients administered either sab or ea . in a prospective study , sharwood - smith et al . concluded that patients with severe preeclampsia administered sab required less ephedrine as compared to those administered ea . a prospective randomized multicenter study comparing the hemodynamic effects of sab and ea for cs in preeclampsia showed that although the incidence of hypotension was more frequent in sab than in the ea group ( 51 % vs. 23 % ) , the duration of significant hypotension ( sbp 100 mmhg ) was short ( 1 min ) in both the groups . hypotension was easily treated in both groups by administration of ephedrine , although its use was more in the sab group . chiu performed a 5 - year retrospective analysis for cs for mild to moderate and severe preeclampsia and found that decreases in bp were similar after sab and ea . phenylepherine and ephedrine have been compared in a number of studies , which have concluded that neonates of women receiving phenylepherine have higher umbilical artery ph values . a study by macarthur et al . found that though the uterine artery resistance may be increased with phenylepherine , the oxygen consumption by the fetus is not and , therefore , the net oxygen balance is more favorable with phenylepherine than with ephedrine . asa task force recommends that both intravenous ephedrine and phenylepherine are acceptable drugs for treating hypotension during neuraxial anesthesia . it has been shown that these variables are not influenced by the type of anesthesia . no statistically significant difference was found in the 1 and 5 minute apgar scores and umbilical artery blood gas markers ( ph , pco2 , hco3 - be ) between two group of patients administered sab or ga . apgar scores have been found to be marginally better in the sab group in a study conducted by van bogaert et al . other studies in support of sab have also shown that transient neonatal depression seen after ga can be avoided by using sab . neonatal outcome of patients with pih for cs under sab and ea has been found to be comparable . even addition of fentanyl to low - dose bupivacaine has not been found to affect the neonatal outcomes . the types of complications associated with sab are less serious and easily manageable as compared to the more serious nature in ga which may even lead to mortality , the reported mortality being as high as 4.3 % . postoperative complications like nausea , vomiting , and hypertension were found to be higher in patients receiving ga . besides these , sab does not expose the mothers to the hazards of ga . in a retrospective observational study of 54 cases of sab , no complications were reported in mothers with preeclampsia and their fetuses , thus establishing the safety of the technique . a retrospective analysis on the duration of hospitalstay was conducted on 1619 women who received ga ( n = 582 ) or neuraxial anesthesia [ n = 614 for combined spinal and epidural anesthesia ( csea ) and n = 423 for ea ] . it was found that neuraxial anesthesia for cs is associated with a shorter duration of hospital stay as compared to ga . platelet function can also be abnormal in such parturients , besides the decrease in platelet count . this , by and large , is not a contraindication for spinal or epidural placement . the overall risk of developing an epidural or spinal hematoma after central neuraxial blockade is 1:1,50,000 to 1:2,20,000 . patients with preeclampsia may have rapidly changing platelet counts and it is important that serial platelet counts be taken instead of relying on a single value . platelet count 1,00,000 mm is also not a contraindication for ea as indicated by the results of three retrospective studies . recommend that ea should not be used if the platelet count is below 8010l . beilin et al . conducted a survey and found that most anesthetists would perform an epidural when the platelet count is between 80,000 to 1,00,000 mm . however , few were willing to place an epidural catheter in counts below 80,000 mm . bleeding time is not a reliable indicator of clotting abnormality as it does not necessarily reflect the risk of bleeding at other sites and it is not prolonged until platelet count falls below 1,00,000 mm . thromboelastography ( teg ) is a better measure of platelet function as it measures all the phases of coagulation and fibrinolysis . conducted a study comparing platelet count , teg parameters , and bleeding time in healthy parturients and those with preeclampsia.there was a strong correlation between platelet count and teg in thrombocytopenic patients . preeclampsia patients may also be on concurrent aspirin prophylaxis , which has been demonstrated to significantly improve the maternal and perinatal outcome in such patients . a history of easy bruising or evidence of petechiae or ecchymoses should alert the anesthesiologist , and regional anesthesia should be avoided . single values may be inconclusive , but a rapidly decreasing platelet count should be a red signal . a review by vandermuelen et al . revealed 61 cases of spinal hematoma out of which 68 % occurred in patients with coagulopathy and 75 % of all the cases had received ea instead of sab . out of the cases conducted under ea , 88 % had an epidural catheter inserted and almost 50 % of these cases developed epidural hematoma after catheter removal . if the epidural catheter is placed , a midline approach should be used and assessment of sensory and motor function should be done every 2 h. immediate evaluation should be done if abnormal blockade or prolonged blockade is suspected . if a patient has an epidural catheter in situ and develops a coagulopathy , the catheter should be removed only after the correction of coagulation status . immediate evaluation is necessary because if the patient has an epidural hematoma , emergency laminectomy and decompression must be performed within 612 h to preserve the neurologic function . sab offers an advantage over ea for it can be performed with a smaller gauge needle in contrast to a larger gauge needle required for ea . koyama et al . have reported a case of spinal subarachnoid hematoma following sab in a patient with hellp syndrome . the case was followed up and managed conservatively and the patient had an almost complete recovery within 3 months . they concluded that it is important for the clinicians to recognize the symptoms and signs of spinal subarachnoid hematoma to avoid delay in the treatment that might result in severe neurological deficit . single shot sab may be a good choice for cs when compared to ga or ea even for patients with severe preeclampsia without features of impending eclampsia . sab is safe both for the mother and the baby ; it provides better neonatal outcome and has fewer complications . the shorter duration of hospital stay is an added advantage for the mother and the newborn .\noutput:\n" }, { "from": "agent", "value": "pregnancy - induced hypertension constitutes a major cause of morbidity and mortality in developing nations and it complicates about 68 % of pregnancies . severe preeclampsia poses a dilemma for the anesthesiologist especially in emergency situations where caesarean deliveries are planned for uninvestigated or partially investigated parturients . this article is aimed to review the literature with regards to the type of anesthesia for such situations . a thorough search of literature was conducted on pubmed , embase , and google to retrieve the articles . studies on parturients with severe preeclampsia , undergoing caesarean section , were included in this article . there is growing evidence to support the use of subarachnoid block in such situations when the platelet counts are > 80,000 mm - 3 . better hemodynamic stability with the use of low - dose local anesthetic along with additives and better neonatal outcomes has been found with the use of subarachnoid block when compared to general anesthesia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the vast majority of infants admitted to the neonatal intensive care unit ( nicu ) must acquire the skills for successful oral feeding prior to discharge . for the preterm infant , successful oral feeding involves the maturation and integration of the nervous , sensory , muscular , and digestive systems . failed oral feeding trials can result in an array of morbidities including choking , aspiration , bradycardia , desaturations , feeding aversions , and both short - and long - term impaired neurological outcomes . further , there is a subset of term infants who have either delayed or unsafe oral feeding skills , resulting in prolonged hospitalization and / or surgical placement of a gastric tube for administration of enteral nutrition . despite the fact that the vast majority of infants in the nicu are at risk for these morbidities , research on neonatal feeding is relatively scarce compared to other complications of prematurity , such as bronchopulmonary dysplasia and necrotizing enterocolitis , that almost exclusively affect a much smaller percentage of infants born at 32 weeks ' gestation and / or at extremely low or very low birthweights . currently , newborns rely on the interpretation of subjective feeding cues by their caregivers to determine when it is safe to orally feed . our understanding of the complexities of oral feeding maturation in the developing infant at the molecular level is largely unknown . thus , there is an opportunity to incorporate emerging molecular techniques with conventional clinical approaches to improve our understanding of the complexities of oral feeding , and to develop objective diagnostic assays to accurately assess neonatal oral feeding skills . previously , our laboratory described the enormous amount of real - time global developmental information available from premature infants through noninvasive salivary gene expression analyses . although in the initial study we did not specifically target gene transcripts involved in oral feeding , this original discovery - driven research identified key regulatory genes , as well as novel pathways , associated with oral feeding in the preterm infant . in the two years since this initial work was published , our understanding of the physiological functions of the genes initially identified continues to improve . this has prompted a targeted reexamination of the data to identify previously unrecognized genes in neonatal saliva that may correlate to oral feeding success . identifying these genes and their associated biological and physiological pathways may not only lead to objective , noninvasive salivary biomarkers that accurately predict oral feeding readiness , but may also highlight aberrant developmental pathways that correlate with pathological feeding behavior in the newborn . pertinent clinical information , including medical complications , of each subject can be found in table 1 . salivary samples were collected from each subject from the following time points : ( 1 ) no feeds ; ( 2 ) partial gastric feeds ; ( 3 ) full gastric feeds ; ( 4 ) some oral feeds ; ( 5 ) advanced oral feeds . salivary rna was extracted , amplified , and hybridized onto the affymetrix hg u1332 .0 plus gene expression arrays . all arrays ( n = 25 ) underwent normalization and bioinformatic analysis as previously described . genes that were shown to statistically significantly alter their gene expression over time at a false discovery rate p value of 0.05 were identified ( n = 9,286 ) . there were 5,764 up - regulated and 3,522 down - regulated genes that met statistical criteria and altered their expression profile as the subjects matured through the feeding stages . for the purpose of this study , the up - and down - regulated gene lists were uploaded into the newest version of ingenuity pathway analysis ( ipa content version : 11904312 , release date 12 - 15 - 2011 ) . ipa then performed a functional analysis of the gene lists with a right - tailed fisher 's exact test to calculate a p value determining the probability that each biological function assigned to that data set was due to chance alone . this analysis provided a comprehensive biological assessment of the gene - gene interactions , gene functions and gene regulation in our data sets . in order to provide a targeted analysis of genes most likely to be related to oral feeding skills , genes that clustered into statistically significantly biological pathways by ipawere only considered if they met the following criteria : ( a ) they were in the five most statistically significantly up - or down - regulated physiological pathways ; ( b ) they were associated with the key terms feeding , digestion , and / or development in the ipa analysis . thus , genes had to statistically significantly alter their gene expression over time , and be identified by ipa as significantly clustering into pathways believed to be associated with oral feeding skills to be considered in this analysis . genes that met these criteria were further reviewed by the author with the use of ipa , pubmed , and entrezgene to better understand their functions and possible roles in neonatal oral feeding . from 2010 when the data was initially published until present , the functions of 4 % of the genes in the original data sets have been modified . as such , those genes are no longer considered valid for previously identified biological functions , canonical pathways , or networks . this recategorization of genes is a direct result of emerging literature and an improved understanding of gene function , gene - gene interaction , and gene regulation . although it is common for gene expression analyses to change over time , the slight difference in gene analysis from this data set has allowed for the identification of genes not previously known to be associated with neonatal oral feeding . the most significant physiologic pathways identified in this analysis highlight the complexity of oral feeding and involve not only tissue and nervous system development , but key pathways involved in feeding behavior . the five most statistically significantly up - regulated pathways were behavior ( 10 p 10 ) , nervous system developmentthe five most statistically significantly down - regulated pathways were hematological system development and function ( 10 p 10 ) , hematopoiesis ( 10 p 10 ) , and cell - mediated immune responsefor example , within nervous system development , the subcategories development of cranial nervethere were 1,807 up - regulated genes that met the search criteria ; 379 down - regulated genes were also considered . one of the most novel aspects of both the current and previous analysis is the prominent role of behavior in neonatal oral feeding . a subcategory entitled feeding was highlighted ( p 10 ) . genes within this pathway were associated withhyperphagia , satiety , obesity , and weight gain ( table 2 ) . this novel pathway suggests that oral feeding in the newborn is neither merely reflexive nor solely dependent upon oral musculature and nervous system development . rather , newborns rely , in part , on complex neurological signaling related to hunger , satiety , and energy expenditure for successful oral feeding . the enormous amount of caloric intake required for such exponential growth is unique to the newborn period of the human lifespan . thus , it is not surprising that the most statistically significant pathway in our analysis is related to biological mechanisms driving feeding behavior . in thefive most significantly up - regulated physiological pathways , new gene functions have also emerged . for example , in the prior study , the development of only the trigeminal nerve ( cranial nerve [ cn ] v ) was highlighted . at the time , we speculated that the development of this nerve , which provides motor innervation to the muscles of mastication , was essential for proper coordination of the suck - and swallow - reflex . in this updated analysis , we not only see upregulation of genes involved in the development of the trigeminal nerve , but also have identified genes involved in the developing facial ( cn vii ) and glossopharyngeal ( cn ix ) nerves ( table 3 ) . each of these nerves is known to be essential for safe coordination of swallowing with respiration , with cn vii innervating the sensory component of the facial mask , and cn ix providing sensory taste fibers to the posterior tongue . in addition , the subcategory development of cranial nerve was new to this analysis . here , genes associated with the oculomotor ( cn iii ) and vestibulocochlear ( cn viii ) nerves were identified . there is an upregulation of genes involved in the developing eye ( p 0.01 ) and ear ( p 0.02 ) , as well as the olfactory system ( p 0.01 ) . genes involved in olfactory receptor development were significantly upregulated as infants matured and learned to orally feed . this , too , is of great interest as emerging literature supports the role of the infant 's olfactory system in the establishment of successful breastfeeding . genes involved in the developing nervous , skeletal and muscle systems were also highlighted in this analysis . there was a wide range of nervous system functions including the development of the brain , spine , central nervous system , neurons , neurites , and ganglions . development of striated muscle ( p = 0.009 ) was significantly upregulated over time , as was developing bone ( p = 0.006 ) and cartilage ( p = 0.005 ) . one of the limitations of this study is that neonatal subjects were followed over several weeks while in the nicu . during that timehowever , by limiting salivary collection to five predefined feeding stages , there was an opportunity to capture , in real - time , gene expression changes directly related to the attainment of safe oral feeding skills . these data support the complexity of oral feeding and further demonstrate how multiple processes involved in oral feeding may be monitored simultaneously in the newborn at the molecular level . of note , statistically significant down - regulated genes were related only to the developing hematological and lymphoid system . there was no obvious link between lymphoid and / or hematological development and oral feeding success that appeared when reviewing the down - regulated pathways and their associated subcategories . while it is possible that the development of the gastrointestinal immune system plays an important role in readiness to feed , our current understanding of these genes prohibits further speculation on their role , if any , in neonatal oral feeding skills . this research demonstrates that with the advent of recent technical advances and high - throughput screening methods , we are able to monitor , in real - time , normal and aberrant developmental processes occurring in the newborn from mere drops of saliva . utilizing this information for the development of noninvasive salivary diagnostic panelsis a novel and exciting aspect of translational medicine . indeed , salivary diagnostic platforms are currently in development for adult patients with oral cancer , breast cancer , sjgren 's disease , pancreatic cancer , melanoma , nonsmall cell lung cancer , acute myocardial infarction , diabetes , and ovarian cancer . these platforms are designed to be utilized at the bedside in order to give an accurate diagnosis within minutes with the use of point - of - care technology currently in development . while these platforms are clinically important , none targets a neonatal or even a pediatric patient population . yetneonates , with their limited blood volumes and clinical fragility , are the ideal patient population on which to apply this technology . compared to our prior analysis which examined global developmental processes in the newborn , the present study focused solely on genes believed to be involved in the attainment of successful oral feeding skills . this targeted analysis of the data is laying the foundation for the development of a neonatal oral readiness to feed salivary diagnostic platform . for example , our laboratory recently determined that salivary detection of one of the genes identified in this data set , neuropeptide y2 receptor ( npy2r ) , a known hypothalamic regulator of feeding behavior , has a 95 % positive predictive value for immature oral feeding skills . a limitation to this biomarkeris that if undetected in saliva , it is only 27 % accurate in determining a safe and effective oral feeding pattern . however , as this work moves forward , other genes identified in this targeted analysis could be incorporated into a comprehensive platform , not only for the development of an accurate and objective diagnostic assay , but also to improve our understanding of aberrant feeding patterns in the newborn ( figure 1 ) . neonatal salivary transcriptomic analysis provides noninvasive and objective information about the learning process of oral feeding in the newborn at the molecular level . these data further confirm the complexities of oral feeding and suggest that the development of feeding behavior is a novel and essential biological component to successful oral feeding . this research lays the foundation for the development of an objective , noninvasive assay for the determination of readiness to feed in the neonatal population in order to reduce morbidities and improve care and outcomes .\noutput:\n" }, { "from": "agent", "value": "background . the development of safe and effective oral feeding skills in the newborn is complex and may be associated with significant morbidities . our understanding of neonatal oral feeding maturation at the molecular level is limited , providing an opportunity to utilize emerging molecular techniques to accurately assess neonatal oral feeding skills . objective . to identify key regulatory genes in neonatal saliva involved in successful oral feeding . methods . previously , our laboratory identified 9,286 genes in saliva that statistically significantly altered their gene expression as premature newborns gained advanced oral feeding skills . in this report , genes previously identified underwent an updated and targeted pathway analysis with ingenuity pathway analysis ( ipa ) to identify potential candidate genes involved in successful oral feeding . genes were considered if they were in the five most significantly up - and down - regulated physiological pathways and were associated with the keywords feeding , digestion and development . results . there were 2,186 genes that met criteria . pathways associated with feeding behavior , cranial nerve development , and the development of the nervous , skeletal , and muscular systems were highlighted . discussion . these data provide important insights into the biological processes involved in oral feeding in the newborn at a molecular level and identify novel pathways associated with successful oral feeding ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the rationale behind artificial insemination is increasing the gamete density at the site of fertilization . since many centuries different pioneers contributed to the history of artificial insemination , not only in humans but even more pronounced in farm animals . the primary reason for using this technique in farm animals was to speed up the rate of genetic improvement by increasing the productivity of food producing animals . this was accomplished by improving the selection differential wherein one highly selected male is mated with thousands of females . the situation is different : artificial insemination was originally developed to help couples to conceive in case of severe male factor subfertility of a physical or psychological nature . nowadays artificial insemination with homologous semen is most commonly used for unexplained and mild male factor subfertility . in the previous century donor inseminationwas mainly used for male infertility due to azoospermia or very low sperm count and for inherited genetic diseases linked to the y - chromosome . nowadays donor insemination is more commonly used in women with no male partner ( lesbians or single women ) . despite the extensive literature on the subject of artificial insemination with husband s semen , controversy remains about the effectiveness of this very popular treatment procedure , particularly in relation to ivf ( in vitro fertilization ) and icsi ( intra - cytoplasmic sperm injection ) ( cohlen 2005 ; ombelet , 2005 ; bensdorp et al . unofficial history claims that the first attempts to artificially inseminate a woman , were done by henry iv ( 1425 - 1474 ) , king of castile , nicknamed the impotent . in 1455 , he married princess juana , sister of afonso v of portugal . spermatozoa were first seen and described by antoni van leeuwenhoek and his assistant johannes ham in 1678 in the netherlands . in a letter to william bounker of the royal society of london ( phil.trans . vol.xii , nbr . 142 , 1678 ) he showed a picture of sperm cells of the human and the dog . living animalcules in human semen ... less than a millionth the size of a coarse grain of sand and with thin , undulating transparent tails . he draws the conclusion that the tails must be operated by means of muscles , tendons and joints ( mol , 2006 ; kremer , 1979 ) . more than 100 years later , in 1784 , the first artificial insemination in a dog was reported by the scientist lazzaro spallanzani ( italian physiologist , 1729 - 1799 ) . this insemination resulted in the birth of three puppy s 62 days later ( belonoschkin , 1956 ; zorgniotti , 1975 ) . it is believed that spallanzani was the first to report the effects of cooling on human sperm when he noted , in 1776 , that sperm cooled by snow became motionless . the first documented application of artificial insemination in human was done in london in the 1770s by john hunter , which has been called in medical history the the founder of scientific surgery . a cloth merchant with severe hypospadias was advised to collect the semen ( which escaped during coitus ) in a warmed syringe and inject the sample into the vagina . j marion sims reported his findings of postcoital tests and 55 inseminations in the mid 1800s . only one pregnancy occurred but this could be explained by the fact that he believed that ovulation occurred during menstruation . he began writing his innovative work clinical notes on uterine surgery , which was controversial but widely read . its revolutionary approach to female diseases was refreshing and its emphasis on treatment of sterility , including artificial insemination , was ahead of its time . in 1897heape , an outstanding reproductive biologist from cambridge , reported the use of ai in rabbits , dogs and horses . heape also studied the relationship between seasonality and reproduction , as a result of his research cambridge became a world centre for reproductive studies . in 1899 the first attempts to develop practical methods for artificial insemination were described by ilya ivanovich ivanoff ( russia , 1870 - 1932 ) . although ivanoff studied artificial insemination in domestic farm animals , dogs , rabbits and poultry , he was the first to develop methods as we know today in human medicine . he was a pioneer in the selection of superior stallions multiplying their progeny through ai . he published his paper on artificial insemination in russia in the journal of heredity in 1938 . milovanov established major projects for cattle breeding and designed the first artificial vaginas , very similar to those used today . the innovating work in russia inspired eduard srensen from denmark to organize the first cooperative dairy ai organization in denmark in 1933 , followed by the introduction of the first ai cooperative in the us in 1938 by ej perry , a dairyman from new jersey . in the us and other western countries the number of ai cooperatives increased rapidly . nowadays more than 90 % of dairy cows are artificially inseminated in the netherlands , denmark and the united kingdom . november 1 , 1939 , the first animal , a rabbit , conceived by artificial insemination was exhibited in the united states at the 12th annual graduate fortnight at the new york academy of medicine . gregory pincus , an american biologist , removed an egg from the ovary of a female rabbit and fertilized it with a salt solution . the egg was then transferred to the uterus of a second rabbit , which functioned as an incubator . considering humans , only after the introduction and availability of donor sperm , artificial insemination became very popular ( aid ) . homologous artificial inseminations were only indicated in cases of physiologic and psychological dysfunction , such as retrograde ejaculation , vaginismus , hypospadias and impotence . with the routine use of post - coital testsother indications were added such as hostile cervical mucus and immunologic causes with the presence of antispermatozoal antibodies in the cervical mucus . the first reports on human artificial insemination originated from guttmacher ( 1943 ) , stoughton ( 1948 ) and kohlberg ( 1953a ; 1953b ) . other important research discoveries in animal studies undoubtly influenced the development of artificial insemination , also in human . phillips and lardy ( 1939 ) were the first to use egg yolk to protect bull sperm cells from temperature shock upon cooling . this protection was explained by the effect of phospholipids and lipoproteins in the egg yolk . ( 1941 ) improved the media by using egg yolk with sodium citrate , permitting the use of semen at 5 c for up to three days . polge and co - workers ( 1949 ) were the first to freeze fowl and bull spermatozoa by using glycerol in the extender media . in 1950cornell university scientists ( new york ) discovered the benefit of antibiotics added to the sperm solution in artificial insemination processes . the so - called cornell extender ( foote and bratton , 1950 ) contained the antibiotic mixture of penicillin , streptomycin and polymyxim b and was used for many years as the standard . jerome k. sherman , an american pioneer in sperm freezing , introduced a simple method of preserving human sperm using glycerol . he combined this with a slow cooling of sperm , and storage with solid carbon dioxide as a refrigerant . sherman also demonstrated for the first time that frozen sperm , when thawed , were able to fertilize an egg and induce its normal development . as a result of this research , considering the hostile climate for di at the time ( the cook county supreme court ruled that artificial insemination with donor semen was contrary to public policy and good morals ) it is not surprising that nearly a decade passed before the first successful birth from frozen sperm was announced in public , a major breakthrough in history . considering all these new developments , it could be expected that in the 1970s the sperm bank industry became very popular and commercialized , especially in the united states . the main reason for the renewed interest in artificial insemination in human was undoubtly the introduction of in - vitro fertilisation ( ivf ) in 1978 by steptoe and edwards . in the early daysthe ejaculate of the husband was inseminated intrauterine without preparation resulting in uterine cramps and increasing the probability of tubal infections . with the arrival of ivf , semen preparation techniqueswere developed and iui regained its popularity , being more safe and painless . these washing procedures are necessary to remove prostaglandins , infectious agents and antigenic proteins . another substantial advantage of these techniques is the removal of nonmotile spermatozoa , either leucocytes or immature germ cells . this may be an important factor in enhancing sperm quality by a decreased release of lymphokines and / or cytokines and a reduction in the formation of free oxygen radicals after sperm preparation . sperm preparation techniques should isolate and select sperm cells with intact functional and genetic properties , including normal morphology , minimal dna damage , and intact cell membranes with functional binding properties . the final result is a better sperm fertilising ability in vitro and in vivo ( aitken and clarkson , 1987 ) and an increasing number of motile sperm that are morphologically normal at the site of fertilization . bypassing the cervix , which acts as a reservoir for sperm , increases the importance of adequate timing of the insemination . most popular are the swim - up procedure , the discontinuous percoll gradient method , the mini - percoll ( small volume ) gradient technique and the use of sephadex columns . novel sperm selection methods ( based on sperm surface charge or nonapoptotic sperm selection ) show promising results . however , they have not yet established themselves in routine practice , and their purpose for aih is unknown ; more evidence is neededas a consequence of these improved sperm selection techniques , the use of artificial insemination became very popular as a first line treatment procedure in case of unexplained and mild male factor infertility . at this moment aih is probably one of the most applied assisted reproductive techniques worldwide . nevertheless , there is still an on - going debate whether or not aih is an effective treatment option for various indications . controversy remains about its effectiveness , particularly in relation to ivf and icsi ( cohlen 2005 ; ombelet , 2005 ; bensdorp et al . , 2007 ; eshre capri workshop group , 2009 ) . the 2013 nice guidelines were very clear with a message that could nt be misunderstood : aih should be abandoned in case of unexplained and moderate male infertility . extended expectant management was recommended although the evidence - based data supporting this recommendation were not convincing at all . recent studies , including a large prospective randomized multicentre study , have shown that aih remains a useful and cost - effective first - line treatment in case of mild male infertility and unexplained infertility with an unfavourable prognosis as compared to the more aggressive techniques such as ivf and icsi ( van rumste et al . , 2014 ; bensdorp et al . , 2015 ; an increasing number of studies highlight the value of aih and support the belief that artificial insemination with husband s semen will remain a widely used treatment option for many couples with cervical factor subfertility , physiologic or psychological sexual dysfunction , mild to moderate male subfertility and unexplained infertility with an unfavourable prognosis ( cohlen and ombelet , 2014 ) . the moral and social implications of artificial insemination were debated in both the medical and popular press in the united states since 1909 , in europe the debate started in the 1940s . the catholic church objected to all forms of artificial insemination , saying that it promoted the vice of onanism and ignored the religious importance of coitus . the main criticism was that artificial insemination with donor semen was a form of adultery promoting the vice of masturbation . after the first successful pregnancy from frozen sperm , reported in 1953 , the development of a thriving sperm - bank industry starting in the 1970s and the commercialization of aid became unavoidable . the growing number of aids raised new concerns leading to new regulations . because of the possible transmission of sexually transmitted diseases , including hiv , when using fresh sperm screening for infections of donors became mandatory . another concern is the possibility to donate semen many times . in order to diminish the chances of unknowing marriage of biological siblings among aid childrensome government regulations tightly restrict the number of times a single donor s semen may be used and / or restrict the number of children by a given donor . sociocultural concerns with biological paternity and the maintenance of the heterosexual , married couple as the basis of the family remain important in many countries . a lot of countries all over the world have not approved the use of ai with donor semen for single women and lesbian couples yet . another point of debate is whether the donor has to be anonymous or non - anonymous , and when to inform and what to tell aid children about their biological parentage , if non - anonymous donors are used . is it possible and / or advisable to use sperm of relatives , such as brothers or the father ? whether or not to pay the donors and sexing of sperm by dna quantification using flow cytometry instrumentation became a point of discussion . the historical story of artificial insemination is a successful one ; the worldwide acceptance of artificial insemination in animals provided the impetus for the innovation and development of many technologies which we are nowadays familiar with such as gamete cryopreservation , ovarian stimulation and cycle regulation , embryo freezing and cloning . many of the principles nowadays used in human artificial insemination are adapted from domestic animal studies , especially from cattle . the use of frozen / thawed donor samples and the renewed interest in sperm washing procedures due to the introduction of ivf were the most important milestones in the history of human artificial insemination . intrauterine insemination with husband s sperm turned out to be a valuable first choice treatment before starting more invasive and more expensive techniques of assisted reproduction for many subfertile patients . the increasing demand of lesbians and single women for ai with donor semen is another challenge in many countries worldwide . many debates , socio - cultural and ethical , are to be expected in the near future . the issue of using anonymous and / or non - anonymous donors will be one of them .\noutput:\n" }, { "from": "agent", "value": "artificial insemination with homologous ( aih ) or donor semen ( aid ) is nowadays a very popular treatment procedure used for many subfertile women worldwide . the rationale behind artificial insemination is to increase gamete density at the site of fertilisation.the sequence of events leading to today s common use of artificial insemination traces back to scientific studies and experimentation many centuries ago . modern techniques used in human artificial insemination programmes are mostly adapted from the work on cattle by dairy farmers wishing to improve milk production by using artificial insemination with sperm of selected bulls with well chosen genetic traits.the main reason for the renewed interest in artificial insemination in human was associated with the refinement of techniques for the preparation of washed motile spermatozoa in the early years of ivf.the history of artificial insemination is reviewed with particular interest to the most important hurdles and milestones ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although the tumor frequently presents as a pleural - based mass lesion , it has been reported from almost every site in the body . with disputed histogenesis , the tumor is now considered to be of mesenchymal origin , which explains the divergent location of this lesion . since the initial description of orbital sft in 1994 , approximately 70 cases of orbital sfts have been reported . however , literature search shows that cytological features of the lesion have been described in very few cases . upon consideration of sft in the differential diagnosis of spindle cell lesions on the basis of typical cytological features , definitive management can be formulated preoperatively in order to prevent its recurrence and an aggressive course following the recurrence . a 50 - year - old male patient presented with multiple swellings over the right eye since 2 years . larger swelling was a firm , pedunculated , and lobulated mass measuring 43 cm over the medial aspect of left upper eyelid involving the palpebral conjunctiva . the second swelling was on the forehead just above the medial aspect of the left eyebrow measuring 33 cm in the subcutaneous plane . the third was on the medial aspect of the bulbar conjunctiva of 11.5 cm size . all the smears were cellular and showed spindle cells in cohesive clusters and in singles lacking polarity . loose cell aggregates of haphazardly arranged spindle cells in a background of amorphous material were also seen . the cells had oval - to - spindle nuclei with bland chromatin and scanty cytoplasm . dense ropy collagen fragments intimately admixed with tumor cells was conspicuous [ figure 1 ] . a diagnosis of spindle cell tumor with the possibilities of sft and neural tumor were considered . ( h and e 40 ) with inset showing tumor cells having bland nuclear chromatin with tapering cytoplasmic ends and naked nuclei in the background . ( pap stain 100 ) the patient later underwent lid construction surgery , during which complete excision of all the three lesions was carried out . on histopathology , a spindle cell tumor was seen with cells arranged in bundles and fascicles . hypo and hypercellular areas , hyalinized blood vessels , and dense collagen were prominent at places [ figure 2 ] . infiltration of adipose tissue and skeletal muscle fibers was seen . on immunohistochemistry ( ihc ) , the tumor cells were diffusely positive for cd34 and negative for s - 100 protein . a final diagnosis of sft was made . tumor displaying hpo and hypercellular areas with hemangiopericytoma - like appearance ( h and e 100 ) sfts are rare soft tissue neoplasms commonly recognized in the pleura , mediastinum , and other serosal sites . because the usual origin is from the pleural surfaces , sft was originally thought to be derived from mesothelial cells . however , occurrence of the lesion at various extraserosal sites , reactivity of neoplastic cells for vimentin , and non - reactivity for cytokeratin favored mesenchymal origin . cd34 reactivity of sft is thought to be consistent with an origin in a mesenchymal progenitor cell . the first case of sft of the orbit was reported in 1994 by dorfman et al . since then , approximately 70 cases of sfts in the orbit have been reported . they may arise from any of the orbital spaces such as medial / superomedial , lateral / superolateral , retrobulbar soft tissues , lacrimal caruncle , and lacrimal gland fossa . as in the present case , soft tissues of the eyelid can also be the site of origin of sft . fnac is considered to be the first - line diagnostic technique for soft tissue swellings . however , due to their complex heterogeneous constituents , soft tissue tumors are a significant diagnostic challenge for the cytopathologists . the cytological features of sft include scant - to - moderately cellular aspirates composed of oval - to - spindle cells in a background of irregular ropy fragments of collagen and a few inflammatory cells . most of the cells are dispersed singly or are present in irregular , loose clusters enmeshed in an eosinophilic collagenous matrix . most consistent features are the presence of stripped nuclei in the background and thick ropy bands of matrix material . on cytology , the cellular features of sft can be found in nodular fasciitis , benign peripheral nerve sheath tumor , smooth muscle tumor , synovial sarcoma , low grade malignant peripheral nerve sheath tumor ( mpnst ) , malignant fibrous histiocytoma ( mfh ) , dermatofibrosarcoma protuberance ( dfps ) , and hemangiopericytoma ( hpc ) . the cells are mainly myofibroblasts with plump spindle - shaped / stellate cells having pale , bland , evenly distributed chromatin and prominent nucleoli . smears from benign peripheral nerve sheath tumors such as schwannoma contain clusters of spindle cells in interlacing bundles against myxoid background . smooth muscle tumors show variable cellularity on aspiration , and unlike sft , isolated cells are not common . in contrast to the cells of sft , smooth muscle tumor cells will have abundant dense cytoplasm and the nuclei are regular , central , and elongated . though pleomorphic and bizarre cells can be observed in both sft and mfh , the classic smear of mfh shows highly cellular pleomorphic spindle cells along with atypical histiocyte - like and giant cells . synovial sarcomas are usually cellular and show a pericapillary arrangement of oval - to - round cells along with the presence of mast cells . low grade fibromyxoid sarcoma and fibrosarcoma may also mimic sft and clinicoradiological details may be of help . the importance of ihc for confirming cytological diagnosis has been emphasized in the present case . however , irregular ropy collagen and presence of stripped nuclei in the background are the prominent and distinctive features in most of the reported cases of sft , including the present case which prompted us to consider sft in the differential diagnosis on the basis of cytology alone . in generalcytology of malignant cases shows hypercellular smears and single cells with moderate degree of nuclear pleomorphism and prominent nucleoli . therefore , the most important prognostic factor of sft is considered to be the complete resectability of the lesion and not the histological appearance . in the appropriate clinical setting , it is possible to make a correct diagnosis of sft on cytology and ihc markers can be judiciously used to establish the diagnosis . however , it is necessary to consider the cytological overlaps to avoid false positive diagnosis . correct preoperative diagnosis on typical cytological appearance permits a wide aggressive resection to avoid recurrence and an aggressive course following recurrence .\noutput:\n" }, { "from": "agent", "value": "solitary fibrous tumor ( sft ) is a distinct and a rare spindle cell neoplasm , commonly known to occur in the pleura and other serosal sites . with the advent of immunohistochemistry , varied extraserosal sites are being recognized as common locations for this rare tumor . we report a case of sft in a 50 - year - old male patient who presented with multiple swellings in the eyelid , with emphasis on the cytological features ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is very important to identify the underlying cause of ear symptoms such as tinnitus and hearing loss . if these symptoms present unilaterally , a retocochlear lesion , vascular lesion or inner ear anomaly should be considered in the diagnostic process . many diagnostic tools have been suggested for use in the evaluation of retrocochlear lesions . however , there is no single novel method to easily evaluate all lesions causing unilateral ear symptoms . since selters first introduced auditory brainstem evoked response ( abr ) as a diagnostic method for retrocochlear lesions , the abr test has been commonly used as a screening test . however , the low sensitivity of the abr test has lowered its diagnostic value as a screening test , especially in small intracanalicular tumors .1,2 ) after the introduction of magnetic resonance image ( mri ) technology , mri testing was applied in the assessment of retrocochlear lesions with high sensitivity and high specificity .3 ) nevertheless , the high cost of conventional mri testing , the use of contrast media and the long image acquisition time might be limitations for using it as a screening tool . recently , three - dimensional fast imaging employing steady - state acquisition ( 3d - fiesta ) images have been introduced .3 d - fiesta imaging can give much higher spatial resolution with outstanding image contrast between the cranial nerves and cerebrospinal fluid . and it has a shorter image acquisition time than conventional mri scan and does not need contrast media .4,5 ) in this study , we aimed to evaluate the usability of 3d - fiesta imaging as a screening tool for inner ear lesions with applying 3d - fiesta image in the diagnostic pathway of the patients with unilateral ear symptoms . from january 2011 to december 2011 , 253 patients who presented with unilateral ear symptoms and underwent 3d - fiesta imaging as a screening were enrolled in this study . patients suspected to have meniere 's disease and complained of bilateral ear symptoms were excluded . all patients underwent 3d - fiesta imaging as a screening tool with a philips achieva ( best , the netherlands ) 3.0 tesla mri scanner . if an inner ear lesion or a brain lesion was suspected on the 3d - fiesta image , an additional diagnostic brain mri scan , a temporal mri scan , or temporal bone ct scans were performed to elucidate the final diagnosis . the images from the screening and diagnostic imaging investigations were reviewed to compare their ability to find various cochlear , retrocochlear or vascular lesions . patients were divided into three groups according to their chief complaint : tinnitus , unilateral hearing loss , and unilateral sudden idiopathic hearing loss , to compare their clinical presentations and radiological results . clinical data and 3d - fiesta results were analyzed to figure out the relationships between the clinical presentations of acoustic neuroma and tumor size . the kruskal - wallis test was applied for the statistical analysis of tumor size using commercially available software ( statistical package for the social sciences , version 17.0 ; spss inc . , chicago , il , usa ) . a p value of 0.05 was considered as statistically significant . among two hundred and fifty - three patients with a unilateral ear symptom , 105 ( 41.5 % ) patients were male and 148 ( 58.5 % ) were female . tinnitus was the most common symptoms of patients ( 129 , 49.6 % ) , sudden sensory neural hearing loss was the second most common ( 83 , 31.9 ) and unilateral hearing loss was the next most common ( 41 , 15.7 % ) . in the 3d - fiesta imaging results , acoustic neuroma was the most common retrocochlear lesion in patients with unilateral ear symptoms in this study ( fig . twelve patients were diagnosed with acoustic neuroma ( figs . 2 - 4 ) , and four patients were confirmed as having enlarged vestibular aqueduct syndrome ( fig . other lesions such as a congenital anomaly , a vascular lesion , a mass and acute infarction could be detected with 3d - fiesta imaging ( figs . we also tried to figure out the association between clinical symptoms and the final diagnosis . six patients who initially presented with tinnitus were diagnosed with acoustic neuroma and two patients were diagnosed with posterior inferior cerebellar artery aneurysm . abnormal findings in 3d - fiesta images in patients with hearing loss were acoustic neuroma , enlarged vestibular aqueduct syndrome , inner ear anomaly and 8th nerve hypoplasia ( table 1 ) . the mean size of acoustic neuromas which were finally diagnosed was 1714 mm ( 43 - 6264 mm ) , the mean size of tumors in the tinnitus group , unilateral hearing loss group and sudden idiopathic sensorineural hearing loss group was 1310 mm , 5223 mm , and 119 mm respectively . table 2 shows the clinical characteristics of patients who were finally diagnosed with acoustic neuroma . the mean tumor size of the unilateral hearing loss group tended to be smaller than that of other groups . however , we could not find any significant correlation between the groups ( p = 0.582 ) . in patients with unilateral ear symptoms , it is important to approach these patients with a high index of suspicion for cochlear or retrocochlear lesions such as an inner ear anomaly , tumor , vascular or inflammatory lesion . with conventional audiologic testing , retrocochlear lesions can be suspected by a relatively low speech discrimination score or low score in the short increment sensitivity index test . retrochoelar lesions were diagnosed more easily after computed tomography ( ct ) and the abr test were introduced .6,7 ) but the temporal bone ct scan is inadequate for screening tool due to the high false or negative positive rate for the diagnosis of retrocochlear lesions especially in the case of acoustic neuroma . abr test has been used as a favored screening tool for retrocochlear lesions ; this test compares the amplitude and latency of waves produced by the auditory pathway . however , barrs , et al. 8 ) reported that even though abr demonstrated 97 % of the tumorsruckenstein , et al. 9 ) reported that the abr screening test for retrocochlear pathology had a sensitivity of 63 % and a specificity of 64 % . these findings imply that abr probably has a limited role in acoustic neuroma screening . after the application of mri for the diagnosis of retrocochlear lesions began in the 1980s , the specificity and sensitivity of mri was found to be up to 100 % and it became to be considered the most accurate diagnostic tool .10,11 ) but mri is a very expensive test and it takes 40 - 60 minutes to get images with contrast . thus , mri has limitations as a screening test due to the low cost and time effectiveness . with the development of the image acquisition technique with mri , new protocols for 3d - fiesta sequences were introduced which provided much higher spatial resolution and clearer depiction of small structures such as cranial nerves especially within the cisternal spaces . the 3d - fiesta uses an ultrafast pulse sequence that produces 0.3 mm thin section high resolution images with outstanding image contrast between the cerebrospinal fluid , vessels and cranial nerves . it usually takes 5 to 7 minutes to get a proper image and does not need contrast media . the cost of 3d - fiesta is just 1/5 - 1/6 that of conventional mri . so it could be a very effective test protocol for the screening of retrocochlear lesions in patients with unilateral ear symptoms . in this study , variable lesions such as small tumors less than 5 mm , inner ear anomalies and vascular malformations could be identified using 3d - fiesta imaging . and there is one report which showed that with 3d - fiesta , there was decreased vestibular signal intensity on the affected side in patients with vestibular schwannoma , but that this was not present in those with cerebellopontine angle meningiomas or in normal subjects .12 ) recently , mri with high - dose contrast media has been introduced for detecting cochlear endolymphatic hydrops .13 ) 3d - fiesta images have a limitation in detecting inner ear lesions ; however , 3d - fiesta images can detect inner ear anomalies so it may be sufficient to use as a screening tool for retrocochlear lesions . acoustic neuroma , one of the most common retrocochlear lesions , is a benign tumor originating from the vestibular nerve sheath in the internal auditory canal . in the early stage of acoustic neuromas , symptoms can be nonspecific but as the tumor grows , progressive unilateral hearing loss and tinnitus are typical symptoms . it is well known that about 10 to 20 % of acoustic neuroma patients can be present with sudden sensorineural hearing loss , and on the other hand only 1 to 3 % of sudden seonsorineural hearing loss patients have acoustic neuroma .14 - 16 ) in this study , 9.7 % of unilateral hearing loss patients , 4.6 % of unilateral tinnitus and 2.4 % of sudden sensorineural hearing loss patients were diagnosed with acoustic neuroma . the mean size of acoustic neuroma varied from a tiny tumor smaller than 5 mm to a large tumor up to 64 mm . the mean size of the tumor in the sudden hearing loss patients group was larger than the other two groups , but there was no statistically significant difference between the groups . in addition to acoustic neuroma , many retrocochlear lesions , intracranial masses and acute infarctions can be diagnosed with screening using 3d - fiesta imaging . with these findings , we suggest that 3d - fiesta imaging could be a reliable screening test for patients who complain of unilateral otologic symptoms . but considering that this study was a simple retrospective observational study , further comparative study investigating the sensitivity and specificity of 3d - fiesta imaging will be required .3 d - fiesta imaging is a cost - effective and sensitive method for the diagnosis of cochlear or retrocochlear lesions .3 d - fiesta imaging is a useful screening tool for patients with unilateral ear symptoms .\noutput:\n" }, { "from": "agent", "value": "background and objectivesunilateral auditory dysfunction such as tinnitus and hearing loss could be a warning sign of a retrocochlear lesion . auditory brainstem response ( abr ) and internal auditory canal magnetic resonance image ( mri ) are suggested as novel diagnostic tools for retrocochlear lesions . however , the high cost of mri and the low sensitivity of the abr test could be an obstacle when assessing patients with unilateral ear symptoms . the purpose of this study was to introduce the clinical usefulness of three - dimensional fast imaging employing steady - state acquisition ( 3d - fiesta ) mri in patients with unilateral ear symptoms.subjects and methodstwo hundred and fifty - three patients with unilateral tinnitus or unilateral hearing loss who underwent 3d - fiesta temporal bone mri as a screening test were enrolled . we reviewed the abnormal findings in the 3d - fiesta images and ear symptoms using the medical records.resultsin patients with unilateral ear symptoms , 51.0 % of the patients had tinnitus and 32.8 % patients were assessed to have sudden sensory neural hearing loss . with 3d - fiesta imaging , twelve patients were diagnosed with acoustic neuroma , four with enlarged vestibular aqueduct syndrome , and two with posterior inferior cerebellar artery aneurysm . inner ear anomalies and vestibulocochlear nerve aplasia could be diagnosed with 3d - fiesta imaging.conclusions3d - fiesta imaging is a highly sensitive method for the diagnosis of cochlear or retrocochlear lesions . 3d - fiesta imaging is a useful screening tool for patients with unilateral ear symptoms ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: obesity is an independent risk factor for chronic diseases , such as diabetes , cardiovascular disease ( cvd ) , and some cancers , which are the leading causes of deaths worldwide . according to the world health organization , 44 % of diabetes , 23 % of ischemic heart disease , and 7 % to 41 % of some cancers are attributable to overweight and obesity . the rising incidence of chronic diseases associated with obesity does not spare developing countries ( dcs ) even low - income ones . who estimates that if appropriate preventive measures are not taken , 20 million deaths by 2015 will be due to cvd and 80 % of this mortality burden will occur in dcs . changes in lifestyle and diet that characterize the ongoing nutrition transition contribute to the outbreak of obesity in dcs . abdominal obesity ( ao ) is a more potent risk factor than gynoid or general obesity . several studies have shown that africans and peoples of african descent have less visceral fat than whites , regardless of gender , age , total body fat , and bmi . the prevalence of metabolic syndrome ( mets ) is reportedly lower among african americans than in caucasians while the prevalence of cvd and insulin resistance is higher . in a nested study of african descent haitians living in montreal and white subjects paired for age , sex , and bmi , haitians had significantly less visceral fat than whites for the same waist circumference ( wc ) . in the large interheart study in 52 countries , the association of myocardial infarction risk with abdominal obesity was higher in europeans than in blacks due to less visceral fat in the latter than the former . the relationship between obesity and other cardiometabolic risk ( cmr ) factors in africans is poorly documented . the prohibitive cost of treatment of obesity - related diseases , both for the patient and the health system , mainly in developing countries , requires that increased attention be paid to cmr assessment . the challenge of addressing cmr factors is especially complex in sub - saharan settings where epidemiologic data related to risk factors are not readily or reliably available at present . the purpose of our study was to assess changes in cmr factors in sub - saharan africans according to baseline obesity status and taking account of diet and lifestyle . we hypothesized that obesity as currently defined by standard anthropometric criteria is weakly associated with unfavourable changes of other cmr factors . this prospective observational study was conducted among benin ( west africa ) adults who were initially in apparent good health . subjects ( n = 541 ) aged 2560 years were randomly selected by multistage sampling and were enrolled in baseline study on cmr factors and nutrition transition . subjects were selected in cotonou , the largest urban city ( n = 200 ) , ouidah , a small - size city located 45 km away from cotonou ( n = 171 ) , and the rural area surrounding ouidah ( n = 170 ) using location data ( urban ) or after enumeration of compounds ( semiurban and rural ) . eligible participants were beninese - born subjects having lived in the study area for at least six months . subjects with a prior diagnosis of hypertension , diabetes or cardiac condition were excluded , but those diagnosed for high blood pressure or diabetes during the baseline study or at followup remained in the cohort , whether or not they received medical treatment . details of sample size determination and sampling process were published elsewhere . after the baseline study ( t0 ) , subjects were followed up after 24 months ( t1 ) and 48 months ( t2 ) . a final sample size of 350 was deemed sufficient to achieve 80 % statistical power with a significance level ( alpha ) of 0.05 using logistic regression on blood pressure as main dependent variable . data were collected between june 2005 and october 2010 by the same investigator team as the baseline study . a laboratory technician handled the blood samples . before each biochemical data collection , participants were informed on the practical arrangements that were prior to blood sampling : ( 1 ) an overnight fast of at least 12 hours , ( 2 ) no alcohol for at least 48 hours , and ( 3 ) no intense physical activity on the previous day . subjects were organized into self - help groups by area of residence to facilitate followup and for active prevention support once the followup study would be over . apart from contacts for formal followup data collection , self - help groups were encouraged to meet every three months for weight and blood pressure checks , and for standard general health advice . anthropometric and blood pressure data that were collected during these meetings were not used in the followup study reported here . anthropometric variables included body weight , height , and wc that were measured according to standard procedures . it was measured to the nearest 0.1 cm at the midpoint between the lower rib margin and the iliac crest while subjects were standing and breathing normally . we used a flexible nonstretch measuring tape at baseline survey and at the first followup . a flexible nonstretch measuring tape ( gulick ) equipped with an estimator of the applied tension during measurement was used in the last followup . two measures of wc were taken for each subject and the mean of the two readings was used in the analyses . generic cutoff values for ao ( 80 and 94 cm for women and men , resp . ) were used , as recently recommended by several organizations for sub - saharan africans , in the absence of specific values . body weight was measured on subjects in fasting with light clothing and without shoes to the nearest 0.1 kg using a mechanical scale that had maximum capacity of 150 kg ( seca , germany ) . height was measured once at baseline to the nearest 0.1 cm with a commercial stadiometer ( seca , germany ) . body mass index ( bmis ) cutoffs for underweight ( 18.5 ) , overweight ( 2529.9 ) , and obesity ( 30 ) were as defined by who . systolic and diastolic blood pressure was measured on the right arm of seated subjects after a 10 - minute rest . the interval of time between the first and the second reading was at least 20 minutes . high blood pressure was defined as systolic blood pressure ( sbp ) 130 mmhg and or diastolic blood pressure ( dbp ) 85 mmhg . blood samples were collected in the morning after a 12 - hour overnight fast and were centrifuged within two hours in the biochemistry laboratory of the institute of applied biomedical sciences in cotonou . using standard enzymatic laboratory methods , fasting glycemia , and serum concentrations of total cholesterol , the ratio of total cholesterol / hdl - c ( tc / hdl - c ) was computed . abnormal values were defined as : elevated triglycerides ( 1.70 mmol / l ) ; high fasting glycemia ( 5.6 fasting insulin was assayed using elisa method with ibl kits ( ibl , hamburg ) . insulin resistance cutoff was the 75th centile of homa - ir ( homeostasis model assessment , insulin resistance ) in the whole sample of subjects . the selected cutoffs for high tc / hdl - c were 4 for men and 5 for women . cmr factors considered in the study along with ao according to wc or high bmi ( overweight / obesity ) were high blood pressure , high fasting glycemia , insulin resistance ( based on homa - ir ) , low hdl - c , high tc / hdl - c , and high triglycerides . in counting cmr factors , high fasting glycemia or ( newly diagnosed ) diabetes , or insulin resistance were considered as one risk factor . dyslipidemia as one risk factor was defined as low hdl - c , high tc / hdl - c , or high triglyceride concentration . ses was assessed at baseline using a household amenity score as proxy of household income , much like in several demographic and health surveys in africa . the items include type of latrine ; paid domestic help ; ownership of land , motorcycle , car , television , mobile phone , land line phone , and refrigerator ; electricity , running water in the house ; type of fuel used for cooking ; wall and floor materials . the ses score was computed separately in each site and tertiles were used in analyses . dietary intake was computed at baseline on the basis of two or three nonconsecutive 24 - hour food recalls conducted over an average period of one month . diet quality was appraised with several scores including a micronutrient adequacy score which was significantly associated with cmr in the cross - sectional study ( unpublished data ) and is therefore used in the present study . the micronutrient score was based on adequacy of intake of 14 micronutrients ( vitamins a , b6 , b12 , c , and e , thiamine , riboflavin , niacin , pantothenic acid , folic acid , magnesium , calcium , iron , and zinc ) according to who / fao recommended dietary intakes for age and sex . alcohol consumption is expressed in the present study as mean quantity of pure alcohol per day . regarding smoking , we distinguished three categories : smokers , ex - smokers , and nonsmokers . for alcohol and tobacco , participants were asked about all their previous day 's activities , from the time they got up to the moment they went to bed . time spent in bed , in various modes of transportation , for main and secondary occupations , for house chores , and for leisure activities was computed from the daily estimated schedule . the intensity level of each activity was estimated in metabolic equivalents ( mets ) . based on who guidelines for the prevention of chronic diseases , we classified subjects as active ( 3 met , 30 min / day ) and inactive ( 3 met , 30 min or 3 met , any duration ) . the differences in cmr factors at baseline and at last followup according to anthropometric status were assessed using chi test . the incidence rate was computed as the number of new cases during the four years divided by the number of subjects without the risk factor at baseline . the relative ( rr ) risk of developing one or the other cmr factor during the course of the followup was assessed using multiple logistic regression models while controlling for baseline age , diet ( micronutrient intake adequacy score ) , and lifestyle ( alcohol consumption and physical activity ) , as well as wc change between t0 and t2 . the study was approved by the ethics committee of the faculty of medicine ( university of montreal ) and by the ministry of health in benin . written informed consent was obtained from each participant before enrolment . the participants were all informed individually of their blood pressure and the results of laboratory tests . out of 622 eligible subjects , a total of 541 completed the study , giving a response rate of 86.9 % . the participation rates were 76.7 % ( 415 out of 541 ) in first followup and 76.9 % ( 416 out of 541 ) in the second followup ; 67.7 % ( 366 out of 541 ) had complete followup data . baseline characteristics of subjects who attended both followups and those who missed one or the other ( table 1 ) were not significantly different except for age , anthropometric status ( in men only ) , and place of residence . average age was higher by roughly two years in men and women with complete data compared to those with incomplete data . a lower proportion of subjects were available for followup in the large city than other locations . obesity - related parameters were significantly higher in men with complete followup than in those with incomplete data . socioeconomic status , diet , and lifestyle were not significantly different in the two groups , however . statistical analyses were performed on subjects with complete data ( n = 366 ) ( figure 1 ) . at baseline , indeed , one man for three women had ao . similarly , one man for two women was obese or overweight based on bmi . table 2 gives the prevalence rate of cmr factors at baseline according to anthropometric status of subjects . initial prevalence of cmr factors was generally higher in obese or overweight subjects compared to those with normal anthropometric status at onset of study , whether on the basis of wc or bmi . the prevalence of hypertriglyceridemia and fasting hyperglycemia was low and not significantly different in obese and nonobese subjects . in ao subjects , only 16.6 % of women and 6.2 % of men were free from other cmr factors . similarly , only 19 % of women and 13.6 % of men who were overweight / obese ( bmi 25 ) at baseline presented no additional cmr factor . in both men and women , the proportion of subjects without any of the cmr factors considered was significantly higher in the nonobese or overweight . the difference was particularly marked in men , with at least a threefold increase in the proportion of cmr - free subjects among the nonobese or overweight . table 3 shows that the prevalence of most cmr factors increased significantly over the four - year followup in both men and women , even hypertriglyceridemia which was low and remained so . of note , subjects who went on medical treatment for high blood pressure ( n = 30 ) are included in the prevalence figures , and those being treated for diabetes with insulin or oral hypoglycemiants ( n = 3 ) are included in high fasting glycemia and insulin resistance . it is reminded that at baseline , already diagnosed cases of hypertension or diabetes were excluded from the cohort . there was over the four - years a significant decrease of high blood pressure prevalence . the rate of general overweight / obesity tended to increase , and that of ao increased significantly , but only in women . in men , only an upward trend for overweight / obesity was observed . figure 2 provides more detail on the evolution of bmi and wc status . in women , overall and abdominal obesity increased significantly . in men , overall obesity and ao rates remained low over the followup period ; a nonsignificant upward trend was only observed for overweight , and not for overall obesity . compared to the nonobese , ao subjects exhibited a significantly higher incidence rate of high tc / hdl - c ( p = 0.002 ) , as shown in table 4 . the incidence rate of insulin resistance tended to be higher in ao subjects ( p = 0.051 ) . subjects who had to go onto medical treatment for high blood pressure or diabetes are included in the incidence figures . at the end of the followup period , the total number of new cases was 81 for low hdl - c , 58 for high tc / hdl - c , 83 for insulin resistance , 59 for high fasting glycemia , and 11 for diabetes , while there were 19 new cases of high blood pressure , including the subjects under medical treatment ( data not shown ) . in table 5 , the relative risk ( rr ) of onset of cmr factors during the followup period according to obesity status is shown separately for men and women , before and after adjusting for wc changes , age , diet , and lifestyles . rr could not be computed for other cmr factors because of too small numbers . in women , in contrast , in men , the rr of onset of dyslipidemia was three - to four - fold in subjects exhibiting initial ao compared to the nonobese in the nonadjusted model . controlling for wc changes and initial diet and lifestyle profile further increased the likelihood of dyslipidemia up to seven times . the study examined the evolution of cardiometabolic risk ( cmr ) factors according to baseline obesity status , while controlling for confounding factors , as well as for obesity change over the followup period . we had to combine overweight and overall obesity ( bmi 25 ) because of the small number of men with overall obesity ( bmi 30 ) . furthermore , results were examined primarily for ao using wc cutoffs as suggested by several organizations ( in an attempt to harmonize the definition of mets ) in the absence of specific values for sub - saharan africans , since ao is considered to be associated with higher risk than general obesity . however , we observed the same trends when considering overweight / obesity based on bmi instead of ao based on wc ( data not shown ) . one practical implication is that until specific cutoff points for obesity ( general or abdominal ) against chronic disease endpoints are validated in sub - saharans africans , bmi cutoff for overweight and wc cutoffs of 80 cm ( for women ) and 94 cm ( for men ) for ao might be used interchangeably for screening . only 16.6 % of women with abdominal obesity at baseline had no other cmr factor , and the proportion was still lower among ao men ( 6.2 % ) . nonetheless , we were able to verify whether baseline ao was associated with a more adverse evolution of other cmr factors , at least during a followup period of four years . the cmr factors studied , except for the high tc / hdl - c ratio , are usually examined together as the metabolic syndrome ( mets ) , which is a clustering of some of the following : high blood pressure , dysglycemia , dyslipoproteinemia , and abdominal obesity . however , as we wanted to isolate obesity and assess its impact on the evolution of other cmr factors , we considered the risk factors separately . another justification for not collapsing the cmr factors into the mets is that mets phenotypes vary widely according to race - ethnicity . high triglyceride concentrations , for instance , are not common among africans while hypertension is highly prevalent . in populations at risk for cvd , it was reported that tc / hdl - c ratio would identify more at - risk subjects than framingham risk scores . furthermore , tc / hdl - c showed the largest area under the curve of homa - ir compared with other lipid components or ratios in indian diabetics . control variables were those found to be significantly associated with one or the other cmr factor in the baseline study : age , physical activity , alcohol consumption , and dietary micronutrient adequacy as the only significant diet quality score . the study confirmed that obesity , which is widespread among women , was associated with elevated cmr in this sub - saharan population . except for high blood pressure , an upward trend of cmr markers was observed over the four - year followup both in obese and non obese individuals . the incidence of high tc / hdl - c was significantly higher in ao than nonobese subjects . the significantly higher relative risk of onset of dyslipoproteinemia in ao men ( not significant in women ) over the followup period , even in the adjusted model , suggests that ao as currently defined using nonspecific cutoffs may be associated with higher cmr in men than women . this is consistent with a recent cross - sectional study in senegal that reported less favourable cmr profiles in men than women in general , with lower hdl - c concentrations . according to a recent review , higher hdl - c may be considered a gender - specific protective factor in women . however , longitudinal studies of longer duration and in larger cohorts , using not only cmr factors but also disease end points would be required to confirm the findings . because of the small number of new cases of high blood pressure and high hypertriglyceridemia , for instance , we were unable to perform logistic regression on these risk factors . the higher observed prevalence of obesity among women than men is consistent with other studies in sub - saharan africa . this may be partly explained by the on - going nutrition transition process in dcs with major shifts in diet and lifestyle patterns under the influence of urbanization , globalization , and economic growth . the observed downward trend for wc among obese subjects , at least in women , whereas the trend was positive in the nonobese , may reflect this nutrition transition process , with normal subjects progressively moving towards more abdominal adiposity ; or else , these opposite trends reflect the phenomenon of regression to the mean . in our study , the baseline proportion of insulin - resistant subjects was significantly higher in obese compared with non obese whereas no difference was observed for high fasting glycemia . furthermore , the incidence of hyperglycemia was not different in obese and non obese while the incidence of insulin resistance tended to be higher in the obese . indeed , under normal conditions , the pancreatic islet - cells increase insulin release to overcome the reduced efficacy of insulin action , thereby maintaining normal glucose tolerance . for obesity and insulin resistance to be associated with high fasting glycemia , - cells must be unable to compensate fully for decreased insulin sensitivity . several studies reported the association of obesity and insulin resistance in obese africans based on bmi , waist / hip ratio , or wc . however , the duration of obesity is reportedly critical , but we did not have this information . low hdl - c was the most prevalent cmr factor in the last followup , in both men and women ( 47.3 % and 30.3 % , resp . ) . concurrently , the incidence rate of high tc / hdl - c was markedly higher in obese subjects . this is consistent with studies showing that low hdl - c is a major dyslipoproteinemia phenotype in obese africans . in fact , studies show a gradual decrease in hdl - c levels in africa , over the last three decades . this decreasing trend in hdl - c levels can be attributed to the urbanization of african populations and changes in diet and physical activity . as suggested by some authors , a longer life expectancy and more access to abundant food may contribute to increased prevalence of low hdl - c in developing countries . the downward trend of blood pressure means as observed in our study over four years , even excluding subjects under treatment for hypertension , can not be fully explained , although some authors reported a weak link between obesity and high blood pressure in africans while others observed an association , for instance in rural communities in south nigeria . several cross - sectional studies in non - africans reported the deleterious effect of obesity on blood pressure . the etiologic mechanism linking obesity and hypertension is the stimulation of sympathetic tone and the activation of the renin - angiotensin - aldosterone system mediated by adipocyte hormones . since blacks had less visceral fat , this relationship between obesity and blood pressure may be weaker than in caucasians . another possible explanation for the reduction of mean blood pressure during the study is that individuals became more aware of their blood pressure as it was checked in the self - help groups , making them more receptive to the general health advice given to them . however , when controlling for participation in group meetings , the results were unchanged ( data not shown ) so that self - help groups may not be considered as confounders . nevertheless , this does not exclude that subjects adopted a more preventive diet and lifestyle , which can not be verified . we can not totally exclude either technical error measurements since blood pressure was not measured by the same medical team throughout the study , although measurement techniques were standardized . first , only 68 % of baseline participants had complete data and were included in the analysis , since significant differences in age , anthropometric status ( bmi and wc ) and location were observed between subjects lost to followup and those with complete followup at t1 and t2secondly , the relatively short followup period did not allow collecting sufficient data on hard endpoints ( incidence of diabetes , cvd , or cancer ) to fully assess the risk associated with obesity status . thirdly , we did not have information on whether weight loss , when it occurred , was intentional or not . finally , the study was only conducted in the southern part of benin and therefore , extrapolation of the findings to other population groups requires caution . these limitations notwithstanding , the study has major strengths , including that it is the first prospective population - based study in sub - saharan africa which addresses the issue of cardiometabolic risk factor changes according to ao . additionally , we were able to control for several lifestyle variables in order to explore the independent effects of baseline ao status in men and women . abdominal obesity as defined by high waist circumference ( generic cutoffs suggested for sub - saharan africans ) was associated with higher cmr at baseline and over the four - year followup period , except for high blood pressure , in initially apparently healthy benin adults . based on our findings , there was a worsening trend of cmr factors during the followup period among the abdominally obese subjects , and particularly for cholesterol profile among men . the lack of association between baseline obesity and blood pressure changes suggests that the effect of obesity on the latter may not be important in the study population . larger longitudinal studies of longer duration in sub - saharan africans are needed to confirm our findings .\noutput:\n" }, { "from": "agent", "value": "the study examined whether abdominal obesity ( ao ) according to waist circumference was associated with more unfavourable changes in other cardiometabolic risk ( cmr ) factors in sub - saharan africans . the study included 541 randomly selected and apparently healthy subjects ( 50 % women ) aged 2560 years . complete data at baseline , 24 , and 48 months later was available in 366 subjects . ao was associated with higher cmr at baseline and over the follow - up period , except for high blood pressure . a significantly higher incidence of high ratio of total cholesterol : hdl - cholesterol ( tc / hdl - c ) was associated with ao . controlling for wc changes , age , baseline diet , and lifestyles , the relative risk ( rr ) of low hdl - c and high tc / hdl - c was 3.2 ( 95 % ci 1.069.61 ) and 7.4 ( 95 % ci 2.0125.79 ) , respectively , in ao men ; the rr was not significant in women . over a four - year period , ao therefore appeared associated with an adverse evolution of cholesterolemia in the study population ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the patients often suffer from metabolic disorders or even develop metabolic syndrome ( ms ) despite manifesting anovulation and signs of hyperandrogenism , such as hirsutism and acne . disturbance of carbohydrate metabolism , which is manifested by insulin resistance ( ir ) and / or compensatory hyperinsulinemia , is now known to be intrinsic to pcos , and contributes in a major way to its pathogenesis . there is considerable evidence suggesting a causal link between hyperinsulinemia and increased ovarian androgen production . ovarian theca cells , which express key enzymes of androgen production , such as 17 - hydroxylase / c1720 lyase cytochrome p50 ( cyp17 ) , and their transcription factors , for example , gata family of zinc finger transcription factor gata - binding factor 6 ( gata6 ) , are the major place of androgen producing in ovary . theca cells from pcos ovaries which have been correlated to increased expression and / or activity of cyp17gata6 gene transcription and the stability of messenger rna ( mrna ) were reported to be increased in pcos theca cells . studies have been conducted regarding the mechanisms of insulin action in women with pcos using fibroblasts , adipocytes and skeletal muscle cells . activation of the insulin receptor increases phosphorylation of intracellular substrates , principally insulin receptor substrate ( irs ) proteins . four irs proteins ; irs - 1 , irs - 2 , irs - 3 , and irs - 4 ; have been identified . phosphorylated irs links activated insulin receptors with mediators of downstream signaling , including phosphatidylinositol -3-kinase ( pi3k ) , fyn , grb - 2 , and crk . andalthough there is evidence for alterations in the proximal insulin signaling events in pcos , the effects of ir in pcos on theca cell androgen production remain exclusive . mirnas are endogenous 22 nucleotide - long , highly conserved , noncoding rnas which , in general , negatively regulate gene expression . functional analysis of mirnas has revealed their significant regulatory influence on the expression of target genes involved in both physiologic and pathologic conditions . however , recent studies focus mainly on the relationship of mirnas expression and the reproductive disorders of pcos patients . and the mirna profile of pcos ovaries , especially theca tissue has not been reported . herein , we hypothesized that the mirna profile of pcos ovaries were different from those of non - pcos ones . we screened mirnas in theca tissue by mirna microarray and then performed quantitative reverse transcriptase polymerase chain reaction ( qrt - pcr ) assays to validate them . results of the present study revealed that pcos is associated with differential expression of regulatory noncoding mirnas in human ovarian theca tissue . all procedures for collection of tissue were approved by the ethics board of memorial hospital of sun yat - sen , sun yat - sen university . ovarian theca tissue was obtained with written informed consent from premenopausal women ( aged 2035 years ) undergoing laparoscopy and / or ovarian wedge resection . all the subjects were screened with an emphasis on menstrual regularity , gynecologic and endocrinologic history , hirsutism , acne , use of birth control pills , or hormone medications ( continuous progestin , glucocorticoids , or an insulin sensitizer ) in 3 months before surgery . the diagnosis of pcos was made according to the established guidelines from revised 2003 consensus on diagnostic criteria . in our study , pcos subjects should meet at least two of the following criteria : oligo - and / or anovulation ( e.g. , eight menstrual periods in a year or menstrual cycles more than 35 days in length ) ; clinical hyperandrogenism ( e.g. , acne or modified ferrimangallwey ( mfg ) scores 6 ) ; and / or biochemical hyperandrogenism ( i.e. , serum total testosterone ( tt ) 2.6 nmol / l , free testosterone ( ft ) 6.0 pg / ml , and tt and ft normal values were determined by the clinical laboratory of the gynecology department at the sun yat - sen memorial hospital , sun yat - sen university ) ; and polycystic ovaries ( e.g. , the presence of 12 follicles in each ovary measuring 29 mm in diameter ) after exclusion of other etiologies ( e.g. , congenital adrenal hyperplasia , androgen - secreting tumors , and cushing 's syndrome ) . homeostasis model assessment ( homa ) was applied to estimate the degree of ir . the equation used to obtain this value is as follows : homa - ir = ( fasting plasma glucose ( mmol / l ) insulin ( mu / ml ) ) / 22.5 . homa - ir 2.14 were considered insulin resistant according to our previous study . ovarian theca tissue samples were obtained from subjects included in this study based on the criteria mentioned above . theca interna was stripped from the follicle wall , and the granulosa cells were removed . samples were immediately placed in rnalater ( invitrogen , carlsbad , ca ) and stored at 20c . total rna are harvested using trizol ( invitrogen ) and rneasy mini kit ( qiagen ) according to manufacturer 's instructions . rna concentration was assessed using nanodrop nd - 1000 , accepting a ratio of 2.0 for sample absorbance at 260/280 . total rna samples were analyzed by kangchen ( kangchen bio - tech ) for mirna microarray experiments . procedures were performed as described in detail on the website of kangchen ( http://www.kangchen.com.cn ) . the samples are labeled using the mircury hy3 / hy5 power labeling kit and hybridized on the mircury lna array ( v. 16.0 ) . this most recent version of the array ( v. 16.0 - hsa , mmu , and rno array ) contains more than 1,700 capture probes , covering all mirnas annotated in mirbase 16.0 , as well as all viral mirnas , related to these species . signal intensities were normalized using the global lowess ( locally weighted scatterplot smoothing ) regression algorithm . normalized data = ( foreground - background ) / median , the median is 50 % quantile of mirna intensity , which is larger than 50 in all samples after background correction . the analysis of mirna predicted targets was determined using the algorithms of targetscan 6.2 , pictar , mirbase , and miranda . mirnas which may interact with cyp17 , gata6 , irs - 2 , and glycogen synthase kinase - 3 ( gsk3 ) were searched using targetscan 6.2 . qrt - pcr analysis was performed to validate the mirna microarray results in this study . the specific stem - looped rt - pcr primers to representatives of differentially expressed mirnas ( mir - 200a , mir - 141 , mir - 200c , mir - 502 - 3p , mir - 32 , mir - 92a , mir - 92b , mir - 19a , mir - 1 , and let - 7 g ) were designed according to a previous study , and are summarized in table 1 . mirna - specific rt primers mirna : micro - ribonucleic acid ; rt : reverse transcriptase . real - time pcr analysis was performed on gene amp pcr system 970 ( applied biosystem ) with 8 l volume reaction containing 2 l reverse transcription product , 0.8 l pcr specific primers ( 10 mol / l ) , and 25 mmol / l mgcl2 , and h2o . the reactions were incubated in 96 - well plates at 95c for 3 minutes , following by 40 cycles ( 95c for 15 seconds , 60c for 20 seconds , 72c for 20 seconds , and 78c for 20 seconds ) , then ramped from 72c to 99c to obtain the melting curve . the relative quantity of each mirna in pcos ovarian theca tissues , normalized to u6 rna and relative to the expression in non - pcos theca tissues , was calculated using the equation rq = 2 , where ct = ( ctmirna ctu6 rna ) pcos ( ctmirnactu6 rna ) meannon - pcos and ct is the threshold cycle to detect fluorescence . for microarray data , the threshold value we used to screen up and down regulated mirnas is fold change 1.50 and fold change 0.67 . for rt - pcr data , statistical analysis was performed in statistical package for social sciences ( spss ) 16.0 for windows ( spss inc ) . two - tailed t - test was used for statistical evaluation of mirna expression differences with significance accepted at p 0.05 . all procedures for collection of tissue were approved by the ethics board of memorial hospital of sun yat - sen , sun yat - sen university . ovarian theca tissue was obtained with written informed consent from premenopausal women ( aged 2035 years ) undergoing laparoscopy and / or ovarian wedge resection . all the subjects were screened with an emphasis on menstrual regularity , gynecologic and endocrinologic history , hirsutism , acne , use of birth control pills , or hormone medications ( continuous progestin , glucocorticoids , or an insulin sensitizer ) in 3 months before surgery . the diagnosis of pcos was made according to the established guidelines from revised 2003 consensus on diagnostic criteria . in our study , pcos subjects should meet at least two of the following criteria : oligo - and / or anovulation ( e.g. , eight menstrual periods in a year or menstrual cycles more than 35 days in length ) ; clinical hyperandrogenism ( e.g. , acne or modified ferrimangallwey ( mfg ) scores 6 ) ; and / or biochemical hyperandrogenism ( i.e. , serum total testosterone ( tt ) 2.6 nmol / l , free testosterone ( ft ) 6.0 pg / ml , and tt and ft normal values were determined by the clinical laboratory of the gynecology department at the sun yat - sen memorial hospital , sun yat - sen university ) ; and polycystic ovaries ( e.g. , the presence of 12 follicles in each ovary measuring 29 mm in diameter ) after exclusion of other etiologies ( e.g. , congenital adrenal hyperplasia , androgen - secreting tumors , and cushing 's syndrome ) . homeostasis model assessment ( homa ) was applied to estimate the degree of ir . the equation used to obtain this value is as follows : homa - ir = ( fasting plasma glucose ( mmol / l ) insulin ( mu / ml ) ) / 22.5 . homa - ir 2.14 were considered insulin resistant according to our previous study . ovarian theca tissue samples were obtained from subjects included in this study based on the criteria mentioned above . theca interna was stripped from the follicle wall , and the granulosa cells were removed . samples were immediately placed in rnalater ( invitrogen , carlsbad , ca ) and stored at 20c . total rna are harvested using trizol ( invitrogen ) and rneasy mini kit ( qiagen ) according to manufacturer 's instructions . rna concentration was assessed using nanodrop nd - 1000 , accepting a ratio of 2.0 for sample absorbance at 260/280 . total rna samples were analyzed by kangchen ( kangchen bio - tech ) for mirna microarray experiments . procedures were performed as described in detail on the website of kangchen ( http://www.kangchen.com.cn ) . the samples are labeled using the mircury hy3 / hy5 power labeling kit and hybridized on the mircury lna array ( v. 16.0 ) . this most recent version of the array ( v. 16.0 - hsa , mmu , and rno array ) contains more than 1,700 capture probes , covering all mirnas annotated in mirbase 16.0 , as well as all viral mirnas , related to these species . signal intensities were normalized using the global lowess ( locally weighted scatterplot smoothing ) regression algorithm . median normalization method are used to obtain normalized data , normalized data = ( foreground - background ) / median , the median is 50 % quantile of mirna intensity , which is larger than 50 in all samples after background correction . the analysis of mirna predicted targets was determined using the algorithms of targetscan 6.2 , pictar , mirbase , and miranda . mirnas which may interact with cyp17 , gata6 , irs - 2 , and glycogen synthase kinase - 3 ( gsk3 ) were searched using targetscan 6.2 . qrt - pcr analysis was performed to validate the mirna microarray results in this study . the specific stem - looped rt - pcr primers to representatives of differentially expressed mirnas ( mir - 200a , mir - 141 , mir - 200c , mir - 502 - 3p , mir - 32 , mir - 92a , mir - 92b , mir - 19a , mir - 1 , and let - 7 g ) mirna - specific rt primers mirna : micro - ribonucleic acid ; rt : reverse transcriptase . real - time pcr analysis was performed on gene amp pcr system 970 ( applied biosystem ) with 8 l volume reaction containing 2 l reverse transcription product , 0.8 l pcr specific primers ( 10 mol / l ) , and 25 mmol / l mgcl2 , and h2o . the reactions were incubated in 96 - well plates at 95c for 3 minutes , following by 40 cycles ( 95c for 15 seconds , 60c for 20 seconds , 72c for 20 seconds , and 78c for 20 seconds ) , then ramped from 72c to 99c to obtain the melting curve . the relative quantity of each mirna in pcos ovarian theca tissues , normalized to u6 rna and relative to the expression in non - pcos theca tissues , was calculated using the equation rq = 2 , where ct = ( ctmirna ctu6 rna ) pcos ( ctmirnactu6 rna ) meannon - pcos and ct is the threshold cycle to detect fluorescence . for microarray data , the threshold value we used to screen up and down regulated mirnas is fold change 1.50 and fold change 0.67 . for rt - pcr data , statistical analysis was performed in statistical package for social sciences ( spss ) 16.0 for windows ( spss inc ) . two - tailed t - test was used for statistical evaluation of mirna expression differences with significance accepted at p 0.05 . ovarian theca tissue samples were obtained from 10 pcos patients with ir and eight age - and body mass index ( bmi ) - matched non - pcos infertile women who had normal insulin sensitivity and normal serum androgen level . pcos : polycystic ovary syndrome ; bmi : body mass index ; mfg : modified ferriman gallwey ; tt : total testosterone ; ft : free testosterone ; fin : fasting insulin ; fbg : fasting blood glucose ; homa - ir : homeostasis model assessment - insulin resistance . using mirna microarray analysis , we evaluated mirna expression profiles of ovarian theca tissues of pcos with ir patients and non - pcos , non - ir controls . a total of 27 mirnas were differentially expressed with a fold change of 1.5 or 0.67 . given that biological significance of mirna deregulation relies on the effect upon their cognate protein - coding gene targets , we analyzed the predicted targets of the most significantly up - and downregulated mirnas : mir - 200a , mir - 141 , mir - 200c , mir - 502 - 3p , mir - 32 , mir - 92a , mir - 92b , mir - 19b , mir - 1 , and let - 7 g . the analysis was done using four algorithms , targetscan 6.2 , pictar , mirbase , and miranda , which are commonly used to predict human mirna gene targets . prediction results [ figure 1 and table 4 ] demonstrated that the putative target genes of the above mirnas include cyp17 , gata6 , and irs - 2 . mirna = micro - ribonucleic acid ; irs - 2 = insulin receptor substrate 2 ; gata6 = gata - binding factor 6 . predicted targets of differentially expressed mirnas just part of the targeted genes of the micro - ribonucleic acids ( mirnas ) are shown here . igf1 : insulin - like growth factor 1 ; igfbp5 : insulin - like growth factor binding protein 5 ; igfbp3 : insulin - like growth factor binding protein 3 ; igf2r : insulin - like growth factor 2 receptor ; insig1 : insulin - induced gene 1 ; insig2 : insulin - induced gene 2 ; irs - 2 : insulin receptor substrate 2 ; igf1r : insulin - like growth factor 1 receptor ; gata6 : gata - binding factor 6 ; gata2 : gata - binding factor 2 ; stard13 : star - related lipid transfer ( start ) domain containing 13 . to validate our array expression findings ,10 differentially expressed mirnas ( mir - 1 , mir - 19b , mir - 32 , mir - 92a , mir - 92b , mir - 141 , mir - 200a , mir - 200c , mir - 502 - 3p , and let - 7 g ) were chosen for qrt - pcr analysis . the trends for downregulation of mirna expression were consistent in five of the 10 ( mir - 19b , mir - 92a , mir - 92b , mir - 141 , and 200a ) qrt pcr measurements [ figure 2 and table 5 ] . relative expression of mir - 200a , mir - 141 , mir - 200c , mir - 502 - 3p , mir - 32 , mir - 92a , mir - 92b , mir - 19b , mir - 1 , and let - 7 g in microarray ( blue ) and qrt - pcr ( red ) . upregulation mirnas were represented as fold change 1 and down regulation ones as fold change 1 at the same time . the dotted lines represented the thresholds ( 1.5 and 0.67 ) of fold change we have set in our study for screening differentially expressed mirnas . mirna = micro - ribonucleic acid ; qrt - pcr = quantitative reverse transcriptase polymerase chain reaction . results of mirna validation the column of fold change ( related to control group ) shows the result of qrt - pcr . the distribution of the data which was calculated by rq = 2 , wherect = ( ctmirna ctu6 rna ) pcos ( ctmirna ctu6 rna ) . mirna : micro - ribonucleic acid ; qrt - pcr : quantitative reverse transcriptase polymerase chain reaction . ovarian theca tissue samples were obtained from 10 pcos patients with ir and eight age - and body mass index ( bmi ) - matched non - pcos infertile women who had normal insulin sensitivity and normal serum androgen level . pcos : polycystic ovary syndrome ; bmi : body mass index ; mfg : modified ferriman gallwey ; tt : total testosterone ; ft : free testosterone ; fin : fasting insulin ; fbg : fasting blood glucose ; homa - ir : homeostasis model assessment - insulin resistance . using mirna microarray analysis , we evaluated mirna expression profiles of ovarian theca tissues of pcos with ir patients and non - pcos , non - ir controls . a total of 27 mirnas were differentially expressed with a fold change of 1.5 or 0.67 . given that biological significance of mirna deregulation relies on the effect upon their cognate protein - coding gene targets , we analyzed the predicted targets of the most significantly up - and downregulated mirnas : mir - 200a , mir - 141 , mir - 200c , mir - 502 - 3p , mir - 32 , mir - 92a , mir - 92b , mir - 19b , mir - 1 , and let - 7 g . the analysis was done using four algorithms , targetscan 6.2 , pictar , mirbase , and miranda , which are commonly used to predict human mirna gene targets . prediction results [ figure 1 and table 4 ] demonstrated that the putative target genes of the above mirnas include cyp17 , gata6 , and irs - 2mirna = micro - ribonucleic acid ; irs - 2 = insulin receptor substrate 2 ; gata6 = gata - binding factor 6 . predicted targets of differentially expressed mirnas just part of the targeted genes of the micro - ribonucleic acids ( mirnas ) are shown here . igf1 : insulin - like growth factor 1 ; igfbp5 : insulin - like growth factor binding protein 5 ; igfbp3 : insulin - like growth factor binding protein 3 ; igf2r : insulin - like growth factor 2 receptor ; insig1 : insulin - induced gene 1 ; insig2 : insulin - induced gene 2 ; irs - 2 : insulin receptor substrate 2 ; igf1r : insulin - like growth factor 1 receptor ; gata6 : gata - binding factor 6 ; gata2 : gata - binding factor 2 ; stard13 : star - related lipid transfer ( start ) domain containing 13 . to validate our array expression findings , 10 differentially expressed mirnas ( mir - 1 , mir - 19b , mir - 32 , mir - 92a , mir - 92b , mir - 141 , mir - 200a , mir - 200c , mir - 502 - 3p , and let - 7 g ) were chosen for qrt - pcr analysis . the trends for downregulation of mirna expression were consistent in five of the 10 ( mir - 19b , mir - 92a , mir - 92b , mir - 141 , and 200a ) qrt pcr measurements [ figure 2 and table 5 ] . relative expression of mir - 200a , mir - 141 , mir - 200c , mir - 502 - 3p , mir - 32 , mir - 92a , mir - 92b , mir - 19b , mir - 1 , and let - 7 g in microarray ( blue ) and qrt - pcr ( red ) . upregulation mirnas were represented as fold change 1 and down regulation ones as fold change 1 at the same time . the dotted lines represented the thresholds ( 1.5 and 0.67 ) of fold change we have set in our study for screening differentially expressed mirnas . mirna = micro - ribonucleic acid ; qrt - pcr = quantitative reverse transcriptase polymerase chain reaction . results of mirna validation the column of fold change ( related to control group ) shows the result of qrt - pcr . the distribution of the data which was calculated by rq = 2 , wherect = ( ctmirna ctu6 rna ) pcos ( ctmirna ctu6 rna ) . mirna : micro - ribonucleic acid ; qrt - pcr : quantitative reverse transcriptase polymerase chain reaction . in present study , we have for the first time tried to identify the differential expression of mirnas in the ovary of women with and without pcos , ha , and ir ; and integrated the findings with the expression patterns of certain specific genes from the same cohort of specimens . in addition , qrt - pcr validation confirmed downregulation of mir - 141 , mir - 200a , mir - 92a , mir - 92b , and mir - 19b . among these mirnas , mir - 92a , and mir - 92b were significantly downregulated . both mir - 92a and mir - 92b belong to the mir - 17 - 92 mirna cluster located at 13q31 .3 . mir - 92a has been associated with cancer pathogenesis and has been reported being significantly downregulated in patients with acute myeloid leukemia ( aml ) and acute lymphocytic leukemia ( all ) , hepatocellular carcinoma ( hcc ) , ovarian cancer , chronic lymphatic leukemia , and during myeloid differentiation . recently , mir - 92a was reported to play a role in non - tumor diseases , such as ischemia . and collaborating with several other mirnas , for example , let - 7a , mir - 19a , mir - 19b , mir - 24 , and mir - 93 ; mir - 92 has been reported to be significantly downregulated in the blastocysts derived from patients with polycystic ovaries . in addition , dysregulated expression of mir - 92 was also correlated to the development of leiomyomas . however , the expression pattern of mir - 92a in pcos ovarian tissue has not yet been illustrated . pcos is a complex and heterogeneous endocrine condition characterized by ha , hyperinsulinemia , and / or ir . our data showed significantly higher fast insulin concentration in pcos patients ( p = 0.001 ) , who thus had higher homa - ir value [ table 1 ] . at the same time , two significantly downregulated mirnas , mir - 92a and mir - 92b , had been predicted to target irs - 2 , a key factor in insulin signaling pathway . this result was consistent with the relative hyperinsulinemia and ir characteristics of pcos patients in our study . hyperinsulinemia and ha are two principal features of pcos and their cause and effect relationship is still being debated . two important androgen producing - related genes , cyp17 , gata6 , and one insulin receptor gene , irs - 2 were shown to be expressed significantly higher in pcos theca tissue compared with non - pcos ones in our previous study . being worthy of note , mir - 92a targeted both gata6 and irs - 2 , which might indicate that there were cross - talk between androgenic and insulin signaling pathways . the other five mirnas which we had validated by qrt - pcr were also reported to be very important in gynecologic physiology and pathophysiology . the let - 7 family , which let - 7 g belonged to , was reported to be the most commonly abundant mirna populations in the ovary . andbioinformatics prediction , screening , and gene ontology analysis of its targeting genes in the mammalian ovary has identified several biological processes and pathways or molecular networks underlying ovarian functions . furthermore , a variant snp in the lcs6 let - 7 mirna binding site of the kras 3 untranslated region was found in 31 % of women with severe treatment - resistant endometriosis , showing the relationship of let - 7 expressing and the development of endometriosis . mir - 200c and mir - 141mir - 200a expression results in decreased expression of dual - specificity phosphatase - 2 that subsequently results in prolonged extracellular - signal - regulated kinases activation through hypoxia - inducible factor , contributing to inflammation in the pathogenesis of endometriosis . according to our analysis , the five mirnas mentioned above might target androgen or insulin - like growth factor signaling pathway factors [ table 4 ] . this was likely due to the small sample size of our study and the significantly different serum level of androgen ( tt and ft ) among the pcos patients . in conclusion , our study showed that mirnas have played an important role in insulin action in local ovarian theca interna . andthe downregulation of mir - 92a and mir - 92b might lead to augmentation of signal transduction in both androgen pathway and insulin pathway . significantly downregulation of insulin signaling factors targeted mirnas in the ovarian theca tissue of pcos patients with ha indicated that hyperinsulinemia and / or ir was perhaps the cause of ha . in addition , although mirnas are known to regulate multiple gene targets in different system , they can also be regulated by other paracrine / autocrine factors . the precise target ( s ) for the reported dysregulated mirna and their immediate downstream processes need to be defined . we are going to focus on function analysis of certain mirnas , for example , mir - 92a , in the future . although with advantage , we recognize that relatively low number of tissues ( n = 18 ) collected as a limitation of our study . however , the careful selection of patients and well - matched control subjects from a larger cohort of well - characterized individuals reduced the , further study is necessary to investigate the mechanisms of androgen - insulin signaling cross - talk .\noutput:\n" }, { "from": "agent", "value": "background : polycystic ovary syndrome ( pcos ) is the commonest endocrinopathy in women of reproductive age . the patients often develop insulin resistance ( ir ) or hyperinsulinemia despite manifesting anovulation and signs of hyperandrogenism . the cause and effect relationship of hyperinsulinemia and hyperandrogenemia ( ha ) is still debated . micro - ribonucleic acids ( mirnas ) have recently been shown to play a role in regulation of ovarian function . our current study focused on the altered expression of mirnas with pcos.methods : ovarian theca interna tissues were obtained from 10 pcos patients and 8 controls that were non - pcos and had normal insulin sensitivity undergoing laparoscopy and / or ovarian wedge resection . total rna of all samples was extracted . we studied the repertoire of mirnas in both pcos and non - pcos women by microarray hybridization . bioinformatic analysis was performed for predicting targets of the differentially expressed mirnas . furthermore , selected mirnas were validated by quantitative reverse transcriptase polymerase chain reaction ( qrt - pcr ) . results : a total of 27 mirnas were differentially expressed in pcos patients with respect to the controls in our discovery evaluationand two ( mir - 92a and mir - 92b ) of them were significantly downregulated in pcos women in followed validation ( p < 0.05 ) . targets prediction revealed that mir - 92a targeted both gata family of zinc finger transcription factor gata - binding factor 6 ( gata6 ) and insulin receptor substrate proteins 2 ( irs - 2 ) . conclusions : mirnas are differentially expressed between pcos patients and controls . we identified and validated two mirnas - mir - 92a and mir - 92b . they are significantly downregulated and may be involved in the pathogenesis of pcos ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a difficult problem in engineering gram - negative bacteria is the directed secretion of proteins to the extracellular environment ( wittrup , 2000 ; harvey et al , 2004 ; lee et al , 2006 ; zhang et al , 2006 ) . there are few secretion systems that are capable of exporting proteins through both the inner and outer membrane . for example , the expression of some recombinant proteins at high titers can lead to the formation of inclusion bodies or retard cell growth ( sorensen and mortensen , 2005 ) . secretion is also critical when the function of the protein requires that it be outside of the cell , as is the case for cellulases and other polymer - degrading enzymes that act on substrates that can not cross the cell membrane . here , we have harnessed the type iii secretion system ( t3ss ) encoded on salmonella pathogeneity island 1 ( spi - 1 ) as a tool to export proteins of biotechnological interest . this is applied to the recombinant production of spider silk proteins , which can form fibrils if they are allowed to accumulate inside of the confined volume of the cell ( huemmerich et al , 2004a ) . the t3ss is unique because it a well - characterized protein secretion system that translocates polypeptides through both the inner and outer membranes . this is in contrast to the sec and tat pathways , which deliver proteins to the periplasm ( georgiou and segatori , 2005 ; wickner and schekman , 2005 ) . the sec pathway threads polypeptides in an unfolded state across the inner membrane in an atp - dependent manner ( economou and wickner , 1994 ; pohlschroder et al , 2005 ) . the tat pathway uses the proton motive force to drive the transport of folded proteins to the periplasm ( sargent et al , 1998 ; rodrigue et al , 1999 ; delisa et al , 2003 ) . an n - terminal signal peptide is required for both sec and tat export ( berks , 1996 ; wickner and schekman , 2005 ) . both types of signal peptides typically end with a signal peptidase i cleavage site , allowing cleavage of the tag on translocation to the periplasm ( nielsen et al , 1997 ; bendtsen et al , 2005 ) . type ii secretion can export proteins from the periplasm through the outer membrane ; however , the secretion signal is difficult to identify and seems to be distributed throughout the protein , making heterologous protein secretion difficult ( pohlschroder et al , 2005 ) . remarkably , it has been shown that all of the genes associated with the erwinia type ii secretion system can be transferred to escherichia coli and used to secrete erwinia cellulases ( zhou et al , 1999 ) . alternatively , gram - positive bacteria offer a single secretion event to the extracellular space and offer an attractive platform for secretion engineering . in its natural context , the spi - 1 t3ss functions as a molecular syringe to inject effector proteins into mammalian host cells that facilitate invasion and pathogenesis ( altier , 2005 ) . the spi - 1 t3ss forms a needle - like structure that crosses both the inner and outer membranes ( marlovits et al , 2006 ) . a chaperone is required for secretion , as well as an n - terminal peptide tag that is not cleaved post secretion ( galan and collmer , 1999 ) . secreted proteins can be folded in the cytoplasm and then are unfolded in an atp - dependent reaction before secretion ( feldman et al , 2002 ; lee and schneewind , 2002 ; akeda and galan , 2005 ) . it is expected based on needle dimensions that proteins must be at least partially unfolded to transit through the needle and would be required to re - fold outside the cell . the e. coli and salmonella flagellum and yersinia enterocolitica ysc t3ss have been shown to be able to export heterologous proteins ( russmann et al , 1998 ; feldman et al , 2002 ; lee and schneewind , 2002 ; majander et al , 2005 ; chen et al , 2006 ; konjufca et al , 2006 ; vegh et al , 2006 ) . these systems have been used to inject foreign proteins and peptides into mammalian cells as a mechanism to confer immunity ( russmann et al , 1998 ; boyd et al , 2000 ; konjufca et al , 2006 ) . a well - characterized regulatory network encoded within spi - 1 controls the dynamics of t3ss gene expression ( box 1 ) ( lucas and lee , 2000 ) . environmental signals from two - component systems and global regulators control the expression of the hilc , hild , and hila transcription factors , which together form a commitment circuit for the expression of spi - 1 genes ( bajaj et al , 1996 ; eichelberg and galan , 1999 ; lundberg et al , 1999 ; kalir et al , 2001 ; ellermeier et al , 2005 ) . within spi - 1 , there is a genetic circuit that links the expression of effector proteins to the completion of functional needles ( darwin and miller , 1999 , 2000 , 2001 ; temme et al , 2008 ) . the circuit consists of a transcription factor ( invf ) that is only functional when bound to the sica chaperone protein . before the cell can secrete protein , the chaperone is sequestered by the sipb / c proteins . after functional needles are completed , sipb / c are secreted and sica is free to bind invf , thus turning on the circuit and gene expression from the sica promoter ( darwin and miller , 1999 , 2000 , 2001 ; tucker and galan , 2000 ) . the salmonella spi - 1 t3ss has several properties that make it a good tool for the secretion of recombinant proteins . it is highly expressed under standard laboratory conditions ( luria - bertani broth at 37c ) , with 10100 needles per cell ( kubori et al , 1998 ) . under these conditions , effector proteins are secreted into the media in significant quantities without the need to co - culture with mammalian cells or expensive media components ( kubori and galan , 2002 ) . finally , the n - terminal secretion tags , chaperone - binding domains ( cbd ) , and chaperones have been identified ( fu and galan , 1998 ; hong and miller , 1998 ; bronstein et al , 2000 ; tucker and galan , 2000 ; russmann et al , 2002 ; zhang et al , 2002 ; ehrbar et al , 2003 ; lee and galan , 2004 ; wood et al , 2004 ; karavolos et al , 2005 ; higashide and zhou , 2006 ; knodler et al , 2006 ) . on the basis of this earlier work , we have constructed a system that contains all of the necessary genetic parts to secrete heterologous proteins ( box 1 ) . this system is demonstrated by using it to export a human protein and three spider silk monomers . natural silks are abundant biomaterials that span a remarkable diversity of physical properties ( vollrath and knight , 2001 ; swanson et al , 2006 ) . for example , the dragline silk of spider webs is extremely strong yet remains highly elastic . these materials have a number of uses including medical device implants , high strength fibers , advanced composites , and drug delivery systems ( lewis , 2006 ; wang et al , 2006a , 2006b ; hofmann et al , 2007 ; lee et al , 2009 ) . spiders are not conducive to scalable agriculture , therefore requiring silk production to be done in a recombinant host ( lewis , 2006 ) . using a solution of natural or recombinant silk monomers , it has been shown that threads can be artificially spun , producing materials with properties approaching natural silks ( seidel et al , 2000 ; lazaris et al , 2002 ) . one of the key limitations in creating materials that match or exceed the natural properties is the lack of practical approaches for recombinant protein expression ( kluge et al , 2008 ) . first , the genes themselves are often unstable because of highly repetitive regions of dna that results in frequent homologous recombination ( arcidiacono et al , 1998 ) . second , the codon usage in silk genes is not optimized for expression outside of the specialized cells in the silk gland ( prince et al , 1995 ; rising et al , 2005 ) . rare codons result in ribosome pausing and early truncation producing incomplete protein products ( fahnestock and irwin , 1997 ) . third , if the proteins are highly expressed in the confined cell volume they can self - assemble to produce fibrils , which have been visualized when recombinantly expressed in insect cells ( huemmerich et al , 2004b ) . in this paper , we use whole gene dna synthesis to construct long , computationally designed dna sequences that exactly match the wild - type amino - acid sequence for the known fragments of silk monomers ( figure 1 ) . synthetic genes were designed and constructed for three silk genes from the orb weaving spider araneus diadematus . these genes are expressed in different silk glands and vary in their amino - acid content and material properties ( vollrath and knight , 2001 ) . adf - 1 is expressed in the minor ampullate gland and is used during web construction , the resulting fibers have high tensile strength , but are inelastic ( guerette et al , 1996 ; gosline et al , 1999 ) . adf - 2 is expressed in the cylindrical gland ( used for egg sacks ) and has a sequence that is similar to human elastins . adf - 3 is expressed in the major ampullate gland and forms the extremely tough and elastic dragline , which anchors the web and is used as a lifeline for escape . each of the synthetic genes is expressed and exported from the cell using the salmonella spi - 1 t3ss . three spider silk genes ( adf - 1 , -2 and -3 ) were computationally designed for expression in eubacteria and constructed using automated dna synthesis and assembly . the wild - type dna sequences of the spider silk genes contain rare codons ( supplementary information ) , which can result in truncated proteins and poor expression ( gustafsson et al , 2004 ) . the sequences also consist of repeated amino - acid units that correspond to repetitive underlying dna sequences . the variation in the repeat amino - acid units is one of the key features that differentiate natural spider silks ( figure 1c ) . these regions can be very large with over 100 nucleotides of exact identity , which is a potential target for homologous recombination , resulting in genetic instability . the degeneracy of the genetic code allows many alternative nucleotide sequences to encode the same protein . this enables synthetic genes to be designed that simultaneously redistribute the codon usage , while reducing the dna repetitiveness ( figure 1a and b ) . each re - designed gene was constructed using automated whole gene dna synthesis ( supplementary information ) . we constructed a genetic system to secrete heterologous proteins into the culture media ( box 1 ) . a circuit is harnessed from the natural spi - 1 regulatory pathway that controls gene expression based on the capacity of the cell to export protein ( darwin and miller , 1999 , 2000 , 2001 ; temme et al , 2008 ) . the output of this circuit ( psica ) drives the transcription of an operon containing the heterologous protein fused to an n - terminal secretion tag and the associated chaperone . the human dh domain ( hussain et al , 2001 ) was chosen as an initial target because it is small ( 24 kda ) , easy to manipulate , and it expresses well in salmonella without affecting cell growth . a protease cleavage site is included between the tag and exported protein so that the tag can be removed after secretion . all of these parts are combined onto a plasmid ( box 1 ) and are available in the registry of standard biological parts ( http://www.partsregistry.org/ ) . the part numbers ( bba _ ) are provided throughout the text . using the sica : first , it restricts expression until the t3ss is built and is functional ( darwin and miller , 1999 , 2000 , 2001 ) . this links expression to secretion capacity and can reduce the build - up of protein before secretion . the circuit can be maintained in the off state when cells are grown in low salt l broth ( lb ) and then turned on after the cells are induced by high salt lb ( inducing medium ) and the needle is constructed ( figure 2a ) ( materials and methods ) ( tartera and metcalf , 1993 ) . the sica promoter has a low basal transcription rate and increases 200-fold in activity when induced . additionally , the sica promoter has no activity in e. coli under inducing conditions , which is a useful trait for cloning purposes ( figure 3a ) . the sica promoter turns on within 3 h after cells are shifted into inducing media ( figure 2a ) ( temme et al , 2008 ) . at this point , this can be clearly visualized in a coomassie gel ( figure 3d ) along with other proteins naturally secreted by salmonella . there was no observable lysis or outer membrane shedding in the secretion assay , as determined using an antibody against the male periplasmic protein ( majander et al , 2005 ) . there are multiple chaperones that target proteins to the spi - 1 t3ss and they interact with different n - terminal tags ( table i ) . a secretion assay was performed for the known tag / chaperone pairs to compare the amount of protein that is exported to the supernatant . this was repeated for each protein in this study to identify the optimal combination ( figure 2b ; supplementary information s2 ) ( materials and methods ) ( collazo and galan , 1996 ) . the sptp / sicp combination was found to yield the largest amount of secreted protein for dh , adf - 2 ( figure 2b ) , and adf - 3 ( supplementary information s2 ) . for adf - 1 , the sptp tag consists of a 15 amino - acid signal sequence and 152 amino - acid cbd ( lee and galan , 2004 ) . the sptp cbd interacts with sicp chaperone dimers , which direct the sptp - tagged protein to the spi - 1 t3ss ( stebbins and galan , 2001 ; akeda and galan , 2005 ) . it has been shown that the signal sequence directs the protein generally to t3sss and flagella . the cbd causes the protein to be directed specifically to the spi - 1 t3ss ( lee and galan , 2004 ) . a tobacco etch virus ( tev ) protease site is added after the tag so that it can be removed after export . variants of the pcasp plasmid were constructed by removing the tag and chaperone parts and tested for the loss of secretion . when expressed without the n - terminal sptp tag , there is a dramatic decline in the amount of dh protein that appears in the supernatent ( figure 3a ) . the deletion of the tag from the silk monomers results in 100-fold less protein in the supernatant ( table ii ) . secretion is also reduced when the sicp chaperone is only expressed at wild - type levels and not co - transcribed on the plasmid ( - sicp ) . we tested the effect of expressing the chaperone in conjunction with a ( ) tag protein in the pcasp system . the construct was run using the secretion assay and analyzed by western blot ( figure 3b ) . secretion was also tested for salmonella strains where components of the spi - 1 t3ss and flagellum have been knocked out ( figure 3c ) . the sica promoter differs in activity for these knockouts , so a plasmid was constructed where the chaperone and tagged protein are under the control of an iptg - inducible promoter . there was little effect when the flagella master regulators ( flhdc ) are knocked out . however , when critical structural components of the spi - 1 t3ss are knocked out ( prghijkorgabc ) , secretion is eliminated . these results were confirmed using a set of earlier constructed knockout strains ( inva and flhghi ) ( supplementary information ) ( lee and galan , 2004 ) . each synthetic silk gene was ligated into the pcasp secretion plasmid with the optimal tag / chaperone pair and tested for secretion ( figure 3e ) . protein expression and secretion rates were determined using quantitative western blots and a typhoon variable mode imager ( supplementary information ) . after 8 h , the total protein secreted ranges between 0.7 and 14 mg l. after recovery , the n - terminal sptp tag can be removed by in vitro tev proteolysis , leaving only two amino acids ( sg ) on the n - terminus of the secreted protein ( figure 3f ) . the total protein that was expressed ranged from 112 mg l h ( table ii ) . the efficiency of secretion is defined as the ratio of secreted protein to expressed protein . for the silks , the ability to export proteins directly to the extracellular environment is an important tool in cellular engineering . the secretion of silk monomers is an example of its utility for the production of recombinant proteins that form inclusion bodies or are toxic when allowed to accumulate inside of the cell . further , there are applications in the export of enzymes that act on substrates that can not diffuse through the cell membranes . here , we describe a control system that contains all of the necessary genetic parts for heterologous proteins to be secreted to the extracellular environment through the salmonella spi - 1 t3ss ( box 1 ) . at the core of this systemis a feedback circuit that responds to the capacity of the bacterium to export protein . this circuit activates the transcription of an operon containing the protein to be secreted , which is fused to the sptp n - terminal secretion signal . the sicp chaperone is also encoded , which binds and directs the heterologous protein to the spi - 1 t3ss . the yields of secreted protein using type iii secretion ( table ii ) are as good or better than other methods of extracellular protein production ( choi and lee , 2004 ) . earlier reported values range from 0.5 to 10 mg l h in shake flasks using a range of protein export and recovery methods ( lucic et al , 1998 ; tong et al , 2000 ; fu et al , 2003 ) . unlike the sec and tat pathways , the t3ss translocates proteins through both membranes to the extracellular environment . natural yersinia , shigella , and salmonella effector proteins have been observed to accumulate up to grams per liter in the growth media . the secretion rate of the spi - 1 t3ss has been measured in individual cells to be 760 proteins per cell per second when secreting a natural effector ( enninga et al , 2005 ; schlumberger et al , 2005 ) . this corresponds to an approximate theoretical yield of 10 mg l h od for a protein the size of adf - 2 . our system is able to achieve 10 % of this yield for the spider silk adf - 2 in a shake flask culture . whole gene dna synthesis is a useful tool to make large - scale changes to genes . in this work , three spider silk genes were computationally designed for expression in eubacteria and constructed using automated dna synthesis and assembly . only the amino - acid sequence information is required for gene construction , rather than physical genetic material from the source organism . the degeneracy of the genetic code allows many alternative nucleotide sequences to encode the same protein . this enables synthetic genes to be designed that simultaneously match the recombinant host 's codon usage , while reducing the dna repetitiveness . as of their highly repetitive amino - acid sequences , silk monomers represent one of the most challenging targets of automated dna synthesis and assembly . the three synthetic adf genes built here represent all of the known sequence information for these silks , but they are still fragments of the complete silk genes . the ability to construct the wild - type genes from information alone will make it possible to further explore and modify the amazing diversity of natural materials . more broadly , declining automated synthesis costs make it possible to rapidly construct large libraries of proteins , enzymes , or pathways from many diverse organisms using only information retrieved from sequence databases ( bayer et al , 2009 ) . this use of synthetic metagenomics could be particularly applicable to areas of material space such as spider silks , when cdna is difficult to obtain from the natural source and when isolated is unstable in recombinant hosts . concurrently , it enables the large - scale modification of the sequences for expression in a recombinant host . the regulatory network controlling t3ss self - assembly is shown ( yellow background ) ( panel a ) . within this network , an operon containing the chaperones , translocators , and effectorsis controlled by a genetic circuit that becomes active once the t3ss is constructed and functional ( green background , centered on invf and sica ) . a secretion control system is constructed that contains all of the necessary parts for the t3ss to export heterologous proteins ( orange background ) . the sica promoter and ribosome - binding site drive the expression of the chaperone ( sicp ) and heterologous protein ( green ) fused to an n - terminal secretion signal ( sptp ) . a tev protease site is included after the tag such that it can be removed post secretion . the cryo - em image of the t3ss is reproduced from reference ( marlovits et al , 2004 ) . the secretion control system superpart is bba_j64032 in the registry of standard biological parts ( www.partsregistry.org ) and the full pcasp sequence is available in genbank ( # ef179157 ) .\noutput:\n" }, { "from": "agent", "value": "the type iii secretion system ( t3ss ) exports proteins from the cytoplasm , through both the inner and outer membranes , to the external environment . here , a system is constructed to harness the t3ss encoded within salmonella pathogeneity island 1 to export proteins of biotechnological interest . the system is composed of an operon containing the target protein fused to an n - terminal secretion tag and its cognate chaperone . transcription is controlled by a genetic circuit that only turns on when the cell is actively secreting protein . the system is refined using a small human protein ( dh domain ) and demonstrated by exporting three silk monomers ( adf - 1 , -2 , and -3 ) , representative of different types of spider silk . synthetic genes encoding silk monomers were designed to enhance genetic stability and codon usage , constructed by automated dna synthesis , and cloned into the secretion control system . secretion rates up to 1.8 mg l1 h1 are demonstrated with up to 14 % of expressed protein secreted . this work introduces new parts to control protein secretion in gram - negative bacteria , which will be broadly applicable to problems in biotechnology ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: at 35 weeks of gestation , a 37 - year - old ( height 162 cm and weight 85.1 kg ) primigravida visited the emergency department with complaints of unceasing palpitations , without associated symptoms such as dizziness , syncope or dyspnea . upon questioning , she described a history of occasional palpitations over the past few years , which went away spontaneously in minutes . ekg showed the presence of a svt at a rate over 160 beats / min with stable blood pressure ( fig . three boluses of iv adenosine ( 6 mg 12 mg 12 mg ) were injected after unsuccessful carotid sinus massage . the svt reverted to a normal sinus rhythm for only several minutes with adenosine , and svt recurred . iv verapamil ( 5 mg ) and two trials of synchronized electric cardioversion ( 150 j 200 j ) were also unsuccessful . emergency cesarean delivery was then performed because of uncertainty about the maternal health and concern for the fetus . a spinal anesthesia was performed using 10 mg of bupivacaine and 20 g of fentanyl after 500 ml of 6 % he s 130/0 .4 infusion . phenylephrine ( 0.2 g / min / kg ) was given to prevent spinal anesthesia related hypotension and 50 g of phenylephrine was occasionally administered when systolic blood pressure was lower than 100 mmhg . total infused dose of phenylephrine before delivery of a baby was 350 g with bolus and 60 g with continuous infusion . a healthy baby was delivered uneventfully , and 100 g of carbetocin was infused slowly without any complications . her heart rate was around 150 beats / min throughout the operation , which suddenly dropped to 80 - 90 beats / min at the end of surgery .2 ) . a 24 - hour holter monitor and a cardiac echography were performed the next day , but no abnormalities were found . she was discharged after one week of postnatal care in the hospital without any episodes of palpitations . it has been reported that newly onset of paroxysmal svt was rare but symptoms of paroxysmal svt were shown to be exacerbated in some patients during pregnancy . hemodynamic , hormonal , autonomic , and emotional changes during pregnancy can be the precipitating factors for arrhythmia [ 3 - 5 ] . depending on the gestational age , maternal and fetal condition , emergency delivery should always be an option . in our case , thus , considering her gestational age and the possibility of heart failure , emergency delivery was the best course of action for the mother and the baby . anesthetic management of parturients with paroxysmal svt for cesarean delivery is not a straightforward decision . anesthetic management should focus on avoiding factors known to produce cardiac ectopy , such as increased sympathetic tone , electrolyte imbalances and acid - base disturbance . volatile agents may reduce the incidence of perioperative tachyarrhythmias because they increased refractoriness within the accessory and atrioventricular pathways . but , it is almost impossible to avoid sympathetic stimulation during intubation in general anesthesia for cesarean delivery . however , we decided to do spinal anesthesia because we had more experience in spinal anesthesia than epidural anesthesia and hypotension during spinal anesthesia can be managed safely with appropriate treatment . there are a few points that should be considered for spinal anesthesia during cesarean delivery in this case . the reduced atrial filling associated with spinal anesthesia has been identified as a risk factor for arrhythmia . fluid pre - loading could prevent a reduction in atrial filling and also reduce sympathomimetic requirements , which may trigger svt . sympathomimetics , which are frequently used to treat hypotension during spinal anesthesia , may also initiate tachycardia . there was a previous case of svt , which was induced by ephedrine during cesarean delivery . the combined use of ephedrine and phenylephrine in treating hypotension after spinal anesthesia for cesarean delivery abolishes the increase in heart rate and effectively maintains the blood pressure . we used phenylephrine alone throughout the surgery and weaned the patient off this drug after svt terminated . phenylephrine increases the vagal tone by indirectly stimulating baroreceptor reflexes , which ultimately reduces svt occurrence , and may have advantages over ephedrine . in general , drug therapy strategy used in parturients is similar to that in non - pregnant patients . however , the effects of antiarrhythmics on the fetus and uterine blood flow and contractility must be considered . for this reason , non - pharmacological treatment such as vagal maneuvers , valsalva maneuver and facial ice immersion should be tried first to terminate tachycardia . when the vagal maneuver fails , intravenous adenosine is the first - choice drug because of its rapid onset , high efficacy and short half - life . the adverse side effect of these drugs is hypotension , which is more common with the use of diltiazem than verapamil . these changes may not be physiologically important to the fetus , but may be consequential in patients with cardiovascular dysfunction . synchronized electrical cardioversion may become necessary for svt that are resistant to pharmacological therapy , like our case . direct current electrical shock has been used in all stages in pregnancy without significant complications . the amount of current that reaches the fetus is thought to be negligible . however , fetal heart rate monitoring during cardioversion is advisable . non - pharmacological treatments , antiarrythmics , and even electrical cardioversion were unsuccessful in our case and emergency cesarean delivery was performed . every treatment provided to the mother should be considered carefully , weighing the risk of their use against the risk of continuing svt . if cesarean delivery is performed , conditions that could exacerbate the symptoms must be avoided .\noutput:\n" }, { "from": "agent", "value": "paroxysmal supraventricular tachycardia ( svt ) is a common arrhythmia in the parturient and can occur with or without an underlying organic heart disease . a woman of 35 weeks ' gestation , who had a paroxysmal svt that was resistant to antiarrhythmic drugs and electric cardioversion , required emergency cesarean delivery . the cesarean delivery was performed under spinal anesthesia and a healthy baby was delivered uneventfully . svt spontaneously converted to normal sinus rhythm right after delivery of the baby ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we enrolled 108 volunteers ( 65 males , 43 females ) with rp , ranging in age from 16 to 85 years , who were members of the korean retintis pigmentosa society . a korean national rp survey was conducted at seoul national university hospital 's retinal clinic from july to december 2006 . rp was diagnosed in the recruited patients on the basis of a fundus examination , goldmann perimetry , and a complete electroretinographic evaluation according to the parameters of the international society for clinical electrophysiology of vision ( iscev ) . our institutional review board ( irb ) approved the study protocol , informed consent was obtained from all of the subjects , and all procedures used were consistent with the tenets of the helsinki declaration . all of the patients underwent a thorough ophthalmic examination including best - corrected visual acuity ( bcva ) , binocular indirect ophthalmoscopy , fundus examination , and goldmann perimetry . if a definite diagnosis of rp could not be made , a standard electroretinogram was performed for confirmation . the bcva was measured using snellen visual acuity charts and was converted into a logarithm of the minimum angle of resolution ( log mar ) va scale . monocular visual fields were measured by goldmann perimetry using the iii -4-e target at a standard luminance . along each meridian , the target was presented from a position of non - seeing to seeing , moving clockwise . the fvs was calculated from the functional acuity score ( fas ) and the functional field score ( ffs ) , as defined in the aforementioned guidelines .10,11 va measurements were converted to a visual acuity score ( vas ) . the weighted average of three vass for each field was used to calculate the fas according to : fas = ( vasod + vasos +3 vasou ) / 5 . to evaluate the ffs , the visual field score ( vfs ) for the right monocularfield ( vfsod ) , the left monocular field ( vfsos ) , and the binocular field ( vfsou ) the fas and ffs were then multiplied to yield the fvs : fvs = fasffs / 100 . the ama fvs classification ( table 1 ) was used to classify patients .11 the nei - vfq 25 - item version with appendix7 ,8 ( a total of 39 items ) was administered by skilled interviewers and scored in the standard manner . there were twelve sub - scale scores and one composite score . the nei - vfq 25 composite score was the average of all available sub - scales , except general health , and was suggested as the vision - related quality of life indicator by the nei . the correlations of the nei - vfq 25 composite score to the fvs , ffs , and fas were analyzed by the spearman correlation test . if the correlations were significant , fisher 's z - transformation analysis was used to determine the better predictor of vision - specific quality of life among the fvs , ffs , and fas . as the median log mar was 0.6 , we divided the patients into two groups according to that value : the better va group ( logmar 0.6 ) , and the worse va group ( logmar0 .6 ) . in each group , the relationship of thevfq composite score to the fvs , ffs , and fas was evaluated and regression analysis was performed . statistical analyses were performed using spss v. 12.0 software ( spss inc . , chicago , il ) , and two - sided p - values of 0.05 were considered statistically significant . the bcva was measured using snellen visual acuity charts and was converted into a logarithm of the minimum angle of resolution ( log mar ) va scale . monocular visual fields were measured by goldmann perimetry using the iii -4-e target at a standard luminance . along each meridian , the target was presented from a position of non - seeing to seeing , moving clockwise . the fvs was calculated from the functional acuity score ( fas ) and the functional field score ( ffs ) , as defined in the aforementioned guidelines .10,11 va measurements were converted to a visual acuity score ( vas ) . the weighted average of three vass for each field was used to calculate the fas according to : fas = ( vasod + vasos +3 vasou ) / 5 . to evaluate the ffs , the visual field score ( vfs ) for the right monocularfield ( vfsod ) , the left monocular field ( vfsos ) , and the binocular field ( vfsou ) were first scored separately : ffs = ( vfsod + vfsos +3 vfsou ) / 5 . the fas and ffs were then multiplied to yield the fvs : fvs = fasffs / 100 . the nei - vfq 25 - item version with appendix7 ,8 ( a total of 39 items ) was administered by skilled interviewers and scored in the standard manner . the nei - vfq 25 composite score was the average of all available sub - scales , except general health , and was suggested as the vision - related quality of life indicator by the nei . the correlations of the nei - vfq 25 composite score to the fvs , ffs , and fas were analyzed by the spearman correlation test . if the correlations were significant , fisher 's z - transformation analysis was used to determine the better predictor of vision - specific quality of life among the fvs , ffs , and fas . as the median log mar was 0.6 , we divided the patients into two groups according to that value : the better va group ( logmar 0.6 ) , and the worse va group ( logmar0 .6 ) . in each group , the relationship of thevfq composite score to the fvs , ffs , and fas was evaluated and regression analysis was performed . chicago , il ) , and two - sided p - values of 0.05 were considered statistically significant . as stated above , there were 108 rp patients enrolled ( 65 males , 43 females ) ranging in age from 16 to 85 years . the demographics and descriptive statistics for the clinical measures of visionare listed in table 2 . most participants were classified into more advanced categories ( fvs 4 , 5 , 6 ) . fvs was highly correlated to the bcva ( r = 0.69 , p 0.001 ) , ffs ( r = 0.86 , p 0.001 ) and the fas ( r = 0.73 , p 0.001 ) ( table 3 ) . significant correlations of the vfq composite score to bcva ( r = 0.60 , p 0.001 ) , ffs ( r = 0.44 , p 0.001 ) , fas ( r = 0.60 , p 0.001 ) , fvs ( r = 0.58 , p 0.001 ) were also found . however , we could not find any differences among the correlations of bcva , fvs , ffs , and fas to the vfq composite score . study patients were older in the poor va group than in the better va group ( 34.79.7 vs. 39.814.7 , p = 0.03 , table 4 ) . multiple regression analysis was performed as follows with the interactive forms of ffs and fas . ( all patients , n = 112 ) , nei - fvq composite = 0.30 fas +0.31 ffs +21.72 , ( r = 0.40 ) . ( better va group , n = 50 ) , nei - fvq composite = 1.50 fas +2.91 ffs - 2.78fvs - 86.11 ( r = 0.37 ) . ( worse va group , n = 62 ) , nei - fvq composite = 0.24 fas +0.23 ffs - 2.78 + 25.8 ( r = 0.22 ) . our results indicate that in rp patients , bcva and the ama guidelines ' fvs , ffs , and fas are equally correlated to those of the self - reported vfq . several other studies6 ,12 evaluating the performance of rp patients demonstrated that reading performance correlates with contrast sensitivity , va , and visual field , while driving performance is the primary correlate of visual field loss . in fact , one of the conclusions of the work is that fvs is no better than bcva ( correlation : 0.60 ) for categorizing rp patients in terms of self - perceived qol . this can be expected since the visual functioning of rp patients can be estimated from bcva on average , although contrast sensitivity may add information . to assess performance function , several studies7 - 9 utilized questionnaires or ama guidelines for fvs . according to the results , the vfq is a reliable , valid method that should be useful for group - level comparisons of vision - specific quality of life in clinical research . the fvs has also been found to be a potent predictor of self - reported vision - specific quality of life . our study confirmed that the bcva , fvs , fas and ffs are highly correlated to the vfq in rp patients . in accordance with our results , szlyk et al . found that self - reporting is strongly correlated with actual task performancein rp patients .5 the group evaluated the correlation of reading composite scores with contrast sensitivity , whereas , in our study , we used the ama 's fvs and vfq composite score . however , compared with bcva and fvs , it suggests that the fvs may not add much to the value of basic measures of visual function in some diseases . we could comment on previous research on the fvs in other diseases or in the general population , such as the study by rubin et al. 15 who stated that monocular acuity and binocular acuity are significantly better predictors of reading speed than the ama weighted score or a recently proposed functional vision score ( fvs ) . in this study , the vfq was affected by both the ffs and the fas , although the regression equation had an interactive form ( fvs ) . we speculate that these findings might reflect the fact that rp is a disease manifesting with progressive visual field loss . a hallmark feature of rp is an insidious , progressive loss of peripheral visual field . therefore , the remaining , functional field is important in advanced rp patients , as ffs represents visual field in the worse va group . however , we can not estimate the rate of visual field progression from our results , though berson et al . suggested that the visual field is lost at a rate of about 4.6 % per year .16 massof et al . proposed that the visual field diminishes approximately 50 % over 4.5 years .17 in any case , the rate of progression of visual field loss is usually slow and relentless in rp patients . the limitations of this study include its cross - sectional design , which does not allow for the assessment of the rp course . because the enrolled patients presented with various stages of rp , selection bias could be an issue . despite these limitations , our study is the first to determine the correlation of fvs to vision - specific quality of life in a relatively large group of rp patients . in conclusion , the vision - specific quality of life correlated with the ama 's guidelines with fvs , ffs and fas in rp patients . these results suggest that visual quality can not be explained only by visual acuity or visual field in rp patients .\noutput:\n" }, { "from": "agent", "value": "purposeto determine the relationship between the american medical association 's ( ama ) functional vision score ( fvs ) and vision - specific quality of life in retinitis pigmentosa ( rp ) patients using the national eye institute 's visual functioning questionnaire ( nei - vfq 25 ) . methodsone hundred eight patients with rp participated in the study . we measured best - corrected visual acuity , conducted goldmann perimetry , and collected the self - reported nei - vfq 25 . the fvs was calculated using the functional field score ( ffs ) and the functional acuity score ( fas ) . the correlations of the vfq composite scores to the fvs , ffs , and fas were determined using correlation and regression analyses.resultsfvs was highly correlated to the bcva ( r = 0.69 , p < 0.001 ) , the ffs ( r = 0.86 , p < 0.001 ) and the fas ( r = 0.73 , p < 0.001 ) . significant correlations of the vfq composite score to the bcva ( r = 0.60 , p < 0.001 ) , ffs ( r = 0.44 , p < 0.001 ) , fas ( r = 0.60 , p < 0.001 ) , fvs ( r = 0.58 , p < 0.001 ) were also found . however , the correlation strengths of bcva , fvs , fas , and ffs to nei - fvq were not different.conclusionsin rp patients , the vision - specific quality of life was correlated with the ama guidelines ' fvs , ffs , and fas . their correlation degrees to nei - fvq were not different . this result suggests that vision - specific quality of life can be explained by both visual acuity and visual field in rp patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the interaction of these components , as well as the components themselves , are not fully understood . this paper will discuss the three main regulatory paradigms involved in the regulation of cerebral blood flow : cerebral autoregulation , flow - metabolism coupling , and neurogenic regulation . in addition , there are two cell types that have repeatedly been shown to play a central role in the regulation of cerebral blood flow : endothelial cells and astrocytes . the process whereby the cerebral arteries ( specifically arterioles ) maintain a constant blood flow ( cbf ) in the face of changing cerebral perfusion pressure ( cpp ) is referred to as cerebral pressure autoregulation . as shown below in figure 1 , between cpp pressures of 50150 mm hg cbf is relatively constant ; above and below these values , however , cbf varies markedly with cpp . we view this phenomenon as independent of metabolic factors , thus this section is limited to changes in vascular tone as a result of cpp only . flow - metabolism coupling is a distinct phenomenon that will be discussed in the following section . several theories have been advanced , focusing on the endothelium , nerves , and the vascular smooth muscle itself . because of the extensive investigation into the perivascular nerve fibers , discussion of this is relegated to a separate section below . in addition , it has been proposed that the endothelium has mechanoreceptor properties that allow it to contribute to cerebral autoregulation . the two main mechanical mechanisms that have been evaluated are shear stress and transmural pressure . increased flow - velocity ( shear stress ) . a similar endothelium - dependent response to increases in transmural pressure has also been demonstrated . harder reproduced this work and also found that arterial constriction was associated with smooth muscle depolarization . lastly , rubanyi showed that perfusate isolated from arteries that had been subjected to increased transmural pressure was capable of inducing vasoconstriction in nave vessels , implying some endothelial - derived factor . stretch responses have also been theorized to originate in smooth muscle cells . originally formulated by bayliss in 1902 , the so - called myogenic hypothesis of cerebral autoregulation focuses on the mechanoreceptor properties of smooth muscle cells themselves . the development in 1981 of isolated vessel techniques allowed the mechanisms to be separated from flow , neural , metabolic , and endothelial influences . recent work has focused on the transduction mechanisms between myogenic stretch and subsequent vasoconstriction , particularly the role of stretch - activated ion channels . since the first recordings of mechanosensitive ion channels in 1988 , a number of investigators have found evidence for these channels in vascular smooth muscle in a variety of tissues . the electrical properties of these channels strongly suggest that they are nonselective cation channels . the resultant membrane depolarization results in influx of ca through voltage - gated ca channels and smooth muscle constriction , a response that is abolished in the presence of inhibitors to voltage - gated ca channels . it has also recently been shown that not only the rhoa - rho kinase pathway plays a pivotal role in cerebral artery mechanotransduction , but also the pathway is more active at progressively higher levels of stretch . gokina and colleagues evaluated the effect of rho kinase inhibition on pressure autoregulation in cerebral arteries in the rat . they found that administration of a specific inhibitor of rho kinase ( y - 27632 ) selectively inhibited pressure - induced rise in intracellular ca as well as the development of myogenic tone . studies have even demonstrated that calcium - independent mechanisms , so - called calcium sensitization , may be present as well . this occurs when agonists lead to muscle contraction without a corresponding rise in intracellular calcium . for over a century it has been appreciated that cerebral blood flow varies with cerebral metabolism . this has most recently been shown with several functional imaging modalities , such as pet scanning and bold fmri . so - called flow - metabolism coupling or functional hyperemia is perhaps the most clinically relevant of the cbf regulation paradigms , as cerebral tissue is among the least tolerant of ischemia . interestingly enough , it has been shown that the generation of action potentials alone is not necessarily the main stimulus in flow - metabolism coupling ; rather the interneuron milieu is capable of generating a significant stimulus even if the endpoint is a decrease in the frequency of action potentials . there are several molecules that investigators have focused on as possible links between neuronal activity and the regulation of cerebral blood flow . all are known to increase with synaptic transmission , either because they are involved in the process itself ( in the case of k + and h + ) or because they are known metabolites ( adenosine ) . potassium and hydrogen ions are produced by synaptic transmission , and it has been shown that elevation of these ions stimulates vasodilation , thus providing a possible mechanism for neurovascular coupling . potassium channels have been found in vascular smooth muscle and have been implicated in the effect of both k and h elevations . in addition , atp - sensitive k - channels have been found in vascular smooth muscle , suggesting a direct link between neuronal activity and cerebral blood flow . the well - known phenomenon of co2 reactivity is mediated through the action of h on cerebral arteries , rather than co2 itself . the transduction mechanism of h into vasodilation remains elusive , although nitric oxide ( no ) has been implicated as the vasodilatory response to hypercapnia and acidosis is attenuated by no inhibitors . metabolites are an attractive option as messengers for flow - metabolism coupling , for obvious reasons . because hypoxia and hypoglycemia do not affect activity - induced vasodilatations , attention has focused on other by - products of neuronal activity , most notably adenosine . extracellular levels of adenosine rise sharply with neuronal activity , and topical application of adenosine to cerebral microcirculation causes vasodilation . furthermore , adenosine has been shown to be released in response to administration of glutamate , a major neurotransmitter in cerebral cortex . iliff et al . showed that selective blockade of adenosine receptor ( specifically receptor 2a ) attenuated the vasodilatory response to glutamate administration . furthermore , this blockade had no effect on either resting vessel diameter or on co2 reactivity . thus adenosine appears to play a significant role in glutamate - induced dilation of pial arterioles . a significant body of evidence supports the function of no in flow - metabolism coupling , although the exact pathway is not completely clear . a recent study by lindauer et al. demonstrated that the vasodilatory response to whisker deflection was blocked by administration of no inhibitors . however , the effect was restored by administration of cyclic guanosine monophosphate ( cgmp ) or no donors , suggesting that no itself is not the relevant mediator . it has been theorized that no acts as a permissive agent , supplying a basal amount of cgmp for other mediators ( like adenosine ) to utilize as second messengers . a wealth of functional and histological evidence supports the existence of an extensive arborization of perivascular nerves that play a role in regulation of cerebral blood flow . the functional unit of endothelial cells , perivascular nerves , and astrocytes has been increasingly recognized as a complex network that can be considered as a single entity rather than separate subunits . referred to as the neurovascular unit , this characterization has led to investigation into supporting the unit as a whole , rather than simply focusing on one aspect . these nerves have diverse origins and neurotransmitters and can be broadly categorized into two categories : extrinsic and intrinsic . three main sources of extrinsic perivascular innervation have been identified : the trigeminal ganglion , the superior cervical ganglion , and the sphenopalatine ganglion . it has been hypothesized that the main role of the sympathetic nervous system is to offer an increased tone to maintain blood pressure below the upper limit of the autoregulatory mechanism . the parasympathetic system is felt to play a role primarily in pathological states . because of the central role the trigeminovascular system plays in pain sensationit was later discovered that calcitonin gene - related peptide ( cgrp ) , a potent vasodilator , is released from trigeminal nerves . it was thus theorized that the trigeminovascular system plays a role in counteracting vasoconstrictive influences . in addition , the triptan class of migraine abortive agents act presynaptically to prevent cgrp release , thereby preventing vascular engorgement and associated headache . as shown in figure 2 , once the blood vessel dives deep into the parenchyma and leaves the virchow - robin space , they lose their extrinsic innervation and the intrinsic innervation begins . a new set of nerves takes over , arising both from distant pathways and local interneurons . the majority of these nerves do not abut directly on blood microvessels themselves ; rather they connect to astrocyte foot processes . depending on the area stimulated , an increase or decrease in cbf can be elicited . the nucleus basalis , locus coeruleus , and raphe nucleus have all been implicated as a source for innervation of cerebral microvasculature . at present , it is not entirely clear if these neurons directly contact the microvessels or if the signal is transduced through astrocytic foot - processes . in addition to distant subcortical pathways , local interneurons also play a role in the regulation of microvascular tone . it has recently been shown that stimulation of gabanergic interneurons causes vasodilation of regional microvessels . furthermore , interneurons also seem to be necessary to transduce the signal from distant subcortical regions described above . the cerebrovascular endothelium plays a central role in the regulation of cerebral blood flow . once thought to simply be an inert antithrombotic barrier , the endothelium is now appreciated as a dynamic organ that acts as a physiologic bridge between the blood vessel lumen and the surrounding smooth muscle . at present , this bridge is thought of as comprising 4 main chemical systems : nitric oxide ( no ) , endothelium - derived hyperpolarization factor ( edhf ) , the eicosanoids , and the endothelins . much of the interest in the endothelium began with the discovery of nitric oxide ( no ) as the endothelium - derived relaxing factor by furchgott and ignarro in 1988 . no is a diffusible second messenger that activates guanylate cyclase ( gc ) , present in smooth muscle cells . guanylate cyclast in turn synthesizes cgmp which causes smooth muscle relaxation through protein kinase g ( pkg ) activation of k channels and / or closure of voltage - gated calcium channels . the enzyme that produces no , nitric oxide synthase ( nos ) has several isoforms . endothelial nos ( enos ) is the isoform found in the cerebral blood vessels , specifically the endothelium . neuronal nos ( nnos ) is the isoform found in neurons . a third isoform , inducible nos ( inos ) has been found in the brain under pathological situations such as hypertension or exposure to endotoxin . immunohistochemistry has localized enos to the endothelium , yet administration of a nos inhibitor ( l - nmma ) to denuded arteries produces vasoconstriction . this provides evidence for the physiological significance of nnos , although the relative contribution of enos versus nnos to resting tone of the cerebral vasculature is not known . despite the dominance of the no paradigm in endothelial - dependent vasodilatation , it appears that there is a second mechanism that also operates in the endothelium to cause vasodilatation . this is based on observations that when no - and eicosanoid - based pathways are fully inhibited , further dilatory capacity remains . similar to the story of edrf prior to the discovery of no , so - called edhf represents an as of yet unelucidated pathway that may be another diffusible molecule ( the present terminology of factor is misleading based on the present data ) . this pathway is characterized by hyperpolarization of the vascular smooth muscle and is inhibited by k - channel blockers . golding et al . defined edhf as a dilation pathway that requires endothelium , is distinct from eicosanoid or no pathways , dilates via hyperpolarization of vascular smooth muscle , and involves k - channel activation . it is known that the edhf pathway begins with an increase in endothelial ca stores and ends with a decrease in smooth muscle ca stores . how these two events are linked is a matter of continuing study . at present , there are 4 main possibilities : eicosanoids , k , gap junctions , and hydrogen peroxide . the eicosanoids are a group of vasoactive chemical mediators that are derived from arachidonic acid . three main enzyme systems have been identified : cyclooxygenase ( cox ) , lipoxygenase ( lox ) , and epoxygenase ( epox ) . arachidonic acid is formed from membrane phospholipids by lipases and is used as a substrate for the aforementioned enzyme systems . it should be emphasized that these enzyme systems are not limited to the endothelium ; rather they are active in a variety of tissues , notably platelets . furthermore , some products cause vasoconstriction and others cause vasodilatation . the differential concentrations of the enzymes and their isoforms in different locations determines the overall effect on cerebral blood flow . although all three enzyme systems have been investigated extensively in the systemic vasculature , cox is the best understood in the cerebral vasculature at present , the role of the lox and epox systems in the cerebral vasculature is poorly understood . three cox isoforms have been found to exist in the cerebral vasculature . of the multiple metabolites produced by cox , the vasodilators prostacyclin ( pgi2 ) and prostaglandin e2 ( pge2 ) are predominant in normal endothelium . while important in pathologic conditions , it appears that under normal physiology the cox system is less dominant , with the no and edhf systems described above being the predominant vasodilatation paradigms . the vasoconstrictive cox metabolites are presently thought to be most relevant in pathological situations such as traumatic brain injury and subarachnoid hemorrhage . the fourth major chemical system active in the endothelium is that of the endothelins . this system is comprised of two receptors ( eta and etb ) and three ligands ( et - 1 , et - 2 , et - 3 ) . the effect of the ligands seems to depend on the receptor rather than the ligand . eta receptors are found predominantly in vascular smooth muscle , are stimulated by et - 1 and et - 2 , and mediate vasoconstriction . etb receptors are found predominantly within the endothelium , are stimulated by all three ligands , and mediate vasodilatation . of the three ligands , et - 1 appears to play the biggest role in the regulation of cerebral blood flow . big et - 1 , or produced de novo from mrna in cerebrovascular endothelial cells . in the presence of an intact endothelium , et - 1 binds to etb and causes vasodilation ; in vessels denuded of endothelium , et - 1 binds to eta and causes vascoconstriction . the picture is somewhat complicated by the fact that eta receptors may be found in the endothelium and etb receptors may be found in smooth muscle . interestingly , there is evidence of a balancing paradigm between the constricting actions of et - 1 and no - mediated vasodilation . et - 1 secretion has been shown to be stimulated by several molecules known to be connected with no - induced vasodilation . however , topical administration of et receptor blockers does not result in an increase in cbf . furthermore , the long lasting effects of the endothelins make them poorly suited for the minute to minute regulation of cbf . it is presently thought that endothelins do not contribute in a major way to resting cbf under normal physiologic conditions , although they have been shown to play a major role in several pathological conditions , most notably cerebral ischemia and cerebral vasospasm . astrocytes are in a unique anatomical position to effect cbf ; their processes extensively ensheath brain capillaries , thereby physically linking the cerebral microvasculature with synapses . more recently , in vitro studies have shown astrocytes to be capable of cell - to - cell communication through gap junctions , suggesting a possible role for modulation of neuronal and vascular function . early work on the mechanism of astrocytic involvement of cerebral blood flow regulation focused on potassium . astrocytes were known to uptake excess extracellular potassium , and newman et al . showed that the ions were then shunted to the endfeet processes . given the location of astrocytic foot processes on the cerebral vasculature and the vasodilatory effects of k , it was theorized that this was a mechanism whereby neuronal activity was linked to cerebral vasodilation . subsequent work by paulson showed that this theory fits the temporal relationship of k increases to vasodilation better than alternative theories involving simple potassium diffusion . found that electrical stimulation of astrocytes resulted in an increase in intracellular ca followed by vasodilation of arterioles contacted by foot processes of that astrocyte . this response was mimicked by administration of glutamate agonists and attenuated by administration of glutamate antagonists . astrocytes are known to express a subtype of glutamate receptor that results in an increase in intracellular ca , thus it was inferred that astrocytic foot processes sensed the synaptic activity and then responded to that activity by inducing vasodilation of the appropriate blood vessels . much current interest is focused on the role microvascular bed in the regulation of cerebral blood flow . specifically , there is evidence that communication within the blood vessels themselves at the microvascular level plays a key role in the overall regulation of blood flow in the brain . since there is a substantial increase in resistance at the arteriole level , the proximal vessels must coordinate with the microvasculature in order to ensure adequate microperfusion . first presented in vivo evidence for the presence of coordinated vasomotor responses ( cvr ) in mouse pial arterioles , by demonstrating that the local constriction response initiated by micropipette application of uridine triphosphate could travel for 300 m or more upstream from the point of application . moreover , conduction could be interrupted by local vascular wall injury ( light - dye technique ) . subsequently , dietrich et al . described conducted vasodilation in penetrating arterioles isolated from the rat brain to various vasoactive agents , including adenosine and atp . they also suggested that endothelial cells appeared to play a key role in the conducted responses of intracerebral arterioles to potassium . the same group also found attenuation of conducted vasodilation by oxyhemoglobin treatment , suggesting a role by vascular conduction in the ischemic conditions developed after subarachnoid hemorrhage . pioneering studies by segal and duling sparked interest in cvr as a mechanism for coordinating vasomotor responses . a simple experimental paradigm , used by these investigators to investigate vascular conduction in peripheral vessels , is to follow the longitudinal spread of vasomotor responses in arterioles to discrete stimulation of arterioles . thus , restricted application of vasoactive substances to arteriolar segments induces both direct effects and secondary conducted vasomotor responses . the conducted dilation response could not be explained by simple diffusion or by neural innervation and is independent of blood flow and pressure , because occlusion of an arteriole to create a sealed sac did not affect the propagated dilation . thus , the pathway of signal conduction is located exclusively in vessel wall components ( endothelium and / or smooth muscle ) . cx40 and cx43 have been identified in smooth muscle and endothelium , whereas cx45 has only been reported in smooth muscle . because connexins have electrical and conductive properties that are different from one another , selective upregulation and downregulation of different connexins , that is , the change in expression profile , likely shapes the change in vasomotor conductivity after an ischemic insult . initial studies showed that the longitudinal spread of arteriolar response to focal agonist application resembled electrical decay along a cable , suggesting that electrical signals travel by passive spread of current between cells in the vessel wall . however , in vivo observations of conducted vasodilation indicate that some vasomotor responses exhibit little decay . for example , hyperpolarization induced by acetylcholine in arteriolar networks of the hamster cheek pouch in vivo was maintained , and even grew , as it traveled . the mechanism for generating the additional current to aid the spread of hyperpolarization may involve inward rectifier kchannels and / or na / k atpase in smooth muscle cells . in cerebral penetrating arterioles , barium chloride ( bacl2 ) attenuatedboth conducted dilation and constriction responses to k , suggesting that kir may be involved in cvr in the cerebrovasculature as well . the regulation of blood flow in the brain is exceedingly complex and only beginning to be elucidated . we have attempted to broadly outline the major categories of mechanisms discovered so far , focusing on pressure autoregulation , metabolic regulation , and neurogenic regulation . central to all three groups is the neurovascular unit , composed of endothelial cells , neurons , and astrocytes . the role of this substrate in a variety of pathologic states characterized in part by failure of cerebral blood flow control ( stroke , traumatic brain injury , hypertension , alzheimer 's disease ) is the target of intense investigation and underscores the need to explore the control of blood flow at level of the microcirculation as well .\noutput:\n" }, { "from": "agent", "value": "the control of cerebral blood flow is complex , and only beginning to be elucidated . studies have identified three key regulatory paradigms . the first is cerebral pressure autoregulation , which maintains a constant flow in the face of changing cerebral perfusion pressure . flow - metabolism coupling refers to the brains ability to vary blood flow to match metabolic activity . an extensive arborization of perivascular nerves also serves to modulate cerebral blood flow , so - called neurogenic regulation . central to these three paradigms are two cell types : endothelium and astrocytes . the endothelium produces several vasoactive factors that are germane to the regulation of cerebral blood flow : nitric oxide , endothelium - dependent hyperpolarization factor , the eicosanoids , and the endothelins . astrocytic foot processes directly abut the blood vessels , and play a key role in regulation of cerebral blood flow . lastly , new research has been investigating cell - cell communication at the microvascular level . several lines of evidence point to the ability of the larger proximal vessels to coordinate vasomotor responses downstream ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: among the childhood brain neoplasms , craniopharyngioma constitutes about 26 % of all primary intracranial tumors , with an incidence of 0.13 cases per lakh person - years . basically , these are benign neoplasms that are commonly located in the sellar or suprasellar region and very rarely present in the infrasellar area . craniopharyngioma poses a multitude of challenges to the neurosurgeon , endocrinologist , oncologist , intensivist and the anesthesiologist . the high - recurrence rates after radical surgery , the presence of vital structures like nerves and vessels in the vicinity of the tumor , the numerous pressure effects of the tumor due to brain tissue compression , various postoperative endocrinological sequelae , high morbidity and mortality as well as hazardous effects of radiotherapy are few of the challenging aspects that force many clinicians to adopt a more conservative and palliative approach . we are reporting a case of craniopharyngioma in an 18 - year - old female who had progressive loss of vision and was successfully managed with combined radical surgery and medical therapy . an 18 - year - old short statured female with a height of 129 cm and weighing 33 kg presented to the ophthalmology outpatient department ( opd ) with chief complaints of progressively increased loss of vision for the last 18 months . primary amenorrhea was another symptom that was revealed during the elicitation of gynecological history . on ophthalmic examination , vision of the right eye was found to be severely compromised , with optic atrophy . the right - sided pupil was semi - dilated and was not reacting to light , but consensual light reflex was present . the left - sided pupil was normal in size and elicited normal reaction to direct light , but had absent consensual reflex [ figure 1 ] . visual field examination findings on physical examination , it was found that patient had poorly developed secondary sexual characteristics . her endocrinological evaluation revealed the following values of thyroid hormones : thyroid stimulating hormone 6 miu / ml , t31 ng / ml and t44 .36 / dl . her morning cortisol levels were estimated at 294.7 nmol / l , the normal value being in the range of 171536follicle stimulating hormone , luteinizing hormone and prolactin levels were estimated at 8.36 miu / ml ( 3.512.5 ) , 4.65 miu / ml ( 2.412.6 ) and 10 ng / ml ( 523 ) , respectively . magnetic resonance imaging ( mri ) of the brain was carried out , which suggested a sellar and suprasellar mass . the sellar portion of the mass was solid while the suprasellar mass was diagnosed to be cystic . compression of the optic chiasma by the tumor mass measuring 32 mm 26 mm 23 mm was very much forthright on mri . a provisional diagnosis of craniopharyngioma was made by the radiologist based on the above radiological evidence [ figures 2 and 3 ] . sagital section of magnetic resonance imaging brain showing the craniopharyngioma coronal section of magnetic resonance imaging brain showing the location of craniopharyngioma the patient was administered medical treatment initially in the form of 50 g of eltroxin and 10 mg hydrocortisone per day , and the surgical procedure was planned after 2 weeks of medical treatment . in the operation theater , induction of anesthesia was carried out with fentanyl 2 g / kg , propofol 2 mg / kg , vecuronium 0.1 mg / kg and 50:50 mixture of oxygen and nitrous oxide in isoflurane . continuous noninvasive monitoring was carried out , which included heart rate ( hr ) , noninvasive blood pressure ( nibp ) , ecg , pulse oximetry ( spo2 ) and end tidal carbon dioxide ( etco2 ) , which was maintained between 30 and 33 mmhg . right pterional ( fronto temporo sphenoidal ) osteoplastic craniotomy was performed and trans - sylvian subtotal tumor removal was carried out . the patient was placed supine on sugita frame at 20 degree low vertex position and the head was rotated 30 degree to the left to bring malar eminence at the highest point with 30 reverse trendelenburg position . surgical findings revealed a widely opened sylvian fissure by the tumor , which had a thick capsule . another remarkable finding was that of lateral displacement and thinning out of the right optic nerve by the tumor invasion . the cystic component of the tumor was containing a straw - colored fluid while the solid component appeared pinkish white with specks of calcification , which could be partly removed by suction . the tumor capsule was adherent to the optic chiasma and , therefore , the floor of the third ventricle was left behind . at the end of the surgical procedure , reversal of the neuromuscular blockade was carried out with neostigmine and glycopyrrolate and extubation was performed after thorough suctioning and return of protective airway reflexes . the patient was kept in the recovery room for 2 h , where strict vigil monitoring was carried out . thereafter , she was shifted to the intensive care unit ( icu ) for further observation . the patient had transient diabetes insipidus for the next 3 days , which responded to intranasal desmopressin that was administered three - times daily for 3 days . the rest of the postoperative course was uneventful and surgical sutures were removed on the eighth postop day . the postoperative investigations revealed a tsh level of 2.2 miu , while postoperative computed tomography scan head revealed a small amount of solid tumor in the sella with left - sided residual capsule . the histopathological examination of the tumor was also carried out , which confirmed the diagnosis of craniopharyngioma . the patient was discharged on the 10 postoperative day and was prescribed tab eltroxin 50 g / day and tab dexamethasone 0.5 mg / day and was advised regular follow - up . the most common postulated hypothesis for the origin of craniopharyngioma revolves around the theory of neoplastic transformation of embryonic cells of the craniopharyngeal duct during the embryological development . another theoretical postulate states that it is the metaplastic transformation of adenophysis cells of the pituitary gland that leads to the development of craniopharyngioma . there is a generalized deficiency of various pituitary hormones like growth hormone , gonadotropin , thyroid stimulating hormone and adrenocorticotropic hormone . in the present case alsothe compressive symptoms manifested as progressive loss of vision while endocrinological dysfunctions were visible in the form of retarded growth , deranged thyroid hormone levels and primary amenorrhea . the patients typically present to the ophthalmology or surgical opd with symptoms related to visual field defects , raised intracranial pressure , growth abnormalities and various symptoms related to pituitary deficiency , as was the scenario in our case where the patient presented with progressive loss of vision . mri is the investigation of choice for precise diagnosis of the tumor location and to supplement the central - type visual field defect diagnosis during ophthalmic examination . the morbidity and mortality due to radical surgical treatment is quite high , to the extent of 4050 % . in many situations , there is hardly any alternative but to adopt a radical surgical approach for the excision of tumor . in the present case also , the patient had severe symptoms that had progressed very rapidly for the last 1 year and therefore the surgical treatment was the only option left . the prognostic criteria for the cure of craniopharyngioma include age greater than 5 years , size of tumor less than 4 cm , complete surgical removal and absence of severe endocrinological dysfunction . the combination of these factors has a favorable prognosis , and the presence of all these factors in our case encouraged us to proceed with radical surgery in our patient . also , the back - up facilities of intensive care that are being managed by the anesthesiolgists further helped us to plan precisely the overall postoperative management . radical surgical intervention is associated with a possible neuronal damage to the parts of the brain including thalamus , mammilo - thalamic tract and basal forebrain . the injury to the vessels during the surgery can result in uncontrolled bleeding , pushing the poor neurosurgeon and the anesthesiologist to the edge of the sword . the ideal surgical conditions were provided in our case as we resorted to hypotensive anesthesia and adopted all the intracranial pressure - lowering interventions . the injury to the nerves during the surgical advancement toward the tumor and its excision can cause permanent neurological impairment necessitating icu admission of the patient in a comatose state . even radical surgery fails to achieve the 100 % results and does require adjuvant therapy , which warrants the active involvement of the oncologist and the radiotherapist as well . the possible advantages of interstitial radiotherapy over radical surgery are still debatable and no general consensus exists regarding the definite treatment of such lesions . there is another school of thought that lay more stress on a conservative approach with limited surgical intervention , and radiotherapy assistance is taken by some neurosurgeons . the potential complications associated with such measures include delayed effects due to the remnants of the tumor and an inadequate control of the general symptomatology . because the symptomatology in the present case was of progressive nature despite medical managementthe difficulties for the anesthesiologist and the intensivist carries on to the postoperative period also as , along with anterior pituitary impairment , posterior pituitary dysfunction also get accentuated in almost 7080 % of the cases . our patient also suffered from severe diabetes insipidus during the postop period , and the excessive urinary output was controlled only after the administration of intranasal desmopressin . the endocrinological emergencies postoperatively can be very challenging if the patient is not prepared well before proceeding for the surgical and anesthetic interventions . the scope of improvement in the treatment of such lesion is huge provided that there exists a general consensus among different school of thoughts . as the majority of these tumors occur in children , a more comprehensive approach is required at an international level for a better functional outcome as the whole future life of these children is going to be affected by the quality of surgical intervention . there should be regular meetings and discussions at an international level regarding the precise treatment options for such intracranial neoplasms . only then will we be able to improve our health services for the successful treatment of similar cases .\noutput:\n" }, { "from": "agent", "value": "among the childhood brain neoplasms , craniopharyngioma constitutes about 26 % of all primary intracranial tumors . craniopharyngioma poses a multitude of challenges to the neurosurgeon , endocrinologist , oncologist , intensivist and the anesthesiologist . the morbidity and mortality due to radical surgical treatment is quite high , to the extent of 4050 % . the conservative approach with limited surgical intervention and radiotherapy assistance is taken by some neurosurgeons , but its usefulness is very doubtful . we are reporting a case of craniopharyngioma in an 18 - year - old female who had progressive loss of vision and was successfully managed with combined radical surgery and medical therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bhanja virus ( bhav ) is , together with two african tick - borne viruses kismayo and forecariah , a member of bhanja group ( family bunyaviridae ) that has not yet been assigned to a recognized genus . the virus was first isolated from the tick haemaphysalis intermedia collected from a paralyzed goat in bhanjanagar ( district ganjam , orissa state , india ) in 1954 . the known geographic distribution of bhav involves southern and central asia , africa , and southern ( partially central ) europe ( figure 1 ) . in europe ( figure 2 ) , bhav has so far been isolated in italy , croatia , bulgaria , slovakia , romania , and portugal ( as palma virus ) . the virus is transmitted by metastriate ixodid ticks : in addition to h. intermedia , it was also isolated from haemaphysalis punctata , h. sulcata , dermacentor marginatus , hyalomma marginatum , h. detritum , h. dromedarii , h. truncatum , h. asiaticum , rhipicephalus bursa , r. appendiculatus , boophilus decoloratus , b. annulatus , b. geigyi , and amblyomma variegatum . vertebrate hosts of bhav are sheep , goat , cattle , african hedgehog atelerix albiventris , and african ground squirrel xerus erythropus . the virus does not usually cause apparent infection in adult animals but is pathogenic for young ruminants ( lamb , kid , calf ) causing fever and symptoms indicating the cns affection . several cases of bhav febrile illness have been described in humans , with symptoms including photophobia , vomiting , meningoencephalitis , and pareses . modern predictive methods for potential geographic distribution of organisms , for example , of ixodid ticks or pathogens they transmit , are usually based on remote sensing satellite imagery combined with the use of geographic information system . in this contributionthe procedure is characterized by comparing known natural foci of bhav within europe to extract their typical features and select those characters that can be used as factors predicting potential presence of the virus in other geographic areas . eight natural foci of bhav in europe were selected ( figure 2 ) being defined as those areas where the virus was either isolated from ixodid ticks or its presence indicated by a very high seroprevalence rate ( 50 % ) among local domestic ruminants in different years . the chosen areas include the following : s : sicily around catania and madonie , italy ; c : cosenza province , calabria region , southern continental italy ; f : fondi areamonti ausoni , latina province , central italy figure 3 ; g : grosseto province , tuscany , central italy ; v : vaglia , florence province , tuscany , northern central italy figure 3 ; b : bra island , central dalmatia , croatia figure 4 ; a : akhtopol and akhtos , burgas district , southeast bulgaria figure 4 ; k : slovak karst , roava district , eastern slovakia figure 5 . complex description of the natural foci has been based on physico - geographic characterization ( for a list of the characters , see supplementary material available online at doi : 10.1155 / 2009 / 372691 ) : topography ( 40 characters ) , geology and pedology ( 47 characters ) , climate ( 39 characters ) , and gross vegetation ( 15 characters ) . description of biota focused on terrestrial vascular plants ( tracheophyta ) , ixodid ticks ( ixodidae table 1 ) and vertebrates ( vertebrata ) , and based on checklists of species present in the eight european areas : a total of 2517 spp . ixodid ticks ( table 1 ) and 96 mammalian , 172 avian , and 40 reptilian spp . were included , each species occurring in at least one of the areas . a great number of resources were utilized for the survey : flora europaea plus national and regional floral checklists , monographs for geographic distribution of ixodid ticks , and an extensive collection of literature for vertebrates . the data recorded as + or ( + ) were evaluated as the presence , - as the absence , while the variables with a doubtfull occurrence ( ? ) in at least one of the two areas compared pairwise were omitted from the similarity calculations of the particular pair of areas . numerical comparative pairwise analysis among the bhav foci was carried out using the jaccard similarity coefficient for binary ( presence - absence ) qualitative data , and euclidean distance for normalized quantitative climatic data . matrices of both the similarity coefficient and euclidean distance values were then subjected to the average linkage upgma cluster analysis , and the results were expressed as dendrograms of relationships ( similarity ) among the areas . the procedure for selection of bioindicators of bhanja virus ( i.e. , those species indicating potential presence of bhav in an area ) consisted in the following steps at scanning the checklists of biota ( i.e. , terrestrial flora , ixodid , and vertebrate faunas ) : ( 1 ) constant species were considered those species present in all ( 8 ) or nearly all ( 6 - 7 ) bhav areas ; ( 2 ) bioindicators were then selected as those constant species having a relatively narrow ecological amplitude and a restricted distribution over europe ( i.e. , ubiquitous and / or generalist / euryoic species were omitted ) . the results of topographical , geological , pedological , and gross vegetational characters ( 102 in total ) revealed a great similarity between the foci c and s on the one hand , among b , f , and k ( all three are karst areas ) on the other , while only a partial similarity between v and g and a marked dissimilarity of a ( figure 6 ) . figure 7 presents climadiagrams of annual course of temperature and precipitation , while figure 6 ( a ) shows the results of cluster analysis of the eight bhav natural foci based on 39 climatic variables . the latter analysis indicates marked similarity among f , g , and b in their climate ; other italian foci ( s , v , c ) are also related , and bulgarian a as well . on the other hand , cluster analysis of terrestrial flora among the foci resulted in a group consisting of three central - italian foci ( f , g , v ) , related floristically to b , south - italian foci ( c , s ) formed another group , while bulgarian a is less similar , and slovak k the least related focus ( figure 6 ) . when the plant species restricted to eumediterranean and littoral zone ( - m ) were excluded from the set , the result was slightly different : central - italian foci were floristically more similar to south - italian foci than to croatian b. again , a and k deviated , the latter more than the former . the topology of dendrograms of avifaunal and herpetofaunal similarity of the foci was identical , and the dendrogram based on mammalian faunas deviated only negligibly ( figure 6 ) . all these three dendrograms showed the formation of three clusters of foci : ( a ) all italian , ( b ) croatian b , ( c ) a and k. on the other hand , ixodid faunas yielded a dendrogram ( figure 6 ( b ) ) very similar to that based on tracheophyta , with formation of two clusters and two singletons : ( a ) central - italian foci ( f , g , v ) and croatian b ; ( b ) south - italian foci ( c , s ) , ( c ) bulgarian a , and ( d ) slovak k. it means that there is a notable congruence between the similarity of foci based on fauna of ixodidae ( a number of them being vectors of bhav ) and that based on terrestrial flora , whereas vertebrate faunas yielded a different pattern . calculations of the congruence among the biotic and abiotic components of the foci by pearson correlation coefficient revealed that ixodid fauna reflects best the terrestrial flora and also climate , much less correlates with vertebrate fauna , whereas physiographic features do not correlate with the other components . in other words , there is an evident , statistically significant relation between climate , terrestrial vascular plants , and ixodid ticks , where the climate is the ultimate causative factor ; vegetation reflects these abiotic weather conditions and affects ( shelter , etc . ) or indicates the formation of tick synusies , while much less closely that of vertebrate communities . a number of biogeographic features in common was found among the natural foci of bhav in europe . the relief is undulating to hilly ( or low mountainous ) , with presence of terraces , plateaus , or peneplains . marine transgression of the area usually occurred during the triassic , lower jurassic , upper cretaceous ( senonian ) , oligocene , and partly mid - miocene periods . mesozoic ( cretaceous or triassic ) or tertiary ( largely pliocene , eocene ) deposits occur . sedimentary rocks ( in contrast to metamorphic and igneous rocks ) prevail ; consequently carbonate minerals ( marls , marly , or clayey shales , sandstones , conglomerates , clays , partly limestone ) are much more usual than silicates . frequent soil types are rendzinas , terrae calcis ( e.g. , terra rossa ) , and illimerized and brown forest soils ; the soil is liable to erosion and drought . climate has the mediterranean pattern , with peak rainfall in the winter ( figures 3 and 4 ) , and a dry , hot summer period or , in central europe ( k , slovak karst figure 5 ) , there are extrazonal xerothermic habitats on karstified limestone approaching meso - and microclimatically those in southern europe . mean annual precipitation is 6001100 mm , air temperature 815c ( january 4c , july 23c ) ; hydrothermic coefficients indicate climate corresponding to the ecotone between steppe and forest ecosystems . dominating vegetation type is mosaic woodland - grassland ( forest - steppe ) ecosystem , consisting largely of thermophilic , broad - leaved deciduous woods ( quercetalia pubescentis ) or pubescent oak bush , and xerothermic meadows with pastures ( festucetalia valesiacae , brometalia erecti , onopordetalia acanthii , prunetalia , origanetalia vulgaris ) . typical for the bhav foci is the colin vegetational belt with trees like quercus pubescens , fraxinus ornus , ostrya carpinifolia , sorbus torminalis , prunus mahaleb , and so forth ; vineyards and thermophilic orchards are common . natural foci of bhav in europe do not occur in the eumediterranean oleo - ceratonion and quercion ilicis zones . the foci are exclusively of boskematic type , that is , associated with grazing domestic ruminants ( largely sheep and goats ) as main hosts of local ixodid vector ticks . characteristic taxa of wild vertebrates are those living in relatively open , dry , and warm habitats for instance , species of the avian genera circaetus , falco , alectoris , caprimulgus , upupa , calandrella , lullula , oenanthe , monticola , lanius . four groups of principal biogeographic predictors for bhav potential areas in europe have been established , based on comparative analysis of the eight european foci : ( 1 ) submediterranean climatic pattern with dry growing season and wet mild winter ( or mesoclimatically similar , e.g. , karstic conditions in central europe ) , ( 2 ) xerothermic woodland - grassland ecosystem , with plant alliances quercetalia pubescentis , festucetalia valesiacae , and brometalia erecti , involving pastoral areas with regular grazing of ( small ) ruminants , on undulating to hilly relief , ( 3 ) at least one of the metastriate tick species haemaphysalis punctata , dermacentor marginatus , rhipicephalus bursa and hyalomma marginatum . ( 4 ) presence of 60 % or more of the 180 ( 157 plant , 4 tick , 19 vertebrate ) spp . ( or species aggregations ) selected bioindicators . as a result of the comparative analysis , 157 plant , table 2 shows suggested bioindicators of bhav natural foci in europe . predicted countries and areas in europe where bhav could potentially occurhave been based on the presence of a sufficiently high ( 60 % ) proportion of species of the bioindicator set ( figure 8 ) . the countries ( areas ) with predicted occurrence of bhanja virus include the following ( table 3 ) : italy , former yugoslavia ( present slovenia , croatia , serbia , monte negro , macedonia , bosnia ) , bulgaria , greece , france ( southern ) , albania , romania , spain , hungary , european part of turkey , ukraine ( southern ) , slovakia ( southern ) , switzerland ( tessin ) , austria ( southeastern ) , corsica , sardinia , germany ( southern ) , moldova , european russia ( southern ) , portugal , and possibly crete . on the other hand , european countries with improbable occurrence of bhanja virus are belgium , czechland ( czech republic ) , poland , great britain , the netherlands , belarus , sweden , denmark , ireland , lithuania , norway , latvia , estonia , finland , and iceland . the geographic distributional centre of the suggested bhav bioindicators is largely the east - mediterranean region , usually with links to asia minor and transcaucasus . further , the number of zooindicators is much lower than that of phytoindicators , though the proportions are identical ( 6 % of the total number of species recorded ) . of the bhav plant indicators an average score of 774383 , with the meaning a xerothermic plant growing on insolated places of suboceanic climate and alkaline ( often calcareous ) , largely nitrogen - deficient soil . the phytoindicator species lying very close by their ecological indices to this average index value have been , for example , quercus pubescens , cerastium brachypetalum , arabis turrita , conringia orientalis , amelanchier ovalis , prunus mahaleb , lathyrus latifolius , l. hirsutus , coronilla emerus , dictamnus albus . acer monspessulanum , helianthemum canum , cornus mas , scandix pecten - veneris , galium tricornutum , asperula cynanchica , a. arvensis , teucrium chamaedrys , stachys germanica , s. recta , legousia speculum - veneris , chondrilla juncea , lactuca viminea , filago vulgaris , hieracium piloselloides , muscari comosum , melica ciliata , agropyron intermedium , phleum paniculatum , and himantoglossum hircinum . eight areas in europe were selected for comparison and called natural foci . in general , a natural focus ( nidus ) of a disease is an area where the agent circulates in an ecosystem between vertebrates and haematophagous arthropod vectors for many years . in a natural focus , the agent should be therefore found repeatedly ( in consecutive years ) either directly ( by isolation from arhropod vectors or vertebrate hosts ) or indirectly , by detection of antibodies in vertebrates . for instance , even in the most deviating and northernmost area , slovak karst , antibodies to bhav were first detected in goats and sheep in 1976 , then repeatedly in the years 1982 and 1983 , and bhav was isolated from local dermacentor marginatus ticks in 1987 . in general , groups of species or whole communities are often more reliable as bioindicators than individual species . therefore only the presence of substantial proportion of the proposed set of indicator species can have a sufficient predictive power . in this study , the cut - off level was established tentatively at 60 % . a unique opportunity to verify the set of predictors of bhav occurrence established in this studyis a comparison of two close and in many respects very similar dalmatian islands bra and hvar ( croatia ) . there is , namely , a known , potent natural focus of bhav infections on bra ( b in this study ) , whereas no known bhav focus on hvar . detected antibodies to bhav in 31.5 % of inhabitants ( 875 examined ) on bra but only in 1.0 % ( 512 examined ) on hvar , though antibodies to , for example , sandfly fever were distributed homogeneously among inhabitants of both islands : 62.1 % and 59.4 % , respectively . the underlying reasons for such a great difference on two neighbouring islands have not as yet been explained . however , the suggested set of predictors of bhav foci does enable clear differentiation of both islands in the following crucial factors : ( 1 ) plant community ostryo - carpinion adriaticum ( order quercetalia pubescentis ) , occurring in the central elevated part of bra , does not appear on hvar ; ( 2 ) very limited numbers of domestic ruminants graze on hvar ( typical extensive pastures are completely lacking ) contrasting to their large numbers ( even for centuries ) on bra ; ( 3 ) population density of bhav vector ticks ( haemaphysalis punctata , dermacentor marginatus ) is ( consequently ) much lower on hvar than on bra . it is therefore probable that this predictive approach could well be used to test the probability of potential bhav occurrence even in individual districts within a particular country . the possibility of indication of natural foci of tick - borne encephalitis ( tbe ) by the presence of specific plant communities was proposed by parasitologists and botanists more than four decades ago . however , ixodes ricinus , the vector of tbe , is a generalist ( euryoic ) tick species with a very wide ecological valence and therefore much less amenable to predictive analysis . on the other hand , prediction is relatively easier in the specialist ( stenoic ) species like some metastriate ticks , including vectors of bhav , having a rather narrow ecological valence . these species are generally bound to certain specific habitats and the analysis of their distribution can thus be more straightforward and effective . although not so sophisticated , is an alternative to remote sensing and applicable for prediction of geographic distribution of ixodid ticks and pathogens they transmit . a prerequisite for this alternative approach is existence of corresponding databases and / or checklists of abiotic and biotic variables in respective areas or a complex field survey . an anonymous reviewer of this manuscript suggested that bhav infection could have followed humans with their domestic animals ( bos indicus ) infested with one - host vector ticks such as boophilus spp . from asia to africa and a mixture of african and asian cattle ( bos taurus ) into the mediterranean . additionally , primaeval movements of tick - infested sheep and goats from asia to africa and europe could play an important role in the dispersion of bhav .\noutput:\n" }, { "from": "agent", "value": "bhanja virus ( bhav ) is pathogenic for young domestic ruminants and also for humans , causing fever and affections of the central nervous system . this generally neglected arbovirus of the family bunyaviridae is transmitted by metastriate ticks of the genera haemaphysalis , dermacentor , hyalomma , rhipicephalus , boophilus , and amblyomma . geographic distribution of bhav covers southern and central asia , africa , and southern ( partially also central ) europe . comparative biogeographic study of eight known natural foci of bhav infections in europe ( in italy , croatia , bulgaria , slovakia ) has revealed their common features . ( 1 ) submediterranean climatic pattern with dry growing season and wet mild winter ( or microlimatically similar conditions , e.g. , limestone karst areas in central europe ) , ( 2 ) xerothermic woodland - grassland ecosystem , with plant alliances quercetalia pubescentis , festucetalia valesiacae , and brometalia erecti , involving pastoral areas , ( 3 ) presence of at least one of the tick species haemaphysalis punctata , dermacentor marginatus , rhipicephalus bursa , and / or hyalomma marginatum , and ( 4 ) presence of 60 % of the 180 bhav bioindicator ( 157 plant , 4 ixodid tick , and 19 vertebrate spp . ) . on that basis , greece , france ( southern , including corsica ) , albania , spain , hungary , european turkey , ukraine ( southern ) , switzerland ( southern ) , austria ( southeastern ) , germany ( southern ) , moldova , and european russia ( southern ) have been predicted as additional european regions where bhav might occur ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: seizures increase fracture risk throughout the skeleton even without any direct trauma by the muscular contractions ( 1 ) . there are numerous reports in the literature about the seizure induced fracture or dislocation in shoulder , femur , acetabulum or even spinal column that mostly reported in thoracic or thoracolumbar region ( 2 ) . it has been reported that fractures are 26 times more common in epileptic patients relative to the general population ( 3,4 ) . vertebral compression fracturesare commoninpatients with epilepsyand not related to the osteomalacia secondary to antiepileptic drugs . vertebral fractures in epilepsy generally involve the vertebral bodies of the thoracic portion of the spine and the affected vertebra is usually single one ( 2 ) . we report one case of vertebral fractures due to a single idiopathic seizure that affected three lumbar vertebrae with no previous illness , trauma , or drug use . a 42 - year - old man with ahistory of seizures ( at the time ofdriving ) and back pain for three days was referred to the orthopedic clinic with severe pain in dorsolumbar area and inability to walk . while driving in the street , he got a single seizure and then without any occurrence of a traffic accident , he was driven out of the car by medical emergency team . the patientwasthe onlypassenger in the car and consciousnesswasnotimpaired . at presentation , the neurological examination of upper and lower limbs was completely intact . laboratory findings , brain ct , mri and electroencephalography were normal , while plain radiography of the dorsolumbar region revealed the l2 - l3 - l4 vertebral fractures ( fig .1 ) . the spiral computerized tomography scanning confirmed three levels lumbar vertebral fracture and the extent of injury ( fig . superior end - plate fracture of the l2 , l3 and l4 are evident . ambulation was started two days later , but a comprehensive study comprised of a thorough internal medical work up to rule out underlying causes like osteoporosis was carried out . bone mineral densities of the hip and lumbar spine were determined by dual - energy x - ray absorptiometry scan . t scores for hip and lumbar area were 0.4 and 0.2 , while z scores for these regions were 0.6 and 0.3 , respectively . these scores according to world health organization ( who ) completely rule out underlying osteoporotic disorders ( 5 ) . one year later at the latest follow up visit , the patient had no problem and returned to his previous level of activity and work . the fractures and dislocations of the shoulder and hip , and fractures of the femur acetabulum and vertebrae following seizure have been reported previously ( 6,7 ) . shoulder dislocation is the most common injury reported and the vertebral fracture is the rarest . fracture is relatively common in epileptic patients , but this usually occurs after generalized tonic and colonic seizures and is unusual in idiopathic seizures ( 8 ) . pathologic fractures are also more commonly observed in epileptic patients and these are usually related to the associated osteopenia ( secondary to epileptic drugs ) , insulin - dependentdiabetes mellitus , and corticotherapy ( 9 - 11 ) . our case had no underlying bony pathology or osteopenia . in the case we reported here , the patient had no previous history of epilepsy and other diseases . usuallyintense musclecontractionsthatoccurduringseizuresmaylead to extension of the cervical and lumbar spine and flexion and angulation of the thoracic spine , therefore the vertebral fracture is more common at thoracic region ( 4 ) the seizure occurred while the patientwasdriving with his lumbar spine in a flexed position . the number of fractured vertebra reported in associate with epileptic seizures is usually one or two ( 4 ) while in this case , three adjacentlumbarvertebrae were injured and according to our knowledge , this is the first case that has been reported with three consecutive lumbar vertebral fractures that occurred after a non - epileptic seizure in an otherwise healthy patient . in the convulsive patients presented with refractory significant pain and localized tenderness on the spinal column , the physician has to consider the probability ofspinalfractures even if no history of a direct trauma existed .\noutput:\n" }, { "from": "agent", "value": "it has been reported that fractures are more common in epileptic patients relative to the general population.seizures by repeated muscular contractions can increase fracture risk throughout the skeleton , but the reportedpapers about non traumatic vertebral fractures following a single episode of seizure are rare and mostly locatedin thoracic spine with only one or two vertebral fracture . the case we reported here was a 42 year old otherwisehealthy man who had three vertebral fractures due to a single idiopathic seizure affected the lumbar region withno previous history of underlying disease , trauma , or drug use ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: lipases ( triacylglycerol acylhydrolases ec 3.1.1.3 ) are a class of serine hydrolases which catalyze the hydrolysis of triglycerides to glycerol and free fatty acids over oil - water interface . in addition , lipases catalyze the hydrolysis and transesterification of other esters as well as the synthesis of esters and exhibit enantioselective properties . lipases are used in chemical processing , dairy industries for improvement of flavour , paper industries , oleochemical industries , pharmaceuticals , synthesis of surfactants , detergent industries , leather industries , and polymer synthesis . lipases are produced by plants , animals , and microbes but only microbial lipases are found to be industrially important since they are diversified in their enzymatic properties and substrate specificity . bacterial lipases that are of commercial importance are obtained from achromobacter , alcaligenes , arthrobacter , bacillus , burkholderia , chromobacterium , and pseudomonas . lactic acid bacteria ( lab ) are generally considered to be weakly lipolytic , as compared to other groups of microorganisms . the lipolytic activity by lab plays an important role in the determination of special aroma of different cheeses . since they are considered as generally recognised as safe ( gras ) , they are used extensively as starter cultures in food and feed industries . although there are reports on lactic acid bacterial lipase production , they are fewer in comparison to other microorganisms like bacillus . most research is now focused on the use of waste residues generated by industries as inexpensive substrates for microbial growth and metabolite production . fish processing industries generate around 63.6 million metric tons ( mmt ) in which 2.8 mmt of waste are generated in india alone . these wastes are a rich source of biomolecules such as lipids , proteins , chitin , collagen , minerals , and vitamins that can be recovered and utilized . the lipids and proteins are extracted from the fish wastes either by addition of enzymes or by fermentation with lab . lactic acid bacterial fermentation has been used for recovery of oil from fish viscera and also for extraction of proteins from shrimp waste and leather industry waste . these lipidic carbon and nitrogen rich sources can be used as ample substrates for lipase production by lab . howeverthe most challenging task in optimization is the presence of interactive effects of media components and culture conditions . response surface methodology ( rsm ) is a collection of statistical and mathematical techniques useful for developing , improving , and optimizing processes in which a response of interest is influenced by several variables and the objective is to optimize this response . it defines the effect of independent variables , alone or in combination , on the processes and generates a mathematical model that describes the process . in the present study , fish waste was used to design a medium for lipase production by enterococcus faecium mtcc 5695 and pediococcus acidilactici mtcc 11361 . the significant parameters ( media components and cultural conditions ) on lipase production were identified using a factorial design and optimized using a box - behnken design . to the very best of our knowledge , there are no reports on the optimization of lipase production by lab from fish waste by rsm . fresh water fish visceral waste devoid of air bladder was collected from local fish markets in mysore , india . enterococcus faecium ncim5335 ( ef - 35 ) used for extraction of fish oil was obtained from institute collection centre . all microbiological media were procured from hi - media ( m / s hi - media , mumbai , india ) . para - nitrophenyl acetate ( p - npa ) and p - nitrophenol were obtained from srl ( srl chemicals , bangalore , india ) . all other chemicals , solvents , and reagents used in the study were of analytical grade , unless otherwise mentioned . the lipase - producing strains used in the present study were isolated from fish processing waste . they were identified by 16s rdna sequencing as enterococcus faecium mtcc 5695 and pediococcus acidilactici mtcc 11361 and deposited in national culture collection of industrial microorganisms , ncl , pune . the gene sequences of enterococcus faecium mtcc 5695 and pediococcus acidilactici mtcc 11361 are deposited in ncbi with accession numbers hq005360 and submission i d 1554294 . extraction of fwo was done as per the procedure detailed in rai et al . with slight modifications . fresh water fish visceral waste devoid of air bladder was subjected to homogenization in a waring blender ( stephen mill , um5 universal , hong kong ) . the uniformly homogenized fish viscera was steam cooked at 85c for 10 minutes to inactivate the inherent enzymes and microflora , followed by fermentation for 72 hours using ef - 35 . the protein hydrolysate was extracted from the protein rich residue layer as per bhaskar et al . with few modifications . the protein residue layer was extracted thrice with distilled water in the ratio 1 : 1 w / v . protein extract obtained on centrifugation was subjected to lyophilisation to give fwph , which was then dissolved in distilled water . the effect of ph ( x1 ) , temperature ( x2 , c ) , time ( x3 , h ) , fwph concentration ( x4 , mg / ml ) , and fwo concentration ( x5 , % v / v ) on lipase production by mtcc 5695 and mtcc 11361 was studied by a ( 5 factors 2 levels ) factorial design encompassing 32 runs ( table 2 ) . lipase activity ( y ) was determined as the response ( dependent variable ) and specifically designated as ya and yb for lipase activities of mtcc 5695 and mtcc 11361 , respectively . fwph and fwo were added as per amounts indicated in table 2 . the most significant factors influencing lipase production by mtcc 5695 and mtcc 11361 were chosen to enhance lipase production by box - behnken design . a box - behnken design for three factors encompassing 15 runs ( table 4 ) was applied for optimization of lipase production by mtcc 5695 and mtcc 11361 . the factors namely fwo concentration ( x1 , % v / v ) , fwph concentration ( x2 , mg / ml ) , and time ( x3 , h ) were employed in three levels ( 1 , 0 , + 1 ) . lipase activity ( y ) was determined as the response ( dependent variable ) . lipase activities of mtcc 5695 and mtcc 11361 were designated as y1 and y2 , respectively . the optimization experiments were performed as presented in tables 2 and 4 in 250 ml erlenmeyer flasks containing 100 ml media . the ph and temperature were maintained at 6.0 and 43c ( central values generated through factorial design ) , respectively . as per the time intervals indicated in tables 2 and 4 , sample aliquots were collected and centrifuged at 10,000 rpm for 10 min . cell pellet was collected and sonicated in phosphate buffer ( ph 7.0 ) for complete lysis . the lysed cells were centrifuged and lipase assay was performed for the cell free extract . lipase activity was determined spectrophotometrically using p - npa as the substrate as described by wang et al . with slight modifications .300 l of cell supernatant and 900 l of acetonitrile : ethanol : phosphate buffer ( ph 6.8 ) in ratio of 1 : 4 : 95 was mixed with 800 l of p - npa ( 100 mm ) in acetonitrile . one unit of lipase activity is defined as the amount of enzyme required to liberate one mol of p - nitrophenol per minute under the standard assay conditions . the data generated from the experiments were analyzed to obtain the optimized conditions by the same . fish waste contains a rich source of both lipids and proteins and thereby can be applied as an efficient substrate for microbial growth and production of various metabolites . henceforth , this study aims at the use of fish waste as an effective alternative for the carbon and nitrogen sources present in media currently used for cultivation of lab . in this study , the carbon and nitrogen sources in the commercial mrs medium were replaced with fwo and fwph , respectively , as indicated in table 1 . fwo and fwph helped in enhanced lipase production by both the organisms thereby acting as a replacement for carbon and nitrogen sources , respectively . fwo consists mainly of triacylglycerols that comprises a variety of fatty acids that act as a remarkable lipidic carbon source for induction of lipase production . on the other hand , fwph serves as a rich source of proteins aiding in the luxurious growth of organisms and metabolite production . moreover , most of the protein supplements used for the cultivation of lab are of bovine origin which makes it unsuitable for use in food industries . the observed lipase activity values are shown in table 2 along with the experimental runs . the influence of the chosen independent parameters on lipase production by mtcc 5695 and mtcc 11361 was studied by a ( 5 factors 2 levels ) factorial design . anova results for mtcc 5695 ( table 3 ( a ) ) and mtcc 11361 ( table 3 ( b ) ) indicate time ( x3 ) , fwph concentration ( x4 ) , and fwo concentration ( x5 ) to be the most significant independent parameters affecting lipase production ( p 0.05 ) . it was observed that time had a negative effect on lipase production , whereas fwo concentration and fwph concentration had a positive effect . the production of lipase by mtcc 5695 ( y1 ) and mtcc 11361 ( y2 ) as a function of these parameters is represented by the following : ( 1 ) y1 = 192.935 + 46.528 x1 + 9.938 x26 .19748 x3 + 2909.623 x4 + 114.0688 x5 , y2 = 58.3232 + 7.766719 x1 + 0.844994 x21 .14688 x3 + 437.0406 x4 + 50.47033 x5 . the optimum levels of the significant independent parameters were determined further by a box - behnken design and the insignificant independent parameters , that is , ph ( x1 ) and temperature ( x2 ) were maintained at the centre of their levels . the influence of fwo concentration ( x1 ) , fwph concentration ( x2 ) , and time ( x3 ) on lipase production was determined by box - behnken design as indicated in table 4 , which also presents the observed values for lipase activity of mtcc 5695 ( y1 ) and mtcc 11361 ( y2 ) at different combinations of the independent parameters . the lipase produced was found to vary from 437 u / ml to 1707 u / ml for mtcc 5695 and from 10.48 u / ml to 487.22 u / ml for mtcc 11361 , in the fifteen experiments conducted which shows the strong influence of media components on the lipase production . tables 5 ( a ) and 5 ( b ) indicate the anova table for mtcc 5695 and mtcc 11361 , respectively . table 5 ( a ) presents that among the independent variables , quadratic effect of fwo and fwph showed significance on the response variable , whereas only linear effect of time had significance ( p 0.05 ) . moreover , the interactions between factors did not significantly influence ( p 0.05 ) lipase production by mtcc 5695 ( y1 ) except for the interaction between fwo and time . table 5 ( b ) depicts that among independent variables quadratic effect of fwo and fwph showed significance on the response variable ( p 0.05 ) , but both quadratic and linear effects of time did not show significance for lipase production by mtcc 11361 ( y2 ) . interactions between the independent variables did not show any significant effect ( p 0.05 ) . similar studies stating the significant influence of sunflower oil and palm oil as inducible carbon sources on lipase production have been reported . the response surface graph for y1 and y2 as a function of fwph concentration and fwo concentrationit was observed that lipase production increased with increase in fwph concentration up to 0.16 mg / ml beyond which there was a decrease in case of both the organisms probably due to inhibition of enzyme activity in the presence of excess nitrogen . a possible mechanism may be that fwph is a complex nitrogen source and the cells may produce more protease for the degradation of fwph before its utilization . the lipase production increased with increase in fwo concentration for mtcc 5695 , whereas lipase production increased with increase in fwo concentration up to 4 % v / v beyond which there was a decrease for mtcc 11361 . the decrease in lipase production by mtcc 11361 beyond 4 % v / v of fwo concentration may be due to the reason that high concentrations of fwo have more incidence of long chain fatty acids which might have an inhibitory effect on lipase production . the influence of time and fwo concentration on y1 and y2 is presented in figures 1 ( b ) and 1 ( d ) , respectively . the figure clearly indicates that lipase production decreases with increase in time for mtcc 5695 however , a slight increase was observed after 48 h for mtcc 11361 . this may be probably due to the fact that mtcc 5695 and mtcc 11361 achieve maximum growth in 24 h after which they enter the stationary phase resulting in a steady decline in lipase production . the optimized levels of variables ( x1 , x2 , and x3 ) were determined using desirability profiles for y1 and y2 ( figures 2 ( a ) and 2 ( b ) ) . the optimized factors for obtaining the highest y1 were 5 % v / v fwo concentration , 0.15 mg / ml fwph concentration at 24 h of fermentation whereas for y2 , 4 % v / v fwo concentration , 0.15 mg / ml fwph concentration at 24 h of fermentation were found to be optimum . the response variables y1 and y2 were assigned a desirability of 1.0 for the highest observed value ( y11707 u / ml and y2487 .22 u / ml ) and a desirability of 0 for the lowest observed value ( y1437 u / ml and y210 .48 u / ml ) to get the overall desirability . the desirability function to get the optimum lipase production was fitted by the least square method . the level of variable giving the highest desirability ( 1.0 ) was selected as the optimum level . the regression equation for lipase activity of mtcc 5695 and mtcc 11361 , as a function of the three independent variables ( x1 , x2 , and x3 ) and their linear and quadratic interactions , is represented by the following : ( 2 ) y1 = 742.6 + 187.4 x1 + 26.6 x12 + 12560.0 x2 + 50350.0 x22 + 9.4 x3 + 445.0 x1x24 .9 x1x3 + 23.7 x2x3 , y2 = 708.7 + 276.0 x137 .0 x12 + 12560.0 x238200 .6 x22 + 0.1 x3211 .6 x32 .4 x1x2 + 0.3 x1x3 + 21.5 x2x3 . coefficient of determination ( r ) is a measure of the strength of the linear relationship between the experimental and predicted values . r for the correlation between the observed and predicted lipase activities of mtcc 5695 and mtcc 11361 was 0.9808 and 0.94246 , respectively . the model was validated by conducting experiments at 5 % v / v fwo concentration , 0.15 mg / ml fwph concentration at 24 h of fermentation for mtcc 5695 and 4 % v / v fwo concentration , 0.15 mg / ml fwph concentration at 24 h of fermentation for mtcc 11361 . the experimental values of y1 ( 1715 u / ml ) and y2 ( 493 u / ml ) at these optimum conditions were quite close to the predicted values ( 1645.75 u / ml and 481.662 u / ml , resp . ) which indicated that the model was highly significant . a fold increase of 3.15 and 2.3 was obtained , respectively , in lipase production for mtcc 5695 and mtcc 11361 by optimization using rsm ( i.e. lipase activity of 543.63 u / ml and 214.74 u / ml under unoptimized conditions , resp . ) . this fold increase is more than the fold increase obtained by sharma et al . wherein a 1.6-fold increase in lipase production was observed in arthrobacter sp . bgcc # 490 and kumari et al . liu et al . reported a 5-fold increase in lipase production by burkholderia sp . enterococcus faecium mtcc 5695 and pediococcus acidilactici mtcc 11361 were found to be potential lipase - producing strains using fish waste substrates . rsm was found to be an efficient methodology for rapid optimization of influencing parameters and development of polynomial equation for lipase production . the significance of this work is that it includes the use of an economical substrate for lipase production , which in turn diminishes the problem of waste disposal from fish processing industries . moreover , the optimized conditions obtained from this study can be used for large - scale cost - effective production of lipase from lab .\noutput:\n" }, { "from": "agent", "value": "a medium using fish waste as substrate was designed for production of lipase by enterococcus faecium mtcc 5695 and pediococcus acidilactici mtcc 11361 . medium components and culture conditions ( fish waste protein hydrolysate ( fwph ) concentration , fish waste oil ( fwo ) concentration , ph , temperature , and fermentation time ) which affect lipase production were screened using factorial ( 5 factors 2 levels ) design of which fwph concentration , fwo concentration , and fermentation time showed significance ( p < 0.05 ) . the levels of these factors were optimized further by box - behnken design using response surface methodology ( rsm ) . optimized conditions were found to be 5 % v / v fwo , 0.15 mg / ml fwph and 24 h of fermentation time for mtcc 5695 , and 4 % v / v fwo , 0.15 mg / ml fwph and 24 h of fermentation for mtcc 11361 , which were further validated . under optimized conditions , mtcc 5695 and mtcc 11361 showed 3.15 - ( 543.63 to 1715 u / ml ) and 2.3 - ( 214.74 to 493 u / ml ) fold increase in lipase production , respectively , as compared to unoptimized conditions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the classic symptom of spinal canal stenosis is pseudoclaudication or neurogenic claudication .16 the classification of spinal stenosis proposed by arnoldi et al . ( 1976 ) remains useful .7 patients typically complain of pain , paresthesia , weakness , or heaviness in the buttocks radiating into lower extremities with walking or prolonged standing , relieved with forward bending and sitting . patients with severe spinal canal stenosis either do not improve with conservative measures or have frequent recurrent symptoms . the long term outcomes of decompressive surgery for relief of pain and disability are still unclear . this study evaluates the outcome of surgical management of secondary degenerative lumbar canal stenosis and analyzes the effect on different outcome variables using the joa score . this prospective study was conducted at our hospital between august 2002 to october 2010 after obtaining clearance from the institutional ethical committee . during this period ,46 patients of degenerative lumbar canal stenosis were deemed eligible for operative treatment based on the inclusion and exclusion criteria out of which 14 patients did not consent and thus a total of 32 patients underwent surgical treatment . patients who had posture - related radicular pain with claudication distance less than 100 m and who could not carry out their routine daily activities were assessed with magnetic resonance imaging ( mri ) [ figure 1a and 1b ] . surgery was performed if the central canal diameter on mri was found to be less than or equal to 10 mm . spinal instability was assessed using flexion and extension lateral radiographs using posner 's criteria .8 patients with primary bony canal stenosis , traumatic lumbar canal stenosis , stenosis due to tumors and infection , and patients not medically fit for surgery due to comorbidities were excluded from the study . instrumentated stabilization was done in all cases with preoperative instability and when laminectomy was done at more than one level . all procedures were performed by senior orthopaedic surgeon . according to this protocol , laminectomy with decompressionwas done in 2 cases , laminectomy and disectomy was done in 23 patients , laminectomy , disectomy with instrumented stabilization was done in 5 cases , and laminectomy , disectomy with posterior lumbar interbody fusion was performed in 2 patients . pre and posttreatment assessment of the patients was done according to joa evaluation system for low back pain . the joa score was determined by direct questioning to assess subjective symptoms , clinical signs , and restriction of activities of daily living . the recovery rate of the patients following treatment was calculated by using the description of hirabayashi et al . recovery rate was classified using a four - grade scale : excellent , 90 % ; good , 7589 % ; fair , 5074 % ; and poor , below 49 % .9 ( a ) preoperative ap and ( b ) lateral x - rays of a 52 years old male patient who presented with secondary degenerative lcs at l3 - 4 , l4 - 5 with retrolisthesis of l4 over l5 . his preoperative joa score was 5 ( a ) preoperative t2 sagittal mri section of the same patient showing degenerative lcs l3 - 4 , l4 - 5 with degenerated disc at l2 - 3 , l3 - 4 , l4 - 5 . discs at l3 - 4 and l4 - 5 were found to be soft and bulging intraoperatively and hence were removed along with posterior decompression , laminectomy and pedicle screw fixation from l2 to l5 , ( b ) preoperative t2 axial mri section showing large herniated disc at l3 - 4 . the patient attained joa score of 28 at 3 months followup which was maintained till last followup of 7 months preoperative and postoperative joa scores at immediate , 3 month , 6 month , and 1 year followup were compared using wilcoxon 's test for nonparametric data . preoperative and postoperative joa scores at immediate , 3 month , 6 month , and 1 year followup were compared using wilcoxon 's test for nonparametric data . complete data of all the 32 patients along with their joa scores are presented [ table 1 ] . distribution of patients in all the variables of joa scoring system was assessed before and after treatment [ table 2 ] . clinical details and outcome of all patients distribution of variables of joa score in surgically managed lcs patients ( preoperative vs. three months postoperative ) preoperatively , 71.87 % of patients ( n = 23 ) presented with continuous severe low backache , 25 % ( n = 8 ) with occasional severe low backache , and 3.13 % ( n = 1 ) presented with occasional mild low backache . three months postoperatively , 62.5 % patients ( n = 20 ) had no back pain and 37.5 % ( n = 12 ) had occasional mild low back pain . most of the patients ( 87.5 % , n = 28 ) had presented to us with posture related severe leg pain , but postoperatively 96.87 % patients ( n = 31 ) had no leg pain . all patients had preoperative claudication distance less than 100 m , but 93.75 % patients ( n = 30 ) had normal gait with walking distance more than 500 m and no claudication symptoms postoperatively . the most common level of involvement was l4 - l5 ( 81.82 % patients , n = 27 ) followed by l5 - s1 ( 54.55 % patients , n = 18 ) .93.74 % patients ( n = 30 ) had abnormal straight leg raising test [ 46.87 % patients ( n = 15 ) had straight leg raising positive below 30 and 46.87 % patients ( n = 15 ) had between 30 and 70 ] , but postoperatively all patients had normal straight leg raising test . sensations were diminished in l4 dermatome in 3 patients , l5 dermatome in 14 patients and s1 dermatome in 8 patients . overall , 20 patients ( 62.5 % ) had shown sensory disturbance preoperatively , but postoperatively 19 of these 20 patients recovered normal sensory function . motor weakness was present in 15 patients ( 46.87 % ) preoperatively , but postoperatively only 6 patients ( 18.75 % ) showed motor deficit . overall , 93.75 % patients ( n = 30 ) in our study showed improvement in all variables of the joa scoring system postoperatively . at 3 monthfollowup , 18.75 % ( n = 6 ) patients showed excellent outcome , 62.50 % ( n = 20 ) showed good outcome , and 18.75 % ( n = 6 ) patients showed fair outcome [ table 3 ] . at 6 month followup ,38.46 % patients ( n = 10 ) showed excellent outcome and 61.54 % patients ( n = 16 ) showed good outcome . at 1 year followup , 64.00 % patients ( n = 16 ) showed excellent outcome and 36.00 % patients ( n = 9 ) showed good outcome . at final followup , 64 % patients ( n = 16 ) showed excellent outcome , 28 % ( n = 7 ) showed good outcome , and 8 % ( n = 2 ) showed fair outcome . outcome of the patients improved as the time after surgery increased till 1 year and was sustained thereafter till the last followup ( only two patients showed decrease in their recovery rate which was due to prolapsed disc or canal stenosis at a different level ) . statistically significant improvement was seen in all variables except running and lifting heavy weight [ table 2 ] . outcome of 32 surgically managed patients assessed by pre and posttreatment ( joa ) score on comparison of preoperative and three months postoperative joa scores using wilcoxon 's test for nonparametric data , p value is 0.001 which meant that outcomes were extremely significant postoperatively . further , joa scores significantly improved even postoperatively till 1 year ( p 0.05 ) . after 1 year , the joa scores did not change significantly with time till the last followup . in our study , 40.63 % ( n = 13 ) patients were in the age group 5059 years , followed by 4049 year age group , and the average age was 45.1 years , with similar age and sex distribution reported by others .1064 % patients showed excellent and 28 % showed good outcome at the end of 1 year followup , while ganz et al . ( 1990 ) reported almost similar result showing 86 % good outcome in their series of 33 patients treated by decompressive surgery . in their patientswhose preoperative symptoms were relieved by postural changes , the success rate was 96 % compared to only 50 % in those unchanged by postural changes .11 weinstein et al . ( 2010 ) showed that patients with degenerative spondylolisthesis and spinal stenosis treated surgically showed substantially greater improvement in pain and function during a period of 2 years than those treated nonsurgically .12 in our study , finally , 62.5 % patients had no back pain and 37.5 % had occasional mild pain , 96.87 % had no leg pain , 93.75 % had normal gait , 100 % had normal straight leg raising , and 95 % had sensory improvement ( i.e. 19 patients out of 20 who presented with sensory impairment ) . ( 1991 ) with average leg pain improvement of 82 % and average back pain improvement of 71 % .13 weinstein et al . ( 2010 ) in their prospective multicentre sport study of 654 patients concluded that patients with symptomatic spinal stenosis treated surgically compared to those treated nonoperatively maintain substantially greater improvement in pain and function through 4 years . all patients in their study were surgical candidates with a history of at least 12 weeks of neurogenic claudication or radicular leg symptoms and spinal stenosis without spondylolisthesis ( as confirmed on imaging ) . they were enrolled in either a randomized cohort ( 289 patients ) or an observational cohort ( 365 patients ) at 13 u.s . spine clinics and were treated by either standard decompressive laminectomy ( 414 patients ) or usual nonsurgical care ( 240 patients ) .14 no patient in our series had poor result . this could be due to the fact that all patients underwent at least a 12 weeks trial of adequate conservative treatment and were only operated after clinicoradiological correlation of their symptoms with imaging was confirmed . decompressive laminectomy was also adequately supplemented with pedicle screw fixation ( in cases of preoperative instability or when more than one level laminectomy was performed ) and / or posterior lumbar interbody fusion ( in cases of degenerative listhesis ) and / or discectomy ( cases with a soft bulging disc ) . the failure of surgery to completely relieve pain in these two patients may be attributed to the widespread degeneration . outcome was also affected due to some variables in scoring system like running and heavy weight lifting in which female patients and patients over 50 years scored less despite being free of pain . getty ( 1980 ) personally reviewed 31 patients ( age range 18 to 75 years ) who had been treated surgically for lumbar spinal stenosis between 1968 and 1978 and followed them for an average of 42 months . in 28 ( 90 % ) patients , degenerative changes in the lumbar spinehad been the principal etiological factor ; the other 3 had idiopathic developmental lumbar spinal stenosis . in 17 ( 55 % ) patients , the result was classified as good , although a total of 26 ( 84 % ) patients were satisfied . this compares well with our study in which 93.75 % patients ( n = 30 ) were satisfied with their surgery . good results of operation for lumbar spinal stenosis in series of getty were characterized by rapid resolution of pain in the leg . the most important reason for failure to relieve symptoms in his series was stated to be inadequate decompression .15 postacchini et al . ( 1992 ) noted bone regrowth in 88 % of 40 patients who had laminectomy or laminotomy for spinal stenosis at an average of 8.6 years of followup . bone regrowth was noted in all patients with associated spondylolisthesis .16 we did not observe any case of bone regrowth in our series . a possible explanation could be that interbody fusion was done in all cases of listhesis and pedicle screw fixation to supplement any case with preoperative instability or multilevel decompression in our series . moreover , we performed a wide laminectomy with medial facetectomy in all our patients as compared to narrow laminotomy in some cases of postacchini et al . postacchini ( 1999 ) described that 7080 % of patients of lumbar canal stenosis had satisfactory result from surgery , but the outcome tended to deteriorate in the long term .17 our outcomes improved postoperatively till 1 year but therafter neither showed any improvement or deterioration till last followup . the authors are of the opinion that operative treatment in patients of degenerative lumbar canal stenosis yields excellent long term functional results as observed on the basis of joa scoring system provided that patients are properly selected and decompressive surgery is performed simultaneously addressing the associated instability or listhesis . all activities of daily living which were assessed using joa score showed significant improvement except for running and lifting heavy weight .\noutput:\n" }, { "from": "agent", "value": "background : the long term outcomes of decompressive surgery on relief of pain and disability in degenerative lumbar canal stenosis are unclear . the aim of our study was to evaluate the outcome of surgical management of secondary degenerative lumbar canal stenosis and to analyze the effect on outcome variables using japanese orthopaedic association ( joa ) score.materials and methods : thirty - two patients of degenerative lumbar canal stenosis managed surgically were included in this study . laminectomy ( n = 2 ) , laminectomy with disectomy ( n = 23 ) , laminectomy and disectomy with instrumental stabilization ( n = 5 ) , and laminectomy , disectomy with posterior interbody fusion ( n = 2 ) were performed . joa scoring system for low backache was used to assess the patients . the recovery rate was calculated as described by hirabayashi et al . ( 1981 ) . surgical outcome was assessed based on the recovery rate and was classified using a four - grade scale : excellent , improvement of > 90 % ; good , 7589 % improvement ; fair , 5074 % improvement ; and poor , below 49 % improvement . the patients were evaluated at 3 months , one year and at last followup.results : at 3 - month followup , 18.75 % patients showed excellent outcome , 62.50 % patients showed good outcome , and 18.75 % showed fair outcome . at 1 - year followup , 64 % patients showed excellent outcome and 36 % patients showed good outcome . at > 1 year followup ( average 34.2 months , range : 2110 months ) , 64 % patients showed excellent outcome , 28 % showed good outcome , and 8 % showed fair outcome . no patient had poor outcome . outcome of the patients improved as the time after surgery increased till 1 year and was sustained thereafter till the last followup.conclusion : operative treatment in patients of degenerative lumbar canal stenosis yields excellent results as observed on the basis of joa scoring system . no patient got recurrence of symptoms of nerve compression ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the prospect of finding a cure for hiv , which at times has appeared tantalisingly close to reality , has ignited public attention and raised the exciting possibility of ending the hiv / aids epidemic .1 although antiretroviral therapy has effectively transformed hiv / aids into a chronic condition , there are still many burdens , costs , side effects and stigma facing those living with hiv / aids .2 this is especially true for hiv - positive children because a child , if successfully treated , will spend more time on antiretrovirals than an individual infected as an adult . therefore , hiv research into alternatives to lifelong antiretroviral therapy , including but not limited to a cure for hiv , has great promise for adults and children . the now famous mississippi baby case initially seemed to offer a way to cure children with hiv by providing them with very early antiretroviral therapy ( vet ) . in that case , an infant received antiretroviral therapy within 30 h of birth and was later taken off therapy for unknown reasons at approximately 18 months of life . this intervention departed from standard of care , which would require giving the infant antiretroviral drugs to prevent transmission , but with fewer drugs and at lower doses . when the mississippi baby returned to care , replication - competent virus could not be detected in her bloodstream , and this finding could not be explained by any of the ways individuals have been able to achieve control of the virus without antiretroviral drugs in the past .3 unfortunately , the mississippi baby experienced viral rebound approximately 2 years after going into remission , and was placed back on therapy in july 2014.4 although the mississippi baby ultimately was not cured , the vet strategy is currently being tested in infants . this is in part because the ability to have sustained viral remission while off therapy has value on its own , and because infants may be uniquely positioned to be treated before the virus takes hold in reservoirs throughout the body that are very difficult to eliminate . although vet is considered a cure strategy , it differs significantly from many of the strategies being used in adult cure research because vet is similar to the current standard of care ,5 and the adult cure research agenda involves testing agents that are much riskier and more speculative .2 some have argued that it is ethically defensible to test vet with certain safeguards ,5 and other scholars have supplemented this analysis .6 leaving aside vet , should other cure interventions currently being tested in adults start paediatric testing early ? there are several reasons that accelerated paediatric testing of hiv cure interventions might make sense . some researchers argue that paediatric and adult cure agendas should better synergize with one another .7 the scientific value of testing cure interventions on infants and children , given their unique and developing immune systems , has been cited as a reason to pursue this research as well .8 at least one hiv cure intervention the use of stem cell transplantation from donors with an hiv - resistant mutation in patients with cancer and hiv has already been tested in a child , though it was not successful .9 the limitations of vet have also led commentators to argue that interventions currently being tested in adults may make it easier to cure infants who have received vet , or that it might even be a necessary step to cure those infants .1011 finally , failing to enrol children in early stages of important research can also lead to a delay in availability of the intervention down the road . putting children towards the front of the line for experimental cure interventions , however , flies in the face of received wisdom about the ethics of paediatric research . the general rule is to test experimental interventions in adults first .12 some have argued that early studies of risky hiv cure interventions should not enrol patients who lack decision - making capacity , which would exclude children from the early phases of hiv cure research .13 there are some exceptions to this general rule of enrolling adults in research before children , however , which might apply to interventions that target hiv .14 this raises the question when should the adult hiv cure agenda be translated into paediatric research ? in this paper , i then evaluate the arguments for and against hiv cure research and conclude that , despite the potential value of hiv cure interventions for children , existing experimental interventions are too risky and speculative to accelerate the involvement of children in this research , particularly in light of the available alternatives . finally , i return to the more general question of when to start testing experimental interventions in children to apply the most interesting implications from the debate over the use of hiv cure interventions in children . children are typically defined as persons who have not attained the legal age for consent ,15 and generally either parents or guardians have to provide proxy consent for children . this makes it more difficult to determine when participating in research or other activities actually reflects the values and preferences of children . children are also more vulnerable to harm than adults , and parents or guardians may have competing interests that depart from the interests of their children , so proxy consent may be insufficient to protect children 's interests in all cases . children do develop greater decision - making capacity over time , even if they are not considered legally competent to make decisions , and can be asked for their assent . although assent is often required by institutional review boards ( irbs ) from children who have the capacity to understand some basic information about research , it does not have the same moral force as consent , and younger children are not considered capable of providing their own assent .16 thus , providing one 's own consent is a way to protect one 's own interests that is precluded for most children . in the 1970s , an important debate took place in the bioethics literature about whether it is acceptable to expose children to risk in non - beneficial research , with one prominent ethicist arguing that it is not because children do not provide their own consent , and another arguing that children can be exposed to minimal net risk in research .17 ethicists now generally agree that children should only be exposed to relatively low amounts of net risk in research if it is justified by the benefits to society ( though there is some disagreement over what counts as low risk research ) .5 there is also some agreement that age de - escalation ( involving older children at earlier stages of research and younger children down the line ) can serve as an additional protection in some cases . today , research with children is legally approvable by irbs in the usa only if the risk involved is offset by a prospect of benefit , or if not , if the risk is relatively low ( up to aminor increase over minimal risk ) and if this risk is justified by the potential value for society .18 of note , the us federal regulations also have a category in which paediatric research of higher risk and no benefit could theoretically be approved if there is sufficient social value , though there are stringent procedural hurdles , and very few studies that pose high risks have been approved in this category .19 international guidelines and regulations typically only permit paediatric research that involves minimal risk , or research that offers the potential for direct benefit .20 controversy persists over how to interpret existing regulations and apply them to research . weighing individual benefits against potential risk is not always straightforward .21 for instance , many scholars have questioned whether early phase research can ever be seen as beneficial to children , noting that the potential for benefit of phase i studies in particular is very low .22 another big challenge , but one that has been much less studied ,23 is determining what counts as sufficient societal benefit ( often referred to as social value ) to justify exposing children to research that poses net risk . in particular , it is hard to determine how much we should discount the social value of research based on how likely ( or unlikely ) it is that the research will generate a product that will help improve health . it makes intuitive sense that a very promising phase iii trial that is likely to result in a product that will improve human health significantly ( such as a product that has the potential to cure an otherwise fatal illness ) has higher social value than a phase i trial of a similar product where the chance of failure is likely to be close to 95 % . although it is often unclear how to do this type of discounting in practice , the social value of an experimental approach with a high probability of failure likely could only justify exposing individual research subjects to relatively low risk . because social value and risk will change as a research intervention or programme moves from earlier phases to later phases , determining when children can be enrolled in research depends on the promise of any given experimental intervention as well as the phase of the research . a european paediatric ethics working group has issued guidelines on when to initiate paediatric research that recommend the involvement of children in early phase research , including during phase ii , in certain cases . this includes when the population suffers from a serious or life - threatening disease that has a different natural history than in adults , or when there is insufficient treatment for the disease .16 this analysis assumes that the interventions being tested would be beneficial to those children given the seriousness of their illness or the lack of comparable alternatives . as the analysis of hiv cure research will reveal below , howeverhiv is a serious disease that has a somewhat different course in children than in adults . in hiv prevention context , based on the scientific necessity for enrolling adolescents and the possible benefits for communities to finding an hiv vaccine , some commentators have recommended increasing the amount of risk to which adolescents can be exposed in research on an hiv vaccine ,24 and enrolling older adolescents in phase iib proof of concept hiv vaccine research .25 hiv cure research similarly has high potential benefit for society , and , as mentioned above , finding a cure in children and infants may be easier or different than finding a cure for hiv in adults . thus , the arguments that have been made to accelerate the involvement of adolescents in hiv vaccine research would seem to apply with similar force to speed up the involvement of children in hiv cure research . however , prominent scholars have argued that children should not be involved in early phase hiv cure research [ b ] ecause the assessment of risks and benefits in these early studies is a complex and value - dependent decision .15 this recommendation bears further examination . as mentioned above , at least one cure intervention has been tested in a child ,7 and cure research has high potential for individual and societal benefit . below i review the ethical arguments for and against earlier initiation of paediatric testing of hiv cure interventions . this analysis will reveal that , given the current state of the adult hiv cure field , it is premature to initiate paediatric testing for several reasons . in theory , the prospect of a cure for hiv could be highly beneficial for children in early cure studies , as a cure would presumably allow previously hiv - infected children the chance to be healthier , live longer , be free of the burdens of daily antiretroviral therapy and to live without the stigma associated with hiv infection . as will be discussed below , however , the potential for benefit in current early phase cure research is minimal at best , what counts as acure in hiv cure research may not coincide with the traditional use of the term . the fact that alternative treatments for hiv are well established and widely available also limits the potential for benefit . the early involvement of children in hiv cure research could have high scientific value , because the timing of infection is easier to isolate in infants who are infected in utero , during labour or during breast feeding than for people in other age groups . children may also be more receptive to some cure interventions because their immune systems are still developing . thus , children may be an ideal population to involve in research aiming at a cure for hiv . moreover , failing to involve children in early phase hiv cure research could lead to delayed access to hiv cure interventions for paediatric patients in the future . some commentators have gone so far as to argue that [ i ] t is imperative that children be included in the early stages of cure research and development , as we would not want to repeat the mistakes of the past by delaying the availability of a cure for children .26 such delay can occur because the translation of adult interventions into paediatric use is often far from straightforward . significant testing may be necessary to ensure that the drugs that work in adults are safe and effective in children , and to find the right dosages , identify relevant drug - drug interactions and develop child - friendly formulations .27 given that most early phase testing is unlikely to be successful , however , these arguments implicitly accept a trade - off between the risks to which individual research participants would be exposed and the potential for advancing scientific understanding and providing benefits for the hiv - infected children who would ultimately receive successful hiv cure interventions . as mentioned above , international regulations governing research only allow children to be exposed to relatively low net risks in research , and do not allow great sacrifices on the part of individual children to benefit others in the future . therefore , the arguments in favour of involving children in earlier phase cure research only work insofar as early phase cure research poses relatively low risk . perhaps the most important reason to wait to enrol children in research towards an hiv cure is that the interventions being tested pose relatively high risks . hiv cure trials are investigating interventions such as chemotherapeutic agents , broadly neutralising antibodies and transplantation of autologous stem cells .1 one promising strategy is to reactivate latent reservoirs of latent t cells where hiv is lodged within the body and then destroy the virus .28 other strategies include : reactivating latently infected cells and stimulating their clearance by the immune system ; genetically modifying host cd4 cells to make them resistant to hiv infection ; and therapeutic vaccines .29 key toxicities of some of the interventions being used in hiv cure research include immune - mediated adverse reactions , which can be severe , and increased risk of lymphomas , skin cancers , [ and ] infection .26 these authors have noted that hiv cure interventions have risks that may be more pronounced in individuals with hiv and that the long - term complications of many of the potentially useful agents have not been established .26 additionally , the research procedures needed to test the efficacy of these interventions pose significant risks . there is general agreement that the ultimate test of an intervention targeting the hiv - 1 reservoir is an analytical treatment interruption .2 hiv - infected individuals who interrupt their antiretroviral therapy can experience viral rebound , the seeding of reservoirs with hiv where few if any existed , the emergence of resistance to antiretrovirals to treat hiv , decreases in cd4 cell counts and unknown risks .5 it is worth noting that if interventions are found not to work in early phase research in adults , then these interventions and research methodologies will not need to be tested in children , thereby sparing them from being exposed to these risks . a second reason not to enrol children in early phase hiv cure researchis that the goal of this research is to achieve sustained viral remission , and although some possibilities have been suggested , it is not entirely clear how the ability to achieve viral remission would be useful in clinical practice . recent experiences such as the viral rebound of the mississippi baby have led some to conclude that a cure for hiv infection , at least considered as a sterilizing cure with complete and definitive eradication of the virus , remains extremely challenging . nevertheless , optimism stays high for the prospects of long - term viral suppression in the absence of art. 30 there is an emerging consensus on the use of the term sustained or long - term remission as the appropriate aim for hiv cure research , though commentators go on to suggest retaining the aspirational goal of working towards an hiv cure .27 to be sure , sustained viral remission could be useful for children in critical developmental phases when exposure to the side effects of antiretrovirals could be especially damaging , or during periods like adolescence when adherence is often poor .31 it is still highly uncertain whether sustained viral remission is a possibility for most children , however , even with the initiation of vet . this strategy has only been tested and reported in two infants , one of whom experienced viral rebound almost immediately . thus , the social value of research aiming at sustained viral remission is probably not sufficient to justify relatively high risks in research involving children . third , the different hiv cure interventions being tested are unlikely to be successful in isolation . to date , studies have not identified a single agent that can reactivate the latent hiv reservoir , andcombination therapies with agents that potently reactivate hiv plus kill the reactivated cells will most likely be required to purge the latent reservoir in patients .27 this strategy is sometimes referred to as kick and kill or shock and kill .26 as some authors have argued , there is clearly a long way to go and key challenges lie in the search for combination interventions that not only lead to activation of latent hiv infection , but also significant decreases in the size of the hiv reservoir .1 as mentioned above , there are also several different experimental candidates for the different components of what may eventually amount to a cure . eyal and kuritzkes contend that the [ d ] evelopment of a strategic plan to prioritise which approaches to combine will require careful thought .2 since cure interventions will be used in a strategy yet to be determined , the value of any individual study aiming at a cure is diminished . unlike an hiv vaccine that might be used to prevent hiv on its own , the social value of any given cure intervention has to be divided by the amount of contribution it makes to the ultimate attainment of viral remission or cure . in other words , if one study is testing an intervention that may be a part of a five - step combination that results in viral remission , the social value of each individual intervention is a fraction of the total social value of achieving viral remission . this diminished social value makes it even less likely that testing early phase , risky hiv cure interventions could be justified in children . finally , the alternatives available to children living with hiv / aids are numerous , well tested and highly effective . antiretroviral therapy has transformed hiv into a chronic illness , with life expectancies of those living with hiv essentially the same as people who are uninfected . although there are side effects of antiretroviral therapy , including mitochondrial toxicity , metabolic abnormalities and skin reactions , these risks are better characterised and less severe than some of the risks associated with hiv cure interventions , and newer drugs pose fewer risks .32 furthermore , because infants will increasingly have access to strategies for the prevention of mother to child transmission , fewer young children are likely to be infected with hiv in the future .33 although adolescents are experiencing growing disease burden , prevention of infection is still the first line strategy , and pre - exposure prophylaxis has been shown to be highly effective for those who take it .34 higher - income countries and lower - income countries have also developed approaches to increase access to antiretroviral therapy around the world . it is true , however , that many of those who are diagnosed as hiv - positive or even begin to receive care are subsequently lost to follow - up ,35 and keeping patients plugged into the continuum of care is an important challenge for and a current limitation of hiv treatment programmes worldwide . yet the cure interventions currently being tested are likely to face very similar challenges . to the extent that cure interventions are intended to result in viral remission for a period of time , people receiving these interventions will have to be closely monitored so they can be placed back on therapy when they experience viral rebound . thus , the current challenges posed by the hiv cascade of care are unlikely to be solved even if current hiv cure interventions are successful . in sum , current approaches to hiv cure largely do not seem to offer a radical improvement over the status quo . as eyal and kuritzkes have argued , cure interventions may simplyreplace safety with great uncertainty .2 without more reason to have confidence in the prospects of any given hiv cure intervention , the social value of early phase hiv cure research is simply not high enough to justify the involvement of children in this research . i have argued that hiv cure research should not be initiated in children until later stages of research . my argument depends on some reasonable assumptions about hiv cure research that are based on the current adult hiv cure agenda , however , and may not hold if the field changes in certain respects . for instance , if there are interventions being tested that are like vet in that they are not much riskier than the current standard of care , then this may be one exception . additionally , if there are methodological breakthroughs that allow more careful measurement of changes in the size of viral reservoirs or better detection of very low levels of replication - competent hiv in the bloodstream , then these breakthroughs may lower the risk of some hiv cure research to a level where it makes sense to involve children in this research earlier . another possibility , although an unlikely one , is that a cure intervention could be developed that has the potential to be used on its own , and this may also change the calculation . finally , if a clear clinical need is articulated for children in general or a subpopulation of children to have sustained periods of time off antiretroviral therapy without incurring damage to their immune systems , initiating cure research in children may have greater value than it currently does and the earlier enrolment of children might be justifiable . children are typically defined as persons who have not attained the legal age for consent ,15 and generally either parents or guardians have to provide proxy consent for children . this makes it more difficult to determine when participating in research or other activities actually reflects the values and preferences of children . children are also more vulnerable to harm than adults , and parents or guardians may have competing interests that depart from the interests of their children , so proxy consent may be insufficient to protect children 's interests in all cases . children do develop greater decision - making capacity over time , even if they are not considered legally competent to make decisions , and can be asked for their assent . although assent is often required by institutional review boards ( irbs ) from children who have the capacity to understand some basic information about research , it does not have the same moral force as consent , and younger children are not considered capable of providing their own assent .16 thus , providing one 's own consent is a way to protect one 's own interests that is precluded for most children . in the 1970s , an important debate took place in the bioethics literature about whether it is acceptable to expose children to risk in non - beneficial research , with one prominent ethicist arguing that it is not because children do not provide their own consent , and another arguing that children can be exposed to minimal net risk in research .17 ethicists now generally agree that children should only be exposed to relatively low amounts of net risk in research if it is justified by the benefits to society ( though there is some disagreement over what counts as low risk research ) .5 there is also some agreement that age de - escalation ( involving older children at earlier stages of research and younger children down the line ) can serve as an additional protection in some cases . today , research with children is legally approvable by irbs in the usa only if the risk involved is offset by a prospect of benefit , or if not , if the risk is relatively low ( up to a minor increase over minimal risk ) and if this risk is justified by the potential value for society .18 of note , the us federal regulations also have a category in which paediatric research of higher risk and no benefit could theoretically be approved if there is sufficient social value , though there are stringent procedural hurdles , and very few studies that pose high risks have been approved in this category .19 international guidelines and regulations typically only permit paediatric research that involves minimal risk , or research that offers the potential for direct benefit .20 controversy persists over how to interpret existing regulations and apply them to research . weighing individual benefits against potential risk is not always straightforward .21 for instance , many scholars have questioned whether early phase research can ever be seen as beneficial to children , noting that the potential for benefit of phase i studies in particular is very low .22 another big challenge , but one that has been much less studied ,23 is determining what counts as sufficient societal benefit ( often referred to as social value ) to justify exposing children to research that poses net risk . in particular , it is hard to determine how much we should discount the social value of research based on how likely ( or unlikely ) it is that the research will generate a product that will help improve health . it makes intuitive sense that a very promising phase iii trial that is likely to result in a product that will improve human health significantly ( such as a product that has the potential to cure an otherwise fatal illness ) has higher social value than a phase i trial of a similar product where the chance of failure is likely to be close to 95 % . although it is often unclear how to do this type of discounting in practice , the social value of an experimental approach with a high probability of failure likely could only justify exposing individual research subjects to relatively low risk . because social value and risk will change as a research intervention or programme moves from earlier phases to later phases , determining when children can be enrolled in research depends on the promise of any given experimental intervention as well as the phase of the research . a european paediatric ethics working group has issued guidelines on when to initiate paediatric research that recommend the involvement of children in early phase research , including during phase ii , in certain cases . this includes when the population suffers from a serious or life - threatening disease that has a different natural history than in adults , or when there is insufficient treatment for the disease .16 this analysis assumes that the interventions being tested would be beneficial to those children given the seriousness of their illness or the lack of comparable alternatives . as the analysis of hiv cure research will reveal below , however , these criteria are not sufficient for evaluating when to initiate paediatric testing . hiv is a serious disease that has a somewhat different course in children than in adults . in hiv prevention context , based on the scientific necessity for enrolling adolescents and the possible benefits for communities to finding an hiv vaccine , some commentators have recommended increasing the amount of risk to which adolescents can be exposed in research on an hiv vaccine ,24 and enrolling older adolescents in phase iib proof of concept hiv vaccine research .25 hiv cure research similarly has high potential benefit for society , and , as mentioned above , finding a cure in children and infants may be easier or different than finding a cure for hiv in adults . thus , the arguments that have been made to accelerate the involvement of adolescents in hiv vaccine research would seem to apply with similar force to speed up the involvement of children in hiv cure research . however , prominent scholars have argued that children should not be involved in early phase hiv cure research [ b ] ecause the assessment of risks and benefits in these early studies is a complex and value - dependent decision .15 this recommendation bears further examination . as mentioned above , at least one cure intervention has been tested in a child ,7 and cure research has high potential for individual and societal benefit . belowi review the ethical arguments for and against earlier initiation of paediatric testing of hiv cure interventions . this analysis will reveal that , given the current state of the adult hiv cure field , it is premature to initiate paediatric testing for several reasons . in theory , the prospect of a cure for hiv could be highly beneficial for children in early cure studies , as a cure would presumably allow previously hiv - infected children the chance to be healthier , live longer , be free of the burdens of daily antiretroviral therapy and to live without the stigma associated with hiv infection . as will be discussed below , however , the potential for benefit in current early phase cure research is minimal at best , what counts as acure in hiv cure research may not coincide with the traditional use of the term . the fact that alternative treatments for hiv are well established and widely available also limits the potential for benefit . the early involvement of children in hiv cure research could have high scientific value , because the timing of infection is easier to isolate in infants who are infected in utero , during labour or during breast feeding than for people in other age groups . children may also be more receptive to some cure interventions because their immune systems are still developing . thus , children may be an ideal population to involve in research aiming at a cure for hiv . moreover , failing to involve children in early phase hiv cure research could lead to delayed access to hiv cure interventions for paediatric patients in the future . [ i ] t is imperative that children be included in the early stages of cure research and development , as we would not want to repeat the mistakes of the past by delaying the availability of a cure for children .26 such delay can occur because the translation of adult interventions into paediatric use is often far from straightforward . significant testing may be necessary to ensure that the drugs that work in adults are safe and effective in children , and to find the right dosages , identify relevant drug - drug interactions and develop child - friendly formulations .27 given that most early phase testing is unlikely to be successful , however , these arguments implicitly accept a trade - off between the risks to which individual research participants would be exposed and the potential for advancing scientific understanding and providing benefits for the hiv - infected children who would ultimately receive successful hiv cure interventions . as mentioned above , international regulations governing research only allow children to be exposed to relatively low net risks in research , and do not allow great sacrifices on the part of individual children to benefit others in the future . therefore , the arguments in favour of involving children in earlier phase cure research only work insofar as early phase cure research poses relatively low risk . perhaps the most important reason to wait to enrol children in research towards an hiv cure is that the interventions being tested pose relatively high risks . hiv cure trials are investigating interventions such as chemotherapeutic agents , broadly neutralising antibodies and transplantation of autologous stem cells .1 one promising strategy is to reactivate latent reservoirs of latent t cells where hiv is lodged within the body and then destroy the virus .28 other strategies include : reactivating latently infected cells and stimulating their clearance by the immune system ; genetically modifying host cd4 cells to make them resistant to hiv infection ; and therapeutic vaccines .29 key toxicities of some of the interventions being used in hiv cure research include immune - mediated adverse reactions , which can be severe , and increased risk of lymphomas , skin cancers , [ and ] infection .26 these authors have noted that hiv cure interventions have risks that may be more pronounced in individuals with hiv and that the long - term complications of many of the potentially useful agents have not been established .26 additionally , the research procedures needed to test the efficacy of these interventions pose significant risks . there is general agreement that the ultimate test of an intervention targeting the hiv - 1 reservoir is an analytical treatment interruption .2 hiv - infected individuals who interrupt their antiretroviral therapy can experience viral rebound , the seeding of reservoirs with hiv where few if any existed , the emergence of resistance to antiretrovirals to treat hiv , decreases in cd4 cell counts and unknown risks .5 it is worth noting that if interventions are found not to work in early phase research in adults , then these interventions and research methodologies will not need to be tested in children , thereby sparing them from being exposed to these risks . a second reason not to enrol children in early phase hiv cure research is that the goal of this research is to achieve sustained viral remission , and although some possibilities have been suggested , it is not entirely clear how the ability to achieve viral remission would be useful in clinical practice . recent experiences such as the viral rebound of the mississippi baby have led some to conclude that acure for hiv infection , at least considered as a sterilizing cure with complete and definitive eradication of the virus , remains extremely challenging . nevertheless , optimism stays high for the prospects of long - term viral suppression in the absence of art. 30 there is an emerging consensus on the use of the term sustained or long - term remission as the appropriate aim for hiv cure research , though commentators go on to suggest retaining the aspirational goal of working towards an hiv cure .27 to be sure , sustained viral remission could be useful for children in critical developmental phases when exposure to the side effects of antiretrovirals could be especially damaging , or during periods like adolescence when adherence is often poor .31 it is still highly uncertain whether sustained viral remission is a possibility for most children , however , even with the initiation of vet . this strategy has only been tested and reported in two infants , one of whom experienced viral rebound almost immediately . thus , the social value of research aiming at sustained viral remission is probably not sufficient to justify relatively high risks in research involving children . third , the different hiv cure interventions being tested are unlikely to be successful in isolation . to date , studies have not identified a single agent that can reactivate the latent hiv reservoir , andcombination therapies with agents that potently reactivate hiv plus kill the reactivated cells will most likely be required to purge the latent reservoir in patients .27 this strategy is sometimes referred to asthere is clearly a long way to go and key challenges lie in the search for combination interventions that not only lead to activation of latent hiv infection , but also significant decreases in the size of the hiv reservoir .1 as mentioned above , there are also several different experimental candidates for the different components of what may eventually amount to a cure . eyal and kuritzkes contend that the [ d ] evelopment of a strategic plan to prioritise which approaches to combine will require careful thought .2 since cure interventions will be used in a strategy yet to be determined , the value of any individual study aiming at a cure is diminished . unlike an hiv vaccine that might be used to prevent hiv on its own , the social value of any given cure intervention has to be divided by the amount of contribution it makes to the ultimate attainment of viral remission or cure . in other words , if one study is testing an intervention that may be a part of a five - step combination that results in viral remission , the social value of each individual intervention is a fraction of the total social value of achieving viral remission . this diminished social value makes it even less likely that testing early phase , risky hiv cure interventions could be justified in children . finally , the alternatives available to children living with hiv / aids are numerous , well tested and highly effective . antiretroviral therapy has transformed hiv into a chronic illness , with life expectancies of those living with hiv essentially the same as people who are uninfected . although there are side effects of antiretroviral therapy , including mitochondrial toxicity , metabolic abnormalities and skin reactions , these risks are better characterised and less severe than some of the risks associated with hiv cure interventions , and newer drugs pose fewer risks .32 furthermore , because infants will increasingly have access to strategies for the prevention of mother to child transmission , fewer young children are likely to be infected with hiv in the future .33 although adolescents are experiencing growing disease burden , prevention of infection is still the first line strategy , and pre - exposure prophylaxis has been shown to be highly effective for those who take it .34 higher - income countries and lower - income countries have also developed approaches to increase access to antiretroviral therapy around the world . it is true , however , that many of those who are diagnosed as hiv - positive or even begin to receive care are subsequently lost to follow - up ,35 and keeping patients plugged into the continuum of care is an important challenge for and a current limitation of hiv treatment programmes worldwide . yet the cure interventions currently being tested are likely to face very similar challenges . to the extent that cure interventions are intended to result in viral remission for a period of time , people receiving these interventions will have to be closely monitored so they can be placed back on therapy when they experience viral rebound . thus , the current challenges posed by the hiv cascade of care are unlikely to be solved even if current hiv cure interventions are successful . in sum , current approaches to hiv cure largely do not seem to offer a radical improvement over the status quo . as eyal and kuritzkes have argued , cure interventions may simplyreplace safety with great uncertainty .2 without more reason to have confidence in the prospects of any given hiv cure intervention , the social value of early phase hiv cure research is simply not high enough to justify the involvement of children in this research . i have argued that hiv cure research should not be initiated in children until later stages of research . my argument depends on some reasonable assumptions about hiv cure research that are based on the current adult hiv cure agenda , however , and may not hold if the field changes in certain respects . for instance , if there are interventions being tested that are like vet in that they are not much riskier than the current standard of care , then this may be one exception . additionally , if there are methodological breakthroughs that allow more careful measurement of changes in the size of viral reservoirs or better detection of very low levels of replication - competent hiv in the bloodstream , then these breakthroughs may lower the risk of some hiv cure research to a level where it makes sense to involve children in this research earlier . another possibility , although an unlikely one , is that a cure intervention could be developed that has the potential to be used on its own , and this may also change the calculation . finally , if a clear clinical need is articulated for children in general or a subpopulation of children to have sustained periods of time off antiretroviral therapy without incurring damage to their immune systems , initiating cure research in children may have greater value than it currently does and the earlier enrolment of children might be justifiable . hiv cure research is currently speculative , risky , focused on combination approaches , and involves interventions that do not compare favourably with the status quo . thus , the early involvement of children in hiv cure research is difficult to justify . there is at least one notable exception , namely research on the initiation of vet in infants , and if certain key aspects of the field achieve breakthroughs , it is possible that earlier initiation of paediatric testing of cure interventions could be justified . this analysis has two important implications for the larger debate on when to initiate paediatric testing in comparison to adult testing . first , interventions that are likely to be part of a combination that will be used to prevent or treat an illness are less viable candidates for early initiation of paediatric testing , because the social value of each element of the combination is diminished . cure can be misleading , and for chronic conditions , a cure that amounts to sustained viral remission may not do much to improve the lives of those living with the disease . cures for chronic diseases where lifelong treatment is available will not always be good candidates for early paediatric testing for this reason . future work on paediatric research ethics could profit from this approach of delving deep into a field like hiv cure research to continue to refine the criteria for when it is ethically acceptable to accelerate the testing of experimental interventions in children .\noutput:\n" }, { "from": "agent", "value": "ethical guidelines recommend that experimental interventions should be tested in adults first before they are tested and approved in children . some challenge this paradigm , however , and recommend initiating paediatric testing after preliminary safety testing in adults in certain cases . for instance , commentators have argued for accelerated testing of hiv vaccines in children . additionally , hiv cure research on the use of very early therapy ( vet ) in infants , prompted in part by the mississippi baby case , is one example of a strategy that is currently being tested in infants before it has been well tested in adults . because infants immune systems are still developing , the timing of hiv transmission is easier to identify in infants than in adults , and infants who receive vet might never develop the viral reservoirs that make hiv so difficult to eradicate , infants may be uniquely situated to achieve hiv cure or sustained viral remission . several commentators have now argued for earlier initiation of hiv cure interventions other than ( or in addition to ) vet in children . hiv cure research is therefore a good case for re - examining the important question of when to initiate paediatric research . i will argue that , despite the potential for hiv cure research to benefit children and the scientific value of involving children in this research , the hiv cure agenda should not accelerate the involvement of children for the following reasons : hiv cure research is highly speculative , risky , aimed at combination approaches and does not compare favourably with the available alternatives . i conclude by drawing general implications for the initiation of paediatric testing , including that interventions that have to be used in combination with others and cures for chronic diseases may not be valuable enough to justify early paediatric testing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: peripheral nerves ( pn ) are specialized organs that form a highly complex network throughout the body providing the motor and / or sensory innervations to target organs . histologically , pn are composed by two main elements , a functional unit or parenchyma and the stroma . the parenchyma consists of the nerve fibers , formed by axons and the surrounding schwann cells ( sc ) , while the stroma is formed by three layers of specialized connective tissues . the sc can myelinate a single axon forming the myelinated nerve fibers , or a single sc can interact with a small group of thinner axons forming the unmyelinated nerve fibers . in the case of the stroma , it regulates the compartmentalization of these organs . in transversal sections of pn , it is possible to observe how nerve fibers are immersed in the endoneurial connective tissue and it is surrounded by the perineurial layer that forms individual fascicles which are immersed in a vascularized connective tissue called epineurium ( geuna et al . , 2009 ; mills , 2012 ) . the normal function of the pn is often affected by traumatic injuries with serious physical and / or psychological consequences for these patients ( daly et al . , 2012 ; direct nerve repair is the preferred treatment for short nerve gaps , and nerve autografting is the gold standard treatment for critical nerve defects , although it has well - known disadvantages . nerve conduits ( tubulization ) are often used with variable success rates ( daly et al . , 2012 ; carriel et al . due to the clinical limitations associated to the autograft and the unsatisfactory results obtained with the tubulization technique , current research is focused on the development of novel tissue engineering alternatives to repair critical nerve gaps . in these sense , a range of strategies were achieved or are under investigation , highlighting the use of micropatterned structures , aligned biomaterials and the use of conduits filled with cellular scaffolds ( daly et al . , 2012 ; carriel et al . , 2013 , 2014b ) . peripheral nerve tissue engineering ( pnte ) is focused on the development of successful strategies to promote nerve regeneration from the clinical , functional and histological point of view . in this sense , the sciatic nerve functional index ( walking track and toe spread ) , the toe spread and the pinch test of sensory recovery are frequently used to measure clinical and functional parameters ( vleggeert - lankamp , 2007 ; carriel et al . , 2013 ) . currently , one of the most used and reliable method to evaluate nerve regeneration is the electrophysiological assessment of the distal muscles ( innervated by the injured nerve ) , which allows determining the degree of muscle denervation or reinnervation ( vleggeert - lankamp , 2007 ; carriel et al . , 2013 ) . in addition , the evaluation of the muscle weight and volume is another simple and useful method to assess the degree of muscle recovery ( vleggeert - lankamp , 2007 ; xie et al . , 2008 ) . regarding to the histological analysis , there are several histological , histochemical , immunohistochemical and also ultrastructural methods with specific applications . first , it is necessary to understand the basic concepts of the pn histology in normal conditions and during regeneration . this process is characterized by the proliferation and migration of the local cells , specially the sc , which progressively synthesize a new extracellular matrix ( ecm ) and form the bands of bngner that guide the axonal growth from the proximal to the distal nerve stump ( geuna et al . , 2009 ; daly et al . , 2012 ; in addition , the most reliable way to evaluate them with high accuracy is the histological and ultrastructural analysis , making the histological analysis one of the most useful quality controls in pnte . the first and more critical step in histology is the fixation of the tissues , whose main objective is to maintain clear and consistent morphological features , to inhibit the metabolic processes and post - mortem bacterial degradation ( kiernan , 2008 ) . currently , cryofixation and chemical fixation ( coagulant and non - coagulant ) are used in pnte ( kalbermatten et al . , 2009 ; carriel et al . , 2011a , 2013 ; di summa et al . , 2014 ) . regarding to the chemical fixation , the aldehyde - based fixatives are the most used for light and electron microscopy . once the tissues are fixed , they can be embedded in oct ( cryofixation ) , paraffin ( light microscopy ) or resin ( electron microscopy ) , and sectioned for their staining ( kiernan , 2008 ) . hematoxylin and eosin ( he ) are the most used staining agents for light microscopy in pathology and research . he staining is commonly non - specific for many tissue elements due to its electropolar nature ( carriel et al . it is not possible to observe the myelin sheath and the ecm is nonspecifically stained . therefore , he is not an ideal method allowing an accurate analysis of the nerve regeneration process ( di scipio et al . , 2008 ; trichrome staining offers the possibility to differentiate the collagen fibers of the ecm from the other types of structures ( epithelial tissue , muscles , parenchyma , etc . ) . masson 's trichrome is the most common trichrome method in pathology and muscle histology , but it is infrequently used for the histological analysis of pn . the quality of the histology of pn with this method is considerably better than he ( raimondo et al . , 2009 ) . however , it is not possible to identify the myelin sheath with high accuracy with this method ( figure 1a ) . longitudinal section of a peripheral nerve stained with masson 's trichrome method ( a ) . transversal section of a neuragen collagen conduit stained with the mcoll histochemical method with low ( b ) and high magnification ( c ) , where it is possible to observe the collagen fibers in red , the myelin in blue and the nucleus darkly stained . identification of schwann cells with s - 100 , with the characteristic nuclear and cytoplasmatic positive reaction ( d ) . immunofluorescence and immunohistochemical identification of regenerated axons by using neurofilament ( green ) and gap - 43 ( brown ) , respectively ( e , f ) . semithin transversal sections of native nerve ( g ) and regenerated nerve tissue ( h ) stained with toluidine blue . scale bar : 50 m ( a , d , f , g , and h ) , 100 m ( c , e ) and 1 mm ( b ) . regarding the myelin , unfortunately , a significant amount of these elements are dissolved by organic solvents during tissue processing , but some of them are preserved ( associated to structural proteins ) , thus allowing their identification . interestingly , pre - embedding myelin sheath staining with oso4 is a useful alternative to identify myelin with high accuracy in light microscopy ( di scipio et al . , 2008 ; li et al . , 2013this method can be combined with other histochemical methods including masson 's method or immunohistochemical procedures . in formalin - fixed tissues myelinis frequently stained with luxol fast blue ( lfb ) method , which specifically stains myelin in blue . however , lfb only allows the specific identification of myelin , and it is not possible to make a comprehensive assessment of the morphologic parameters and ecm remodeling associated to the pn regeneration process ( carriel et al . , 2011a ) . in this sense , the technical limitations associated to the lfb were improved with the new integrated histochemical method called mcoll . this method combines the specificity and sensibility of conventional lfb ( myelin ) , picrosirius staining ( collagen fibers ) and harris haematoxylin ( cellular nucleus ) allowing the identification of different parameters simultaneously ( figure 1b , c ) . this method was successfully used in pnte , allowing an accurate histological and histochemical evaluation of the nerve regeneration ( carriel et al . finally , another useful technique is the histochemical identification of the acetylcholinesterase activity in skeletal muscle cryosections . this method was used to identify with high specificity the newly - formed endplate during the reinnervation of the distal skeletal muscles ( jiao et al . , 2009 ) . the immunohistochemical and immunofluorescence methods allow the identification of highly specific proteins in tissue sections . currently , there are several antibodies that recognize specific proteins related to cell lineage ( surface or intracellular markers ) , cytoskeletal proteins , ecm molecules , growth factors , etc . , and their correct application is essential to establish the degree of pn regeneration in pnte ( vleggeert - lankamp , 2007 ; raimondo et al . , 2009 ; mills , 2012 ; carriel et al . , 2013 , 2014b ) . scs play a key role during pn regeneration , and their identification with conventional histological techniques is extremely difficult , but they can be identified with high accuracy with antibodies that recognize the glial fibrillar acid protein ( gfap ) and the s - 100 protein ( figure 1d ) . due to the importance of sc during nerve regeneration , high levels of sc immunostaining associated to an organized pattern of regeneration is considered as a positive indicator of nerve regeneration in pnte ( kalbermatten et al . , 2009 ; siemionow et al . , 2011 ; carriel et al . axons are mainly composed by neurotubules and neurofilaments and both cytoskeletal proteins can be easily evaluated by the immunohistochemical identification of - iii tubulin ( huang et al .2013 ) and growth associated protein - 43 ( gap - 43 ) , which is specific of newly - formed axons that do not express neurofilaments ( figure 1e , f ) ( carriel et al . , 2014b ) . another commonly used marker to evaluate the axonal growth is the protein gene product 9.5 ( pgp9 .5 ) , which is positive in neurons and neuroendocrine cells ( kalbermatten et al . , 2008 ) . regarding the ecm , it plays a crucial role in guiding the complex process of pn regeneration . laminin is a normal component of the basal membrane of nerve fibers and this glycoprotein supports sc proliferation and migration during nerve regeneration ( chernousov et al . , 2008 ; carriel et al . , it is infrequently evaluated in pnte . however , its expression is a valid parameter to determine the degree of pn regeneration ( siemionow et al . , 2011 ; carriel et al . , myelin can also be detected by immunohistochemistry and immunofluorescence using antibodies that specifically recognize the myelin basic proteins ( carriel et al . this also applies to the muscular endplate , which can be evaluated with high accuracy and resolution by using a rhodamine - conjugated bungarotoxin that irreversibly binds to the postsynaptic acetylcholine receptor site ( ma et al . histology is classically considered as a purely descriptive method . however , over the recent years , several studies demonstrate that it is possible to perform morphometric or quantitative analyse in histological sections ( raimondo et al . ,2009 ) . regarding the morphometric analysis , it is possible to determine the number of cells in a specific area , the diameters of cells or structures , the area occupied by regeneration tissue or injury etc . more recently , it is possible to determine with accuracy the intensity and area fraction of the positive reaction for histochemical ( carriel et al . the intensity is related to the increase of the expression or synthesis of some proteins ( not all of them ) . neurofilament intensity is significantly higher in native nerves as compared to the newly - formed axons during nerve regeneration . however , the experimental groups with high levels of regeneration ( functional and histological ) showed similar intensity values than native nerves in contrast to other experimental groups ( carriel et al . , 2014b ) . the same was performed for the intensity of s - 100 and laminin ( carriel et al . , 2013 ) . in relation with the area fractionthis method was successfully applied to the quantitative determination of the area fraction occupied by myelinated nerve fibers with the mcoll histochemical method . in addition , quantitative analysis was applied to immunohistochemical methods for determination of s - 100 area fraction , laminin , neurofilament ( carriel et al . , 2013 ) andadditionally , this quantitative approach was also used as histological quality control of the ecm following a chemical and physical decellularization of small intestine for tissue engineering applications ( oliveira et al . , 2013 ) . for more researchers , the gold standard in pn histology is toluidine blue staining of resin - embedded semithin sections ( raimondo et al . , 2009 ; carriel et al . , 2011a ; mills , 2012 ) . by using this method , most of the myelinated axons can be clearly identified and myelin sheaths are sharply delimited due to post - fixation and staining with oso4 ( figure 1 g , h ) . the high morphological quality of this method makes it a suitable method to perform a morphometric analysis of pn regeneration . in this sense , the most important parameters that can be used as quality control are : number of fibers , density of fibers , diameter of fibers and axons , cross - sectional area of fibers and axons , perimeter of fibers and axons , myelin thickness , myelin thickness / axon - diameter ratio , and fiber - diameter / axon - diameter ratio or axon - diameter / fiber - diameter ( g - ratio ) ( vleggeert - lankamp , 2007 ; raimondo et al . , 2009 ; bozkurt et al . , the ultrathin sections are often used to evaluate ultrastructural changes associated to the axonal growth and myelination process by transmission electron microscopy . in addition , it is a suitable method to perform morphometric analyses and also to identify and evaluate the unmyelinated nerve fibers ( hirano , 2005 ) . in order to determine the degree of pn regeneration with high accuracy in pnte , it is necessary to combine clinical , functional , electrophysiological and histological analyses . regarding the histology , there are several technical alternatives to evaluate different important parameters associated to the success of failure of nerve regeneration . in all cases , a proper knowledge of the pn histology in normal and regenerative conditions is essential to perform an adequate histological description and to apply the most adequate histological method . currently , there are useful histochemical techniques available for assessment of the nerve regeneration process such as oso4 technique , the mcoll histochemical method and the gold standard toluidine blue in semithin sections . in relation to the immunohistochemical markers , there are a wide range of antibodies available to evaluate pn regeneration , especially s - 100 , gfap , neurofilament , - iii tubulin , gap - 43 , and laminin . in conclusion , pn regeneration is a complex process and the use of a single descriptive histological method may not be enough to assess the degree of regeneration . in this sense , it is and it will be necessary to combine different histochemical and immunohistochemical techniques with morphometric or quantitative parameters in order to find statistical differences between the different models of nerve regeneration . finally , histological assessment of the pn regeneration is one of the most reliable methods available to demonstrate the success or failure of the pn regeneration in tissue engineering .\noutput:\n" }, { "from": "agent", "value": "the histological analysis of peripheral nerve regeneration is one of the most used methods to demonstrate the success of the regeneration through nerve conduits . nowadays , it is possible to evaluate different parameters of nerve regeneration by using histological , histochemical , immunohistochemical and ultrastructural techniques . the histochemical methods are very sensible and are useful tools to evaluate the extracellular matrix remodeling and the myelin sheath , but they are poorly specific . in contrast , the immunohistochemical methods are highly specific and are frequently used for the identification of the regenerated axons , schwann cells and proteins associated to nerve regeneration or neural linage . the ultrastructural techniques offer the possibility to perform a high resolution morphological and quantitative analysis of the nerve regeneration . however , the use of a single histological method may not be enough to assess the degree of regeneration , and the combination of different histological techniques could be necessary ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: oxidative stress plays an important role in the pathogenesis of many chronic inflammatory lung disorders , particularly in copd and asthma , where it is an important consequence of irritant - induced damage of bronchial epithelial cells and represents an amplifying mechanism through the recruitment of inflammatory cells in the airways . among the many biological targets of oxidative stress , membrane lipids are the most commonly involved class of biomolecules . in addition to their cytotoxic properties , lipid peroxides are increasingly recognized as being important in signal transduction for a number of events in the inflammatory response . exhaled breath condensate ( ebc ) , obtained by cooling exhaled air , has recently been proven as a good biological tool to monitor inflammatory and oxidative stress of lower respiratory tract . several biomarkers have been measured in ebc , including aldehydes , h2o2 , adenosine , isoprostanes , leukotrienes and cytokines , and an increasing number of studies report the use of ebc in the investigation of airway lining fluid composition in several respiratory diseases . malondialdehyde ( mda ) has been widely studied as a product of polyunsaturated fatty acid peroxidation . high mda levels have been observed in several biological fluids from patients with different airway diseases including asthma , copd , and bronchiectasis . mda in ebc has been measured in relatively few studies , and only few of them include large number of subjects . in this study , we measured and compared ebc levels of mda in a large group of subjects with different pulmonary diseases in order to explore the possible usefulness of this measurement in the assessment of different lung diseases . exhaled breath condensate was collected from 194 subjects affected by different airway diseases attending to our pulmonary unit . patients with asthma ( a , n = 64 ) , bronchiectasis ( be , n = 19 ) , chronic obstructive pulmonary disease ( copd , n = 73 ) and idiopathic pulmonary fibrosis ( ipf , n = 38 ) were included in the study . for each subject , diagnosis and assessment of severity for the different diseases were performed according to international guidelines recommendations . in particular , asthmatic patients were divided according to the presence of regular treatment with inhaled corticosteroids , whereas copd patients were divided into moderate or severe according to fev1 or 50 % predicted , respectively . the diagnosis of bronchiectasis was confirmed in all patients by chest high - resolution computed tomography ( hr - ct ) ; bronchiectasis was primary or idiopathic in 13 patients , secondary in 6 patients . all patients with ipf except 6 were on low - dose oral corticosteroids associated with azathioprine ( in 9 patients ) and / or n - acetyl - cysteine ( in 23 patients ) . clinical data of patients and healthy subjects are reported in table 1 . pulmonary function tests and other measurements used to assess diagnosis and level of severity of the different diseasespulmonary function tests were performed by means of a computerized spirometer ( medgraphics , cardiorespiratory diagnostics , st . paul , minn , usa ) and the results were expressed as percentage of ceca ( european community for steel and coal ) predicted values . all patients were examined in a stable phase of the disease , with no acute exacerbation in the previous month . ebc was collected cooling exhaled air with a specifically designed condenser ( ecoscreen , jaeger , wurzburg , germany ) . subjects breathed tidally for 15 min through a two - way non - rebreathing valve in order to prevent inspiratory and respiratory air mixing and trap saliva . ebc samples were immediately stored at 80c until analysis , which was performed within 6 months from the collection , as recommended by previous studies . malondialdehyde ( mda ) concentrations were measured in ebc samples according to the method described by lrstad et al . . samples were derivatized with thiobarbituric acid ( 25 mm in h2po40 .3 m , ph 3.5 ) in a water bath at 95c for 60 minutes , cooled in ice for 5 minutes , and then allowed to recover at room temperature for 40 minutes before analysis . analyses were performed using a high - performance liquid cromatography ( hplc ) connected to a fluorescence detector ( binary hplc pump 1525 and 2475 multi fluorescence detector , waters , milan , italy ) , equipped with a polaris c18 column , 1504.6 mm i d , particle size 5 m ( varian , usa ) . the mobile phase was composed by acetonitrile : 20 mm potassium phosphate buffer ph 6.8 ( 25 : 75 , v / v ) , the flow rate was 1.3 ml / min . the method had a limit of detection of 4.1 nm and a recovery of 96 % . figure 1 shows the bland - altman scattergram of two repeated measurements of 150 samples : intraclass correlation coefficient ( ri ) was 0.854 . sputum was performed in 108 subjects with asthma ( n = 52 ) , copd ( n = 41 ) and bronchiectasis ( n = 15 ) . sputum induction and analysis were carried out as previously described . after inhaled salbutamol pretreatment , hypertonic saline solution ( hs : nacl 4.5 % w / v ) was delivered by means of an ultrasonic nebulizer ( 2.8 ml / min output ; devilbiss ultraneb 2000 , somerset , pa , usa ) to induce sputum production . in subjects with fev1 lower than 35 % , isotonic saline ( is : nacl 0.9 % w / v ) was used as recommended in . nebulization was stopped after 15 min or earlier if fev1 fell by 20 % or more from baseline values . before andevery 5 min after the start of nebulization , fev1 was measured , and patients were then asked to rinse their mouth and throat carefully to discard saliva and to try to cough sputum into a container . sputum samples were processed within two hours from collection ; more viscid and dense sputum portions were selected and processed as follows . briefly , samples were homogenated by adding 0.1 % ( dtt ) in a shaking bath at 37c for 15 min , then centrifuged to separate cells from supernatant . the cell pellet was resuspended in pbs for viability and total cell count , and aliquots were used to prepare slides for differential cell counts . macrophage , lymphocyte , neutrophil , and eosinophil values were expressed as percent of total inflammatory cells . slides with cell viability 50 % and an amount of squamous cells such that 300 inflammatory cells could not be counted were considered inadequate and discarded . functional data were expressed as mean and standard deviation and biological data as median and range . differences between two groups were tested using unpaired t - test and mann - whitney test for normally and nonnormally distributed variables , respectively . differences among three or more groups were tested using anova and kruskal - wallis test for normally and nonnormally distributed variables , respectively . intraclass correlation coefficient was calculated to assess mda interassay reproducibility ( ri values over 0.70 are usually interpreted as satisfactory ) and the bland - altman plot was used to graphically represent the variability between the two measurements . the limits of agreement were expressed as 2 standard deviations ( sds ) of the mean of differences between the two measurements within which 95 % of the repeated measures are expected to lie . the distribution of all measurements of mda in ebc in normal subjects and in patients with different diseases is reported in figure 2 . healthy subjects and patients with ipf were distributed in the lower range of mda , while copd patients were mainly represented in the categories with higher mda concentrations . except for ipf patients , who showed mda levels similar to those of healthy controls ( 15.2 ( 479 ) versus 15.6 ( 425 ) nm , resp . ) , all the disease groups showed higher levels of mda than healthy controls ( figure 3 ) . among asthmatics , no difference in mda was observed between difficult - to - control and mild / moderate asthma ( 26.0 ( 1472 ) versus 26.1 ( 691 ) nm ) . comparing asthmatic patients according to treatment , we found that ics - treated subjects had lower levels of mda than untreated subjects ( 21.5 ( 672 ) versus 32.0 ( 891 ) nm , p .05 ) . copd patients had significantly higher levels of mda than asthmatic and be subjects ( 37.0 ( 8126 ) versus 26.3 ( 691 ) nm , p .05 , and 19.2 ( 654 ) nm , p .05 , resp . ) . within the copd group , subjects with severe copd showed higher levels of mda than patients with moderate copd ( 39.0 ( 8126 ) versus 29.1 ( 981 ) nm , resp . , p .05 ) . an inverse correlation between mda concentrations and fev1 was observed both in the whole group of patients ( p .001 , rho : 0.25 ) and in the copd subgroup ( p .05 ; rho : 0.24 ) ( figure 4 ) . no difference in mda was found dividing the whole group of patients according to their smoking status ( p = .52 ) . considering each disease group separately , we found that among copd patients , mda levels in current smokers were not different from ex - and nonsmokers ( p = .11 ) , whereas among asthmatics , current smokers had higher mda levels than ex - and nonsmokers ( 38.5 ( 1991 ) versus 25.5 ( 672 ) nm , p .05 ) . in the subgroup of 108 patients who underwent induced sputum analysis , no relationship between ebc levels of mda and sputum inflammatory cell counts was found . however , patients with high ( 64 % ) sputum neutrophils showed significantly higher mda levels ( p .05 ) than patients with low sputum neutrophils , even when copd patients only were considered ( figure 5 ( a ) ) . no difference for mda values was found between subjects with high ( 2 % ) or low sputum eosinophils in the whole group of patients , but copd subjects with high sputum eosinophils had lower mda levels ( figure 5 ( b ) ) . we found that subjects with chronic airway disorders have increased levels of mda in ebc , thus confirming that oxidative stress plays a role in the pathophysiology of lung diseases . we also found that mda concentrations in ebc are related to fev1 and neutrophilic inflammation , particularly in copd patients . mda is a marker of oxidative stress that can be measured , using different and sometimes complex analytical procedures , in blood , sputum , bronchoalveolar lavage fluid , and ebc . lipid mediators , in fact , at body temperature gain some volatility , thus becoming detectable also in ebc . some authors have shown a relationship between mda and other markers of severity of airway diseases as well as its sensitivity to the effect of treatment , but these data have not been confirmed by others . this discrepancy may be ascribed to the different populations studied ( considering also the heterogeneity of asthma and copd ) and to the different methods of measurements used . in our experience , mda measurement in ebc was reproducible and accurate : interassay reproducibility was good and not different from what reported by other authors using different , more complex methods . we checked storage stability of ebc samples , just in few samples showing a good repeatability ; however , we analyzed all samples within 6 months from the collection , as suggested by the international recommendations and previous papers . our method differentiates normal subjects from patients with different airway diseases despite some overlapping of single measurements . furthermore , mda was sensitive to changes induced by therapeutic intervention , as shown by the lower levels of mda in asthmatics treated with ics in comparison with untreated asthmatics . this issue is controversial in literature : while some studies reported a reduction in mda levels after corticosteroid treatment , other studies found no difference between ics - treated and untreated subjects . antioxidant treatment has been generally reported to be ineffective in modifying markers of oxidative stress . in a preliminary study , we observed a mild , significant attenuation in ozone - induced ebc - mda increase after 4 - week treatment with oral n - acetyl - cysteine in asthmatic patients . this observation was expected , considering that oxidative stress plays a relevant role in smoke - induced airway damage and chronic inflammation . this was confirmed by the higher levels of mda in patients with higher percentage of sputum neutrophils , and by the inverse correlation between ebc - mda and fev1 . these results are in agreement with other reports , suggesting that mda may be a good marker of the severity of the disease . similar results were obtained in copd when other markers of oxidative stress were considered ( such as 8 - isoprostane , hydrogen peroxide , ltb4 , or other copd - related cytokines ) . no difference was observed between current smoker and ex - or nonsmoker copd patients , and this might be due both to the small number of current smokers and to the similar pattern and degree of airway inflammation in copd patients regardless of their smoking habit . in asthmatic patients , ebc - mda levels were lower than those observed in copd patients , but higher than normal subjects . there was no difference according to asthma severity , but ics treatment was associated with lower values of mda . while some authors demonstrated a significant decrease in blood mda during the recovery from asthma exacerbation treated with oral corticosteroids , other authors did not find any difference between ics - treated and untreated asthmatic patients . in our asthmatics , current smokers showed higher levels of ebc - mda than nonsmokers ; this observation is in agreement with the prominent neutrophilic airway inflammation in smoking asthmatics . in bronchiectasis , we found ebc - mda levels slightly higher than normal subjects , but lower than copd patients . this result may be unexpected , considering that sputum neutrophilia is a prominent feature of this kind of patients . we found no papers evaluating ebc - mda levels in bronchiectasis , and only one paper reports increased blood mda levels in children with bronchiectasis . increased levels of other markers of oxidative stress ( such as hydrogen peroxide or ph ) in ebcno difference in ebc - mda levels was observed in comparison with healthy subjects . in the literature , few data are reported showing ebc increase of hydrogen peroxide , 8 - isoprostane and nitrates in comparison with healthy subjects . the low levels of ebc - mda observed in our study may be explained by the fact that most ipf patients were on oral corticosteroid and / or n - acetyl - cysteine treatment . in conclusion , we demonstrated that mda may be accurately measured in ebc of most patients with chronic pulmonary diseases and that it is partially related to the severity of airway obstruction and neutrophilic inflammation . this was particularly evident in copd patients , where oxidative stress seems to play a major role in the pathophysiology of the disease . thus , mda may be a promising marker of oxidative stress in asthma and copd . its usefulness in the management of these diseases , as well as for other inflammatory markers , needs to be explored with well - designed , specific studies .\noutput:\n" }, { "from": "agent", "value": "background . oxidative stress plays a role in the pathogenesis of many chronic inflammatory lung diseases . exhaled breath condensate ( ebc ) collection is a noninvasive method to investigate pulmonary oxidative stress biomarkers such as malondialdehyde ( mda ) . subjects and methods . we measured mda levels in ebc in a large number of patients ( n = 194 ) with respiratory diseases : asthma ( n = 64 ) , bronchiectasis ( be , n = 19 ) , chronic obstructive pulmonary disease ( copd , n = 73 ) , idiopathic pulmonary fibrosis ( ipf , n = 38 ) . fourteen healthy nonsmoking subjects were included as controls . results . excluding ipf subjects , mda levels were significantly higher in all disease groups than in control group . mda was significantly higher in copd than asthmatic and be subjects . among asthmatics , corticosteroids - treated subjects had lower mda levels than untreated subjects . copd subjects showed an inverse correlation between mda concentrations and fev1 % ( rho : 0.24 , p < .05 ) . conclusions . ebc - mda is increased in subjects with chronic airway disorders , particularly in copd , and it is related to fev1 reduction ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: actinic granuloma ( ag ) was first described by obrien in 1975 , as a rare granulomatous disease . lesions present on sun - exposed sites , most commonly on the face , neck and scalp with a slight predominance in middle - aged women . they are generally asymptomatic , single or multiple , annular or polycyclic lesions that can measure up to 6 cm , showing slow centrifugal expansion , with an erythematous elevated edge and a hypopigmented , atrophic center . despite initial debate regardingwhether ag would represent a variant of granuloma annulare , it is now considered a distinct entity , believed to be related to photo damage . a 60 - year - old female rural worker presented with an annular lesion with elevated , erythematous borders and a hypopigmented , atrophic center , located on the right calf [ figure 1 ] . it measured approximately 147 cm and was slowly extending centrifugally for more than 2 years , despite treatment with systemic and topical antifungals . annular lesion with erythematous scalloped borders and an atrophic center occupying the right calf the patient had a previous history of dyslipidemia , treated with atorvastatine , 40 mg daily . she had no history of diabetes mellitus , temporal arteritis , polymyalgia rhematica , relapsing polychondritis and pseudoxanthoma elasticum . she had worked in the fields for several decades , usually with exposed legs due to the use of skirts . complete blood count , erythrocyte sedimentation rate , chemistry panel with renal and hepatic function and nuclear antibodies were all negative or within normal range . microscopic examination of skin scrapings was negative for fungal elements . a biopsy taken across the border of the lesion showed a superficial dermal granulomatous infiltrate with multinucleated giant cells that exhibited elastophagocytosis [ figure 2 ] . with verhoeff van gieson stain , solar elastosis in the upper and mid dermis became evident , as well as phagocytosis of elastotic fibers [ figure 3 ] . multinucleated giant cells composing a granulomatous infiltrate occupying the upper and mid dermis , with foci of elastophagocytosis ( arrow ) , adjacent to areas of solar elastosis ( star ) . ( h and e , original magnification 200 ) a detailed image of elastophagocytosis using verhoeff van gieson stain . ( original magnification 400 ) a diagnosis of o brien ag was made , and the patient started clobetasol 0.05 % ointment , that she maintained daily for 2 months with slow but progressive extension of the lesion . she then began acitretin 25 mg daily for 6 months , with stabilization of the lesion and further discontinuation of therapy . according to obrien , ag consisted of a granulomatous reaction to solar damage , with histiocytes and foreign - body type multinucleated cells engulfing elastotic fibers within a background of solar elastosis . the absence of elastic fibers would characterize the center of the granuloma , corresponding clinically to the atrophic , hypopigmented center of the lesion . he concluded that this was also the likely diagnosis for other previously described entities such as miescher 's granuloma of the face and necrobiosis lipoidica presenting on the face and scalp and in 1985 he further characterized ag in four subvariants , the original giant cell annular form , the necrobiotic form , the histiocytic and the sarcoidal variant . predilection for sun - exposed skin and a three - zone typical histopathology were the clinical and pathological hallmarks of ag and seemed to support the actinic hypothesis proposed by obrien . hypothetically , elastotic fibers resulting from actinic radiation could represent an antigenic trigger for an autoimmune granulomatous reaction that would then ensue . a report associating ag with giant cell temporal arteritis ( gca ) further strengthened this belief . in gca , actinic damage of the internal elastic lamina of the artery would occur with surrounding presence of matrix metalloproteinase 9 and macrophages . while mcgrae was demonstrating a t - helper cell infiltrate with perivascular and interstitial distribution amidst the granulomatous reaction of ag , also elastase - derived elastin peptideswere reported to be high in the sera of patients with gca , being targeted by t - helper lymphocytes , in an analogous manner to what was happening in ag . the actinic pathogenesis , however , was opposed by ragaz and ackerman that viewed elastolytic granuloma as a variant of granuloma annulare in solar - damaged skin . others preferred the descriptive term of annular elastolytic giant cell granuloma ( aegcg ) , stating its independent classification from granuloma annulare ( highlighted by the absence of mucin deposition ) but not finding definite evidence for the actinic hypothesis . they believed that the association between solar elastosis and granulomatous inflammation should not necessarily imply a causecase reports showing the occurrence of the granuloma on sun - protected skin further supported this idea . currently , the denomination of aegcg is still in use , with disregard for obrien 's original view on the actinic pathogenesis recently , reports associating lesions of ag in skin affected by late - onset x - linked protoporphyria and vitiligo again corroborate the causative role of elastotic fibers and solar damage . however , in our patient , this location was subjected to chronic sun exposure , in accordance to most described reports . other associated entities include diabetes and leukemia , polymialgia rheumatica , relapsing polychondritis and pseudoxanthoma elasticum , although the relevance of these associations remains unproven . obrien ag is reported to have a slow but self - limiting course and can take up to 10 years to resolve . nonetheless , because lesions are often extensive and frequently affect sites of cosmetic importance such as the face , therapy is necessary in order to prevent new lesions and enlargement of existing ones . although oral and topical corticosteroid therapy is generally ineffective , there are reports of successful treatment with systemic retinoids , such as acitretin but also with isotretinoin . in our patient , the progression of the lesion was halted after 6 months of the former drug and did nt return on its suspension . nonetheless , we can not prove whether this was due to acitretin or to the self - limiting nature of the disease . ag is currently a widely accepted entity , even though its pathogenesis is not fully clarified . its specific histopathologic findings suffice to establish it outside the granuloma annulare spectrum , however , the full grasp of the role of actinic damage and its consequences not only in the skin , but also systemically , still remains elusive . the role of actinic damage has been favored by the concomitant occurrence of obrien 's actinic granuloma , protoporphyria and vitiligo . its diagnosis should be considered in patients presenting with annular plaques with photodistribution even if they are located in an unusual site . despite its slow self - limiting course , therapeutic options include systemic retinoids , namely acitretin .\noutput:\n" }, { "from": "agent", "value": "obrien first described the actinic granuloma in 1975 , as an infrequent granulomatous disorder occurring in sun - exposed skin , with a slow but often self - limited course . ever since its initial description , the actinic physiopathogenic hypothesis has been debated by many authors . we report a 60 - year - old female rural worker that presented with a 14 7 cm annular lesion with erythematous elevated borders and an atrophic center on the right calf . the lesion was evolving for 2 years , and histopathology confirmed actinic granuloma . she started acitretin with halting of disease progression after 6 months of therapy . our case can also be associated to actinic damage , despite its unusual location , therefore highlighting the role of solar elastosis in the development of obrien actinic granuloma ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in particular , its main biological actions ( mediated through a receptor system present on the sertoli cells ) are the following : cellular sperm differentiation , modulation of spermatid morphogenesis , and the maturation of epididymal spermatozoa . the biological actions of fsh are more relevant in the clinical condition of hypogonadotropic hypogonadism and are more controversial in functional hypogonadism and / or in patients with idiopathic oligoasthenoteratozoospermia ( oat ) . functional hypogonadism is defined as a clinical condition in which the gonadotropin levels are in the low - normal range but the testosterone level is inadequate ( or often in the low - normal range ) . idiopathic oat means that no etiological factor can be found by common clinical , instrumental , or laboratory methods . the demonstrated biological effects of fsh treatment in male infertile patients are increased spermatogonial population and sperm count , , increased rate of fertilization , and increased pregnancy rate in programs of assisted fertilization . however , several studies show a lack of effects of fsh on sperm parameters . the italian medicines agency authorizes the use of preparations of fsh for the treatment of male infertility in males with hypogonadism and in infertile males with low or normal levels of fsh , but not more than 8 miu / ml in any case . there are , however , lesser known aspects relating to the possible usefulness of fsh therapy with fsh on unconventional as well as conventional sperm parameters ( density , morphology , and motility ) . for example , fsh therapy could induce modifications that could restore the quality of the inflammatory response of the semen . under particular conditions , the leukocyte concentration in sementhe defects of spermatogenesis represent a potential target of hormonal treatment as well as a potential cause of increased inflammatory response , in particular the response of leukocytes , the main mediators of this phenomenon . together with their classic antimicrobial action , leukocytes also remove immature germ cells and / or sperm with maturational defects , suggesting they have a protective role in semen at concentrations of 1 million / ml . however , the complete characterization of the leukocytes requires the identification of the specific populations ( polymorphonuclear granulocytes , macrophages , and lymphocytes ) that reflect more accurately the possible chronicization of the inflammatory process ( in particular the increase in lymphocytes ) . the failure to characterize specific populations of leukocytes may explain the frequent underestimation of the inflammatory process in the semen of patients with idiopathic oat , because only polymorphonuclear granulocytes are reported in routine practice . finally in clinical practice , leukospermia and bacteriospermia frequently are not associated , and often the clinical andrologist must reduce the negative effects on spermatozoa caused by the mere presence of leukocytes , which are not improved only with anti - inflammatory treatment . from the technical point of view , flow cytometry is able to discriminate ( with the use of monoclonal antibodies ) the different subpopulations of leukocytes . in this context , the aims of this study were the following.to evaluate the quality of the conventional sperm parameters ( density , morphology , and progressive motility ) in infertile patients with idiopathic oat after treatment with three different preparations of follicle - stimulating hormone : recombinant fsh - and - ( gonal f , puregon ) and highly purified human fsh ( fostimon ) . to evaluate in these patients the semen concentration of cd45pos cells ( a pan - leukocytemarker ) before and after hormonal treatment with one of the three different hormonal preparations . to evaluate the quality of the conventional sperm parameters ( density , morphology , and progressive motility ) in infertile patients with idiopathic oat after treatment with three different preparations of follicle - stimulating hormone : recombinant fsh - and - ( gonal f , puregon ) and highly purified human fsh ( fostimon ) . to evaluate in these patients the semen concentration of cd45pos cells ( a pan - leukocytemarker ) before and after hormonal treatment with one of the three different hormonal preparationswe retrospectively reviewed patient clinical , instrumental , and laboratory data obtained from june 2012 to june 2013 . all patients enrolled in this study were referred to the department of andrology and endocrinology of catania university , italy , for the diagnosis and treatment of male infertility . the men were 1840 years old , with a mean age of 26.08.0 years and a body mass index ( bmi ) ranging between 18.0 and 27.0 kg / mvaricocele , hydrocele , testicular focal injury / injuries , testicular microlithiasis , inhomogeneous testicular echotexture ( ultrasound examination ) , and abnormal hemodynamic parameters of the testis ( altered values of systolic peak velocity and resistance index ) via ultrasound examination . ( 2 ) other criteria . genetic disorders ( altered karyotype and / or the presence of y chromosome microdeletions ) , clinical history of cryptorchidism , varicocelectomy , eversion of the tunica vaginalis , head trauma , endocrine abnormalities ( increased gonadotropins , reduced serum total testosterone ( 2.8 ng ml ) , hyperprolactinemia , and increased estrogen concentrations ) , systemic diseases ( kidney disease , liver disease , and diabetes mellitus ) , cigarette smoking , alcohol use , concomitant use of other drugs during the previous 6 months , leukocytospermia ( leukocyte concentration in semen 1 million / ml ( detected with the peroxidase test ) ) , male accessory gland inflammatory disease , positive seminal , urine and / or urethral swab cultures , and ultrasound signs of epididymal obstruction . applying these exclusion criteria , we analyzed data from 54 patients with an age range of 1833 years ( mean 24.06.0 years ) and a bmi of 19.026.0 kg / mthe protocol was approved by the internal institutional review board , and informed written consent was obtained from each participant . the scrotal ultrasound evaluation was performed in two phases : the first with the patient in a supine position ( with the penis resting on the suprapubic region ) and the second in an upright position to evaluate reflux along the pampiniform plexus , testicular pain , testicular malposition , and the extent of any fluid collection . the examination was performed with a gx megas esaote ( esaote spa genova ( italy ) ) device , equipped with linear , high - resolution , and high - frequency ( 7.5 to 14 mhz ) probes dedicated to the study of soft body areas , with color doppler for detecting slow flow and a scanning surface of at least 5 cm . testicular volume was calculated automatically by the ultrasound machine using the ellipsoid formula ( length width thickness 0.52 ) . the testis was considered normal in size when it had a volume between 15 and 25 cm , low - normal when it had a volume between 10 and 12 cm , and hypotrophic when it had a volume of less than 10 cm . the parenchymal echostructure was considered normal in the presence of thin , densely packed , and homogeneously deployed echoes . the presence of a finely inhomogeneous echopattern and weakly hypo - or hyperechogenic areas was considered indicative of primary testicular disease . during the doppler evaluation , flow was detected at the level of the spermatic artery and the testicular artery and their branches . the velocity analysis was considered normal in the presence of low resistance , a prolonged systolic phase , flow maintenance during diastole , and a low resistance index ( ir : 0.62 ) . systolic flow speed along the centripetal arteries was considered normal if it was lower than 15 cm / sec and / or between 4 and 12 cm / sec . hormonal evaluations were performed by electrochemiluminescence with hitachi - roche equipment ( cobas 6000 , roche diagnostics , indianapolis , in , usa ) . the reference intervals were as follows : lh = 1.69.0 miu ml , fsh = 2.012.0 miu ml , 17 - estradiol = 8.043.0 pg ml , total testosterone = 2.88.0 ng ml , and prolactin = 4.015.0 ng ml . blood sampling was performed at 8:00 am , after at least 8 hours of sleep . the determination of serum lh and prolactin was repeated after an interval of 30 minutes . semen samples were collected by masturbation into a sterile container after 27 days of sexual abstinence and were transported to the laboratory within 30 minutes after ejaculation . according to the 2010 who guidelines , each sample was evaluated for seminal volume , ph , sperm count , progressive motility , morphology , and round cell concentration . for all patients , the sperm analysis was repeated after 4 months , at the end of the hormonal treatment . the working solution used for the test was obtained by adding 1 l of h2o2 to 20 l of a 0.09 % 3,3 - diaminobenzidine tetrahydrochloride stock solution ( dab , isopac , sigma , milan , italy ) in 40 % ethanol . in each assay , 20 l of semen was incubated with 20 l of working solution in an eppendorf tube for 5 minutes at room temperature . before setting up the slide , 40 l of pbs was added . peroxidase - positive cells were marked by yellow - brown - red staining , while peroxidase - negative cells remained colorless . at least 100 round cells were counted using an optical microscope at 400x magnification , and the percentages of peroxidase - positive and - negative cells were evaluated . the total leukocyte count is expressed in millions per milliliter of semen . spermatids were differentiated from leukocytes by a seminal fluid smear stained using the papanicolaou technique . spermatids were identified on the basis of the following parameters : coloration , size , core shape and size ( approximately 5 m ) , absence of intracellular peroxidase , and the absence of leukocyte - specific antigen ( see section 2.6 ) . morphologically , multinucleated spermatids were distinguished from polymorphonuclear leukocytes by the presence of a pink color in contrast to the bluish color of polymorphonuclear leukocytes . the analysis was conducted with an epics xl flow cytometer ( coulter electronics , il , usa ) , equipped with an argon laser at 488 nm and three fluorescence detectors : green ( fl - 1 at 525 nm ) , orange ( fl - 2 to 575 nm ) , and red ( fl - 3 at 620 nm ) . for each sample ,100,000 events were measured at a low flow velocity and analyzed using system ii , version 3.0 . to perform the absolute lymphocyte count , 100 l of each liquefied semen sample was incubated with a mixture containing syto - 16 green fluorescent nucleic acid stain to identify the spermatozoa and exclude debris ( final concentration 200 nm ) ( molecular probes , eugene , oregon , usa ) , 7 - amino - actinomycin d ( 7 - aad , via - probe , bd pharmingen , san diego , ca , usa ) to assess viability , anti - cd45 - apc ( pan - leukocyte antigen ) to recognize white blood cells , and anti - cd16 - pe to pmn recognize . the addition of 100 l of flow - count fluorospheres ( beckmann - coulter , fullerton , ca , usa ) at 1034 beads / ml allowed us to determine the absolute lymphocyte count by flow cytometry . after incubation in the dark for 20 minutes at room temperature , 1 ml of pbs was added , and the sample was analyzed by flow cytometry ( facscalibur , becton dickinson , san jose , ca , usa ) . for each testthe total number of leukocytes per milliliter was calculated by applying the following formula : ( 1 ) % monoclonal antibody ( positive cellsno . of spermatozoa / ml ) 100 . sperm parameters of three different groups ( arbitrarily assigned ) before and after the treatment with different preparations of follicle - stimulating hormone were evaluated : group a ( 20 patients ) treated with recombinant fsh - ( gonal f ; merck serono europe ) ; group b ( n = 20 patients ) treated with recombinant fsh - ( puregon ; organon ) ; group c ( 14 patients ) treated with highly purified human fsh ( fostimon ; ibsa ) . group a ( 20 patients ) treated with recombinant fsh - ( gonal f ; merck serono europe ) ; group b ( n = 20 patients ) treated with recombinant fsh - ( puregon ; organon ) ; group c ( 14 patients ) treated with highly purified human fsh ( fostimon ; ibsa ) . all patients were treated for 4 months ( according to the period of treatment admitted from the current ministerial note ( note 74 ) ) , with the following scheme of therapy : 150 units 3 times a week ( monday , wednesday , and friday ) , always injected subcutaneously . no patient received combination therapy with chorionic gonadotropin because no patient had a low concentration of total testosterone ( exclusion criteria ) . the data were analyzed using a one - way analysis of variance ( anova ) followed by duncan 's multiple range test . a correlation analysis was conducted by evaluating the pearson correlation coefficient to assess possible covariance linearity between cd45pos cells and the other examined parameters . the three examined groups did not show statistically significant difference at baseline in the evaluated physical parameters ( age , body mass index , and testicular volume ) or hormonal parameters ( fsh , lh , total testosterone , estradiol , and prolactin ) ( table 1 ) . the correlation analysis conducted on all patients before and after the treatment showed the presence of a positive linear correlation between the concentration of cd45pos cells in the semen and the percentage of spermatids and a negative correlation between the concentration of cd45pos cells and the percentage of spermatozoa with normal morphology ( table 2 ) . the three examined groups did not show statistically significant differences at baseline in the evaluated sperm parameters ( density , morphology , progressive motility , percentage of spermatids , leukocyte concentration , and cd45pos cell concentrations ) ( table 3 ) . after hormonal treatment , we did not detect a statistically significant difference between the examined groups in any of the investigated sperm parameters . however , within each group , the following sperm parameters showed statistically significant differences ( p 0.05 ) compared to the baseline : percentage of spermatozoa with normal morphology , percentage of spermatids , and concentration of cd45pos cells ( table 3 ) . table 4 shows the percentage distribution of patients according to the different concentrations of cd45pos cells before and after therapy . finally , the mean testicular volume in the three examined groups did not change significantly from before to after therapy ( group a = 16.07.0 versus 16.27.4 cm ; group b = 15.58.5 versus 15.88.0 cm ; group c = 16.26.6 versus 16.38.2 cm ) . the results of this study show that a group of selected patients with idiopathic oat had a significant improvement of the percentage of spermatozoa with regular morphology after pharmacological treatment with fsh for 4 months . the patients treated with different formulations of fsh ( recombinant fsh - and - and recombinant purified human fsh ) after therapy showed similar improvements of this parameter . in the three examined groups , we observed a significant reduction of the seminal concentration of cd45pos cells and of the percentage of immature germ cells ( spermatids ) after the pharmacological treatment . the seminal concentration of cd45pos cells before and after treatment showed a positive linear correlation with the percentage of spermatids and a negative correlation with the percentage of spermatozoa with normal morphology . on the basis of these results , we think further studies should examine the frequency of increased concentration of seminal cd45pos cells in infertile patients with idiopathic oat because this parameter is not routinely assessed in practice . other studies have examined the quality of conventional sperm parameters after pharmacological treatment with fsh in patients with idiopathic infertility , with discordant results . in the placebo - controlled study of kamischke and colleagues ,34 patients were treated with 150 iu rh - fsh on alternate days for 3 months , and 33 patients received placebo ( 30 mg saccharose ) . after the treatment , they observed a significant increase of testicular volume in patients receiving fsh , but they did not find any significant modification of conventional sperm parameters . caroppo and colleagues confirmed the increase of testicular volume in patients treated with fsh . other studies , in accordance with kamischke and colleagues , observed an absence of significant effects of this treatment on the conventional sperm parameters . significant increases in sperm concentration , motility , and morphology were reported in oligoasthenozoospermic patients receiving high p - fsh ( 150 iu p - fsh every day for 3 months ) , but not low p - fsh ( 150 iu p - fsh on alternate days for 3 months ) , in another study conducted by iacono and colleagues . similarly , paradisi et al . showed that oligoasthenozoospermic patients benefitted from the administration of a high dosage of rh - fsh ( 300 iu on alternate days for 4 months ) . their results agreed with other studies reporting the ability of this hormone to quantitatively improve spermatogenesis in mammals . foresta and colleagues found , after 3 months of treatment with hp - fsh ( 75 iu , on alternate days ) , increased spermatogonial cell population . the authors subdivided the cohort of patients into responders ( normal serum fsh and isolated hypospermatogenesis ) and nonresponders ( hypospermatogenesis associated with abnormal spermatogenetic maturation ) . two recent studies confirmed that the administration of either rh - fsh ( 150 iu on alternate days for 3 months ) or hp - fsh ( 150 iu on alternate days for 3 months ) significantly improved conventional sperm parameters . to our knowledge , this is the first study that has demonstrated a significant reduction in the concentration of cd45pos cells in the semen of infertile patients with idiopathic oat . leukocytes are detectable in the male reproductive tract and in the seminal fluid ; under physiological conditions , they represent approximately 5 % of the round cells in these locations . particularly , polymorphonuclear granulocytes represent 5060 % of the leukocytes , macrophages represent 2030 % , and t lymphocytes represent approximatively 5 % . according to the who , a concentration of leukocytes in the ejaculate exceeding 10 / ml as assessed by the peroxidase test defines a condition known as leukocytospermia . the clinical significance of this condition in the pathogenesis of male infertility is still controversial . in fact , leukocytospermia is frequently not associated with a microbiologically provable genitourinary infection . in these casesit has been suggested that white blood cells originate from the epididymis and appear to have favorable effects on semen quality , with an important role in immunosurveillance and in phagocytosis of morphologically abnormal spermatozoa or apoptosis . in the present study , the patients were carefully selected . in particular , the exclusion criteria included the absence of leukocytospermia , the absence of magi , and the absence of urogenital infection detected through bacterial culture . the same patients after hormonal treatment showed a significant reduction in the seminal concentration of cd45pos cells and a significant improvement of conventional sperm parameters . moreover , before the treatment , the seminal concentration of cd45pos cells was correlated with the percentage of spermatids and negatively correlated with the percentage of spermatozoa with normal morphology . most likely , the maintenance of a high concentration of cd45pos cells ( there are poor data in the literature concerning the threshold value , but politch and colleagues in 1993 suggested a threshold value of 210 wbc / ml ) is initially protective for spermatozoa , due to their suggested action of immunosurveillance for the maturational defects of the spermatozoa . however , no clinical studies have demonstrated whether the chronicization of this clinical model maintains these characteristics or is associated with the worsening of the sperm parameters . the results of this study suggest the latter hypothesis , but these data should be confirmed by further studies that evaluate other markers of inflammation and / or oxidative stress in the semen of infertile patients with high concentrations of cd45pos cells . theoretically , according to the data provided by transmission electron microscopy , the proportions of the main constituents of the nonsperm cellular components are the following : germinal elements ( 84 % ) ( anucleate bodies = 43 % ; spermatids = 22.2 % ; cellular masses with anucleate organelles and spermatocytes = 18 % ) , leukocytes ( 13 % ) ( neutrophils = 12 % ; macrophages = 0.9 % ; lymphocytes = 0.1 % ) , epithelial cells ( 2.3 % ) , and sertoli cells ( 0.7 % ) . the prevalence of leukocytospermia in semen of infertile patients is between 10 and 20 % , while the presence of lymphocytes is detectable up to 20 % . frequently , the concentration of leukocytes detected in the ejaculate is significantly higher with the immunocytological method than the traditional technique . in most cases , chlamydia infections represent the main stimulus for the persistence of the inflammatory process in the urogenital tract . however , bacteriospermia and leukocytospermia are not statistically associated with each other , and the presence of bacteriospermia alone is associated with sperm damage , but the presence of only leukocytes is also associated with deterioration of sperm parameters . leukocytes , in addition to their antimicrobial role , participate in the response to defects of sperm maturation . in particular , the concentration of cd45pos cells is reduced in semen samples that have defects in the morphology of the head of 50 % of spermatozoa . finally , semen samples with high concentrations of white blood cells contain a higher frequency of sperm with ideal morphology compared with samples with a high number of immature germ cells and a low concentration of leukocytes . this study has limitations that may explain some seemingly unfavorable results , such as the nonsignificant increase of sperm density and / or testicular volume after therapy . these limitations include the lack of data concerning the polymorphism of the fsh receptor , a factor known to be associated with different individual responses to therapy ; the first evaluation of sperm parameters immediately after the end of therapy ; and the lack of a control group . future studies should examine these factors with a larger number of patients . in conclusion , the results of this study suggest that treatment with fsh has significant positive effects on sperm morphology in patients with idiopathic oat . the most novel finding is the reduction of cd45pos cells in the semen of infertile males . future studies should clarify the importance of this diagnostic parameter in patients with idiopathic oat and the significance of this result , in particular the relationships between cd45pos cells and spermatids and sperm morphology before and after hormonal treatment .\noutput:\n" }, { "from": "agent", "value": "the present study evaluated the conventional sperm parameters and the seminal concentration of cd45pos cells ( pan - leukocyte marker ) of infertile patients with idiopathic oligoasthenoteratozoospermia ( oat ) . the patients were arbitrarily divided into three groups treated with recombinant follicle - stimulating hormone fsh : ( group a = 20 patients ) , recombinant fsh - ( group b = 20 patients ) , and highly purified human fsh ( group c = 14 patients ) . all treated groups achieved a similar improvement of the main sperm parameters ( density , progressive motility , and morphology ) , but only the increase in the percentage of spermatozoa with normal morphology was significant compared to the baseline in all three examined groups . moreover , all groups had a significant reduction of the seminal concentration of cd45pos cells and of the percentage of immature germ cells . before and after the treatment , the concentration of cd45pos cells showed a positive linear correlation with the percentage of immature germ cells and a negative correlation with the percentage of spermatozoa with regular morphology . these results demonstrate that treatment with fsh is effective in patients with idiopathic oat and that there are no significant differences between the different preparations . the novelty of this study is in the significant reduction of the concentration of cd45pos cells observed after the treatment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: basal cell carcinoma ( bcc ) , which accounts for 80 % of non - melanoma skin cancers ( nmscs ) , is the most common cancer in the us , with more than two million bccs diagnosed annually ( rogers et al . , 2010 ; acs , 2011 ) . while bcc is unlikely to metastasize and is associated with low mortality , morbidity associated with this disease is quite high . in 1992 among us medicare beneficiaries , nmsc ranked among the top five most costly cancers to treat ( housman et al . , 2003 ) . newer data indicate from 1992 to 2006 in the medicare population , there was a 77 % increase in the total number of skin cancer - related procedures ( 93.7 % nmsc ) , due to an increase in the number of individuals with these malignancies ( rogers et al . , 2010 ) . in recent decades , bcc incidence has increased ( arits et al . , 2011 ; bath - hextall et al . , 2007 ; birch - johansen et al . , 2010 ; doherty et al . , 2010 ; flohil et al . , 2011 ; , 1999 ; levi et al . , 2001 ) , with notable increases among adults under the age of 40 , particularly women ( bath - hextall et al . , 2007 ; birch - johansen et al . , 2010 ; ultraviolet ( uv ) radiation is the primary environmental etiologic factor for bcc , yet intrinsic or host factors , including pigment - related characteristics , are also likely to play a role in carcinogenesis in conjunction with uv ( reviewed in ( dessinioti et al . , 2010 ; madan et al . ,2010 ) ) . among pigment - related factors , the melanocortin 1 receptor gene ( mc1r ) , which encodes a protein that binds melanocyte - stimulating hormone and regulates skin and hair pigmentation ( valverde et al . ,1995 ) , has received considerable attention and has been associated with an increased risk of melanoma and bcc ( reviewed in ( scherer and kumar , 2010 ) ) . even though mc1r variants are related to light pigmentation phenotypes ( bastiaens et al . , 2001 ; , 2004 ; han et al . , 2006 ; kanetsky et al . , 2004 ; kennedy et al . , 2001 ; koppula et al . , 1997 ; 1995 ) , there seems to be an effect of genotype independent of phenotype on both bcc ( bastiaens et al . , 2001 ; dwyer et al . , 2004 ; han et al . , 2006 ; liboutet et al . , 2006 ; scherer et al . , 2008 ) and melanoma ( dwyer et al . , 2004 ; kanetsky et al . , 2010 ; kennedy et al , 2001 ; landi et al . , 2005 ; palmer et al . , 2000these findings , in combination with other emerging evidence from epidemiologic , clinical , and basic science research , indicate bcc may be more similar to melanoma than squamous cell carcinoma ( scc ) in etiology ( dessinioti et al . , 2010 ; madan et al . , bcc has been relatively understudied in epidemiologic research because it is not reported to most cancer registries . thus far , two studies provided an intriguing glimpse at risk factors for early - onset bcc , but these had small sample sizes ; 30 cases ( boyd et al . , 2002 ) and 25 cases ( bakos et al . , 2011 ) . due to the limited understanding of early - onset bcc etiology , we conducted a case - control study in connecticut among individuals under age 40 investigating lifestyle , environmental , and genetic factors . the rationale for this study was multifold and included increasing incidence among young people , the opportunity to evaluate genetic factors in a genetically enriched population , the potential for younger individuals to better recall early - life exposures , and a growing prevalence of indoor ( iarc , 2007 ) and outdoor tanning . here , we describe the design of the yale study of skin health in young people and the associations between host phenotype characteristics and mc1r in relation to early - onset bcc . sixty - nine percent of the 767 participants were female ( 257 cases , 274 controls ) . the mean age at skin biopsy in cases was 35.1 years ( sd = 4.6 ) and 34.7 years ( sd = 5.5 ) in controls . among cases ,54.1 % ( n = 204 ) had the referent bcc on the head or neck , followed by 101 ( 26.8 % ) with a trunk bcc , and 72 ( 19.1 % ) with a bcc on an extremity . approximately 37 % ( n = 140 ) of cases had two or more bccs under age 40 . all phenotype characteristics and mc1r were significantly associated with early - onset bcc , with lighter pigment phenotypes at greater risk ( table 1 ) . the most pronounced risk factor was skin reaction to first summer sun of the season ; those who experienced severe sunburn and blistering were 12.27 ( 95 % ci = 4.0836.94 ) times more likely to have bcc than those who turned brown / tanned with no burning . skin color was another strong risk factor ; individuals with very fair skin were 11.06 ( 95 % ci = 5.9020.74 ) times more likely to have bcc than those with olive skin . in a sensitivity analysis , excluding the top three control conditions one at a time from the control group did not impact risk estimates for all exposures ( data not shown ) . controlling for indoor and outdoor uv exposures did not alter associations for the characteristics of interest ( data not shown ) . individuals with one mc1r non - synonymous variant were 93 % more likely than those without non - synonymous variants to have bcc , with a stronger association for individuals with two or more non - synonymous mc1r variants ( or = 3.59 , 95 % ci = 2.375.43 ) ( table 1 ) . all host characteristics were associated with both single and multiple bcc case status , but the magnitude of the risk estimates for multiple bcc was much greater ( table 1 ) . one of the most pronounced differences was for skin color . while very fair skin as compared to olive skin was associated with a 6.62 increased risk of single bcc , the or for multiple bcc was almost 5.5 times greater ( or = 36.07 , 95 % ci = 8.95161.94 ) . participants with lighter pigment characteristics , less ability to tan , and more freckles were more likely to have at least one non - synonymous mc1r variant as compared to those with darker phenotypes ( supplemental table 2 online ) . in the mutually adjusted model , hair and skin color , mc1r , moles , and skin reaction to first summer sun were independently associated with bcc ( table 3 ) . very fair skin was associated with a 4.48 fold independent increased risk of bcc compared to olive skin ( or = 4.48 , 95 % ci = 2.219.09 ) and individuals with two or more non - synonymous variants had a 91 % independent increased risk compared to those with no variants ( or = 1.91 , 95 % ci = 1.203.03 ) . while there was no evidence of significant interactions between phenotypes and mc1r in relation to bcc risk , we observed some general patterns in risk across strata ( table 4 ) . the association between mc1r and bcc was stronger among individuals with darker phenotypes including , darker eye and skin color , fewer moles and freckles , and tanning rather than burning with sun exposure . in this case - control study of early - onset bcc , host phenotype characteristics of lighter pigmentation and inability to tan , as well as mc1r were independently associated with increased disease risk . to our knowledge , a large - scale epidemiologic study focused exclusively on bcc among young adults has not been previously reported . in our unique population , the magnitudes of risk associated with phenotype characteristics often associated with bcc were generally magnified as compared to studies in older individuals ( dessinioti et al . , 2010 ; hogan et al . , 1989 ; kiiski et al . , 2010 ; maia et al . , 1995 ; naldi et al . , 2000 ; vitasa et al . although bcc is relatively rare in young people , 37 % of our cases had two or more bccs under the age of 40 , and the association with each of our exposures was much stronger for these cases . our finding of a nearly two - fold increase in bcc risk for one non - synonymous mc1r variant and a 3.6 fold increase for two non - synonymous variants is in agreement with other bcc studies ( bastiaens et al . , 2001 ; 2006 ; scherer et al . , 2008 ) . yet , as we hypothesized , the magnitude of risk we observed was greater than in studies of older adults , where risk estimates have been less than or equal to 2.6 ( bastiaens et al . one small case - control study with a heterogeneous case group enrolled on the basis of having either familial bcc , multiple bcc , bcc with another cancer , or bcc before age 40 , observed a seven - fold increased risk of bcc with two mc1r variants ( liboutet et al . , 2006 ) . similar to our findings , mc1r variants have been associated with lighter pigment phenotypes in numerous studies ( bastiaens et al . , 2001 ; , 2001 ; dwyer et al . , 2004 ; han et al . , 2006 ; , 2001 ; koppula et al . , 1997 ; naysmith et al . , 2004 ; palmer et al . , 2000 ; the independent associations with early - onset bcc for mc1r , hair and skin color , moles , and skin reaction are in line with several studies of bcc ( bastiaens et al . , 2001 ; dwyer et al . , 2004 ; han et al . , 2006 ; liboutet et al . , 2006 ; scherer et al . , 2008 ) and melanoma ( dwyer et al . , 2004 ; , 2001 ; landi et al . , 2005 ; palmer et al . , 2000 ) . that mc1r remained an independent risk factor suggests variants in this gene contribute to bcc pathogenesis through mechanisms besides pigmentation . as a potential tumor initiator , impairment of mc1r function leads to synthesis of pheomelanin , which acts as a free radical generator and may cause oxidative dna damage on top of the uvb - induced damage typically associated with sunlight exposure to fair skin ( scherer and kumar , 2010 ) . furthermore , mouse studies show an effect of mc1r genotype on production of premalignant clones in the absence of any melanin pigment , suggesting a mechanism separate from pigment modulation ( robinson et al . , 2010 ) . a role in tumor progression through regulation of cytokines and their associated receptors , such as nf - kb , has been suggested ( eves et al . , 2003 ; getting , 2006 ) . there is a complex interplay between nf - kb regulation and the ability of tumor cells to escape immune surveillance and invade surrounding tissues . the association of pigment phenotypes independent of mc1r genotype points toward the involvement of other pigment - related genes in bcc risk . tyr , asip , and slc45a2 have been identified in other bcc studies ( gudbjartsson et al . , 2008 ; nan et al . , 2009 ; we found that mc1r was more strongly associated with early - onset bcc among those with darker phenotypes . several other bcc studies have evaluated this genotype - phenotype interaction , but results have been inconsistent . one study observed no clear variation in the association of mc1r and bcc risk by hair or skin color ( han et al . , 2006 ) , while others found an increased risk in those with darker hair and skin , but opposite patterns for eye color ( liboutet et al . , 2006 ) , or suggestive increased risk among individuals with the lightest skin ( bastiaens et al .2008 ) . one study of bcc ( dwyer et al . , 2004 ) and several of melanoma ( dwyer et al . , 2004 ; our findings , in conjunction with research in melanoma , may have applicability in primary prevention . among participants with the darkest pigment phenotypes , the estimated etiologic fractions for carrying two or morenon - synonymous mc1r variants ranged from a low of 12 % among individuals with no freckles on the face to a high of 28 % among individuals with brown eyes . because people with darker phenotypes are also at risk of skin cancer , sun protection interventions may need to be broadened to include these individuals who would otherwise consider themselves low - risk . our study had several strengths including extensive self - report phenotype data from a face - to - face interview and mc1r sequencing for nearly all participants . importantly , the laboratory was blinded to case - control status and interviewers were blinded to case - control status until the end of the interview . utilizing a centralized dermatopathology facility serving many dermatologists in connecticut enabled us to identify controls most likely to constitute the source population of our cases ; that is , young people who see a dermatologist for a skin lesion . because our controls had undergone a skin biopsy , this may have reduced differential reporting by case status , as our controls may have been more sensitive to exposures concerning skin health than general population controls . our results were robust in sensitivity analyses removing specific control conditions , indicating associations were not driven by inclusion of one benign condition . another potential limitation is related to possible misclassification within participant self - reported measures of phenotype , as we did not have more objective measures of pigment characteristics , such as clinician assessment or spectroscopy , but this is most likely to be non - differential . finally , although controls were seen by a dermatologist for a benign skin condition , we did not know if a complete skin examination was performed . therefore , controls could have possibly had a bcc ; however , the likelihood of this is low in our young sample . in summary , several host phenotype characteristics and mc1r were strongly and independently related to early - onset bcc . in this young population , the associations between the exposures of interest and disease risk were more pronounced for multiple bcc , and the relationship between mc1r and bcc was stronger among individuals with darker pigmentation phenotypes . even persons with darker pigment phenotypes , traditionally considered to be low risk of skin cancer , were at substantial risk of early - onset bcc if they had mc1r variants . to our knowledge a large scale epidemiologic investigation of these characteristics in relation early - onset bcc is previously unreported , so our results need confirmation in other populations . the yale study of skin health in young people was conducted in connecticut between july 2007 and december 2010 . bcc cases diagnosed between july 1 , 2006 and september 30 , 2010 were identified through yale university s dermatopathology database . approximately two - thirds of dermatologists in connecticut send their biopsied tissue to yale for dermatopathologic evaluation . potential controls were randomly sampled from individuals in the database with a variety of minor benign skin conditions . to be eligible for the study , participants had to : be less than 40 years of age at the time of skin biopsy , reside in connecticut , speak english , and themselves ( or appropriate guardian for decisionally impaired individuals and those under age 18 ) be mentally and physically capable of completing study components . yale university s institutional review board approved the study and participants ( or guardians ) provided written informed consent . one of two study interviewers then contacted individuals by telephone and invited them to participate in the study . if the telephone number was not working ( disconnected , wrong number , no number listed ) , another letter was mailed asking for updated contact information via telephone or mail . if the telephone number and mailing address were incorrect , updated contact information was sought periodically . among the 665 potentially eligible bcc cases identified during the study period , 17 ( 2.6 % ) were determined ineligible upon initial contact : 14 moved out of the state and 3 could not complete all study components ( two non - english speakers , one severe illness ) . of the remaining 648 individuals , 114 ( 17.6 % ) could not be contacted directly ( no telephone number , non - working telephone number , only spoke to other person in household , left message only ) . among the 534 cases we were able to directly reach and determine full eligibility , 145 ( 27.2 % ) declined to participate , resulting in 389 enrolled cases ( participation rate = 72.8 % ) . cases were classified into single ( only one bcc ) or multiple ( two or more bccs ) bcc under the age of 40 based on participant self - report and searching the yale dermatopathology database ( records from 1990 on ) . a total of 242 ( 62.2 % ) cases had one bcc in the database and did not self - report a prior bcc and 120 ( 30.9 % ) cases had two or more bccs in the database . the remaining 27 ( 6.9 % ) cases had one bcc in the database , but self - reported a prior bcc ; these individuals were categorized as multiple cases , as this did not significantly alter risk estimates . to determine control eligibility , two dermatologists reviewed skin conditions diagnosed during a one - year period in persons under age 40 in the yale dermatopathology database . a variety of diagnoses were determined ineligible for sampling , including skin cancers / precancers ( e.g. , melanoma , squamous cell carcinoma , t - cell lymphomas , actinic keratoses ) , potentially uv - related benign conditions ( e.g. , solar lentigo , abnormal nevus , erythematous conditions ) , dermal conditions treated with uv therapy ( e.g. , psoriasis ) and pigment disorders ( e.g. , vitiligo ) . randomly sampled controls were frequency matched to bcc cases on age at biopsy ( 5 year age groups ) , gender , and biopsy site ( head / neck , trunk , extremity ) . among the 1,102 potentially eligible controls , 60 ( 5.4 % ) were found ineligible upon initial contact ( 39 moved out of state , 10 non - english speakers , 2 did not recall having a skin biopsy , 1 hearing impaired , 1 hospitalized ) or during the interview ( 7 self - reported a bcc ) . of the remaining 1,042 individuals , 288 ( 27.6 % ) could not be contacted directly . among the 754 potential controls we could directly reach and determine full eligibility , 296 ( 39.3 % ) declined to participate and 458 controls enrolled ( participation rate = 60.7 % ) . the three most common were cyst ( 16.4 % ) , seborrheic keratosis ( 16.2 % ) , and wart ( 11.4 % ) . participants completed an in - person face - to - face interview during which interviewers obtained information on sociodemographics , uv exposure ( solar and artificial ) , personal and family medical history , and host phenotype characteristics including , self - reported eye color , skin color ( inner upper arm ) , hair color ( natural color ) , skin reaction to strong sunlight for the first time in the summer for one hour without sunscreen , skin reaction after repeated and prolonged exposure to sunlight , amount of freckles on the face ( selected from a range of images ) , and number of moles on the back = 5 mm ( using clear acetate size template ) using a structured questionnaire . interviewers were blinded to case - control status until the end of the interview , when personal history of cancer , including bcc , was queried . participants also completed several mailed self - administered questionnaires ( residence history , outdoor jobs , attitudes toward sunless , outdoor , and indoor tanning ) . interviewers collected buccal cells from 98.9 % of participants using oragenedna 2 ml saliva collection kits ( dna genotek inc . ; ontario , canada ; http://www.dnagenotek.com/index.html ) at the end of the interview following the manufacturer s protocol , including rinsing the mouth with drinking water and then waiting five minute before collection . each 25 l pcr reaction contained 2550 ng of dna ; 200 mol / l dntps ; 5 mol / l of each primer , 5 - actaagcaggacacctggag - 3 and 5 - tctttaggagcctgaggttg - 3 ; pc2 buffer ( 50 mm tris - hcl ph 9.1 , 16 mm ammonium sulfate , 3.5 mm mgcl2 , and 150 mg / ml bsa ; ab peptides , inc . ) ; 0.25 mmol / l spermidine ; 0.125 units of taq dna polymerase ( amplitaq , roche ) ; and 0.125 units of taq extender ( stratagene ) . pcr was performed with an initial denaturation for two minutes at 97c ; followed by 35 cycles of denaturation at 96c for 30 seconds , annealing at 66c for 30 seconds , and extension for one minute at 72c ; and a final extension at 72c for five minutes . pcr products were size fractionated on a 1.5 % gpg / letm ( american bioanalytical ) agarose gel , stained with ethidium bromide , and photographed under ultraviolet light in order to confirm the presence of the correct pcr fragment .5 l of the pcr products were treated with 20 units exonuclease i ( e.coli ) ( new england biolabs ) and two units shrimp alkaline phosphatase ( usb ) . either 0.4 mol / l of the forward primer , 5 - actaagcaggacacctggag - 3 , or the reverse primer 5 - ggtcacacaggaaccagacc - 3 were added . the sequencing was carried out at yale university s w. m. keck facility using applied biosystems 3730 capillary instruments . the sequencing reactions utilized fluorescently - labeled dideoxynucleotides ( big dye terminators ) and taq fs dna polymerase in a thermal cycling protocol . the sequence was analyzed using sequencher 4.9 ( gene codes corporation ) comparing the query sequence to the standard sequence with no variants in mc1r ( nm_002386.3 ) . , 1997 ; kanetsky et al . , 2004 ; valverde et al . , 1995 ) . we then calculated the number of total non - synonymous variants within the mc1r coding region . analyses were limited to non - hispanic whites ; 380 ( 97.7 % ) cases and 390 ( 85.2 % ) controls . three bcc cases with gorlin syndrome , which predisposes individuals to multiple bccs early in life ( gorlin and goltz , 1960 ) , were also excluded . our analytic population consisted of 767 individuals ( 377 cases , 390 controls ) ; three cases and three controls were under age 18 at enrollment . phenotype characteristics and mc1r ( count of all non - synonymous variants within the gene , 0 , 1 , 2 variants ) were treated as categorical variables . we calculated odds ratios ( ors ) and 95 % confidence intervals ( cis ) using multivariate logistic regression for all cases . analyses were then restricted to cases with only one bcc ( n = 237 ) and then cases with two or more bccs ( n = 140 ) . we determined independent relationships using backward stepwise selection ; retaining only exposures statistically significant at alpha = 0.05 , as well as gender , age , and body site . the yale study of skin health in young people was conducted in connecticut between july 2007 and december 2010 . bcc cases diagnosed between july 1 , 2006 and september 30 , 2010 were identified through yale university s dermatopathology database . approximately two - thirds of dermatologists in connecticut send their biopsied tissue to yale for dermatopathologic evaluation . potential controls were randomly sampled from individuals in the database with a variety of minor benign skin conditions . to be eligible for the study , participants had to : be less than 40 years of age at the time of skin biopsy , reside in connecticut , speak english , and themselves ( or appropriate guardian for decisionally impaired individuals and those under age 18 ) be mentally and physically capable of completing study components . yale university s institutional review board approved the study and participants ( or guardians ) provided written informed consent . one of two study interviewers then contacted individuals by telephone and invited them to participate in the study . if the telephone number was not working ( disconnected , wrong number , no number listed ) , another letter was mailed asking for updated contact information via telephone or mail . if the telephone number and mailing address were incorrect , updated contact information was sought periodically . among the 665 potentially eligible bcc cases identified during the study period , 17 ( 2.6 % ) were determined ineligible upon initial contact : 14 moved out of the state and 3 could not complete all study components ( two non - english speakers , one severe illness ) . of the remaining 648 individuals , 114 ( 17.6 % ) could not be contacted directly ( no telephone number , non - working telephone number , only spoke to other person in household , left message only ) . among the 534 cases we were able to directly reach and determine full eligibility , 145 ( 27.2 % ) declined to participate , resulting in 389 enrolled cases ( participation rate = 72.8 % ) . cases were classified into single ( only one bcc ) or multiple ( two or more bccs ) bcc under the age of 40 based on participant self - report and searching the yale dermatopathology database ( records from 1990 on ) . a total of 242 ( 62.2 % ) cases had one bcc in the database and did not self - report a prior bcc and 120 ( 30.9 % ) cases had two or more bccs in the database . the remaining 27 ( 6.9 % ) cases had one bcc in the database , but self - reported a prior bcc ; these individuals were categorized as multiple cases , as this did not significantly alter risk estimates . to determine control eligibility , two dermatologists reviewed skin conditions diagnosed during a one - year period in persons under age 40 in the yale dermatopathology database . a variety of diagnoses were determined ineligible for sampling , including skin cancers / precancers ( e.g. , melanoma , squamous cell carcinoma , t - cell lymphomas , actinic keratoses ) , potentially uv - related benign conditions ( e.g. , solar lentigo , abnormal nevus , erythematous conditions ) , dermal conditions treated with uv therapy ( e.g. , psoriasis ) and pigment disorders ( e.g. , vitiligo ) . randomly sampled controls were frequency matched to bcc cases on age at biopsy ( 5 year age groups ) , gender , and biopsy site ( head / neck , trunk , extremity ) . among the 1,102 potentially eligible controls , 60 ( 5.4 % ) were found ineligible upon initial contact ( 39 moved out of state , 10 non - english speakers , 2 did not recall having a skin biopsy , 1 hearing impaired , 1 hospitalized ) or during the interview ( 7 self - reported a bcc ) . of the remaining 1,042 individuals , 288 ( 27.6 % ) could not be contacted directly . among the 754 potential controls we could directly reach and determine full eligibility , 296 ( 39.3 % ) declined to participate and 458 controls enrolled ( participation rate = 60.7 % ) . the three most common were cyst ( 16.4 % ) , seborrheic keratosis ( 16.2 % ) , and wart ( 11.4 % ) . participants completed an in - person face - to - face interview during which interviewers obtained information on sociodemographics , uv exposure ( solar and artificial ) , personal and family medical history , and host phenotype characteristics including , self - reported eye color , skin color ( inner upper arm ) , hair color ( natural color ) , skin reaction to strong sunlight for the first time in the summer for one hour without sunscreen , skin reaction after repeated and prolonged exposure to sunlight , amount of freckles on the face ( selected from a range of images ) , and number of moles on the back = 5 mm ( using clear acetate size template ) using a structured questionnaire . interviewers were blinded to case - control status until the end of the interview , when personal history of cancer , including bcc , was queried . participants also completed several mailed self - administered questionnaires ( residence history , outdoor jobs , attitudes toward sunless , outdoor , and indoor tanning ) . interviewers collected buccal cells from 98.9 % of participants using oragenedna 2 ml saliva collection kits ( dna genotek inc . ; ontario , canada ; http://www.dnagenotek.com/index.html ) at the end of the interview following the manufacturer s protocol , including rinsing the mouth with drinking water and then waiting five minute before collection . each 25 l pcr reaction contained 2550 ng of dna ; 200 mol / l dntps ; 5 mol / l of each primer , 5 - actaagcaggacacctggag - 3 and 5 - tctttaggagcctgaggttg - 3 ; pc2 buffer ( 50 mm tris - hcl ph 9.1 , 16 mm ammonium sulfate , 3.5 mm mgcl2 , and 150 mg / ml bsa ; ab peptides , inc . ) ; 0.25 mmol / l spermidine ; 0.125 units of taq dna polymerase ( amplitaq , roche ) ; and 0.125 units of taq extender ( stratagene ) . pcr was performed with an initial denaturation for two minutes at 97c ; followed by 35 cycles of denaturation at 96c for 30 seconds , annealing at 66c for 30 seconds , and extension for one minute at 72c ; and a final extension at 72c for five minutes . pcr products were size fractionated on a 1.5 % gpg / letm ( american bioanalytical ) agarose gel , stained with ethidium bromide , and photographed under ultraviolet light in order to confirm the presence of the correct pcr fragment .5 l of the pcr products were treated with 20 units exonuclease i ( e.coli ) ( new england biolabs ) and two units shrimp alkaline phosphatase ( usb ) . either 0.4 mol / l of the forward primer , 5 - actaagcaggacacctggag - 3 , or the reverse primer 5 - ggtcacacaggaaccagacc - 3 were added . the sequencing was carried out at yale university s w. m. keck facility using applied biosystems 3730 capillary instruments . the sequencing reactions utilized fluorescently - labeled dideoxynucleotides ( big dye terminators ) and taq fs dna polymerase in a thermal cycling protocol . the sequence was analyzed using sequencher 4.9 ( gene codes corporation ) comparing the query sequence to the standard sequence with no variants in mc1r ( nm_002386.3 ) . major and minor red hair variants ( box et al . , 1997 ; kanetsky et al . , 2004 ; valverde et al . , we then calculated the number of total non - synonymous variants within the mc1r coding region . analyses were limited to non - hispanic whites ; 380 ( 97.7 % ) cases and 390 ( 85.2 % ) controls . three bcc cases with gorlin syndrome , which predisposes individuals to multiple bccs early in life ( gorlin and goltz , 1960 ) , were also excluded . our analytic population consisted of 767 individuals ( 377 cases , 390 controls ) ; three cases and three controls were under age 18 at enrollment . phenotype characteristics and mc1r ( count of all non - synonymous variants within the gene , 0 , 1 , 2 variants ) were treated as categorical variables . we calculated odds ratios ( ors ) and 95 % confidence intervals ( cis ) using multivariate logistic regression for all cases . analyses were then restricted to cases with only one bcc ( n = 237 ) and then cases with two or more bccs ( n = 140 ) . we determined independent relationships using backward stepwise selection ; retaining only exposures statistically significant at alpha = 0.05 , as well as gender , age , and body site .\noutput:\n" }, { "from": "agent", "value": "basal cell carcinoma ( bcc ) incidence is increasing , particularly among adults under age 40 . pigment - related characteristics are associated with bcc in older populations , but epidemiologic studies among younger individuals and analyses of phenotype - genotype interactions are limited . we examined self - reported phenotypes and melanocortin 1 receptor gene ( mc1r ) variants in relation to early - onset bcc . bcc cases ( n = 377 ) and controls with benign skin conditions ( n = 390 ) under age 40 were identified through yale s dermatopathology database . factors most strongly associated with early - onset bcc were skin reaction to first summer sun for one hour [ severe sunburn vs. tan odds ratio ( or ) = 12.27 , 95 % confidence interval ( ci ) = 4.0836.94 ] and skin color ( very fair vs. olive or = 11.06 , 95 % ci = 5.9020.74 ) . individuals with two or more mc1r non - synonymous variants were 3.59 times ( 95 % ci = 2.375.43 ) more likely to have bcc than those without non - synonymous variants . all host characteristics and mc1r were more strongly associated with multiple bcc cases status ( 37 % of cases ) than single bcc case status . mc1r , number of moles , skin reaction to first summer sun for one hour , and hair and skin color were independently associated with bcc . bcc risk conferred by mc1r tended to be stronger among those with darker pigment phenotypes , traditionally considered to be at low - risk of skin cancer ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the first part of this review article focused on practical and technical aspects of iohexol plasma clearance [ i.e. plasma iohexol analysis and clearance investigation procedures ( number of samples and timing ) ] . in this second part , we focus on the indication of glomerular filtration rate ( gfr ) measurements in clinical practice as wellas in epidemiological and clinical research . it is beyond the scope of this article to review and summarize all clinical settings where measured gfr is recommended . briefly , and as stated in the kidney disease : improving global outcomes guidelines , additional tests for gfr assessment are needed in specific populations where creatinine - based equations are unreliable , because serum creatinine is largely dependent on muscle mass . cystatin c can be used as an alternative test but is influenced by other non - gfr - related factors such as obesity , thyroid function and cardiovascular risk factors . thus , measured gfr is recommended for specific patients or subjects with an abnormal muscule mass or body composition , such as anorectic , cirrhotic , obese and renal and non - renal transplant patients . if , in daily practice , repeated measurements of gfr in these patient groups are infeasible , at least one gfr measurement will indicate the relationship between serum creatinine ( or plasma cystatin c ) concentrations and themeasured gfr is the only available test to certify gfr levels , and according to the gfr level , to confirm or refute chronic kidney disease ( ckd ) status . also , in longitudinal studies , several authors have described the limitations of estimated gfr ( egfr ) to adequately assess the true decline in measured gfr . another clear indication for gfr measurement applies when an exact value of gfr is required . the two typical examples are the measurement of gfr before potential living kidney donation or before prescribing a potentially toxic hydrosoluble drug with a narrow therapeutic window , e.g. aminoglycosides or cisplatin . abnormally elevated gfr , or hyperfiltration , has been established as an initial pathophysiological step to ckd in patients with diabetes and may also be of importance in common conditions such as obesity , metabolic syndrome and prediabetes . importantly , data suggest that treating hyperfiltration with angiotensin - converting enzyme inhibitors could be beneficial . however , it is well accepted that the condition of hyperfiltration can only be correctly detected with measured gfr , as all egfr equations perform poorly in this specific , highly relevant pathological state . the role of measured gfr in both clinical epidemiology and clinical research is another important objective of this review . for example , the cric ( chronic renal insufficiency cohort ) , bis ( berlin initiative study ) , ages - ii ( age , gene / environment susceptibility ) and renis ( renal iohexol clearance survey ) studies are four large observational cohorts with gfr measured by iothalamate ( cric ) and iohexol ( bis , ages - ii and renis ) . the renis study is interesting since it is a european observational study with a representative sample of the general population in troms , norway , and gfr measurement has been repeated in the follow - up . the bis study also measured gfr with iohexol plasma clearance in a large population - based cohort of older patients ( mean age 79 years ) , which also proves the feasibility of performing measured gfr in this fragile age group . data from numerous epidemiological studies show high but different prevalence rates of ckd in the general population . moreover , ckd status is associated with mortality , especially cardiovascular mortality . it is known that all egfr equations , based on creatinine and / or cystatin c , have limitations , particularly at high gfr levels . also , it has been shown that the prevalence of ckd is largely dependent on the equation [ modification of diet in renal disease ( mdrd ) versus chronic kidney disease epidemiology collaboration ( ckd - epi ) versus cockcroftgault ] and biomarker used ( creatinine versus cystatin c ) . the major limitations of gfr estimations include issues in calibration of the biomarkers , different performance of the estimators according to age and lack of precision in high gfr values . even if data are limited , we can not exclude that the prevalence of ckd in the general population , defined as gfr 60 ml / min / 1.73 m , may be much lower with measured gfr compared with egfr . the higher risk of mortality associated with decreased gfr is another hot topic in clinical epidemiology . once again , associations between cardiovascular risk and ckd have been described with egfr in the vast majority of patients . this fact could lead to confusion or false - positive associations , as egfr may include variables such as gender , ethnicity , weight and age that are per se risk factors for cardiovascular morbidity and mortality and often referred to as non - gfr determinant . the different weights of these factors in different equations might explain differences in the magnitude of association between cardiovascular outcomes and egfr . some authors have suggested a closer association between mortality and the cockcroft gault equation compared with the mdrd study equation . the fact that age is handled differently mathematically in the two equations could explain the discrepancies . c versus creatinine - based equations , an increased hazard ratio for all - cause mortality was found for egfr 85 ml / min / 1.73 m based on cystatin c , but when the egfr was based on creatinine , the hazard ratio increased when egfr was 60 ml / min / 1.73 m . also , the classical association between the mdrd ( or ckd - epi ) equation and mortality is u - shaped , with a higher mortality at high gfr values . this u - shaped association has not been found when cystatin c based equations were investigated . overall , it is virtually impossible to know whether this u - shaped association is ( i ) a mathematical artefact , ( ii ) due to hyperfiltration ( true elevated gfr ) or ( iii ) due to sarcopenia and falsely low creatinine concentrations . measured gfr has recently been discredited because it was insufficiently able to predict mortality compared with creatinine - or cystatin c based equations . using measured gfr is , however , the only way to really study the potential link between decreased renal function and cardiovascular or total mortality , being sure that this association is not due to confounders , i.e. non - gfr determinants of biomarkers [ muscule mass ( serum creatinine ) , traditional cardiovascular risk factors ( cystatin c ) and non - traditional cardiovascular risk factors ( creatinine and cystatin c ) ] . in nephrological trials , the classic clinical endpoints are mortality , end - stage renal disease or doubling of serum creatinine . however , these are relatively rare events developing over a long period of time , especially in low - risk patients . for this reason , clinical studies in nephrology require large sample sizes and a long follow - up time . however , egfr lacks precision , especially at high gfr levels , and is , as mentioned above , not only dependent on gfr , but also on non - gfr determinants included in the equations . moreover , several authors have described large discrepancies between slopes based on measured gfr versus egfr . the majority of these studies have shown that the decline in measured gfr is underestimated by egfr . for these reasons , detection of potential differences in gfr slopes between two groups ( e.g. one treated with active therapy and the other with placebo ) requires larger sample sizes with egfr than with measured gfr . an example is the trial of belatacept in renal transplant patients , which showed a benefit of belatacept therapy when measured gfr was used , whereas a non - significant difference was observed with egfr . importantly , the number of patients with measured gfr in the three groups was relatively small ( n = 32 in the intensive belatacept group , n = 37 in the less intensive group and n = 27 in the cyclosporine group ) . another illustrative example is the aladin ( a long - acting somatostatin on disease progression in nephropathy due to autosomal dominant polycystic kidney disease ) trial in which the efficacy of somatostatin in polycystic kidney disease was studied . the authors were able to show that the slope of measured gfr was significantly different between treatment groups ( n = 36 and 34 in the active and placebo arm , respectively ) . such important results would have been missed if only egfr had been used . a similar trial with similar resultsthe authors also showed a significantly different slope in egfr after 3 years of follow - up between the tolvaptan and placebo groups , but had to include 1445 patients to detect this significant difference . the lack of precision of egfr is also particularly important in the context of drug dosage adaptation . it is beyond the scope of this article to discuss all the limitations of equations in this context . due to these limitations , the european medicines agency now recommends that a method accurately measuring gfr using an exogenous marker [ should be ] used in pharmacokinetic studies in subjects with decreased renal function . measuring gfr is also feasible in large epidemiological studies . for example , the cric ( chronic renal insufficiency cohort ) , bis ( berlin initiative study ) , ages - ii ( age , gene / environment susceptibility ) and renis ( renal iohexol clearance survey ) studies are four large observational cohorts with gfr measured by iothalamate ( cric ) and iohexol ( bis , ages - ii and renis ) . the renis study is interesting since it is a european observational study with a representative sample of the general population in troms , norway , and gfr measurement has been repeated in the follow - up . the bis study also measured gfr with iohexol plasma clearance in a large population - based cohort of older patients ( mean age 79 years ) , which also proves the feasibility of performing measured gfr in this fragile age group . data from numerous epidemiological studies show high but different prevalence rates of ckd in the general population . moreover , ckd status is associated with mortality , especially cardiovascular mortality . . it is known that all egfr equations , based on creatinine and / or cystatin c , have limitations , particularly at high gfr levels . also , it has been shown that the prevalence of ckd is largely dependent on the equation [ modification of diet in renal disease ( mdrd ) versus chronic kidney disease epidemiology collaboration ( ckd - epi ) versus cockcroftgault ] and biomarker used ( creatinine versus cystatin c ) . the major limitations of gfr estimations include issues in calibration of the biomarkers , different performance of the estimators according to age and lack of precision in high gfr values . even if data are limited , we can not exclude that the prevalence of ckd in the general population , defined as gfr 60 ml / min / 1.73 m , may be much lower with measured gfr compared with egfr . the higher risk of mortality associated with decreased gfr is another hot topic in clinical epidemiology . once again , associations between cardiovascular risk and ckd have been described with egfr in the vast majority of patients . this fact could lead to confusion or false - positive associations , as egfr may include variables such as gender , ethnicity , weight and age that are per se risk factors for cardiovascular morbidity and mortality and often referred to as non - gfr determinant . the different weights of these factors in different equations might explain differences in the magnitude of association between cardiovascular outcomes and egfr . the fact that age is handled differently mathematically in the two equations could explain the discrepancies . c versus creatinine - based equations , an increased hazard ratio for all - cause mortality was found for egfr 85 ml / min / 1.73 m based on cystatin c , but when the egfr was based on creatinine , the hazard ratio increased when egfr was 60 ml / min / 1.73 m . also , the classical association between the mdrd ( or ckd - epi ) equation and mortality is u - shaped , with a higher mortality at high gfr values . this u - shaped association has not been found when cystatin c based equations were investigated . overall , it is virtually impossible to know whether this u - shaped association is ( i ) a mathematical artefact , ( ii ) due to hyperfiltration ( true elevated gfr ) or ( iii ) due to sarcopenia and falsely low creatinine concentrations . measured gfr has recently been discredited because it was insufficiently able to predict mortality compared with creatinine - or cystatin c based equations . using measured gfr is , however , the only way to really study the potential link between decreased renal function and cardiovascular or total mortality , being sure that this association is not due to confounders , i.e. non - gfr determinants of biomarkers [ muscule mass ( serum creatinine ) , traditional cardiovascular risk factors ( cystatin c ) and non - traditional cardiovascular risk factors ( creatinine and cystatin c ) ] . in nephrological trials , the classic clinical endpoints are mortality , end - stage renal disease or doubling of serum creatinine . however , these are relatively rare events developing over a long period of time , especially in low - risk patients . for this reason , clinical studies in nephrology require large sample sizes and a long follow - up time . therefore , several authors proposed so - called surrogate markers instead of true endpoints . however , egfr lacks precision , especially at high gfr levels , and is , as mentioned above , not only dependent on gfr , but also on non - gfr determinants included in the equations . moreover , several authors have described large discrepancies between slopes based on measured gfr versus egfr . the majority of these studies have shown that the decline in measured gfr is underestimated by egfr . for these reasons , detection of potential differences in gfr slopes between two groups ( e.g. one treated with active therapy and the other with placebo ) requires larger sample sizes with egfr than with measured gfr . an example is the trial of belatacept in renal transplant patients , which showed a benefit of belatacept therapy when measured gfr was used , whereas a non - significant difference was observed with egfr . importantly , the number of patients with measured gfr in the three groups was relatively small ( n = 32 in the intensive belatacept group , n = 37 in the less intensive group and n = 27 in the cyclosporine group ) . another illustrative example is the aladin ( a long - acting somatostatin on disease progression in nephropathy due to autosomal dominant polycystic kidney disease ) trial in which the efficacy of somatostatin in polycystic kidney disease was studied . the authors were able to show that the slope of measured gfr was significantly different between treatment groups ( n = 36 and 34 in the active and placebo arm , respectively ) . such important results would have been missed if only egfr had been used . a similar trial with similar resultsthe authors also showed a significantly different slope in egfr after 3 years of follow - up between the tolvaptan and placebo groups , but had to include 1445 patients to detect this significant difference . the lack of precision of egfr is also particularly important in the context of drug dosage adaptation . it is beyond the scope of this article to discuss all the limitations of equations in this context . due to these limitations , the european medicines agency now recommends that a method accurately measuring gfr using an exogenous marker [ should be ] used in pharmacokinetic studies in subjects with decreased renal function . in conclusion , both in clinical practice and in research , measured gfr is considered too rarely . nephrology is certainly the only discipline where a gold standard measurement is so uncommonly used . measuring gfr by iohexol has several advantages : simplicity , low cost , stability and low interlaboratory variation . we are convinced that iohexol plasma clearance is the best chance to implement a standardized gfr measurement protocol that would be applicable worldwide both in clinical practice and in research . even if it is not as perfect as the gold standard method ( inulin urinary clearance ) , iohexol plasma clearance appears to provide the best compromise between physiology , reliability and feasibility .\noutput:\n" }, { "from": "agent", "value": "a reliable assessment of glomerular filtration rate ( gfr ) is of paramount importance in clinical practice as well as epidemiological and clinical research settings . it is recommended by kidney disease : improving global outcomes guidelines in specific populations ( anorectic , cirrhotic , obese , renal and non - renal transplant patients ) where estimation equations are unreliable . measured gfr is the only valuable test to confirm or confute the status of chronic kidney disease ( ckd ) , to evaluate the slope of renal function decay over time , to assess the suitability of living kidney donors and for dosing of potentially toxic medication with a narrow therapeutic index . abnormally elevated gfr or hyperfiltration in patients with diabetes or obesity can be correctly diagnosed only by measuring gfr . gfr measurement contributes to assessing the true ckd prevalence rate , avoiding discrepancies due to gfr estimation with different equations . using measured gfr , successfully accomplished in large epidemiological studies , is the only way to study the potential link between decreased renal function and cardiovascular or total mortality , being sure that this association is not due to confounders , i.e. non - gfr determinants of biomarkers . in clinical research , it has been shown that measured gfr ( or measured gfr slope ) as a secondary endpoint as compared with estimated gfr detected subtle treatment effects and obtained these results with a comparatively smaller sample size than trials choosing estimated gfr . measuring gfr by iohexol has several advantages : simplicity , low cost , stability and low interlaboratory variation . iohexol plasma clearance represents the best chance for implementing a standardized gfr measurement protocol applicable worldwide both in clinical practice and in research ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in the fall of 2012 , a man in his early 30s was found dead in his room by his family . he had attended a party and the next morning reported fever , chills , and general malaise ( day 1 ) . he was not seen again until day 3 when a family member found him unresponsive in his room . the case was reported to the new york city office of the chief medical examiner , and the medicolegal investigator noted that the man was in an early state of decomposition . no suspicious circumstances or evidence of external trauma or alcohol or drug use were present . an autopsy performed on day 4 was remarkable for a purpuric rash more pronounced on the legs , arms , hands , and soles of feet ( figure 1 ) . early decomposition , commented on by the medicolegal investigator , was also noted at autopsy . internal organs had a markedly soft consistency , but no other substantial abnormality was noted . the only substantial internal finding was a thin layer of purulent exudate on the leptomeninges . a limited amount of vitreous humor was collected ; brain and other organ tissue samples collected were fixed in formalin . postmortem purpuric rash on sole of a man for whom invasive meningococcal disease was diagnosed after death ( case 1 ) , new york city , new york , usa . the body was brought to the funeral home and embalmed on day 6 . the medical examiner reviewing the case on day 6 became concerned that the patient might have died of meningococcal disease , and the examiner notified the new york city department of health and mental hygiene ( dohmh ) . dohmh recommended that the medical examiner collect additional samples , specifically skin , for ihc . three hours after embalming , skin samples were collected from areas of purpuric rash on the leg and stored in saline . vitreous humor and skin samples were sent to wadsworth center laboratory of the new york state department of health ( albany , ny , usa ) for testing by pcr , and tissue specimens ( brain , lung , heart , liver , and kidney collected at autopsy and fixed in formalin and skin collected after embalming ) were sent to the centers for disease control and prevention ( cdc ; atlanta , ga , usa ) for ihc staining and pcr ( 24 ) . skin and vitreous humor specimens were positive for neisseria meningitidis serogroup c dna by real - time pcr at wadsworth center ( 2 ) . gram - staining of brain and skin tissue ( examination performed at cdc ) showed gram - negative cocci and gram - positive bacilli in leptomeninges and vascular lumens . therefore , the gram - positive bacilli were deemed likely to represent postmortem bacteria overgrowth and did not contribute to an etiologic diagnosis . meningitidis group y antiserum that is broadly reactive with serogroups a , b , c , w , and y , and a specific monoclonal antimeningitidis serogroup c antibody , revealed immunostaining in the leptomeninges , lung , and skin tissues ( 3,4 ) . results confirmed n. meningitidis serogroup c as the etiologic agent causing acute meningitis and systemic infection . approximately 2 months after the first case occurred , a man in his mid-30s was found dead in his apartment by his friends and police after he was reported missing from work . he had last spoken to friends 4 days previously when he reported a sore throat ( day 1 ) . the man had a history of hiv infection and crystal methamphetamine use , which was confirmed by urine toxicology at autopsy . the patient had marked putrefactive skin changes on the left side of the body , consistent with his postmortem position , and visible purpura on the right side of the torso and lower extremities but not on palms or soles . cerebral cortex and leptomeninge tissues were cultured and grew gram - positive rods and mixed flora . tissue samples of lung , liver , spleen , kidney , and pancreas were fixed in formalin and sent to cdc . vitreous humor and a swab of the leptomeninges collected at autopsy were sent to wadsworth center . at wadsworth center , testing of the vitreous humor by real - time pcr showed n. meningitidis serogroup c dna , haemophilus influenzae dna , streptococcus agalactiae dna , and staphylococcus aureus dna ( 2 ) . as in case 1 , the bacteria other than n. meningitidis were thought to represent postmortem bacteria overgrowth and did not contribute to etiologic diagnosis . at cdc , n. meningitidis dna was extracted and amplified by pcr from formalin - fixed paraffin - embedded brain , liver , lung , spleen , and kidney tissue ( 4 ) . although multiple tissues showed marked autolysis , distinct and specific ihc staining for n. meningitidis serogroup c was identified within blood vessels and in neutrophilic infiltrates in the leptomeninges ( figure 2 ) ( 3,4 ) . the results confirmed n. meningitidis serogroup c as the etiologic agent causing acute meningitis and systemic infection . dohmh did not learn about the case until after it was too late to administer prophylaxis to close contacts , but no known secondary cases were identified . immunostaining of neisseria menigitidis in meninges of a man for whom invasive meningococcal disease was diagnosed after death ( case 2 ) , new york city , new york , usa . naphthol fast red substrate with light hematoxylin counterstain . in the fall of 2012 , a man in his early 30s was found dead in his room by his family . he had attended a party and the next morning reported fever , chills , and general malaise ( day 1 ) . he was not seen again until day 3 when a family member found him unresponsive in his room . the case was reported to the new york city office of the chief medical examiner , and the medicolegal investigator noted that the man was in an early state of decomposition . no suspicious circumstances or evidence of external trauma or alcohol or drug use were present . an autopsy performed on day 4 was remarkable for a purpuric rash more pronounced on the legs , arms , hands , and soles of feet ( figure 1 ) . early decomposition , commented on by the medicolegal investigator , was also noted at autopsy . internal organs had a markedly soft consistency , but no other substantial abnormality was noted . the only substantial internal finding was a thin layer of purulent exudate on the leptomeninges . a limited amount of vitreous humor was collected ; brain and other organ tissue samples collected were fixed in formalin . postmortem purpuric rash on sole of a man for whom invasive meningococcal disease was diagnosed after death ( case 1 ) , new york city , new york , usa . the body was brought to the funeral home and embalmed on day 6 . the medical examiner reviewing the case on day 6 became concerned that the patient might have died of meningococcal disease , and the examiner notified the new york city department of health and mental hygiene ( dohmh ) . dohmh recommended that the medical examiner collect additional samples , specifically skin , for ihc . three hours after embalming , skin samples were collected from areas of purpuric rash on the leg and stored in saline . vitreous humor and skin samples were sent to wadsworth center laboratory of the new york state department of health ( albany , ny , usa ) for testing by pcr , and tissue specimens ( brain , lung , heart , liver , and kidney collected at autopsy and fixed in formalin and skin collected after embalming ) were sent to the centers for disease control and prevention ( cdc ; atlanta , ga , usa ) for ihc staining and pcr ( 24 ) . skin and vitreous humor specimens were positive for neisseria meningitidis serogroup c dna by real - time pcr at wadsworth center ( 2 ) . gram - staining of brain and skin tissue ( examination performed at cdc ) showed gram - negative cocci and gram - positive bacilli in leptomeninges and vascular lumens . therefore , the gram - positive bacilli were deemed likely to represent postmortem bacteria overgrowth and did not contribute to an etiologic diagnosis . meningitidis group y antiserum that is broadly reactive with serogroups a , b , c , w , and y , and a specific monoclonal antimeningitidis serogroup c antibody , revealed immunostaining in the leptomeninges , lung , and skin tissues ( 3,4 ) . results confirmed n. meningitidis serogroup c as the etiologic agent causing acute meningitis and systemic infection . approximately 2 months after the first case occurred , a man in his mid-30s was found dead in his apartment by his friends and police after he was reported missing from work . he had last spoken to friends 4 days previously when he reported a sore throat ( day 1 ) . the man had a history of hiv infection and crystal methamphetamine use , which was confirmed by urine toxicology at autopsy . the patient had marked putrefactive skin changes on the left side of the body , consistent with his postmortem position , and visible purpura on the right side of the torso and lower extremities but not on palms or soles . cerebral cortex and leptomeninge tissues were cultured and grew gram - positive rods and mixed flora . tissue samples of lung , liver , spleen , kidney , and pancreas were fixed in formalin and sent to cdc . vitreous humor and a swab of the leptomeninges collected at autopsy were sent to wadsworth center . at wadsworth center , testing of the vitreous humor by real - time pcr showed n. meningitidis serogroup c dna , haemophilus influenzae dna , streptococcus agalactiae dna , and staphylococcus aureus dna ( 2 ) . as in case 1 , the bacteria other than n. meningitidis were thought to represent postmortem bacteria overgrowth and did not contribute to etiologic diagnosis . at cdc , n. meningitidis dna was extracted and amplified by pcr from formalin - fixed paraffin - embedded brain , liver , lung , spleen , and kidney tissue ( 4 ) . although multiple tissues showed marked autolysis , distinct and specific ihc staining for n. meningitidis serogroup c was identified within blood vessels and in neutrophilic infiltrates in the leptomeninges ( figure 2 ) ( 3,4 ) . the results confirmed n. meningitidis serogroup c as the etiologic agent causing acute meningitis and systemic infection . dohmh did not learn about the case until after it was too late to administer prophylaxis to close contacts , but no known secondary cases were identified . immunostaining of neisseria menigitidis in meninges of a man for whom invasive meningococcal disease was diagnosed after death ( case 2 ) , new york city , new york , usa . naphthol fast red substrate with light hematoxylin counterstain . suspecting and diagnosing meningococcal disease early is critical for initiating timely prophylaxis and preventing secondary cases . the 2 cases described here posed multiple challenges for diagnosing invasive meningococcal disease . in both cases , csf and blood samples , where n. meningitidis is typically identified , were unavailable . given the patients unattended deaths and delayed discovery , putrefaction had set in and tissue samples were fairly decomposed . additional bacteria were identified through real - time pcr or culture , further complicating the diagnosis for both cases . n. meningitidis is a fastidious organism that frequently undergoes autolysis , although it has been found in csf by pcr up to 10 days postmortem ( 5,6 ) . vitreous fluid has been described as a useful specimen for postmortem analysis because the eye is isolated and the fluid is less subjected to contamination or purification ( 7 ) . n. meningitidis has been isolated from vitreous humor of living patients , usually in conjunction with symptoms of meningococcal endopthalmitis ( 8,9 ) . we have demonstrated that postmortem diagnosis of n. meningitidis from vitreous humor and ihc staining 3 days after death is possible . this testing might prove a useful option for medical examiners and public health officials for diagnosing suspected meningococcal disease when blood and csf are unavailable for testing .\noutput:\n" }, { "from": "agent", "value": "we diagnosed invasive meningococcal disease by using immunohistochemical staining of embalmed tissue and pcr of vitreous humor from 2 men in new york city . because vitreous humor is less subject than other body fluids to putrefaction , it is a good material for postmortem analysis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: recently , a great advance was achieved in the understanding of pathogenesis of autoimmune diabetes , particularly regarding the molecular mechanism of pancreatic - cell apoptosis and immunological significance of - cell apoptosis . hence , it has been shown that pancreatic - cell death is important not only in the final effector phase of autoimmune type 1 diabetes ( 1,2 ) but also in the initiation of - cell autoimmunity ( 3,4 ) . such progress was mostly achieved by employing murine models of autoimmune diabetes because application of most essential genetic manipulation or immunological intervention is possible only in animal models . murine autoimmune diabetes models and human type 1 diabetes have many common characteristics such as the presence of insulitis , requirement for specific mhc haplotypes and autoimmune responses to autoantigens including glutamic acid decarboxylase ( gad ) . thus , many recent progress obtained employing murine autoimmune diabetes models would be applicable to human type 1 diabetes , implying important therapeutic potential . autoreactive t lymphocytes are the most important effector cells in murine autoimmune diabetes ( 5 - 7 ) , and probably in human type 1 diabetes . they will ultimately induce apoptosis of - islet cells in murine autoimmune diabetes ( 8,9 ) , while apoptosis of pancreatic - cells in human type 1 diabetes has not been demonstrated because of the difficulty in procuring human pancreatic tissue and inability to synchronize disease process in human type 1 diabetes . we have shown that ifn / tnf synergism is responsible for murine pancreatic - cell apoptosis both in vitro and in vivo ( 2 ) , which was critically dependent on stat1 activation by ifn ( 1 ) . in vivo role of stat1 activation by ifnother death effector molecules such as fas ligand ( fasl ) might be an effector molecule for a small number of autoreactive lymphocytes ( 10 ) but not for the majority of final death effector cells ( 9,11 ) . ifn appears to sensitize otherwise resistant pancreatic islet cells or insulinoma cells to tnf - mediated apoptosis by activating stat1 / irf - 1 signal pathway ( 2 ) . most such pancreatic - cell death and signal pathways were studied in murine autoimmune diabetes models . such findings might also be relevant in human type 1 diabetes also . in an effort to elucidate the possible mechanism of human pancreatic islet cell apoptosis leading to human type 1 diabetes , we investigated if similar cytokine synergism could induce apoptosis of human pancreatic islet cells and similar signal molecules are induced in them . human pancreatic islets were obtained from brain - dead patients between 1998 and 2002 at samsung medical center , using a modification of the automated method for human islet isolation ( 12 ) . briefly , 350 ml of hank 's buffered salt solution ( hbss ) containing 9.1 mol / l collagenase solution ( liberase , boehringer - mannheim , mannheim , germany ) was injected through the pancreatic duct after cannulation . the pancreas was loaded into a stainless steel digestion chamber , and islets were separated during a continuous digestion process for 30 ~ 45 min . during the recirculation phase ( flow rate , 85 ml / min ) , intrachamber temperature was increased at a rate of 2 / min by the passage of the solution through a stainless steel coil immersed in a water bath ( 50 ) . the chamber containing the distended pancreas was gently agitated and samples were taken every 2 min to monitor digestion . after 20 ~ 30 min of recirculation , digestion was stopped by dilution in 400 ml / min ice - cold hbss . in this phase , the digested tissue was rapidly collected in sterile bottles containing 200 ml fcs . purification of the islets was carried out over discontinuous euro - ficoll gradients ( 1.108 , 1.096 , 1.037 and hbss ) . purified islets were then washed twice , evaluated for purity , and counted after dithizone ( sigma , st . the pellet was resuspended in 3 ml warm 53.7 mol / l trypsin - 3 mmol / l edta . after incubation at 37 for 5 min and pipetting for 2 ~ 3 min , islets became invisible . then , cells were washed with warm rpmi - 10 % fcs at 1,500 rpm for 5 min . single islet cells were frozen in liquid nitrogen until use . at the time of assays , single islet cells were thawed and 1.410 cells were plated per single well of 96 - well plates . viability of the islet cells after thawing was above 90 % , as judged by trypan blue staining and acridine orange / propidium iodide staining . isolated human pancreatic islet cells were grown in dmem containing 15 % fbs , 2 mm glutamine , and penicillin - streptomycin ( gibco - brl , gaithersburg , md ) . recombinant human tnf and recombinant human il - 1 were purchased from r & d systems ( minneapolis , mn ) . louis , mo ) unless stated otherwise . cells ( 210 / well for human single islet cells ) were seeded in 96 - well microtiter plates and treated with various combinations of cytokines for the indicated time periods . the optimal concentrations of cytokines for the cytotoxic action were 1,000 u / ml for ifn , 10 ng / ml for tnf , and 17.5 ng / ml for il - 1 . after cytokine treatment , the medium was removed and 3 - [ 4,5 - dimethylthiazol -2-yl ] -2,5-diphenyltetrazolium bromide ( mtt , 0.5 mg / ml ) was added followed by incubation at 37 for 2 hr in co2 incubator . after a brief centrifugation , supernatant was carefully removed and dmso was added . after insoluble crystals were completely dissolved , absorbance at 540 nm was measured using thermomax microplate reader ( molecular devices , sunny vale , ca ) . morphological changes in the nuclear chromatin of cells undergoing apoptosis were detected by staining with 2.5 g / ml of dna - binding bisbenzimide hoe33342 fluorochrome ( calbiochem , san diego , ca ) , followed by an examination on a fluorescence microscope . for transmission electron microscopy , cells were fixed in 4 % glutaraldehyde / 1 % paraformaldehyde / 0.2 m phosphate ( ph 7.2 ) at 4 for 2 hr . after two washes in 0.2 m phosphate , the cell pellets were postfixed with 2 % oso4 in the same buffer for 30 min . the pellets were dehydrated in ethanol and then in 100 % propylene oxide , followed by embedding at 37 overnight and 60 for another 3 days . ultrafine sections were cut and examined on an electron microscope ( hitachi h7100 , 75 kv ) . cells were lysed in triple - detergent lysis buffer ( 50 mm tris - cl , ph 8.0 , 150 mm nacl , 0.02 % sodium azide , 0.1 % sds , 1 % np - 40 , 0.5 % sodium deoxycholate , 1 mm pmsf ) . an equal amount of protein for each sample was separated by 10 % or 12 % sds - page and transferred to hybond ecl nitrocellulose membrane ( ge healthcare life sciences , buckinghamshire , uk ) . after blocking with 5 % skim milk , the membranes were sequentially incubated with one of the primary antibodies ( rabbit anti - mouse irf - 1 , santa cruz ; rabbit anti - phospho - stat1 , new england biolabs , ipswich , ma ) and then hrp - conjugated secondary antibodies ( anti - rabbit igg , ge healthcare life sciences , buckinghamshire , uk ) , followed by ecl detection ( ge healthcare life sciences , buckinghamshire , uk ) . human pancreatic islets were obtained from brain - dead patients between 1998 and 2002 at samsung medical center , using a modification of the automated method for human islet isolation ( 12 ) . briefly , 350 ml of hank 's buffered salt solution ( hbss ) containing 9.1 mol / l collagenase solution ( liberase , boehringer - mannheim , mannheim , germany ) was injected through the pancreatic duct after cannulation . the pancreas was loaded into a stainless steel digestion chamber , and islets were separated during a continuous digestion process for 30 ~ 45 min . during the recirculation phase ( flow rate , 85 ml / min ) , intrachamber temperature was increased at a rate of 2 / min by the passage of the solution through a stainless steel coil immersed in a water bath ( 50 ) . the chamber containing the distended pancreas was gently agitated and samples were taken every 2 min to monitor digestion . after 20 ~ 30 min of recirculation , digestion was stopped by dilution in 400 ml / min ice - cold hbss . in this phase , the digested tissue was rapidly collected in sterile bottles containing 200 ml fcs . purification of the islets was carried out over discontinuous euro - ficoll gradients ( 1.108 , 1.096 , 1.037 and hbss ) . purified islets were then washed twice , evaluated for purity , and counted after dithizone ( sigma , st . the pellet was resuspended in 3 ml warm 53.7 mol / l trypsin - 3 mmol / l edta . after incubation at 37 for 5 min and pipetting for 2 ~ 3 min , islets became invisible . then , cells were washed with warm rpmi - 10 % fcs at 1,500 rpm for 5 min . single islet cells were frozen in liquid nitrogen until use . at the time of assays , single islet cells were thawed and 1.410 cells were plated per single well of 96 - well plates . viability of the islet cells after thawing was above 90 % , as judged by trypan blue staining and acridine orange / propidium iodide staining . isolated human pancreatic islet cells were grown in dmem containing 15 % fbs , 2 mm glutamine , and penicillin - streptomycin ( gibco - brl , gaithersburg , md ) . recombinant human tnf and recombinant human il - 1 were purchased from r & d systems ( minneapolis , mn ) . cells ( 210 / well for human single islet cells ) were seeded in 96 - well microtiter plates and treated with various combinations of cytokines for the indicated time periods . the optimal concentrations of cytokines for the cytotoxic action were 1,000 u / ml for ifn , 10 ng / ml for tnf , and 17.5 ng / ml for il - 1 . after cytokine treatment , the medium was removed and 3 - [ 4,5 - dimethylthiazol -2-yl ] -2,5-diphenyltetrazolium bromide ( mtt , 0.5 mg / ml ) was added followed by incubation at 37 for 2 hr in co2 incubator . after a brief centrifugation , supernatant was carefully removed and dmso was added . after insoluble crystals were completely dissolved , absorbance at 540 nm was measured using thermomax microplate reader ( molecular devices , sunny vale , ca ) . morphological changes in the nuclear chromatin of cells undergoing apoptosis were detected by staining with 2.5 g / ml of dna - binding bisbenzimide hoe33342 fluorochrome ( calbiochem , san diego , ca ) , followed by an examination on a fluorescence microscope . for transmission electron microscopy , cells were fixed in 4 % glutaraldehyde / 1 % paraformaldehyde / 0.2 m phosphate ( ph 7.2 ) at 4 for 2 hr . after two washes in 0.2 m phosphate , the cell pellets were postfixed with 2 % oso4 in the same buffer for 30 min . the pellets were dehydrated in ethanol and then in 100 % propylene oxide , followed by embedding at 37 overnight and 60 for another 3 days . ultrafine sections were cut and examined on an electron microscope ( hitachi h7100 , 75 kv ) . cells were lysed in triple - detergent lysis buffer ( 50 mm tris - cl , ph 8.0 , 150 mm nacl , 0.02 % sodium azide , 0.1 % sds , 1 % np - 40 , 0.5 % sodium deoxycholate , 1 mm pmsf ) . an equal amount of protein for each sample was separated by 10 % or 12 % sds - page and transferred to hybond ecl nitrocellulose membrane ( ge healthcare life sciences , buckinghamshire , uk ) . after blocking with 5 % skim milk , the membranes were sequentially incubated with one of the primary antibodies ( rabbit anti - mouse irf - 1 , santa cruz ; rabbit anti - phospho - stat1 , new england biolabs , ipswich , ma ) and then hrp - conjugated secondary antibodies ( anti - rabbit igg , ge healthcare life sciences , buckinghamshire , uk ) , followed by ecl detection ( ge healthcare life sciences , buckinghamshire , uk ) . treatment of single human islet cells with cytokines disclosed that combination of ifn , tnf and il - 1 induced significant death after 5 days of incubation . when the effect of individual cytokine was studied , a combination of ifn and tnf induced death of human islet cells while single cytokine did not exert significant cytotoxicity on human islet cells ( fig . the addition of il - 1 to the ifn / tnf combination had only a minor effect on islet cell viability . our results showing death of human islet cells by the triple combination of ifn , tnf and il - 1 is similar to previous reports by others employing human islet cells ( 13 - 16 ) . percent death of human islet cells by the cytokine combination in this investigation was similar to a previous report ( 13 ) , and was smaller than that of murine islet cells by the similar cytokine combination even after prolonged incubation for 5 days ( 2 ) . most of the death of human islet cells by the triple combination could be explained by ifn / tnf combination because the addition of il - 1 to the ifn / tnf combination increased human islet cell death only to a small degree , consistent with a previous paper ( 13 ) . hoechst 33342 staining and electron microscopic examination showed that the death of human islet cells by ifn / tnf combination was a typical apoptosis characterized by nuclear condensation and fragmentation with preserved plasma membrane integrity ( fig . these results are similar to previous reports showing nuclear condensation or tunel nuclei after cytokine treatment of human islet cells ( 15,16 ) . next we asked if ifn activates stat1 and induces irf - 1 which has been reported to be important for induction of tnf susceptibility in otherwise resistant murine islet cells or cancer cells ( 2,17 ) . immunoblot analysis using antibody to phosphorylated stat1 showed that stat1 became activated 30 min after ifn treatment , similar to murine insulinoma cells ( 2 ) ( fig . irf - 1 was also induced by ifn treatment of human islet cells for 48 hrs again similar to murine insulinoma cells suggesting that stat1 activation and irf - 1 induction by ifn may sensitize human islet cells to tnf - induced apoptosis , similar to the case of murine islet cell death by ifn / tnf synergism ( 2 ) ( fig . these results were similar to our previous study using murine islet / insulinoma cells and suggests the possibility that intracellular signal activated by ifn may sensitize otherwise resistant human pancreatic islet cells to tnf - induced apoptosis , which could not be proved because of shortage of human islet cells , the absence of immortalized human islet cells and unavailability of genetic manipulation system . a recent paper has shown that bim , a bh3 - only proapoptotic bcl - 2 family member , is induced in human islets or rat islet cells after treatment with ifn + tnf which plays an important role in - cell death by ifn + tnf synergism ( 18 ) . in that model , bim induction was attributed to ifn - induced activation of stat1 which was bound to bim promoter ( 18 ) . while detailed biochemical and cellular mechanism of human islet cell death by cytokines could not be investigated further because of limited availability of human islets for diabetes research , our results suggest that the death of human islet cells is basically similar to that of murine islet cells .\noutput:\n" }, { "from": "agent", "value": "fasl , perforin , tnf , il - 1 and no have been considered as effector molecule ( s ) leading to - cell death in autoimmune diabetes . however , the real culprit ( s ) of - cell destruction have long been elusive despite intense investigation . previously we have suggested ifn / tnf synergism as the final effector molecules in autoimmune diabetes of nod mice . a combination of ifn and tnf but neither cytokine alone , induced classical caspase - dependent apoptosis in murine insulinoma and pancreatic islet cells . ifn treatment conferred susceptibility to tnf - induced apoptosis on otherwise resistant murine insulinoma cells by stat1 activation followed by irf - 1 induction . here we report that ifn / tnf synergism induces apoptosis of human pancreatic islet cells . we also observed stat1 activation followed by irf - 1 induction by ifn treatment in human islet cells . taken together , we suggest that ifn / tnf synergism could be involved in human islet cell death in type 1 diabetes , similar to murine type 1 diabetes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: gingival fibromatosis is a bizarre condition causing aesthetic , functional , psychological , and masticatory disturbance . it is characterized by progressive enlargement of the gingiva caused by an increase in the sub - epithelial connective tissue elements . causes of this enlargement are varied such as plaque accumulation , poor oral hygiene , inadequate nutrition , or hormonal stimulation . it may be related to long term intake of certain drugs such as nifedipine , phenytoin . it is also seen in several blood dyscrasias , e.g. leukemia , thrombocytopenia , or thrombocytopathy . idiopathic gingival fibromatosis is a rare hereditary condition ( 1 in 750,000 people ) characterized by a slow , progressive increase in the gingiva . it is also known as gingival elephantiasis , hereditary gingival hyperplasia , and gingival hypertrophy . this condition is generally diagnosed alone or occasionally in association with a number of syndromes , such as zimmerman laband , rutherfold and ramon syndrome ; juvenile hyaline fibromatosis ; or juvenile hyalinosis . isolated cases of gingival fibromatosis with amelogenesis imperfecta and aggressive periodontitis have also been reported . we report a case of idiopathic gingival fibromatosis with aggressive periodontitis and without any associated systemic findings , along with its management . a 30 - year - old female patient reported to the outpatient department of oral diagnosis with a complaint of recurrent swelling all over the gums since 2 years , which was gradual in onset and increased in size since 2 months . along with this , there was difficulty in mastication , bleeding gums while brushing the teeth and bad breadth since 2 months . patient reported similar swelling 2 years ago , for which surgical management in form of gingivectomy was carried out . family history was also void of any genetic disorders . on extra - oral examination , the patient had incompetent lips and convex profile . there was mild asymmetry of the face with fullness over both right and left side of face . single , left submandibular lymph node was palpable , which was tender , soft and movable . intra - oral examination revealed massive generalized , diffuse , nodular enlargement of the gingiva involving both maxillary and mandibular arch [ figure 1 ] . grade iii mobility was seen with 17 , 25 , 26 , 31 , 32 , 35 , 37 , 38 , 41 , 42 and grade ii mobility was observed with 34 and 43 . bleeding on probing and pus discharge was seen in association with majority of teeth . posterior teeth were barely visible as the enlarged gingiva covered occlusal 1/3 of crown [ figures 2 and 3 ] . based upon clinical features , a provisional diagnosis of chronic inflammatory generalized gingivitis with advanced periodontitis was made . intra - oral photograph showing upper and lower arch intra - oral photograph showing upper right and left posterior teeth intra - oral photograph showing lower right and left posterior teeth radiographic examination revealed presence of all permanent teeth except 16 and 36 and severe generalized vertical and horizontal bone loss in maxillary and mandibular posterior teeth . panoramic radiograph showing generalized bone loss blood chemistry was nonsignificant except for mild lymphocytosis and low hemoglobin level ( 9 g / dl ) . connective tissue showed collagen fibers arranged in bundles and coalescing pattern . marked chronic inflammatory cells were present [ figure 5 ] . photomicrograph showing elongated rete ridges , collagen fibers arranged in bundles and chronic inflammatory infiltrate ( h and e , 10 ) on the basis of medical , family , drug history , clinical , radiographic and histopathological findings , a final diagnosis of recurrent idiopathic fibromatosis with aggressive periodontitis was given . treatment plan included oral prophylaxis followed tetracycline irrigation and administration of chlorhexidine mouth wash and extraction of grade iii mobile teeth . gingival fibromatosis has been associated with a variety of factors , including medications , inflammation and systemic disorders . hereditary gingival fibromatosis , as an iatrogenic gingival hyperplasia associated with medications such as nifedipine , phenytoin , verapamil and cyclosporine ; or may be idiopathic . these includes an increase in proliferation of resident tissue fibroblasts , a reduced level of metalloproteinases synthesis ( matrix metalloproteinases - 1 and matrix metalloproteinase - 2 ) , resulting in low levels of extracellular matrix - degrading , an increase in collagen type i production , heat - shock protein 47 production , and other extracellular matrix components . it is usually noticed during or after eruption of permanent dentition and occasionally during the eruption of the deciduous dentition . the enlargement is usually prominent on the labial and buccal surface of the gingiva , occasionally palatal and lingual surfaces are also involved . severity varies from minimal enlargement of free gingiva to complete submersion of crown of the teeth . pain is not the common symptom and bleeding is rare to occur unless underlying inflammation is present . at first , the gingiva is smooth and finely stippled , but with age they become coarser and may throw up papillary projection . labial enlargement leads to an open lip posture and mouth breathing , which in turn leads to further enlargement . the enlargement creates conditions favorable for the accumulation of plaque and material alba by accentuating the depth of the gingival sulci . idiopathic gingival enlargement is differentiated from chronic inflammatory hyperplasia by the absence of reddening of papillae , no loss of stippling and absence of pitting on pressure . the clinical appraisal of the patient and history of drug intake will aid in differential diagnosis . histological features of gingival fibromatosis have been focused on the connective tissue alterations , which shows an increased amount of collagen fiber bundles running in all direction associated with few fibroblast and the epithelium shows elongated rete pegs . the treatment of choice in this condition is gingivectomy / gingivoplasty to satisfy patient 's aesthetic demands . however , considering the recurrence of the lesion , radical treatment with extraction of grade iii mobile teeth and gingivectomy was planned in our patient . because the lesion has tendency to recur following repeated gingivectomy procedure , patient and familythis case highlights the unusual coexistence of nonsyndromic idiopathic gingival fibromatosis with generalized aggressive periodontitis . however , further research is needed to establish a syndromic association between the two conditions based on genetic evaluation and linkage studies , to improve prognosis if possible .\noutput:\n" }, { "from": "agent", "value": "gingival fibromatosis is an enlargement of the gingival tissue , which may be localized or generalized , characterized by hypertrophy and proliferation of the connective tissue , predominantly type i collagen , with occasional presence of an increased number of cells , supposedly fibroblasts . gingival fibromatosis occurs more commonly as a side - effect of systemic drugs , such as phenytoin , cyclosporine , nifedipine , or due to hereditary factors . however , in some cases , it is idiopathic . we report one such case in 30 - year - old - female who presented with a complaint of swelling of gums since 2 months . this case appears to be of special interest because of the recurrent nature of gingival enlargement along with excessive osseous destruction ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the indications for our approach were as follows : ( 1 ) isolated pcl avulsion fracture ; and ( 2 ) posterior tibial sag present at 90 of knee flexion . intra - articular lesions except pcl avulsion fracture were excluded using preoperative magnetic resonance image because of posteromedial approach and the consequential prone position . a c - arm device was used to avoid the penetration of growth plate by the anchors in pediatric or adolescent patients . patients were placed in the prone position , with the knee flexed 20 to 30 . an oblique incision of 10 cm was made between semitendinosus tendon and medial head of the gastrocnemius ( fig . the medial head of the gastrocnemius was held laterally to expose the posterior capsule of the knee joint . capsulotomy with an l - shaped incision was made longitudinally and then extended laterally to expose the fracture site ( fig . after debridement of fracture site , 2 suture based anchors ( 3.5 mm ; biomet sports medicine , warsaw , in , usa ) were inserted into the superomedial and superolateral region of the fracture site . each suture limb from the proximal row was placed through the hole at the end of the push - lock device ( 3.5 mm ; bio - pushlock , arthrex inc . , naples , fl , usa ) . pilot holes for the push - lock device were created using a punch just inferior to the distal edge of the fracture site . after the device was fully engaged in the pilot hole , the sutures were cut . the use of a knotless anchor provides a compressive force and consequently fixes the reduced avulsion fragment strongly to the fracture bed ( fig . if the patients were children , the anchors were inserted so as not to penetrate a physeal plate . a well - padded plaster splint was applied to the knee at 5 to 10 of flexion . on the first day , after surgery , the drain was removed and patients were encouraged to start quadriceps muscle strengthening exercise and begin non - weight bearing walking using crutches . after 2 weeks , protected range of motion exercise was started and partial weight bearing ambulation using crutches was permitted with locked brace in full extension . six weeks later , the brace was unlocked and the patients began full weight bearing ambulation . at 8 weeks , the brace was removed and patients were encouraged to increase activity gradually . a 20 - year - old man presented with a right knee injury resulting from a motor vehicle accident . clinical examination revealed a swollen knee , limited range of motion and posterior tibial sag at 90 on knee flexion . the knee range of motion was 135 with a flexion 135 and flexion contracture 0 after 2 weeks postoperatively . the patient was able to return to his usual daily activities after postoperative 6 months ( fig .2 ) . a 13 - year - old boy presented with left knee injury resulting from a fall . clinical examination revealed hemarthrosis of the knee , limited range of motion , and posterior tibial sag . the knee range of motion was 140 with flexion 140 and flexion contracture 0 after 4 weeks postoperative . a well - padded plaster splint was applied to the knee at 5 to 10 of flexion . on the first day , after surgery , the drain was removed and patients were encouraged to start quadriceps muscle strengthening exercise and begin non - weight bearing walking using crutches . after 2 weeks , protected range of motion exercise was started and partial weight bearing ambulation using crutches was permitted with locked brace in full extension . six weeks later , the brace was unlocked and the patients began full weight bearing ambulation . at 8 weeks , the brace was removed and patients were encouraged to increase activity gradually . a 20 - year - old man presented with a right knee injury resulting from a motor vehicle accident . clinical examination revealed a swollen knee , limited range of motion and posterior tibial sag at 90 on knee flexion . the knee range of motion was 135 with a flexion 135 and flexion contracture 0 after 2 weeks postoperatively . the patient was able to return to his usual daily activities after postoperative 6 months ( fig . a 13 - year - old boy presented with left knee injury resulting from a fall . clinical examination revealed hemarthrosis of the knee , limited range of motion , and posterior tibial sag . the knee range of motion was 140 with flexion 140 and flexion contracture 0 after 4 weeks postoperative . currently , open reduction or arthroscopic fixation is more commonly used in treatment of displaced pcl tibial bony avulsion .3456 ) the latter has both advantages and disadvantages . since the site of attachment of the pcl to the tibia is located deep within the posterior tibial plateau , multiple arthroscopic sutures and tunnels are required , making the procedure more challenging and difficult . furthermore , some authors reported that arthroscopic fixation using suspensory device needs a sizeable drill hole that may break thinner bone fragments .9 ) open reduction can be performed with a traditional s - shaped approach , but this incision is associated with injury to adjacent neurovascular structures . in contrast , we used a less invasive posteromedial approach , which had several advantages , including exposure of the posterior capsule through the gap between the medial head of the gastrocnemius and the semitendinosus muscle . with the approach in this study , it is possible to minimize risks of damage to vessels and nerves , as well as providing satisfactory exposure of the fracture site . similar methods using posteromedial approach with suture anchors are previously reported .6 ) these studies used 2 suture anchors and fixed bony fragment by knotting with the sutures of 2 suture anchors . the most important advantage of the present suture bridge fixation technique with posteromedial incision , is its indication for use regardless of the thickness , size , and comminution of bony fragment . this technique is similar to the double - row , trans - osseous equivalent or suture bridge techniques for rotator cuff repair or internal reduction and fixation of greater tubercle fractures of the humerus . it allows for a simple reproducible anatomic reduction and compression of the fracture fragment , even though the fragment is small or comminuted . furthermore , suture anchor is relatively small , as compared to other fixation devices , such as cannulated screws , wires , sutures , and absorbable screws . the anchor also offers strong purchase , and the attached suture can resist strong tension , resulting in reliable fixation . previous study on anterior cruciate ligament avulsion fracture , reported that suture bridge construct provides superior fixation with regard to ultimate load , as compared with standard screw fixation and suture fixation in biomechanical analysis of suture bridge fixation for tibial eminence fractures .10 ) similarly , the suture bridge mattress fixation in this study may provide enough ultimate load and compressive force to the avulsed fragment and thus maximize the surface area for bony healing . furthermore , there is no risk of causing comminution . in conclusion , the results of the study indicated that the posteromedial approach , combined with suture anchors , is a suitable treatment for isolated tibial avulsion fractures of the pcl .\noutput:\n" }, { "from": "agent", "value": "we presented a surgical technique including a suture bridge technique with relatively small incision for the reduction and fixation of posterior ligament avulsion fractures . a suture anchor was used to hold the avulsed fragment and a knotless anchor was used to continuously compress the bony fragment into the fracture site , thereby maintaining reduction during healing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: relevant english - language articles were identified by searching the medline database ( national library of medicine , bethesda , md ) from 1966 to may 2010 for prospective cohort studies of intake of ssbs ( soft drinks , carbonated soft drinks , fruitades , fruit drinks , sports drinks , energy and vitamin water drinks , sweetened iced tea , punch , cordials , squashes , and lemonade ) and risk of metabolic syndrome and type 2 diabetes in adults . key words such as soda , soda - pop , and sugar - sweetened beverage combined with diabetes , type 2 diabetes , and metabolic syndrome were used in the primary search strategy and in a subsequent medical subheading ( mesh ) terms search . because of the high potential for intractable confounding and reverse causation , cross - sectional studies were excluded . we did not consider short - term experimental studies because they are not well - suited to capture long - term patterns , but rather provide important insight into potential underlying biological mechanisms . our literature search identified 15 studies with metabolic syndrome as an end point and 136 studies with type 2 diabetes as an end point . an additional study of type 2 diabetes by de koning and colleagues was identified via personal communication . the criteria for inclusion of studies in our meta - analysis included prospective cohort design , end points of metabolic syndrome or type 2 diabetes , presentation of a relative risk ( rr ) and associated measure of variance ( se or 95 % ci ) , definition , and metric for ssb intake and description of adjustment for potential confounders . after application of these criteria , three studies of metabolic syndrome ( 1113 ) and eight studies of type 2 diabetes ( 11,1419 ) were retained for our meta - analysis . coefficients and ses were obtained from nettleton et al . ( 11 ) and bazzano et al . ( 18 ) via correspondence . data extraction was independently performed by v.s.m . and f.b.h . , and there were no differences in extracted information to yield effect estimates comparing extreme quantiles of intake , most often comparing none or 1 serving / month with 1 or 2 servings / day . ( 19 ) in which the highest category of intake was 238 - oz servings / week , montonen et al . ( 14 ) in which the comparison between median intakes of the first and fourth quartiles was 0 vs. 143 g / day ( note : one 12 - oz serving = 336 g ) , and paynter et al . ( 15 ) in which 18 - oz serving / day was the reference category . unless otherwise specified a standard serving size of 12 oz was the metric used . a total of eight studies with nine data points were included in our meta - analysis of type 2 diabetes ( 11,1419 ) and three studies were included in our meta - analysis of metabolic syndrome ( 1113 ) . stata ( version 9.0 ; statacorp , college station , tx ) was used to obtain summary rrs using both random - and fixed - effects models calculated from the logarithm of the rrs and corresponding 95 % cis of the individual studies . we primarily used a random - effects model because it incorporates both a within - study and an additive between - studies component of variance , is the accepted method to use in the presence of between - study heterogeneity , and is generally considered the more conservative method ( 20 ) . significance of heterogeneity of study results was evaluated using the cochrane q test , which has somewhat limited sensitivity , and further by the i statistic , which represents the percentage of total variation across studies that is due to between - study heterogeneity ( 21 ) . because adjustment for total energy intake and duration of follow - up could be important sources of heterogeneity , we conducted independent meta - regressions using adjustment for energy and study duration as predictors of effect . because the association between ssb consumption and these outcomes is likely to be mediated in part by an increase in overall energy intake or adiposity , adjusting for these factors is expected to attenuate the effect . where possible we used estimates that were not adjusted for energy intake or adiposity and conducted sensitivity analysis by removing studies that only provided energy - or adiposity - adjusted estimates . the potential for publication bias was evaluated using begg and egger tests and visual inspection of the begg funnel plot ( 22,23 ) . relevant english - language articles were identified by searching the medline database ( national library of medicine , bethesda , md ) from 1966 to may 2010 for prospective cohort studies of intake of ssbs ( soft drinks , carbonated soft drinks , fruitades , fruit drinks , sports drinks , energy and vitamin water drinks , sweetened iced tea , punch , cordials , squashes , and lemonade ) and risk of metabolic syndrome and type 2 diabetes in adults . key words such as soda , soda - pop , and sugar - sweetened beverage combined with diabetes , type 2 diabetes , and metabolic syndrome were used in the primary search strategy and in a subsequent medical subheading ( mesh ) terms search . because of the high potential for intractable confounding and reverse causation , cross - sectional studies were excluded . we did not consider short - term experimental studies because they are not well - suited to capture long - term patterns , but rather provide important insight into potential underlying biological mechanisms . our literature search identified 15 studies with metabolic syndrome as an end point and 136 studies with type 2 diabetes as an end point . an additional study of type 2 diabetes by de koning and colleagues was identified via personal communication . the criteria for inclusion of studies in our meta - analysis included prospective cohort design , end points of metabolic syndrome or type 2 diabetes , presentation of a relative risk ( rr ) and associated measure of variance ( se or 95 % ci ) , definition , and metric for ssb intake and description of adjustment for potential confounders . after application of these criteria , three studies of metabolic syndrome ( 1113 ) and eight studies of type 2 diabetes ( 11,1419 ) were retained for our meta - analysis . coefficients and ses were obtained from nettleton et al . ( 11 ) and bazzano et al . ( 18 ) via correspondence . data extraction was independently performed by v.s.m . and f.b.h . , and there were no differences in extracted information to yield effect estimates comparing extreme quantiles of intake , most often comparing none or 1 serving / month with 1 or 2 servings / day . ( 19 ) in which the highest category of intake was 238 - oz servings / week , montonen et al . ( 14 ) in which the comparison between median intakes of the first and fourth quartiles was 0 vs. 143 g / day ( note : one 12 - oz serving = 336 g ) , and paynter et al . ( 15 ) in which 18 - oz serving / day was the reference category . unless otherwise specified a standard serving size of 12 oz was the metric useda total of eight studies with nine data points were included in our meta - analysis of type 2 diabetes ( 11,1419 ) and three studies were included in our meta - analysis of metabolic syndrome ( 1113 ) . stata ( version 9.0 ; statacorp , college station , tx ) was used to obtain summary rrs using both random - and fixed - effects models calculated from the logarithm of the rrs and corresponding 95 % cis of the individual studies . we primarily used a random - effects model because it incorporates both a within - study and an additive between - studies component of variance , is the accepted method to use in the presence of between - study heterogeneity , and is generally considered the more conservative method ( 20 ) . significance of heterogeneity of study results was evaluated using the cochrane q test , which has somewhat limited sensitivity , and further by the i statistic , which represents the percentage of total variation across studies that is due to between - study heterogeneity ( 21 ) . because adjustment for total energy intake and duration of follow - up could be important sources of heterogeneity , we conducted independent meta - regressions using adjustment for energy and study duration as predictors of effect . because the association between ssb consumption and these outcomes is likely to be mediated in part by an increase in overall energy intake or adiposity , adjusting for these factors is expected to attenuate the effect . where possible we used estimates that were not adjusted for energy intake or adiposity and conducted sensitivity analysis by removing studies that only provided energy - or adiposity - adjusted estimates . the potential for publication bias was evaluated using begg and egger tests and visual inspection of the begg funnel plot ( 22,23 ) . characteristics of the prospective cohort studies included in our meta - analyses are shown in table 1 . three studies evaluated risk of metabolic syndrome ( 1113 ) and eight studies ( nine data points ) evaluated risk of type 2 diabetes ( 11,1419 ) . the cohorts included men and women of predominately white or black populations from the u.s . , adults from finland , and chinese adults from singapore , with duration of follow - up ranging from 4 to 20 years and number of participants ranging from 3,000 to 91,000 . the majority of studies used food frequency questionnaires ( ffqs ) to evaluate dietary intake and six studies ( seven data points ) ( 13 , 1517 , 19 ) provided effect estimates that were not adjusted for total energy or measures of adiposity . based on data from these studies , including 310,819 participants and 15,043 cases of type 2 diabetes , the pooled rr for type 2 diabetes was 1.26 ( 95 % ci 1.121.41 ) comparing extreme quantiles of ssb intake , illustrating an excess risk of 26 % associated with higher consumption of ssb compared with lower consumption ( fig .1 a ) . among three studies evaluating metabolic syndrome including 19,431 participants and 5,803 cases , the pooled rr was 1.20 ( 1.021.42 ) ( fig . pooled rr estimates from the fixed - effects model were 1.25 ( 1.171.32 ) and 1.17 ( 1.091.26 ) for type 2 diabetes and metabolic syndrome , respectively . results from a dose - response meta - analysis for type 2 diabetes risk per increase in 112 - oz serving of ssb / day were rr 1.25 ( 95 % ci 1.101.42 ) from the random - effects model and rr 1.15 ( 95 % ci 1.111.20 ) from the fixed - effects model ( not shown ) . ssb intake and risk of type 2 diabetes and metabolic syndrome aric , atherosclerosis risk in communities study ; bwhs , black women 's health study ; mesa , multi - ethnic study of atherosclerosis ; nhs , nurses ' health study . * national register confirmed by medical record . presence of one of the following : 1 ) fasting glucose 126 mg / dl , 2 ) nonfasting glucose 200 mg / dl , 3 ) current use of hypoglycemic medication , and 4 ) self - report physician diagnosis . self - report of physician diagnosis and supplemental questionnaire . confirmed self - report of physician diagnosis . presence of one of the following : 1 ) fasting glucose 126 mg / dl , 2 ) current use of hypoglycemic medications ; and 3 ) self - report physician diagnosis . metabolic syndrome diagnosed according to the modified national cholesterol education program adult treatment panel iii criteria / american heart association guidelines as the presence of three or more of the following : 1 ) waist circumference 102 ( men ) or 88 cm ( women ) , 2 ) triglycerides 150 mg / dl , 3 ) hdl cholesterol 40 ( men ) or 50 mg / dl ( women ) , 4 ) blood pressure 130/85 mmhg or antihypertensive treatment , and 5 ) fasting glucose 100 mg / dl or antihyperglycemic treatment / insulin . # metabolic syndrome diagnosed according to the modified national cholesterol education program adult treatment panel iii definition / american heart association guidelines as the presence of three or more of the following : 1 ) waist circumference 102 ( men ) or 88 cm ( women ) , 2 ) triglycerides 150 mg / dl , 3 ) hdl cholesterol 40 ( men ) or 50 mg / dl ( women ) , 4 ) blood pressure 135/85 mmhg or antihypertensive treatment , and 5 ) fasting glucose 100 mg / dl or antihyperglycemic treatment / insulin . * * includes diet and nondiet soft drinks . a : forrest plot of studies evaluating ssb consumption and risk of type 2 diabetes , comparing extreme quantiles of intake . b : forrest plot of studies evaluating ssb consumption and risk of metabolic syndrome comparing extreme quantiles of intake . although all studies except one ( 11 ) showed positive associations , there was significant heterogeneity among studies in both analyses ( for type 2 diabetes : i 66 % [ 95 % ci 3183 % ] , p value , test for homogeneity 0.003 ; for metabolic syndrome : 76 % [ 2293 % ] ; p value , test for homogeneity 0.01 ) . in general , larger studies with longer durations of follow - up tended to show stronger associations . among studies evaluating type 2 diabetes , ( 11 ) is both the shortest and among the smallest , and the only one to show an inverse although nonsignificant association ( 11 ) . removal of this study from our analysis only reduced heterogeneity slightly ( i 62 % [ 95 % ci 1782 % ] , p value , test for homogeneity 0.01 ) . ( 17 ) , which are longer and larger , show clearly significant positive associations . despite this , results from a meta - regression did not find duration of study to be a significant predictor of effect ( p = 0.84 ) . ( 14 ) , which shows a borderline significant positive association , has the fewest number of participants and considerably lower levels of intake relative to those of other studies ( median intake of ssb is 143 g / day in highest quartile of intake , where one 12 - oz serving is 336 g ) . removal of this study from our analysis did not reduce heterogeneity , which is to be expected , given its small percentage weight ( p value , test for homogeneity 0.002 ) . ( 16 ) , which is the largest and which used repeated measures of ssb intake , reported the strongest study - specific estimate . removal of this study from the pooled analysis reduced heterogeneity to borderline significance ( i 51 % [ 95 % ci 078 % ] ; p value , test for homogeneity 0.05 ) . tests for publication bias generally rely on the assumption that small studies ( large variance ) may be more prone to publication bias , compared with larger studies . visual inspection of the begg funnel plot ( supplementary fig . 1a and b , available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc10-1079/dc1 ) , whereby the se of log rr ( measure of study size ) from each study was plotted against the log rr ( treatment effect ) , showed symmetry about the plot , suggesting that publication bias is unlikely , although values for metabolic syndrome may not be particularly informative because of the small number of studies included in the analysis . studies with a large se and large effect may suggest the presence of a small - study effect ( the tendency for smaller studies in a meta - analysis to show larger treatment effects ) . results from the begg ( type 2 diabetes p = 0.75 ; metabolic syndrome p = 1.0 ) and egger ( type 2 diabetes p = 0.75 ; metabolic syndrome p = 0.72 ) tests also suggest that publication bias is unlikely . because the association between ssb consumption and risk of these disease outcomes is mediated in part by energy intake and adiposity , adjustment for these factors will tend to underestimate any effect . results from our sensitivity analysis in which energy - and adiposity - adjusted coefficients were excluded ( 11,14,18 ) showed a slight increase in risk of type 2 diabetes with a pooled rr of 1.28 ( 95 % ci 1.131.45 ) from the random - effects model and rr 1.25 ( 1.181.34 ) from the fixed - effects model . a greater magnitude of increase was noted in the dose - response meta - analysis when these studies ( 11,14,18 ) were excluded : rr 1.35 ( 1.141.59 ) and rr 1.18 ( 1.121.24 ) from the random and fixed - effects models , respectively . however , results from a meta - regression did not find adjustment for energy to be a significant predictor of effect ( p = 0.38 ) . sensitivity analysis was not possible for studies of metabolic syndrome because they are too few in number ; however , both studies that adjusted for these potential mediators of effect had marginal nonsignificant associations ( 11,12 ) , whereas the study that reported unadjusted estimates showed a strong positive association ( 13 ) . findings from our meta - analyses show a clear link between ssb consumption and risk of metabolic syndrome and type 2 diabetes . based on coefficients from three prospective cohort studies including 19,431 participants and 5,803 cases of metabolic syndrome , participants in the highest category of intake had a 20 % greater risk of developing metabolic syndrome than those in the lowest category of intake . for type 2 diabetes , based on data from eight prospective cohort studies ( nine data points ) , including 310,819 participants and 15,043 cases of type 2 diabetes , participants in the highest category of ssb intake had a 26 % greater risk of developing type 2 diabetes than participants in the lowest category of intake . because we compared extreme quantiles of ssb intake , most often none or 1 serving / month with 1 or 2 servings / day , categories of intake between studies were not standardized . therefore , it is possible that random misclassification somewhat attenuated the pooled estimate ; however , results were similar to the dose - response analysis , which used data from all categories . for those studies that did not define serving size , a standard serving of 12 oz was assumed , which may over - or underestimate empirical ssb intake levels but should not materially affect our results . indeed there is substantial variation in study design and exposure assessment , across studies , which may explain the large degree of between - study heterogeneity we observed . meta - analyses are inherently less robust than individual prospective cohort studies but are useful in providing an overall effect size , while giving larger studies and studies with less random variation greater weight than smaller studies . publication bias is always a potential concern in meta - analyses , but standard tests and visual inspection of funnel plots suggested no evidence of publication bias in our analysis . because our analysis compared only the top with the bottom categories , we did not use data from the intermediate categories . thus , the comparison of extreme categories was not statistically significant for the studies of montonen et al . ( women ) ( 15 ) , and bazzano et al . ( 18 ) , even though the overall tests for trend in these studies were significant . all studies included in our meta - analysis considered adjustment for potential confounding by various diet and lifestyle factors , and for most a positive association persisted , suggesting an independent effect of ssbs . however , residual confounding by unmeasured or imperfectly measured factors can not be ruled out . higher levels of ssb intake could be a marker of an overall unhealthy diet as they tend to cluster with factors such as higher intakes of saturated and trans fat and lower intake of fiber ( 12 ) . therefore , incomplete adjustment for various diet and lifestyle factors could overestimate the strength of the positive association between ssb intake and risk of metabolic syndrome and type 2 diabetes . however , consistency of results from different cohorts reduces the likelihood that residual confounding is responsible for the findings . longitudinal studies evaluating diet and chronic disease risk may also be prone to reverse causation , i.e. , individuals change their diet because of symptoms of subclinical disease or related weight gain , which could result in spurious associations ( 24 ) . although it is not possible to completely eliminate these factors , studies with longer durations of follow - up and repeated measures of dietary intake tend to be less prone to this process . in several studies , type 2 diabetes was assessed by self - report ; however , it has been shown in validation studies that self - report of type 2 diabetes is highly accurate according to medical record review ( 25 ) . the majority of studies used validated ffqs to measure ssb intake , which is the most robust method for estimating an individual 's average dietary intake compared with other assessment methods such as 24 - h diet recalls ( 26 ) . however , measurement error in dietary assessment is inevitable , but because the studies we considered are prospective in design , misclassification of ssb intake probably does not differ by case status . such nondifferential misclassification of exposure is likely to underestimate the true association between ssb intake and risk of these outcomes . ssbs are thought to lead to weight gain by virtue of their high added sugar content , low satiety potential and incomplete compensatory reduction in energy intake at subsequent meals after consumption of liquid calories , leading to positive energy balance ( 7,8 ) . although ssbs increase risk of metabolic syndrome and type 2 diabetes , in part because of their contribution to weight gain , an independent effect may also stem from the high levels of rapidly absorbable carbohydrates in the form of added sugars , which are used to flavor these beverages . ( 16 ) suggested that approximately half of the effects of ssbs on type 2 diabetes were mediated through obesity . in a recent study among 88,000 women followed for 24 years , those who consumed 2 ssbs / day had a 35 % greater risk of coronary heart disease compared with infrequent consumers after adjustment for other unhealthy lifestyle factors ( rr 1.35 [ 95 % ci 1.11.7 , ptrend 0.01 ) ( 27 ) . additional adjustment for potential mediating factors including bmi , total energy , and incident type 2 diabetes attenuated the associations , but they remained statistically significant , suggesting that the effect of ssbs is not entirely mediated by these factors . because ssbs have been shown to raise blood glucose and insulin concentrations rapidly and dramatically ( 28 ) and are often consumed in large amounts , they contribute to a high dietary glycemic load . high glycemic load diets are known to induce glucose intolerance and insulin resistance particularly among overweight individuals ( 9 ) and can increase levels of inflammatory biomarkers such as c - reactive protein , which are linked to type 2 diabetes risk ( 29 ) . findings from our cohortsindicate that a high dietary glycemic load also increases risk of developing cholesterol gallstone disease , which is associated with insulin resistance , metabolic syndrome , and type 2 diabetes ( 30 ) . endogenous compounds in ssbs , such as advanced glycation end products , produced during the process of caramelization in cola - type beverages may also affect pathophysiological pathways related to type 2 diabetes and metabolic syndrome ( 31 ) . ssbs may also increase risk indirectly by inducing alterations in taste preferences and diet quality , resulting from habitual consumption of highly sweetened beverages , which has also been noted for artificially sweetened beverages ( 5 ) . short - term experimental studies suggest that fructose , which is a constituent of both sucrose and high - fructose corn syrup in relatively equal parts , may exert particularly adverse metabolic effects compared with glucose . fructose is preferentially metabolized to lipid in the liver , leading to increased hepatic de novo lipogenesis , the development of high triglycerides , low hdl cholesterol , small , dense ldl , atherogenic dyslipidemia , and insulin resistance ( 32 ) . recent evidence has also shown that fructose consumption may promote accumulation of visceral adiposity or ectopic fat deposition ( 10 ) , two key features of a dysmetabolic state increasing risk of type 2 diabetes and cardiovascular disease ( 33 ) , despite no difference in weight gain between glucose and fructose conditions ( 10 ) . in contrast , some studies have shown greater satiety and lower total energy intake after intake of fructose - containing beverages compared with glucose beverages ( 34 ) . ( 35 ) found evidence of oxidative and inflammatory stress after intake of glucose but not fructose or orange juice . however , fructose has also been shown to increase blood pressure when administered acutely or when consumed as ssbs , an effect not observed with glucose administration or consumption of aspartame - sweetened beverages ( 36,37 ) . a number of prospective cohort studies have found positive associations between ssb consumption and incident hypertension ( 11,13 ) . fructose is also the only sugar able to increase blood uric acid concentrations , and ssb consumption has been linked to development of hyperuricemia ( serum uric acid level 7 mg / dl for men and 5.7 mg / dl for women ) ( 38 ) and gout ( 39 ) . men who consumed 2 ssbs / day had an 85 % greater risk of developing gout compared with infrequent consumers ( rr 1.85 [ 95 % ci 1.083.16 ] ; ptrend 0.001 for trend ) . no association was shown with diet soda . a recent randomized controlled trial among men in spain showed that high doses of fructose increased blood pressure and induced features of metabolic syndrome and that pharmacologically lowering uric acid levels prevented the increase in mean arterial blood pressure ( 40 ) . in summary , this meta - analysis has demonstrated that higher consumption of ssbs is significantly associated with development of metabolic syndrome and type 2 diabetes . it provides further support to limit consumption of these beverages in place of healthy alternatives such as water to reduce obesity - related chronic disease risk .\noutput:\n" }, { "from": "agent", "value": "objectiveconsumption of sugar - sweetened beverages ( ssbs ) , which include soft drinks , fruit drinks , iced tea , and energy and vitamin water drinks has risen across the globe . regular consumption of ssbs has been associated with weight gain and risk of overweight and obesity , but the role of ssbs in the development of related chronic metabolic diseases , such as metabolic syndrome and type 2 diabetes , has not been quantitatively reviewed.research design and methodswe searched the medline database up to may 2010 for prospective cohort studies of ssb intake and risk of metabolic syndrome and type 2 diabetes . we identified 11 studies ( three for metabolic syndrome and eight for type 2 diabetes ) for inclusion in a random - effects meta - analysis comparing ssb intake in the highest to lowest quantiles in relation to risk of metabolic syndrome and type 2 diabetes.resultsbased on data from these studies , including 310,819 participants and 15,043 cases of type 2 diabetes , individuals in the highest quantile of ssb intake ( most often 12 servings / day ) had a 26 % greater risk of developing type 2 diabetes than those in the lowest quantile ( none or < 1 serving / month ) ( relative risk [ rr ] 1.26 [ 95 % ci 1.121.41 ] ) . among studies evaluating metabolic syndrome , including 19,431 participants and 5,803 cases , the pooled rr was 1.20 [ 1.021.42 ] . conclusionsin addition to weight gain , higher consumption of ssbs is associated with development of metabolic syndrome and type 2 diabetes . these data provide empirical evidence that intake of ssbs should be limited to reduce obesity - related risk of chronic metabolic diseases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: neuronal activity results in focal changes in hemodynamics , metabolism , and blood oxygenation of associated brain areas . functional maps of cerebral blood flow ( cbf ) can be used to monitor hemodynamic changes in the healthy brain as well as alterations associated with cerebrovascular disease . positron emission tomography ( pet ) is capable of providing in vivo quantitative measures of cbf and has evolved to be considered the gold standard for studying cerebral hemodynamics . however , pet imaging involves the injection of radioactive tracers , which limits its repeatability and application in healthy volunteers . among other limitationsare low temporal and spatial resolution , low signal - to - noise ratio ( snr ) , as well as the requirement for a cyclotron . thus , magnetic resonance ( mr ) perfusion imaging , being widely available and having relatively high spatial and temporal resolution , is increasingly seen as an attractive alternative to pet . mr perfusion imaging is performed using dynamic susceptibility contrast ( dsc ) techniques or arterial spin labeling ( asl ) . dsc imaging has not been widely applied in human functional research due to the requirement of an exogenous contrast agent and limited temporal resolution . asl is based on the detection of magnetically labeled arterial blood water spins and has therefore been used with more success in functional mri ( fmri ) studies . pulsed asl methods such as proximal inversion with control for off - resonance effects ( picore ) , flow - sensitive alternating inversion recovery ( fair ) , quantitative imaging of perfusion using a single subtraction ( quipss i / ii ) , and quipss ii with thin - slice ti1 and periodic saturation ( q2tips ) have greatly facilitated perfusion - based fmri . the validation of mr perfusion measurements using various invasive and noninvasive methods has been a topic of considerable interest . walsh et al . compared cbf measured using continuous asl and radioactive microspheres using a rat model and found asl to underestimate cbf under high flow . on the other hand , based on radiotracer - enhanced quantitative autoradiography flow measurements in rats , ewing et al . concluded that cbf were overestimated by asl under ischemia . in healthy humans , stergaard et al . found a highly linear relationship between pet and dsc mr cbf measurements ( using gd - dtpa ) , consistent with the values reported in the literature . in healthy human subjects . quantitative cbf values of 68.19.5 and 26.75.0 ml / 100 g / min were measured for grey matter ( gm ) and white matter ( wm ) , respectively . in addition , grandin et al . reported a high correlation between dsc and pet cbf measurements under the effect of vasodilative pharmacological agents , with pet results having higher reproducibility . however , carroll and grandin found that gm cbf values were overestimated with dsc mr possibly due to sensitivity to the presence of large blood vessels . ye et al . reported a comparison of resting cbf using steady - state asl and pet and measured gm cbf of 64.12 and 67.13 ml / 100 g / min , respectively . the pet and asl measurements were not statistically different from one another and were both in good agreement with literature values . however , the wm asl cbf ( 23.8 ml / 100 g / min ) was 30 % lower compared to pet ( 33.7 ml / 100 g / min ) , the discrepancy being attributed to the arterial tagging time difference between gm and wm , specific to the quantitative model employed in this study . in epilepsypatients , liu et al . studied perfusion in the temporal lobe using the fair - prepared half - fourier single - shot turbo spin - echo ( haste ) technique and also found a statistically significant correlation between asl and pet data . a functional comparison involving pet and asl was first performed by zaini et al . using a simple finger - tapping task . however , the matching of spatial resolution and noise was not possible for pet and asl data . in a more recent study by feng et al . , another comparison of pet and fair fmri measurements of cbf changes was reported , using a single level of visual stimulation in healthy subjects . once again , results obtained by the two methods were very similar , with the pet cbf percent change being slightly higher than that of fair ( cbf of 38.79 % versus 36.95 % ) . notwithstanding the contributions of the above studies , several factors limit the scope and applicability of the existing studies . firstly , an accurate comparison of pet and fmri perfusion is challenging due to methodological differences . in particular , spatial resolution disparities lead to difficulties in accurate region - of - interest ( roi ) registration and partial - volume matching , which are critical for direct comparisons . secondly , both techniques are inherently sensitive to physiological variations , which reduce measurement reproducibility . carroll et al . measured interexam asl cbf variation in a single subject to be as high as 20 ml / 100 g / min in gm and 15 ml / 100 g / min in wm , while those observed with pet were 4 - 5 ml / 100 g / min . observed variations of up to 13 % for pet and 16 % for mr cbf measurements at rest in the same individual . as a result , high intersubject and interexam variability between pet and mr are expected , particularly in inexperienced volunteers scanned over several days . thirdly , past comparisons of cbf measurements were largely performed without functional stimulation , and for those within the fmri context , the impact of graded stimulus intensity has not been explored . finally , previous asl and pet cbf data were not always collected in similar environments . we were interested in evaluating the relative accuracy of the fair asl method for cbf measurements in comparison with pet . previous asl research has shown the accuracy of fair in determining cbf to be dependent on the transit delay and label width , which can be variable across subjects and experimental conditions . this has led to the introduction of techniques less sensitive to transit delay and bolus width , such as quipss ii , and their adoption by our group and others . however , the fair technique has been and continues to be used extensively in the literature as a well - established method for the investigation of functional hemodynamics . notably , some widely adopted and investigated biophysical models of the bold signal have been developed and validated based on cbf data using fair . thus , a dedicated assessment of the validity of fair for cbf measurement would be a highly valuable addition to our knowledge . in this study , we compare fair fmri measurements of cbf with those made using pet during graded levels of visual stimulation . in addition , we measured cbf changes induced by hypercapnia , which has been employed to explore global , activation - independent perfusion increases and applied to cross - subject calibrations of the bold response . also , over the course of our experiments , the conditions for asl and pet data collection were also closely matched and monitored . visual stimuli were generated using locally developed software ( glstim ) based on the opengl graphics library ( silicon graphics , mountain view , calif , usa ) . the baseline condition consisted of a uniform grey field , while the activation pattern was a yellow - blue radial checkerboard with 30 spokes and 6.5 rings of equal radial thickness , reversing contrast at 4 hz . the checkerboard contains both color and luminance contrast designed to produce robust local cbf increase in the primary visual cortex ( v1 ) . in an effort to maintain the subjects ' attention , a fixation task ( a small arrow randomly changing directions ) was present at the centre of the field of view ( fov ) throughout the scans . subjects were requested to continuously report the arrow direction by means of an mr - compatible mouse . the graded visual stimulation and hypercapnia schemes were matched to those previously employed in calibrated fmri studies of flow - metabolism coupling . in addition to the uniform grey - field reference condition , the subjects were presented with 4 graded levels of visual stimulation , ranging from 25 % to 100 % intensity , while inhaling atmospheric composition medical air supplied at 16 l / min . furthermore , mild hypercapnia ( induced using air mixture of 5:21:74 % co2 : o2 : n2 ) was used to study global cbf changes . both pet and asl scans included 6 sessions of 3 minutes , each consisting of one visual - respiratory condition played out continuously . each stimulation session was preceded and followed by a baseline condition ( figures 1 and 2 ) of 1 and 2 minutes , respectively . a total of 10 healthy human subjects ( 8 males , 2 females ) , aged 23.93.3 years , were imaged under the above six experimental conditions . informed consent was obtained from every subject prior to each pet and mri scanning session , with the experimental protocol being approved by the research ethics board of the montreal neurological institute ( mni , montreal , canada ) . in order to achieve maximal similarity between the pet and fmri experimental conditions , the sizes of the projected checkerboards were matched , as well as the lighting intensity at the two imaging locations . during the scans , subjects were asked to breathe through a nonrebreathing face mask , allowing control of the incoming air composition . subjects were immobilized with a foam headrest and head restraints . a nasal cannula connected to a capnometer was used to monitor end - tidal carbon dioxide ( etco2 ) and the respiratory rate , whereas the arterial oxygen saturation ( o2sat ) and the pulse rate were measured with a finger pulse oximeter . the stimulus was presented by an adjustable back - projection mirror mounted on the head coil . the mr scans were performed on a 1.5 t siemens magnetom vision system ( siemens , erlangen , germany ) . to optimize the snr of the functional data in the visual cortex , a transmit - receive surface coil placed near the occipital lobethus , prior to the functional scans , a surface - coil t1 - weighted ( t1w ) anatomical scan , acquired at a resolution of 112 mm , was used in slice selection and alignment of all functional data . however , as the surface - coil anatomical data has highly nonuniform intensity , registration to pet data using our local software was difficult . therefore , an additional high - resolution 111 mm t1w anatomical scan with a head coil was also acquired to facilitate the registration of pet and surface - coil mr data . we use the interleaved fair - bold echo - planar imaging sequence as implemented by hoge et al . in order to directly evaluate their measurements as well as to achieve simultaneous bold monitoring . furthermore , we selected imaging parameters to best enable replication of experimental conditions in previous fmri flow - metabolism studies . the fair inversion time and echo time ( te ) were 900 milliseconds and 20 milliseconds , respectively , while the bold te was 50 milliseconds . a 7 - mm thick single oblique slice parallel to the calcarine sulcus was acquired on a 6464 matrix with a 55 mm inplane voxel size . as seen in figure 1 , the repetition time of the sequence was 12 seconds , allowing acquisition of a total of 60 frames per 6 minutes run , 30 fair and 30 bold frames . of these 30 frames ,11 were excluded ( 1 minute postonset and postcessation of stimulation plus the first scan in the run ) to ensure that only data corresponding to the physiological steady - state response was examined . the chosen fair implementation minimizes errors related to the tagging slab arrival time and width through the use of a single - slice acquisition and a body coil inversion . in order to obtain an accurate masking location of v1 ( primary visual cortex ) , bold - based retinotopicmapping was performed in a separate session , using a visual stimulus composed of a thick black - and - white expanding ring , also designed using glstim . a total of 16 slices of 4 mm parallel to the calcarine sulcus were acquired using a bold sequence during 6 randomly ordered runs of a 6 - minute visual stimulation . the protocol for the pet experiments was adapted from previous pet studies aimed at reproducing mri results . the subjects were immobilized using a self - inflating foam headrest , which minimized motion during scans . as previously described , the o2sat level and pulse rate were monitored using a finger pulse - oxymeter , while a capnometer connected via a nasal cannula monitored the etco2 and the respiratory rate . in addition , a short indwelling catheter was placed by an anesthetist into the left radial artery for blood sampling and a more precise examination of blood gases . a three - way stop cock allowed for simultaneous automatic ( using a locally developed sampling system for blood activity measurement ) and manual ( for blood gases examination ) blood sample withdrawal . a fine needle catheter was placed into the antecubital vein of the right arm for injection of the isotope . pet images were acquired on an ecat exact hr ( cti / siemens , knoxville , tn ) whole - body tomography system operating in three - dimensional ( 3d ) mode . the volumetric images were reconstructed on 128128 matrices of 22 mm pixels using filtered back - projection with an 8 - mm hanning filter . for each of the 6 sessions , 10 mci of h2o were injected . the h2o isotopes were prepared in a cyclone 18/9 cyclotron ( iba , louvain - la - neuve , belgium ) adjacent to the scanner . the reconstructed images were automatically corrected for random and scattered events , detector efficiency variation and dead time . also , a transmission scan was collected for each subject before the experiments for estimating attenuation of the 511 kev gamma rays as a function of tissue density . a normalization scan was acquired for eliminating effects due to ring geometry and crystal sensitivity . the stimulation conditions were presented in random order . as shown in figure 2 , during each 3 - minute scan , the subjects were presented with only one type of stimulation , which started 1 minute before the start of the scan . arterial blood sampling and dynamic imaging started at injection time , and each scan was followed by a 15 - minute resting period , allowing the radioisotope to decay before a new injection . due to the short half - life of h2o ( 2 minutes ) and its kinetic behaviour , the observed h2o activity changes are very fast immediately after injection , requiring the acquisition of more frames at the beginning of the scan . thus , each 3 - minute scan consists of 21 frames acquired in 125 - second intervals , followed by 6 frames at 10 - second and 3 frames at 20 - second intervals . finally , due to the tracer kinetic model fitting required for pet data , only one volumetric cbf image was obtained for each experimental condition and no time evolution was measured . flow - sensitive mr perfusion images were obtained by subtraction of the slice - selective and nonselective fair acquisitions . subject motion , assessed by examining the temporal standard deviation images , was deemed negligible . quantitative analysis of pet images was performed using the two - compartment weighted integration method . no motion correction was performed given the longer acquisition time , due to which the effects of motion are greatly reduced . the rois were defined on an individual basis due to intersubject slice placement variability . in addition , for group analysis , pet ( volume ) and fmri data ( single - slice ) were resampled into the same reference frame , accounting for pet 's lower image resolution . ( i ) v1 - based roi : the first roi selection criterion involved choosing only voxels within the primary visual cortex ( v1 ) , since this region should contain the most reliable activation for the stimulus used . v1 was defined using fmri - based retinotopic mapping with an eccentricity range of 510 , as described previously , and resampled onto the slice corresponding to the fmri data for each subject . however , retinotopic v1 regions meeting these criteria can be small , rendering the masking process highly sensitive to misregistration between mri and pet . also , a small roi mask might produce variable results , with activation data outside v1 ignored . ( ii ) t - map - based roi : the second type of roi was obtained based on activation t - maps for both pet and fmri cbf images . for fmri , pet t - maps were automatically generated with the locally developed software used for pet analysis , dot ( version 1.8.0 , s milot , mni ) . both fmri and pet t - maps were thresholded at the 0.05 significance level to obtain the mask , accounting for multiple comparisons for each subject . ( iii ) gm - based roi : since the cbf changes occur mostly in gm , a third set of rois , consisting of a gm map in the fmri occipital lobe slice , was defined for each subject . the gm rois were obtained using bayesian fuzzy classification on the high resolution anatomical mr images . this is well suited for hypercapnia studies , which are best analyzed via the global demarcation of gm . the occipital gm rois include activated visual cortical areas . in this study , the raw fair fmri images have a higher spatial resolution than pet images . to maximize the degree of matching between the mr and pet data , the surface - coil mr anatomical scans were first manually registered to the head - coil images using register ( d macdonald , mni ) , then transformed into talairach space . prior to the subsequent resampling the surface - coil fmri data into the head - coil and stereotaxic coordinates , the images were blurred using a 1212 mm fwhm ( full - width - at - half - maximum ) gaussian kernel , resulting in a resolution approximately equal to that of pet data . the postblurring mr data was then resampled into a 11 mm grid using trilinear interpolation . sincefair data is single slice , pet data was transformed into the fair slice space . individual pet scans were registered to the first pet scan for each subject using an in - house implementation of the variance - of - ratios algorithm . following this , an average pet scan was calculated for registration of pet onto the mr anatomical space . these images were subsequently resampled onto the same slice from the fmri data in talairach space , and the final sampling of the pet cbf slices corresponds to that of fmri for each subject . all roi masks were also resampled into tailarach space , with a resolution of 111 mm . to characterize the relationship between cbf changes measured using pet and fair , the initial analysis was at the level of individual cbf changes for each subject , averaged across all voxels in the subject 's rois , while the subsequent analysis was performed on the cbf data averaged across all subjects in the individually defined rois . it ranged from 55.6 to 58.3 beats / min ( subject average ) throughout the experiment . the subjects also maintained a reasonably constant respiratory rate , between 15.7 and 17.9 breaths / min . while etco2 was stable at 40.242.1 mmhg during the five normocapnia conditions , a small etco2 increase of about 4 to 6 mmhgwas observed during hypercapnia , in agreement with rise in pressure introduced by co2 . finally , arterial saturation of o2 remained constant at 98 - 99 % throughout all the sessions . the three rois used for the cbf comparisons were defined on a subject basis , as described in methods and materials , and an example is shown in figure 3 . for all subjects , the v1 rois were the smallest , containing only between 0.101 cc and 0.187 cc , due to the stringent retinotopic mapping criteria . v1 was correctly identified by the rois , but due to the small mask size , the corresponding cbf measurements are prone to variations introduced by misregistration and motion . on the other hand , the t - map rois contained between 0.202 cc and 0.407 cc . to obtain the t - map roi 's at p = .05 , the fmri t - maps were thresholded at 5.42 , and the pet maps at 4.45 . a lower standard deviation was seen in the responses detected in these rois , and the fair t - maps contained no statistically significant voxels for 2 of the 10 subjects . the largest were the gm rois , covering 1.489 - 0.625 cc for the same group of subjects . some automatically classified gm voxels were excluded by the certainty - level threshold , but the final gm rois were still significantly larger than the v1 rois . as previously mentioned , larger roi masks may include nonactivated voxels , leading to reduced levels of measured cbf . nonetheless , the gm masks provide an effective means of comparing cbf measurement across modalities , especially for the hypercapnia condition . time - series cbf data were obtained only from fmri data as pet measurements were not available as separate frames . the bold and fair time courses were obtained by averaging all voxels in the roi and shown in figure 4 in the v1 roi of one subject ( activation paradigm from left to right : baseline , checkerboards from 25 % to 100 % intensity and hypercapnia ) . we observed an increase in the level of signal change with increasing checkerboard intensity for both bold and fair . as expected , the activation snr , defined as the ratio of the roi mean over the standard deviation during activation , was lower for fair than for bold . in the averaged time courses , fair cbf ranged between 11.4 % and 22.5 % for the various stimulation intensities , and bold changes between 1.0 % and 1.9 % . these are in the range of percent changes previously reported by hoge et al . using the same stimulation and acquisition design ( between 1.1 % and 2.2 % for bold , and between 23 % and 48 % for fair ) . the measured percent changes in small rois such as the v1 were expected to decrease with the application of image blurring . this was true for average fair cbf in v1 , where lower values ( between 16.4 % and 30.4 % ) were measured compared to the study by hoge et al . comparatively lower signal changes were also measured during hypercapnia ( 1.5 % and 7.2 % for bold and fair , resp . , in previous studies ) , despite similarity in observed etco2 changes . however , our postblurring bold percent changes in the v1 roi ( between 1.1 % and 2.1 % ) were still similar to those obtained by hoge et al . relative pet cbf changes were calculated from absolute pet cbf values and compared with relative fair cbf changes . pet cbf values in the v1 rois for all 10 subjects , as well as averaged cbf over all subjects in the 3 roi types , are presented in table 1 . the results are in the range of published cbf values . however , the pet cbf measurements have a high standard deviation , largely attributable to the abnormally high cbf measured in subject 8 . as previously mentioned , cbf time courses could not be obtained for pet data ; instead , time - averaged cbf in the pet rois were compared to individual and group - averaged fair results . the pet cbf maps were found to have significantly lower snr than fair ( 1.0 for v1 and gm rois , and 2.27 for t - map rois ) for all the experimental conditions , as seen in table 1 , and to demonstrate considerable intersubject variability under each condition . we further noted that cbf for subject 10 in the v1 and gm rois were negative for pet ( possibly due to a relatively high pet cbf measured at baseline ) and only very slightly positive for fmri ( the subject having no significant voxels in the t - maps roi ) . data from this subject is likely to account for much of the standard deviation seen in both techniques . the cbf values measured with fair and pet in all the rois during baseline and 4 graded levels of visual stimulation are presented in figure 5 . pet data is shown as having much higher standard deviation than fair measurements , even when the gm rois were used . the group - averaged results seem to provide a better indication of the cbf changes . the fair baseline signal value was obtained from the 6 - minute baseline data , whereas in pet , since only one baseline volume was obtained , the baseline percent change was fixed at 0 % . the regions of activation - induced cbf in both the v1 and t - map rois were localized to the expected site of activation . however , as seen in figure 6 , the cbf in the gm rois are lower , since many less than maximally activated voxels are likely to have been included in the mask . in addition , a postblurring data resolution of 1414 mm implies that both gm and wm contribution can be expected in the same voxel ; the gm signal intensity thus diminished in both pet and fair . we further observed that for all rois , increases of fair cbf appear to correspond well with increases in visual stimulation intensity , in agreement with previous observations . finally , for the hypercapnic condition , cbf in all three rois were similar for fair and pet . in figure 6 , group - averaged cbf values for baseline and the 4 visual stimulation conditions are shown as dots , while the hypercapnic cbf is represented by a triangle . note that for all experimental conditions , higher correlation was seen when comparing the pet and mr group averages ( figure 6 ) than when comparing the two sets of individual subject values ( 0.76 , 0.87 , 0.73 versus 0.45 , 0.29 , 0.57 for the v1 , t - map and gm rois , resp . ) . the line - fitting algorithm used accounted for data variance on both the pet and the asl axis , and the resulting slopes in all 3 roi types were similar . values had high probabilities ( q = 92 % 98 % ) , well below the threshold for rejection of the fit ( 9.488 for 4 degrees of freedom at p = .05 ) . furthermore , the two - tailed t - test was used to assess whether the slopes were significantly different from unity . the t - values obtained for all 3 rois ( 0.10 , 0.35 , and 0.06 for the v1 , t - map , and gm rois , resp . ) suggest that the slopes of the mr - pet linear fits do not differ statistically from unity . arterial spin labeling ( asl ) - based perfusion fmri techniques are fast , noninvasive , have high resolution ( temporal and spatial ) , and are widely accessible . furthermore , asl can easily be used in conjunction with other mr techniques to provide information on a variety of physiological parameters in a single session . the goal of this study was to compare pet and fair asl , under conditions extensively used in numerous brain flow - metabolism studies . the fair and pet data were fit to a straight line taking into account the variations in both modalities . the resulting slopes were not significantly different from unity , though large standard deviations were associated with the fit . furthermore , our results showed a consistent monotonic increase in the cbf percent change ( cbf ) with stimulus intensity in the fair cbf data which could not be observed consistently with pet due to its low snr . on average , fair cbf values were slightly lower than those measured with pet under the same conditions . also , a lower snr was observed in the fair group - average time course , likely due to intersubject variability and group outliers . despite these differences , the regional cbf values measured with fair were highly correlated with pet measurements . when comparing pet and fmri data , a key step was the transformation of both datasets into the same frame of reference and to have the same spatial resolution , since the numerous registration steps could potentially introduce errors . first of all , pet data had to be aligned between runs and also to the surface - coil fmri data , which was in turn manually registered to the head - coil mr anatomical images through a process susceptible to intersubject variations . subsequently , pet and mr scans were transformed into talairach space along with the chosen roi masks , allowing for additional image degradation . moreover , since the fmri data consisted of a single slice , no blurring could be performed in the slice direction , and hence the slice resolution of the fair images did not match that of the pet volume data . in some cases where the fmri slice may have been positioned above the activated area , pet data would reflect activation while the fair data may not , resulting in fair cbf values being lower than those of pet . this may be one of the sources of the systematic cbf underestimation using this single - slice fair implementation . furthermore , since the scan sessions were usually on different days , measurements are prone to various intrasubject variations . in fact , intrasubject variability as high as 16 % has been reported in the literature for trained subjects , and simple factors such as caffeine intake can alter the cbf response . pet data were acquired with lower temporal resolution and over longer scan periods , thus the effects of motion would be reduced through data averaging . in addition , as all pet scans were aligned to the first run , the effect of potential movement between runs was greatly reduced . although this process does not account for motion within runs , the need for in - plane motion correction was reduced due to the use of image blurring . on the other hand , each fmri image was acquired in 100 milliseconds , and motion could have potentially shifted the location of the activated region out of the roi mask , resulting in an underestimation of the activation as well as diminished snr . complete 3d retrospective motion correction was not possible for the mr data , since the surrounding regions were not scanned , but visual examination suggested minimal displacement between runs or between frames in one run . nonetheless , for both pet and mr , intersession positioning differences could result in a slight data misalignment and therefore comparison of slightly shifted brain regions . an additional source of potential error could originate from the experimental setup . although the pet experiments were designed to reproduce the conditions found in the mr environment as closely as possible , some elements in the experimental setup were difficult to reproduce . these include factors such as head and mirror orientations , sensory stimulation induced by mr scanner noise and vibration , the presence of arterial and venous lines during the pet experiment , and the duration of the study . changes in mirror orientation might occur between subjects and scans . while this should not have a large impact on the activation if the subject maintains fixation on the centre , the quality of the subjects ' attention could be influenced by the degree of ease with which the stimulus was viewed . sensory stimulation from the high background noise and vibration in the mr scanner , absent in the pet environment , could have added an additional variability . this factor was , however , previously reported to have little impact on the analysis . on the other hand , in the pet experiments , the stress associated with having an arterial line and multiple injections could also have affected the subject 's response . moreover , the scan durations for pet and fmri were different ; subject motion generally increases during longer scans . in the fmri experiments , nearly 36 minutes of continuous stimulation was used with no breaks between runs , whereas in pet , the scan sessions were shorter ( 4 minutes ) , and the subjects were given breaks , relieving strain on subject attention . as we mentioned , the dependence of fair cbf estimates on transit delay as well as label width has been previously discussed . the transit delay is influenced by the label gap size , and an underestimation of the delay leads to cbf underestimation . the quantification and correction of the underestimation requires asl acquisitions at a range of different inversion times for each flow condition . however , such measurements could not be included in this study given the number of graded flow increases being investigated . instead , in the fair implementation used in this study , we made an effort to minimize the influence of transit delays by using a substantially smaller gap size ( 3 mm ) than typically reported in the literature . in addition , we used body coil transmission to achieve a very large label width , thereby minimizing cbf estimation errors due to labeling slab size . finally , it should be noted that while the single - slice fair sequence we used did not allow the measurement of absolute cbf , the literature has recently described various quantitative and multislice asl sequences such as q2tips and quipss ii with bassi pulse tagging , which would better suit future fmri studies . multislice perfusion sequences provide a definite advantage when studying large rois , reducing the dependence on slice placement , facilitating visualization of global cbf changes , and benefiting the clinical utility of asl perfusion imaging . in addition , multichannel acquisitions and higher field strengths can provide higher global snr while abolishing the need for surface - coil functional scans . this would reduce the number of steps needed for registration of fmri and pet data by eliminating the subject - dependent manual registration step between head and surface coil anatomical scans . improved data snr and reduced postprocessing variability would permit further exploration of cbf variation with stimulation intensity . in recently published studies involving cbf measurements by our group , the quipss ii technique was employed . however , as stated earlier , the current study was motivated by the need to assess the accuracy and validity of the fair method with its known technical limitations , particularly given the importance attached to results published in recent years based on fair measurements . in addition , we wanted to address the intense interest in a comprehensive evaluation of the relative quality of perfusion imaging using mri and pet , the latter being the de facto golden standard technique for perfusion imaging . the chief finding of the present study is that there was no significant difference between measurements of cbf change using pet and fair under matched levels of graded visual stimulation and hypercapnia . these findings directly support the argument that fair , while leaving room for improvement , provides a valid measure of cbf changes under our experimental conditions , characterized by an accuracy well within the range measured using h2o pet . the other important observation is that cbf measurements made using pet have a much lower snr than those made using asl - fmri , stresses the immense importance in validating the latter for a wide array of applications .\noutput:\n" }, { "from": "agent", "value": "an important aspect of functional magnetic resonance imaging ( fmri ) is the study of brain hemodynamics , and mr arterial spin labeling ( asl ) perfusion imaging has gained wide acceptance as a robust and noninvasive technique . however , the cerebral blood flow ( cbf ) measurements obtained with asl fmri have not been fully validated , particularly during global cbf modulations . we present a comparison of cerebral blood flow changes ( cbf ) measured using a flow - sensitive alternating inversion recovery ( fair ) asl perfusion method to those obtained using h215o pet , which is the current gold standard for in vivo imaging of cbf . to study regional and global cbf changes , a group of 10 healthy volunteers were imaged under identical experimental conditions during presentation of 5 levels of visual stimulation and one level of hypercapnia . the cbf changes were compared using 3 types of region - of - interest ( roi ) masks . fair measurements of cbf changes were found to be slightly lower than those measured with pet ( average cbf of 21.5 8.2 % for fair versus 28.2 12.8 % for pet at maximum stimulation intensity ) . nonetheless , there was a strong correlation between measurements of the two modalities . finally , a t - test comparison of the slopes of the linear fits of pet versus asl cbf for all 3 roi types indicated no significant difference from unity ( p > .05 ) ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: autism spectrum disorders ( asd ) include a group of neurodevelopmental disorders characterized by impairments in 3 major domains : socialization , communication , and behavior . the causes of asd are not well understood ; however , the etiology of asd is likely a combination of genetic predisposition interacting with environmental factors in early life . it is postulated that a risk factor of asd should occur frequently enough to explain the high prevalence of asd and have the potential for brain injury . bilirubin is a product of heme catabolism and at low levels a beneficial antioxidant , but at higher levels is neurotoxic to the normal development of a neonatal brain . bilirubin neurotoxicity has a spectrum of manifestations , with kernicterus being the most severe outcome among survivors . a recent meta - analysis of 13 studies has shown that asd is associated with neonatal hyperbilirubinemia . the majority of the studies included in the meta - analysis , however , were small ( 400 subjects ) , did not account for confounding of factors such as prematurity , or used a variety of definitions for jaundice and asd . utilizing a large us health care database representing a heterogeneous , demographically and socioeconomically diverse population , we sought to expand on previous smaller studies evaluating the risk of asd among infants with a history of neonatal unconjugated hyperbilirubinemia ( jaundice ) , while utilizing a more refined definition of both neonatal jaundice and asd . all patient data were obtained from the tricare management activity s military health system ( mhs ) database , which oversees all health care delivery for the us military and their family members . children born between october 1 , 2000 , and september 30 , 2009 , were eligible for inclusion . children with asd were identified as those with at least one outpatient visit to a pediatric specialist neurologist , psychiatrist , or developmental behavioral pediatrician with an international classification of diseases , ninth edition clinical modification ( icd -9-cm ) diagnostic code for asd ( 299.0 x , 299.8 x , 299.9 x ) from october 1 , 2002 , through september 30 , 2012 . for each case , 3 controls without any outpatient diagnoses of asd ( given by a specialist or a generalist ) were selected and matched on gender and age ( birth date within 90 - day period ) . the demographic information , enrollment date , birth order , and inpatient birth health claims records , including information on discharge diagnoses and procedures of each case and control , were extracted . for the primary exposure of jaundice , the first definition was a diagnosis of jaundice during the hospital stay associated with birth , or during an admission within the first month of life . the second definition was any phototherapy or exchange transfusion procedure in the first month of life . documentation of phototherapy or exchange transfusion was defined as an indication of more severe hyperbilirubinemia compared with an admission for jaundice without those procedures . icd -9-cm diagnostic and procedure codes utilized for the definition of jaundice are listed in supplemental tables 1 and 2 ( available online at http://gph.sagepub.com/content/by/supplemental-data ) . prematurity was defined as birth before 37 weeks gestational age and was identified using icd -9-cm codes at the birth admission . season of birth was categorized into birth in the colder months ( october - march ) versus birth in the warmer months ( april - september ) . test determined the unadjusted odds ratio ( or ) of the development of asd with a history of neonatal jaundice , as previously defined . birth season , prematurity , multiple gestation , and birth order were considered as independent variables in multivariate models . analyses were conducted using stata intercooled 10 ( stata corp , college station , tx ) . this study was reviewed and approved by the responsible institutional review boards . there were 783047 children who had a birth record available and 2917 of these were diagnosed with asd by a specialist between 2002 and 2012 in the mhs database . the median age of asd diagnosis was 5.3 years ( interquartile range [ iqr ] = 3.8 - 7.2 years ) . of children with asd ,80 % of cases were male , 7.7 % were born premature , and 34 % were firstborn . admissions for neonatal jaundice occurred in 19 % of all subjects , and a procedure for treating hyperbilirubinemia was recorded in 2.8 % . of subjects who received a procedural treatment for jaundice , 100 % had phototherapy and only one subject received an exchange transfusion for jaundice . a history of admission with a diagnosis of neonatal jaundice was present in 640 ( 21.9 % ) of children with asd compared with 1614 ( 18.4 % ) of controls ( p .001 ) . a procedural treatment for jaundice was documented in 107 ( 3.7 % ) of children with asd and 221 ( 2.5 % ) of controls ( p .001 ) . in unadjusted conditional logistic regression , there was a 24 % increased odds of asd in children who had an inpatient diagnosis of jaundice ( or = 1.24 ; 95 % confidence interval [ ci ] = 1.22 - 1.38 ; p .001 ) . there was a 47 % increased odds of asd in children who required phototherapy ( or = 1.47 ; 95 % ci = 1.16 - 1.86 ; p = .001 ) . after adjusting for season of birth , birth order , multiple gestation , and prematurity , odds of asd were increased in children with an admission for jaundice ( or = 1.18 ; 95 % ci = 1.06 - 1.31 ; p = .001 ) . using the procedure code for phototherapy as a more rigorous definition / confirmation of jaundice , the increased adjusted odds of asd remained significant ( or = 1.33 ; 95 % ci = 1.04 - 1.69 ; p = .008 ) . point estimates and confidence intervals of odds ratios for covariates as determined by multivariate models are shown in table 2 . unadjusted and adjusted odds ratios ( confidence intervals ) of the diagnosis of autism spectrum disorders associated with neonatal jaundice . a separate subgroup analysis of only preterm infants resulted in loss of the significant association between asd and jaundice ( unadjusted or = 1.08 ; 95 % ci = 0.78 - 1.49 ; p = .65 ) . after adjusting for season of birth , birth order , and multiple gestation , the association remained nonsignificant ( or = 1.06 ; 95 % ci = 0.77 - 1.47 ; p = .71 ) . in preterm infants , phototherapy treatment was also not significantly associated with asd ( unadjusted or = 0.98 ; 95 % ci = 0.65 - 1.47 ; p = .91 ; and adjusted or = 0.99 ; 95 % ci = 0.66 - 1.48 ; p = .94 ) . our study demonstrates an association between a diagnosis of asd and previous hospitalization with a diagnosis of neonatal hyperbilirubinemia or treatment for hyperbilirubinemia in the neonatal period . the large number of cases of asd and more rigorous definitions of clinically significant jaundice using inpatient admissions and treatments for jaundice strengthen the evidence for an association between hyperbilirubinemia and asd . hyperbilirubinemia occurs frequently enough to explain the high prevalence of asd and has the potential to cause brain injury . the globus pallidus , cerebellum , hippocampus , and subthalamic nuclear bodies have been identified as areas in the brain vulnerable to bilirubin toxicity . there is evidence of lower gray matter volumes in the putamen and cerebellar hypoplasia in individuals with autism , creating a degree of overlap that may indicate shared mechanisms . additionally , there is overlap in the clinical features of bilirubin - induced neurologic dysfunction ( bind ) and asd . bind may present with neuromotor abnormalities , muscle tone abnormalities , hyperexcitable neonatal reflexes , neurobehavior manifestations , speech and language abnormalities , and central processing abnormalities , such as sensorineural , audiological , and visuomotor dysfunctions . clinical features of asd include social and communication impairment , rigid ritualistic interests , behavioral abnormalities , and can include intellectual disability . the median age of asd diagnosis ( 5.3 years ) and male preponderance ( 80 % ) of children with asd in our cohort are similar to other estimates . the season of birth was not significantly associated with an increased risk for asd in our cohort , contrary to other studies that found as association in children born in colder months ( between october and march ) . however , we sought to use a more strict definition of asd by restricting the cases to children with a diagnosis obtained from an outpatient visit with a pediatric subspecialist ( neurologist , psychiatrist , developmental behavioral pediatrician ) . in the 7 previously published studies specifically addressing jaundice as a risk factor for asd , 4 required specialist - diagnosed asd or utilized the autism diagnostic interview revised criteria . in all 4 of these studies , jaundice was significantly associated with asd . the 2 studies showing no association did not specify whether a general pediatrician or a pediatric subspecialist assigned the asd icd codes . buchmayer et al defined asd cases through utilization of an inpatient database , which may result in an overrepresentation of severe cases . additionally , their study used admission diagnoses , which raised the possibility that asd may only have been a suspected diagnosis from the referring pediatrician , increasing the chance misclassification bias of noncases to be included in the asd group resulting in an underestimate of the risk . of the infants included in our study , 19.3 % met criteria for neonatal jaundice . previous association studies have been criticized for the low prevalence of jaundice when it has been estimated that 60 % to 80 % of newborns experience jaundice . in an attempt to capture only early jaundice and clinically significant jaundice , we included only icd -9-cm codes linked to an inpatient admission . our jaundice rate is the result of a more stringent definition of jaundice and is similar to previous association studies . furthermore , the only other study that limited classification of jaundice to the first 30 days of life found only 27.8 % of their cases had a bilirubin level drawn . our study did not aim to capture all cases of jaundice but rather clinically significant jaundice warranting laboratory analysis or inpatient admission . only 2 previous studies investigating the association between neonatal jaundice and asd have conducted separate analyses for preterm infants . similar to our findings neither study found a significant association in the preterm infant group . a meta - analysis combined these 2 studies , for fewer cases than our study , and found no significant association between neonatal jaundice and asd in premature infants . this finding may be due to differences in bilirubin metabolism and pathogenesis of neurotoxicity between term and preterm infants . we were not able to control for gestational age but only prematurity as defined by gestational age 37 weeks . this may slightly overestimate the association between jaundice and asd as clinical estimates of risk , which determine the need for admission and for treatment , are based on bilirubin levels in conjunction with gestational age , hours of life , and an infant s overall stability . a specific dosethere is a chance that cases of asd would not have been captured as subjects with asd diagnosis was only captured up until 2012 , resulting in possible misclassification bias of children born in 2008 - 2009 . in contrast to prior studies , we report a large number of cases of asd using more strict and validated definitions . our population is geographically , demographically , and socioeconomically diverse and representative of the us population as a whole . we compensated for potential misclassifications by implementing strict definitions of hyperbilirubinemia ( only those who were inpatient or who required treatment ) and for asd ( diagnosis made by a pediatric subspecialist ) . we included all subjects with the diagnosis of asd made by a subspecialist during the study period , making it unlikely to be affected by selection bias . in conclusion , our study provides further evidence that neonatal unconjugated hyperbilirubinemia is associated with the development of asd . further prospective studies are needed to clarify specific serum levels of bilirubin in combination with other neonatal risk factors that mediate the association of jaundice and asd .\noutput:\n" }, { "from": "agent", "value": "autism spectrum disorders ( asd ) are a common neurodevelopmental disorder of unknown etiology . studies suggest a link between autism and neonatal jaundice . a 1:3 matched case control study was conducted with children enrolled in the military health system born between october 2002 and september 2009 . diagnostic and procedure codes were used for identifying asd and hyperbilirubinemia . two definitions for hyperbilirubinemia were evaluated : an inpatient admission with a diagnosis of jaundice and treatment with phototherapy . a total of 2917 children with asd and 8751 matched controls were included in the study . after adjustment , there remained an association between asd in children and an admission with a diagnosis of jaundice ( odds ratio = 1.18 ; 95 % confidence interval = 1.06 - 1.31 ; p = .001 ) and phototherapy treatment ( odds ratio = 1.33 ; 95 % confidence interval = 1.04 - 1.69 ; p = .008 ) . children who develop asd are more likely to have an admission with a diagnosis of jaundice in the neonatal period and more likely to require treatment for this jaundice ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: neuroblastoma , the most common extracranial solid pediatric malignancy , is an embryonal tumor of the sympathetic nervous system . along with rhabdomyosarcoma , ewing sarcoma and lymphoma , these malignancies collectively represent the small , round blue cell tumors of childhood . in the united statesthe incidence is estimated at 1 in 10,000 births or about 500 new cases per year . neuroblastoma has been described as an enigmatic tumor because of its highly variable biologic behavior . tumors may spontaneously regress , differentiate into benign ganglioneuromas or follow an unrelenting progressive course with ultimate fatal outcome . more than 50 % of patients present with high - risk features including large , unresectable tumors and widely metastatic disease . the prognosis for these patients remains suboptimal with a long - term survival of about 40 % . the international neuroblastoma staging system ( inss ) , developed in 1988 and modified in 1993 , is still used by many cooperative groups today . this system relies on tumor resectability as well as pathologic features of the tumor ( table 1 ) . a limitation of the system is that the same tumor can be classified as inss stage 1 or 3 depending on the local surgeon 's experience and expertise . also , tumors that are expected to spontaneously regress can not be adequately staged using the inss . in addition , assessment of lymph node involvement is difficult to apply uniformly across institutions . these drawbacks led to heightened international collaboration to facilitate comparison of results of clinical trials performed worldwide . in 2004the international neuroblastoma risk group ( inrg ) task force was formed to develop the inrg staging system ( inrgss ) and inrg risk classification system , both published in 2009 . table 1the original international neuroblastoma staging systemtumor stagedescription1localized tumor with complete gross excision , with or without microscopic residual ; representative ipsilateral lymph nodes negative for tumor . nodes attached to and removed with tumor may be positive2alocalized tumor with incomplete gross excision ; ipsilateral nonadherent lymph nodes negative for tumor2blocalized tumor with or without complete gross excision , ipsilateral nonadherent lymph nodes positive for tumor ; enlarged contralateral lymph nodes negative for tumor3unresectable unilateral tumor infiltrating across midline ( beyond opposite side of vertebral column ) with or without regional lymph node involvement , or midline tumor with bilateral extension via infiltration ( unresectable ) or lymph node involvement4any primary tumor with dissemination to distant lymph nodes , bone , bone marrow , liver , skin , and / or other organs ( except as defined for stage 4s ) 4slocalized primary tumor with disseminated disease limited to skin , liver and / or bone marrow ( only in infants 1 year , marrow involvement 10 % on biopsy and mibg negative marrow ) the original international neuroblastoma staging system the inrgss is designed to stage patients before surgery or other therapy . tumors are classified as l1 or l2 disease based on whether one or more of 20 imaging - defined risk factors ( idrf ) are present . the idrfs are imaging features that predict the risk of tumor resection . with the inrgsssince imaging can be retrospectively and centrally reviewed by experts in the field , a system based on baseline imaging features should be more robust and reproducible than one based on surgical resection . it is hoped that this will result in an accelerated refinement of risk stratification and more appropriate therapies for individual patients . the inrgss is not intended to replace the inss but should be used in parallel . because inrgss staging is based on imaging features , the radiologist 's role will be increased . the purpose of this review is to heighten the radiologist 's awareness of the definitions and importance of the idrfs in neuroblastoma . there are four inrgss stages : ( 1 ) stage l1 tumors are localized tumors that do not involve vital structures as defined by the idrfs ( table 2 ) . tumor must be confined to one body cavity , i.e. neck , chest , abdomen or pelvis . the isolated finding of intraspinal tumor extension does not fulfill the criteria for an irdf and such tumors are considered stage l1 . for example , a left - sided abdominal tumor with left - sided chest involvement is considered l2 . however , a left - sided abdominal tumor with clearly right - sided chest involvement is considered metastatic . ( 3 ) stage m is defined as distant metastatic disease ( not contiguous with the primary tumor ) except when defined as stage ms . non - regional , distant , lymph node involvement is considered metastatic disease . however , an upper abdominal tumor with enlarged lower mediastinal nodes or a pelvic tumor with inguinal adenopathy is considered local regional disease . ascites and pleural effusion , even when they contain malignant cells , do not constitute metastatic disease unless they are remote from the body compartment of the primary tumor . ( 4 ) stage ms is metastatic disease in patients younger than 18 months ( 547 days ) with metastases confined to the skin , liver and / or bone marrow . bone marrow involvement must be limited to 10 % of total nucleated cells on smears or biopsy . if the primary tumor shows avidity for [ i ] meta - iodobenzylguanine ( mibg ) there must be no evidence of bone or bone marrow disease on mibg nuclear scintigraphy . if the primary tumor is not mibg avid , there must be no evidence of bone or bone marrow involvement on [ tc ] methyldiphosphonate ( mdp ) nuclear bone scan . the primary tumor can be l1 or l2 and there is no restriction regarding crossing the midline . in addition to the irdfs and independent of stage , three special conditions should be recorded : ( 1 ) multifocal primary tumors , ( 2 ) pleural effusion , and ( 3 ) ascites . patients with multifocal tumors should be staged according to the greatest extent of disease as defined above . table 2description of imaging - defined risk factors for the international neuroblastoma risk group staging systemanatomic regiondescriptionmultiple body compartmentsipsilateral tumor extension within two body compartmentsnecktumor encasing carotid artery , vertebral artery , or jugular veintumor extending to skull basetumor compressing tracheacervicothoracic junctiontumor encasing brachial plexustumor encasing subclavian vessels , vertebral artery or carotid arterytumor compressing tracheathoraxtumor encasing aorta or major branchestumor compressing trachea or main bronchilower mediastinal tumor infiltrating costovertebral junction between t9 and t12 vertebral levelsthoracoabdominal junctiontumor encasing aorta or vena cavaabdomen and pelvistumor infiltrating porta hepatis or hepatoduodenal ligamenttumor encasing branches of superior mesenteric artery at mesenteric roottumor encasing origin of celiac axis or superior mesenteric arterytumor invading one or both renal pediclestumor encasing aorta or vena cavatumor encasing iliac vesselspelvic tumor crossing sciatic notchintraspinal tumor extensionintraspinal tumor extension ( any level ) provided that more than one - third of spinal canal in axial plane is invaded , the perimedullary leptomeningeal spaces are not visible , or the spinal cord intensity is abnormalinfiltration of adjacent organs and structurespericardium , diaphragm , kidney , liver , duodenopancreatic block , and mesentery description of imaging - defined risk factors for the international neuroblastoma risk group staging systemto promote reproducible staging it is recommended that radiologists use specific terms to describe the relationship between tumors and neighboring vital structures . separation means that a visible layer ( usually fat ) is present between the tumor and the neighboring structure . when a tumor is separated from a vital structure an irdf is not present.contact means no visible layer is present between the tumor and adjacent structure . for an artery , the term flattened is used to describe veins with reduced diameter that still have a partially visible lumen . when a tumor is in contact with a vital structure or is flattening a vein without encasement , an idrf is not present , except in the case of renal vessels ( see below ) . encasement means that the neighboring structure is surrounded by tumor . a flattened vein with no visible lumen is considered to be encased.compression is used only when referring to airways . when tumor contacts an airway and causes the short axis to be reduced , this is considered an idrf . for other vital structures , a contact may cause displacement ( abnormal anatomic location ) or distortion ( abnormal anatomic shape ) , but these situations are not considered idrfs unless there is infiltration or total encasement.infiltration refers to involvement of vital structures other than vessels since infiltration of a vessel wall can not be determined from imaging . an infiltrating tumor demonstrates extension into an adjacent organ thus causing the margins between them to be absent or poorly defined . when a tumor infiltrates an adjacent structure an idrf is present.because surgical dissection of the renal pedicle is risky in patients with neuroblastoma , an idrf is present even if the strict criteria for encasement are not fulfilled , that is , even if the tumor is only in contact with the renal vessels . separation means that a visible layer ( usually fat ) is present between the tumor and the neighboring structure . contact means no visible layer is present between the tumor and adjacent structure . for an artery , the term flattened is used to describe veins with reduced diameter that still have a partially visible lumen . when a tumor is in contact with a vital structure or is flattening a vein without encasement , an idrf is not present , except in the case of renal vessels ( see below ) . when tumor encases a vital structure , an idrf is present . for a vessel , total encasement means that a vital structure is completely surrounded by tumor . a flattened vein with no visible lumen is considered to be encased . compression is used only when referring to airways . when tumor contacts an airway and causes the short axis to be reduced , this is considered an idrf . for other vital structures , a contact may cause displacement ( abnormal anatomic location ) or distortion ( abnormal anatomic shape ) , but these situations are not considered idrfs unless there is infiltration or total encasement . infiltration refers to involvement of vital structures other than vessels since infiltration of a vessel wall can not be determined from imaging . an infiltrating tumor demonstrates extension into an adjacent organ thus causing the margins between them to be absent or poorly defined . when a tumor infiltrates an adjacent structure an idrf is present . because surgical dissection of the renal pedicle is risky in patients with neuroblastoma , an idrf is present even if the strict criteria for encasement are not fulfilled , that is , even if the tumor is only in contact with the renal vessels . an idrf is present when more than one - third of the spinal canal , in the axial plane , is infiltrated , the leptomeningeal fluid spaces are no longer visible or the spinal cord magnetic resonance signal intensity is abnormal . tumors that infiltrate the spinal canal below the level of the spinal cord are considered idrfs if they fulfill these criteria . a lower mediastinal tumor that infiltrates the costovertebral junction between the t9 and t12 vertebral levels is associated with a theoretic risk of spinal cord ischemia caused by surgical injury to the anterior spinal artery ( artery of adamkiewicz ) and is considered an idrf . because injury to the inferior mesenteric artery ( i m a ) almost never causes complications , encasement of this vessel is not considered an idrf ( i.e. the i m a is not a vital structure ) . kidneys can be infiltrated through the cortex , by adrenal tumors , or through the renal hilum by retroperitoneal tumors . approximately 50 % of neuroblastoma patients present with metastatic disease . in the inrgss , metastatic disease is designated stage m and is distinct from stage ms which refers to metastatic disease in children younger than 18 months with metastases confined to the skin , liver , and / or bone marrow ( 10 % involvement on bone marrow biopsy with negative mibg ) . patients with lymph node involvement outside the body cavity of the primary tumor are considered to have disseminated metastatic disease . metastases occur hematogenously , most commonly to the bone marrow ( 70 % ) or bone ( 55 % ) and less commonly to the liver . metastatic disease to the lung and brain parenchyma is seen in end - stage disease and is becoming more commonly recognized in children undergoing current therapy who have longer survival . distant metastasis must be assessed with mibg nuclear scintigraphy . because approximately 10 % of neuroblastoma is non - mibg avid , patients with non - mibg avid primary tumors should be assessed with [ tc ] mdp bone scan . one unequivocal site of abnormal , distant mibg avidity is sufficient to define metastatic disease . however , a solitary , equivocal focus of mibg uptake must be confirmed with additional imaging or biopsy . the use of single - photon emission computed tomography ( spect ) - ct has proven utility in accurately localizing sites of mibg avidity when planar mibg imaging or diagnostic ct or mr imaging is equivocal . to standardize the assessment of extent of bone / bone marrow disease and response to therapy , a semi - quantitative scoring systemas efforts are made by the international community toward standardizing the staging of children with neuroblastoma the role of the radiologist is increasing . therefore , it is important for radiologists to be familiar with the idrfs set forth by the inrg . because the inrgss is based on the extent of disease before surgery or other therapy , the criteria should be more robust and reproducible than the prior staging system , which was based on extent of surgical resection . the goal of the inrgss is to facilitate the comparison of clinical trials worldwide and ultimately accelerate the advancement of treatment strategies for children with neuroblastoma .\noutput:\n" }, { "from": "agent", "value": "abstractneuroblastoma is the most common extracranial solid malignancy in children . the tumor has variable biological behavior that can be predicted by patient age , genetic features , tumor biology and extent of disease at diagnosis . factors chosen by various cooperative groups to define risk of treatment failure have been non - uniform . therefore , historically , it has been difficult to compare outcomes across clinical trials performed around the world . this has hindered the advancement of treatment strategies to improve survival of these patients . the international neuroblastoma risk group ( inrg ) was established in 2004 to develop a consensus approach to pretreatment risk stratification . the result was the development of the inrg staging system ( inrgss ) which relies on imaging - defined risk factors ( idrfs ) that are determined before surgery or other therapy . with the application of the inrgss the radiologist 's role in staging children with neuroblastoma is increased . this review provides an overview of the inrgss and the idrfs ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: glucose metabolism governs many functions , because the oxidation of glucose generates a major source of metabolic energy in eukaryotic cells .1 thus , glucose regulates transcription , enzymatic activity , hormone secretion and the activity of glucoregulatory neurons . these functions typically are secondary to glucose uptake , which is controlled primarily by the glucose transporter family ( glut 114 ) .2 facilitative glucose transporters in the plasma membrane mediate the flux of glucose between the extra - and intracellular enviroments ; 3 their expression and kinetic and regulatory activities can be influenced by oncogenes and growth factors .4 the transport of glucose and other sugars is effected by a gradient between the external and internal faces of the plasma membrane .5 glucose uptake in nearly all cells is mediated by gluts .2,3 after glucose enters normal cells , it is converted into pyruvate through glycolysis . subsequently , pyruvate is transformed into acetyl - coa , which is used as substrate in mitochondria to generate atp .6 in contrast , aerobic glycolysis occurs in tumor cells known as the warburg effect7 also involving glucose transporter expression .8 hypoxia is a hallmark of cancer , upregulating glut expression .9 the glut family is expressed in the membrane of nearly all cell types ; 10 glut isoforms have tissue - specific expression patterns . there are 14 glut members ,11 of which glut1 , the first member of the glut family to be identified , has been the most extensively studied . glut1 was reported originally as a marker of infantile skin hemangioma ; 12 other vascular tumors and malformations do not express glut1 as robustly or ubiquitously .13 some groups have proposed the use of glut1 as a diagnostic marker for hemangiomas in various locations .12 - 15 glut1 is overexpressed in many tumors , including hepatic , pancreatic , breast , esophageal , brain , renal , lung , cutaneous , colorectal , endometrial , ovarian and cervical cancers .16 - 25 conversely , immunohistochemistry shows that glut1 expression is absent from certain human cancers . further , glut1 positivity in malignant cells revealed by immunohistochemistry indicates increased proliferative activity , energy requirements and aggressive behavior .26,27 increases in glucose consumption help supply the energy that is necessary for tumor cell proliferation and reflect adaptation to the adverse conditions of the tumoral environment . thus , metabolic changes have prognostic and diagnostic value .28 although the metabolic consequences of increased glucose transport are not understood , glut1 expression apparently has significant clinical function in several tumors . currently , positron emission tomography ( pet ) scans are performed to evaluate glucose uptake by cancer cells . f - fluorodeoxyglucose is a glucose analog that is used in pet to determine the anatomical and metabolic properties of tumors .29,30 thus , enhanced glycolysis of tumor cells can be detected , which is valuable in the diagnosis , staging , assessments of recurrence and response to therapy of many malignancies .30,31 tumors that express low levels of glut1 , however , pose a challenge for evaluations by pet scan . this study was performed to measure glut1 immunoexpression in 1955 samples of malignant tumors of various origins and locations and to evaluate its diagnostic value by immunohistochemistry . we obtained 1955 cases of malignant tumor from the archives of the department of anatomic pathology , hospital a.c . the primary sites , histological types and the number of samples evaluated are shown in table 1 . representative areas were obtained in 2 cores ( 2 mm each ) for each tumor . the original blocks were retrieved from the hospital archives and used to construct the tissue microarrays ( tmas ) . the tma blocks were sectioned onto coated slides ( starfrost , lowestoft , uk ) at a thickness of 4 m using adhesive tape for subsequent uv crosslinking ( instrumedics inc , hackensack , nj , usa ) , dipped in a layer of paraffin to prevent oxidation and stored at 20c . one section was stained with hematoxylin and eosin to evaluate the morphology of each spot and the remaining slides were used in the immunohistochemistry study . the sections were immunostained for glut1 using a polyclonal antibody and the advance polymeric visualization system ( dako , ca , usa ) . two slides from the same tma block , separated by 40 sections , were stained . the sections were dewaxed , rehydrated and antigens retrieved into citrate buffer , ph 6.0 , for 15 minutes in a pressure cooker ( pascal , dako ) . after being cooled at room temperature and washed in water for 5 minutes , the sections were quenched in h202 to block endogenous peroxidase activity , followed by protein block for 20 minutes . the primary antibody was applied for 2 hours at room temperature and the stains were visualized with 3,3 - diaminobenzidine tetrachloride for 5 minutes . the slides were counterstained lightly with hematoxylin , dehydrated in ethanol and xylene and mounted with cover slips using permanent mounting medium . in negative control slides , the primary antibody was nonimmune igg , with erythrocytes , which were present in every section , serving as internal controls . semiquantitative analysis was performed , as previously described ,30,32,33 wherein tumors with up to 10 % of cells stained were considered to be negative and those with more than 10 % were positive . we obtained 1955 cases of malignant tumor from the archives of the department of anatomic pathology , hospital a.c . the primary sites , histological types and the number of samples evaluated are shown in table 1 . representative areas were obtained in 2 cores ( 2 mm each ) for each tumor . the original blocks were retrieved from the hospital archives and used to construct the tissue microarrays ( tmas ) . the tma blocks were sectioned onto coated slides ( starfrost , lowestoft , uk ) at a thickness of 4 m using adhesive tape for subsequent uv crosslinking ( instrumedics inc , hackensack , nj , usa ) , dipped in a layer of paraffin to prevent oxidation and stored at 20c . one section was stained with hematoxylin and eosin to evaluate the morphology of each spot and the remaining slides were used in the immunohistochemistry study . the sections were immunostained for glut1 using a polyclonal antibody and the advance polymeric visualization system ( dako , ca , usa ) . two slides from the same tma block , separated by 40 sections , were stained . the sections were dewaxed , rehydrated and antigens retrieved into citrate buffer , ph 6.0 , for 15 minutes in a pressure cooker ( pascal , dako ) . after being cooled at room temperature and washed in water for 5 minutes , the sections were quenched in h202 to block endogenous peroxidase activity , followed by protein block for 20 minutes . the primary antibody was applied for 2 hours at room temperature and the stains were visualized with 3,3 - diaminobenzidine tetrachloride for 5 minutes . the slides were counterstained lightly with hematoxylin , dehydrated in ethanol and xylene and mounted with cover slips using permanent mounting medium . in negative control slides , the primary antibody was nonimmune igg , with erythrocytes , which were present in every section , serving as internal controls . semiquantitative analysis was performed , as previously described ,30,32,33 wherein tumors with up to 10 % of cells stained were considered to be negative and those with more than 10 % were positive . glut1 expression patterns varied between malignant tumor samples ( figure 1 and table 1 ) . sarcomas , lymphomas , melanomas and hepatoblastomas did not express glut1 ( figure 2 and table 1 ) . however , in adenocarcinoma , cytoplasmic and diffuse patterns of staining were observed concomitantly with membranous staining ( figure 3 ) . in 195 prostate tumors , the proportion of glut1 - positive : glut1 - negative tumors was 92103 ( 47 % positive ) , 2560 in 85 cases of thyroid tumor ( 29 % positive cases , 35 % of which were papillary and 19 % follicular tumors ) , 38339 in 377 gastric tumor samples ( 10 % positive , 17 % of which were intestinal and 14 % diffuse tumors ) and 13254 in 267 breast tumor cases ( 5 % positive ) ( figure 3 ) . conversely , squamous cell carcinomas expressed glut1 exclusively in the membrane . in 172 cases of head and neck tumors , the proportion of glut1 - positive : glut1 - negative cases was 62110 ( 36 % positive ) compared with 6995 in 164 cervix uterine samples ( 42 % positive ) ( figure 3 ) . glioblastoma and retinoblastoma samples showed membranous glut1 expression in 16 of 86 cases and 12 of 128 ( 18.6 % and 9.4 % positive cases ) , respectively . glucose transporters , such as glut1 , mediate basal glucose transport in cancer cells , regulating the maintenance of energy metabolism in the cells located in limited supply tissue regions .34 hypoxia ( low tissue oxygen pressure ) is a hallmark of various cancers and is often associated with disease progression . thus , tumors respond to hypoxic conditions by activating genes that regulate glycolysis and glucose transport .35 malignant cells require high energy levels via glycolytic generation of atp to proliferate and survive . in cancer - induced starvation , glut1 overexpression governs mechanisms that favor tumor growth at the expense of host tissues .36,37 thus , we examined glut1 expression , because higher levels of glut1 in cancer indicate a poor prognosis .38,39 this study performed a novel examination of glut1 expression in several tumor types . glut1 expression and its function have not been previously reported in most of the tumors that we examined . we analyzed several primary sites and histological types of tumors ( 1955 tumors of 12 histological types ; see table 1 for reference ) and observed that glut1 expression varied between tumor types . glut1 was evaluated by immunohistochemistry using a standardized scale , which considers tumors in which more than 10 % of cells per field are stained to be positive .30 - 33 the patterns of glut1 expression in adenocarcinomas and squamous cell carcinomas differed in location and frequency in tumor cell compartments . the highest frequency of glut1 expression was observed in prostate ( 47 % ) and thyroid tumors ( 29 % ) . some groups evaluated glut expression in human prostate cancer , noting glut1 and glut12 mrna and protein expression .40 also , they observed membranous and cytosolic glut1 and glut12 expression in prostate carcinoma cell lines , demonstrating glut1 colocalization with the golgi . recently , jans et al. 41 suggested that cytoplasmic glut1 expression is an important prognostic factor . they showed that patients with elevated levels of glut1 have significantly shorter times before biochemical recurrence after radical prostectomy . nevertheless , it is unknown whether elevated glut1 expression accurately reflects the hypoxic state of the tumor ( the hypoxic state influences disease progression ) or whether elevated glut1 levels are an indication of the altered metabolic state of tumor cells . regardless , cytoplasmic glut1 expression can be used as a prognostic marker in prostate cancer .40,42 our prostate adenocarcinoma samples showed robust cytoplasmic glut1 expression , consistent with other reports . but , the significance of cytoplasmic glut1 expression in several tumors is unknown , because it is active as a transporter only in the cell membrane . recently , taganaka and frommer43 examined whether glucose transporters that are destined for the plasma membrane are active during endoplasmic reticulum transit , concluding that gluts mediate endoplasmic reticulum glucose transport en route to the plasma membrane . we grouped thyroid adenocarcinoma cases into 2 subtypes papillary ( 35 % positivity ) and follicular ( 19 % positivity ) both of which showed glut1 cytoplasmic expression . similarly , a study44 analyzed 268 cases of thyroid carcinoma by immunohistochemistry and observed that papillary carcinoma cells had membranous staining patterns ( 19 % ) and some cytoplasmic staining ( 52 % ) . moreover , they noted glut1 expression in 5 % of follicular carcinomas but that all follicular adenomas and adenomatous goiters were negative . their results suggest that glut1 can be used to distinguish papillary and follicular carcinomas and benign diseases . also , glut1 might aid the determination of papillary carcinoma and lymph node metastasis ; its membranous expression appears to have greater clinical value than its cytoplasmic expression .44 another study45 analyzed the expression of several glut isoforms in tumor cell lines from anaplastic , papillary , follicular and medullary human thyroid carcinomas . glut1 mrna was expressed in malignant tissues and was the most prevalent isoform in less - differentiated cells .45 ten per cent of gastric tumors ( including intestinal and diffuse tumors ) are positive for glut1 , generating cytoplasmic patterns . in 2001 , kawamura et al. 46 evaluated 667 gastric tumors ( including 50 tubular gastric adenomas and 617 gastric carcinomas ) by immunohistochemistry and showed that 182 gastric carcinomas , but none of the tubular gastric adenomas , expressed glut1 . moreover , in an analysis of clinicopathological characteristics , glut1 was expressed late in carcinogenesis , increasing with disease progression . the authors considered only membrane - specific reactions to be positive .46 subsequently , wei et al. 47 examined glut1 expression in gastric carcinomas and observed a stronger correlation between expression and clinical parameters , suggesting that glut1 is a prognostic factor . in our study , we evaluated many samples and noted robust cytoplasmic staining and , additionally , some gastric tumors showed membranous staining . glut expression48 - 54 has been correlated to tumor grade in breast cancer .54,55 hao et al. 56 linked glut1 overexpression and progression of breast carcinoma . however , glut1 is absent in fibroadenoma and hyperplastic lesions , suggesting it as a target for treatment . groves et al. 57 examined the correlation between f - fdg uptake and glut1 or cd105 expression in 20 patients with early breast cancer , observing a poor association . a stronger correlation was noted between cd105 , a marker of angiogenesis , and pet results in patients with early breast cancer . no significance was observed in glut1 analysis . in our experiments , only 5 % of breast tumors ( 13/254 samples ) expressed glut1 . because we did not assess the clinical characteristics of our patients , we could not determine whether the smaller number of glut1 - expressing samples was due to variations in disease status and development . also , several compounds have been reported to regulate glucose transporter expression in breast cancer , such as hypoxia , estradiol and epidermal growth factor .7 polymorphisms in glut1 have also been considered as a regulator of expression . grabellus et al. 58 analyzed 3 glut1 polymorphisms and observed increased glucose uptake in samples that harbored the xbai g t single nucleotide polymorphism by pet . they did not assess glut1 levels but noted that glut1 polymorphisms interfered with glucose uptake in tumors . however , the variability in glut1 expression in breast tumor must be further examined . in general , we observed adenocarcinomas with cytoplasmic glut1 expression ( with or without continuous staining of the membrane ) . this expression profile has not previously been described in tumors , necessitating further investigation of its effects on tumor behavior and biology . head and neck ( 36 % ) and cervix uterine squamous cell carcinomas ( 42 % ) showed significant membranous staining in our samples . glut1 function in squamous cell carcinoma biology and behavior is being examined by our group . similarly , baer et al. 59 noted consistent overexpression of glut1 ( 100 % ) in 48 biopsy specimens from patients with laryngeal invasive carcinoma ; this expression does not influence survival rates . glut1 is highly expressed in squamous cell carcinomas of the head and neck ( hnsccs ) .60 that glut1 expression increases in dysplastic lesions and sustains its expression in squamous cell carcinoma indicates that changes in glut1 levels represent early events during the development of hnsccs . the study authors concluded that glut1 is a reliable marker in the diagnosis of premalignant lesions of the oropharyngeal mucosa . recently , we demonstrated that higher glut1 expression in oral squamous cell carcinoma is associated with poor prognosis .61 few studies have examined glut expression in melanomas , lymphomas , sarcomas and hepatoblastomas , and some of these concluded that glut1 levels in melanoma samples by immunoblotting contribute to variability in the responses of these tumors to treatment .62 glut1 is also expressed in sarcomas , detected in 50 % of intrauterine leiomyosarcomas and 25 % of extrauterine sarcomas by immunohistochemistry . glut1 positivity correlates closely with aggressive biological behavior , reflected by distant metastatic spread .63 our samples comprised a wide and heterogeneous group of sarcomas , but we failed to detect glut1 in any of these cases . there was no detectable expression of glut1 in our sarcoma , melanoma , hepatoblastoma or lymphoma samples , which suggests that another glucose transporter maintains glycolytic metabolism in these tumors or that glut1 is expressed at specific stages of carcinogenesis . recent studies with pet have shown that primarily t - cell lymphomas and indolent malignant lymphomas have lower metabolic activity .64,65 our group examined glut3 expression in non - hodgkin lymphoma samples , observing higher levels in tumor cells ( data not shown ) . also , some studies have shown that prostate adenocarcinomas preferentially express glut12 , in association with lower levels of glut1 .66 we can not reject the hypothesis that inhibitory elements block glut1 protein , such as post - transcriptional regulatory factors , glut1 polymorphisms and epigenetic events . nevertheless , glut1 can be a useful marker for the differential diagnosis of negative tumors and others . to this end , pet scans are useful in determining the prognosis of several tumors , as described for breast , lymphomas , thyroid , oral squamous cell carcinomas and other cancers ,33,41,56,58,67 providing anatomical and metabolic data on tumors . pet scans have provided indirect evidence about the function of glut1 in carcinogenesis , and several studies have correlated glucose analog ( f - fdg ) uptake and tumor aggressiveness .68 - 70 thus , this technique demonstrates the value of f - fdg as a prognostic factor for hepatocarcinomas , breast and colorectal cancers , thymic epithelial tumors and other cancers . tumors that express little or no glut1 may pose a challenge for pet scan analysis for example , when tumors express another glucose transporter that can not be recognized or does not have affinity for f - fdg . our results suggest that immunohistochemical staining of glut1 can identify patients for evaluation by pet . similarly to other reports , our results demonstrate variable glut1 expression in different tumor types . yet , we believe that its absence in sarcomas , melanomas , hepatoblastomas and lymphomas suggests that other glucose transporters regulate the glycolytic pathway in these tumors . financial support was provided by coordenao de aperfeioamento de pessoal de nvel superior ( capes ) and fundao de amparo pesquisa no estado de so paulo ( fapesp ) . we also are thankful for jos i. neves , carlos f. nascimento and severino s. ferreira for their expert technical assistance .\noutput:\n" }, { "from": "agent", "value": "objective : to analyze glucose transporter 1 expression patterns in malignant tumors of various cell types and evaluate their diagnostic value by immunohistochemistry.introduction : glucose is the major source of energy for cells , and glucose transporter 1 is the most common glucose transporter in humans . glucose transporter 1 is aberrantly expressed in several tumor types . studies have implicated glucose transporter 1 expression as a prognostic and diagnostic marker in tumors , primarily in conjunction with positron emission tomography scan data.methods : immunohistochemistry for glucose transporter 1 was performed in tissue microarray slides , comprising 1955 samples of malignant neoplasm from different cell types.results : sarcomas , lymphomas , melanomas and hepatoblastomas did not express glucose transporter 1 . forty - seven per cent of prostate adenocarcinomas were positive , as were 29 % of thyroid , 10 % of gastric and 5 % of breast adenocarcinomas . thirty - six per cent of squamous cell carcinomas of the head and neck were positive , as were 42 % of uterine cervix squamous cell carcinomas . glioblastomas and retinoblastomas showed membranous glucose transporter 1 staining in 18.6 % and 9.4 % of all cases , respectively . squamous cell carcinomas displayed membranous expression , whereas adenocarcinomas showed cytoplasmic glucose transporter 1 expression.conclusion : glucose transporter 1 showed variable expression in various tumor types . its absence in sarcomas , melanomas , hepatoblastomas and lymphomas suggests that other glucose transporters mediate the glycolytic pathway in these tumors . the data suggest that glucose transporter 1 is a valuable immunohistochemical marker that can be used to identify patients for evaluation by positron emission tomography scan . the function of cytoplasmic glucose transporter 1 in adenocarcinomas must be further examined ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: dysfunction in the quality and the quantity of saliva has deleterious effects on the oral ecological system .1 , 2 a total amount of 1 l to 1.5 l of saliva is produced each day by 3 major paired glands the parotid , the submandibular , and the sublingual glands . the parotid glands are composed primarily of serous acini and produce a watery like secretion , whereas the sublingual and submandibular glands are composed of both serous and mucous acini . serous acini are considered more sensitive and immediately degenerate after radiation .1 , 2 because of this , as soon as radiation therapy is begun , the patient s saliva will become thicker . however , as radiation therapy continues , mucous cells are also affected and the quantity of saliva also decreases .2 , 3 the severity of xerostomia is related to the radiation dose , dose rate and amount of salivary tissue irradiated . during radiotherapy of a salivary gland tumor , if the salivary glands of the opposite side are not in the direct field of the radiation beam , the xerostomia will not be severe .2 , 3 , 4 in patients undergoing radiation therapy , decreased secretion of saliva and the change in the oral micro flora may increase the risk of dental caries . therefore , it is important that dentists be aware of the potential oral problems that may occur following head and neck radiation therapy since appropriate treatment will minimize or eliminate complications .2 , 5 it is reported that the initial caries usually occur around the third week of treatment . since there is no definite treatment modalities introduced to prevent dental caries in patients receiving radiation therapy , we sought to determine the prevalence of posterior class v caries in these patients on the third week of the radiation therapy . the present study was a clinical trial carried out in imam khomeini hospital , tabriz , iran . twenty - seven patients with head and neck malignancies referring to the department of radiotherapy from december 2005 to december 2006 , with caries - free intact posterior teeth were included in this study , after they granted an informed written consent . the exclusion criteria were as follow : ( 1 ) edentulism ; ( 2 ) history of drug abuse ; ( 3 ) history of saliva - reducing medications use ; and ( 4 ) uptake of substances decreasing the ph of saliva . the radiotherapy of these patients was a conventional external procedure , in which the nasopharynx and lymph nodes of the neck received cobalt 60 ( 4 mv ) radiation with two lateral fields , which consisted of initial dose of 4400 - 4500 cgy in 25 fractions , comprising 180 - 200 cgy daily . then , after a ten - day interval , the radiation field was tapered and the treatment continued until the dose reached to 6500 - 6700 cgy . dental examination was carried out in three stages : before treatment , 3 weeks after the initiation of the treatment , and at the end of treatment . the condition of posterior class v decays was evaluated using an explorer under artificial light based on the color and the consistency of the lesion . data were presented using descriptive statistics ( mean standard deviation ) . paired sample t - testwas used to compare mean percentage of decayed teeth between 3 weeks after the initiation of the treatment and the end of radiotherapy . pearson s correlation coefficient was used to evaluate the association between age and the rate of radiation caries . spss 14.0 was used for data analysis and p - values 0.05 was considered statistically significant . a total of 27 patients ( male : 16 [ 59.3 % ] , female : 11 [ 40.7 % ] ; mean age : 45.211.4 ) participated in this study . the results of the paired sample t - test indicated that the differences in the mean percentage of class v decays in patients between 3 weeks after the initiation of the treatment and at the end of the treatment was statistically significant ( p 0.05 , df = 26 , t = 9 ) . based on the results of pearson s correlation coefficient analysis , there was no statistically significant association between the patients age and the increase of posterior class v caries in 3 weeks after beginning of the treatment ( p = 0.18 , n = 21 , r = 0.37 ) . however , a statistically significant association between age and increase in posterior class v was seen at the end of the treatment ( p 0.05 , n = 82 , r = 0.61 ) . malfunction of salivary glands subsequent to radiation therapy of head and neck malignancies is a major problem . the present study addressed the radiotherapy - induced dental caries in patients with head and neck malignancies , in whom the salivary glands were in the radiation field . the results showed that the rate of dental caries 3 weeks after the initiation of treatment and at the end of treatment was statistically higher than the rate before treatment . the rate of caries at the end of treatment was also significantly higher than the rate 3 weeks after the beginning of the radiotherapy . these finding are in accordance with the results of other studies .8 - 11 radiation caries is mainly an indirect effect of irradiation - inducedchanges in salivary gland tissue that result in hyposalivation . therefore , prevention of hyposalivation will invariablycontribute to the prevention of radiation caries . hyposalivation lead to accelerated dental caries through changes in salivary composition , a shift in oral flora toward cariogenicbacteria and dietary changes . decrease in salivary flow rate has been attributed to the destruction of cells in serous acini in a recent study by yee et al . they introduced the received radiation dose as the most important factor involved in radiotherapy - induced xerostomia . nagler stated that the complications of radiotherapy manifested in the salivary glands secondary to oropharyngeal syndrome . the syndrome consists of transient severe mucositis , resulting in dehydration , malnutrition and inadequate chewing of food due to intense pain . in accordance with this , another study attributed the noticeable decrease in salivation to the death of cells in serous acini . it has been shown severe demineralization of enamel with dentinoenamel junction involvement occurs in patients with radiation - induced xerostomia . in addition , a study on radiation caries indicated that caries appear in all tooth surfaces rather than proximal surfaces . regarding the use of similar doses , we consider the same mechanisms to be involved in our study . researchers have attributed the inconsistent results to differences in the case selection and also inclusion of patients taking medications that influence salivation . the results of the present study regarding the effect of age on the salivary flow rate and also the posterior class v dental caries , was similar to the results of another study . unstimulated salivary flow rate decreases with age , which can be attributed to the destruction of the parenchyma of the glands .14 , 15 further studies are warranted to evaluate the effects of new techniques such as modulated intensity radiotherapy on occurrence of dental caries , in which a higher dose is beamed at the tumor site without increased received dose of the surrounding tissues . the results of the present study revealed that patients with head and neck malignancies will experience class v dental caries on their posterior teeth subsequent to radiation therapy .\noutput:\n" }, { "from": "agent", "value": "background and aims salivary glands are very susceptible to radiation and any disturbances in their function are detrimental to the hard tissues in the oral cavity . the aim of this study was to evaluate posterior class v dental caries in patients with head and neck cancers undergoing radiotherapy . materials and methods in this study , twenty seven patients undergoing conventional radiotherapy were included . class v dental caries of posterior teeth in these patients were evaluated in three intervals : before treatment , 3 weeks after the initiation of the treatment , and at the end of the treatment . differences of mean caries activity between intervals were evaluated using paired sample t - test . results there were no class v decays prior to radiotherapy . mean percentage of class v caries three weeks after radiotherapy and at the end of radiotherapy were 28.42 % 14.41 and 67.05 % 19.02 , respectively . there were statistically signifi - cant differences in mean values among three stages ( p = 0.00025 ) . conclusion the results of the present study re - vealed that radiotherapy in patients with head and neck cancers causes class v dental caries on posteri - or teeth ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we carried out a prospective , unblinded study in six healthy volunteers at the prince of wales hospital in shatin , hong kong . we compared the filtration capacity of the stryker t4 and stackhouse freedomaire surgical helmets with an 8233 n100 filtering facepiece respirator ( 3 m , st . approval was obtained from the clinical research ethics committee of the chinese university of hong kong . each test measured the ability of the device to filter ambient dust particles , normally present in room air , by using a previously described standard , quantitative , fit - testing protocol ( 9 ) . in brief , the testing compared particle counts inside and outside the protective device during a series of activities normal breathing , deep breathing , turning the head from side to side , flexing and extending the head , talking loudly , and bending over followed by normal breathing . the tube for sampling the mask particle count was connected to a test probe designed for this purpose ( tsi incorporated , st . paul , mn ) , which was inserted through the fabric of the protective device . on the n100 respirator , the probe was passed through both the respirator and covering surgical mask 1 cm to the right of the valve . on the surgical helmets , the probe was placed centrally in the breathing zone 1 cm below the bottom edge of the transparent face piece . the tube for sampling the ambient particle count was fixed approximately 3 cm from the sampling probe . no participant had been previously fit tested on this brand of n100 respirator ; however , all participants received instructions on donning both the respirators and the surgical helmets before use . before each test we checked that all participants were wearing their devices correctly . a portacount plus ( tsi incorporated ) connected to a computer running fitplus for windows software ( tsi incorporated ) was used to count particles and calculate the ratio of ambient - to - device particle counts . this device counts all particles between 0.02 and 1 m in diameter ; it also calculates a fit factor , which is the average ratio of ambient - to - device particle concentrations . the equation used is where : n is the number of exercises performed and ffj is the fit factor for the individual exercise . the reusable tubing supplied by the manufacturer was replaced with disposable polyvinyl chloride ( pvc ) tubing of the same internal diameter and length to minimize any risk for cross - infection . to ensure an adequate ambient particle count , the 8026 particle generator ( tsi incorported ) when the surgical helmet - hood combinations were being tested , the helmet and hood were put on and then a disposable surgical gown ( microcool specialty gown , kimberly - clark , roswell , ga ) was worn over the top of the hood , in accordance with the manufacturer s instructions . since buildup of carbon dioxide has been found to be a problem with these helmets ( 10 ) , the highest fan speed was used throughout the testing . during testing of the n100 mask , the participants wore a standard three - ply surgical mask ( surgicos johnson & johnson , arlington , tx ) tied over the top ( since the n100 mask is not licensed for use as a surgical mask ) and a full face shield ( splash shield , woburn , ma ) . the median ratios of ambient - to - device particle counts were compared by using the mann - whitney u test ( statview 5.0 , sas institute , cary , nc ) . during the tests , the median ambient concentration of 0.02 - to 1 - m particles was 7,650 / cm ( range 3,98029,200 / cm ) . results of the filtration capacity of the three devices are shown in the table . in all tests , the n100 mask filtered significantly more particles than either of the surgical helmet - hoods . during testing , a half - face respirator , such as the n100 mask , should reduce the particle count by a minimum of a factor of 100 ( 11 ) . the greatest particle count reduction achieved with a surgical helmet - hood was a factor of 4.8 . ratios for stryker t4 and stackhouse freedomaire were significantly lower in all tests compared to the combination of n100 mask , surgical mask , and face shield ( p 0.004 . ) our data demonstrate that both surgical helmet - hoods have markedly inferior in vivo filtration performance compared to the combination of n100 mask , surgical mask , and face shield . more importantly , both surgical helmet - hoods failed in all cases to meet the national institute for occupational safety and health performance requirement for even a half - mask respirator . clearly , this failure rate would be unacceptable if these devices were to be considered for use as respirators . neither surgical helmet is approved as a respirator nor marketed as a method of protecting the user against respiratory pathogens . in fact , stryker recommends that its helmet be used in combination with additional eye and respiratory protection in this setting ( available from : url : http://sars.medtau.org/strykerreport.doc ) . first , we tested filtration of particles , not the coronavirus postulated to cause sars . in addition , it is impossible to be certain what size of particles the surgical helmet - hoods were failing to adequately filter , nor is it obvious which particle size is most important to filter , since many aerosolized particles will be larger than a naked coronavirus . it is therefore conceivable , but we believe unlikely , that the surgical helmet - hoods would efficiently filter coronavirus - containing particles . second , we modified the portacount plus by using disposable tubing rather than reusable tubing . as the disposable tubing and the tubing supplied by the manufacturer are both pvc , and of the same internal diameter and length , this change is unlikely to have made a difference in the results . sars is believed to be transmitted by contact of the virus with mucosal surfaces such as the eyes , as is the case with other respiratory viruses such as respiratory syncytial virus ( 12 ) . although both surgical helmet - hoods reduce the particle count compared to ambient counts , we believe this benefit may be counteracted by the fact that both devices direct a flow of gas into the eyes . finally , the high particle count inside the hoods might have been due to the fan s blowing particles off the hood material , the wearer s head , or even the fan itself . in further experimentation , we found that when the surgical helmet was worn inside a papr system , the particle count inside the helmet was low , regardless of whether the fan was turned on or off ( j. l. derrick & c.d . particles might also be drawn up from under the hood rather than through the hood material . in this case , the exact mechanism of entry would be irrelevant , as in both cases the indrawn air would be potentially contaminated if the patient had sars . our data indicate that neither the stryker t4 nor the stackhouse freedomaire helmet - hood filters enough particles of 0.021 m in diameter to meet the standard for protective respirators . as the size of coronaviruses falls within this range ,\noutput:\n" }, { "from": "agent", "value": "performance testing of two brands of surgical helmets indicated that their efficiency at in vivo filtration of sub micrometer - sized particles is inadequate for their use as respirators . these helmets are not marketed for respiratory protection and should not be used alone for protection against severe acute respiratory syndrome when performing aerosol - generating procedures ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: adrenal - renal fusion is a rare entity infrequently described , usually as an incidental pathologic or radiologic finding . the patient is a 59 - year - old man from bosnia with a two decade history of hypertension refractory to a combination of four high - dose antihypertensive medications . he had concomitant hypokalemia , reaching a nadir of 2.2 meq / l in 2009 , requiring significant daily supplementation . computed tomography ( ct ) of the abdomen at that time identified multiple bilateral low - attenuating adrenal lesions . elevated plasma aldosterone - to - renin concentration ratio ( pac / prc ) confirmed primary hyperaldosteronism . the pac / prc worsened , and in 2013 , it reached a peak of 281 . a repeat ct at that time revealed an enlarging right adrenal lesion [ figure 1 ] . adrenal venous sampling ( avs ) revealed an aldosterone to cortisol ratio of 1.4 and 12.2 in the left and right adrenal veins , respectively , for a cortisol - corrected aldosterone ratio of approximately nine . the patient was referred to surgery given that the workup suggested a right aldosterone - producing adrenal adenoma in the setting of bilateral adrenal hyperplasia . ct abdomen revealing a smooth round low - attenuating lesion of the right adrenal gland with close approximation of the inferolateral aspect of the right adrenal gland and superior pole of the right kidney in may 2014 , the patient underwent laparoscopic right adrenalectomy . during dissection along the inferolateral portion of the adrenal gland it became apparent that the normally avascular plane between the adrenal and renal capsule was absentinstead , there appeared to be a dense fibrotic adhesion between the surfaces of the two organs . electrocautery dissection to include a portion of the superior pole of the kidney into the specimen was required for complete excision of the adrenal gland [ figure 2 ] . the patient tolerated the procedure well , postoperative laboratories revealed normokalemia without supplementation , and a 24 - hour urine aldosterone level of less than 1.5 mcg / 24 h confirmed the resolution of hyperaldosteronism . the patient 's blood pressure was within normal limits with decreasing antihypertensive administration 1 month after excision . pathologic evaluation of the specimen confirmed multinodular adrenal cortical hyperplasia and partial adrenal - renal fusion [ figure 3 ] without evidence of adrenal heterotopia . gross specimen of adrenal gland with adjacent renal tissue from the superior pole of the right kidney hematoxylin and eosin staining revealing normal appearing adrenal cortical cells ( left ) and renal cells , including glomeruli ( right ) , fused , without intervening fibrous capsulerokitansky first described adrenal - renal fusion in 1855 , differentiating congenital lesions from those acquired secondary to postinflammatory fibrosis of perirenal fat . its true incidence remains unknown as most reported cases are incidental findings on autopsy . in 1976 , honor et al . presented the first and only case report other than this one in the surgical literature of isolated adrenal - renal fusion , proposing that the congenital lesion is likely due to failure of the retroperitoneal mesenchymal tissue to stimulate capsule formation . to date , only four other cases have been reported , though all were in the setting of synchronous heterotopias . the former describes ectopic adrenal tissue whereas the latter describes incomplete encapsulation of those two organs involved with histologically adjacent functional tissue . the case presented is , to our knowledge , the only published account in english literature of in vivo identification of adrenal - renal fusion . this is only the second case in the literature to describe isolated adrenal - renal fusion . from a surgical perspective , unexpected loss of plane between the two organs may be concerning for invasive malignancy , which would require a more extensive resection . intraoperative frozen section of the fused adrenal tissue may appear similar to cystic renal cell carcinoma , leading to conversion to open radical nephrectomy , as in one previous report . ideally , the surgeon would be able to preoperatively identify which patients undergoing laparoscopic adrenalectomy may have renal - adrenal fusion . in our case , in retrospect , the adrenal gland abutted the superior pole of the kidney on ct in the area that was fused in a way that suggested the fusion that we encountered at the time of surgery . this mirrors the ct finding in the only other case of isolated adrenal - renal fusion . further study is required to determine if this is a reliable indicator of renal - adrenal fusion . regardless , awareness of this anomaly , during preoperative imaging and during intraoperative dissection , may help avoid the morbidity of unnecessary total or partial nephrectomy .\noutput:\n" }, { "from": "agent", "value": "adrenal - renal fusion is a rare entity defined as incomplete encapsulation of the adrenal gland and kidney with histologically adjacent functional tissue . this report describes the first published intraoperative identification of this anomaly during laparoscopic adrenalectomy . the patient was a 59 - year - old man with chronic hypertension refractory to multiple antihypertensives found to be caused by a right - sided aldosterone - producing adrenal adenoma in the setting of bilateral adrenal hyperplasia . during laparoscopic adrenalectomy , the normal avascular plane between the kidney and adrenal gland was absent . pathologic evaluation confirmed adrenal - renal fusion without adrenal heterotopia . identified intraoperatively , this may be misdiagnosed as invasive malignancy , and thus awareness of this anomaly may help prevent unnecessarily morbid resection ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in 1963 , rowell et al . described a distinctive subset of patients with lupus erythematosus ( le ) consisting of erythema multiforme - like skin lesions , anti - la ( ss - b ) / anti - ro ( ss - a ) antibodies , positive serum rheumatoid factor and a speckled pattern of antinuclear antibodies . though its progression to acute le has been documented , progression to anti - double - stranded dna ( ds - dna ) negative lupus nephritis has not been reported till date . an 18 - year - old female presented with fever since 1 month and rash over face and forearms since 3 weeks . the patient was apparently all right prior to 1 month , when she developed high - grade continuous fever . three days later she developed blisters and red lesions over face and forearms and blackish lesions over forearms . she did not give any history of joint pains , decreased urine output and hematuria , chest pain , dyspnea , cough or no history of spontaneous bleeding tendencies . lesions over the face are in the form of palpable purpura , scars and targetoid lesions [ figure 1a and b ] . purpuric and targetoid lesions were also seen over the arms [ figure 2a ] and chest . non - tender erythematous macules and targetoid lesions were seen over palms [ figure 2b ] . nail - fold capillaroscopy revealed proximal nail fold erythema , ragged cuticles , and capillary telangiectasia and nail - fold infarcts [ figure 4a c ] . ( a ) clinical photograph showing scars and targetoid lesions over face and crusting over lower lip . ( b ) clinical photograph of face showing scars and targetoid lesions on closer view ( a ) clinical photograph showing scars and targetoid lesions and palpable purpura over arm . ( b ) clinical photograph showing non tender erythematous macules and targetoid lesions were seen over palms crusting erosions and edema were seen over lips ( a ) nail fold capillaroscopy showing erythema , telangiactasia , ragged cuticles and infarcts over proximal nail fold . ( c ) nail - fold capillaroscopy showing nail fold infact on higher magnification systemic examination was normal . complete hemogram and urine examination were normal except for a raised esr of 30 mm / hour . anti - nuclear antibody was positive with a titer of 1:160 and showed a speckled pattern . anti- ro antibody was found to be negative with a titer of 11 u / ml ( titer of 10 u / ml is considered positive by immunofluorescence method ) . histopathological examination of the biopsy specimen taken from targetoid lesion over the forearm revealed orthokeratosis , focal hypergranulosis , basal cell vacuolar degeneration , lymphohistiocyic infiltrate at the dermo epidermal junction with pigment incontinence [ figure 5a and b ] . ( a ) section from targetoid lesion showing orthokeratosis , focal hypergranulosis , basal cell vacuolar degeneration , lymphohistiocyic infiltrate at the dermo epidermal junction with pigment incontinence ( h and e 10x ) . ( b ) section from targetoid lesion showing basal cell vacuolar degeneration with lymphohistiocytic infiltrate at dermoepidermal junction ( h and e 40x ) a diagnosis of rowell 's syndrome was made on the basis of clinical and laboratory findings . the patient was duly started on tablet hydroxychloroquine 200 mg twice daily and tablet prednisolone at 30 mg which was gradually tapered was gradually tapered to 5 mg over a period of 6 months . four months later , she developed recurrence of lesions on face , chest , back , arms and ears . erythematous papules with dusky red hue were seen over the concha of ears and forearms . twenty - four hour urine protein examination revealed 472 grams of protein per 24 hours ( normal range is less than 80 mg per day ) . complement c3 levels were low with a titer of 83.4 mg / dl . ( normal range is 75 - 135 mg / dl ) . histopathology of the kidney revealed increased mesangial cellularity and increased cellular proliferation in few glomeruli with mild basement membrane thickening . there was no evidence of tubular casts , interstitial inflammation or blood vessel thickening [ figure 6 ] . immunofluorescence showed moderate peripheral coarse granular igg , iga and c3 deposits with weak igm deposits . the patient was started on prednisolone 40 mg , tacrolimus 1.5 mg twice daily and ramipril10 mg for one month . withthe above treatment 24 hour urine protein decreased to 744 mg of protein per 24 hours . histopathological section from kidney showing increased mesangial cellularity and increased cellular proliferation in few glomeruli with mild basement membrane thickening . interstitial inflammation and blood vessel thickening was seen . an association of erythema multiforme and le was first noted by scholtz in 1922 . in 1963 , during a study of 120 patients with discoid le , rowell et al . found four patients to have distinctive clinical and immunologic findings that included erythema multiforme - like lesions , chilblain - like lesions , speckled pattern of antinuclear antibodies , positive serum rheumatoid factor , and antibodies to saline extract of human tissues ( anti sjt positivity ) . of the characteristic immunological abnormalities speckled pattern of ana was theanti - sjt positivity has been replaced by anti - ro and anti - la positivity . in 2000 , zeitouni et al . redefined rowell 's syndrome with major and minor criteria . major criteria included i ) le : acute , subacute or discoidii ) erythema multiforme like lesions ( with / without involvement of the mucous membranes ) , iii ) speckled pattern of ana . le : acute , subacute or discoid erythema multiforme like lesions ( with / without involvement of the mucous membranes ) , speckled pattern of ana . i ) chilblains , ii ) anti - ro antibody or anti - la antibody , iii ) positive rf . anti - ro antibody or anti - la antibody , our patient satisfied all three major and one of the minor of the above criteria and also satisfied four of the acr criteria for sle . though originally described in cases of dle , there is now evidence to classify rowell 's syndrome as a type of subacute le rather than a separate entity . the early annular polycyclic lesions of scle may resemble erythema multiforme with similar histopathological and immunologic findings . rowell 's syndrome has been described with all subtypes of le ( systemic , acute , subacute or discoid ) . unidentified hsv , ebv or other viral infections may cross - react with lupus autoantigens and they can initiate the immunologic response , hence triggering the em like lesions in sle . similarly , immunopathogenetic mechanisms described in both diseases may be responsible for the co - occurrence . anti - smith ( sm ) and anti - ds - dna antibodies are considered to be nephritogenic and their correlation with lupus nephritis ( ln ) has been well established . patients with drug - induced ln ( hydralazine ) have been described in the literature to have negative ds - dna and anti - sm antibodies on serological screening . only seven cases of non - drug - induced severe ln with negative ds - dna antibodies are reported . progression of rowell 's syndrome to ds - dna negative ln has not been reported in the literature . nail changes seen at presentation when the patient only had features of rowell 's syndrome have not been documented in previously reported cases . nail changes as seen in our case have not yet been described with rowell 's syndromeour case developed lupus nephritis and was ds - dna negative . ds - dna negativity has not been described in non - drug - induced lupus with cutaneous features . nail changes as seen in our case have not yet been described with rowell 's syndrome our case developed lupus nephritis and was ds - dna negative . ds - dna negativity has not been described in non - drug - induced lupus with cutaneous features .\noutput:\n" }, { "from": "agent", "value": "rowell 's syndrome is now identified as a subtype of subacute lupus erythematosus ( le ) with erythema multiforme - like skin lesions , positive serum rheumatoid factor , anti - ro la positivity and speckled pattern of antinuclear antibodies . here we describe a case of rowell 's syndrome in an 18 - year - old female who was found to be ds - dna negative , who later progressed to develop stage v lupus nephritis ( ln ) over a course of 4 months . although extremely rare , most cases of ln are drug induced . of only seven cases of non - drug induced ln with negative dsdna , none had cutaneous involvement . ours was a unique case of progression of rowells syndrome to ds - dna negative ln ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cystoscopic evaluation of the lower urinary tract is a vital part of an office - based urologic practice . however , regular surveillance cystoscopy is a significant source of morbidity for patients , and therefore attempts have been made to minimize discomfort secondary to this procedure . flexible cystoscopy was first introduced in 1973 as a potentially less painful technique and has since become routine , particularly in men . the current american urological association guidelines on the evaluation of microscopic hematuria recommend cystoscopy in appropriate individuals and report flexible cystoscopy to be associated with less pain or fewer postprocedure complications . as expected , most of the initial studies concerning flexible cystoscopy involved men . the purpose of our study was to compare tolerability of rigid versus flexible cystoscopy in women . we performed a randomized , single - blind , prospective study comparing tolerability of flexible versus rigid cystoscopy in women in an out - patient clinic setting at the university of wisconsin - madison . with full irb approval , women 18 years of age and older were randomized in a patient - blinded manner to rigid or flexible cystoscopy . patients were approached to participate in the study at the time of cystoscopy , and informed consent was obtained . indications for cystoscopy included hematuria , recurrent urinary tract infections , surveillance for cancer , and voiding difficulties . all procedures were performed with the patient in the dorsal lithotomy position with the same sterile preparation utilizing 2 % lidocaine jelly urethral instillation as a local anesthetic . the olympus cyf type v2 flexible cystoscope and acmi m3 series gold rigid cystoscope were utilized in this study . questionnaires were completed just prior to the procedure , immediately after the procedure , and one week later . these addressed pain and the location of pain before , during , and after the procedure rated on a 10 - point ( 10 - cm ) visual analog scale ( vas ) ( figure 1 ) . women who had previously had rigid cystoscopy performed were also asked whether they preferred the current technique or the previous rigid technique . questionnaires obtained one week later addressed duration of symptoms of hematuria , dysuria , and urinary frequency . patients were asked to retrospectively rate their discomfort during the procedure and were also asked whether they had contacted any health providers due to concerns after the procedure . physicians also completed a form evaluating their success at visualizing the bladder completely , listing which scopes where used , and rating the level of difficulty of using the scopes on a 5 - point scale with higher numbers representing more complexity . results were analyzed by using wilcoxon rank sums and fisher 's exact test with sas statistical software version 9 ( sas institute inc . , cary , nc ) . thirty - six women were randomized to rigid ( 18 ) or flexible ( 18 ) cystoscopy . median discomfort of those patients experiencing pain during flexible and rigid cystoscopy was 1.4 and 1.8 , respectively ( p = 0.39 , wilcoxon ) . median recall of pain 1 week later was 0.8 and 1.15 ( p = 0.37 , wilcoxon ) . in terms of peri - procedural painthe overall average pain scores before , during , and after cystoscopy on vas were 0.33 , 1.0 , 0.47 , and 0.16 , 1.71 , 0.67 in patients undergoing flexible versus rigid cystoscopy , respectively . average pain scores for those patients actually reporting discomfort associated with the procedure are shown in table 2 . the average duration of dysuria , hematuria , and frequency amounted to less than a day in both groups , and these differences were not significant when comparing rigid and flexible cystoscopy ( table 3 ) . average ease of examination ( on a 5 - point scale ) as rated by physicians was 1.78 for flexible scopes and 1.65 for rigid scopes ( p = 0.61 , wilcoxon ) . cytology was obtained at the time of cystoscopy in 9 ( flexible ) and 11 ( rigid ) patients and was normal in all cases . indications for cystoscopy patients reporting pain before , during , and after cystoscopy and recall of pain during the procedure on a questionnaire one week later average duration ( in days ) of patients reporting symptoms of dysuria , hematuria , frequency , or all of these although representing a small group , 10 of the patients who had flexible cystoscopy performed had previously had rigid cystoscopy . among these patients , the remainder either noted no difference between techniques ( 5 ) or preferred flexible cystoscopy ( 4 ) . office cystoscopy was utilized in the present study to survey the bladder for a variety of indications , most commonly hematuria and recurrent urinary tract infections . symptoms of dysuria , hematuria , and voiding difficulty following cystoscopy can last several days . while alternatives to cystoscopy such as urinary markers continue to be developed , a recent study indicates that patients are reluctant to forego cystoscopy without tests with 95 % accuracy or better , such that cystoscopy remains an important surveillance tool . although it is anticipated that less invasive modalities will gain wider acceptance , it is important to evaluate methods of minimizing morbidity related to office cystoscopy . prior studies evaluating flexible and rigid cystoscopy have focused on complications , tolerability , and effectiveness . earlier comparisons revealed male patients preferred flexible cystoscopy in the clinic rather than rigid cystoscopy in the operating room with general anesthesia . our current study is unique in that our data were obtained in the form of a randomized , patient - blinded trial in an attempt to minimize bias . furthermore , this study is the first to focus on tolerability of cystoscopy in women in the outpatient ambulatory setting . overall , both techniques are well tolerated by women with pain scores of 1.4 versus 1.8 out of 10 for flexible and rigid cystoscopy respectively . in contrast , flexible cystoscopy in men is better tolerated than rigid cystoscopy , presumably due to urethral length and the angle required to inspect the bladder . in general , excellent tolerability was noted with both techniques with the majority of women reporting minimal discomfort on the vas .60 % of women reported pain less than 2 on a vas when evaluated after flexible cystoscopy . it should be noted that most of the patients in this study [ 14/22 ( 61 % ) ] had previously undergone cystoscopy , which may have affected their perception of discomfort . it is noteworthy that only 1 out of 10 patients undergoing flexible cystoscopy with previous rigid cystoscopy experience actually preferred rigid cystoscopy , whereas 4 preferred flexible cystoscopy and 5 had no preference . furthermore , with flexible cystoscopy , women may be positioned supine in a frog - leg position which could be advantageous in the office setting . as has been shown previously , performing cystoscopy with the patient in the supine position can decrease preparatory and procedural time . because differences in positioning could potentially influence perceptions of pain or discomfort , in our study cystoscopy was performed with the patient in the dorsal lithotomy position to avoid any potential bias in this regard and to maintain blinding for both flexible and rigid techniques . this study was not actually designed to evaluate time elapsed in cystoscopy , although it may follow that with the use of 1 scope as opposed to 2 , the flexible procedure may be faster . this study was also not designed to evaluate the role of local anesthetic in cystoscopy , given recent studies including a metaanalysis of 9 randomized trials indicating no difference in pain perception in patients with local anesthetic versus sterile lubricant alone . in addition to technique , several other aspects of office cystoscopy have been evaluated in relation to patient discomfort , which could potentially confound our findings . for instance , administration of midazolam has been found to be effective in lessening patient discomfort . in this randomized trial , patients were divided into groups in which either flexible or rigid cystoscopy was performed in men and women , although the trial , designed to determine the effectiveness of midazolam , did not directly address flexible versus rigid cystoscopy . another factor that may be significant in affecting patient discomfort is whether patients can observe the monitor during cystoscopy . patient age has also been cited as an important factor in that older patients are generally better able to tolerate cystoscopy . although patient preparation and maintenance costs for rigid and flexible cystoscopy are similar , the purchase price for rigid cystoscopes can be 2 to 3 times less than that for flexible cystoscopes . both flexible and rigid cystoscopes are well tolerated by women . although a benefit for men may be noted with flexible cystoscopy , either the flexible or rigid technique may be used with a comparable pain tolerance and ease of use in women .\noutput:\n" }, { "from": "agent", "value": "purpose : previous studies have evaluated the tolerability of rigid versus flexible cystoscopy in men . similar studies , however , have not been performed in women . we sought to determine whether office - based flexible cystoscopy was better tolerated than rigid cystoscopy in women.materials and methods : following full irb approval , women were prospectively randomized in a single - blind manner . patients were randomized to flexible or rigid cystoscopy and draped in the lithotomy position to maintain blinding of the study . questionnaires evaluated discomfort before , during , and after cystoscopy.results : thirty - six women were randomized to flexible ( 18 ) or rigid ( 18 ) cystoscopy . indications were surveillance ( 16 ) , hematuria ( 15 ) , recurrent utis ( 2 ) , voiding dysfunction ( 1 ) , and other ( 2 ) . all questionnaires were returned by 31/36 women . using a 10 - point visual analog scale ( vas ) , median discomfort during the procedure for flexible and rigid cystoscopy were 1.4 and 1.8 , respectively , in patients perceiving pain . median recalled pain 1 week later was similar at 0.8 and 1.15 , respectively . none of these differences were statistically significant.conclusions : flexible and rigid cystoscopy are well tolerated in women . discomfort during and after the procedure is minimal in both groups . urologists should perform either procedure in women based on their preference and skill level ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it frequently occurs after trauma , hemorrhage , burn or abdominal surgery , which cause a systemic inflammatory response syndrome ( sirs ) . without timely and aggressive therapeutic intervention , sirs and sepsis remain the prime causes of death in intensive care units worldwide , with mortality rates ranging between 30 and 70 % . the initiating event in sepsis may be release of endotoxins ( i.e. , bacterial cell wall lipopolysaccharides ( lps ) ) from gram - negative and gram - positive pathogenic bacteria . lps triggers activation of inflammatory cells , such as polymorphonuclear leukocytes ( neutrophils ; pmn ) , monocytes / macrophages and lymphocytes . it is generally agreed that it is not the bacterial infection itself , but rather the inflammatory response to infection that is the predominant determinant of outcome in sepsis . one of the key features of sepsis is tissue infiltration by phagocytic cells . in this scenario , pmn and monocytes / macrophages respond to septic stimulation by producing reactive oxygen species ( ros ) ( e.g. , superoxide , hydrogen peroxide ) and reactive nitrogen species ( rns ) ( e.g. , nitric oxide ) . in addition , pmn release granular enzymes ( e.g. elastase , cathepsin ) and the myeloperoxidase ( mpo ) - derived oxidant , hypochlorous acid ( hocl ) . all these components may contribute to pmn / macrophage - mediated killing of the bacteria . however , if produced in excess during sirs and sepsis , the ros , rns and proteolytic enzymes cause microvascular dysfunction followed by organ dysfunction ( fig . 1 ) . an inflammatory response to septic stimuli is crucial for host defense , because it up - regulates anti - inflammatory mediators ( e.g. , il - 1 receptor antagonist , il - 4 , il - 10 ) and antioxidant enzymes ( e.g. , catalase , glutathione peroxidase , manganese superoxide dismutase ) . however , excessive production of pro - inflammatory mediators in sepsis overwhelms the anti - inflammatory signaling . this results in suppression of innate immune functions ( especially those of pmn ) and leads to immunoparalysis and subsequently to increased susceptibility to infection . it is important to note that , besides immune cells , microvascular endothelial cells also become activated in sepsis and may contribute to amplification of the inflammatory response . in support to this hypothesis , it has been shown that septic stimuli ( e.g. , lps , tnf - ) initiate activation of transcription factors such as nfb and ap - 1 , resulting in transcriptional activation of multiple genes . this leads to the release of pro - inflammatory cytokines ( e.g. tnf - , il - 1 etc ) , and increased expression of adhesion molecules ( e.g. e - selectin , icam - 1 , vcam - 1 ) and chemokines by endothelial cells . a key role of ros / rns in modulation of the endothelial cell pro - inflammatory phenotype has been highlighted previously ( fig . 1 ) . given the complexity of sirs and sepsis , it is perhaps not surprising that little progress has been made in improving outcome . efforts to block one or other component of the sepsis - associated inflammatory pathways have had little impact on patient survival . future advances in sepsis therapy will depend on improved understanding of the underlying pathophysiology . in this review , we will focus on the early events in the response to septic stimuli of microvascular endothelial cells , the cell type that occurs in all organs . the endothelium provides a non - adhesive and anti - thrombotic surface for blood - born components , including circulating leukocytes . however , during sepsis , the microvascular endothelium is activated to a pro - adhesive and pro - thrombotic phenotype . in addition , septic endothelium becomes both a target and a source of ros and rns , and it thereby contributes to the onset of organ dysfunction . clinically , sepsis is characterized by a severe microvascular dysfunction that persists despite fluid resuscitation . it has been suggested that microvascular dysfunction under septic conditions is closely related to : ( i ) arteriolar hyporesponsiveness to vasoconstrictors and vasodilators , including endothelium - dependent vasodilators ; ( ii ) increased capillary permeability that manifests as a breakdown of the microvascular endothelial barrier ; ( iii ) loss of the anti - adhesive function of endothelial surfaces ; ( iv ) coagulopathy ; ( v ) decreased density of perfused capillaries and elevated proportion of non - perfused capillaries , even in fluid - resuscitated patients with adequate arterial blood oxygenation and cardiac output . tissue hypoxia develops because the diffusion distance for oxygen increases between blood and tissue cells . this may explain why approximately one - third of patients with severe sepsis ( i.e. , sepsis with at least one organ failure or dysfunction ) die of organ failure even when shock is prevented by fluid resuscitation and administration of vasopressor drugs . for example , superoxide is a ros that is synthesized in endothelial cells by the mitochondrial electron transport chain , xanthine oxidase , uncoupled nitric oxide synthases ( nos ) and nadph oxidases . bacterial bloodstream infection exposes endothelial cells to blood - borne endotoxins ( e.g. , e. coli lipopolysaccharide , lps ) and inflammatory cytokines ( e.g. , interferon - , ifn ) . the cells respond to this septic insult by activating endothelial nadph oxidases that synthesize intracellular superoxide . indeed , nadph oxidase activity is the principal source for stimulated production of superoxide in microvascular endothelial cells exposed to septic insult . for example , in microvascular endothelial cell cultures , septic insult ( lps and ifn in combination ; lps + ifn ) increases superoxide levels within 2 h . nadph oxidase evidently is the principal source because the rise in superoxide levels is abolished by nadph oxidase inhibitors ( apocynin and diphenylene iodonium ) but not by inhibitors of mitochondrial respiration ( rotenone ) , xanthine oxidase ( allopurinol ) or nos ( l - name ) . longer incubation ( 12 h ) with lps + ifn increases nadph oxidase activity and nadph oxidase protein expression . increases in intracellular ros , whether caused by acute stimulation of nadph oxidase or by entry of extracellular ros , induce the expression of nadph oxidase subunits that subsequently assemble and produce more ros . dismutation of superoxide forms hydrogen peroxide and nitration of superoxide forms peroxynitrite . compared to superoxide , both hydrogen peroxide and peroxynitrite are strong oxidants and the latter is also a nitrosative stressor . thus , activation of nadph oxidase during sepsis induces oxidative and nitrosative stress in endothelial cells . normally endothelial cells regulate vascular smooth muscle tone by basal rates of production of endothelial nitric oxide synthase ( enos ) - derived nitric oxide and prostaglandin endoperoxide h2 synthase - 1 ( pghs ) -1-derived prostacyclin ( pgi2 ) . nitric oxide directly enters the smooth muscle cell and activates soluble guanylyl cyclase , thereby raising intracellular cgmp . cgmp and camp then mediate smooth muscle relaxation . however , septic insult increases production of superoxide that reacts with nitric oxide to form peroxynitrite that nitrates and inactivates endothelial pgi2 synthase , which can then no longer synthesize pgi2 . superoxide may also decrease the effective cellular level of nitric oxide below that required for guanylyl cyclase activation . nadph oxidase - derived oxidants ( i.e. , hydrogen peroxide and peroxynitrite ) oxidize tetrahydrobiopterin , which is a cofactor for synthesis of nitric oxide by nos enzymes . the loss of tetrahydrobiopterin ( due to its oxidation ) uncouples enos , so that the enzyme synthesizes superoxide rather than nitric oxide . this is detrimental to blood flow in capillaries , which depends on nitric oxide synthesized locally by enos . further , ros activate intracellular redox signaling pathways to increase adhesion of leukocytes , platelets and red blood cells to the endothelium and thereby precipitate capillary blood flow cessation . increased permeability of the endothelium occurs in multiple organs during sepsis , leading to plasma extravasation and edema formation . this causes loss of blood volume and progression of septic shock ( i.e. , severe sepsis with hypotension unresponsive to fluid resuscitation ) . basal nitric oxide production by enos is necessary for maintenance of the endothelial barrier function . the protective effect of nitric oxide is diminished during the inflammatory response due to the simultaneous production of superoxide . the source of this superoxide is likely the nadph oxidase that is co - localized with enos in subcellular compartments within endothelial cells . indeed , there is experimental evidence that nadph oxidase - derived ros mediate endothelial barrier failure . the latter causes lipid peroxidation , oxidation of sulfhydryl groups and nitration of tyrosine residues . in particular , nitration of cytoskeletal proteins by peroxynitrite appears to be a key step for endothelial barrier dysfunction . the oxidants that arise from nadph oxidase activity ( e.g. , hydrogen peroxide formed by dismutation of superoxide ) exert prolonged redox signaling effects that enhance induction of inducible nitric oxide synthase ( inos ) in septic blood vessels and endothelial cells . inos synthesizes abundant nitric oxide that in turn reacts with superoxide resulting in an excess production of peroxynitrite . for instance , inos expression in omental arteries of septic patients is associated with a subnormal arteriolar response to norepinephrine that can be normalized by the non - selective nos inhibitor n ( g ) - methyl - l - arginine ( l - nmma ) . in addition , expression of the vascular adhesion molecule , e - selectin ( a marker of vascular pro - inflammatory phenotype ) is significantly abridged in the organs of inos - deficient mice challenged with lps ( fig . 2 ) . important to note , that interfering with production of peroxynitrite by pretreating cultured endothelial cells with the peroxynitrite decomposition catalyst 5,10,15,20 - tetrakis ( 4 - sulfonatophenyl ) prophyrinato iron [ iii ] ( fetpps ) also reduces activation of nuclear factor nfb and subsequent up - regulation of nfb - dependent expression of e - selectin ( fig . the oxidants produced in endothelial cells during sepsis also induce expression of tissue factor . this transmembrane glycoprotein ( formerly known as thromboplastin ) because endothelial cells and monocytes do not express tissue factor under physiological conditions , there is no appreciable contact of cellular tissue factor with the circulating blood . however , these cells do express tissue factor when exposed to inflammatory cytokines and this response contributes to coagulopathy in sepsis . when tissue factor is exposed to blood , it forms a high - affinity complex with coagulation factors , leading to the formation of an insoluble fibrin clot . coagulation is activated rapidly after septic insult and results in diffuse microvascular clot formation that may disrupt blood flow in capillary beds . nadph oxidase - derived oxidants also stimulate the activation of the heterodimeric transcription factor hypoxia inducible factor - 1 ( hif - 1 ) in endothelial cells . normally the hif - 1 subunit has a short half - life because it is covalently modified by hif - 1 prolylhydroxylase , which targets hif - 1 for proteolysis by the ubiquitin - proteosome system . however , oxidants inhibit prolylhydroxylase activity and thereby allow hif - 1 to dimerize with the hif - 1 subunit . the dimerization activates hif - 1 to translocate to the nucleus , bind dna and promote expression of inos and other inflammatory genes . sepsis is treated by controlling the source of infection , administering antimicrobial ( e.g. , antibiotic ) therapy , assuring hemodynamic support with fluid resuscitation and vasopressor drugs , inducing sedation or analgesia as needed ; and providing adequate nutrition . despite these interventions , approximately one - third of all patients with severe sepsis die before leaving hospital . therefore , the development of additional therapies is a research topic of urgent priority . this hypothesis is based on the observation that many patients with sepsis die of organ failure despite adequate arterial blood oxygenation and cardiac output . further , survival is improved by treatments that improve microvascular function ( e.g. , antioxidants , inos deficiency , and tissue factor pathway inhibitor ) in animal models of polymicrobial sepsis . several potential therapies that target septic microvascular dysfunction are discussed next . the administration of activated protein c ( apc ) to septic patients is a recently introduced therapy . further , the adherence of leukocytes to arteriolar and venular endothelium is strongly diminished by activated protein c infusion , which is associated with an increased density of blood - perfused capillaries in an animal model of sirs . apc also induces rearrangement of endothelial cells actin cytoskeleton and thereby stabilizes endothelial barrier function . indeed , therapeutic benefit of apc in sepsis may be largely due to augmentation of endothelial barrier function . unfortunately , any benefit from apc may be outweighed by adverse effects , especially an increased rate of hemorrhage . a recent cochrane review recommended that apc should not be given to patients at low risk of death or to pediatric patients . the review also concluded that the evidence supporting apc use in patients with severe sepsis and at high risk of death was very weak . however , chemical variants of apc have been synthesized that may retain therapeutic efficacy while reducing the risk of bleeding . experiments in mouse sepsis models , for example , show that survival is increased by a recombinant apc variant with normal cell signaling activity but 10 % anticoagulant activity . therefore , a therapy may be developed in future that treats septic patients with apc variants that have normal cell signaling but reduced anticoagulant activities . a second intervention that has been tested in critically ill patients is administration of the nonselective nos inhibitor n ( g ) - methyl - l - arginine ( l - nmma ) . a phase iii clinical trial of l - nmma in patients with septic shock was terminated early because of increased mortality , but post hoc analysis indicated an overall survival benefit for low - dose l - nmma . the adverse effect of high - dose l - nmma may have been due to inhibition of the enos necessary for microvascular homeostasis . vitamin c injection is also a candidate therapy . in a randomized , prospective , double - blind , placebo - controlled trial with 226 critically ill patients ,28 - day survival was increased in the patients who received combined vitamin c and vitamin e by i.v . another large , randomized , prospective trial demonstrated decreased incidence of organ failure and shortened icu stay for critically ill patients who began receiving i.v . injections of combined vitamin c ( 3 g / day for up to 28 days ) and vitamin e within 24 h of traumatic injury or major surgery . yet another randomized , prospective study reported decreased morbidity for severely burned patients who were infused with an even higher dose of vitamin c ( 1584studies of animal models have shown that vitamin c prevents lps - induced edema and hypotension , prolongs survival in experimental bacteremia , and improves arteriolar responsiveness , arterial blood pressure , capillary blood flow , liver function and survival in experimental sepsis . therefore , the biological plausibility of this intervention is discussed further in the following paragraphs . ascorbate functions as an antioxidant and enzyme cofactor , becoming oxidized to dehydroascorbic acid ( dhaa ) in the process . sirs and sepsis lower plasma ascorbate concentration . injection i.v . of vitamin c can increase the amount of ascorbate delivered to endothelial cells to a greater extent than can oral ingestion . as depicted in fig . 4 , ascorbate is transported into microvascular endothelial cells by the specific transporter svct2 , while dhaa is taken up through facilitative glucose transporters ( glut ) and then reduced to ascorbate . the intracellular concentrations of ascorbate thus achieved are 416 mm . this intracellular ascorbate may protect microvascular function in two phases of action : initially by inhibiting nadph oxidase activation and increasing enos activity , and subsequently by suppressing expression of nadph oxidase , inos and tissue factor ( fig . ascorbate in endothelial cells prevents tetrahydrobiopterin oxidation , increases tetrahydrobiopterin content and elevates synthesis of nitric oxide by enos . studies of endotoxin induced shock indicate that inos inhibition has little or no beneficial effect in the presence of a failing enos system , because some nitric oxide is needed to maintain adequate organ function . an antioxidant role for vitamin c is supported by the observation that ascorbate abrogates stimulation by septic insult of superoxide production in microvascular endothelial cells . intracellular concentrations of ascorbate inside cells are high enough to prevent the reaction of superoxide and nitric oxide that creates peroxynitrite and to re - reduce the oxidation products that peroxynitrite creates when it reacts with cellular components . intracellular ascorbate blocks induction by lps + ifn or hydrogen peroxide of endothelial nadph oxidase activity , nadph oxidase protein expression and inos protein expression . also diminishes inos mrna expression in microvascular endothelial cells and arterioles in an in vivo model of sepsis . ascorbate is required for the optimal activity of the proline and asparagine hydroxylases that control the transcription factor hif - 1 . expression of hif - 1 sensitive genes , such as inos , is similarly inhibited by ascorbate . injection of 2 g vitamin c in human subjects does not alter superoxide production by neutrophils . similarly , incubation of neutrophils with either ascorbic acid or dhaa , to raise intracellular ascorbate concentration , does not inhibit the production of extracellular ros elicited when these cells are subsequently challenged by inflammatory stimuli such as e. coli . there is cause for concern about potential adverse effects of high - dose vitamin c injections . under certain conditions in vitro , ascorbic acid donates electrons to transition metals ( e.g. iron ) that then catalyze the synthesis of hydrogen peroxide . is not followed by elevation of oxidative stress biomarkers in healthy human subjects , but its injection prior to surgery increases oxidative modification of plasma lipids in venous blood during the ischemic phase of surgery . because injection of high doses of vitamin c may increase the risk of hemolysis in glucose -6-phosphate dehydrogenase deficiency , patients should be prescreened for this deficiency before administering i.v . vitamin c. also , because hyperoxaluric responses may occur and predispose susceptible individuals to nephrolithiasis , oxalate measurements are recommended during long - term vitamin c therapy . in conclusion , therapies targeting microvascular dysfunction may have a significant impact on morbidity and mortality in sepsis . based on the low ascorbate concentrations in septic patients , the improved microvascular function and survival observed in septic animal models injected with vitamin c , the improved outcomes observed in critically ill patients administered i.v . vitamins c and e as adjuvant therapy , and the preservation of neutrophils capacity to produce ros during exposure to supraphysiological extracellular ascorbate levels , clinical trials of vitamin c injection as an adjunct therapy in sepsis should be undertaken .\noutput:\n" }, { "from": "agent", "value": "sepsis , as a severe systemic inflammatory response to bacterial infection , represents a major clinical problem . it is characterized by the excessive production of reactive oxygen species ( ros ) both in the circulation and in the affected organs . the excessive generation of ros inevitably leads to oxidative stress in the microvasculature and has been implicated as a causative event in a number of pathologies including sepsis . in this review , we focus on the role of oxidative and nitrosative stress during the early onset of sepsis . changes in microvascular endothelial cells , the cell type that occurs in all organs , are discussed . the mechanisms underlying septic induction of oxidative and nitrosative stresses , the functional consequences of these stresses , and potential adjunct therapies for microvascular dysfunction in sepsis are identified ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the objective pursued in this note is to frame the research on the immune system as part of data science . such research is naturally complex and articulated and our contribution intends to be here along the lines of seeing it as a viable candidate for topological data analytics and an example of the s [ b ] paradigm for modeling complex systems . we recall that data science is the practice to deriving valuable insights from data by challenging all the issues related to the processing of very large data sets , while big data is jargon to indicate such a large collection of data ( for example , exabytes ) characterized by high - dimensionality , redundancy , and noise . the analysis of big data requires handling high - dimensional vectors capable of weaning out the unimportant , redundant coordinates . the notion of data space , its geometry and topology are the most natural tools to handle the unprecedentedly large , high - dimensional , complex sets of data ( carlsson 2009 ; edelsbrunner and harer 2010 ) ; basic ingredient of the new data - driven complexity science ( topdrim 2012 ; merelli and rasetti 2013 ) . topology , the branch of mathematics dealing with qualitative geometric information such as connectivity , classification of loops and higher dimensional manifolds , studies properties of geometric objects ( shapes ) in a way which is less sensitive to metrics than geometric methods : it ignores the value of distance function and replaces it with the notion of connective nearness : proximity . all these features make topology ideal for analysing the space of data . starting from the notion of a mean field proposed by parisi in his simple model for idiotypic network ( parisi 1990 ) , we propose a more sophisticated version that is multilinear in the configurational variables ( the antibody concentrations ) instead of being constant or at most linear . multi - linearity allows us to recognize in the partition function \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ z $ $ \\ end { document } z of the model , that embodies all the statistical properties of the system at equilibrium , features similar to those of a particular functor of a topological field theory . the latter contains indeed the same global information about the topological properties ( specifically its global invariants ) of the system configuration space and can be identified with the generating function of betti numbers , namely the poincar polynomial of data space ( atiyah and bott 1983 ) . once the homology of the space of data has been constructed , and its generating cycles have been defined , the related two sets of betti numbers can be compared . in this way , self - consistent information is obtained , regarding \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 2 { \\ hbox { - } } ary $ $ \\ end { document } 2 - ary , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 3 { \\ hbox { - } } ary , \\ , \\ dots n { \\ hbox { - } } ary $ $ \\ end { document } 3 - ary , n - ary relations among antibodies . comparison between the betti numbers of the model and the real betti numbers , obtained by constructing the topology of phenomenological immune system space of data , will unveil the hidden relations between idiotypes and anti - idiotypes ; in particular , those relations where components interact indistinctly and therefore can not be reduced to a mere subgraph , but rather they bear on a new concept of interaction , scale - free and metric - free . the analysis of betti numbers on phenomenological data can be dealt with techniques based on persistent homology ( carlsson 2009 ; petri et al . the challenge we are facing is to unveil whether in natural , multi - level complex systems , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - body interactions can drive the emergence of novel qualia in these systems . in physics , this means that mutual forces and motions are produced by two - body interactions , the building blocks of any many - particle system . thus at the atomic or molecular level description of matter ( living or not ) the total force acting on any given particle is the result of the composition of binary interactions . however , how can we discover if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - body interactions do exist ? what we are proposing here is to use the is metaphor , i.e. a complex system whose adaptivity is driven by data , as a global topological application of the s [ b ] paradigm . s [ b ] allows us to entangle in a unique model the computational component with the coordination . in particular , b accounts for the computation while s describes the global computation context ( merelli et al . the adaptation phase occurs when a machine can no longer compute in a given state of the system , thus the system changes state , i.e. the global context of computation . in the is metaphorthe computation context can be identified by the global invariants while the computation with the model of interactions , a sort of interactive machine . each time we discover new global invariants , a new context of computation arises and with it a new is model must be generated ; we call this step the adaptation phase . in the following , after giving a brief description of the antigen - free immune system and recalling parisi s mean field model , we formally define the new topological field model , and , finally , discuss the s [ b ] paradigm . an appendix is provided with a general introduction to the fundamental tool of persistent homology and betti numbers . cells and molecules of the immune system not only recognize foreign substances ; they react and regulate each other , so that the immune system can be seen as a network of interacting cells and antibodies . this perspective is known as the idiotypic or immune network theory ( jerne 1974 ) . it refers to the immune system as a complex process that takes place at the cellular level for protecting organisms from infectious agents ( the antigens ) , which are antibody generators . in the scheme proposed by jerne , it is the antigen that provokes an immune response and each antibody is represented as a large y - shaped protein . . the antibody can recognize and bind a specific part of the antigen ; resorting to this binding mechanism it can block the attack . moreover , in jerne s network theory , antibodies are capable of being recognized by other antibodies ; whenever this happens the former is suppressed and its concentration is reduced while the latter is stimulated and its concentration increases ( see fig1jerne s idiotypic network ; \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 2 $ $ \\ end { document } 2 - body interactions jerne s idiotypic network ; \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 2 $ $ \\ end { document } 2 - body interactions the mechanism whereby the production of a given antibody elicits or suppresses the production of other antibodies that , in turn , elicit or suppress the production of other antibodies like a concatenation of events , hints to a strict analogy of the immune system function with memory in the brain . it recalls the way in which a firing neuron may induce or inhibit the firing of other neurons , and so forth . on the assumption that a functional network of antibodies is possiblethe latter studies the persistence of immune memory in the absence of any driving effect of external antigens and it offers a robust , though simple , theoretical framework without providing detailed description of the system ( parisi 1990 ) . the model we propose is a preliminary test of data field theory ; it aims at a deeper understanding of the functional properties that the global and persistent topological properties of an antibodies data space can imply . in particular , it targets at discovering the existence of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - ary relations among antibodies and determining how the ensuing configurations influence the immune system reaction to the presence of antigens . the extraction of global qualitative information from an antibodies data space ( e.g. concentrations ) , should lead to the discovery of those characteristics that are shared in a group of immunoglobulin receptor molecules . this means not only discovering a single idiotype , but the capacity of being active in the presence of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n others . we want to prove that topological data analysis , through persistent homology and its betti numbers , allows us to determine the effective \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - antibody configurations . note that the models proposed in literature to describe the relationship between structure and function in biological networks are all based on the concept that any relation can be reduced to a set of binary relation ( hart et al . we start thinking of models as relationships , i.e. facts in logical space of forms . forms that can be directly classified by betti numbers , extracted by calculating the betti numbers through the persistent homology of the space of data and used in the frame of a conceptual model able to bear on those topological features . the simplest and most efficient network of the immune system is represented by a model that can be easily formulated in the absence of antigens . although it is well known that the number of specific lymphocytes plays a crucial role , the variables of the network model are limited to the antibody concentrations . the mean - field idiotypic network model of antigen - free immune system , proposed by g. parisi and inspired by an earlier hopfield s model conceived to represent the brain and many other similar models ( hopfield 1982 ; hoffmann 1975 , 2010 ; farmer et al .1988 ) , describes essentially an iterated cascade of events , in which the production of a given antibody provokes , or possibly inhibits , the production of other antibodies , which in turn induce , or possibly impede , the production of other antibodies , which in turn give rise to or prevent the production of other antibodies , etc . . in the parisi model , the concentration \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i ( t ) $ $ \\ end { document } ci ( t ) of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i is assumed to have , in absence of external antigens , only two values , conventionally \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 0 $ $ \\ end { document } 0 or \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 1 $ $ \\ end { document } 1 ( in the presence of antigen concentrations \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci might become \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ gg 1 $ $ \\ end { document } 1 ) ; \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ t $ $ \\ end { document } t is time . the immune system state at time \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ t $ $ \\ end { document } t is determined by the values of all \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci s for all possible antibodies \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( i = 1 , \\ dots , n ) $ $ \\ end { document } ( i = 1 , , n ) . the dynamical process is typically described by a discretized time ( the time step \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ tau $ $ \\ end { document } being the time needed to implement the immune response ) . the dynamical variable \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i $ $ \\ end { document } hi ( the mean field ) represents the total stimulatory / inhibitory ( depending on its sign ) effect of the whole network on the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i - th antibody . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i $ $ \\ end { document } hi is positive when the excitatory effect of the other antibodies is greater than the suppressive effect and then \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci is one . otherwise \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i $ $ \\ end { document } hi is negative and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci is zero . the mean - field is expressed typically as1 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { h_i ( t ) = s + { { \\ mathop { \\ mathop { \\ sum } \\ limits _ { k = 1 } } \\ limits _ { k \\ ne i } ^ { n } } } j _ { ik } c_k ( t ) } , \\ , \\ , \\ , where \\ , \\ , \\ , c_i ( t ) = \\ theta [ h_i ( t - \\ tau ) ] \\ end { aligned } $ $ \\ end { document } hi ( t ) = s + k = 1kinjikck ( t ) , whereci ( t ) = [ hi ( t - ) ] \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ theta ( x ) $ $ \\ end { document } ( x ) denotes the heaviside function that is zero for negative \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x and 1 for positive \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x , while \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik ( \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ii } = 0 , j _ { ki } = j _ { ik } $ $ \\ end { document } jii = 0 , jki = jik ) represents the influence of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k on antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i . if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik is positive , antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k triggers the production of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i , whereas if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik is negative , antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k suppresses the production of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ left | j _ { ik } \\ right | $ $ \\ end { document } jik is a measure of control efficiency that the antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k exercises on antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i . the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik are distributed in the interval \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ [ - 1 , + 1 ] $ $ \\ end { document } [ - 1 , +1 ] . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s is the threshold parameter ; it regulates the dynamics when the couplings \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik are all very small ; otherwise \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s is equal to zero . at equilibrium , when the concentrations of antibodies are time independent , the eq . ( 1 ) simplifies to2 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { h_i = s + { { \\ mathop { \\ mathop { \\ sum } \\ limits _ { k = 1 } } \\ limits _ { k \\ ne i } ^ { n } } } j _ { ik } c_k } \\ , , \\ , c_i = \\ theta ( h_i ) \\ in \\ { 0 , 1 \\ } \\ ; . \\ end { aligned } $ $ \\ end { document } hi = s + k = 1kinjikck , ci = ( hi ) { 0,1 } . this idiotypic network model has the advantage of being simple and easy to analyze . the phenomenon of dependence of the immunity / tolerance pathway on the amount of antigens suggests that the concentration of any given antibody is crucial to determine the effects on the other antibodies . the assumption of two levels of concentration ( 0 or 1 ) bypasses the problem of the choice of a pathway . however , this model is elementary in view of testing the perspectives of a data field theory . we need to increase its complexity in order to reach a description of the system sufficiently detailed to catch the global features of its data space . we generalize the mean field in such a way that it crucially depends on those topological features of the space of antibody concentrations that will be reflected in the topological properties of the system space of data . we construct a model sensitive to global features , designed to benefit of the advantage of lending itself to a kind of reverse engineering of the process of field construction . in the model , the antibodies with positive \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i \\ , ( = 1 ) $ $ \\ end { document } ci ( = 1 ) are actually produced by the system while those absent \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( c_i = 0 ) $ $ \\ end { document } ( ci = 0 ) are suppressed . the simplest and most efficient network of the immune system is represented by a model that can be easily formulated in the absence of antigens . although it is well known that the number of specific lymphocytes plays a crucial role , the variables of the network model are limited to the antibody concentrations . the mean - field idiotypic network model of antigen - free immune system , proposed by g. parisi and inspired by an earlier hopfield s model conceived to represent the brain and many other similar models ( hopfield 1982 ; hoffmann 1975 , 2010 ; farmer et al .1988 ) , describes essentially an iterated cascade of events , in which the production of a given antibody provokes , or possibly inhibits , the production of other antibodies , which in turn induce , or possibly impede , the production of other antibodies , which in turn give rise to or prevent the production of other antibodies , etc . . in the parisi model , the concentration \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i ( t ) $ $ \\ end { document } ci ( t ) of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i is assumed to have , in absence of external antigens , only two values , conventionally \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 0 $ $ \\ end { document } 0 or \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 1 $ $ \\ end { document } 1 ( in the presence of antigen concentrations \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci might become \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ gg 1 $ $ \\ end { document } 1 ) ; \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ t $ $ \\ end { document } t is time . the immune system state at time \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ t $ $ \\ end { document } t is determined by the values of all \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci s for all possible antibodies \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( i = 1 , \\ dots , n ) $ $ \\ end { document } ( i = 1 , , n ) . the dynamical process is typically described by a discretized time ( the time step \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ tau $ $ \\ end { document } being the time needed to implement the immune response ) . the dynamical variable \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i $ $ \\ end { document } hi ( the mean field ) represents the total stimulatory / inhibitory ( depending on its sign ) effect of the whole network on the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i - th antibody . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i $ $ \\ end { document } hi is positive when the excitatory effect of the other antibodies is greater than the suppressive effect and then \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci is one . otherwise \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i $ $ \\ end { document } hi is negative and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i $ $ \\ end { document } ci is zero . the mean - field is expressed typically as1 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { h_i ( t ) = s + { { \\ mathop { \\ mathop { \\ sum } \\ limits _ { k = 1 } } \\ limits _ { k \\ ne i } ^ { n } } } j _ { ik } c_k ( t ) } , \\ , \\ , \\ , where \\ , \\ , \\ , c_i ( t ) = \\ theta [ h_i ( t - \\ tau ) ] \\ end { aligned } $ $ \\ end { document } hi ( t ) = s + k = 1kinjikck ( t ) , whereci ( t ) = [ hi ( t - ) ] \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ theta ( x ) $ $ \\ end { document } ( x ) denotes the heaviside function that is zero for negative \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x and 1 for positive \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x , while \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik ( \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ii } = 0 , j _ { ki } = j _ { ik } $ $ \\ end { document } jii = 0 , jki = jik ) represents the influence of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k on antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i . if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik is positive , antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k triggers the production of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i , whereas if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik is negative , antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k suppresses the production of antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ left | j _ { ik } \\ right | $ $ \\ end { document } jik is a measure of control efficiency that the antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k exercises on antibody \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i . the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik are distributed in the interval \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ [ - 1 , + 1 ] $ $ \\ end { document } [ - 1 , +1 ] . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s is the threshold parameter ; it regulates the dynamics when the couplings \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } $ $ \\ end { document } jik are all very small ; otherwise \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s is equal to zero . at equilibrium , when the concentrations of antibodies are time independent , the eq . ( 1 ) simplifies to2 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { h_i = s + { { \\ mathop { \\ mathop { \\ sum } \\ limits _ { k = 1 } } \\ limits _ { k \\ ne i } ^ { n } } } j _ { ik } c_k } \\ , , \\ , c_i = \\ theta ( h_i ) \\ in \\ { 0 , 1 \\ } \\ ; . \\ end { aligned } $ $ \\ end { document } hi = s + k = 1kinjikck , ci = ( hi ) { 0,1 } . this idiotypic network model has the advantage of being simple and easy to analyze . the phenomenon of dependence of the immunity / tolerance pathway on the amount of antigens suggests that the concentration of any given antibody is crucial to determine the effects on the other antibodies . the assumption of two levels of concentration ( 0 or 1 ) bypasses the problem of the choice of a pathway . however , this model is elementary in view of testing the perspectives of a data field theory . we need to increase its complexity in order to reach a description of the system sufficiently detailed to catch the global features of its data space . we generalize the mean field in such a way that it crucially depends on those topological features of the space of antibody concentrations that will be reflected in the topological properties of the system space of data . we construct a model sensitive to global features , designed to benefit of the advantage of lending itself to a kind of reverse engineering of the process of field construction . in the model , the antibodies with positive \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c_i \\ , ( = 1 ) $ $ \\ end { document } ci ( = 1 ) are actually produced by the system while those absent \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( c_i = 0 ) $ $ \\ end { document } ( ci = 0 ) are suppressed . in this section , we generalize the way how parisi s linear model represents immunological memory by a linear mean field . the antibodies of the idiotypic cascade are denoted by \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_i $ $ \\ end { document } abi ; during the production of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_1 $ $ \\ end { document } ab1 , ignited directly by the antigen , the environment of lymphocytes is modified by \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_2 $ $ \\ end { document } ab2 : the life - span of the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_1 $ $ \\ end { document } ab1 - producing cells and the population of helper cells specific for \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_1 $ $ \\ end { document } ab1 increase . the symmetry of the couplings \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( j _ { ik } = j _ { ki } ) $ $ \\ end { document } ( jik = jki ) implies that \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_3 $ $ \\ end { document } ab3 should be rather similar to \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_1 $ $ \\ end { document } ab1 , the internal image of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_2 $ $ \\ end { document } ab2 should persist after it disappeared , its presence induces the survival of memory cells directed against the antigen . , we assume the production of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ab_i $ $ \\ end { document } abi is conditioned to different extents and also by the simultaneous presence of a subset of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 2 , 3 , ... , a weakness of this representation is that the possible equilibrium configurations of the network are fixed , whereas we want the network to be capable of learning which antibodies should be produced without assuming that only a fraction of all antibodies have physiological relevance . therefore , whilst we maintain the global cost function3 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { e = \\ sum _ { i = 1 } ^ n h_i c_i } , \\ , \\ , \\ , \\ ; c_i = \\ theta ( h_i ) \\ in \\ ; , \\ end { aligned } $ $ \\ end { document } e = i = 1nhici , ci = ( hi ) , we consider in the space of antibodies \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { a } $ $ \\ end { document } a , the points of which are labelled by \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i = 1 \\ dots , n $ $ \\ end { document } i = 1 , n , the graph \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g generated by the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } \\ ne 0 $ $ \\ end { document } jik0 ( for simplicity we assume here that \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } \\ in [ -1 , + 1 ] $ $ \\ end { document } jik [ - 1 , +1 ] when \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { ik } \\ ne 0 $ $ \\ end { document } jik0 ) . we next extend \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g to the simplicial complex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c , obtained from \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g by completion , constructing the simplicial complex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c which has \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g as 1 - skeleton ( scaffold ) , see fig . each \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - cycle in \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c can not be seen as composition of two - body interactions , but represents a true \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - body interaction ; in other words , any relationship expressed in the cycle is unique in its configuration . we denote by \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c ^ { ( n ) } ( [ l_1 , \\ dots l _ { ( n +1 ) } ] $ $ \\ end { document } c ( n ) ( [ l1 , l ( n +1 ) ] ) the cycles of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c , and by \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta _ { k , i } $ $ \\ end { document } k , i the presence or the absence of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i in the cycle ( \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta _ { k , i } = 1 $ $ \\ end { document } k , i = 1 if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k = i $ $ \\ end { document } k = i , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta _ { k , i } = 0 $ $ \\ end { document } k , i = 0 if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k \\ ne i $ $ \\ end { document } ki ) and we generalize then the standard linear form for the mean field \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i $ $ \\ end { document } hi to the form : 4 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } h_i = s + \\ sum _ { k = 1 } ^ n \\ , { \\ mathop { \\ mathop { \\ sum } \\ limits _ { c ^ { ( n ) } ( [ \\ ell _ 1 , \\ dots \\ ell _ { ( n +1 ) } ] ) } } \\ limits _ { 1 \\ le n \\ le n - 1 } } j _ { \\ ell _ 1 \\ dots \\ ell _ k \\ dots \\ ell _ { n +1 } } \\ prod _ { j = 1 } ^ n c _ { \\ ell _ j } \\ , \\ delta _ { k , i } \\ ; \\ end { aligned } $ $ \\ end { document } hi = s + k = 1nc ( n ) ( [ 1 , ( n +1 ) ] ) 1nn - 1j1kn +1 j = 1ncjk , iin the partition function5 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { z ( x ) \\ doteq \\ sum _ { \\ left \\ { c _ \\ ell \\ right \\ } } e ^ { - x e \\ left ( \\ left \\ { c _ \\ ell \\ right \\ } \\ right ) } } \\ ; \\ ; x \\ in \\ mathbb { r } , \\ end { aligned } $ $ \\ end { document } z ( x ) ce - xecxr , the sum runs over the set of all possible valuations \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c _ \\ ell = 0 , 1 \\ ; , \\ ; \\ forall \\ ell $ $ \\ end { document } c = 0,1 , , subdivides the set of states in classes of equivalence , giving different statistical weights depending on a parameter \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x \\ in { \\ mathbb { r } } \\ ; , \\ ; x 0 $ $ \\ end { document } xr , x 0to those states which are invariant with respect to a given set of transformations . a phase transition , if any , would allow us to pass from one class of equivalence to the other when the state symmetry is ( partially or fully ) broken . this turns the model into a theoretical framework where , given a parameter for example the average specific antibody concentration we can predict when and if a configuration may break into another , giving rise to a different immunity type , i.e. change the adaptive immunity . in terms of formal language theory , going from one configuration to another belonging to a different class of equivalencehas the following meaning : if we associate to the space of data a group of possible transformations preserving its topology ( e.g. , its mapping class group ) , and the related regular language , the general semantics thus naturally generated describes the set of all transformations and hence of all phases in the form of relations . we consider then the functor partition function , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ z ( x ) $ $ \\ end { document } z ( x ) . we might of course access more information ( patterns ) by considering higher ( \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k - th ) order correlation functions ,6 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ gamma _ k ( x ) \\ doteq \\ frac { 1 } { z ( x ) } \\ sum _ { \\ left \\ { c _ \\ ell \\ right \\ } } c _ { \\ ell _ 1 } \\ dots c _ { \\ ell _ k } e ^ { - x e \\ left ( \\ left \\ { c _ \\ ell \\ right \\ } \\ right ) } \\ ; , \\ end { aligned } $ $ \\ end { document } k ( x ) 1z ( x ) cc1cke - xec , for any given set of points \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ ell _ 1 \\ dots \\ ell _ k } \\ in \\ mathcal { a } $ $ \\ end { document } 1ka . we can represent with strings of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n dichotomic variables the set of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ { c _ \\ ell \\ } $ $ \\ end { document } { c } , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ 2 ^ { n - 1 } $ $ \\ end { document } 2n - 1 possible configurations . a crucial assumption we add to the model is that the coupling constants \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { \\ ell _ 1 \\ dots \\ ell _ k \\ dots \\ ell _ { n +1 } } $ $ \\ end { document } j1kn +1 are taken to be proportional to a linear combination ( with negative coefficients ) of the simplex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - volume \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ v ^ { ( n ) } $ $ \\ end { document } v ( n ) , the simplex corresponding to the cell defined by the set \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ bigl \\ { \\ ell _ 1 , \\ dots , \\ ell _ n \\ bigr \\ } $ $ \\ end { document } { 1 , , n } in the cells of cycle \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ c ^ { ( n ) } ( [ \\ ell _ 1 , \\ dots , \\ ell _ { ( n +1 ) } ] ) $ $ \\ end { document } c ( n ) ( [ 1 , , ( n +1 ) ] ) , with the volume of the cell boundary of dimension \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n - 2 $ $ \\ end { document } n - 2 , weighted by the curvature at that boundary . the latter measures the ease with which the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - body interaction is favored by the manifold bending . the ensuing action is expected to measure reasonably well the probability that the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - body process described by that coupling takes place . when the model with such interaction form is dealt with as a statistical field theory it turns out to be fully isomorphic with a euclidean topological field theory describing a totally different physical system : gravity coupled with matter in a simplicial complex setting , consistent with general relativity . we think back to the standard example of the ising model , which also has variables in \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ mathbb { z } } _ 2 $ $ \\ end { document } z2 ( parisi 1998 ) and recall that a statistical field theory is any model in statistical mechanics where the degrees of freedom comprise a field ; i.e. the microstates of the system are expressed through field configurations . the topology of the associated moduli space depends only on the manifold genus \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ g $ $ \\ end { document } g , on the dimension \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n of the ( vector ) bundle over it used to define the field , and on the dimension \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta ( { \\ mathrm { mod } } \\ , n ) $ $ \\ end { document } ( modn ) of the associated determinant bundle . such space is a projective variety , smooth only if \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( \\ delta , the recursive determination of the betti numbers in this case is given by the harder and narasimhan and atiyah and bott recursions ( harder and narasimhan 1975 ; atiyah and bott 1983 ) . the former explicitly counts points of the moduli space , the latter resorts to an infinite - dimensional morse theory with the field action functional as morse function . these recursions lead to a closed formula for the poincar polynomial , i.e. for the betti numbers of the moduli space . what is intriguing is that our field theory turns out to be isomorphic to \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ mathbb { z } } _ 2 $ $ \\ end { document } z2 ( quantum ) gravity , dealt with in nonperturbative fashion by standard regge calculus ( regge 1961 ) . let us recall here that the construction of a consistent theory of quantum gravity in the continuum is a problem in theoretical physics that has so far defied all attempts of a rigorous formulation and resolution . the only effective approach to try and obtain a non - trivial quantum theory proceeded via discretization of space - time and of the einstein action , i.e. , by replacing the space - time continuum by a combinatorial simplicial complex and deriving the action from simple physical principles . quantum regge calculus , based on the well - explored classical discretization of the einstein action due to regge , and the essentially equivalent method of dynamical triangulations are the tools that proved most successful . regge s method consists in approximating einstein s continuum theory by a simplicial discretization of the space - time ( in gravity a four - dimensional lorentz manifold ) resorting to local building blocks ( simplices ) and then constructing the gravitational action as the sum of a term depending on the ( hyper ) volumes of the different simplicial complexes and another reflecting the space - time curvature . the metric tensor associated with each simplex is expressed as a function of the squared edge lengths , which are the dynamical variables of this model . summing over all interpolating geometries ( state sum ) generated by the simplicial complex construction in the embedding higher - dimensional ones ( filtration ) , allows us to derive both the einstein action and the equilibrium configurations simply by means of counting procedure ( entropy estimate ) . the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ mathbb { z } } _ 2 $ $ \\ end { document } z2 version of the model is one in which representations of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ su ( 2 ) $ $ \\ end { document } su ( 2 ) labeling the edges in quantum regge calculus are reduced to \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ mathbb { z } } _ 2 $ $ \\ end { document } z2 . the power of the method resides in the property that the infinite degrees of freedom of riemannian manifolds are reduced by discretization ; and the theory can deal with pl spaces , described by a finite number of parameters . moreover , for the manifolds approximated by a simplicial complex ( or by dynamically triangulated random surfaces ) , the local coordination numbers are automatically included among the dynamical variables , leaving the quadratic link lengths \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ q _ \\ ell $ $ \\ end { document } q , globally constrained by triangle inequalities , as true degrees of freedom . more precisely , the model adopted here for the immune system is isomorphic to the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ mathbb { z } } _ 2 $ $ \\ end { document } z2 regge model , where the quadratic link lengths \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ q _ \\ ell $ $ \\ end { document } q of the simplicial complexes are restricted to take on only two values : \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ q _ \\ ell = 1 + { \\ mathfrak { l } } \\ sigma _ \\ ell $ $ \\ end { document } q = 1 + l , where \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ sigma _ \\ ell = \\ pm 1 = 2 c _ { \\ ell } - 1 $ $ \\ end { document } = 1 = 2c - 1 . such model has been exactly solved ( in the case of quantum gravity ) via the matrix model approach ( ambjrn et al .1985 ) and with the help of conformal field theory ( knizhnik et al . 1988 ) . a crucial ingredient is the choice of functional integration measure , whose behavior , with respect to diffeomorphisms , is fundamental . the very definition of diffeomorphism is a heavy constraint in constructing the pl space exactly invariant under the action of the full diffeomorphism group ( menotti 1998 ) , and only the recent construction of a simplicial version of the mapping class group made it viable ( merelli and rasetti 2013 ) . as regge regularization leads to the usual liouville field theory in the continuum limit based on a description of pl manifolds with deficit angles , not edge lengths , we may assume that also in our case the correct measure has to be nonlocal . starting point for the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ mathbb { z } } _ 2 $ $ \\ end { document } z2 regge model is a discrete description of general relativity in which space - time is represented by a piecewise flat , simplicial manifold ( regge skeleton ) . the procedure works for any space - time dimension \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ d $ $ \\ end { document } d , metrics of arbitrary signature , and action7 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } a ( \\ mathbf { { q } } ) = x \\ left ( \\ sum _ { s ^ d } v ^ { ( d ) } \\ left ( s ^ d \\ right ) - \\ zeta \\ sum _ { s ^ { d - 2 } } { \\ mathfrak { d } } ( s ^ { d - 2 } ) \\ , v ^ { ( d - 2 ) } \\ left ( s ^ { d - 2 } \\ right ) \\ right ) \\ ; \\ end { aligned } $ $ \\ end { document } a ( q ) = xsdv ( d ) sd - sd - 2d ( sd - 2 ) v ( d - 2 ) sd - 2with the quadratic edge lengths \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ left \\ { q _ \\ ell \\ right \\ } $ $ \\ end { document } q ( more precisely , the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ sigma _ { \\ ell } $ $ \\ end { document } s ) describing the dynamics of the complex . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ zeta $ $ \\ end { document } denote free constants ( in the discrete time picture , with uniform time step \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ tau $ $ \\ end { document } , energy functional and action are merely proportional ) . the first sum runs over all \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ d $ $ \\ end { document } d - simplices \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s ^ d $ $ \\ end { document } sd of the simplicial complex , while \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ v ( s ^ d ) $ $ \\ end { document } v ( sd ) is the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ d $ $ \\ end { document } d - volume of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s ^ d $ $ \\ end { document } sd . the second term represents the curvature of the simplicial complex , concentrated along the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( d - 2 ) $ $ \\ end { document } ( d - 2 ) - simplices , leading to deficit angles \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ mathfrak { d } } ( s ^ { d - 2 } ) $ $ \\ end { document } d ( sd - 2 ) . the physical meaning of the terms entering action \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ a $ $ \\ end { document } a is what makes it acceptable for a consistent description of the immune system with higher order ( many body ) interactions : the lower the volumes and the higher the curvature , the lower is the action \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( x , \\ zeta 0 ) $ $ \\ end { document } ( x , 0 ) . at equilibrium , i.e. in the absence of an explicit time - dependence of the expectation values of the variables , the partition function for our antigen - free is model is nothing but the field propagator of the theory , expressed via path integral8 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { z = \\ int \\ mathcal { { d } } \\ , [ \\ mathbf { { q } } ] \\ , \\ mathrm { { e } } ^ { - a ( \\ mathbf { { q } } ) } } \\ end { aligned } $ $ \\ end { document } z =d [ q ] e - a ( q ) functional integration should extend over all metrics on all possible topologies , hence the path - integral approach , typically suffers from a nonuniqueness of the integration measure and a need for a nonlocal measure is advocated . the standardsimplicial measure9 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } \\ displaystyle { \\ int \\ mathcal { { d } } \\ , [ \\ mathbf { { q } } ] = \\ prod _ \\ ell \\ , \\ int \\ frac { \\ mathrm { { d } } q _ \\ ell } { q _ \\ ell ^ \\ alpha } \\ , \\ mathcal { { f } } ( \\ mathbf { { q } } ) } , \\ , \\ , \\ , \\ mathrm { { where } } \\ , \\ , \\ , \\ alpha \\ in { \\ mathbb { r } } \\ end { aligned } $ $ \\ end { document } d [ q ] = dqqf ( q ) , whererallows exploring a family of measures , as \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { { f } } ( \\ mathbf { { q } } ) $ $ \\ end { document } f ( q ) can be designed to constrain integration to those configurations which do not violate triangular inequalities , and moreover can be chosen so as to remove non realistic simplices . the characteristic partition function of the model becomes then \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ begin { aligned } z = \\ left [ \\ prod _ \\ ell ^ \\ mathcal { { n } } \\ int \\ limits _ 0 ^ \\ infty { \\ mathrm { d } } q _ \\ ell \\ , q _ \\ ell ^ { - \\ alpha } \\ right ] \\ , \\ mathcal { { f } } ( \\ mathbf { { q } } ) \\ , \\ mathrm { { e } } ^ { - \\ sum _ s a_s ( \\ mathbf { { q } } ) } \\ ; , \\ end { aligned } $ $ \\ end { document } z = n0dqq - f ( q ) e-sas ( q ) , where \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { { n } } $ $ \\ end { document } n is the number of links and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ a_s $ $ \\ end { document } as is the contribution to the action of simplex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s . it is worth recalling that in ( desale and ramanan 1975 ) arithmetic techniques and the weil conjecture were used , and a crucial ingredient was the property that the volume of a particular locally symmetric space attached to \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ sl_n $ $ \\ end { document } sln with respect to the canonical measure an invariant known as the tamagawa number of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ sl_n $ $ \\ end { document } sln equals 1 . the simplicial volume is a homotopy invariant of oriented , closed , connected manifolds defined in terms of the singular chain complex with real coefficients . such invariant measuressince the fundamental class is nothing but a generalized triangulation of the manifold , the simplicial volume can be interpreted as well both as a measure for the complexity of the manifold and as a homotopy invariant approximation of the riemannian volume . \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ z ( x ) $ $ \\ end { document } z ( x ) provides then the generating function ( poincar polynomial ) of the betti numbers of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { a } $ $ \\ end { document } a . the final step is to compare the betti numbers obtained empirically from the data against such generating function , thus determining [ simply through the solution of a system of ( non - linear ) algebraic equations ] the set of non - zero \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { \\ ell _ 1 \\ dots \\ ell _ k \\ dots \\ ell _ { n +1 } } $ $ \\ end { document } j1kn +1 . this fully determines which antibody influences which , including many - body influences , i.e. when and if it may happen that a given set of ( two or more than two ) antibodies play a role only when simultaneously active . a short discussion of regge calculus , meant to introduce in simple way , accessible also to readers not familiar with the notion of geometry over discrete spaces ( simplicial complexes ) , and some of the notions actually used in the derivation can be found in battaglia and rasetti ( 2003 ) , where some of the preliminary ideas of the scheme are described , successively developed in extended way for present and other applications . as for the work in \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathbb { z } _ 2 $ $ \\ end { document } z2 quantum gravity which our generalized model of immune system is isomorphic to , a more articulated and complete set of references is available in giulini ( 2007 ) and bittner et al . in this section we introduce the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] paradigm for modeling complex adaptive systems and we discuss the is metaphor as a global topological application of the adaptation phase ; the aim is to contribute to understand the adaptability feature that , as addressed in the paper of stepney et al . poorly understood . in the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] paradigm a complex system consists of two components , the computation level from where its behavior \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b emerges , the interactive machine , and the context of the computation , its global structure \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s . both levels are distinct but entangled in a unique computational model that evolves by learning and adapting . the computational model associated to the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] plays a crucial role in the characterization of the adaption phase , it can be represented by any mathematical model of computation , provided that it allows to express the dependency between different levels of abstraction . figure 2 shows a simple adaptive system represented by finite state machines , which is the most general among other models , such as complex automata , higher dimensional automata , hypernetworks , recurrent neural network , multiagent , etc . on the left hand side , the two components are entangled in such a way that the emergent behaviour \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b is subject to the global constraints while the global structure \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s is affected by the emergent behavior . on the right , an \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] system is depicted as a light oval \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s that embeds a dark round \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b , showing the adaptation phase that takes place whenever the computation can no longer evolve in the current context ( the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] on the lower right corner ) . the adaptation phase allows \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s to relax the set of constraints so as to permit further computations in the figure the black arrow drawn between the two \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s components , represents the change of the global context , and the dashed arrow between the dark rounds represents the unfolding of the computation . the evolution of such a model relies on the ability of the system to adapt its computation to global requirements.fig .2 \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] model \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] model a full yet concise description of the formal definition of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] on a finite state machine that encapsulates both the computation \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( b ) $ $ \\ end { document } ( b ) and its controller \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( s ) $ $ \\ end { document } ( s ) follows . in this framework , both \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s are classically described as a finite state machine of the form \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b = ( q , q_0 , \\ rightarrow _ b ) $ $ \\ end { document } b = ( q , q0 , b ) ( \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ q $ $ \\ end { document } q set of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b states , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ q_0 $ $ \\ end { document } q0 initial \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b state and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ rightarrow _ b $ $ \\ end { document } b transition relation ) and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s = ( r , r_0 , \\ mathcal { o } , \\ rightarrow _ s , l ) $ $ \\ end { document } s = ( r , r0 , o , s , l ) where \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ r $ $ \\ end { document } r is a set of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s states , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ r_0 $ $ \\ end { document } r0 is the initial \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s state , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { o } $ $ \\ end { document } o is an observation function of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b states , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ rightarrow _ s $ $ \\ end { document } s is a transition relation and \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ l $ $ \\ end { document } l is a state labeling function . the function \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ l $ $ \\ end { document } l labels each \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s state with a formula representing a set of constraints over an observation of the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b states . therefore , a \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s state \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ r $ $ \\ end { document } r can be directly mapped to the set of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b states satisfying \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ l ( r ) $ $ \\ end { document } l ( r ) . through this hierarchy , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s can be viewed as a second - order structure \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( r \\ subseteq 2 ^ q , r_0 , \\ rightarrow _ s \\ subseteq 2 ^ q \\ times 2 ^ q , l ) $ $ \\ end { document } ( r2q , r0 , s2q2q , l ) where each \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s state \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ r $ $ \\ end { document } r is identified with its corresponding set of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b states . an \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] system is the combination of an interactive machine \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b = ( q , q_0 , \\ rightarrow _ b ) $ $ \\ end { document } b = ( q , q0 , b ) and a coordinator \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s = ( r , r_0 , \\ mathcal { o } , \\ rightarrow _ s , l ) $ $ \\ end { document } s = ( r , r0 , o , s , l ) such that for all \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ q \\ in q $ $ \\ end { document } qq , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { o } ( q ) \\ ne \\ perp $ $ \\ end { document } o ( q ) . in any \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] system the initial \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b state must satisfy the constraints of the initial \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s state , i.e. \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ q_0 \\ modelsl ( r_0 ) $ $ \\ end { document } q0l ( r0 ) . during adaptation phase the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b $ $ \\ end { document } b machine is no longer regulated by the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s $ $ \\ end { document } s controller , except for a condition , called transition invariant , that must be fulfilled by the system undergoing adaptation . the complete and formal definition of the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] based on finite state machine , its semantics and the adaptability checking can be found in merelli et al . it is quite evident that the model described above can be applied when the system requirements are known a priori and the adaptation phase reduces to dynamic selection of possible states with respect to environmental changes . to overcome this limit and allow the definition of a model that can change the set of global constraints and consequently the set of computations at run - time , we adopt the is metaphor to characterize the adaptation phase of an \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] model . the global context is defined as a function of the topological invariants extracted from the analysis of the space of data : the betti numbers . in the modelproposed in previous section the betti numbers and the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { \\ { \\ ell \\ } } $ $ \\ end { document } j { } interaction matrix faithfully represent the relations hidden in the current space of data . thus , the adaptation phase of an \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] system is indeed represented as the interplay capabilities of the immune system to identify , classify and learn the new relationship emerging among the actors of the system . figure 3 graphically mimics the adaptability checking performed by an \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] system ; it starts on the upper left corner of the figure with the actual model \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] that , when necessary , may be adapted to a new context provided by the topological analysis of the space of data ( set of observations of real system ) . the changes in the context is determined by comparing the betti numbers of the space of data with the betti numbers of the actual model . if there is no new knowledge , the model remains \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s [ b ] $ $ \\ end { document } s [ b ] otherwise it adapts to the new context by learning the knowledge provided by the betti numbers , updating its computation with new set of relations \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { \\ { \\ ell \\ } } $ $ \\ end { document } j { } and becoming \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ s ' [ b ' ] $ $ \\ end { document } s [ b ] . this learning process reminds us of what in literature is called recurrent neural network , a process based on active exploration of an unknown environment and the generation of a finite state automata model of the environment.fig .3 s [ b ] adaptability checking s [ b ] adaptability checking summarizing , inspired by the is metaphor we present a computational model as an higher order relational model which deals with multilinear n - body interactions , the interactions characteristic of the immune response . in such case , the model adapts when it no longer fits the space of observed data , and the construction of the topological field model allows us to determine the values of the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j _ { { \\ { \\ ell \\ } } } $ $ \\ end { document } j { } matrix , hence , e.g. , the classes of antibodies that are in relation in the current immune response . we call this step a recursive construction of a relational model that learns new antibody relations as immune response to the presence of an antigene . as future work , we aim to apply the proposed approach to real - world is phenomena treated bot in silico and in vivo experiments and compare the results with other similar models . we have defined a new topology - based method suitable to provide a benchmarking application of the s [ b ] paradigm . the method relies on a multi - linear model of immune system inspired by the topology of space of data . starting from the notion of an ising model in a mean field , given by parisi and others in their seminal work , we proposed a more sophisticated version that is multilinear in the configurational variables ( the antibody concentrations ) instead of constant or at most linear . this work is not intended to be the study of the dynamics of the immune network in view of establishing the equilibrium among antibodies , but , instead , it has a prospective interest and strategic aim at defining a new approach for the analysis of the immune system as a metaphor of a real - life system represented in terms of big data . in this appendix we describe a general approach that allows to extract global topological information from a space of data . it is based on three basic steps : ( i ) the interpretation of the huge collection of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ points $ $ \\ end { document } points that constitutes the space of data ; this is achieved by resorting to a family of simplicial complexes ( figthis operation converts the data set into a global topological object . in order to fully exploit the advantages of topologyit measures the expression of a possible \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ relation $ $ \\ end { document } relation . ( ii ) the reduction of noise , affecting the data space , as the result of the parametrized persistent homology . ( iii ) the encoding of the data set persistent homology in the form of a parameterized version of topological invariants , in particular betti numbers , i.e. the invariant dimensions of the homology groups . these three steps provide an exhaustive knowledge of the global features of the space of data , even though such a space is neither a metric space nor a vector space , as other approaches require ( carlsson 2009 ) . fig .4 simplices in \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathbb { r } ^ 3 $ $ \\ end { document } r3 .0 - simplex is point or vertex , 1 - simplex is an edge , 2 - simplex is a triangle , and 3 - simplex is a thetrahedronfig .5 simplicial complex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c from the graph \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g simplices in \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathbb { r } ^ 3 $ $ \\ end { document } r3 .0 - simplex is point or vertex , 1 - simplex is an edge , 2 - simplex is a triangle , and 3 - simplex is a thetrahedron simplicial complex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c from the graph \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g in order to better comprehend the scheme , it is necessary to recall that homology is a mathematical tool thatholes in the manifold . a basic set of invariants of a topological space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x is just its collection of homology groups , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i ( x ) $ $ \\ end { document } hi ( x ) . computing such groupsis certainly non - trivial , even though efficient algorithmic techniques are known to do it systematically . important ingredients of these techniques , and outcomes as well of the computation , are just betti numbers ; the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i - th betti number , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_i = b_i ( x ) $ $ \\ end { document } bi = bi ( x ) , denotes the rank of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i ( x ) $ $ \\ end { document } hi ( x ) . it is worth remarking that betti numbers often have an intuitive meaning , for example , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_0 $ $ \\ end { document } b0 is simply the number of connected components of the space considered . while oriented 2 - dimensional manifolds are completely classified by \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_1 = 2g $ $ \\ end { document } b1 = 2 g , where \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ g $ $ \\ end { document } g is the genus ( i.e. number ofholes ) of the manifold ; \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_j $ $ \\ end { document } bj with \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j \\ ge 2 $ $ \\ end { document } j2 classifies the features ( number of higher - dimensional holes ) of higher - dimensional manifolds . what makes them convenient is the fact that in several cases knowing the betti numbers is the same as knowing the full space homology . sometimes to know the homology groups it is sufficient to know the corresponding betti numbers , typically much simpler to compute . in the absence of torsion , if we want to distinguish two topological objects via their homology , their betti numbers may already do it . data can be represented as a collection , unordered sequence , of points in a \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - dimensional space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ e_n $ $ \\ end { document } en , the space of data . the conventional way to convert a collection of points within a space such as \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ e_n $ $ \\ end { document } en into a global object , is to use the point cloud as the vertex set of a combinatorial graph , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g . the edges of the graph are exclusively determined by a given notion of proximity , specified by some weight parameter \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . the parameter \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } should not fix adistance , that would imply fixing some sort of metric , but rather provide information aboutif dependence had to do with distance , it should be a non - metric notion , rather a chemical distance or ontological distance just to mention an example . a graph of this sort , while capturing pretty well connectivity data , essentially ignores a wealth of higher order features beyond clustering . such features can instead be accurately discerned by thinking of the graph as the scaffold ( 1 - skeleton ) of a different , higher - dimensional , richer ( more complex ) discrete object , generated by completing the graph \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g to a simplicial complex , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c . the latter is a piecewise - linear space built from simple linear constituents ( simplices ) identified combinatorially along their faces . the decisions as how this is done , implies a choice of how to fill in the higher dimensional simplices of the proximity graph . two among the most natural and common ones , equally effective to our purpose , but with different characteristic features , are : ( i ) the ech simplicial complex , where \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k - simplices are all unordered \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( k +1 ) $ $ \\ end { document } ( k +1 ) - tuples of points of the space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ e_n $ $ \\ end { document } en , whose closed \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ frac { 1 } { 2 } \\ delta $ $ \\ end { document } 12 - ball neighborhoods have a non - empty mutual intersection ; ( ii ) the rips complex , an abstract simplicial complex whose \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k - simplices are the collection of unordered \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( k +1 ) $ $ \\ end { document } ( k +1 ) - tuples of points pairwise within distance \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . the rips complex is maximal among all simplicial complexes with the given 1 - skeleton ( the graph ) , and the combinatorics of the 1 - skeleton completely determines the complex . the rips complex can thus be stored as a graph and reconstructed out of it . for a ech complex , on the contrary , one needs to store the entire boundary operator , and the construction is more complex ; however , this complex contains a larger amount of information about the topological structure of the data space . algebraic topology provides a mature set of tools for counting and collating holes and other topological pattern features , both spaces and maps between spaces , for simplicial complexes . it is therefore able to reveal patterns and structures not easily identifiable otherwise . as persistent homologyis generated recursively , corresponding to an increasing sequence of values of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . complexes grow with \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . this leads us to naturally identifying the chain maps with a sequence of successive inclusions . the available algorithms for computing persistent homology groups focus typically on this notion of filtered simplicial complex . fortunately , homology is exceptional under this respect because the invariants arise as quotients of finite - dimensional spaces . topological information is contained in persistence homology , that can be determined and presented as a sort of parameterized version of the set of betti numbers . its role is just that of providing summaries of information over domains of parameter values , so as to better understand relationships among the geometric objects constructed from data . the emerging geometric / topological relationships involve continuous maps between different objects , and therefore become manifestations of functoriality , i.e , imply the notion that invariants can be extended not just to the objects studied , but also to the maps between such objects . functoriality is central in algebraic topology because the functoriality of homological invariants is what permits one to compute them from local information . we recall the k \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ ddot { u } $ $ \\ end { document } unneth theorem that allows to consider the poincar polynomial of the space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x as the generating function of the betti numbers of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x . in this appendix we describe a general approach that allows to extract global topological information from a space of data . it is based on three basic steps : ( i ) the interpretation of the huge collection of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ points $ $ \\ end { document } points that constitutes the space of data ; this is achieved by resorting to a family of simplicial complexes ( figthis operation converts the data set into a global topological object . in order to fully exploit the advantages of topologyit measures the expression of a possible \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ relation $ $ \\ end { document } relation . ( ii ) the reduction of noise , affecting the data space , as the result of the parametrized persistent homology . ( iii ) the encoding of the data set persistent homology in the form of a parameterized version of topological invariants , in particular betti numbers , i.e. the invariant dimensions of the homology groups . these three steps provide an exhaustive knowledge of the global features of the space of data , even though such a space is neither a metric space nor a vector space , as other approaches require ( carlsson 2009 ) . fig .4 simplices in \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathbb { r } ^ 3 $ $ \\ end { document } r3 .0 - simplex is point or vertex , 1 - simplex is an edge , 2 - simplex is a triangle , and 3 - simplex is a thetrahedronfig .5 simplicial complex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c from the graph \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g simplices in \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathbb { r } ^ 3 $ $ \\ end { document } r3 .0 - simplex is point or vertex , 1 - simplex is an edge , 2 - simplex is a triangle , and 3 - simplex is a thetrahedron simplicial complex \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c from the graph \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g in order to better comprehend the scheme , it is necessary to recall that homology is a mathematical tool thatholes in the manifold . a basic set of invariants of a topological space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x is just its collection of homology groups , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i ( x ) $ $ \\ end { document } hi ( x ) . computing such groupsis certainly non - trivial , even though efficient algorithmic techniques are known to do it systematically . important ingredients of these techniques , and outcomes as well of the computation , are just betti numbers ; the \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ i $ $ \\ end { document } i - th betti number , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_i = b_i ( x ) $ $ \\ end { document } bi = bi ( x ) , denotes the rank of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ h_i ( x ) $ $ \\ end { document } hi ( x ) . it is worth remarking that betti numbers often have an intuitive meaning , for example , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_0 $ $ \\ end { document } b0 is simply the number of connected components of the space considered . while oriented 2 - dimensional manifolds are completely classified by \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_1 = 2g $ $ \\ end { document } b1 = 2 g , where \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ g $ $ \\ end { document } g is the genus ( i.e. number ofholes ) of the manifold ; \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ b_j $ $ \\ end { document } bj with \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ j \\ ge 2 $ $ \\ end { document } j2 classifies the features ( number of higher - dimensional holes ) of higher - dimensional manifolds . what makes them convenient is the fact that in several cases knowing the betti numbers is the same as knowing the full space homology . sometimes to know the homology groups it is sufficient to know the corresponding betti numbers , typically much simpler to compute . in the absence of torsion , if we want to distinguish two topological objects via their homology , their betti numbers may already do it . data can be represented as a collection , unordered sequence , of points in a \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ n $ $ \\ end { document } n - dimensional space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ e_n $ $ \\ end { document } en , the space of data . the conventional way to convert a collection of points within a space such as \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ e_n $ $ \\ end { document } en into a global object , is to use the point cloud as the vertex set of a combinatorial graph , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g . the edges of the graph are exclusively determined by a given notion of proximity , specified by some weight parameter \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . the parameter \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } should not fix adistance , that would imply fixing some sort of metric , but rather provide information aboutif dependence had to do with distance , it should be a non - metric notion , rather a chemical distance or ontological distance just to mention an example . a graph of this sort , while capturing pretty well connectivity data , essentially ignores a wealth of higher order features beyond clustering . such features can instead be accurately discerned by thinking of the graph as the scaffold ( 1 - skeleton ) of a different , higher - dimensional , richer ( more complex ) discrete object , generated by completing the graph \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { g } $ $ \\ end { document } g to a simplicial complex , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ mathcal { c } $ $ \\ end { document } c . the latter is a piecewise - linear space built from simple linear constituents ( simplices ) identified combinatorially along their faces . the decisions as how this is done , implies a choice of how to fill in the higher dimensional simplices of the proximity graph . two among the most natural and common ones , equally effective to our purpose , but with different characteristic features , are : ( i ) the ech simplicial complex , where \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k - simplices are all unordered \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( k +1 ) $ $ \\ end { document } ( k +1 ) - tuples of points of the space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ e_n $ $ \\ end { document } en , whose closed \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ frac { 1 } { 2 } \\ delta $ $ \\ end { document } 12 - ball neighborhoods have a non - empty mutual intersection ; ( ii ) the rips complex , an abstract simplicial complex whose \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ k $ $ \\ end { document } k - simplices are the collection of unordered \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ ( k +1 ) $ $ \\ end { document } ( k +1 ) - tuples of points pairwise within distance \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . the rips complex is maximal among all simplicial complexes with the given 1 - skeleton ( the graph ) , and the combinatorics of the 1 - skeleton completely determines the complex . the rips complex can thus be stored as a graph and reconstructed out of it . for a ech complex , on the contrary , one needs to store the entire boundary operator , and the construction is more complex ; however , this complex contains a larger amount of information about the topological structure of the data space . algebraic topology provides a mature set of tools for counting and collating holes and other topological pattern features , both spaces and maps between spaces , for simplicial complexes . it is therefore able to reveal patterns and structures not easily identifiable otherwise . as persistent homologyis generated recursively , corresponding to an increasing sequence of values of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . complexes grow with \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ delta $ $ \\ end { document } . this leads us to naturally identifying the chain maps with a sequence of successive inclusions . the available algorithms for computing persistent homology groups focus typically on this notion of filtered simplicial complex . fortunately , homology is exceptional under this respect because the invariants arise as quotients of finite - dimensional spaces . topological information is contained in persistence homology , that can be determined and presented as a sort of parameterized version of the set of betti numbers . its role is just that of providing summaries of information over domains of parameter values , so as to better understand relationships among the geometric objects constructed from data . the emerging geometric / topological relationships involve continuous maps between different objects , and therefore become manifestations of functoriality , i.e , imply the notion that invariants can be extended not just to the objects studied , but also to the maps between such objects . functoriality is central in algebraic topology because the functoriality of homological invariants is what permits one to compute them from local information . we recall the k \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ ddot { u } $ $ \\ end { document } unneth theorem that allows to consider the poincar polynomial of the space \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x as the generating function of the betti numbers of \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ x $ $ \\ end { document } x .\noutput:\n" }, { "from": "agent", "value": "in order to define a new method for analyzing the immune system within the realm of big data , we bear on the metaphor provided by an extension of parisi s model , based on a mean field approach . the novelty is the multilinearity of the couplings in the configurational variables . this peculiarity allows us to compare the partition function \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ z $ $ \\ end { document } z with a particular functor of topological field theory the generating function of the betti numbers of the state manifold of the system which contains the same global information of the system configurations and of the data set representing them . the comparison between the betti numbers of the model and the real betti numbers obtained from the topological analysis of phenomenological data , is expected to discover hidden n - ary relations among idiotypes and anti - idiotypes . the data topological analysis will select global features , reducible neither to a mere subgraph nor to a metric or vector space . how the immune system reacts , how it evolves , how it responds to stimuli is the result of an interaction that took place among many entities constrained in specific configurations which are relational . within this metaphor , the proposed method turns out to be a global topological application of the s [ b ] paradigm for modeling complex systems ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: benign smooth muscle cell lesions are frequently found in a diversity of body organs , such as the breast , gastrointestinal tract , kidney , bladder , and skin ( 1 ) , but they are extremely rare in the spermatic cord or paratesticular tissue of the male genital tract . they are described as hypertrophy , hyperplasia or hamartomatous proliferations in the few published reports ( 2 ) . they are however a largely unrecognised non - neoplastic cause of intrascrotal masses . in this article , we report a rare case of an intrascrotal epididymal mass , diagnosed as smooth muscle cell hyperplasia . a 55 - year - old caucasian male presented with a two - year history of a firm , tender lump in his scrotum , which was also increasing in size . the patient was otherwise fit with no significant past medical history including no vasectomy history , exposure to tb or recent foreign travel . physical examination revealed a 3 cm irregular hard mass in the upper pole of his left epididymis , which was completely separate from a normal feeling testis and from the scrotal wall . the serum level of alpha - fetoprotein and - human chorionic gonadotropin were within normal limits . on ultrasonography both testes appeared normal and a small varicocoele was noted in the right hemi scrotum . there was an irregular , hypoechoic cystic mass in the upper epididymis with internal echoes measuring up to 2 cm in diameter and slightly prominent left testicular veins . a staging ct of the chest , abdomen and pelvis excluded the possibility of metastases or another primary . sectioning the orchidectomy specimen revealed a well circumscribed , predominantly multicystic , mass measuring 17 mm in the tail of epididymis ( figure 1 ) . further sectioning showed the lesion extending towards the epididymal head and measured maximally 34 mm . both proximally and distally the lesion was less well demarcated from the normal epididymal structures . well circumscribed multicystic mass within the epididymis microscopic examination of the lesion showed cystic spaces and ducts lined predominantly by flattened and , to a lesser extent , by columnar epithelium , identical to that seen within the normal epididymis . a prominent layer smooth muscle was found lining these cystic spaces and was also identified within the interstitium between them ( figure 3 ) . the lesion merged with tubules in the epydidymal tail and head ( figure 4 ) . the rete testis showed extensive cystic dilatation as did the tubules in the epididymal head . columnar epididymal type epithelium lining a ductular structure with abundant spermatozoa within the lumen cystic duct with surrounding cuff of hyperplastic smooth muscle low power view showing the mass blending with ducts in the epididymal tail based on the histopathological findings a diagnosis of smooth muscle hyperplasia of the epididymis was made . hyperplastic and hamartomatous extratesticular intrascrotal lesions are exceptionally rare and may simulate neoplasia on clinical examination ( 2 ) . the largest series was published by barton et al ( 1999 ) , ( 7 ) . he described 16 testicular adnexal lesions in males aged between 46 and 81 , mean 63 years . ultrasonography was the imaging modality of choice , followed by orchidectomy in all cases except a few where only epididymis was surgically excised . nine of the 16 cases were in the epididymis ; of the remaining three were in the spermatic cord and one each in the tunica vaginalis and tunica albuginea . grossly , the masses ranged in size from 6 mm to 70 mm ( mean 26 mm ) . microscopically all cases showed smooth muscle hyperplasia in a periductal , perivascular , interstitial or mixed pattern . the periductal pattern as described by barton is similar to the pattern of proliferation in our case . when considering the normal anatomy of the epididymis , the tubules in the tail have a prominent smooth muscle coat compared with those in the head . in addition the presence of spermatozoa in the cystic spaces and the overall preservation of the epididymal architecture further support the theory that this is a hyperplastic process . what we have is an overgrowth of muscle normally present in this area . as barton points out it is debatable if these lesions are better classified as hamartomas ( 8 ) , but we agree hyperplasia better describes the proliferation . the cause of this proliferation is unknown . in other body systems , such as the gallbladderthe possibility of obstruction of the epididymal or vas deferens ducts has been considered ( 7 ) . however in our case , as in the cases described by barton there is no clear relationship to previous injury , surgery or an inflammatory disorder . the proximal ectatic changes in the epididymal head and rete testis are presumed a secondary phenomenon related to pressure affect in the area of smooth muscle hyperplasia . in summarywe have presented a case of smooth muscle hyperplasia of the epididymis , a very rare and benign lesion , the cause of which is unknown . in addition , more careful examination of the epididymis in all orchidectomy specimens may reveal coincidental subclinical smooth muscle hyperplasia , which would otherwise have gone undetected .\noutput:\n" }, { "from": "agent", "value": "benign smooth muscle cell proliferation commonly involves a variety of body organs , yet is a rare finding in the spermatic cord or paratesticular tissue of the male genital tract . here we discuss a case of smooth muscle hyperplasia of the epididymis which presented as an intrascrotal mass . this is a very rare condition and should be considered in the differential diagnosis of any paratesticular mass ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: neurofibromatosis ( nf ) is considered one of a group of multisystem hereditary diseases that also include tuberous sclerosis , von hippelthis heterogeneous group of diseases has been alternatively defined as phakomatoses , neurocutaneous syndromes , tumor predisposition syndromes , and ectodermal dysplasia by different authors over the years . the eye and the ocular adnexa may be affected by characteristic lesions that are relatively frequent , and are , therefore , considered as diagnostic hallmarks of the disease , while other ocular manifestations are rare and inconstant . a number of authors have chosen the name disseminated hamartomatosis because of findings of hamartoma and tumors in various organs . the associated tumors may lead to morbidity due to their progressive growth and mass effect , and although initially not characterized by aggressive histological characteristics , they can show malignant transformation in a small proportion of cases . since nf is characterized by considerable variability of clinical features , riccardi1 proposed the classification of nf into seven types , but a more recent classification only includes nf type 1 ( nf1 ) and nf type 2 ( nf2 ) , while the other types are now considered as variants . in fact , the genetic alteration in the main two variants is different , being on chromosome 17 - 17q11 .2 in nf12 and chromosome 22 - 22q12 .2 in nf2 .2 the prevalence of nf1 is about one in 3,500 live births .1 the transmission modality is autosomal dominant ; however , approximately 50 % of cases are caused by spontaneous mutations , and there is considerable variability of expression between affected families . diagnosis is usually performed clinically and is based on specific diagnostic criteria . mutation analysis using multiple molecular diagnostic techniques for genomic dna and rna can also be considered in some cases , for example , in very young children when the diagnosis is suspected but not clinically confirmed . this is because many clinical features of nf1 are age dependent , and diagnosis is occasionally more challenging in the pediatric population .3 the genetic modification in nf1 leads to alteration of expression of the cytoplasmatic protein normally encoded by the nf1 gene known as neurofibromin , a 220 kda guanosine triphosphate ( gtp ) ase - activating cytoplasmatic protein that is involved in cell growth regulation mechanisms by regulating the ras protein , specifically by converting ras - gtp active form to ras - gdp inactive form .3,4 the consequence of the lack of neurofibromin results in an excess of the ras - gtp active form , which promotes excessive cell growth , leading to deregulation and tumorigenesis . for this reason , nf1 is also considered as an rasopathy , which is defined as a disorder caused by a germline mutation that causes deregulation of the ras mitogen - activated protein kinase pathway .3,4 nf1 is characterized by considerable clinical heterogeneity and age - related nature of clinical expression . the disease may also be seen as mosaicism , also called segmental nf1 . in these cases , nf1 maintains the usual characteristics of the disease but is localized only in a body segment .57 segmental nf1 is approximately ten times less frequent than nf1 .8 in fact , prevalence of these forms is 1/36 ,00040,000.9 patients with segmental nf1 are also at relatively lower risk for life - threatening complications . as for other features of nf1 , ocular findings in segmental nf , such as lisch nodules , are found only when the ocular district is involved . in nf1 , the various clinical features affecting the nervous , dermatologic , ocular , and skeletal systems are usually absent at birth but develop shortly after . approximately 95 % of nf1 patients meet diagnostic criteria by age 8 , and all do so by age 20 . the diagnostic criteria currently used for diagnosis were presented by the national institute of health statement in 1987.10 an individual with at least two of the following criteria is considered affected by the disease : at least six caf au lait spots with a minimum diameter of 0.5 cm prior to puberty or a minimum diameter of 1.5 cm following puberty , inguinal and / or axillary freckling , at least two lisch nodules , optic pathway glioma , typical bony lesions such as sphenoid wing dysplasia , pseudoarthritis of the tibia , and a first - degree relative with nf1 .10 caf au lait spots are not present at birth but become evident at about 1 year of age ; they are pigmentary lesions of the skin with well - characterized , uniform pigmentation and defined margins . freckling is found in approximately 80 % of patients under the age of 6 and in 90 % of adults over age 30.11 they appear as small freckles less than 5 mm in size and are localized usually in the axillary or inguinal area ( crowes sign ) . neurofibromas , found in almost all nf1 patients over 30 years of age , are prevalently located over the trunk , with 20 % seen in the head and neck region .12 they are divided into cutaneous , subcutaneous , and plexiform neurofibromas ; the latter are observed in 25 % 30 % of cases .12,13 histologically , neurofibromas are formed by schwann cells , nonneoplastic fibroblast - like cells , mast cells and macrophages , and endothelial and perineural cells .11,14 clinically , cutaneous neurofibromas are asymptomatic , soft , brown - colored tumors that range from a few millimeters to several centimeters in size . the subcutaneous variety is characterized by firm consistency , tenderness on manipulation , and a size of approximately 34 cm . the plexiform neurofibroma shares characteristics similar to the other types , but is more prone to transformation into variants of malignant nerve sheath tumors ( 7 % 13 % of cases also known as mpnst tumors ) such as neurofibrosarcoma or malignant schwannoma .15 with advancing age , these tumors can continue to grow to significant sizes and may physically hinder functionality . in fact , enormous neurofibromas , invading the palpebrae , have been described , and these can create functional disturbances . rare systemic alterations of nf1 include cardiovascular abnormalities with hypertension , increased incidence of pheochromocytoma and aortic coarctation , neurocognitive deficits of various severities in 60 % of cases ,13 leukemia , and lymphoma .16 in nf1 , various skeletal anomalies may be found : scoliosis in 10 % 15 % of patients , thinning of the long bones , pseudoarthrosis of tibia , and absence of the greater wing of the sphenoid bone in 1 % 6 % of patients .16 palpebral plexiform neurofibroma is usually monolateral , frequently affects the upper eyelid , and appears usually after 2 years of age ; it has the tendency to grow and cause asymmetric ptosis associated with deformation of the palpebral margin ( figure 1 ) . in some cases , enormous neurofibroma of the palpebra , defined palpebral elephantiasis , may result .15 the hypertrophy of the nerve fibers of the nerve sheath tumor can be occasionally felt by digital palpation during physical examination of the eyelids . katz syndrome .15 an unusually rapid growth , increase in tenderness , or bleeding , warrants further investigation to rule out malignant transformation . these palpebral plexiform neurofibromas have a propensity to relapse , and surgical operations are complicated with profuse bleeding with disappointing results .1719 other rare ocular findings in nf1 include conjunctival neurofibroma ( figure 2 ) and a characteristic hypertrophy of corneal intrastromal nerves known aslignes grise .20 iris hamartoma in nf1 known as lisch nodules21 are unusual before 2 years of age , may be occasionally observed before 6 years , but their prevalence , number , and dimensions in individual cases increase considerably with age .22,23 lewis and riccardi24 ,25 described the case of a woman with lisch nodules as the sole clinical manifestation of nf1 other than having two sons with the disorder . histologically , lisch nodules are melanocytic hamartomas composed of melanocytes , elongated fibroblasts , and mast cells . mast cells have been found to be present both in neurofibromas and lisch nodules .26 lisch nodules do not represent a cause of morbidity or disability , but they are diagnostically significant , being one of the principal hallmark manifestations of nf1 .8 slit - lamp observation reveals characteristic nodules with dimensions of approximately 2 mm , absence of vasculature , and a certain chromatic variability ranging from white to yellow or brown15 ,23 ( figure 3 ) . it has been reported in 1/300 nf1 patients .29 recent studies have made a distinction between nf1 patients with or without orbital facial involvement ( such as plexiform palpebral neurofibroma ) , and a finding of glaucoma was seen in 23 % of the patients with orbitalfacial nf1 .30 asymmetric globe enlargement in ipsilateral orbital facial nf1 was found in patients with glaucoma , with axial lengths ranging from 26 to 36 mm ; difference with the contralateral unaffected eye was of 46 mm .29,30 interestingly , this study revealed slight ocular enlargement in oculofacial nf1 , even in eyes with normotensive intraocular pressure ; indeed , it has been speculated that megalophthalmous may be present in nf1 irrespective of ocular hypertension .30 during clinical evaluation of patients with glaucoma , ultrasound biomicroscopy and anterior chamber optical coherence tomography ( oct ) is fundamental to evaluate the ciliary body and anterior chamber3134 ( figure 4 ) . the ciliary body may show thickening , and there may be signs of angle infiltration by neurofibroma or lischnodules .3133 glaucoma evident at birth usually suggests congenital abnormality of the angle , while onset at a later date suggests involvement of the anterior angle secondary to nf115 ,35,36 ( figure 4 ) . assessment for glaucoma , including intraocular pressure evaluation , gonioscopy , visual field examination , and optic nerve assessment , is advisable in patients with nf1 .3740 choroidal abnormalities of nf1 are undetectable by fundus biomicroscopic examination or fluorescein angiography . rescaldani et al41 used indocyanine green angiography to study the choroid in nf1 patients and showed that there were hypofluorescent areas in the early phases of angiography corresponding to choroidal nodules and speculated that there could be delayed perfusion of the choriocapillaris in these areas . yasunari et al42 first described the choroidal findings with the use of confocal microscopy using infrared light and found numerous bright patchy areas , especially localized in the posterior pole of the fundus . these authors also performed indocyanine green angiography and found that these bright areas corresponded to hypofluorescence . more recently , the use of new noninvasive technology such as near infrared reflectance ( nir ) and oct has made it possible to better evaluate choroidal alterations . viola et al43 evaluated choroidal abnormalities in nf1 patients using nir in a large group of patients and found nodules in 82 % of patients . they found a diagnostic sensitivity of 83 % and a specificity of 96 % , with a cut - off value of 1.5 nodules ( figure 5 ) . nakakura et al44 found that most choroidal nodules were located at the posterior pole especially in pediatric patients and also found that there was a higher number of choroidal alterations in the arcade regions and that the extent of choroidal alterations increased with age . oct uses an 830 nm near infrared light source and measures light waves reflected from and scattered by the tissues of the eye , enabling the acquisition of cross - sectional , high - quality in vivo images with accurate differentiation of the retinal layers .45 furthermore , enhanced depth imaging ( edi ) in spectral domain oct sets the peak sensitivity , or zero - delay line , behind the retinal pigment epithelium and enables the study of the choroid .46 in a recent investigation , using spectral domain technology , choroidal nodules were studied both with nir imaging and cross - sectional edi - oct images , and the authors showed that nir detected choroidal alterations corresponding to two types of hyperreflective choroidal nodules that were either dome - shaped or had placoidmorphology .47 furthermore , as the spectral domain software enables segmentation measurements , the authors evaluated choroidal and individual retinal layer thicknesses in patients with nf1 and reported a reduction of the mean choroidal thickness . interestingly , the neuroepithelium , photoreceptor - retinal pigment epithelium , and outer nuclear layer were also reduced in thickness in nf1 patients compared to healthy control subjects . the authors speculated that altered choroidal circulation , due to the presence of nodules , could be the cause of retinal thinning . a number of other case reports have also shown choroidal and retinal thickness alterations in nf1 .48,49 retinal alterations in nf1 have not been frequently reported . there are a few reports on cases with retinal hamartomas also involving the retinal pigment epithelium .50 muci - mendoza et al51 reported retinal microvessel alterations or corkscrew vessels in 38 % of 32 patients with nf1 . these were described as second - or third - order microvenules more frequently found close to the temporal veins ( figure 6 ) . they had a morphological spectrum from very small subtle microvascular alterations to corkscrew - shaped vessels or larger microvessel venous anastomoses . similar retinal alterations were also recently reported in another study in 35 % of 17 patients ; the microvascular abnormalities were found overlying choroidal nodules as demonstrated with nir imaging of the fundus . the authors speculated that neural crest alterations in nf1 can cause functional abnormalities in autonomic vasomotor nerve cells , leading to the formation of retinal microvessel abnormalities .52 makino et al53 reported a patient with retinal microvascular abnormalities linked with congenital retinal macrovessels across the macula , showing dynamic changes over time . optic pathway glioma has been described in 15 % 25 % of patients with nf1 ; they usually develop at an early age , typically from age 3 to 5 years . these are actually low - grade tumors and do not possess malignant histological characteristics , nor do they show tendency to malignant transformation . they are classified as who grade 1 pilocytic astrocytoma .54 these frequently arise within the optic pathway , optic nerve , optic chiasma , and postchiasmatic radiations , but may arise in 25 % of cases in the brainstem .5456 essentially , clinical consequences of these tumors are caused by their volume - occupying characteristics , so depending on location and size , various consequences can follow . orbital localization at the optic nerve may cause proptosis , strabismus , edema of the papilla , visual field defects , and reduction of visual acuity . intracranial localization may cause general neurological symptoms of mass - occupying lesions associated with more specific signs based on the localization of tumor , such as visual field alterations , pupillary defects , and puberal precocity . magnetic resonance imaging is , therefore , indicated in these nf1 cases to rule out progression and to follow - up intracranial / intraorbital tumors . visual acuity and visual field analysis can not be immediately evaluated in young and uncooperative children .57,58 some authors have used visual - evoked potentials to objectively evaluate the visual pathways and to detect vision variations in nf1 .59 however , this testing is not sensitive or specific and is technically stringent ; thus , evidence that is reliable in evaluating vision loss in children with nf1 is lacking .55 oct also allows evaluation of the peripapillary retinal nerve fiber layer ( rnfl ) . novel research suggests that peripapillary rnfl alterations are detected with oct earlier than with conventional methods such as visual field testing .60 furthermore , the peripapillary rnfl can be compared with the macular rnfl thickness and ganglion cell layer thickness to potentially monitor disease progression . using oct rnfl thickness analysis , some authors have reported a reduced thickness of the peripapillary rnfl in children affected with nf1 who have optic nerve gliomas .6163 gu et al64 also showed a thinning of the ganglion cell layer - inner plexiform layer in children with optic nerve gliomas . furthermore , avery et al65 showed that handheld oct gives highly reproducible thickness measurement of the ganglion cell layer - inner plexiform layer in children with optic pathway gliomas . recently , spectral domain oct was used in adult nf1 patients without optic pathway glioma to evaluate the peripapillary rnfl using the circular diameter scan on the optic disc . the authors also evaluated the thickness of the macular rnfl and the ganglion cell - inner plexiform layer using the spectral domain software , which allows manual segmentation thickness measurements . these authors reported thinning of the peripapillary and macular rnfl and the ganglion cell - inner plexiform layer in adult patients with nf1 compared to healthy controls , which suggested neuronal and axonal loss .66 figure 7 shows evaluation of the peripapillary rnfl in a patient with nf1 . noonan syndrome is characterized by ocular hypertelorism , low - set ears , downslanting palpebral fissures and may occur in almost 12 % of nf1 patients .67 segmental nf1 is diagnosed in patients with both parents unaffected and with clinical nf1 features localized to one part of the body in a circumscribed , patchy , or linear arrangement , or in localized regions or organs .6870 unilateral lisch nodules with no other clinical manifestations have also been described in isolated case reports of segmental nf1 .71 nf2 is also an autosomal dominant disease caused due to a mutation in the gene for nf2 , which is located on chromosome 22 - 22q12 .2.72 this gene encodes for merlin , which is a protein that assists in linking actin cytoskeleton to the surface of glycoproteins and has an important function in remodeling cells and regulating growth .73 there is a 50 % chance of transmission from an affected individual to their offspring , but 50 % 60 % of patients have no family history , having instead de novo mutations .16 clinical characteristics of the condition may include bilateral vestibular schwanomas , multiple meningiomas , cranial nerve tumors , spinal tumors , and eye abnormalities . the most serious ocular findings are optic nerve hamartomas and hamartomas of the retina ( combined pigment epithelial and retinal hamartomas ) 16,74 ( figures 8 and 9 ) . a large proportion ( 60 % 80 % ) of patients have early - onset cataracts , usually with an onset of posterior subcapsular lenticular opacities or cortical wedge opacities .74 fluorescein angiography images of combined hamartomas of the retina and the retinal pigment epithelium can provide further details . early angiography phases show tortuous vessels due to the retraction of the internal limiting membrane and patchy areas of hypofluorescence due to hyperpigmentation .16 other sporadic findings in nf2 are as follows : dystrophic keratitis due to fifth cranial nerve involvement or facial paresis due to seventh cranial nerve involvement .75 patients with a diagnosis of nf2 should undergo magnetic resonance imaging of the brain to better evaluate any tumor involvement . over the past decades , radiation therapy was used in the management of nf2 - related tumors ; today , surgery is considered the standard treatment even if it is not always possible or advisable to remove all lesions .76 since the introduction of anti - vascular endothelial growth factors ( anti - vegf ) , this treatment has been used in a broad range of pathologies .7780 studies with bevacizumab suggest that anti - vegf therapies may cause significant reductions in tumor volume and significant improvement in hearing function in nf2 patients .81 since the description by von recklinghausen in 1882,82 nf1 has been extensively studied . nf1 together with other phakomatoses such as von hippel s disease and sclerosis tuberous complex are now known to be caused by alterations of tumor suppressor genes . however , many questions about these diseases remain unanswered ; the role of the neural crest and why different types of neurocutaneous conditions occur together in the same individual , still need clarification . weber syndrome from the group of phakomatoses ,8385 but further advances in the field of molecular genetics are necessary and can certainly contribute to the diagnosis and management of nf . in ophthalmology , we believe that the advent of new diagnostic instruments such as near infrared imaging and oct have provided new insight to study the ophthalmic manifestations of the disease .\noutput:\n" }, { "from": "agent", "value": "neurofibromatosis ( nf ) is a multisystem disorder and tumor predisposition syndrome caused by genetic mutation on chromosome 17 - 17q11 .2 in nf type 1 ( nf1 ) , and on chromosome 22 - 22q12 .2 in nf type 2 . the disorder is characterized by considerable heterogeneity of clinical expression . nf1 is the form with the most characteristic ocular manifestations . lisch nodules of the iris are among the well - known diagnostic criteria for the disease . glaucoma and associated globe enlargement have been described in a significant proportion of patients with nf1 and orbital facial involvement . optic nerve glioma may cause strabismus and proptosis , and palpebral neurofibroma may reach considerable size and occasionally show malignant transformation . near infrared reflectance has greatly contributed to enhancing our knowledge on choroidal alterations in nf1 . indeed , some authors have proposed to include these among the diagnostic criteria . optical coherence tomography has given new insight on retinal alterations and is a noninvasive tool in the management of optic nerve gliomas in children . ocular manifestations in nf type 2 can range from early - onset cataracts in up to 80 % of cases to optic nerve hamartomas and combined pigment epithelial and retinal hamartomas ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: jak - stat signaling pathway plays important roles in maintenance of cardiac homeostasis . to date , much attention has been paid to the biological and / or pathophysiological roles of jak - stat signal in cardiac myocytes . accumulating evidence has indicated that jak - stat signaling pathway is activated in cardiac myocytes by various cytokines , such as interleukin ( il ) -6-type cytokines , granulocyte colony - stimulating factor ( g - csf ) , leptin , erythropoietin and so on , and that the cardiac activation of jak - stat pathway promotes cardiomyocyte survival and myocardial angiogenesis , protecting myocardium from pathological stresses . thus , the regulation of jak - stat activities in cardiomyocytes could be one of promising strategies for cardioprotection against cardiovascular diseases , though their over - activation might be detrimental to the cardiac functions . it has been a long - standing belief that the mammalian hearts have the limited capacity of regeneration since postnatal cardiomyocytes substantially fail to proliferate . therefore , the cardiac homeostasis has been thought to depend mainly on cardioprotection , not on de novo synthesis of cardiac myocytes . in this context , one of the most surprising findings in this decade is the discovery of cardiac stem / progenitor cells . cells expressing c - kit , sca - 1 or islet - 1 have been identified as resident cardiac stem / progenitor cells in myocardium . these cells possess the ability to differentiate into cardiac lineage cells , including cardiomyocytes , vascular smooth muscle cells and endothelial cells . importantly , the transplantation of these cells results in the improved cardiac repair and regeneration after myocardial injury . in addition , bone marrow - or blood - derived cells , such as hematopoietic stem cells , mesenchymal stem cells and endothelial progenitor cells ( epcs ) , have been also proposed as the endogenous source of cardiac lineage cells . though the mechanisms of the differentiation of embryonic stem ( es ) cells into cardiac lineage have been precisely investigated , the signals responsible for the differentiation of cardiac resident and bone marrow - derived stem / progenitor cells remain to be fully elucidated . interestingly , recent studies have suggested that jak - stat pathway could be involved in determining the cell fates of the stem / progenitor cells . in this review , we focus on the jak - stat - mediated regulation of cardiomyogenesis in es cells , bone marrow - derived cardiac progenitor cells , and cardiac resident stem / progenitor cells . since es cells are attractive sources of cardiomyocytes in cardiac regenerative medicine , intensive studies have been performed to control es cell differentiation into cardiac lineage cells . while jak - stat signal is essential for maintenance of self - renewal and pluripotency of es cells , several lines of studies have reported that stat3 is involved in cardiomyogenesis in es cells . in murine es cells , foshay et al . demonstrated that the blockade of jak2 - stat3 signaling by pharmacological inhibitors or the by expression of their dominant - negative forms diminished beating areas in embryonic bodies , whereas the transfection of constitutively - active jak2 increased the beating areas . reported that leukemia inhibitory factor ( lif ) and bone morphogenetic protein ( bmp ) - 2 synergistically differentiated murine es cells into cardiomyocytes . importantly , inhibition of stat3 or mitogen - activated protein kinase ( mapk ) repressed synergistic effect of lif and bmp - 2 on cardiomyocyte differentiation in murine es cells . interestingly , the intracardiac injection of es cells , pretreated with lif and bmp - 2 , improved postinfarct left ventricular functions in a murine acute myocardial infarction model and decreased area of fibrosis . furthermore , the intracardially injected murine es cells exhibited the expression of cardiomyocyte and endothelial cell markers in vivo and increased capillary density . these results suggested that activation of glycoprotein 130 ( gp130 ) - jak2 - stat3 signaling pathway leads to the differentiation of es cells into cardiac lineage , though the jak - stat - independent differentiation is also reported . previously , it has been proposed that bone marrow - derived cells , such as hematopoietic stem cells , bone marrow stromal cells and epcs , transdifferentiate into cardiac lineage cells , including cardiomyocytes , vascular smooth muscle cells and endothelial cells . on the other hand , several groups demonstrated that transplanted hematopoietic stem cells transdifferentiated into cardiomyocytes at negligible frequency in infarct myocardium . thus , the ability of bone marrow - derived cells to differentiate into cardiomyocytes is controversial ; however , it is widely accepted that the transplantation of these cells improves cardiac function in injured hearts through paracrine factors from transplanted cells , accompanied by neovascuralization . interestingly , several studies have revealed that these paracrine circuits are mediated by jak - stat signaling . recently , it has been demonstrated that the injection of bone marrow mesenchymal stem cells into the hind limb muscles significantly improved ventricular function in the cardiomyopathic hamsters , although the existence of intramuscularly injected mesenchymal stem cells were limited in the injected muscles . those results indicate that the mesenchymal stem cell injection resulted in the activation of jak - stat3 signaling pathway and that upregulation of growth factors not only in skeletal muscles and but also in the diseased hearts . in addition , the administration of jak - stat inhibitors abrogated mesenchymal stem cell - mediated growth factor expression and functional improvement in the diseased hearts , suggesting that the tissue trophic paracrine network is activated by mesenchymal stem cell - mediated jak - stat3 signaling . il - 10 augments epc - mediated functional improvement and neovascularization in the ischemic myocardium possibly through enhancement of epc mobilization and survival . since il -10-mediated vascular endothelial growth factor ( vegf ) expression in epcs was abrogated by a stat3 inhibitor , it is suggested that il - 10 might enhance epc survival and function through activation of stat3 . the il -6-type cytokine is also a candidate that regulates the dynamics of bone marrow - derived cells in cardiac repair . the intramuscular injection of lif cdna after myocardial infarction attenuated infarct size and improved cardiac function , accompanied by the increased myocardial neovascularization . interestingly , increased level of serum lif led to the differentiation of bone marrow cells into cardiomyocytes and endothelial cells , possibly by enhancing the cell migration . moreover , it is proposed that lif - mediated recruitment of bone marrow - derived cells is essential for the cardiac repair as an endogenous regenerative mechanism . the postnatal bone marrow contains a population of nonhematopoietic sca - 1 + / lin - / cd45 - mononuclear cells that express early cardiac lineage markers such as nkx2 .5 / csx and gata - 4 and these cells migrate in response to several cytokines after myocardial infarction . interestingly , supernatants from infracted myocardial tissue increased the motility of the bone marrow - derived mononuclear cells , and inhibition of lif signaling by anti - lif receptor neutralizing antibodies suppressed the cell motility . since lif utilizes jak - stat signaling pathway as is the case with other il -6-type cytokines , it is likely that jak - stat pathway plays important roles in the lif - mediated differentiation and migration of bone marrow - derived cells after myocardial injury . recently various kinds of cardiac resident stem / progenitor cells expressing c - kit , sca - 1 or islet - 1 have been identified in the myocardium . these cells were reported to differentiate into cardiac lineage cells including cardiomyocytes , vascular endothelial and smooth muscle cells ; however , little has been known about signaling pathways that determine their cell fates . since jak - stat pathway plays important roles in stem cell differentiation , as described above , we examined the biological significances of il -6-type cytokines in the cardiac stem / progenitor cells . il -6-type cytokines , such as lif , cardiotrophin - 1 and il - 11 , induced the expression of the endothelial cell marker genes and proteins , but not cardiomyocyte or smooth muscle cell markers , in cultured cardiac sca - 1 cells , accompanied by activation of stat3 and erk1 / 2 but not akt . similarly , cardiac c - kit + cells are also differentiated into endothelial cells by lif - mediated stat3 activation . in contrast , il - 6 failed to induce the endothelial differentiation because of the lacking of its receptor in sca - 1 cells ; however , il - 6 exhibited the activity to induce the endothelial differentiation and stat3 phosphorylation in the presence of soluble il - 6 receptor , an agonistic receptor . thus , il - 6 might contribute to vascular formation by activating cardiac stem cell in the presence of soluble il - 6 receptor . importantly , the inhibition of stat3 pathway by the transduction with its dominant negative form or with sirna abrogated the il -6-type cytokines - induced differentiation of sca - 1 cells into endothelial cells and the inhibition of erk1 / 2 with the mek1 / 2 inhibitor u0126 also prevented the endothelial differentiation , suggesting that il -6-type cytokines could elicit the endothelial differentiation of cardiac sca - 1 cells through gp130 - stat3 in coordination with gp130 / erk pathway . although cardiac sca - 1 cells were differentiated into beating cardiomyocytes by oxytocin , jak - stat signaling did not induced the differentiation of cardiac sca - 1 cells into cardiomyocytes . in contrast , jak - stat3 signaling pathway evokes the differentiation of murine es cells into beating cardiomyocytes as described above , suggesting that the signaling pathways responsible for the regulation of differentiation into cardiomyocytes might be different between es cells and cardiac sca - 1 cells . we have addressed molecular mechanisms for jak - stat - mediated endothelial cell differentiation of sca - 1 cells , focusing on pim - 1 kinase . pim - 1 has been originally identified as an oncogenic serine / threonine kinase involved in the regulation of cell survival , proliferation and differentiation . in cardiac sca - 1 cellsthe blockade of stat3 pathway abrogated the upregulation of pim - 1 expression by lif and the gene transduction of constitutively - active form of stat3 cdna induced expression of pim - 1 , indicating that stat3 activation is necessary and sufficient for pim - 1 induction . importantly , the overexpression of dominant negative form of pim - 1 abrogated the endothelial differentiation , indicating that pim - 1 kinase activity is essential for stat3 - mediated endothelial cell differentiation of cardiac sca - 1 cells . furthermore , the functional roles of pim - 1 in cardiac sca - 1 cells were evaluated in vivo . the transplantation of sca - 1 cells increased the capillary density in myocardium after myocardial infarction , associated with the improvement of cardiac function , as reported previously . interestingly , these beneficial effects were abrogated by the overexpression of dominant - negative form of pim - 1 , suggesting that jak - stat - pim - 1 pathway could contribute to neovascularization , promoting cardiac repair / regeneration in vivo . the biological significances of pim - 1 in the regulation of stem cell differentiation have been previously described . similar to the findings described above , it was reported that pim - 1 is required for vegf - induced endothelial cell differentiation of flk - 1 es cells . therefore , it is possible that cardiac sca - 1 cells utilize the common signaling pathway with flk - 1 es cells , in the process of the endothelial differentiation . in cardiacc - kit stem / progenitor cells , other aspects of pim - 1 have been reported . transplantation of cardiac c - kit stem / progenitor cells overexpressing pim - 1 into infract myocardium significantly enhanced myocardial regeneration accompanied with reduction of infarct size , upregulation of c - kit cells , and increased vasculature in the damaged region . furthermore , pim - 1 stimulates cell cycling and promotes asymmetric division in cardiac c - kit progenitor cells , leading to a preservation of the progenitor cell pool as well as cardiogenic daughter cells . taken together , pim - 1 may exhibit the differential functions , depending on the kinetics of its activity . , the preexisting endothelium grows and contributes to the formation of vascular network , while vasculogenesis is defined as a de novo vessel formation from vascular endothelial precursor cells . in postnatal neovascularization , it is certain that angiogenesis plays important roles in vessel formation ; however , recent studies have proposed that the bone marrow - derived cells , such as epcs , participate in the vascular formation , by homing to the target organs and by differentiating into endothelial cells . considering that il -6-type cytokines , which activate jak - stat pathway in cardiac stem cells , are induced in injured myocardium , it is suggested that cardiac resident stem cells contribute to postnatal vasculogenesis as novel endothelial precursor cells . it should be noted that the cardiac resident stem cells could mediate vasculogenesis without homing process , designated as in situ vasculogenesis , unlike the bone marrow - derived cells ( fig . 1 ) . interestingly , recent studies have described the existence of tissue resident epcs in non - cardiac tissues . further studies would be required to elucidate whether the activation of jak - stat pathway in these non - cardiac resident stem cells also induces their differentiation . in order to develop novel therapeutic strategies that target cardiac stem cells , it is essential to elucidate the signaling pathways that determine their cell fates . in this review , we discussed the roles of jak - stat pathway in the differentiation of stem / progenitor cells into cardiac lineage cells . and we have described that jak - stat - pim - 1 pathway plays critical roles in the endothelial differentiation of cardiac sca - 1 stem / progenitor cells . toward the clinical application of these findingsfirst , we should identify the human cells that correspond to murine sca - 1 cells and to make clear whether these cells differentiate into endothelial cells in response to activation of jak - stat signaling pathway . especially in clinical situations in cardiovascular medicine , stem cell therapies would be performed in elderly patients whose stem / progenitor cells , such as epcs , are likely to be senescent . in this context , it is important to maintain the ability of cardiac stem cells to differentiate into endothelial cells . interestingly , it has recently been demonstrated that erythropoietin secreted by cardiomyocytes restored the endothelial cell differentiation of cardiac sca - 1 progenitor cells , and preserved the cardiac microvasculature and cardiac function in murine heart failure model . second , it is required to develop the interventional methods that safely activate jak - stat - pim - 1 and their downstream pathways . to address this problem , further effort should be made to identify pim - 1 substrates responsible for the endothelial differentiation . in spite of these difficulties , targeting jak - stat signaling in cardiac resident stem / progenitor cells might be a promising therapeutic strategy against cardiovascular diseases since the neovascularization is critical to preserve myocardium in failing hearts . ( a ) in the vasculogenesis by bone marrow - derived cells , endothelial progenitor cells migrate from the bone marrow , home to peripheral organs , and participate in the postnatal neovascularization . ( b ) jak - stat pathway in cardiac resident stem / progenitor cells may contribute to neovascularlization by inducing the endothelial differentiation . il -6-type cytokines , secreted from myocardium , stimulate gp130 - jak - stat - pim - 1 signaling pathway in cardiac resident stem / progenitor cells , and induce the endothelial differentiation . the newly differentiated endothelial cells may participate in vessel formation without homing process , designated as in situ vasculogenesis .\noutput:\n" }, { "from": "agent", "value": "recently various kinds of cardiac stem / progenitor cells have been identified and suggested to be involved in cardiac repair and regeneration in injured myocardium . in this review , we focus on the roles of jak - stat signaling in cardiac stem / progenitor cells in cardiomyogenesis . jak - stat signaling plays important roles in the differentiation of stem cells into cardiac lineage cells . the activation of jak - stat signal elicits the mobilization of mesenchymal stem cells as well , contributing to the maintenance of cardiac function . thus we propose that jak - stat could be a target signaling pathway in cardiac regenerative therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the causes of persistent submacular detachment after successful rhegmatogenous retinal detachment ( rrd ) surgery remain unknown . its presenceis associated with poor postoperative visual acuity , but due to its spontaneous resolution no additional therapeutic or diagnostic procedure is recommended . a case of central serous chorioretinopathy ( csc ) that simulated persistent subfoveal fluid after rrd surgery is presented . to the authors knowledge , no other case of visual impairment after successful retinal detachment surgery due to csc has been reported in the pubmed database . in view of this report , csc should be considered in the differential diagnosis of persistent subretinal fluid after successful retinal detachment surgery . persistent submacular fluid after successful rhegmatogenous retinal detachment ( rrd ) surgery is associated with poor initial visual outcome .1 its spontaneous resolution may take several months and no additional procedure is recommended to accelerate its natural course as it does not seem to influence the final visual acuity .2,3 the causes of persistent foveal detachment are unclear ; however , its incidence is more often significantly reduced after vitrectomy and gas surgery than after scleral buckle procedure .1,2 central serous chorioretinopathy ( csc ) is an idiopathic serous detachment of the macula related to increased adrenergic and steroidal stimulation state and has been reported secondary to different surgical procedures .46 a case of csc misdiagnosed as persistent subretinal fluid after successful retinal detachment surgery , with no spontaneous improvement over an 18 - month period , is reported here . a 48 - year - old phakic man underwent successful pars plana vitrectomy and encircling buckle for a 360 macula - off rrd in his right eye . the patient was started postoperatively on prednisolone drops five times per day in a decreasing dosage for the following 5 weeks . at the 5 - month visit , best corrected visual acuity was 0.4 in his right eye and persistent submacular fluid was identified on spectral - domain optical coherence tomography ( figure 1a ) with an increased epimacular signal that was believed to be a thickened internal limiting membrane . to relieve tangential macular tractions , which might have accounted for the persistent foveal detachment , the patient underwent a second vitrectomy with internal limiting membrane peeling and long - lasting gas . one month later , an increase in subretinal fluid was noted ( figure 1b ) . fundus fluorescein angiography revealed two retinal pigment epithelium leaking points in the juxtafoveolar area , which led to the diagnosis of csc ( figure 2 ) . the presence of submacular fluid after successful retinal detachment surgery is associated with poor postoperative visual acuity . no additional therapeutic procedure is recommended due to its spontaneous resolution , which can take up to 18 months and is accompanied by slow visual improvement . optical coherence tomography is useful in detecting persistent subretinal fluid , which is otherwise difficult to identify on clinical examination .2,7 the causes of persistent submacular detachment after successful retinal detachment surgery remain unknown .13 its incidence seems to be higher after scleral buckling surgery than after vitrectomy surgery ( 55 % versus 15 % ) .1,2 complete drainage of subretinal fluid during pars plana vitrectomy plus the displacement of fluid by a large gas bubble have been proposed to explain such differences .1 however , no definitive mechanism has been established . in the patient discussed , csc simulated persistent subfoveal fluid after rrd surgery . fundus fluorescein angiography , which is not routinely performed in this setting , revealed retinal pigment epithelium leaking points underlying the detached fovea . it has been proposed that csc is more likely in patients having type a personality and when its occurrence is preceded by a variety of stressful events in a patient s life .46 csc in the patient discussed here could have worsened after the second vitrectomy since subretinal fluid increased after internal limiting membrane peeling . another explanation for the clinical course of this patient could be the persistence of subretinal fluid after rrd repair and the developing of csc following macular surgery . to the authors knowledge , no other case of visual impairment after successful retinal detachment surgery due to csc has been reported in the pubmed database . in view of this report , csc should be considered in the differential diagnosis of persistent subretinal fluid after successful retinal detachment surgery . this disease is associated with increased levels of catecholamines ( stress ) and glucocorticoids ( steroidal medication ) , both related to ocular surgery for rrd .\noutput:\n" }, { "from": "agent", "value": "backgroundthe causes of persistent submacular detachment after successful rhegmatogenous retinal detachment ( rrd ) surgery remain unknown . its presence is associated with poor postoperative visual acuity , but due to its spontaneous resolution no additional therapeutic or diagnostic procedure is recommended.case reporta case of central serous chorioretinopathy ( csc ) that simulated persistent subfoveal fluid after rrd surgery is presented.conclusionto the authors knowledge , no other case of visual impairment after successful retinal detachment surgery due to csc has been reported in the pubmed database . in view of this report , csc should be considered in the differential diagnosis of persistent subretinal fluid after successful retinal detachment surgery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: neurocognitive and concussion like sickness behaviour is a cluster of signs and symptoms following a traumatic brain injury or systemic infections . these signs and symptoms such as headaches , dizziness , neuropsychiatric manifestations , and cognitive impairment are usually deficits in somatic and behavioural domains . literature shows that impairment in mental functions following traumatic event has a common biological origin in the form of neuroinflammation , which triggers a complex cascade of events such as activation of inflammatory cells and proteins and expression of cytokines . these inflammatory events lead to unavoidable brain damage such as alteration in hippocampal cholinergic function , which mediate changes in cognition and behaviour . the circumstantial data suggests that proinflammatory cytokines may play a role in instigating long - term cognitive and depressive like behaviour by infiltrating neurological tissue in individuals . cytokines have been studied to assess neurologic injury in various surgeries , traumas , infections , strokes , neuropsychiatric disorders , and autoimmune diseases such as multiple sclerosis . postoperative cognitive deficits such as impairment of recent memory , concentration , language comprehension , and social integration have been reported in 25.8 % of patients one week after the surgery and in 9.9 % of patients three months after the surgery . reported that neurocognitive decline ( ncd ) is a common complication with a prevalence up to 50 % . the postoperative cognitive deficits also depend on type of surgery , medications , and preexisting medical conditions . the cognitive deficits after trauma and after operation are associated with significant decline in patient 's quality of life , prolonged hospitalization , and increased overall morbidity and mortality . in our opinionthe overexpression of proinflammatory cytokines in muscular trauma directly influences the hippocampal dependent long - term potentiation and memory , that is , spatial memory , attention , executive function , object recognition , and contextual fear conditioning and synaptic plasticity . the higher cognitive processes rely heavily on learning and memory processes but their relationship with cytokines remains poorly understood.in this review we proposed cytokines and neuroinflammatory model of neurocognitive symptoms in trauma situation . the main research question of the current study is whether there is an association of muscular il - 6 , il - 1 , tnf , and other inflammatory mediators with neurocognitive impairment when released as result of the trauma or perioperatively . our main hypothesis is that il - 6 , tnf , il - 1 , and other inflammatory mediators released in muscular , orthopedic trauma or perioperative conditions are associated with neurocognitive impairment and concussion like illness and are not merely the result of anesthesia or medications . the purpose of this review is to systematically evaluate the literature and to clarify this entrenched belief . in our opinion , this hypothesis has implications for the pathogenesis and treatment of cognitive psychosomatic deficits in the trauma and postoperatively . the mc master university database using ovid / medline database was searched for articles published between 1946 and july 2013 using the following combination of the terms : cognitive impairment , traumatic brain injury , cytokines ( il - 1 , il - 6 , il - 8 , and tnf - a ) , neuroinflammation , concussion like symptoms , blood brain barrier , systemic inflammatory response , and polytrauma . all articles were published in peer - reviewed journals , reporting original data on cytokines and systemic inflammatory response . all the key words were used by using mesh words and were initially combined by using or . the words in each category such as neuroinflammation , cytokines , and cognitionour initial data search showed gave us 303447 in neurocognitive domains , 396588 in muscle and peripheral injury group , and 715522 in neuroinflammation category . on combing with andthe selection was further limited to human and english language , which gave us 172 published articles . for articles review , i followed the prisma and second chapter of 3rd edition of clinical epidemiology in clinical research . we also excluded articles that studied cytokines response in nontraumatic causes such as stroke , sah , hiv , or infections , cancers , and immunotherapy . out of those 172 published articles , 9 articles were selected to support the systemic effects of the cytokines , 23 articles to support the cognitive and behavioural symptoms that can be explained secondary to cytokines , and 21 articles to support the evidence that cytokines are related to peripheral trauma . clinical studies of peripheral blood or autopsy specimens show elevated increases in cytokines tnf - , il - 1 , and il - 6 in serum and cerebrospinal fluid ( csf ) of patients with mild to moderate late - onset alzheimer disease ( ad ) . simultaneously , age - associated changes in glial reactivity may predispose individuals to exacerbated neuroinflammatory cytokine responses that are permissive to cognitive and behavioural complications . it has been suggested that surgical tissue trauma and stress response induce perioperative nonspecific inflammatory response . il - 6 response to injury is robust , being demonstrated across many types of injuries including muscle , skin , bone , lung , and fat . elevated il - 6 , in a lumbar decompression surgery , in the first 24 hours is associated with cognitive deficits and prolonged hospital stay . hogevold et al reported that chemical mediators particularly il - 6 , ck , tnf - alpha and il - 1 are strongly correlated with muscular injury response and surgery , which supports our opinion . found that only elevations in il - 6 , s100b , were associated with cognitive impairment and delirium , following hip fracture surgery . perioperative increase in crp and inflammatory cytokines such as il - 1 and -10 is associated with neurocognitive deficits ( ncd ) in patients after cardiopulmonary bypass . reported elevated levels of inflammatory biomarkers in csf as predictor of cognitive decline in coronary artery bypass surgery . haas has found that professional amateur sports athletes , whiplash , and polytrauma patients show neurocognitive weakness in the absence of brain injuries , gram negative pathogenesis , infections , cerebrovascular disease , and neurodegeneration . elevated serum il - 6 has been shown to correlate with multiorgan failure and death in polytrauma patients . , alexander , gunstad and suhr , and iverson and lange reported increased serum concentrations of proinflammatory cytokines , including il - 6 , in patients with multiple injuries and a high prevalence of the neurocognitive and behavioural symptoms ( see table 1 ) . in various diseases states , and behavioral syndromes , inflammatory biomarkers have been found to be positively correlated with fatigue , sleep disturbances and irritability , and irritability . negative changes in mood and impaired learning and memory are significantly correlated with increases in il - 6 , tnf - , and il - 1 . on contrary to the above , there are studies that show that a decrease in peripheral systemic inflammation reduces the neuroinflammation , thus decreasing the sickness induction behaviour and improving cognitive functions . acute and chronic exercises have anti - inflammatory effects , reducing levels of proinflammatory cytokines and crp . exercise as a therapy for pcs seems to be supported by the fact that young athletic individuals have evidence of anti - inflammatory mediators that oppose the actions of il - 6 and tnf - . nonsteroidal anti - inflammatory drug ( nsaids ) user has a lower risk and progression of ad and nsaids are already being explored as a treatment for depression . acetylsalicylic acid has already been shown to accelerate remission in individuals who are not responsive to ssris . interestingly , a recent report from tobinick and gross shows a rapid cognitive improvement following perispinal etanercept ( a potent tnf - antagonist ) administration in an alzheimer patient . animal inflammatory models suggest focal dysregulation in cerebrovascular flow in areas important to memory , such as the hippocampus . animals treated with cytokines , such as il - 1 or tnf - or ifn - 1 , exhibit sickness behaviours , including reduced locomotor activity , diminished social interactions , and diminished consummatory behaviours . transgenic mice expressing il - 6 in glial cells show ataxia , seizures , and extensive neurodegeneration . tnf uptake into the hypothalamus is 9 times faster than into the parietal cortex and is not taken up by the striatum or the midbrain . differences also exist between brain and spinal cord transport rates ; for example , the transport rate of il - 1 into the spinal cord is about 80 % of the brain . variations also occurred among the regions of the spinal cord . the cervical spinal cord was the region with the fastest transport rate for both interferon ( inf ) and tnf . reported that ibuprofen restored learning ability in rats with hepatic encephalopathy induced by portacaval shunts . the posttraumatic blood levels and pharmacological therapy aimed at enhancing the protective cytokines and inhibiting the damaging cytokines have shown improved survival rates in experimental animals . trauma initiates immune reaction , circulating t cells activation , proliferation , and cytokines expression . once activated , cytokines exert inflammatory and compensatory anti - inflammatory process and wound repair and healing mechanisms . however their dysregulation and prolonged and excessive inflammatory response to pathophysiological insults lead to secondary injury , immune alteration , and multiorgan failure . a person is more prone to develop cognitive decline following a major muscular injury or surgery as compared to minor injury or laparoscopic surgery . after the major trauma or surgery , immune cells such as cd +4 t lymphocytes , peripheral blood mononuclear cells ( pmbc ) , and macrophages are activated . cytokines are derived from type i and ii cd +4 helper t cells ( ht ) . type 1 cd +4 ht promote cytokines il -1-alpha and - beta , il - 2 , ifn - , and tnf . type ii cd +4 ( ht ) secrete cytokines such as il - 4 , il - 6 , and il - 10 . a balance between the cd +4 ( i and ii ) cells is critical to maintain immune homeostasis ; however , imbalance between the two cell lineages is responsible for antigen presentation to peripheral blood mononuclear cells ( pmbc ) , increase in expression of tnf , il - 1 , and il6 , and alteration in antigen presentation and mitogen in trauma patients . these systemic cytokines are involved in cell - to - cell communication and are partially propagated by systemic immune response system ( sirs ) and multiorgan dysfunction ( mods ) . the brain is an immunologically active organ and is in direct communication with the immune and endocrine systems . human brain has il - 1 , il - 2 , il - 6 , and tnf - cytokine receptors at frontal cortex , hippocampus , hypothalamus , cerebellums , and cerebrovascular endothelium . the hippocampal formation and the dentate hilar region are differentially sensitive to injury relative to other regions of the brain , even in the absence of hypoxia or elevated intracranial pressure or without actual neuronal cell death . cytokines alert human brain through immunoneuropsychiatric ( inp ) cascade , secondary to peripheral inflammatory process due to injury . in brain , the peripheral cytokines act as a second messenger and activate calcium , which triggers the blood brain barrier ( bbb ) damage and destruction of tight junctions . first is direct or active transport of cytokines across the blood brain barrier through cytokines receptors . second is indirect transport diffusion at the circumventricular region ( cvo ) , where the bbb is incomplete . another indirect mechanism of peripheral cytokines transport is via vagal nerve stimulation of nucleus tractus solitarius ( nts ) in brain stem and then preoptic area of hypothalamus ( figure 1 ) . once in brain , the peripheral cytokines particularly il - 1 stimulate the microglia , which further stimulates the endogenous or central cytokines ( il - 1 , il - 6 , and tnf - production ) . cytokines are pleotropic mediators and exert their effects through complex immune cascades , interaction with complement system , altered excitotoxic glutamate transmission , abnormal neurotransmission , oxidative stress , and nitric oxide production , leading to apoptotic neurodegeneration . neuroinflammation influences neuronal and axonal survival and alters the central noradrenergic , dopaminergic , tryptophan , and serotonergic neurotransmission in the hypothalamus hippocampus . the cell debris and central stress further induce the central expression of il - 1 , il - 6 , and tnf in a vicious cycle . cytokine known as mediator of physical and psychological stress also alters the hypothalamic - pituitary - adrenal axis and cortisol regulation . peripheral cytokines also exert indirect effects on the cognitions such as disrupting sleep regulation , micronutrient deficiency by appetite suppression , and endocrine interactions . on the other handas a mediator of bidirectional communication between cns and the peripheral immune system , systemic inflammatory reactions can influence brain function and conversely cns processes may affect distant organs ( figures 2 and 3 ) . the most important and well - studied cytokines after peripheral trauma are il - 6 , tumour necrosis factor - alpha ( tnf - ) , il - 1 , il - 2 , il - 8 , and il - 4 and recently il - 18 , il - 12 , and ifn - . in the periphery , il - 1 , il - 6 , and tnfare typically considered proinflammatory , whereas il - 4 , il - 10 , and il - 13 are typically considered anti - inflammatory . the proinflammatory cytokines particularly il - 6 are the acute - phase response proteins that contribute to the development and resolution of signs and symptoms of acute and chronic inflammation after soft tissue injury ; see table 2 . peripheral il - 1 plays important role in neuroendocrine modulation , proliferation , and expression of microglia . peripheral il - 1 also alters central release and turnover of norepinephrine , serotonin , dopamine , and cholinergic neurotransmission . il - 1 also affects hippocampal neurons and the synaptic plasticity , thus inhibiting the long - term potentiation ( ltp ) . peripheral il - 6 is acute - phase protein , increases vascular permeability , and induces lymphocytic activation . il - 6 once in brain induces microglia and astrocyte activation , which further triggers the release of proinflammatory cytokines . il - 6 alters the neuroendocrine neurotransmission , hypothalamic - pituitary - adrenal ( hpa ) axis , and acth release . il - 6 impacts cognitive function via effects on synaptic plasticity , decline in learning , memory , and long - term potentiation ( ltp ) . it exerts its effects by activating caspases , which activate the death signalling pathway via glutamate excitation . tnf alters the synaptic efficacy by upregulating surface expression of - amino -3-hydroxy-5-methyl-4-isoxazolepropionic ( ampa ) receptors and phosphatidylinositol 3 ( pi3 ) kinase - dependent processes , thus causing a decrease in the synaptic inhibition and cognitive impairment . crp is associated with inflammation , impaired endothelial function , and cerebral amyloid deposits in areas important to memory , such as the hippocampus . crp is associated with memory , visuospatial impairment , and disruption of frontal subcortical pathways . il - 2 alters dopaminergic transmission and impairs the spatial memory performance via hippocampal neurodegeneration and suppression of long - term potentiation . immunotherapy , using il - 2 , induces a depressive like state that may be attenuated by antidepressant treatment . ifn - . ifn - gamma is associated with more general cognitive dysfunction , confusion , psychomotor slowing , parasthesia , visual disorientation anxiety , and depression . ifn induces il - 1 , tnf secretion , and depletion of serotonin , which contributes to cognitive and behavioural effects . as previously mentioned , brain regions particularly dorsolateral frontal cortex , hippocampus , hypothalamus , cerebellums , and cerebrovascular endothelium are susceptible to cytokines and neuroinflammation . these brain regions are involved in memory , learning , executive functions , and personality . the manifestations of sickness behaviour include increased somatic complaints , lethargy , sleep disruption , reduced social activity , reduced mobility , anhedonia , decreased learning , anorexia , decreased libido , and neuropsychiatric side effects including depressed mood , poor motivation , and impaired thought processing ; see table 3 . almost all the signs and symptoms of disease , including altered behaviour and neuropsychiatric phenomena , can be accounted for by the actions of immune cell and peripheral cytokines secretions . these profound discoveries have recently been applied to psychosocial disease , schizophrenia , and depression yielding completely new models for the etiology of these unexplained diseases . there is abundant evidence that peripheral inflammation can worsen or cause the axonal injury and exacerbate preexisting psychiatric disorders as well as the new onset of mood disorders ( depression and mania ) , anxiety disorders , and psychotic disorders . overall , based on the above literature reviews , the peripheral inflammatory response interferes with cognitive function as evidenced by abnormal memory , learning , and inability to develop long - term potentiation in hippocampus . given that similar symptoms may be seen in such diverse situations as perioperatively , after orthopedic or general trauma , perhaps it is time to consider pcs as merely one of many states in which there is an elevation of inflammatory cytokines . this hypothesis certainly opens a room to develop or determine inflammatory markers that might be helpful to address the cognitive weakness in postoperative and trauma patients and to study potential prediction of postsurgical or posttrauma risks and complications . currently , pcs or sickness behaviour such as neurocognitive and behavioural deficits is treated based on the specific symptoms primarily supportive to the individual and as such not treating the underlying cause . despite ongoing research , little progress has been achieved in terms of prevention or management of this problem , largely because of an incomplete understanding of the pathophysiology of cognitive impairment , which is essential to improve outcomes . in our opinion , some aggressive anti - inflammatory measures ( including inflammatory cytokines antagonists or nsaids ) may improve cognitive function in cognitive deficient subjects , particularly in trauma and perioperative patient . in our opinionthe same will also be true for the pcs patients and may prevent the long - term neurologic sequelae of tbi , systemic inflammation , including cognitive impairment . on the basis of the above overview , we believe there is sufficient clinical and research evidence to suggest clearly that cognitive impairment is not only limited to concussion , systemic infections and neurodegeneration . furthermore , most pcs symptoms can be explained with current evidence by increased levels of cytokines such as il - 1 , il - 6 , tnf - , and ifn - , which are all important cytokines after trauma . peripheral cytokines as those due to muscular injury or orthopedic trauma can influence neurotransmission and cause cognitive deficits . there is abundant evidence that there are cytokine - mediated interactions between neurons and glial cells , subserving cognition ( e.g. , cholinergic and dopaminergic pathways ) , and can modulate neuronal and glial cell function to facilitate neuronal regeneration and contribute to cognitive impairment .\noutput:\n" }, { "from": "agent", "value": "besides brain injury and systemic infection , cognitive and concussion like sickness behaviour is associated with muscular trauma and perioperative patients , which represents a major obstacle to daily activities and rehabilitation . the neuroinflammatory response triggers glial activation and consequently the release of proinflammatory cytokines within the hippocampus . we review clinical studies that have investigated neurocognitive and psychosomatic symptoms related to muscular trauma and in perioperative conditions . these include impaired attention and executive and general cognitive functioning . the purpose of this literature review is to focus on the systemic inflammation and the role of proinflammatory cytokines il1 , il6 , and tnf and other inflammatory mediators which mediates the cognitive impairment and induces sickness behaviour . moreover , this review will also help to determine if some patients could have long - term cognitive changes associated with musculoskeletal injuries or as a consequence of surgery and thereby will lead to efforts in reducing that risk ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the sagittal diameter of the cervical spinal canal is important , as a small canal diameter is associated with cervical myelopathy and with a high risk of spinal cord injury after trauma .1234 the majority of the published reports investigate the subaxial spine , and a sagittal canal diameter of 12 mm or less is regarded as stenotic .235 there are few studies regarding stenosis at the level of the atlas , with little data existing to define a critical threshold for stenosis .678 at the level of the atlas , the space available for the cord ( sac ) is equal to the sagittal diameter of the atlas minus the dens diameter and ligamentous structures , with steel 's rule of thirds dictating that the dens , sac , and spinal cord account for one third each of the contents of the c1 ring .8 atlantoaxial instability decreases the effective sac and may be associated with myelopathy . in the absence of instability , hypoplasia and other congenital malformations of the atlashave been associated with myelopathy .9101112 in most of these cases , this pathology is often associated with other skeletal abnormalities , such as spondyloepiphyseal dysplasia congenita and down syndrome .1314 on the other hand , hypoplasia of the atlas causing spinal cord compression in the absence of instability or other skeletal abnormalities is rare , although there have been several case reports .9101112 given the relative rarity of this diagnosis , the diagnosis of stenosis at the level of the atlas may be missed or underdiagnosed . the purpose of this study was to clarify the relative measurements of the sac between c1 and c2 . first , we investigated the sensitivity of the c3c2 spinolaminar line as a reliable screening tool for the hypoplasia of c1 sac on lateral radiographs . computed tomography ( ct ) scans were used to analyze the detailed and relative measurements of c1 and c2 sac , and magnetic resonance imaging ( mri ) was used to identify cases of spinal cord compression to test the diagnostic value of the spinolaminar line rule . the records of patients who underwent both ct scans and mri of cervical spine at a cervical spine clinic of a single attending surgeon between april 2005 and august 2011 were reviewed . the patients presented with various cervical spine complaints , including neck or head pain , cervical spondylotic myelopathy or radiculopathy , disk herniation , and ossification of the posterior longitudinal ligament . patients with rheumatologic disease ( e.g. , rheumatoid arthritis ) , congenital deformities ( e.g. , klippel - feil ) , and prior surgeries were excluded . patients with instability between c1 and c2 or with congenital defects of the posterior arch of the atlas were also excluded . the sac of the atlas was measured on neutral , lateral radiographs using digital radiographs , with a correction for magnification by 10 % . the c1 sac was defined as the distance from the posterior border of the dens to the ventral c1 lamina . also , the c3c2 spinolaminar line was drawn , beginning at c3 and extending cranial through c2 to the lamina of c1 ( fig . when the ventral lamina of c1 lay ventral to this line , the spinolaminar test was defined as positive , which indicated the possibility of existence of a relatively narrow sac of c1 . the dimensions of the atlas , dens diameter , atlantodental interval ( adi ) , and c1 sac were measured using ct scans . the mri evaluation included measurements of the spinal cord diameters at c1 and c7 levels on t2 - weighted images as well as checking the existence of spinal cord compression . the images investigated were taken in digital imaging formats , and all the measurements were made using the digital data . posterior wall of c1 spinal canal lies ventral ( left ; top arrow ) or dorsal ( right ; top arrow ) to the spinolaminar line ( dotted line ) from c3 and c2 . the sensitivity and specificity of the spinolaminar line rule was calculated using ct measurements as the gold standard for c1 and c2 sac . the calculations were performed using spss 17 software ( spss , chicago , illinois , united states ) . of the 570 patients identified in the specified period , 487 patients met the inclusion criteria . a sample of this size is appropriate for a population larger than 264 million , assuming a 5 % margin of error .15 there were 246 men and 241 women , with an average age of 53 years ( range 18 to 86 ) . the mean sac of the c1 canal on plain lateral radiographs was 21.2 mm ( standard deviation [ sd ] : 2.2 mm , range : 13.5 to 28.2 ; fig .2 ) . the mean diameter was 21.5 mm ( sd : 2.3 ) in male subjects and was 20.9 mm ( sd : 2.0 ) in female subjects ( p = 0.01 ) . twenty - one patients ( 4.3 % ) had a c1 ring ventral to the c3c2 spinolaminar line ( i.e. , positive for the spinolaminar line test ) ; all of these patients had c1 sac of 19.4 mm or less ( fig . the interobserver reliability of this line was considered to be excellent ( table 1 ) . distribution of c1 space available for the cord ( sac ) on lateral x - ray . the ct scans of all 85 patients ( 17.5 % ) with c1 sac 19.4 mm or less on plain lateral radiographs were analyzed further . the c1 sac on the ct scans was 89 % of that on radiographs , with a coefficient of 0.82 , which was considered reasonable given that the radiograph was magnified by 10 % . of these , 8 patients ( 8/487 , 1.6 % ) had c1 sac smaller than c2 sac , and all 8 had a positive spinolaminar line screening test . the sensitivity and specificity of the spinolaminar line test to detect a relatively small c1 sac were 100 and 97 % , and the positive and negative predictive values were 38 and 100 % ( table 2 ) . abbreviations : ct , computed tomography ; sac , space available for the cord . estimated values because only 85 patients with c1 sac of 19 mm or less on x - rays underwent measurements on ct . mri analysis revealed a significantly larger spinal cord diameter at c1 ( average 7.7 mm , sd 1.2 ) versus c7 ( average 6.2 , sd 1.2 ; p 0.01 ) . four of the 8 patients with a smaller c1 sac had effacement of the subarachnoid space including 2 patients with spinal cord compression at the c1 level ; all these patients had c1 sac smaller than 13.0 mm on ct . in contrast , no patients showed evidence of cord compression or effacement of the subarachnoid space when the c1 sac was larger than c2 . this study was undertaken to examine the value of the spinolaminar line rule at c1c2 and to investigate the relative diameters of c1 sac and c2 in relation to spinal cord compression . we found that the spinolaminar line is an effective , simple screening test , with a high sensitivity ( 100 % ) , specificity ( 97 % ) , and negative predictive value ( 100 % ) . hinck and sachdev first described developmental stenosis of the cervical spinal canal on the subaxial levels , which is now familiar among spine surgeons .1 on the other hand , few case reports have documented small c1 ring as a cause of myelopathy . therefore , one may overlook this relatively rare condition , especially when the patient has a normal measurement of adi . the c3c2 spinolaminar line test is a simple screening tool that can be performed quickly in the clinic with lateral plain radiographs . in this study , a positive spinolaminar line test excluded all the patients with c1 sac larger than 19.5 mm as well as those without spinal cord compression at the level of the atlas . compared withthe 4.3 % of patients who had a positive c3c2 spinolaminar line test , only 1.6 % had a c1 sac smaller than c2 on ct . the determination of the posterior wall of the spinal canal may vary , and therefore the spinolaminar line is somewhat subjective . nevertheless , we believe that the spinolaminar line meets the criterion for a screening test in that it appears to be sensitive . indeed , all patients with a c1 sac smaller than c2 were detectable by this simple screening test , including those with spinal cord compression . gupta et al performed a radiographic study of 300 normal indians and reported that the mean sac of c1 was 21.43 mm in male and 20.13 mm in female subjects , compared with the mean c2 sac of 19.66 mm in male and 18.60 mm in female subjects .16 although the results were almost similar with those in our study , they did not mention the relative measurements of c1 versus c2 sac . from our study , the relatively small c1 sac compared with c2 was seen in only 1.6 % of the patients , which indicates the rarity of this condition . as for cervical spine stenosis below c3 , diameters of less than12 mm are reported to be related to the high incidence of compression myelopathy .2 given that the diameter of the spinal cord at c1 level was 1.5 mm larger than that of c7 level , it is reasonable that the c1 canal diameter of 13.0 mm is potentially pathologically narrow . if one considers a normal adi ( 2 mm ) ,17 then the c1 sac may be even smaller and more likely to be pathologic . although we excluded the cases with congenital anomalies and focused on cases without hypoplasia of the atlas , senoglu et al reported that congenital anomalies of the atlantal arch were found in 2.95 % of 1,354 evaluated subjects , most of whom were asymptomatic .18 needless to say , we should also pay attention to such rare cases . this study suffers from selection bias , as all the patients were evaluated in a cervical spine clinic and underwent ct and mri scanning for concern of some pathology . as suchsecond , we did not investigate the ct analysis in all the cases but focused on patients screened by plain radiographs . however , the correlation between plain radiographs and ct scans is high , and we do not think we excluded patients suitable for further study . we feel our sample size , 487 , is appropriately large to make estimates for the population on the whole . in conclusion , few patients ( 1.6 % ) had a smaller sac of c1 than that of c2 , and all of these patients had a positive spinolaminar line test . although spinal cord compression at the level of atlas without instability is a rare condition , the spinolaminar line test is a simple screening test for c1 stenosis .\noutput:\n" }, { "from": "agent", "value": "study design retrospective cohort . objective to clarify the sensitivity of c3c2 spinolaminar line test as a screening tool for the stenosis of c1 space available for the cord ( sac ) . methods spine clinic records from april 2005 to august 2011 were reviewed . the c1 sac was measured on lateral radiographs , and the relative positions between a c1 posterior arch and the c3c2 spinolaminar line were examined and considered positive when the c1 ring lay ventral to the line . computed tomography ( ct ) scans and magnetic resonance imaging ( mri ) were utilized to measure precise diameters of c1 and c2 sac and to check the existence of spinal cord compression . results four hundred eighty - seven patients were included in this study . there were 246 men and 241 women , with an average age of 53 years ( range : 18 to 86 ) . the mean sac at c1 on radiographs was 21.2 mm ( range : 13.5 to 28.2 ) . twenty - one patients ( 4.3 % ) were positive for the spinolaminar line test ; all of these patients had c1 sac of 19.4 mm or less . eight patients ( 1.6 % ) had c1 sac smaller than c2 on ct examination ; all of these patients had a positive spinolaminar test , with high sensitivity ( 100 % ) and specificity ( 97 % ) . mri analysis revealed that two of the eight patients with a smaller c1 sac had spinal cord compression at the c1 level . conclusion although spinal cord compression at the level of atlas without instability is a rare condition , the spinolaminar line can be used as a screening of c1 stenosis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: as we gear up to a world free of measles , rubella and congenital rubella syndrome ( world health organization 2012 ) , evidence - based communication planning must be an integral component of all elimination plans . importantly , communication plans must be effectively resourced to impart the necessary impact on immunization coverage . experience from the polio eradication programme has shown that there is a 1220 % or more increase in the absolute level of immunization coverage when communication is included as a key component of immunization strengthening ( waisborda et al . even more important is that the channels and approaches used must be evidence - based , locally appropriate , interactive , community owned and reach all households before the vaccination days . africa in general and kenya in particular , has witnessed unprecedented expansion in the numbers and coverage of mobile phones , thus connecting millions of people that previously were unconnected . the massive availability of mobile phones creates new opportunities for disease prevention programmes and implementation ( dglise et al . secondly , kenya , as in many african countries , can not reach all households relying only on the traditional mass media approaches . the most recent demographic and health survey in kenya ( kenya national bureau of statistics ( knbs ) and icf macro 2010 ) showed that there has been a dramatic increase in ownership of telephones from 13 % in 2003 to at least 62 % in 200809 . during the same time period , changes in proportions of households owning television sets only increased from 18 % to 28 % with no change in ownership of radio that stayed at 74 % . these changes in access to mobile telephones as a media platform are unprecedented and provided an opportunity to kenya red cross in integrating their use to support house - to - house canvassing visits . the innovation to use mobile phones was motivated by evidence on use of mobile phones that showed that short text messaging is a potentially powerful tool for complementing behaviour change communication because it is widely available , inexpensive and instant ( cole - lewis and kershaw 2010 ) . in this article , we document the innovative and additional activity of using house - to - house inter - personal communication visits conducted by red cross volunteers and documented by a web - enabled mobile phone application to create a real - time platform for linking household and immunization service providers . this additional intervention was specifically aimed at improving coverage in urban populations ( cutts 1991 ; cockcroft et al . the american red cross society in collaboration with kenya red cross funded a project that conducted a house - to - house canvassing for supplemental measles immunization days implemented from 3 to 7 november 2012 . by design , 1952red cross volunteers were recruited , trained and deployed to conduct house - to - house canvassing and mobilization of communities 13 days before the supplemental immunization days . this additional social mobilization intervention was conducted in eight districts of nairobi and three districts of nyanza / western provinces . the red cross volunteers were selected from their respective communities to assure knowledge of households to be visited , community gatekeepers and most importantly acceptance . recruitment was based on the fundamental principles of the red cross / crescent movement , namely humanity , impartiality , neutrality , independence , voluntary service , unity and universality . however , only volunteers with android smart phones would be recruited to conduct the house - to - house canvassing . first day of training was facilitated by district trainers on communications for the supplemental measles immunization days ( including house - to - house inter - personal strategies / skills ) . the second day of training was facilitated by the kenya red cross trainers specifically on the use of the mobile phone application for documenting house - to - house visits . the process of training and house - to - house canvassing ( before and after the supplemental measles immunization days ) was supervised by the district medical officers of health directly or through the community health extension workers and their structures . three days before the supplemental measles immunization days , the trained red cross volunteers conducted house - to - house visits . for every household head or caregiver , the volunteer would provide a standardized package of messages specifying ( 1 ) the rationale of the campaigns , ( 2 ) the targeted age - group , ( 3 ) location of the nearest vaccination point , ( 4 ) what interventions the targeted children would receive and ( 5 ) expected reactions after the vaccinations . the volunteer would then open up an inter - personal communication session in which the household head / caregiver would seek clarifications or ask questions in the comfort of their compound / home . the dialogue would end with a volunteer seeking the consent of the family to bring the targeted children for a supplemental measles dose . basic contacts ( mobile phone number ) , number of children in the target age - range , sources of information on the supplemental measles immunization days and consent to bringing the eligible children for vaccination were captured on an epi - surveyor real - time entry screen installed on the volunteers mobile phone handset . kenya red cross volunteers developed the application with technical support from datadyne consultants hired and paid by the social mobilization project . safaricom hosted the web - access point for all volunteer collected data as part of their corporate social responsibility programme . the web application accessible to district , provincial and national levels would provide ( 1 ) sources of information flow that are not reaching the community targets , ( 2 ) basic demographics on the numbers to expect during the supplemental immunization days , ( 3 ) households ( and their contacts ) of families likely to refuse supplemental doses and ( 4 ) most importantly , frequency tables for reasons given by non - consenting households . during the supplemental measles immunization days , the red cross volunteers were under the supervision of the vaccination team leaders and their roles were to : ( 1 ) receive mothers and caregivers bringing children , ( 2 ) screening for age eligibility ( 959 months ) , ( 3 ) providing non - invasive interventions like vitamin a supplementation and ( 4 ) making reminder telephone calls or sending short text messages targeting households visited before the supplemental immunization days . when there were no children turning up for vaccinations , the volunteers would conduct reminder visits to the households in their catchment areas . at the end of each supplemental immunization day , the volunteers would relay the numbers of measles immunizations given at each vaccination point , using mobile phones to their district coaches for presentation and discussions at the daily progress review meetings . such daily immunization data provided catalytic information for re - engineering and re - design of the vaccination delivery strategies for subsequent days . at the end of the supplemental immunization days , all the red cross volunteers embarked on post - campaign house - to - house mop - up visits in which they performed the following tasks ( 1 ) cross - checked the immunization status of all children 959 months by history ( verbal report from mother ) or checking finger markings ( valid coverage ) , ( 2 ) documented the household sources of information on the supplemental measles immunization days , ( 3 ) collected / collated community events associated with the supplemental measles immunization days and ( 4 ) identified and referred all consenting but not immunized children to the nearest vaccinating health facility . all house - to - house visits conducted after the supplemental immunization days were also documented using the real - time mobile phone data collection tool installed on the phones of volunteers . a total of 164643 households with 161695 children were visited by mobile phone - enabled red cross volunteers 3 days before the 2012 supplemental measles immunization days in eight and three districts of nairobi and nyanza / western provinces , respectively . one to three days before the supplemental measles immunization days , 56 % of the 164643 households visited said that they had heard of the planned supplemental measles immunization days . of the households visited , 75 % ( 123161 ) said that they planned to bring their children for a measles supplemental immunization dose . in pre - campaign house - to - house visits , a total of 41482 ( 25 % ) households with 42041 ( 26 % ) of the targeted children had no plans to bring their children for the measles supplemental dose if they had not been reassured by the red cross volunteers . post - campaign house - to - house evaluations showed that the actual number of households with un - vaccinated children was 170 only . the major reasons cited for immunization refusal in pre - and post - campaign databases ( on a multiple answers question ) are illustrated in figure 1 below . figure 1reasons for refusal to take a supplemental measles immunization dose in kenya , november 2012 . reasons for refusal to take a supplemental measles immunization dose in kenya , november 2012 . daily immunizations as documented and remitted by the red cross volunteers at the immunization points using mobile phones were collated and shown as illustrated in figure 2 below : figure 2daily monitoring of measles sias doses administered in selected districts of kenya , november 2012 . daily monitoring of measles sias doses administered in selected districts of kenya , november 2012 . after the campaign , phone - enabled red cross volunteers re - visited 175617 households in which 180493 children were counted . of the children found in the post - campaign house visits , 96 % reported to have received a measles supplemental immunization dose , although only 92 % had confirmation ( finger mark ) of vaccination . of the 17627 households visited in post - campaign house - to - house visits , only 16217 ( response rate of 92 % ) were able to provide a source of information on the november measles campaign in kenya . table 3 outlines the frequency distribution of sources of information as provided in the post - campaign house - to - house survey . table 1pre - campaign house visits and consent to supplemental measles immunization dose by district of kenya ; november 2012districth / holds visitednumber of eligible children countedh / holds with information prior to the visitnumber of h / holds consenting to a supplemental measles immunization dose % h / hold consenting to supplemental measles immunizationbusia / nambale204003654691061431670dagoreti1198393716178785566embakasi2540620066144161639565kamukinji1193787288196919077kasarani14283122647303821858kisumu east2217533262134651890485langata123281082373351114290makadara771260874219633282njiru1306595547413843165starehe14591916392661294389westlands1076358316229943588total1646431616959220112316175 table 2post - campaign house visits and measles sias coverage verification by district of kenya ; november 2012districth / holds visitednumber of children countednumber of children reported vaccinatednumber of children found vaccinated and finger markedcoverage ( un weighted ) crude ( % ) valid ( % ) busia / nambale20403646357334279894dagoreti10851067104610149895embakasi27572318222521099691kamukinji10731104109310279993kasarani1624108110499959792kisumu east22153362332832959998langata8686425525268682makadara1473124710239858279njiru15381226117711169691starehe21161636153814729490westlands8386646375989690total176271799317241165649692 table 3sources of information on measles sias from post - campaign house visit in kenya , november 2012where did you get the information on supplemental measles immunization days conducted from 3 to 7 november 2012 ? frequency of citation ( multiple responses ) proportionate contribution ( % ) house visit1209875megaphones624338radio528033health facility322920tv269817chw232014newspaper12107others210413 pre - campaign house visits and consent to supplemental measles immunization dose by district of kenya ; november 2012 post - campaign house visits and measles sias coverage verification by district of kenya ; sources of information on measles sias from post - campaign house visit in kenya , november 2012of the 17627 households visited in post - campaign house - to - house visits , only 16217 ( response rate of 92 % ) were able to provide a source of information on the november measles campaign in kenya . table 3 outlines the frequency distribution of sources of information as provided in the post - campaign house - to - house survey . table 1pre - campaign house visits and consent to supplemental measles immunization dose by district of kenya ; november 2012districth / holds visitednumber of eligible children countedh / holds with information prior to the visitnumber of h / holds consenting to a supplemental measles immunization dose % h / hold consenting to supplemental measles immunizationbusia / nambale204003654691061431670dagoreti1198393716178785566embakasi2540620066144161639565kamukinji1193787288196919077kasarani14283122647303821858kisumu east2217533262134651890485langata123281082373351114290makadara771260874219633282njiru1306595547413843165starehe14591916392661294389westlands1076358316229943588total1646431616959220112316175 table 2post - campaign house visits and measles sias coverage verification by district of kenya ; november 2012districth / holds visitednumber of children countednumber of children reported vaccinatednumber of children found vaccinated and finger markedcoverage ( un weighted ) crude ( % ) valid ( % ) busia / nambale20403646357334279894dagoreti10851067104610149895embakasi27572318222521099691kamukinji10731104109310279993kasarani1624108110499959792kisumu east22153362332832959998langata8686425525268682makadara1473124710239858279njiru15381226117711169691starehe21161636153814729490westlands8386646375989690total176271799317241165649692 table 3sources of information on measles sias from post - campaign house visit in kenya , november 2012where did you get the information on supplemental measles immunization days conducted from 3 to 7 november 2012 ? frequency of citation ( multiple responses ) proportionate contribution ( % ) house visit1209875megaphones624338radio528033health facility322920tv269817chw232014newspaper12107others210413 pre - campaign house visits and consent to supplemental measles immunization dose by district of kenya ; november 2012 post - campaign house visits and measles sias coverage verification by district of kenya ; november 2012 sources of information on measles sias from post - campaign house visit in kenya , november 2012mobile phone platforms were used to obtain real - time data on household perceptions , attitudes and concerns ( reasons for likely refusal to take a supplemental measles dose ) . the innovation to use mobile phones ( for household data collection / transmission , short text messages and phone calls ) was adapted based on reviewed evidence on providing reminders for attendance of health care appointments ( car et al . this was in addition to documented importance of mobile phones in promotion of physical activity in children and adolescents ( lau et al .2011 ) , adherence to malaria treatment guidelines in kenya ( zurovac et al . 2011 ) , testing and treatment of tuberculosis ( tb ) , hiv and syphilis ( horvath et al . 2010 ; lester et al . 2010 ; person et al . 2011 ; pop - eleches et al . 2011 ) . information collected using mobile phones was in real - time uploaded to a web application that was designed based on the principles of epicollect ( aanensen et al . the characteristics of measles epidemiology in kenya ( unpublished surveillance reports ) justified extra and focused efforts directed to the three major cities of kenya in the november 2012 supplemental immunization days . in the three major cities of nairobi , nambale and kisumu , special and additional strategies ( house - to - house social mobilization by red cross volunteers supported by mobile phone applications ) were put in place , given their size and the potential roles in sustaining measles transmission . specifically , the high population density that is commonly associated with increased risk of measles transmission ( anderson and may 1990 ) . although measles transmission can be interrupted with lower immunization coverage levels in sparsely populated rural areas , the urban focus was needed to attain higher coverage rates needed for similar disease control effects ( cutts 1991 ; atkinson and cheyne 1994 ) . emphasis being mobile phone supported word - of - mouth communications by kenya red cross volunteers over and above the community health extension workers system , established by the ministry of public health and sanitation . data from the house - to - house visits that spread information by word - of - mouth and conducted dialogue at household level show that the large majority ( 75 % ) of urban households in selected kenya cities would accept supplemental measles immunizations with or without additional information . the 25 % likely refusals in these cities compare well with what is published on individual and contextual factors associated with low immunization coverage in sub - saharan africa ( wiysonge et al . although house - to - house canvassing strategy for social mobilization was conducted in previous supplemental immunization activities ( sias ) , no similar data had ever been collected and made available in kenya . this mobile phone application enabled a cross - sectional status of awareness on supplemental measles immunization days at least a day before the start date . as red cross volunteers spread information by word - of - mouth and held dialogue sessions on immunization at household level , they also collected data on sources of information , education and awareness . this data would then trigger the shifting of communication strategies from information , education and awareness to wider but yet specific ecological complexities that influence household choices and capacity to choose . this shift in social mobilization was informed by the documented experiences from the polio eradication initiative that emphasizes use of data to guide actions in behaviour change communication ( taylor and shimp 2010 ) . in the house - to - house canvassing visits by red cross volunteers , emphasis would not be on a top - down information delivery approach but rather a hybrid strategy that combined informed activism supported by programme rationalization and key messages ( obregn and waisbord 2010 ) . comparing pre - and post - campaign reasons for refusal shows that targeted communicationsignificantly reduced fear of injections , misconceptions , trust in herbs , fear of side effects and lack of time . lack of knowledge / forgetting and travel did not improve with house - to - house canvassing visit , underscoring the importance of good service delivery micro - planning in supplemental measles immunization days specifically and immunization in general ( shefer et al .2012 ) . with daily immunization targets provided to all districts and provinces , we were able to document the slow start on day 1 and 2 ( saturday and sunday ) of the supplemental measles immunization days , when most vaccinations were expected and allowed the campaign managers to take timely corrective actions . major reasons for the slow start ( unpublished monitoring and daily review reports ) were heavy rains , parents expectation of house - to - house vaccination as had been the practice with supplemental polio immunization days , inadequacies in vaccination teams ( numbers and distribution ) and late start of sessions . armed with evidence of slow starts , innovations in the campaign delivery strategy and plan were put in place on day 3 and 4 ( monday / tuesday ) that included ( 1 ) the creation of additional teams ( by splitting vaccinators from the standard two , to one vaccinator ) , ( 2 ) creation of more temporary fixed points , ( 3 ) village - to - village vaccination services and ( 4 ) targeting early childhood development centers . this adaptive planning and management of supplemental measles immunization activities was always feasible but was more evidence based due to information available on real - time numbers of children immunized relayed by mobile phones on a daily basis . post - campaign house - to - house coverage verification data show that 9 out of 11 districts supported by kenya red cross attained 90 % supplemental measles immunization coverage . even when 90 % measles coverage was not attained , the changes in attained rates ( comparing 2009 and 2012 administrative data on follow - up campaigns ) were increased from 57 % and 53 % to 73 % and 86 % in langata and makadara districts , respectively . most importantly , the data show that despite several other confounding factors across board , the changes in coverage are more pronounced in districts that were introducing house - to - house strategy for the first time compared with those implementing the phone - documented house - to - house visits ( unpublished 2009 and 2012 administrative coverage reports ) for the second time . the major sources of information on the 2012 supplemental measles immunization days in kenya were documented as house visits , megaphones and radio in descending order . this data show that house - to - house visits can be very penetrative compared with traditional mass media approaches . the observed importance of interpersonal communication was confirmed by a survey in three coast region districts in which exit interviews with 104 mothers / caretakers of measles vaccine recipients showed that the major sources of information were health workers ( health facility at 24 % ) , house visits by community health extension workers at 17 % and radio at 14 % . although radio and other mass media approaches to communication for immunization remain relevant , these results show that a house visit , by an independent and neutral but trusted community resource person like red cross volunteers contributes to an array of factors that parents need in decision making to vaccinate or not to vaccinate ( jackson et al . 2008 ) . the trust and confidence kenya red cross enjoys as a brand seemed to be more effective than all other sources of information , which is in line with what has been documented elsewhere ( brownlie and howson 2005 ; hobson - west 2007 ) . in conclusion , this article articulates the targeted use of a trusted , neutral and community - based support by red cross volunteers in attaining high measles coverage rates in selected urban populations of kenya . the use of house - to - house strategy supported by real - time documentation using mobile phones to conduct dialogue and seek consent to immunization is a shift from awareness , education and information giving approaches that have dominated planning and execution of sias for decades . second , documentation of house - to - house visits showed that this approach combined with giving information and education as well as seeking consent and creating a feedback loop between households and service delivery planners had a pronounced improvement in vaccination uptake . in turn , individualized and focused dialogue is documented to convince immunization sceptics while illustrating that good and adaptive operational micro - plans are an essential element to attainment of high vaccination coverage . last , we document that a house visit in which dialogue is held is more remembered and cited as a source of information on supplemental immunization . we recommend the use of household dialogue by trained house - to - house volunteers in promotion of immunization service utilization in future immunization promotional campaigns . where access to mobile communication technologies is high , it is also recommended that documentation of house visit findings be used to create a real time platform for adaptive communication strategy .\noutput:\n" }, { "from": "agent", "value": "background to achieve a measles free world , effective communication must be part of all elimination plans . the choice of communication approaches must be evidence based , locally appropriate , interactive and community owned . in this article , we document the innovative approach of using house visits supported by a web - enabled mobile phone application to create a real - time platform for adaptive management of supplemental measles immunization days in kenya.methods one thousand nine hundred and fifty - two red cross volunteers were recruited , trained and deployed to conduct house - to - house canvassing in 11 urban districts of kenya . three days before the campaigns , volunteers conducted house visits with a uniform approach and package of messages . all house visits were documented using a web - enabled mobile phone application ( episurveyor ) that in real - time relayed information collected to all campaign management levels . during the campaigns , volunteers reported daily immunizations to their co - ordinators . post - campaign house visits were also conducted within 4 days , to verify immunization of eligible children , assess information sources and detect adverse events following immunization.results fifty - six per cent of the 164 643 households visited said that they had heard about the planned 2012 measles vaccination campaign 13 days before start dates . twenty - five per cent of households were likely to miss the measles supplemental dose if they had not been reassured by the house visit . pre - and post - campaign reasons for refusal showed that targeted communication reduced misconceptions , fear of injections and trust in herbal remedies . daily reporting of immunizations using mobile phones informed changes in service delivery plans for better immunization coverage . house visits were more remembered ( 70 % ) as sources of information compared with traditional mass awareness channels like megaphones ( 41 % ) and radio ( 37 % ) . conclusions in high - density settlements , house - to - house visits are easy and more penetrative compared with traditional media approaches . using mobile phones to document campaign processes and outputs provides real time evidence for service delivery planning to improve immunization coverage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: all reactions were performed in oven - or flame - dried round - bottomed flasks , reinforced screw - capped pressure tubes , or modified schlenk ( kjeldahl shape ) flasks . the flasks were fitted with rubber septa , and reactions were conducted under a positive pressure of argon . stainless steel syringes or cannulaeflash column chromatography was performed as described by still et al . using silica gel ( 60 pore size , 4063 m , 46 % h2o content ) . analytical thin - layer chromatography was performed using glass plates precoated with 0.25 mm 230400 mesh silica gel impregnated with a fluorescent indicator ( 254 nm ) . thin layer chromatography plates were visualized by exposure to ultraviolet light and / or an aqueous solution of ceric ammonium molybdate ( cam ) followed by heating ( 1 min ) on a hot plate ( 250 c ) . unless otherwise stated , all chemicals and solvents were obtained from commercial sources and used as received with the following exceptions : dichloromethane , tetrahydrofuran , hexane , toluene , methanol , and triethylamine were purified by the method of grubbs et al . under positive argon pressure . proton ( h ) and carbon ( c ) nuclear magnetic resonance spectra were recorded with 600 , 500 , and 400 mhz spectrometers . proton nuclear magnetic resonance ( h nmr ) spectra are reported in parts per million on the scale and are referenced from the residual protium in the nmr solvent ( cdcl3 , 7.24 ( chcl3 ) ; cd3od , 3.31 ( ch3oh ) ) . data is reported as follows : chemical shift [ multiplicity ( s = singlet , d = doublet , t = triplet , q = quartet , st = sextet , sp = septet , m = multiplet , app = apparent , br = broad ) ] , coupling constant ( s ) in hertz , integration . spectra are reported in parts per million on the scale and are referenced from the carbon resonances of the solvent ( cdcl3 , 77.23 ; cd3od , 49.15 ) . assignments of c chemical shifts for boron - bound carbons were not made owing to the effect of quadrupolar relaxation on the intensity of these signals . infrared data ( ir ) were obtained with a ftir and are reported as follows : [ frequency of absorption ( cm ) , intensity of absorption ( s = strong , m = medium , w = weak , br = broad ) ] . high - resolution mass spectrometric data ( hrms ) were recorded on a ft - icr - ms spectrometer using electrospray ionization ( esi ) source or direct analysis in real - time ( dart ) ionization source . triethylamine ( 1.80 ml , 12.9 mmol , 1.04 equiv ) was added via syringe to a solution of tryptamine ( 2.0 g , 12.4 mmol , 1 equiv ) in dichloromethane ( 60 ml ) at 23 c under an argon atmosphere . a sample of 2 - mesitylenesulfonyl chloride ( 2.6 g , 11.9 mmol , 0.96 equiv ) was added cautiously , resulting in a slight exotherm . after 1 h , the reaction mixture was diluted with diethyl ether ( 500 ml ) and washed with distilled water ( 300 ml ) . the aqueous layer was removed , and the organic layer was acidified to ph 12 by slow addition of aqueous hydrochloric acid ( 1n , 600 ml ) . the organic layer was washed with saturated aqueous sodium bicarbonate solution ( 2300 ml ) , dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the residue was dissolved in toluene and concentrated ( 2100 ml ) to give n - ( 2 - ( 1h - indol -3-yl ) ethyl ) -2,4,6-trimethylbenzenesulfonamide s1 as a yellow solid . this material was sufficiently clean to be used in the next step without further purification ; mp 9295 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 8.15 ( br s , 1h ) , 7.447.27 ( m , 2h ) , 7.17 ( dd , j = 7.5 , 8.5 hz , 1h ) , 7.02 ( t , j = 7.5 hz , 1h ) , 6.94 ( d , j = 2.5 hz , 1h ) , 6.83 ( s , 2h ) , 4.51 ( t , j = 6.0 hz , 1h ) , 3.20 ( q , j = 6.5 hz , 2h ) , 2.92 ( t , j = 6.5 hz , 2h ) , 2.45 ( s , 6h ) , 2.26 ( s , 3h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 142.3 , 139.2 , 136.7 , 133.5 , 132.1 , 127.0 , 122.8 , 122.5 , 119.7 , 118.6 , 111.7 , 111.5 , 42.6 , 25.5 , 22.9 , 21.1 . ftir ( thin film , cm ) : 3397 ( br s ) , 1604 ( m ) , 1458 ( s ) , 1317 ( s ) , 1153 ( s ) , 1076 ( m ) , 744 ( s ) , 656 ( s ) . hrms ( esi , tof ) ( m / z ) : calcd for c19h23n2o2s [ m + h ] , 343.1475 ; found , 343.1466 . tlc ( 30 % ethyl acetate in hexanes ) , rf = 0.36 ( cam , uv ) . the sulfonamide s1 was dissolved in dimethylformamide ( 60 ml ) , and 1,8 - diazabicyclo [ 5.4.0 ] undec -7-ene ( 7.18 ml , 48.0 mmol , 3.87 equiv ) was added . a sample of dimethyl sulfate ( 2.88 ml , 30.0 mmol , 2.42 equiv ) was added , and the reaction mixture was stirred at 23 c . after 3 h , another sample of 1,8 - diazabicyclo [ 5.4.0 ] undec -7-ene ( 7.18 ml , 48.0 mmol , 3.87 equiv ) and dimethyl sulfate ( 2.88 ml , 30.0 mmol , 2.42 equiv ) was added . after 3 h , the reaction mixture was diluted with diethyl ether ( 200 ml ) and washed with aqueous hydrochloric acid ( 1n , 500 ml ) . the organic layer was washed with saturated aqueous sodium bicarbonate solution ( 2300 ml ) and brine ( 300 ml ) and was dried over anhydrous sodium sulfate . the organic layer was filtered and concentrated under reduced pressure , and the resulting brown residue was purified by flash column chromatography ( silica gel , 4 cm 8 cm ; eluent , 50 % ethyl acetate in hexanes ) to afford n - methyl sulfamide 11a as an orange powder ( 3.30 g , 77.3 % over two steps ) ; mp 104105 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 8.03 ( br s , 1h ) , 7.36 ( d , j = 7.5 hz , 1h ) , 7.32 ( app dd , j = 0.5 , 8.0 hz , 1h ) , 7.15 ( t , j = 8.0 hz , 1h ) , 7.03 ( t , j = 7.0 hz , 1h ) , 6.94 ( d , j = 2.0 hz , 1h ) , 6.87 ( s , 2h ) , 3.433.38 ( m , 2h ) , 3.322.97 ( m , 2h ) , 2.84 ( s , 3h ) , 2.55 ( s , 6h ) , 2.27 ( s , 3h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 142.5 , 140.5 , 136.4 , 132.4 , 132.0 , 127.3 , 122.2 , 122.1 , 119.5 , 118.6 , 112.6 , 111.3 , 49.6 , 33.1 , 23.9 , 22.9 , 21.2 . ftir ( thin film , cm ) : 3403 ( br s ) , 1604 ( m ) , 1457 ( s ) , 1309 ( s ) , 1148 ( s ) , 949 ( s ) , 742 ( s ) , 727 ( s ) . hrms ( esi , tof ) ( m / z ) : calcd for c20h25n2o2s [ m + h ] , 357.1631 ; found , 357.1617 . tlc ( 30 % ethyl acetate in hexanes ) , rf = 0.49 ( cam , uv ) . a round - bottomed flask equipped with a stir barwas charged sequentially with bis ( pinacolato ) diboron ( 142 mg , 560 mol , 2.00 equiv ) , tryptamine 11a ( 100 mg , 281 mol , 1 equiv ) , ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 3.7 mg , 5.6 mol , 2.0 mol % ) , and 4,4 - di - tert - butyl -2,2-bipyridine ( 3.0 mg , 11 mol , 4.0 mol % ) . the flask was placed under an argon atmosphere , anhydrous tetrahydrofuran ( 1.4 ml ) was added to the flask , and the resulting red brown solution was stirred at 65 c . after 20 h , the volatiles were then removed under reduced pressure , and the resulting black residue was purified by flash column chromatography ( eluent : 25 % ethyl acetate in hexanes ) to afford 12a as a white foamy solid ( 136 mg , 80.1 % ) ; mp 163.5165 c . h nmr ( 400 mhz , cdcl3 , 20 c ) : 9.06 ( br s , 1h ) , 7.62 ( dd , j = 1.0 , 7.0 hz , 1h ) , 7.36 ( d , j = 8.0 hz , 1h ) , 6.96 ( t , j = 7.0 hz , 1h ) , 6.72 ( s , 2h ) , 3.273.20 ( m , 2h ) , 3.193.12 ( m , 2h ) , 2.97 ( s , 3h ) , 2.46 ( s , 6h ) , 2.21 ( s , 3h ) , 1.39 ( s , 12h ) , 1.33 ( s , 12h ) . c nmr ( 100 mhz , cdcl3 , 20 c ) : 143.1 , 142.2 , 140.4 , 132.4 , 131.8 , 131.5 , 127.0 , 125.0 , 122.9 , 119.0 , 84.0 , 83.9 , 50.6 , 32.5 , 25.2 , 25.1 , 23.4 , 22.9 , 21.2 . ftir ( thin film , cm ) : 3455 ( m ) , 2978 ( m ) , 2930 ( m ) , 1598 ( m ) , 1551 ( m ) , 1372 ( s ) , 1320 ( s ) , 1292 ( s ) , 1141 ( s ) , 683 ( m ) . hrms ( esi , tof ) ( m / z ) : calcd for c32h47b2n2o6s [ m + h ] , 609.3360 ; found , 609.3371 . tlc ( 20 % ethyl acetate in hexanes ) , rf = 0.47 ( cam , uv ) . a sample of diborotryptamine 12a ( 500.0 mg , 822 mol , 1 equiv ) in a 25 ml round - bottomed flask was flushed three times with argon , then was dissolved in anhydrous dichloromethane ( 8.0 ml ) and cooled to 0 c . trifluoroacetic acid ( 0.620 ml , 8.34 mmol , 10.2 equiv ) was then added dropwise via a gastight syringe , and the colorless reaction solution was stirred at 0 c for 5 min before warming to 23 c over 10 min . after a further 5 min , the resulting light - green solution was concentrated under reduced pressure to leave a pale - green residue , which was purified by flash column chromatography on silica gel ( eluent : 20 % ethyl acetate in hexanes ) to provide the boronic ester 13a as a white foamy solid ( 320 mg , 80.7 % ) . structural assignments were made with additional information from gcosy , hsqc , and ghmbc data ; mp 4444.5 c . h nmr ( 600 mhz , cdcl3 , 20 c ) : 9.03 ( br s , 1h ) , 7.62 ( d , j = 7.0 hz , 1h ) , 7.47 ( d , j = 7.8 hz , 1h ) , 7.05 ( app t , j = 7.3 hz , 1h ) , 7.01 ( d , j = 1.7 hz , 1h ) , 6.86 ( s , 2h ) , 3.39 ( t , j = 7.7 hz , 2h ) , 3.00 ( t , j = 8.0 hz , 2h ) , 2.85 ( s , 3h ) , 2.55 ( s , 6h ) , 2.27 ( s , 3h ) , 1.38 ( s , 12h ) . c nmr ( 150 mhz , cdcl3 , 20 c ) : 142.4 , 141.5 , 140.3 , 132.4 , 131.9 , 129.3 , 126.0 , 122.1 , 122.0 , 118.9 , 112.0 , 83.9 , 49.7 , 33.0 , 25.1 , 23.8 , 22.9 , 21.1 . ftir ( thin film , cm ) : 3457 ( s ) , 2978 ( s ) , 2936 ( s ) , 1605 ( m ) , 1592 ( m ) , 1372 ( s ) , 1328 ( s ) , 1151 ( s ) , 729 ( w ) . hrms ( esi , tof ) ( m / z ) : calcd for c26h36bn2o4s [ m + h ] , 483.2498 ; found , 483.2488 . tlc ( 5 % acetone , 15 % dichloromethane , 80 % hexanes ) , rf = 0.11 ( cam , uv ) . a round - bottomed flask equipped with a stir barwas charged sequentially with bis ( pinacolato ) diboron ( 71.1 mg , 280 mol , 1.00 equiv ) , tryptamine 11a ( 100 mg , 280 mol , 1 equiv ) , ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 3.7 mg , 5.6 mol , 2.0 mol % ) , and 4,4 - di - tert - butyl -2,2-bipyridine ( 3.0 mg , 11 mmol , 4.0 mol % ) . after flushing with argon for 5 min , anhydrous dichloromethane ( 1.4 ml ) was added to the flask and the resulting red solution was stirred at 60 c . after 3 h , the volatiles were removed under reduced pressure , and the resulting black residue was purified by flash column chromatography ( eluent : 25 % ethyl acetate in hexanes ) to afford 14 as a white foamy solid ( 91.6 mg , 67.7 % ) ; mp 4243 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 8.34 ( br s , 1h ) , 7.26 ( t , j = 8.0 hz , 2h ) , 7.16 ( ddd , j = 1.0 , 7.0 , 8.0 hz , 1h ) , 6.95 ( ddd , j = 1.0 , 7.0 , 8.0 hz , 1h ) , 6.74 ( s , 2h ) , 3.323.27 ( m , 2h ) , 3.213.17 ( m , 2h ) , 2.98 ( s , 3h ) , 2.49 ( s , 6h ) , 2.21 ( s , 3h ) , 1.33 ( s , 12h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 142.2 , 140.3 , 138.2 , 132.3 , 132.0 , 131.8 , 127.9 , 125.2 , 123.8 , 119.4 , 111.4 , 84.0 , 50.4 , 32.5 , 25.1 , 23.4 , 22.9 , 21.2 . ftir ( thin film , cm ) : 3395 ( br m ) , 2975 ( s ) , 1550 ( s ) , 1315 ( s ) , 1144 ( s ) , 730 ( s ) . hrms ( esi , tof ) ( m / z ) : calcd for c26h36bn2o4s [ m + h ] , 483.2498 ; found , 483.2490 . tlc ( 30 % ethyl acetate in hexanes ) , rf = 0.41 ( cam , uv ) . a pressure tube was charged sequentially with ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 5.0 mg , 7.5 mol , 2.5 mol % ) , 4,4 - di - tert - butyl -2,2-bipyridine ( 4.0 mg , 15 mol , 5.0 mol % ) , and tryptamine 11a ( 107 mg , 300 mol , 1 equiv ) . freshly distilled anhydrous tetrahydrofuran ( 2 ml ) was then introduced to the flask via a gastight syringe to afford a dark - brown solution . pinacolborane ( 218 l , 1.50 mmol , 5.00 equiv ) was added in a single portion via a gastight syringe to afford a red solution . the pressure tube was sealed and was stirred at 80 c for 21 h and 15 min . the tube was subsequently cooled to 0 c , and anhydrous dichloromethane ( 3 ml ) was added under an argon atmosphere . trifluoroacetic acid ( 2 ml ) was then added dropwise via a gastight syringe to afford a clear - orange solution . the solution was stirred at 0 c for 10 min and was then warmed to 23 c and was stirred for 5 h and 15 min . the resulting solution was diluted with dichloromethane ( 50 ml ) and was washed with saturated aqueous sodium bicarbonate solution ( 50 ml ) . the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 5 % acetone , 15 % dichloromethane , 80 % hexanes ) to provide the boronic ester 13a ( 86.4 mg , 59.6 % ) . all data was in accordance with that obtained from the aforementioned protodeboronation of 12a . a pressure tube was charged sequentially with ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 5.0 mg , 7.5 mol , 2.5 mol % ) , 4,4 - di - tert - butyl -2,2-bipyridine ( 4.0 mg , 15 mol , 5.0 mol % ) , and tryptamine methyl carbamate11b ( 67.0 mg , 307 mol , 1 equiv ) . freshly distilled anhydrous tetrahydrofuran ( 2 ml ) was introduced to the flask via a gastight syringe to afford a dark - brown solution . pinacolborane ( 218 l , 1.50 mmol , 4.86 equiv ) was added in a single portion via a gastight syringe , at which point the solution turned bright red . the pressure tube was sealed and the reaction mixture stirred at 60 c for 6 h and 15 min and then cooled to 0 c , whereupon anhydrous dichloromethane ( 3 ml ) was added under an argon atmosphere . trifluoroacetic acid ( 2 ml ) was then added dropwise via a gastight syringe to afford an orange solution . the solution was stirred at 0 c for 10 min and then warmed to 23 c and stirred for 2 h and 30 min . the solution was diluted with dichloromethane ( 50 ml ) and washed with saturated aqueous sodium bicarbonate solution ( 50 ml ) . the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 10 % acetone , 20 % dichloromethane , 70 % hexanes ) to provide the boronic ester 13b ( 70.0 mg , 66.2 % ) as a white waxy solid . structural assignments were made with additional information from gcosy , hsqc , and ghmbc data ; mp 138140 c . h nmr ( 600 mhz , cdcl3 , 20 c ) : 9.07 ( br s , 1h ) , 7.71 ( d , j = 7.8 hz , 1h ) , 7.64 ( d , j = 6.9 hz , 1h ) , 7.13 ( app t , j = 7.3 hz , 1h ) , 7.09 ( br s , 1h ) , 4.71 ( br s , 1h ) , 3.63 ( s , 3h ) , 3.49 ( app q , 2h ) , 2.97 ( app t , 2h ) , 1.37 ( s , 12h ) . c nmr ( 150 mhz , cdcl3 , 20 c ) : 157.2 , 141.7 , 129.6 , 126.3 , 122.4 , 122.2 , 119.1 , 112.4 , 84.0 , 52.2 , 41.4 , 25.9 , 25.1 . ftir ( thin film , cm ) : 3451 ( s ) , 2978 ( s ) , 2939 ( s ) , 1713 ( s ) , 1522 ( m ) , 1373 ( m ) , 1135 ( s ) , 966 ( w ) , 684 ( m ) . hrms ( esi , tof ) ( m / z ) : calcd for c18h26bn2o4 [ m + h ] , 345.1994 ; found , 345.1996 . tlc ( 10 % acetone , 20 % dichloromethane , 70 % hexanes ) , rf = 0.21 ( cam , uv ) . a pressure tube was charged sequentially with ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 5.0 mg , 7.5 mol , 2.5 mol % ) , 4,4 - di - tert - butyl -2,2-bipyridine ( 4.0 mg , 15 mol , 5.0 mol % ) , and 3 - methylindole 11c ( 39.0 mg , 0.297 mmol , 1 equiv ) . anhydrous tetrahydrofuran ( 2 ml ) was introduced to the flask under an argon atmosphere to afford a clear - brown solution . pinacolborane ( 218 l , 1.50 mmol , 5.05 equiv ) was added in a single portion via a gastight syringe , the pressure tube was sealed , and the resulting red solution was stirred at 60 c . after 5 h and 30 min , the reaction contents were cooled to 0 c , and anhydrous dichloromethane ( 3 ml ) was added under an argon atmosphere . trifluoroacetic acid ( 2 ml ) was then added dropwise via a gastight syringe to afford an orange solution that was stirred at 0 c for 10 min and then warmed to 23 c and stirred for a further 3 h. the resulting solution was diluted with dichloromethane ( 50 ml ) and washed with saturated aqueous sodium bicarbonate solution ( 50 ml ) . the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure to give a brown residue that was purified by flash column chromatography on silica gel ( eluent : 1.5 % acetone in hexanes ) to provide the boronic ester 13c ( 41.0 mg , 53.6 % ) as a white waxy solid . structural assignments were made with additional information from gcosy , hsqc , and ghmbc data ; mp 4647 c . h nmr ( 600 mhz , cdcl3 , 20 c ) : 8.94 ( br s , 1h ) , 7.69 ( d , j = 7.9 hz , 1h ) , 7.63 ( d , j = 7.0 hz , 1h ) , 7.11 ( t , j = 7.2 hz , 1h ) , 7.00 ( d , j = 0.6 hz , 1h ) , 2.33 ( s , 3h ) , 1.37 ( s , 12h ) . c nmr ( 150 mhz , cdcl3 , 20 c ) : 141.5 , 129.2 , 127.3 , 122.5 , 121.6 , 118.7 , 111.2 , 83.9 , 25.1 , 9.8 . ftir ( thin film , cm ) : 3462 ( s ) , 2977 ( s ) , 2923 ( m ) , 1607 ( m ) , 1592 ( m ) , 1437 ( m ) , 1371 ( s ) , 1136 ( s ) , 848 ( m ) . hrms ( esi , tof ) ( m / z ) : calcd for c15h21bno2 [ m + h ] , 258.1673 ; found , 258.1668 . tlc ( 5 % diethyl ether in hexanes ) , rf = 0.26 ( cam , uv ) . anhydrous tetrahydrofuran ( 11 ml ) was added via syringe to 3 - methylindole 11c ( 201 mg , 1.53 mmol , 1 equiv ) , ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 25.4 mg , 38.3 mol , 2.50 mol % ) , and 4,4 - di - tert - butyl -2,2-bipyridine ( 20.6 mg , 76.6 mol , 5.00 mol % ) sealed in a flame - dried round - bottomed flask under an argon atmosphere to result in a dark - brown solution . pinacolborane ( 1.10 ml , 7.66 mmol , 5.00 equiv ) was introduced in a single portion via a gastight syringe , and the resulting red solution was stirred at 60 c for 8 h. after cooling to 23 c and removal of volatiles under reduced pressure , the subsequent brown residue was dissolved in acetic acid ( 4.0 ml ) and palladium ( ii ) acetate ( 17.2 mg , 76.6 mol , 5.00 mol % ) was added and the resulting mixture was stirred under argon at 30 c . after 8 h , the mixture was cooled to 23 c and was filtered through celite with ethyl acetate ( 150 ml ) as eluent . the filtrate was washed with saturated aqueous sodium bicarbonate solution ( 200 ml ) , and the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 1.5 % acetone in hexanes ) to provide the boronic ester 13c ( 228 mg , 57.9 % ) as a white waxy solid . all data for 13c was in accordance with that obtained from the previous procedure . a pressure tube was charged sequentially with ( 1,5 - cyclooctadiene ) ( methoxy ) - iridium ( i ) dimer ( 5.0 mg , 7.5 mol , 2.5 mol % ) , 4,4 - di - tert - butyl -2,2-bipyridine ( 4.0 mg , 15 mol , 5.0 mol % ) , and l - tryptophan methyl ester 11d ( 83.0 mg , 300 mol , 1 equiv ) . anhydrous tetrahydrofuran ( 2 ml ) was introduced to the flask via a gastight syringe to afford a clear dark - brown solution . pinacolborane ( 218 l , 1.50 mmol , 5.00 equiv ) was then added in a single portion via a gastight syringe , the pressure tube was sealed , and the resulting red solution was stirred at 60 c . after 4 h , the tube was subsequently cooled to 0 c and anhydrous dichloromethane ( 3 ml ) was added via a gastight syringe . trifluoroacetic acid ( 2 ml ) was added dropwise via a gastight syringe to afford an orange solution that was stirred at 0 c for 10 min , then was warmed to 23 c and was stirred for a further 5 h and 15 min . the resulting solution was diluted with dichloromethane ( 50 ml ) and washed with saturated aqueous sodium bicarbonate solution ( 50 ml ) . the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 8 % acetone , 30 % dichloromethane , 62 % hexanes ) to provide the boronic ester 13d ( 101 mg , 83.5 % ) as a white powder . structural assignments were made with additional information from gcosy , hsqc , and ghmbc data ; mp 151152 c . h nmr ( 600 mhz , cdcl3 , 20 c ) : 9.16 ( br s , 1h ) , 7.65 ( d , j = 8.4 hz , 1h ) , 7.62 ( d , j = 7.2 hz , 1h ) , 7.13 ( app t , j = 7.3 hz , 1h ) , 7.05 ( d , j = 1.7 hz , 1h ) , 5.28 ( d , j = 8.1 hz , 1h ) , 4.68 ( q , j = 2.8 hz , 1h ) , 3.66 ( s , 3h ) , 3.64 ( s , 3h ) , 3.30 ( d , j = 4.7 hz , 2h ) , 1.37 ( s , 12h ) . c nmr ( 150 mhz , cdcl3 , 20 c ) : 172.6 , 156.5 , 141.3 , 129.5 , 126.5 , 122.9 , 122.2 , 119.2 , 109.3 , 83.9 , 54.5 , 52.4 , 52.3 , 28.0 , 25.0 . ftir ( thin film , cm ) : 3448 ( s ) , 2979 ( s ) , 2953 ( m ) , 1722 ( s ) , 1591 ( m ) , 1516 ( s ) , 1374 ( m ) , 1329 ( m ) , 1134 ( s ) , 684 ( w ) . hrms ( esi , tof ) ( m / z ) : calcd for c20h28bn2o6 [ m + h ] , 403.2050 ; found , 403.2030 . tlc ( 10 % acetone , 20 % dichloromethane , 70 % hexanes ) , rf = 0.19 ( cam , uv ) . anhydrous tetrahydrofuran ( 6 ml ) was added to l - tryptophan methyl ester 11d ( 203 mg , 735 mol , 1 equiv ) , ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 12.2 mg , 18.4 mol , 2.50 mol % ) , and 4,4 - di - tert - butyl -2,2-bipyridine ( 9.8 mg , 37 mol , 5.0 mol % ) sealed in a flame - dried round - bottomed flask under an argon atmosphere . pinacolborane ( 530 l , 3.68 mmol , 5.00 equiv ) was added to the resulting dark - brown solution in a single portion via a gastight syringe , and the resulting red solution was stirred at 60 c . after 8 h , the mixture was allowed to cool to 23 c and the volatiles were removed under reduced pressure to give a brown residue . acetic acid ( 1.8 ml ) and palladium ( ii ) acetate ( 8.3 mg , 37 mol , 5.0 mol % ) were added , and the resulting mixture was stirred under argon at 30 c . after 18 h , the mixture was allowed to cool to 23 c and filtered through celite with ethyl acetate ( 100 ml ) as eluent . the filtrate was washed with saturated aqueous sodium bicarbonate solution ( 150 ml ) , and the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 8 % acetone , 30 % dichloromethane , 62 % hexanes ) to provide the boronic ester 13d ( 213 mg , 72.3 % ) as a white powder . all data for 13d was in accordance with that obtained from the previous procedure . a pressure tube was charged sequentially with ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 20.4 mg , 30.7 mol , 2.42 mol % ) , 4,4 - di - tert - butyl -2,2-bipyridine ( 16.5 mg , 61.4 mol , 4.84 mol % ) , and tryptophol 11e ( 205 mg , 1.27 mmol , 1 equiv ) . freshly distilled anhydrous tetrahydrofuran ( 10 ml ) was introduced to the flask via a gastight syringe to afford a dark - brown solution . pinacolborane ( 895 ml , 6.17 mmol , 4.87 equiv ) was added in a single portion via a gastight syringe , at which point the solution turned bright red . the pressure tube was sealed and the reaction mixture was stirred at 60 c for 7 h , then cooled to 0 c , whereupon anhydrous dichloromethane ( 15 ml ) was added under an argon atmosphere . trifluoroacetic acid ( 10 ml ) was then added dropwise via a gastight syringe to afford an orange solution . the solution was stirred at 0 c for 10 min and was then warmed to 23 c and was stirred for 4 h. the reaction solution was diluted with dichloromethane ( 100 ml ) and was washed with saturated aqueous sodium bicarbonate solution ( 2200 ml ) . the organic layer was concentrated under reduced pressure , dissolved in pentane / diethyl ether ( 2:1 , 300 ml ) , and washed with water ( 5300 ml ) . the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure to leave a yellow residue that was purified by flash column chromatography on silica gel ( eluent : 15 % ethyl acetate in hexanes ) to give a white solid . this material was vacuum - dried ( 68 mtorr ) for 48 h at 70 c to remove remaining pinacol , and 7 - borotryptophol 13e was obtained as a white solid ( 227 mg , 62.7 % ) ; mp 7878.5 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 9.12 ( br s , 1h ) , 7.75 ( d , j = 7.8 hz , 1h ) , 7.67 ( d , j = 7.0 hz , 1h ) , 7.15 ( t , j = 7.4 hz , 1h ) , 7.13 ( s , 1h ) , 3.923.86 ( m , 2h ) , 3.05 ( t , j = 6.2 hz , 2h ) , 1.73 ( br s , 1h ) , 1.40 ( s , 12h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 142.3 , 130.2 , 127.0 , 123.2 , 123.1 , 119.7 , 112.3 , 84.5 , 63.4 , 29.5 , 25.7 . ftir ( thin film , cm ) : 3457 ( br ) , 2978 ( s ) , 1684 ( s ) , 1559 ( m ) , 1437 ( m ) , 1374 ( w ) , 1329 ( w ) , 1135 ( w ) , 1048 ( s ) , 668 ( m ) . hrms ( esi , tof ) ( m / z ) : calcd for c16h23bno3 [ m + h ] , 288.1766 ; found , 288.1763 . tlc ( 30 % ethyl acetate in hexanes ) , rf = 0.24 ( cam , uv ) . n - boc - l - tryptophan methyl ester 11f ( 1.01 g , 3.18 mmol , 1 equiv ) , ( 1,5 - cyclooctadiene ) ( methoxy ) iridium ( i ) dimer ( 52.8 mg , 79.6 mol , 2.50 mol % ) , and 4,4 - di - tert - butyl -2,2-bipyridine ( 42.7 mg , 159 mol , 5.00 mol % ) were sealed in a flame - dried round - bottomed flask under an argon atmosphere and anhydrous tetrahydrofuran ( 32 ml ) was added . to the resulting dark - brown solutionwas added pinacolborane ( 2.31 ml , 15.9 mmol , 5.00 equiv ) in a single portion via a gastight syringe , and the resulting red solution was stirred at 60 c for 12 h. after cooling to 23 c and removal of volatiles under reduced pressure , the subsequent brown residue was dissolved in acetic acid ( 3.5 ml ) and palladium ( ii ) acetate ( 35.7 mg , 0.159 mmol , 5.00 mol % ) was added . the mixture was stirred under argon at 30 c for 10 h , then cooled to 23 c and filtered through celite with ethyl acetate ( 50 ml ) as eluent . the filtrate was washed with saturated aqueous sodium bicarbonate solution ( 50 ml ) , and the organic layer was dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 5 % acetone , 15 % dichloromethane , 80 % hexanes ) to provide the 7 - borotryptophan derivative 13f as a white powder ( 1.03 g , 73.1 % ) ; mp 152153 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 9.11 ( br s , 1h ) , 7.65 ( d , j = 8.0 hz , 1h ) , 7.62 ( d , j = 7.0 hz , 1h ) , 7.11 ( t , j = 7.5 hz , 1h ) , 7.04 ( s , 1h ) , 5.03 ( d , j = 8.0 hz , 1h ) , 4.654.57 ( m , 1h ) , 3.65 ( s , 3h ) , 3.29 ( d , j = 5.0 hz , 2h ) , 1.41 ( s , 9h ) , 1.37 ( s , 12h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 172.9 , 155.4 , 141.5 , 129.7 , 126.8 , 122.9 , 122.5 , 119.3 , 109.8 , 84.0 , 79.9 , 54.4 , 52.4 , 28.5 , 28.1 , 25.2 . ftir ( thin film , cm ) : 3451 ( br s ) , 2978 ( m ) , 1745 ( s ) , 1714 ( s ) , 1592 ( m ) , 1493 ( s ) , 1436 ( m ) , 1373 ( m ) , 1329 ( m ) , 1167 ( m ) , 1134 ( s ) , 1050 ( m ) , 966 ( s ) , 914 ( s ) , 849 ( m ) . hrms ( esi , tof ) ( m / z ) : calcd for c23h34bn2o6 [ m + h ] , 445.2520 ; found , 445.2515 . calcd for c23h33bn2o6 : c , 62.17 ; h , 7.49 ; n , 6.30 . found : c , 62.24 ; h , 7.42 ; n , 6.24 . tlc ( 5 % acetone , 15 % dichloromethane , 80 % hexanes ) , rf = 0.28 ( cam , uv ) . to a methanol solution ( 2.4 ml ) of 7 - borotryptophan 13d ( 80.5 mg , 200 mol , 1 equiv ) was added an aqueous solution ( 2.4 ml ) of copper ( ii ) chloride dihydrate ( 102 mg , 670 mol , 3.35 equiv ) . the resulting mixture was stirred for 3 h at 80 c , then cooled to 23 c and diluted with ethyl acetate ( 10 ml ) . the organic layer was separated , and the aqueous layer was extracted with ethyl acetate ( 220 ml ) . the combined organic layers were washed with brine , dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting residue was purified by flash column chromatography on silica gel ( eluent : 25 % ethyl acetate in hexanes ) to provide tryptophan 15 as white needles ( 57.7 mg , 92.7 % yield ) ; mp 118.5119 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 8.33 ( br s , 1h ) , 7.42 ( d , j = 8.0 hz , 1h ) , 7.17 ( d , j = 7.0 hz , 1h ) , 7.087.01 ( m , 2h ) , 5.22 ( d , j = 7.5 hz , 1h ) , 4.724.64 ( m , 1h ) , 3.66 ( s , 3h ) , 3.65 ( s , 3h ) , 3.27 ( d , j = 5.0 hz , 2h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 172.5 , 156.6 , 133.6 , 129.2 , 123.6 , 121.9 , 120.7 , 117.5 , 117.0 , 111.4 , 54.6 , 52.63 , 52.57 , 28.3 . ftir ( thin film , cm ) : 3341 ( br s ) , 2952 ( s ) , 1709 ( s ) , 1521 ( m ) , 1439 ( s ) , 1341 ( m ) , 1205 ( m ) , 1082 ( m ) , 895 ( s ) , 843 ( s ) , 779 ( s ) , 738 ( s ) . hrms ( esi , tof ) ( m / z ) : calcd for c14h16cln2o4 [ m + h ] , 311.0793 ; found , 311.0808 . tlc ( 25 % ethyl acetate in hexanes ) , rf = 0.17 ( cam , uv ) . to a methanol solution ( 2.4 ml ) of 7 - borotryptophan 13d ( 80.5 mg , 200 mol , 1 equiv ) was added an aqueous solution ( 2.4 ml ) of copper ( ii ) bromide ( 134 mg , 600 mol , 3.00 equiv ) . the resulting mixture was heated at 80 c for 4 h and 30 min . the reaction mixture was cooled to 23 c and was diluted with ethyl acetate ( 10 ml ) . the organic layer was separated , and the aqueous layer was extracted with ethyl acetate ( 210 ml ) . the combined organic layers were washed with brine , dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting residue was purified by flash column chromatography on silica gel ( eluent : 25 % ethyl acetate in hexanes ) to provide tryptophan 16 as a light - yellow powder ( 54.2 mg , 76.2 % yield ) ; mp 123124 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 8.30 ( br s , 1h ) , 7.46 ( d , j = 7.5 hz , 1h ) , 7.32 ( d , j = 7.5 hz , 1h ) , 7.04 ( d , j = 1.0 hz , 1h ) , 6.99 ( t , j = 8.0 hz , 1h ) , 5.23 ( d , j = 8.0 hz , 1h ) , 4.724.64 ( m , 1h ) , 3.66 ( s , 3h ) , 3.65 ( s , 3h ) , 3.26 ( d , j = 5.0 hz , 2h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 172.5 , 156.6 , 135.0 , 128.9 , 124.8 , 123.6 , 121.1 , 118.1 , 111.5 , 105.1 , 54.6 , 52.64 , 52.57 , 28.4 . ftir ( thin film , cm ) : 3335 ( br s ) , 2952 ( s ) , 1707 ( s ) , 1521 ( m ) , 1437 ( s ) , 1337 ( m ) , 1203 ( m ) , 1077 ( m ) , 882 ( s ) , 827 ( s ) , 777 ( s ) , 738 ( s ) . hrms ( esi , tof ) ( m / z ) : calcd for c14h16brn2o4 [ m + h ] , 355.0288 ; found , 355.0281 . tlc ( 25 % ethyl acetate in hexanes ) , rf = 0.17 ( cam , uv ) . a round bottomed flask was charged with copper ( i ) oxide ( 2.9 mg , 20 mol , 10 mol % ) and 28 % aqueous ammonia ( 62 l , 500 mol , 2.5 equiv ) , and the resulting mixture was stirred under air at 23 c for 15 min .7 - borotryptophan 13d ( 80.5 mg , 200 mol , 1 equiv ) , sodium iodide ( 150 mg , 1.00 mmol , 5.00 equiv ) , and methanol ( 0.6 ml ) were then added to the reaction solution , and stirring under air was continued at 23 c for 14 h. the resulting solution was concentrated under reduced pressure , and the residue was dissolved in water ( 5 ml ) . this aqueous solution was then extracted with ethyl acetate ( 320 ml ) , and the combined organic layers were dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting residue was purified by flash column chromatography on silica gel ( eluent : 25 % ethyl acetate in hexanes ) to provide tryptophan 17 as a white solid ( 68.5 mg , 85.1 % yield ) ; mp 119119.5 c . h nmr ( 500 mhz , cdcl3 , 20 c ) : 8.13 ( br s , 1h ) , 7.53 ( d , j = 7.5 hz , 1h ) , 7.49 ( d , j = 8.0 hz , 1h ) , 7.05 ( d , j = 2.0 hz , 1h ) , 6.88 ( t , j = 8.0 hz , 1h ) , 5.19 ( d , j = 8.0 hz , 1h ) , 4.714.65 ( m , 1h ) , 3.66 ( s , 3h ) , 3.65 ( s , 3h ) , 3.25 ( d , j = 5.5 hz , 2h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 172.5 , 156.6 , 138.1 , 131.1 , 127.8 , 123.3 , 121.6 , 119.0 , 111.8 , 54.5 , 52.64 , 52.57 , 28.5 . ftir ( thin film , cm ) : 3464 ( br s ) , 1708 ( s ) , 1517 ( m ) , 1432 ( s ) , 1333 ( m ) , 1202 ( m ) , 1075 ( m ) , 776 ( s ) , 666 ( s ) . hrms ( esi , tof ) ( m / z ) : calcd for c14h16in2o4 [ m + h ] , 403.0149 ; found , 403.0151 . tlc ( 25 % ethyl acetate in hexanes ) , rf = 0.14 ( cam , uv ) . a dry round - bottomed flask was charged sequentially with 7 - borotryptophan 13d ( 80.5 mg , 200 mol , 1 equiv ) , tris ( dibenzylideneacetone ) dipalladium ( 0 ) ( 9.1 mg , 10 mol , 5.0 mol % ) , sphos ( 8.2 mg , 20 mol , 10 mol % ) , and tribasic potassium phosphate ( 84.9 mg , 400 mol , 2.00 equiv ) , sealed , and placed under an argon atmosphere . toluene ( 0.8 ml ) was added , and to the resulting red brown slurry p - bromoanisole ( 30.0 l , 239 mol , 1.20 equiv ) was added via syringe in a single portion . the resulting dark - green reaction mixture was stirred at 80 c for 12 h , then was cooled to 23 c and filtered through celite with ethyl acetate as eluent . the filtrate was concentrated under reduced pressure to yield a residue that was purified by flash column chromatography on silica gel ( eluent : 40 % ethyl acetate in hexanes ) to provide tryptophan 18 as a white waxy solid ( 58.5 mg , 76.4 % yield ) ; mp 165 c ( decomp . ) . h nmr ( 400 mhz , cdcl3 , 20 c ) : 8.26 ( br s , 1h ) , 7.52 ( d , j = 8.5 hz , 2h ) , 7.49 ( dd , j = 7.3 hz , 1.3 hz , 1h ) , 7.207.14 ( m , 2h ) , 7.02 ( d , j = 9.0 hz , 2h ) , 6.99 ( s , 1h ) , 5.24 ( d , j = 7.5 hz , 1h ) , 4.744.67 ( m , 1h ) , 3.86 ( s , 3h ) , 3.69 ( s , 3h ) , 3.65 ( s , 3h ) , 3.31 ( d , j = 5.5 hz , 2h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 172.7 , 159.3 , 156.7 , 134.3 , 131.5 , 129.5 , 128.1 , 125.7 , 123.1 , 122.2 , 120.5 , 117.6 , 114.8 , 110.6 , 55.6 , 54.7 , 52.6 , 52.5 , 28.2 . ftir ( thin film , cm ) : 3374 ( br s ) , 2952 ( s ) , 1710 ( s ) , 1610 ( s ) , 1513 ( s ) , 1438 ( m ) , 1355 ( m ) , 1247 ( m ) , 1056 ( s ) , 1029 ( s ) , 836 ( s ) , 799 ( m ) , 748 ( s ) . hrms ( esi , tof ) ( m / z ) : calcd for c21h23n2o5 [ m + h ] , 383.1601 ; found , 383.1617 . tlc ( 40 % ethyl acetate in hexanes ) , rf = 0.29 ( cam , uv ) . conditions : ( i ) a sample of n - boc tryptophan boronic ester 13f ( 20.2 mg , 45.5 mol , 1 equiv ) was dissolved in anhydrous tetrahydrofuran ( 0.5 ml ) and a solution of 2 % aqueous sodium hydroxide was added ( 0.5 ml ) , followed by slow addition of 30 % ( wt ) aqueous hydrogen peroxide ( 51.5 l , 455 mol , 10.0 equiv ) . the resulting purple reaction solution was stirred for 30 min at 23 c and then quenched by addition of a solution of saturated ammonium hydroxide / saturated ammonium chloride ( 3:1 , 5 ml ) . after extracting with ethyl acetate ( 35 ml ) , the organic layers were combined and washed with brine ( 210 ml ) , dried over anhydrous sodium sulfate , filtered , and concentrated under reduced pressure . the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 15 % acetone , 15 % dichloromethane , 70 % hexanes ) to afford phenol 19 as an off - white solid ( 9.8 mg , 64.6 % ) . ( ii ) to a sample of n - boc tryptophan boronic ester 13f ( 25.3 mg , 56.9 mol , 1 equiv ) in methanol ( 1.0 ml ) was added 50 % aqueous hydroxylamine ( 18.8 l , 285 mol , 5.00 equiv ) , and the resulting white slurry was stirred at 23 c . after 3 h , another dose of 50 % aqueous hydroxylamine ( 18.8 mg , 285 mol , 5.00 equiv ) was added and the reaction was stirred at 23 c . after 15 h , the reaction mixture had turned into a light - brown solution , at which time tlc analysis indicated complete disappearance of starting material . the reaction was diluted with water ( 5 ml ) and was extracted with ethyl acetate ( 35 ml ) . the organic layers were combined and were washed sequentially with saturated aqueous ammonium chloride ( 210 ml ) , saturated aqueous sodium bicarbonate ( 10 ml ) , and brine ( 10 ml ) before being dried over anhydrous sodium sulfate . after filtration and concentration under reduced pressure , the resulting brown residue was purified by flash column chromatography on silica gel ( eluent : 15 % acetone , 15 % dichloromethane , 70 % hexanes ) to afford phenol 19 as an off - white powder ( 16.8 mg , 86.3 % ) ; mp 185 c ( decomp . ) . h nmr ( 500 mhz , cd3od , 20 c ) : 7.02 ( d , j = 7.0 hz , 1h ) , 7.01 ( s , 1h ) , 6.83 ( t , j = 7.6 hz , 1h ) , 6.51 ( d , j = 7.6 hz , 1h ) , 4.404.37 ( m , 1h ) , 3.65 ( s , 3h ) , 3.20 ( d , j = 14.5 , 5.5 hz , 1h ) , 3.08 ( d , j = 14.5 , 8.2 hz , 1h ) , 1.39 ( s , 9h ) . c nmr ( 125 mhz , cdcl3 , 20 c ) : 174.9 , 157.9 , 144.8 , 130.9 , 128.1 , 124.1 , 120.7 , 111.3 , 111.0 , 106.8 , 80.8 , 56.3 , 52.7 , 29.0 , 28.8 . ftir ( thin film , cm ) : 3384 ( br ) , 2899 ( m ) , 1684 ( s ) , 1583 ( m ) , 1506 ( m ) , 1437 ( w ) , 1368 ( m ) , 1164 ( m ) . hrms ( esi , tof ) ( m / z ) : calcd for c17h23n2o5 [ m + h ] , 335.1601 ; found , 335.1614 . tlc ( 15 % acetone , 15 % dichloromethane , 70 % hexanes ) , rf = 0.17 ( cam , uv ) .\noutput:\n" }, { "from": "agent", "value": "a versatile strategy for c7 - selective boronation of tryptophans , tryptamines , and 3 - alkylindoles by way of a single - pot c2 / c7 - diboronation c2 - protodeboronation sequence is described . the combination of a mild iridium - catalyzed c2 / c7 - diboronation followed by an in situ palladium - catalyzed c2 - protodeboronation allows efficient entry to valuable c7 - boroindoles that enable further c7 - derivatization . the versatility of the chemistry is highlighted by the gram - scale synthesis of c7 - boronated n - boc - l - tryptophan methyl ester and the rapid synthesis of c7 - halo , c7 - hydroxy , and c7 - aryl tryptophan derivatives ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the term subclinical hypothyroidism is used to define that grade of primary hypothyroidism , in which there is an elevated thyroid - stimulating hormone ( tsh ) concentration in the presence of normal serum free thyroxine ( t4 ) and triiodothyronine concentrations . the worldwide prevalence of spontaneous overt hypothyroidism is between 1 % and 2 % and ten times more common in women than in men while approximately 8 % of women and 3 % men have subclinical hypothyroidism . the prevalence of overt hypothyroidism has been reported between 3.5 % and 4.2 % while subclinical hypothyroidism has been reported in 8.02 % 19.3 % of population in various studies across india . globally , thyroid disorders continue to be common yet one of the most under - diagnosed and neglected chronic health conditions . patient 's knowledge and awareness about the disease and its treatment is very important for good long - term outcome and compliance in any chronic disease . studies have shown the importance of improving patient 's knowledge through education and associated benefits of improving compliance with health - care appointments and medications for patients with hypertension and diabetes although such data are scarce in the context of hypothyroidism . such studies on hypothyroidism can help the physician to concentrate on specific issues during their first interaction with the patients as well as during follow - up . there is a paucity of data on the knowledge , awareness , and practices ( kap ) among the primary hypothyroidism patients in the indian population . the present study was planned to assess kap and adherence of treatment of patients with primary hypothyroidism who have been diagnosed and receiving treatment for at least 3 months and visited our center for the first time . an observational cross - sectional study was conducted in the outpatient department of endocrinology clinic at maharaja agrasen hospital , punjabi bagh , new delhi , a 400 - bedded teaching , superspecialty , national accreditation board for hospitals and healthcare providers and joint commission international accredited hospital . consecutive subjects of primary hypothyroid with age 18 years , who were on treatment for at least 3 months and visited our center first time , were invited to participate in the study . newly diagnosed patients , hypothyroidism secondary to pituitary / hypothalamic diseases , radioiodine ablation , surgery , neck irradiation , and drugs were excluded . pediatric patients 18 years of age and patients with transient hypothyroidism were also excluded . patients with significant mental retardation , who were otherwise incapable of answering questionnaires , were also excluded from the study . a structured questionnaire was used to collect information on demographic parameters and to check subjects ' kap with respect to hypothyroidism and adherence of treatment . the questionnaire covered demographic parameters of study participants including their education level , duration of hypothyroidism , baseline tsh at diagnosis ; current dose of levo - t4 , current level of tsh if available , self - reported other comorbid medical conditions . the questionnaire covered issues such as meaning of medical terms thyroid , and hypothyroidism , patient 's knowledge about the basis of the treatment , monitoring during treatment , correct method of medication intake and belief in alternative medications , common beliefs and misconceptions about hypothyroidism , and common symptoms perceived by patients related to hypothyroidism . adherence to t4 therapy was assessed by asking the patients the number of doses missed in the last 1 month and was categorized as follows : adherent to treatment : missed 5 % dose in the last 1 monthmoderately adherent to treatment : missed 5 % but 15 % dose in the last 1 monthnonadherent to treatment : missed 15 % dose in the last 1 month . adherent to treatment : missed 5 % dose in the last 1 month moderately adherent to treatment : missed 5 % but 15 % dose in the last 1 month nonadherent to treatment : missed 15 % dose in the last 1 month . categorical variables were presented in number and percentage ( % ) , and continuous variables were presented as mean standard deviation . the data were entered into ms excel spreadsheet , and analysis was done using statistical package for social sciences ( spss ) ( chicago , illinois , usa ) version 21.0 software . categorical variables were presented in number and percentage ( % ) , and continuous variables were presented as mean standard deviation . the data were entered into ms excel spreadsheet , and analysis was done using statistical package for social sciences ( spss ) ( chicago , illinois , usa ) version 21.0 software . majority of participants belonged to the age group between 41 and 50 years ( 30.4 % ) . median baseline tsh at diagnosis was 13.10 miu / l ( range : 320.8 ) . common associated comorbidities in these respondents were diabetes mellitus ( 24.8 % ) and hypertension ( 23.6 % ) . majority of participants were well educated , with 53.6 % being graduates / postgraduates [ table 2 ] . demographic parameter of study population education level of study participants ( n = 250 ) regarding knowledge of terminologies , out of 250 , only 88 ( 35.2 % ) participants were aware of correct meaning of the term thyroid [ table 3 ] . similarly , only 128 ( 51.2 % ) participants were aware about correct meaning of the term hypothyroidism . hypothyroidism as a swelling in the neck or increased hormone production by the thyroid gland . only 64 ( 25.6 % ) participants knew correctly that t4 is used to replace and normalize the blood level of thyroid hormone . knowledge of terminologies related to thyroid of the study participants symptoms perceived related to hypothyroidism by study participants were weight gain ( 93.6 % ) , easy fatigability ( 80 % ) , irregular menstrual cycle ( 65.2 % ) , infertility ( 55.6 % ) , constipation ( 51.2 % ) , excessive hair fall ( 41.2 % ) , and skin problems ( 38 % ) . nearly 11.6 % participants believed that it can result in weight gain 15 kg while another 18.8 % believed that maximum weight gain can be between 10 and 15 kg . beliefs of study participants related to disease , its treatment and dietary precautions in the context of hypothyroidism are summarized in table 4 . regarding treatment ,20.4 % participants believed that alternative therapy can cure hypothyroidism ; while 20.8 % believed that iodized salt can be used to treat hypothyroidism . a large number of participants ( 40.8 % ) believed that cabbage , cauliflower , and soya products should be avoided by patients with hypothyroidism .9.6 % participants felt that t4 can be stopped once lab reports return to normal level while 18.8 % participants did not have any idea for same . regarding conception , 7.6 % participants thought that hypothyroid women can not conceive , 62.8 % thought they can conceive , while remaining 29.6 % were not sure about it . a fair number of participants ( 22.8 % ) did not follow the correct method of t4 administration with respect to meal ; 20.4 % participants were not keeping minimum 30 min gap between t4 and meal ; while 2.4 % were taking t4 either with meals or after meals . only 62.2 % participants answered tsh as single best test for monitoring of treatment of primary hypothyroidism . regarding adherence , 90.4 % participants were adherent to t4 , 2.4 % were moderately adherent , and remaining 7.2 % participants were nonadherent to t4 . this observational cross - sectional study was conducted to assess the kap and adherence to treatment in patients with primary hypothyroidism from a tertiary care teaching hospital in new delhi . knowledge and awareness about the disease among the patients is very important for better long outcome for any chronic disease . our study shows that a large number of patients with primary hypothyroidism lack basic knowledge about the disease ; fairly large number of patients have dietary as well as treatment - related false beliefs . kannan et al . did a pilot study of 34 hypothyroid patients from chennai , south india , to assess the kap among these patients . did kap study of 200 patients with thyroid swelling who attended cytology clinic at their institution . perumal et al . reported one cross - sectional study of 100 hypothyroid patients to assess their existing hypothyroidism related knowledge , health - seeking behavior , and health literacy among these patients . rai et al . reported one community - based cross - sectional study of 250 females of age group 1850 years from different areas of indore city of madhya pradesh belonging to different socioeconomic status and occupation to assess their knowledge about thyroid disorders , in this study only 20 % females had either personal or family history of thyroid disorders . in our study , regarding the meaning of medical term thyroid , only 35.2 % participants knew correctly that thyroid is a normal gland in the body , 29.6 % considered thyroid as a hormonal disease , 9.2 % as a swelling in the neck , and the remaining 26 % did not have any idea about it . hypothyroidism is a clinical term for reduced secretion by thyroid gland , 11 % participants thought hypothyroidism as a swelling in the neck , and 18 % regarded it as increased secretion by thyroid gland , and remaining 31 % had no idea regarding the same . in kannanstudy , 79.41 % and 55.88 % participants knew correct meaning of the terms thyroid and hypothyroidism , respectively . knowledge of disease - related basic terminologies is very important for patients to acquire further knowledge regarding their disease . in our study , only 25.6 % participants knew correctly that t4 is used to replace and normalize the blood level of thyroid hormone while 36 % participants considered it as means to stimulate thyroid gland to work normally . others considered that t4 was a drug to reduce neck swelling or for weight reduction . , 50 % patients were aware that t4 is given to replace and normalize blood level of thyroid hormone . regarding treatment in our study , 9.6 % participants felt that thyroid medication can be stopped once laboratory reports return to normal while 71.6 % thought otherwise and the remaining 18.8 % had no idea regarding the same . similarly , 8.4 % patients felt that thyroid medication should be stopped during pregnancy as it can harm the fetus , 36.4 % did not feel so and remaining 53.4 % had no idea about same . , 32.35 % patients felt that thyroid medication should be stopped once laboratory reports return to normal and 26.47 % patients believed that thyroid medications should be stopped during pregnancy . among alternative medication use , 20.4 % participants believed that alternative medicines such as ayurveda , yoga , unani , siddha , and homeopathy can cure hypothyroidism . our results are comparable to the previous studies , 20.58 % and 35 % participants with hypothyroidism had faith in alternative medications in studies by kannan et al . and singh et al . , respectively . among other misconceptions , 20.8 % patients believed that hypothyroidism can be treated using iodized salt corresponding figures were much higher in a study by kannan et al . inappropriate knowledge regarding treatment leads to poor outcome of chronic diseases such as hypothyroidism . in india , considerable time needs to be spent in explaining the patient about the lifelong nature of the illness , need for long - term medication , and regular follow - up . in our study , 62.8 % participants believed that hypothyroid female patients can conceive while 7.6 % believed that hypothyroid women can not conceive and rest 29.6 % were not sure about it . hypothyroidism is a common cause of infertility which can be easily managed by correcting the hypothyroid state . inadequate knowledge about pregnancy and hypothyroidism has created a certain amount of blemish in the minds of patients and their relatives , which leads to mental trauma as well as social differences in relationships , especially among young females . this needs to be addressed not only just by patient education at the level of physician but also at a social level in the form of awareness campaigns involving mass education . symptoms perceived related to hypothyroidism by participants were weight gain ( 93.6 % ) , easy fatigability ( 80 % ) , irregular menstrual cycle ( 65.2 % ) , infertility ( 55.6 % ) , constipation ( 51.2 % ) , excessive hair fall ( 41.2 % ) , skin problems ( 38 % ) , and sore throat / neck pain ( 35 % ) . patients commonly tend to attribute any symptom pertaining to neck ( commonly sore throat ) to their thyroid gland . the various misconceptions held by patients with respect to weight gain attributable to hypothyroidism are of clinical importance . it is well known that primary hypothyroidism does not cause an increase in weight gain of more than 35 kg . however , in our study , 11.6 % participants believed that it can result in weight gain 15 kg while another 18.8 % believed that weight gain can be between 11 and 15 kg . a study by kannan et al . and singh et al . also showed that a significant number of subjects believed that hypothyroidism causes excessive weight gain and obesity . however , in the previous studies , patient 's perception about quantitative weight gain in hypothyroidism was not assessed . physicians should always clarify to patients that hypothyroidism generally causes mild weight gain ( 5 kg ) and should lay emphasis on the importance of diet and exercise for weight loss . among dietary misconceptions ,40.8 % believed in dietary restrictions such as avoiding cabbage , cauliflower , and soya products . study results were almost similar to our study where 38.23 % subjects believed in dietary restriction of cabbage , cauliflower , and soya products . in our study ,97.6 % participants used to take t4 empty stomach in the morning while remaining 2.4 % were taking it either with or after meal . almost 20.4 % participants were not keeping minimum advised gap of 30 min between t4 ingestion and meals . regarding adherence , 90.4 % participants were adherent to t4 , 2.4 % were moderately adherent , and remaining 7.2 % participants were nonadherent to t4 . it is well known that thyroid disease is not a major cause of mortality . however , hypothyroidism can contribute to morbidity from osteoporosis , hypercholesterolemia , cardiovascularm , and neuropsychiatric diseases . better knowledge and awareness regarding the disease in primary hypothyroid patients can significantly improve compliance of treatment and decrease the associated morbidity . in addition , this can further help even make patients spread correct facts and information regarding the disease to their relatives and friends in the society . there are a lot of factors contributing to lack of knowledge among patients in our country . lack of qualified physicians , less time spent by doctors on patient education because of high patient burden , lack of awareness , and not using available electronic media are some of them . lot of awareness is still required at physician level in developing countries like india for optimum management of hypothyroid patients . in addition , there is urgent need for endocrine nurses / counselors or dieticians who understand thyroidology and can spend time with patients explaining about their disease and its treatment . our study showed significant caveats in knowledge and awareness about the disease and its treatment in patients with primary hypothyroidism . in addition , a large number of patients had dietary as well as treatment - related misconceptions . public health measures are required to improve knowledge and awareness regarding the disease in patients with primary hypothyroidism .\noutput:\n" }, { "from": "agent", "value": "background : there is a paucity of data on knowledge , awareness , and practices ( kap ) of patients with hypothyroidism in india.aims and objectives : to study the kap and adherence to treatment of participants with primary hypothyroidism.materials and methods : an observational cross - sectional study was conducted in endocrinology outpatient department of maharaja agrasen hospital , punjabi bagh , new delhi . two - fifty consecutive primary hypothyroidism participants , aged 18 years , who were on treatment for at least 3 months responded to a structured questionnaire , to assess their kap about the disease and adherence to treatment.results : a total of 250 patients completed the questionnaire . the mean age of the participants was 43.24 10.80 years ; with majority being females ( 85.6 % ) . the median duration of hypothyroidism was 8 years ( range : 310 ) . most were well educated , with 53.6 % being graduates / postgraduates . knowledge and awareness related to hypothyroidism was poor in majority of participants . only 35.2 % and 51.2 % knew correct meaning of the terms thyroid and hypothyroidism respectively . only 25.6 % participants knew correctly that thyroxine ( t4 ) is used to replace and normalize blood levels of thyroid hormone . forty percent had false dietary beliefs in the context of hypothyroidism . ten percent participants felt t4 can be stopped once laboratory reports return to normal . only 36.4 % participants knew correctly that t4 need to be continued during pregnancy . many participants ( 30.4 % ) believed hypothyroidism can lead to weight gain in excess of 10 kg . regarding adherence , 90.4 % participants were adherent to t4 , 2.4 % were moderately adherent , and remaining 7.2 % participants were nonadherent to t4.conclusion : a large number of patients with primary hypothyroidism lack basic knowledge about disease and have dietary and treatment - related prejudices and poor treatment adherence . public health measures are required to improve kap in patients with primary hypothyroidism ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: hemicrania continua ( hc ) is an uncommon primary headache disorder characterized by a continuous , mild to moderate intensity , unilateral headache . most patients will experience superimposed exacerbations of more severe pain , often associated with ipsilateral autonomic symptoms . headache for greater than 3 months fulfilling the following criteria : all of the following : unilateral pain without side shift , daily and continuous , without pain - free periods , moderate intensity , but with exacerbations of severe pain.at least one of the following autonomic features occurs during exacerbations and ipsilateral to the side of pain : conjunctival injection and / or lacrimation , nasal congestion and / or rhinorrhea , ptosis and / or miosis.a complete response to therapeutic doses of indomethacin.finally , not attributed to another disorder . unilateral pain without side shift , daily and continuous , without pain - free periods , moderate intensity , but with exacerbations of severe pain . at least one of the following autonomic features occurs during exacerbations and ipsilateral to the side of pain : conjunctival injection and / or lacrimation , nasal congestion and / or rhinorrhea , ptosis and / or miosis . a complete response to therapeutic doses of indomethacin . finally , not attributed to another disorder . there is a group of patients that meets the above criteria for hc , but has to discontinue indomethacin secondary to adverse effects , primarily involving the gastrointestinal ( gi ) tract . the side effects can range from gastritis to severe bleeding , patients may also develop an allergy to indomethacin , see an elevation of blood pressure , or an exacerbation of asthma symptoms . gabapentin is often used in an off label fashion for the treatment of neuropathic pain and is well tolerated from a side effect profile . marinano da silva , alcantara , bordini , and speciali reported a case of a unilateral headache similar to hc that was responsive to gabapentin . institutional review board approval was obtained for the study . a retrospective chart review of nine patients with hc between october 2006 and february 1 , 2008 . inclusion criteria included men and women age 18 or above presenting to the headache center with a headache that meets ihs criteria for hc , including a response to indomethacin , but were unable to continue on indomethacin secondary to adverse side effects . exclusion criteria included anyone under the age of 18 and anyone not meeting ihs criteria for hc including an adequate trial at therapeutic doses of indomethacin and response to indomethacin . patients with concomitant disease , specifically involving pain were not excluded , although every effort was made to enroll patients where hc was their primary complaint . this was decided since the purpose of this study was to examine gabapentin as an alternative therapy , indomethacin remains the gold standard . points of measurement included the duration of disease which is considered to be from onset to completion of the study , temporal profile , duration of therapy , range of dose , and concurrent use of other medications for pain , concomitant disease , especially related to pain , reduction of pain , and the side effects of gabapentin . the duration of therapy on gabapentin ranged from 3 months to 13 months with eight out of nine patients remaining on gabapentin at the end of the study . one patient discontinued after reaching 3,600 mg a day due to lack of efficacy . the other doses ranged from 600 mg to 3,600 mg per day of gabapentin . one patient also on fentanyl patch 50 mcg every 72 h reported an 80 % reduction in pain after reaching 2,400 mg of gabapentin . the second patient was taking topiramate and became pain free upon reaching 600 mg of gabapentin.table 1treatment of hc with gabapentinpgardi / day ( mg ) arirdg dose / day ( mg ) rpdd ( months ) tpdt ( months ) cdcmse # 1f41150gastritis1 ,5008 / 100 / 1013c5nonenonenone # 2f5575gastritis2 ,4006 / 101 / 106c4lumbar radiculopathyfentanyl patch 50 mcg / 72 hsedation # 3f44300g . i . bleed 2 episodes3 ,6009 / 109 / 1025c6nonenonecognitive impairment # 4f25150fatique9004 / 101 / 1036c12nonenonenone # 5f46150gastritis9005 / 104 / 107c4nonenonenone # 6f33150gastritis1 ,8008 / 100 / 1034c7nonenonevertigo # 7m6375rectal bleed3 ,60010 / 104 / 1017c13nonenonenone # 8f45300excerbation of asthma60010 / 100 / 108c5migrainetopiramate 50 mg / daynone # 9f42250gastritis9005 / 100 / 103ep3atypical facial painnoneweight gainp patient , g gender , f female , m male , a age , rdi responsive dose of indomethacin , ari adverse reaction to indomethacin , rdg responsive dose of gabapentin , rp reduction of pain , dd disease duration , tp temporal profile , c chronic , ep episodic , dt duration of treatment , cd concomitant disease , cm concomitant medication , se side effects on gabapentin treatment of hc with gabapentin p patient , g gender , f female , m male , a age , rdi responsive dose of indomethacin , ari adverse reaction to indomethacin , rdg responsive dose of gabapentin , rp reduction of pain , dd disease duration , tp temporal profile , c chronic , ep episodic , dt duration of treatment , cd concomitant disease , cm concomitant medication , se side effects on gabapentin the seven patients that achieved the primary end point and reported a 5080 % reduction of pain had doses ranging from 900 to 3,600 mg per day . the one man reported a 50 % reduction of pain and reached the maximum dose of 3,600 mg of gabapentin per day . four patients achieved the secondary end point and reported being completely pain free on gabapentin . the dose ranges for these patients were , 600 mg , 900 mg , 1,500 mg , and 1,800 mg / day respectively . it should be noted that one of the four patients was also taking topiramate , which has been reported to be efficacious for hc . the patient , who reported no benefit , responded to indomethacin on two separate occasions but developed gi bleeding as a result of indomethacin . the major side effects reported on gabapentin include sedation , cognitive impairment , depression , and weight gain . none of the patients chose to discontinue gabapentin as a result of the above side effects . hc was first described in 1981 and officially named by sjaastad and spierings in 1984 . hc was originally believed to be a rare primary headache disorder but more recent evidence suggests that hc is not rare , just under recognized . in the clinical setting , hc is characterized by a unilateral headache that is continuous and of mild to moderate severity . the pain is usually reported as dull , aching , or pressure - like pain without associated symptoms . exacerbations or more severe pain , lasting anywhere from 20 min to several days , are experienced in the majority of those with hc , and when present are associated with one or more autonomic symptoms on the ipsilateral side . migrainous features , such as photophobia , phonophobia , nausea , and vomiting commonly occur during exacerbations of pain . many patients will experience a sensation of a foreign body in their eye similar to sand or an eyelash on the affected side . the pathophysiology of hc is not known , some scientist believe it is a subtype of migraine , while others believe it is more closely related to the trigeminal autonomic cephalalgias ( tac ) . it was hoped that functional brain imaging would help to clarify our understanding of hc , but it revealed that hc is a distinct headache syndrome , not belonging to the migraine or tac group . the scans revealed activation of the contralateral posterior hypothalamus and ipsilateral dorsal rostral pons , as well as activation of the ipsilateral ventrolateral midbrain , extending over the red nucleus and substania nigra and the bilateral pontomedullary junction . these areas have been previously demonstrated to be the sites of activation in the tacs and migraine , ipsilateral activation hypothalamic activation in short - lasting unilateral neuralgiform headache attacks with conjunctival injection and tearing ( sunct ) and cluster ; in hc the findings are reversed . hc was not included in the first edition of the ichd - i , but is included within the other primary headaches section of the second edition of the ichd - ii . hemicrania continua presents as two temporal profiles : an episodic form with distinct headache phases separated by periods of pain - free remissions , and a chronic form in which the headache persists without remission for years . hc is chronic from onset in 53 % of patients ; the disorder began in the episodic form and evolved into the chronic form in 35 % , and it begins and remains episodic in 12 % of patients . this can occur by focusing exclusively on the ipsilateral autonomic features that accompany the painful exacerbations of hc . similarly , focusing on the associated photophobia , phonophobia , nausea , and vomiting that may occur during exacerbations of hc may lead to misdiagnosing hc as migraine . autonomic features on the ipsilateral side , which are present during exacerbations of hc , are at times also present during acute attacks of migraine . hc is also distinguished from cluster headache and migraine by the presence of a continuous baseline headache that is usually unilateral and mild to moderate in severity . the associated features of photophobia , phonophobia , nausea , and vomiting , as well as the ipsilateral autonomic features of cluster are absent with the continuous baseline pain of hc . some patients are unable to tolerate indomethacin due to gi distress , renal disease , or concurrent anticoagulation therapy , and alternative types of therapy must be considered . peres and silberstein demonstrated in a study using cyclooxygenase - 2 inhibitors ( cox - 2 ) , efficacy of celecoxib and rofecoxib , the latter of which has since been removed from the market . they found 60 % of patients who received celecoxib and 33 % who received rofecoxib experienced a complete response . there is one case in the literature of a unilateral headache similar to hc that did not respond to indomethacin , and many other standard headache agents , but was responsive to gabapentin at 1,200 mg per day . there have also been two separate reports of melatonin being efficacious for hc , one case reported by spears , and three cases by rozen . there have also been four cases in the literature of patients responding to topiramate , one by camarda et al . , one by matharu et al . , and two cases by brighina et al . . gabapentin is an antiepileptic drug that is approved for use in the adjunctive treatment of partial seizures with and without secondary generalization in patients over 12 years of age . gabapentin is also indicated as adjunctive therapy in the treatment of partial seizures in pediatric patients age 312 years of age . benefit has been reported in gabapentin treatment for hypobaric hypoxia - induced headache , high altitude headache , nummular headache , sunct syndrome , chronic cluster headache , post - dural puncture headache , and primary thunderclap headache just to mention headaches disorders . the mechanism by which gabapentin exerts its analgesic action is unknown , but in animal models of analgesia , gabapentin prevents allodynia ( pain related behavior in response to a normally innocuous stimulus ) and hyperalgesia ( exaggerated response to painful stimuli ) . the mechanism by which gabapentin exerts its anticonvulsant action is unknown , but in animal test systems designed to detect anticonvulsant activity , gabapentin prevents seizures . gabapentin is structurally related to the neurotransmitter gamma - aminobutyric acid ( gaba ) but does not modify gaba a or gaba b radioligand binding , it is not converted metabolically into gaba or a gaba agonist , and it is not an inhibitor of gaba uptake or degradation . gabapentin was tested in radioligand binding assays and did not exhibit affinity for a number of other common receptor sites including benzodiazepine , glutamate , n - methyl - d - aspartate ( nmda ) , quisqualate , kainate , strychnin - insensitive glycine , alpha 1 , alpha 2 , or beta adrenergic , adenosine a1 or a2 , cholinergic muscarinic or nicotinic , dopamine d1 or d2 , histamine h1 , serotonin s1 or s2 , opiate mu , delta or kappa , cannabinoid 1 , voltage sensitive calcium channel sites labeled with nitrendipine or diltiazem , or at voltage sensitive sodium channel sites labeled with batrachotoxinin a 20 alpha benzoate . one patient reported an 80 % reduction of pain on 2,400 mg of gabapentin but was also on the fentanyl patch . there have been reports in the literature of enhancement of pain control on the combination of opioids and gabapentin . this patient met the primary endpoint , but the concomitant use of an opioid is a confounding factor . this study demonstrates that gabapentin is a good choice for alternative therapy in the treatment of hc . seven out of nine patients demonstrated at least a 50 % reduction of pain on gabapentin , four patients becoming completely pain free . the results of the study are confounded in two patients that were taking concomitant medications specifically fentanyl patch and topiramate . another potential confounding factor is that a proton pump inhibitor was not initiated when patients had difficulty tolerating indomethacin . clinically it may be prudent to first try initiating therapy with a proton pump inhibitor while continuing indomethacin prior to changing to gabapentin . hc is a particularly difficult headache disorder to treat if the patient is not able to tolerate indomethacin , therefore alternative therapies are being sought to provide relief to this patient population . the results of this study should be validated in a double - blinded randomized control trial .\noutput:\n" }, { "from": "agent", "value": "the objective of this study is to examine the efficacy of gabapentin for the treatment of hemicrania continua ( hc ) in cases where patients had difficulty tolerating indomethacin due to adverse effects . a retrospective chart review of nine patients with hc between october 2006 and february 2008 . inclusion criteria included men and women age 18 or above presenting to the headache center with a headache that meets international headache society criteria for hc including a response to indomethacin , but were not able to continue on indomethacin secondary to adverse effects . four patients report being pain free , three patients report a 5080 % reduction of pain , one patient reports a 10 % reduction of pain , and one patient reports no change in pain . seven out of nine patients demonstrated at least a 50 % reduction of pain on gabapentin , four patients becoming completely pain free ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: comparison of the restriction sites between the cytb fragment deposited in genbank and the sequenced fragment from didelphis marsupialis .\noutput:\n" }, { "from": "agent", "value": "an analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses . the present study evaluated the potential of polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) analysis of the mitochondrial cytochrome b ( cytb ) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals . the complete cytb gene sequences of 11 vertebrate species available in the national center for biotechnology information database were digested with aci i , alu i , hae iii and rsa i restriction enzymes in silico using restriction mapper software . the cytb gene fragment ( 358 bp ) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes . vertebrate species presented a restriction fragment profile that differed from that of other species , with the exception of canis familiaris and cerdocyon thous . the 358 bp fragment was identified in 76 sandflies . of these , 10 were evaluated using the restriction enzymes and the food sources were predicted for four : homo sapiens ( 1 ) , bos taurus ( 1 ) and equus caballus ( 2 ) . thus , the pcr - rflp technique could be a potential method for identifying the food sources of arthropods . however , some points must be clarified regarding the applicability of the method , such as the extent of dna degradation through intestinal digestion , the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtdna ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: with only one jak and one stat , the janus kinase / signal transducer and activator of transcription ( jak - stat ) pathway has lower complexity in the fruit fly drosophila melanogaster than in mammals . there are 3 interleukin - 6 ( il - 6 ) - like cytokines unpaired ( upd ) , also called outstretched , upd2 , and upd3 . these ligands bind to the receptor domeless ( dome ) , which is homologous to gp130 , the common chain for the il - 6 receptor family ( fig . 1 ) . there is a second transmembrane receptor , eye transformer , also called latran , which forms heterodimers with dome and antagonizes jak - stat signaling . the sole drosophila jak , called hopscotch ( hop ) , is most similar to jak2 , and the sole stat , called stat92e , is most homologous to stats 3 and 5 . activated stat92e dimers modulate expression of target genes , the best characterized of which is socs36e , which encodes a negative regulator . the reduced genetic complexity of the pathway in drosophila and the observation that numerous human disease genes are conserved in flies , make drosophila an excellent model for studying this pathway . three unpaired ( upd ) ligands here collectively referred to as upd ( orange ) activate a dimeric receptor domeless ( dome ) ( magenta ) . this results in activation of the jak hopscotch ( hop ) ( green ) , leading to tyrosine phosphorylation of dome . the phosphorylated receptor / jak complex phosphorylates stat92e dimer ( blue ) on y711 , generating an active stat92e dimer . a consensus ttcnnngaa site is bound by the activated stat92e dimer , leading altered gene expression . one of the best - characterized stat92e target genes is socs36e , encoding a negative regulator of jak / receptor activity ( pink ) . a second receptor eye transformer ( et ) ( also called latran [ lat ] ) , referred to as et / lat ( red ) , forms heterodimers with dome and inhibits jak - stat signaling . brown circles represent phospho - tyrosine residues . it is well established that dominant - active mutations in jak2 result in human leukemia and myeloproliferative disorders . in addition , sustained stat3 signaling is linked to tumorigenesis in mouse models and a dozen types of human cancer , including all classes of carcinoma . cytokine signaling is also important for normal organ size during development as mice deficient for socs2 , a negative regulator of growth hormone signaling , exhibit gigantism . roles of the jak - stat pathway in growth control have been well described in drosophila . with the advantages of powerful genetic approaches and in vivo clonal growth assays , studies in drosophila have advanced our knowledge of the importance of this pathway during development , homeostasis and transformation . in this review , we discuss the current understanding of the functions of the jak - stat pathway in the growth of imaginal discs . imaginal discs are comprised of epithelial cells that give rise to the cuticular structures of the adult , such as compound eyes and wings . each imaginal disc is formed from a small number of cells ( e.g. , 50 cells in the case of the wing disc ) that are specified in the embryonic ectoderm . once the embryo hatches into the larva , which promptly begins to feed , the discs start to grow rapidly . larval development lasts ~ 4 d at 25 c and consists of three distinct periods called instars , each separated by a molt . imaginal disc cells proliferate exponentially during larval development to give rise to thousands of cells ( e.g. , 50000 cells in the case of the wing disc ) at the end of third instar . most of the cells in the larva are polyploid , undergoing endoreplication ( s phase but not cytokinesis ) and increasing their volume substantially . in contrast , imaginal cells are diploid and undergo both s and m phase . growth in wild - type eye discsis mediated by an organizer which forms during second instar at the dorsalventral ( d v ) midline through the actions of iroquois - complex ( iro - c ) genes , which repress the o - glycosyltransferase fringe ( fng ) to the ventral domain ( fig . 2 ) . this juxtaposition of ventral fng cells and dorsal fng cells leads to activation of notch signaling . v midline is required for appropriate disc growth , and the role of notch in this process is at least partially dependent on jak - stat signaling . the upd gene is induced cell - autonomously by notch , and jak - stat signaling has been shown to act downstream of notch in this context . for example , misexpression of upd rescued the growth defects observed by decreased notch signaling and , reciprocally , reduction in upd levels suppressed the eye over - growth caused by increased notch signaling . the role of the drosophila jak - stat pathway in eye development . during the second larval instar , iro - c genes are induced by wg signaling in the dorsal domain of the eye disc . this creates a border of fng - expressing and non - fng - expressing cells at the midline of the disc , leading to notch signaling there . upd is presumed to be repressed by prc1 in cells outside of the posterior midline . upd leads to activation of stat92e ( stat ) , which represses the notch ligand ser to the ventral domain and wg to the anterior margin . delta ( dl ) , another notch ligand in drosophila , is expressed only in the dorsal domain . jak - stat pathway is one of the earliest signaling events known to promote eye development ; in the eye disc , upd can be detected as early as first instar , approximately 36 h after egg laying . as expected by the timing of upd expression , consistent with the expression pattern of upd , a viable hypomorphic allele in the upd locus outstretched ( os ) has a small eye phenotype that can be rescued by activating stat92e . indeed , . one important function of jak - stat signaling is in formation of the eye field ; it promotes proliferation and growth of cells in the eye field while cell - autonomously repressing wingless ( wg ) , which specifies head cuticle fate ( see below ) . interestingly , jak - stat signaling has been shown to act downstream of notch signaling . specifically , activated stat92e represses expression of serrate ( ser ) , which encodes a notch ligand homologous to mammalian jagged and which is normally restricted to the ventral eye ( fig . 2 ) . the loss of stat92e in clones in the dorsal eye results in ectopic expression of ser there and over - growth of this compartment . finally , the expression of upd prior to the reported formation of the d v organizer ( described above ) suggests that either the organizer is actually active in first instar or that upd can be induced independently of notch signaling . in fact , one study did report an early role of upd in formation of the organizer , implying that jak - stat activity can also function upstream of notch in the eye disc . studies from several labs have since shown that stat92e is a central regulator of eye size . the functional effects of sustained activation of the jak - stat pathway in imaginal discs was forecasted fortuitously by transposon insertion in the om ( 1e ) gene , a paralog of upd , in the related species d. ananassae , resulting in increased om ( 1e ) expression and outgrowths in the adult eye . subsequently , the role of sustained jak - stat pathway activation in tissue growth was confirmed by targeted mis - expression of upd in the developing eye disc of d. melanogaster ; gmr - upd transgenic animals have enlarged eye imaginal discs , resulting in a dramatically enlarged compound adult eye . a characterization of gmr - upd and similar transgenic animals revealed that upd acts as a mitogen for undifferentiated eye cells . the increased production of upd ligand in gmr - upd animals expands the number of eye progenitor cells without affecting their patterning , leading to a distinctly larger eye that is otherwise patterned normally . the gmr - upd enlarged eye phenotype can be largely suppressed by halving the genetic dose of stat92e , suggesting that activation of stat92e downstream of upd is primarily responsible for the overgrowth . shortly after the publication of the gmr - upd animal , another study reported a similar enlarged - eye phenotype resulting from inactivation of c - terminal src kinase ( csk ) function in the eye disc . stat92e is autonomously activated in csk clones , suggesting that jak - stat signaling plays an important role in the csk over - grown eye . the activation of stat92e in csk clones is likely due to upregulation of src kinases in the absence of negative regulation by csk ( as opposed to csk - dependent activation of dome or hop ) , but this has not been formally shown . of note , mutations in endosomal sorting complex required for transport ( escrt ) components tsg101 andvps25 , which trap the notch receptor in an activated state , also result in cell - autonomous increases in upd expression and dramatic eye over - growth , a phenotype that depends on stat92e activation . in fact , a recent study of notch - dependent hyperplastic wing imaginal disc tissue has revealed that all three upd ligands are direct targets of notch signaling and their loci interact directly with the notch transcriptional effector suppressor of hairless . as mentioned above , although notch is activated along the entire midline , upd is induced only at the posterior margin at the midline , i.e. , only in a small region of active notch signaling , indicating that other factors must repress its expression elsewhere in the disc . interestingly upd genes , particular upd3 , are repressed by polycomb - group repressive complex 1 ( prc1 ) and are ectopically expressed in mutations in any prc1 component , leading to eye - overgrowth that is suppressed by lowering the dose of stat92e . finally , in the ras / scribble ( scrib ) metastatic tumor model , upd is upregulated by jun n - terminal kinase ( jnk ) signaling , which leads to stat92e activation in both the tumor and adjacent cells and is required for metastasis of the tumor from the eye disc to the ventral nerve cord . thus , restricting induction of upd to the posterior midline by balancing notch activation with prc1 repression during development and jnk activation during tumorigenesis is important to prevent over - growth ( fig . 2 ) . given the significant role of the jak - stat pathway in specification of eye size , a key issue is how this pathway controls proliferation . facs analysis of cells from eye and wing discs with sustained jak - stat signaling revealed that these cells appear to progress through g1 / s and g2 / m cell cycle checkpoints faster than control disc cells . these results raise the possibility that jak - stat signaling controls the expression or activation of factors required for cell cycle progression . in fact , one study reported that cyclin - dependent kinase 4 ( cdk4 ) functions between hop and stat92e in the embryo . however , in drosophila cdk4 is primarily a regulator of cellular growth ( see below ) and is dispensable for proliferation . cyclin b ( cycb ) , which is required for g2 / m progression in the embryo , was elevated in a cell - autonomous manner in clones with increased jak - stat signaling . it is not known if cycb is a target of jak - stat signaling or if increased cycb in jak - stat pathway gain - of - function clones simply reflects increased proliferation rates . in fact , two independent genetic screens failed to reveal a cell cycle gene that strongly modified the gmr - upd phenotype . while this could be due to the possibility that cell cycle genes are largely dosage - insensitive in the gmr - upd background , expression profiling of gmr - upd eye discs also did not reveal any potential candidates . in addition , three independent whole - genome rnai screens did not identify a connection between jak - stat signaling and genes known to regulate proliferation . one study reported that stat92e clones induced late in larval wing development grew to larger sizes than their sibling ( + / + ) clones . the observation that hop clones did not display the same overgrowth phenotype led to the model that in late larval wing discs , stat92e acts non - canonically ( i.e. , independently of upd or hop ) to constrain proliferation . this study postulates that drosophila stat92e contains both the pro - proliferative function of stat3 and the anti - proliferative function of stat1 and that evolutional forces subsequently assigned these roles to distinct mammalian stat proteins . first , are there distinct regions of stat92e that mediate these opposite effects on proliferation ? second , what factors are the pro - proliferative and anti - proliferative targets of stat92e ? finally , the proposed switch from pro - proliferative to anti - proliferative occurs within a 24 - h window . what changes occurs in stat92e or the chromatin of late larval wing imaginal disc cells to facilitate this switch ? our current understanding of jak - stat regulation of proliferation is limited , and more studies will be required at the molecular level to sufficiently answer these questions . local interactions between cells influence their growth and their ability to contribute to the adult . some of these interactions have been revealed by studying cell competition , a process that has been best studied in the drosophila wing disc but that also exists in mammals . in the last 10 years57 and 58 ) , but a consensus on definitions for each type of competitive interaction has not yet been achieved . in this review , we will use the term cell competition to mean the context - specific behavior of cells of a particular genotype : they are killed ( out - competed ) when surrounded by wild - type cells but viable when placed in the context of slower - growing cells . the first example of cell competition was observed with minutes ( m ) , dominant mutations in ribosomal protein ( rp ) genes that are lethal when homozygous ( m / m ) but produce viable , slow - developing animals when heterozygous ( m / + ) . m / + cells exhibit distinct outcomes depending on the local environment ; m / + clones are viable when residing in a homotypic environment ( i.e. , when they are surrounded by m / + cells ) but die when grown in the presence of wild - type ( + / + ) cells . these studies also revealed that death of m / + cells is associated with proliferation of wild - type cells . the wild - type cells ( termed winners ) subsequently occupy the space of the m / + cells ( termed losers ) , which are eliminated by the winners through cell death to ensure maintenance of normal tissue size . it has been subsequently shown that differences in levels of other growth - regulatory genes such as dmyc , a transcription factor that regulates expression of genes controlling proliferation , cellular growth , and ribosome biogenesis , elicit similar types of competitive interactions ; clones with lower levels of dmyc become losers , which are killed by winners that have normal levels of dmyc . knowing the dependence of proper cell growth and tissue development on stat92e activity , clonal growth assays were employed to assess whether modulating the levels of jak - stat signaling could induce competitive interactions . stat92e clones and their wild - type ( + / + ) sibling clones were induced by flp / frt - mediated mitotic recombination early in embryonic development and clone size was measured in wing and eye discs after a defined period . since disc cells are epithelial and remain associated after mitosis , differences in clone size reflect differential growth rates . if stat92e were not required for clonal growth , stat92e clone areas should comprise ~ 50 % of the total clone area . in one study , control frt wild - type clones and their sibling clones grew to equal sizes and were each ~ 50 % of the total clone area . by contrast , stat92e clones comprised only ~ 5 % of the total clone area in the disc . ( in another study , stat92e clones induced during early larval development were larger [ 40 % of the total clone area ] . the discrepancy in stat92e clone size is presumably due to the use of weaker stat92e alleles in the latter study . ) by contrast , stat92e clones in a mosaic background underwent caspase - dependent but jnk - independent cell death and were extruded from the epithelium . however , when programmed cell death was blocked in the stat92e cells , they grew to the same size as sibling clones . by contrast , clones lacking dmyc or ribosomal genes like rpl135 can not grow even when death is inhibited . this may represent an important distinction between the function of activated stat92e and dmyc in losers . the context - specific behavior of cells with reduced jak - stat signaling was revealed when stat92e clones were given a growth advantage . when induced in a minute backgroundthis result reveals that stat92e cells die in a wild - type background because they have become losers and are out - competed by the more robust wild - type winner cells . similar results that loss of stat92e reduces cellular fitness and renders cells losers have been observed in a scrib tumor suppressor model in drosophila . cells with increased dmyc or increased wingless ( wg ) signaling become supercompetitors , which we define as a clone of cells overexpressing a particular factor that causes neighboring wild - type cells to experience a growth disadvantage . of note , clones with increased dmyc expression kill losers up to 10 cells away . clonal growth assays , such as the two - clone assay , which serve as a direct measurement of supercompetitor behavior , revealed that clones with sustained jak - stat pathway activation become winners , acquire supercompetitor characteristics , and can kill losers located several cell diameters away through non - autonomous induction of apoptosis . this study also demonstrated that , like with dmyc , cells with activated stat92e require the pro - apoptotic gene head involution defective ( hid ) to kill surrounding neighbors and achieve supercompetitor status . these results suggest a link between stat92e and dmyc or between stat92e and the wg pathway . surprisingly , however , no link was found between jak - stat signaling and either dmyc mrna , dmyc protein , or targets of the hippo pathway , which regulate dmyc levels . in addition , clonal mis - expression of dmyc did not activate stat , nor did clonal mis - expression of crumbs , which is a target of jak - stat signaling in the embryo and an upstream regulator of hippo pathway signaling . finally , hyperactivation of jak - stat signaling had no effect on wg signaling and , reciprocally , wg did not modulate stat92e activity . these results strongly suggest that at least in the wing imaginal disc jak - stat pathway activity functions in parallel to dmyc and wg in growth and cell competition ( fig . 3 ) . super - competitor status can be confirmed by sustained activation of wg signaling through - catenin / armadillo ( - cat / arm ) or of jak - stat signaling ( stat ) . it can also be achieved through increased ribosome biogenesis , increased yki expression , which activates the dmyc gene , or through increased dmyc levels . all of these lead to cells ( super - competitors ) that non - autonomously induce death of neighboring wild - type cells ( losers ) . tissue growth occurs as a result of both cellular growth ( also called mass accumulation ) and subsequent proliferation . studies from drosophila imaginal discs have shown that cell division and cellular growth are regulated independently . it follows that in order to get overgrown imaginal tissue , both proliferation and cellular growth must be accelerated concomitantly . numerous factors affect cell size , including dmyc , cycd / cdk4 , and hippo . since jak - stat signaling in the eye imaginal disc is causal for tissue overgrowth , it is of great interest to unravel how this pathway regulates cellular growth . we define cellular growth as the net production of new proteins , which can occur by a variety of means , including but not limited to increased de novo synthesis of ribosomes ( i.e. , ribosome biogenesis ) or accelerated translation on existing ribosomes . increased cell size can result from increased cellular growth and can be measured by the forward scatter parameter on a flow cytometer . facs analysis of cells with sustained jak - stat signaling revealed no change in cell size . consistent with this , there was no change in cell density in clones with activated jak - stat signaling . the unaltered cell size in cells with sustained jak - stat signaling is likely due to the fact that cell division rates are also increased when this pathway is hyper - activated . furthermore , jak - stat signaling does not induce genes such as nop5 , nop60b , and tif - 1a ( which , incidentally , are targets of dmyc ) that regulate de novo ribosome biosynthesis . as mentioned above , the jak - stat pathway also does not interact with dmyc , which upregulates ribosome biogenesis , or regulators of dmyc . these data suggest that jak - stat signaling does not regulate cellular growth by means of increasing ribosome biogenesis . as mentioned above , one study reported that cycd / cdk4 functions to promote proliferation and acts between hop and stat92e in jak - stat signaling . however , there are lines of evidence that suggest that this conclusion needs to be re - examined , particularly with respect to jak - stat signaling in imaginal discs . first , several groups have reported that cycd / cdk4 is not required for proliferation but instead promotes growth through mitochondrial biogenesis . second , we have not found a link between mitochondrial functions and jak - stat signaling ( rodrigues and bach , unpublished data ) . taken together , how jak - stat signaling controls cellular growth at the molecular level remains a critical area of investigation for the field . in summary , these studies have revealed that the jak - stat pathway is a central regulator of tissue size in drosophila imaginal discs . in the eye disc , upd is subject to positive and negative regulation , but only notch - mediated induction of upd has been delineated at the genetic level . future work should reveal how jnk activates and how prc1 represses the upd locus . furthermore , the inhibitory effects of csk on activated stat92e also need to be further explored . despite the central role that jak - stat signaling plays in proliferation and cellular growth , the targets of stat92e required for these processes are yet unknown and need to be determined in future studies . finally , the recent work showing that cells with sustained jak - stat activity become super - competitors raises several outstanding questions , including : ( 1 ) do stat92e winners secrete a notum - like molecule , which inhibits neighboring cells from transducing upd signals ? ( 2 ) what are non - autonomous signals downstream of stat92e that cause death in losers ? ( 3 ) are these signals regulated by other factors involved in cell competition such as dmyc and wg signaling ? using drosophila as a model to study how jak - stat signaling regulates proliferation , cellular growth , and cell competition is poised to shed light on mechanisms of tumorigenesis in mammals .\noutput:\n" }, { "from": "agent", "value": "the jak - stat pathway is a key regulator of tissue size in drosophila melanogaster . here we provide an overview of its roles in processes that regulate the size of drosophila imaginal discs , epithelia of diploid cells that proliferate and acquire specific fates in the larvae and that become functional in the adult . drosophila has a single jak and a single stat gene , which has facilitated genetic dissection of this pathway . moreover , the sophisticated genetic tools available in flies for clonal growth assays have made drosophila an ideal organism in which to dissect the multiple roles of the jak - stat pathway in growth control . studies in flies have revealed jak - stat pathway activity as a central node for diverse signals that control proliferation and mass accumulation . in addition , recent work has establish a new role for the pathway in cell competition , a process thought to be akin to the early stages of transformation in which more robust cells kill and take the place of less robust ones ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: statins are widely prescribed cholesterol - lowering agents and are considered to be relatively well - tolerated and effective drugs that significantly reduce cardiovascular morbidity and mortality . in addition , aggressive lowering of low density lipoprotein cholesterol ( ldl - c ) with higher doses of statins is increasingly encouraged for the reduction of cardiovascular events in primary and secondary prevention . the widely known adverse effects of statins include liver enzyme elevation , lack of energy , muscle weakness , and myalgia . meanwhile , statins are known to modulate insulin secretion and sensitivity , and recent trial data have suggested that statins cause worsening of hyperglycemia and increase the risk of new - onset diabetes [ 5 - 8 ] . the first report on an association between statin use and incident diabetes was derived from post hoc analyses of west of scotland coronary prevention study ( woscop ) published in 2001 , which reported a 30 % risk reduction for incident diabetes with the use of 40 mg of pravastatin . however , the conflicting evidence on the diabetogenicity of statins became widely apparent after the release of 2008 report on justification for the use of statins in primary prevention : an intervention trial evaluating rosuvastatin ( jupiter ) . food and drug administration placed a warning regarding the risk of diabetes on the labels of all statin agents in march 2012 . therefore , it is necessary to address the messages of several clinical trials for study on diabetogenic effects of statins that should be weighed against the cardiovascular benefits that have been extensively established by clinical trials . as previously described , woscop , while introducing the notion of direct association between statins and incident diabetes , showed that 5 - year treatment of pravastatin 40 mg / day in 5,974 middle - aged men resulted in decreased new - onset diabetes by 30 % ( p = 0.042 ) . however , in this post hoc analysis , the definition of new - onset diabetes included at least one glucose level of 2.0 mmol / l ( 36 mg / dl ) above baseline , which was a nonstandardized diagnostic criteria for diabetes . sattar et al . , who conducted a reanalysis of this trial using standard criteria for diabetes , found that the risk of incident diabetes with pravastatin was no longer significantly increased ( odds ratio [ or ] , 0.79 ; 95 % confidence interval [ ci ] , 0.58 to 1.10 ) . in the aftermath , numerous randomized placebo - controlled trials of statins have reported inconsistent results on statin use and incident diabetes [ 10,12 - 15 ] . given these inconsistencies , a meta - analysis of five available randomized placebo - controlled trials - heart protection study ( hps ; simvastatin 40 mg ) , long - term intervention with pravastatin in ischemic disease ( lipid ; pravastatin 40 mg ) , anglo - scandinavian cardiac outcomes trial ( ascot ; atorvastatin 10 mg ) , controlled rosuvastatin multinational study in heart failure ( corona ; rosuvastatin 10 mg ) , and jupiter ( rosuvastatin 20 mg ) - was conducted in order to identify the possible effect of statin therapy in the development of type 2 diabetes . the results of this hypothesis - testing trial including 51,619 participants , among whom 1,943 developed diabetes , showed a slight increase in the risk of diabetes ( relative risk , 1.13 ; 95 % ci , 1.03 to 1.23 ) with no evidence of heterogeneity across trials . recently , sattar et al . reported large meta - analyses of published and unpublished data providing a stronger concept that statins may have a diabetogenic effect . in their analysis of 13 trials including 91,140 participants , they demonstrated a 9 % increased risk for incident diabetes ( or , 1.09 ; 95 % ci , 1.02 to 1.17 ) during a mean of 4 years , with little heterogeneity between trials ( fig . , meta - regression showed that the risk for development of diabetes with statins was highest in trials with older subjects . neither the change in ldl - c nor baseline body mass index ( bmi ) showed an association with the risk of new - onset diabetes . collectively , the findings from the two independent meta - analyses described above suggest an association between statin use and the risk of incident diabetes ; furthermore , it also implies that the increased incidence of diabetes is secondary to a class effect . it was a randomized placebo - controlled primary prevention trial , which included 17,802 middle aged men and women ( mean age of 66 years ) with serum ldl - c less than 130 mg / dl and high - sensitivity c - reactive protein levels of 2.0 mg / l . the primary outcome was the occurrence of myocardial infarction , stroke , unstable angina , arterial revascularization , or death from cardiovascular causes . treatment with rosuvastatin 20 mg / day resulted in a 43 % decrease of primary endpoint at the expense of a 25 % increase in physician - diagnosed diabetes . therefore , they provided a post hoc analysis from the jupiter trial in order to directly address the balance of cardiovascular benefits and diabetes risk of statin use . in this analysis , an important prespecified secondary aim ofhistory of diabetes was an exclusion criterion for the trial ; however , many participants in jupiter trial had major risk factors for diabetes , such as metabolic syndrome , impaired fasting glucose , bmi 30 kg / m , and hemoglobin a1c6 % at study entry . in individuals with one or more risk factors , statin treatment showed an association with a 39 % reduction in the primary endpoint ( p = 0.0001 ) and a 28 % increase in diabetes ( p = 0.01 ) . in subjects with no risk factors , statin treatment showed an association with a 52 % reduction in primary endpoint ( p = 0.0001 ) , and no increase in diabetes ( p = 0.99 ) ( table 1 ) . in analysislimited to the 486 participants who developed diabetes , reduction in cardiovascular risk associated with statin therapy ( hazard ratio [ hr ] , 0.63 ; 95 % ci , 0.25 to 1.60 ) was consistent with that for the trial as a whole ( hr , 0.56 ; 95 % ci , 0.46 to 0.69 ) . in either case , the absolute cardiovascular event lowering benefit by statin therapy was greater than the risk of developing new onset diabetes , both in subjects with and without risk factors of diabetes . the results of another post hoc analysis of jupiter based on gender indicated that women in the rosuvastatin group showed a striking 50 % increase in new onset diabetes ( p = 0.008 ) , equal to the absolute decrease in cardiovascular events . by contrast , men in the rosuvastatin group exhibited a statistically nonsignificant 13 % increase in new onset diabetes ( p = 0.29 ) . intensive - dose statin therapy has been shown to further reduce cardiovascular events compared with moderate - dose statin , whereas side effects of statins appear to be dose related . therefore , it is important to know whether an intensive dose of statin is associated with a greater risk of incident diabetes . results of meta - analysis from five intensive - dose statin trials ( n = 32,752 ) - pravastatin or atorvastatin evaluation and infection therapy - thrombolysis in myocardial infarction 22 ( atorvastatin 80 mg / pravastatin 40 mg ) , the aggrastat to zocor ( a to z trial ; simvastatin 40 mg , simvastatin 80 mg / placebo , simvastatin 20 mg ) , treating to new target ( tnt ; atorvastatin 80 mg / atorvastatin 10 mg ) , incremental decrease in end points through aggressive lipid lowering ( ideal ; atorvastatin 80 mg / simvastatin 20 mg or 40 mg ) , and the study of the effectiveness of additional reductions in cholesterol and homocysteine ( simvastatin 80 mg / simvastatin 20 mg ) - revealed that the risk of new - onset diabetes over a weighted mean follow - up of 4.9 years increased by 12 % ( 95 % ci , 1.04 to 1.22 ) in subjects in intensive - dose statin therapy group compared with those in moderate - dose statin group . on the other hand , cardiovascular eventsdecreased by 16 % in intensive - dose group compared with the moderate - dose group ( 95 % ci , 0.75 to 0.94 ) also investigated the effect of high - dose statin on new - onset diabetes within three large randomized trials with atorvastatin . among them , the tnt and ideal trials showed a trend toward an increase in new - onset diabetes for the atorvastatin 80 mg group compared with atorvastatin 10 mg ( hr , 1.10 ; 95 % ci , 0.94 to 1.29 ) or simvastatin 20 mg ( hr , 1.19 ; 95 % ci , 0.98 to 1.43 ) . however , in the stroke prevention by aggressive reduction in cholesterol levels trial , an 80 - mg dose of atorvastatin showed an association with an increased risk of incident diabetes compared with placebo ( hr , 1.34 ; 95 % ci , 1.05 to 1.72 ) . this is slightly higher , but it still overlaps with the hr of 1.09 reported in the meta - analysis of 13 placebo - controlled statin trials . according to multivariate analysis , fasting glucose 100 mg / dl , bmi 30 kg / m , fasting triglycerides 150 mg / dl , and hypertension were strong predictors of new - onset diabetes in all three trials and in each of the three trials the risk of developing new - onset type 2 diabetes mellitus increased with an increasing number of risk factors ( table 2 ) . along with dose - related adverse effects of statins , there are also concerns regarding increased risk for patients who may have increased sensitivity to statins . the potential mechanisms are related to genetic differences between asians and caucasians in the metabolism of statins at the level of hepatic enzymes and drug transporters . an analysis of 153,840 postmenopausal women without diabetes participating in the women 's health initiative reported an association of statin use with a 71 % increase in new onset diabetes and a 48 % increase after adjustment for other potential confounders ( age , race , bmi , etc . ) for all types of statins . a subgroup analysis based on race / ethnicity showed a hr of 1.78 ( 95 % ci , 1.32 to 2.40 ) for new - onset diabetes in asian and pacific islander statin users ; by contrast , caucasian statin users had a hr of 1.49 ( 95 % ci , 1.38 to 1.62 ) . thus , this finding indicates that genetic differences cause asians to be more susceptible to the diabetogenic effects of statin therapy . the question of whether distinct statins have differential effects on insulin sensitivity and metabolic homeostasis remains controversial . however , pravastatin has been reported to improve insulin sensitivity in patients with metabolic syndrome and in patients with coronary artery disease and impaired glucose tolerance , and this effect was accompanied by a significant increase of plasma adiponectin levels . on the other hand , other statins , including atorvastatin , rosuvastatin , and simvastatin , significantly contribute to an increase in insulin levels and a decrease in plasma adiponectin levels and insulin sensitivity . these varying effects of statins on insulin sensitivity in patients without pre - existing diabetes were supported by systemic review and meta - analysis ( fig . , a recent population - based cohort study also showed that , compared with pravastatin , atorvastatin ( adjusted hr , 1.22 ; 95 % ci , 1.15 to 1.29 ) , simvastatin ( adjusted hr , 1.10 ; 95 % ci , 1.04 to 1.17 ) , and rosuvastatin ( adjusted hr , 1.18 ; 95 % ci , 1.10 to 1.26 ) increased the risk of incident diabetes , whereas no significantly increased risk was observed for fluvastatin ( hr , 0.95 ) or lovastatin ( hr , 0.99 ) . taken together , statins do not appear to have a class effect on insulin sensitivity in nondiabetic patients , and differences between individual statins are likely to exist . statins have been shown to lower ldl - c levels in patients with diabetes in addition to lowering the risk of major cardiovascular diseases ( cvds ) . the meta - analysis conducted by the cholesterol treatment trialists reported a 21 % reduction in the incidence of major vascular events per 1 mmol of ldl - c reduction ( p 0.001 ) in 18,686 subjects with diabetes from 14 randomized controlled trials of primary and secondary cvd prevention . overall , in subjects with diabetes , statins have been shown to lower ldl - c by 22 % to 40 % , with a significant reduction in the 10 - year risk of major cvd by 8 % to 50 % ( p = 0.007 ) . consequently , it seems necessary to weigh the risk of diabetes and the cardiovascular benefits of statins . determined that treatment of 255 patients with a statin for 4 years would result in one extra case of new - onset diabetes but would prevent 5.4 major coronary events ( coronary heart disease death and nonfatal myocardial infarction ) for a reduction of 1.0 mmol / l in ldl - c . the rate of cardiovascular events in patients with new - onset diabetes was much lower than that of patients with diabetes at baseline and was not appreciably higher than that of patients without new - onset diabetes ( adjusted hr , 1.02 ; 95 % ci , 0.77 to 1.35 ) . post hoc analysis of jupiter demonstrated a 28 % increase in incident diabetes yet also exhibited a reduction of 39 % in the primary endpoint among subjects assigned to rosuvastatin with at least one risk factor . that is , 134 vascular events or deaths were avoided for every 54 cases of new - onset diabetes . in addition , subjects with no risk factors showed no increased risk of diabetes ( hr , 0.99 ; 95 % ci , 0.45 to 2.21 ) and a 52 % reduction in the primary endpoint ( hr , 0.48 ; 95 % ci , 0.33 to 0.68 ) . these results demonstrate that the benefit for cardiovascular events and mortality of statin exceed the risk of diabetes . many mechanisms have been suggested in order to explain how statin might cause diabetes , and it seems that interaction of each mechanism is variably involved , such as combined pathophysiologic nature of diabetes characterized by a combination of - cell dysfunction and insulin resistance of peripheral tissue . a hypothetical paradigm for statin - induced impairment of glucose metabolism was proposed by sampson et al . with available experimental evidence ( fig .3 ) . statins ( especially lipophilic statins ) have been shown to inhibit glucose - induced calcium signaling and insulin secretion by blocking l - type ca channels in - cells . glucokinase , the rate limiting enzyme for intracellular glucose metabolism , is inhibited by highly increased uptake of plasma ldl - c by statins , thus impairing glucose - induced calcium signaling for insulin secretion . moreover , statins reduce the synthesis of coenzyme q 10 ( coq10 ) , an essential factor in the mitochondrial electron - transfer system , resulting in inhibition of insulin secretion by reduced production of atp . reduction of coq10 levels in blood and muscle also leads to disruption of muscle mitochondrial function , which is related to the pathogenesis of insulin resistance and decreased exercise tolerance . in in vitro and in animal studies , statins inhibit synthesis of isoprenoids leading to down - regulation of glut4 expression on adipocytes , resulting in impairment of glucose uptake . from the perspective of - cell inflammation , statinsenhance uptake of plasma ldl - c by up - regulation of ldl receptors and oxidation of ldl - c , triggering intracellular inflammatory response that compromises the functional and structural integrity of islet - cells and ultimately leads to insulin secretory dysfunction . in addition , cytokine - induced excessive production of nitric oxide has been shown to induce - cell apoptosis via activation of calcium dependent protease , calpain . comprehensive interaction of these processes may contribute to development of diabetes by statin and may become more significant in elderly persons with age - dependent loss of - cells . also , statin - induced cholesterol lowering per se contributes to myocyte damage of skeletal muscle fiber in a majority of patients , despite their being asymptomatic , which may cause skeletal muscle insulin resistance . furthermore aging - related skeletal muscle wasting may accelerate statin - induced peripheral insulin resistance . although most of clinical trials of statins are conducted during relatively short duration , available data suggest that statin therapy increases the risk of new - onset diabetes , and the risk of diabetes increased with higher dose of statins and increased in susceptible groups , such as the the elderly , women , and asians . meanwhile , statins do not appear to have a class effect on insulin sensitivity in nondiabetic patients . however , it is important to note that statins are highly effective for prevention of cardiovascular events in individuals with or without diabetes . therefore , the benefits of statin treatment appear to outweigh the risk of new - onset diabetes . in particular , the benefits of atorvastatin clearly outweigh the risks in patients with coronary or cerebrovascular disease . therefore , it would not be appropriate to argue that potential risk of incident diabetes should result in discontinuation of statins for primary or secondary prevention in any patient with moderate to high cardiovascular risk . it is more reasonable to investigate the question of whether individuals known to be susceptible to statins with a lower cardiovascular risk show the similar benefits of statin therapy outweighing the potential risk of incident diabetes . avoidance of high - dose statin therapy , if possible , and more careful monitoring for development of diabetes are recommended . moreover , proactive and intensive lifestyle intervention should be implemented in individuals with a high risk of incident diabetes when statins are used .\noutput:\n" }, { "from": "agent", "value": "statins are widely prescribed cholesterol - lowering agents , which have been demonstrated to significantly reduce cardiovascular morbidity and mortality . however , recent trials have reported that statins cause worsening of hyperglycemia and increase the risk of new - onset diabetes . the association between the diabetogenic effect of statins with intensive dose and accompanying major risk factors for diabetes has been demonstrated . however , statins do not appear to have a class effect on insulin sensitivity in non - diabetic patients . numerous mechanisms have been suggested to explain how statins cause - cell insulin secretory dysfunction and peripheral insulin resistance leading to incident diabetes . according to findings from an aggregate of large clinical trials , the benefits of statin treatment appear to outweigh the risk of new - onset diabetes . therefore , it would be inappropriate to discontinue the use of statins for prevention of cardiovascular events because of its potential risk for development of incident diabetes . this review addresses the currently available evidence related to statin use and new - onset diabetes from a clinical perspective ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: testing of blood - fed mosquitoes plays an integral role in the surveillance for arboviruses to understand the interaction mechanisms between host , vector and reservoir , and to identify and evaluate the role of potential bridge vector species in transmission of pathogens of public health importance . additionally , blood - fed mosquitoes can give us information regarding the feeding preference , seroconversion status of that host , infectivity level of the reservoir host , etc . , which immensely helps researchers in understanding the ecology of arboviruses . sampling a blood - fed mosquito is equivalent to sampling a host - seeking mosquito as well as a wild bird simultaneously . for the purpose of arbovirus surveillancedifferent types of traps are available in the market for trapping mosquitoes which can be basically grouped into three main categories . evs traps collect host - seeking mosquitoes but as they have not yet taken blood - meal the majority of them are sterile / non - infective and non - blood - feds . gravid traps are attractant towards oviposition females after they have digested the blood - meal and are ready to lay eggs . resting boxes are attractant to mosquitoes after they have taken blood - meal and should be ideal for collection of blood - fed mosquitoes . surprisingly , review of the literature revealed that on the us east coast , resting boxes were the least successful for disease surveillance purposes because of their low mosquito trap count . the present study was conducted to evaluate the efficacy of resting boxes in comparison with gravid traps for collecting blood - fed female mosquitoes of different species in the northwestern part of the riverside county of california . three trapping sites were selected in the northwest mosquito and vector control district ( nwmvcd ) of the riverside county of california based upon their resemblance to semi - urban and rural topographies [ figure 1 ] . these sites had a mixed resident population of horses , dogs , birds and humans . one resting box measuring h d w : 664 [ figure 2 ] was placed at each selected site , in shade under a tree , with its open end facing south . resting mosquitoes were aspirated once a week with in - house - developed battery - operated mechanical aspirator [ figure 3 ] . overnight trappings were done on a weekly basis between july - december 2009 . to maintain consistency trap deployment and mosquito collectionmosquitoes were collected the next morning at the same time during cooler hours ( before 9 am ) ; transported to the nwmvcd laboratory over blue ice ; identified up to species level on chill table ; and classified as male , female and blood - fed females . the data was stored in microsoft excel spread data sheet and statistically analyzed for percentage proportion of species , sex and blood - fed females of each species collected per trap type . the brief description about the three study sites is as under : resting box used in the present study in - house - developed battery - operated mechanical mosquito aspirator located in the city of norco ( latitude : 335623.7 n , longitude : 1173259.4 w , altitude : 504 feet , semi - urban type ) , this site provides indoor and outdoor boarding facility to 55 horses . in addition to horses , there were over 300 chicken roosters ( gallus gallus ) , 10 goats ( capra hircus ) , 4 watchdogs ( corgi mixed breed ) and 8 human attendants living on the property . three sides of this ranch have boundaries with neighboring horse - boarding facilities . located in the city of norco ( latitude : 335411.05 n , longitude : 1773312.76 w , altitude : 533 feet , semi - urban type ) , this is a horse boarding place with indoor and outdoor riding arenas . thirty - five horses were living in this place with four dogs ( labrador mix breed ) and four humans . the east side of this property has an approach road while the west side of the property has a huge pond filled with waste runaway rainwater . located in the city of mira loma ( latitude : 335826.28 n , longitude : 1772959.04 w , altitude : 559 feet , rural type ) , this site has outdoor horse boarding with 40 horses in addition to 5 dogs ( 3 : pomerians , 2 : labrador mix breed ) . this site mimics a rural setup with the south end touching the basin of santa ana river and having floodwater wash on the east side . located in the city of norco ( latitude : 335623.7 n , longitude : 1173259.4 w , altitude : 504 feet , semi - urban type ) , this site provides indoor and outdoor boarding facility to 55 horses . in addition to horses , there were over 300 chicken roosters ( gallus gallus ) , 10 goats ( capra hircus ) , 4 watchdogs ( corgi mixed breed ) and 8 human attendants living on the property . located in the city of norco ( latitude : 335411.05 n , longitude : 1773312.76 w , altitude : 533 feet , semi - urban type ) , this is a horse boarding place with indoor and outdoor riding arenas . thirty - five horses were living in this place with four dogs ( labrador mix breed ) and four humans . the east side of this property has an approach road while the west side of the property has a huge pond filled with waste runaway rainwater . located in the city of mira loma ( latitude : 335826.28 n , longitude : 1772959.04 w , altitude : 559 feet , rural type ) , this site has outdoor horse boarding with 40 horses in addition to 5 dogs ( 3 : pomerians , 2 : labrador mix breed ) . this site mimics a rural setup with the south end touching the basin of santa ana river and having floodwater wash on the east side . during this study period ( july to december 2009 ) , 3953 mosquitoes ( 826 blood - fed females ) belonging to three different genera and eight species were collected in various traps . resting boxes ( rb ) collected maximum variety of different mosquito species ( rb : seven , gravid : one , evs : three species ) . quinquefasciatus ( rb : 70.7 % and gravid : 97.4 % of their total respective mosquito collection ) . quinquefasciatus is one of the local competent vectors for west nile virus ( wnv ) and other arboviruses . during this study period , out of the total 2474 mosquitoes collected from resting boxes , the majority ( 98.3 % ) of the females belonged to the culex genus comprising five species ( cx . the proportion of blood - fed females of the culex species collected in resting boxes was 28.8 times more , while of blood - fed females of cx . overall , the proportion ( 63.3 % of the total 1273 female mosquitoes collected ) of blood - fed female mosquitoes collected was the highest in resting boxes followed by gravid traps with 2.2 % of their individual total female count . species - wise , 63.4 % of culex , 50 % of culiseta and 61.35 % of anopheles females collected in resting boxes were blood - fed while the proportion of blood - fed females of these three genera in gravid traps was very low [ table 1 ] . historically speaking , since the invasion of southern california by wnv in 2003 , it has been detected in pools of cx . resting boxes collected blood - fed female mosquitoes of all the above species except cx . erythrothorax which are commonly found in the wetland area containing cattails ( typha spp . ) and bullrush ( schoenoplectus californicus ) . although in the present study area all the three collection sites were lacking such ecotone , some host - seeking but non - blood - fed cx . the success of resting boxes in collecting such a huge proportion of blood - fed females was due to their strategic locations i.e. they were strategically placed close to a potential source of blood - meals . after taking blood - meal , it is insect physiology that female mosquitoes try to rest at the next available cool dark place for its digestion and production of eggs . a resting box nearby offered such cool dark shade and care was taken to avoid exposure of resting mosquitoes to sunlight from the setting or rising sun by facing the open face of the box towards the south . another important aspect for a higher proportion of blood - fed mosquitoes from resting boxes was the aspiration time . resting boxes were aspirated during early morning cooler hours ( not later than 9 am in the present study area ) as with the rising sun , the temperature also rises , resulting in flying away of blood - fed females . during this study , whenever we were in the neighborhood of resting boxes , they were checked for the presence of mosquitoes during mid - day or afternoon hours . since resting boxesdo not have any trap - door or fan to hold back the mosquitoes , they were either found empty or having very few mosquitoes . so if a researcher did not come to collect the mosquitoes from resting boxes during morning cooler hours , he / she would be disappointed with their collection ability . thus , resting boxes proved to be a huge success in collection of blood - fed mosquitoes in the northwestern part of riverside county . during this study period mosquitoes belonging to three different genera and eight species were collected in various traps . quinquefasciatus , which is one of the local competent vectors for wnv and other arboviruses . the proportion of blood - fed females of the culex species collected in resting boxes was 28.8 times more , while of blood - fed females of cx . additionally , in comparison to gravid traps , resting boxes require no batteries or dry ice to operate , generate no hazardous waste , require less man - hours per mosquito collection , have extremely low running cost and are not prone to thefts or vandalisms . these advantages make the choice of resting boxes extremely beneficial to researchers and public health agencies who have limited resources , especially in developing / underdeveloped countries where the epidemics of arboviruses , e.g. dengue , chickungunya , etc .\noutput:\n" }, { "from": "agent", "value": "objectives : testing of blood - fed mosquitoes plays an integral role in arbovirus surveillance and in understanding its interaction mechanisms between host , vector and reservoir . the present study was undertaken to evaluate the efficacy of two different traps ( gravid and resting boxes ) for collection of blood - fed mosquitoes in the northwestern part of riverside county.materials and methods : three trapping sites were selected in the northwest mosquito and vector control district of riverside county , california . at each site resting boxes and gravid traps were set ; and mosquitoes were collected on a weekly basis between july - december 2009 . mosquitoes were transported over blue ice , identified up to species level on chill table , and classified as male , female and blood - fed females.results : during this study period , 3953 mosquitoes ( 826 blood - fed females ) belonging to three different genera and eight species were collected ; resting boxes collecting maximum number ( seven ) of mosquito species . overall as well as individually in each trap kind , the most abundant mosquito species collected was cx . quinquefasciatus . the proportion of blood - fed females of the culex species collected in resting boxes was 28.8 times more , while of blood - fed females of cx . quinquefasciatus was 32.2 times more than the proportion collected from gravid traps.conclusions : overall , the proportion of blood - fed female mosquitoes collected for each species trapped was highest in resting boxes . additionally , resting boxes showed the advantage of extremely low running and maintenance cost ; generation of no hazardous waste ; quick turnaround time in terms of mosquito collection per man - hour spent ; and they were less prone to vandalism or thefts ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: human 2ar bearing an amino - terminal flag epitope tag and truncated after residue 365 was expressed in sf9 insect cells using the bestbac baculovirus system ( expression systems ; davis , ca ) . cells were infected at a density of 410 cells / ml , then incubated for two days at 27 c . receptor was first purified by flag affinity chromatography , then labeled with a 10-fold molar excess of biotin - peg11 - maleimide ( thermo scientific ; rockford , il ) , which reacts with the endogenous residue cys265 . following a one - hour incubation at room temperature , unlabeled receptor was blocked with 2 mm iodoacetamide for 15 minutes and then purified by alprenolol sepharose chromatography to isolate only functional receptor . alprenolol sepharose eluate was concentrated on flag affinity resin , and then washed with ligand - free buffer for 30 minutes at room temperature to eliminate bound alprenolol . detergent was gradually exchanged from dodecyl maltoside ( ddm ) to lauryl maltose neopentyl glycol ( mng ) by washing in buffer containing decreasing amounts of ddm and mng at a fixed concentration of 0.1 % ( w / w ) . nb80 was cloned into the carboxy - terminal aga2 yeast - display vector pyal and transformed and displayed on yeast as previously described . induced yeast displaying nb80 were washed with pbe buffer ( phosphate buffered saline with 0.5 mm edta and 0.5 % bsa ) supplemented with 0.02 % mng detergent ( pbem buffer ) and stained with varying concentrations of biotinylated receptor bound to either bi167107 or carazolol for one hour at 4c . the yeast were then washed with pbem buffer and stained with alexa 647 - conjugated streptavidin for 15 minutes at 4c . mean cell fluorescence was measured using the fl - 4 channel of an accuri c6 flow cytometer . the affinity maturation library was prepared by assembly pcr with oligonucleotide primers ( supplementary table 3 ) containing degenerate codons at 15 distinct positions ( supplementary fig . the pcr product was further amplified with primers containing 50 basepairs of homology to pyal . mutagenic nanobody dna and linearized pyal vector were co - electroporated into eby100 yeast to yield a library of 0.810 transformants . for the first round of selection , 1.010 yeast induced with sgcaa medium were washed with pbem buffer and then resuspended in 5 ml of pbem buffer containing 200 nm biotinylated 2ar bound to bi167107 . after one hour of incubation at 4 c with rotation , yeast were washed with pbem buffer , and then stained with alexa647 - conjugated streptavidin in pbem buffer for 15 minutes at 4c . yeast were washed again with pbem buffer and magnetically labeled with 250 l anti-647 microbeads ( miltenyi ) in 4.75 ml pbem buffer for 15 minutes at 4c . yeast were washed a final time and labeled yeast were isolated by magnetic selection with an ls column ( miltenyi ) pre - equilibrated with pbem buffer . rounds 26 were selected in a similar manner , with the following modifications . prior to positive selection with agonist - occupied 2ar , negative selection with antagonist - bound receptorwas performed to select for clones that maintained a preference for the active state of the 2ar . briefly , 1.010 yeast were washed with pbem buffer and resuspended in 500 l pbem buffer containing 1 m biotinylated 2ar bound to carazolol . yeast were incubated at 4 c for one hour , then labeled with alexa647 or pe - conjugated streptavidin , and magnetically labeled with 50 l of the respective anti - fluorophore microbeads ( miltenyi ) in 450 l pbem buffer . magnetically - labeled yeast were applied to an ls column and the depleted flow - through was collected for subsequent positive selection . in this manner , positive selections on active , agonist - occupied receptor were performed as for round one , but in a staining volume of 500 l and with successively decreasing concentrations of bi167107 - bound 2ar : 200 nm receptor for rounds 2 and 3 , 20 nm receptor for round 4 , and 1 nm receptor for round 5 . for round 6 , positive selection was performed by a kinetic selection strategy to select for clones with the slowest off - rates ( supplementary fig . yeast were stained with 200 nm biotinylated bi167107 - bound 2ar for one hour , washed with pbem , and then resuspended in 500 l pbem containing 15 m nb80 . the cells were incubated at 25 c for 155 minutes , after which they were washed with ice - cold pbem and stained with fluorescent streptavidin . enrichment with magnetic separation for rounds 26 was performed as for round one , but with 50 l anti - fluorophore magnetic microbeads with 450 l pbem buffer . subsequent to round 6 , post - sorted yeast were plated onto sdcaa - agar plates , colonies were picked and cultured in liquid sdcaa medium , and the plasmids encoding the nanobodies were isolated with a zymoprep yeast plasmid miniprep ii kit ( zymo research ) and sequenced . nanobodies were cloned into the periplasmic expression vector pet26b , containing an amino terminal signal sequence and a carboxy - terminal 8histidine tag and transformed into bl21 ( de3 ) rosetta2 e. coli ( novagen ) . cells were induced in terrific broth at an od600 of 0.8 with 1 mm iptg and incubated with shaking at 22 c for 24 hours . periplasmic protein was obtained by osmotic shock and the nanobodies were purified using nickel nitrilotriacetic acid ( ni - nta ) chromatography . for crystallography , nb6b9 was digested overnight with 1:50 ( w / w ) carboxypeptidase a ( sigma ) to remove the his tag , then purified by size exclusion chromatography over a sephadex s200 size exclusion column . protein concentrations were determined by 280 nm absorbance with a nanodrop2000 spectrometer ( thermo scientific ) . biotinylated bi167107 - bound 2ar was immobilized on an sa sensorchip ( ge ) at an rmax of approximately 40 response units ( ru ) . biotinylated tiotropium - bound m2 muscarinic receptor was immobilized with an ru value matching that of the reference surface to control for nonspecific binding . measurements were made using serial dilutions of nb80 or nb6b9 in hbsm ( 10 mm hepes ph 7.4 , 150 mm nacl , 0.01 % mng ) using single - cycle kinetics . all data were analyzed with the biacore t100 evaluation software version 2.0 with a 1:1 langmuir binding model . radioligand binding assays were performed using purified 2ar reconstituted into hdl particles comprised of apolipoprotein a1 and a 3:2 ( mol : mol ) mixture of popc : popg lipid . binding reactions were 500 l in volume , and contained 50 fmol functional receptor , 0.5 nm h dihydroalprenolol ( h - dha ) , 100 mm nacl , 20 mm hepes ph 7.5 , 0.1 % bovine serum albumin , and ligands and nanobodies as indicated . reactions were mixed , then incubated for four hours at room temperature prior to filtration with a brandel 48 - well harvester onto a filter pre - treated with 0.1 % polyethylenimine . human 2ar fused to an amino - terminal t4 lysozyme was expressed and purified as described above . following purification by alprenolol sepharose , the receptor was washed extensively with 30 m of the low affinity antagonist atenolol while bound to flag affinity resin to fully displace alprenolol , then washed and eluted in buffer devoid of ligand to produce a homogeneously unliganded preparation . the receptor was then incubated for 30 minutes at room temperature with a stoichiometric excess of ligand ( hbi or bi167107 ) . a 1.3-fold molar excess of nb6b9 was then added , and the sample was dialyzed overnight into a buffer consisting of 100 mm sodium chloride , 20 mm hepes ph 7.5 , 0.01 % lauryl maltose neopentyl glycol detergent , and 0.001 % cholesteryl hemisuccinate . in each case , ligand was included in the dialysis buffer at 100 nm concentration or higher . the sample was then concentrated using a 50 kda spin concentrator and purified over a sephadex s200 size exclusion column in the same buffer as for dialysis , and the 2ar - nb6b9 - ligand ternary complex was isolated . in the case of adrenaline , the low affinity and chemical instability of the ligand precluded overnight dialysis , so 100 m adrenaline was added to receptor for 30 minutes at room temperature , then a 1.3-fold molar excess of nb6b9 added and the sample was incubated for 30 minutes at room temperature . following incubation , following purification , samples were concentrated to a280 = 55 using a 50 kda concentrator to minimize the detergent concentration in the final sample , then aliquoted into thin - walled pcr tubes at 8 l per aliquot . aliquots were flash frozen in liquid nitrogen and stored at -80 c for crystallization trials . for crystallization , samples were thawed and reconstituted into lipidic cubic phase with a 1:1 mass : mass ratio of lipid . the lipid stock consisted of a 10:1 mix by mass of 7.7 monoacylglycerol ( generously provided by martin caffrey ) with cholesterol ( sigma ) . samples were reconstituted by the two syringe mixing method and then dispensed into glass sandwich plates using a gryphonlcp robot ( art robbins instruments ) . in the case of the 2ar - adrenaline complex , 1 mm fresh adrenaline was mixed with receptor prior to reconstitution . crystals were grown using 30 nl protein / lipid drops with 600 nl overlay solution , which consisted of 1824 % peg400 , 100 mm mes ph 6.2 to ph 6.7 , and 40100 mm ammonium phosphate dibasic . crystals grew in 13 days , and were harvested and frozen in liquid nitrogen for data collection . x - ray diffraction data were collected at advanced photon source gm / ca beamlines 23id - b and 23id - d . the best diffracting crystals were identified by rastering , and wedges of 110 were collected using a 10 m beam with typically 2 seconds exposure , 0.6 oscillation , and no beam attenuation . diffraction data were processed in hkl2000 , and the structure was solved using molecular replacement with the structures of active 2ar , nb80 ( pdb i d : 3p0 g ) , and t4 lysozyme ( pdb i d : 2rh1 ) used as search models in phaser . human 2ar bearing an amino - terminal flag epitope tag and truncated after residue 365 was expressed in sf9 insect cells using the bestbac baculovirus system ( expression systems ; davis , ca ) . cells were infected at a density of 410 cells / ml , then incubated for two days at 27 c . receptor was first purified by flag affinity chromatography , then labeled with a 10-fold molar excess of biotin - peg11 - maleimide ( thermo scientific ; rockford , il ) , which reacts with the endogenous residue cys265 . following a one - hour incubation at room temperature , unlabeled receptor was blocked with 2 mm iodoacetamide for 15 minutes and then purified by alprenolol sepharose chromatography to isolate only functional receptor . alprenolol sepharose eluate was concentrated on flag affinity resin , and then washed with ligand - free buffer for 30 minutes at room temperature to eliminate bound alprenolol . detergent was gradually exchanged from dodecyl maltoside ( ddm ) to lauryl maltose neopentyl glycol ( mng ) by washing in buffer containing decreasing amounts of ddm and mng at a fixed concentration of 0.1 % ( w / w ) . nb80 was cloned into the carboxy - terminal aga2 yeast - display vector pyal and transformed and displayed on yeast as previously described . induced yeast displaying nb80 were washed with pbe buffer ( phosphate buffered saline with 0.5 mm edta and 0.5 % bsa ) supplemented with 0.02 % mng detergent ( pbem buffer ) and stained with varying concentrations of biotinylated receptor bound to either bi167107 or carazolol for one hour at 4c . the yeast were then washed with pbem buffer and stained with alexa 647 - conjugated streptavidin for 15 minutes at 4c . mean cell fluorescence was measured using the fl - 4 channel of an accuri c6 flow cytometer . the affinity maturation library was prepared by assembly pcr with oligonucleotide primers ( supplementary table 3 ) containing degenerate codons at 15 distinct positions ( supplementary fig . the pcr product was further amplified with primers containing 50 basepairs of homology to pyal . mutagenic nanobody dna and linearized pyal vector were co - electroporated into eby100 yeast to yield a library of 0.810 transformants . for the first round of selection , 1.010 yeast induced with sgcaa medium were washed with pbem buffer and then resuspended in 5 ml of pbem buffer containing 200 nm biotinylated 2ar bound to bi167107 . after one hour of incubation at 4 c with rotation , yeast were washed with pbem buffer , and then stained with alexa647 - conjugated streptavidin in pbem buffer for 15 minutes at 4c . yeast were washed again with pbem buffer and magnetically labeled with 250 l anti-647 microbeads ( miltenyi ) in 4.75 ml pbem buffer for 15 minutes at 4c . yeast were washed a final time and labeled yeast were isolated by magnetic selection with an ls column ( miltenyi ) pre - equilibrated with pbem buffer . rounds 26 were selected in a similar manner , with the following modifications . prior to positive selection with agonist - occupied 2ar , negative selection with antagonist - bound receptorwas performed to select for clones that maintained a preference for the active state of the 2ar . briefly , 1.010 yeast were washed with pbem buffer and resuspended in 500 l pbem buffer containing 1 m biotinylated 2ar bound to carazolol . yeast were incubated at 4 c for one hour , then labeled with alexa647 or pe - conjugated streptavidin , and magnetically labeled with 50 l of the respective anti - fluorophore microbeads ( miltenyi ) in 450 l pbem buffer . magnetically - labeled yeast were applied to an ls column and the depleted flow - through was collected for subsequent positive selection . in this manner , positive selections on active , agonist - occupied receptor were performed as for round one , but in a staining volume of 500 l and with successively decreasing concentrations of bi167107 - bound 2ar : 200 nm receptor for rounds 2 and 3 , 20 nm receptor for round 4 , and 1 nm receptor for round 5 . for round 6 , positive selection was performed by a kinetic selection strategy to select for clones with the slowest off - rates ( supplementary fig . , yeast were stained with 200 nm biotinylated bi167107 - bound 2ar for one hour , washed with pbem , and then resuspended in 500 l pbem containing 15 m nb80 . the cells were incubated at 25 c for 155 minutes , after which they were washed with ice - cold pbem and stained with fluorescent streptavidin . enrichment with magnetic separation for rounds 26 was performed as for round one , but with 50 l anti - fluorophore magnetic microbeads with 450 l pbem buffer . subsequent to round 6 , post - sorted yeast were plated onto sdcaa - agar plates , colonies were picked and cultured in liquid sdcaa medium , and the plasmids encoding the nanobodies were isolated with a zymoprep yeast plasmid miniprep ii kit ( zymo research ) and sequenced . nanobodies were cloned into the periplasmic expression vector pet26b , containing an amino terminal signal sequence and a carboxy - terminal 8histidine tag and transformed into bl21 ( de3 ) rosetta2 e. coli ( novagen ) . cells were induced in terrific broth at an od600 of 0.8 with 1 mm iptg and incubated with shaking at 22 c for 24 hours . periplasmic protein was obtained by osmotic shock and the nanobodies were purified using nickel nitrilotriacetic acid ( ni - nta ) chromatography . for crystallography , nb6b9 was digested overnight with 1:50 ( w / w ) carboxypeptidase a ( sigma ) to remove the his tag , then purified by size exclusion chromatography over a sephadex s200 size exclusion column . protein concentrations were determined by 280 nm absorbance with a nanodrop2000 spectrometer ( thermo scientific ) . biotinylated bi167107 - bound 2ar was immobilized on an sa sensorchip ( ge ) at an rmax of approximately 40 response units ( ru ) . biotinylated tiotropium - bound m2 muscarinic receptor was immobilized with an ru value matching that of the reference surface to control for nonspecific binding . measurements were made using serial dilutions of nb80 or nb6b9 in hbsm ( 10 mm hepes ph 7.4 , 150 mm nacl , 0.01 % mng ) using single - cycle kinetics . all data were analyzed with the biacore t100 evaluation software version 2.0 with a 1:1 langmuir binding model . radioligand binding assays were performed using purified 2ar reconstituted into hdl particles comprised of apolipoprotein a1 and a 3:2 ( mol : mol ) mixture of popc : popg lipid . binding reactions were 500 l in volume , and contained 50 fmol functional receptor , 0.5 nm h dihydroalprenolol ( h - dha ) , 100 mm nacl , 20 mm hepes ph 7.5 , 0.1 % bovine serum albumin , and ligands and nanobodies as indicated . reactions were mixed , then incubated for four hours at room temperature prior to filtration with a brandel 48 - well harvester onto a filter pre - treated with 0.1 % polyethylenimine . human 2ar fused to an amino - terminal t4 lysozyme was expressed and purified as described above . following purification by alprenolol sepharose , the receptor was washed extensively with 30 m of the low affinity antagonist atenolol while bound to flag affinity resin to fully displace alprenolol , then washed and eluted in buffer devoid of ligand to produce a homogeneously unliganded preparation . the receptor was then incubated for 30 minutes at room temperature with a stoichiometric excess of ligand ( hbi or bi167107 ) . a 1.3-fold molar excess of nb6b9 was then added , and the sample was dialyzed overnight into a buffer consisting of 100 mm sodium chloride , 20 mm hepes ph 7.5 , 0.01 % lauryl maltose neopentyl glycol detergent , and 0.001 % cholesteryl hemisuccinate . in each case , ligand was included in the dialysis buffer at 100 nm concentration or higher . the sample was then concentrated using a 50 kda spin concentrator and purified over a sephadex s200 size exclusion column in the same buffer as for dialysis , and the 2ar - nb6b9 - ligand ternary complex was isolated . in the case of adrenaline , the low affinity and chemical instability of the ligand precludedovernight dialysis , so 100 m adrenaline was added to receptor for 30 minutes at room temperature , then a 1.3-fold molar excess of nb6b9 added and the sample was incubated for 30 minutes at room temperature . following incubation , following purification , samples were concentrated to a280 = 55 using a 50 kda concentrator to minimize the detergent concentration in the final sample , then aliquoted into thin - walled pcr tubes at 8 l per aliquot . aliquots were flash frozen in liquid nitrogen and stored at -80 c for crystallization trials . for crystallization , samples were thawed and reconstituted into lipidic cubic phase with a 1:1 mass : mass ratio of lipid . the lipid stock consisted of a 10:1 mix by mass of 7.7 monoacylglycerol ( generously provided by martin caffrey ) with cholesterol ( sigma ) . samples were reconstituted by the two syringe mixing method and then dispensed into glass sandwich plates using a gryphonlcp robot ( art robbins instruments ) . in the case of the 2ar - adrenaline complex , crystals were grown using 30 nl protein / lipid drops with 600 nl overlay solution , which consisted of 1824 % peg400 , 100 mm mes ph 6.2 to ph 6.7 , and 40100 mm ammonium phosphate dibasic . crystals grew in 13 days , and were harvested and frozen in liquid nitrogen for data collection . x - ray diffraction data were collected at advanced photon source gm / ca beamlines 23id - b and 23id - d . the best diffracting crystals were identified by rastering , and wedges of 110 were collected using a 10 m beam with typically 2 seconds exposure , 0.6 oscillation , and no beam attenuation . diffraction data were processed in hkl2000 , and the structure was solved using molecular replacement with the structures of active 2ar , nb80 ( pdb i d : 3p0 g ) , and t4 lysozyme ( pdb i d : 2rh1 ) used as search models in phaser .\noutput:\n" }, { "from": "agent", "value": "g protein - coupled receptors ( gpcrs ) are integral membrane proteins that play an essential role in human physiology , yet the molecular processes through which they bind to their endogenous agonists and activate effector proteins remain poorly understood . thus far , it has not been possible to capture an active - state gpcr bound to its native neurotransmitter . crystal structures of agonist - bound gpcrs have relied on the use of either exceptionally high - affinity agonists1 ,2 or receptor stabilization by mutagenesis3 - 5 . many natural agonists such as adrenaline , which activates the 2 - adrenoceptor ( 2ar ) , bind with relatively low affinity , and they are often chemically unstable . using directed evolution , we engineered a high - affinity camelid antibody fragment that stabilizes the active state of the 2ar , and used this to obtain crystal structures of the activated receptor bound to multiple ligands . here , we present structures of active - state 2ar bound to three chemically distinct agonists : the ultra high - affinity agonist bi167107 , the high - affinity catecholamine agonist hydroxybenzyl isoproterenol , and the low - affinity endogenous agonist adrenaline . the crystal structures reveal a highly conserved overall ligand recognition and activation mode despite diverse ligand chemical structures and affinities that range from 100 nm to ~ 80 pm . the adrenaline - bound receptor structure is overall similar to the others , but shows substantial rearrangements in extracellular loop three and the extracellular tip of transmembrane helix 6 . these structures also reveal a water - mediated hydrogen bond between two conserved tyrosines , which appears to stabilize the active state of the 2ar and related gpcrs ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in recent years , abdominal muscle training has gained increasing popularity , and exercises like crunches orabdominal training serves to improve core stability , which is the ability to strengthen the lumbopelvic complex and transfer forces from the upper to the lower limbs of the body while maintaining the spine in a neutral position1 , 2 . the core region of the body has been anatomically described as a box , with the abdominals at the front , spinal and gluteal muscles at the back , the diaphragm on the top , and the pelvic floor and hip muscles on the bottom3 . generally , the core muscles , which form the primary muscle group for maintaining spinal stability4 , can be divided into two groups according to their functions and attributes : local system and global system5 . the most common traditional exercises21 and training methods to enhance abdominal strength and stability employ body weight exercises consisting of static or dynamic contractions in various body positions ( e.g. , supine , lateral ) , starting with isolated movements and then continuing through with more complex sequences1 , 6 such as crunches , sit - ups , and planks ( prone or lateral ) . however , such exercises , especially the crunch , are performed with repeated flexions and lateral bending motions that produce vertebral compression at high lumbar overloads and therefore may be injurious for the spine7 ,8,9,10,11 . correct breathing ( especially as it involves the respiratory muscles ) is vital to abdominal training because respiratory muscles are directly involved during common core stability exercises12 ,13,14 . found that the diaphragm is actively recruited in many resistance training exercises , including sit - ups13 . other studies demonstrated that the respiratory muscles are involved in a variety of activities in which respiration is not primarily involved12 , 13 , 15 , 16 . because breathing is one of the most basic patterns directly related to human movement17 , as seen in neonates18 , 19 , inefficient breathing may result in muscular imbalance and motor control alterations that can affect general motor quality17 . to our knowledge , few publications to date have evaluated the impact of breathing in relation to abdominal exercises . our hypothesis was that exercises based on a combination of global stretching postures , which are advantageous for improving respiratory apparatus efficiency20 , and breathing exercises may exert a concurrent positive effect on core function and body movement . the aim of this study was to evaluate whether , as compared with a training protocol of common exercises21 , abdominal training plus breathing exercises would more greatly enhance abdominal fitness , quality of movement , and respiratory function . all participants gave their written informed consent after having been informed about the objectives and scope , procedures , risks , and benefits of the study . participation was voluntary , and withdrawal from the study was permitted at any time . all procedures were carried out in accordance with the declaration of helsinki ; the study protocol was approved by the university s institutional review board . the study sample comprised 32 healthy male nonsmokers without pulmonary disease or a history of low back pain ( experimental group [ eg ] n = 16 , mean age 302 years , height 1.733 m , weight 672 kg ; control group [ cg ] , n = 16 , mean age 283 years , height 1.762 m , weight 703 kg ) . before the start of the study , all subjects engaged in regular physical activity at least 3 times per week with a training regimen that included medium - intensity aerobic activity ( 6575 % heart rate maximum ) for at least 45 minutes and a resistance training program that included free - weight and machine exercises to 6070 % of one repetition maximum ( 1rm ) for 2 days per week . the subjects were matched and randomly assigned to two groups as determined by a chance process ( a random number generator on a computer ) that could not be predicted . no other physical exercise , aside from that specified for the purposes of this study , was performed during the study period . respiratory measurements were taken with the subjects comfortably seated and the trunk at a 90 angle . pulmonary function was measured with a portable spirometer ( pony fx , cosmed , rome , italy ) while the subjects were wearing a nose clip . the test was repeated three to five times to obtain at least two acceptable trials ( variability 100 ml ) , with a 2 - minute rest interval between the trials to ensure adequate recovery . a single experienced investigator interpreted the data according to established guidelines23 to obtain a target value for each subject and to ensure that the maneuver had been performed correctly . forced vital capacity ( fvc ) , forced expiratory volume in one second ( fev1 ) , and peak expiratory flow ( pef ) were evaluated . the american college of sports medicine ( acsm ) curl - up ( cadence ) test and the functional movement screen ( fms ) , two simple , practical , valid , and reliable tests17 , 24,25,26 , were used to assess abdominal muscle fitness . the acsm curl - up ( cadence ) test evaluates local muscular endurance of the abdominal muscle groups , which are important for good posture and performing various daily tasks . the fms evaluates the efficiency of basic human motion , for example , as during breathing ; a proper breathing pattern in turn influences movement efficiency17 , 24 . the acsm curl - up ( cadence ) test protocol is carried out with the subject lying on his or her back on a mat with knees bent at a 90 angle and feet on the floor . the arms are extended to the sides with the fingers touching a piece of masking tape . a second piece of tape is placed 12 cm beyond the first piece . for this study , the metronome was set to 40 beats per minute . at the first beep , the subject lifts his or her shoulder blades off the mat by flexing the spine until the fingertips reach the second piece of tape . at the next beep , the subject slowly returns the shoulder blades to the mat by flattening the lower back . the subject performs as many curl - ups as possible without stopping , up to a maximum of 75 repetitions24 . the fms , developed by cook & burton27 ,28,29 , consists of seven patterns : deep squat , hurdle step , in - line lunge , shoulder mobility , active straight leg raise , trunk stability push - up , and rotary stability . movement competency is graded on a scale from 0 to 3 points based on how the tasks are accomplished : 0 indicates movement with pain , 1 indicates inability to perform the pattern , 2 indicates pattern performed with compensations or imperfections , and 3 indicates pattern performed as directed . instruction and administration of the fms were carried out by a certified fms instructor according to published guidelines27 ,28,29 . the two training protocols were administered for 15 minutes twice per week for 6 weeks in both groups ; all exercises were performed after a standardized 10 - minute warm - up consisting of cycling on a stationary bike . the eg exercises were focused on achieving and maintaining a proper diaphragmatic breathing pattern for 23 seconds during inspiration and 810 seconds during expiration , with a vocal sound emitted to induce active recruitment of the pelvic floor muscles and deep internal abdominals30 ,31,32 . to do this , the subject inhales , expanding the lower abdominal region , the side and back of the abdomen , and the lower ribs . the chest is kept relaxed without pushing out the stomach , and the head is aligned with the spine to avoid excessive bending of the spine or body compensations . he or she stretches the arms upward , and on exhalation , produces a sound from the mouth , maintaining the spine aligned and stretched . the subject sits with the spine erect , lower limbs elongated , and arms extended in front of the chest . during exhalation , a vocal soundthe subject sits in a kneeling position with buttocks resting on his heels and legs slightly apart ; the face is directed forward with the left arm bent overhead . during exhalation , a sound is produced while starting to bend the body laterally and stretching the opposite side of the body . the subject sits in a kneeling position , with one arm bent in front of the eyes and the other resting on the floor . during inhalation , the trunk is rotated to the right while maintaining normal spinal curvature . during exhalation , a vocal soundthe cg exercises were chosen from a variety of common exercises21 during which a spontaneous breathing rhythm ( 1 second for inspiration and 1 second for expiration ) is maintained in the following sequence : 1 . crunch : the subject lies on his back with knees bent , feet on the floor , and hands resting on the chest . during inhalation , the shoulders are lifted off the ground ; during exhalation , the subject returns to the starting position .2 . crunch with rotation : the subject lies on his back with knees bent and feet on the floor . during exhalation , the trunk is lifted and rotated ; during inhalation , the subject returns to the starting position . supine bridge : the subject lies on his back with knees bent and feet on the floor . during exhalation , the pelvis is lifted an inch off the floor while pressing into the soles of the feet . during inhalation4 . prone bridge : the subject begins prone in a table position with knees under the hips and arms under the shoulder ; on inhalation , the right leg is simultaneously lifted straight out and behind , and the left arm is lifted straight out in front . the routine for exercise numbers 1 and 2 consisted of two series of 15 repetitions each . exercise numbers 3 and 4 consisted of two series for 10 seconds in isometric contraction . all sessions were supervised by an expert instructor to ensure that the exercises were properly performed . data were entered into a personal computer , and all statistical analyses were performed using the statistical package for the social sciences ibm spss version 21.0 ( ibm corp . , armonk , ny , usa ) . two - way [ time ( before vs. after ) 2 group ( eg vs. cg ) ] repeated analysis of variance ( anova ) tests were used to measure differences in respiratory parameters , acsm curl - up ( cadence ) test scores , and fms scores , followed by tukey s test . a dependent - measure t - test was used to determine pre - and posttest differences between the groups . partial eta squared ( part ) effect size was used to estimate the magnitude of the difference within each group ; the thresholds for small , moderate , and large effects were defined as 0.01 , 0.06 , and 0.14 , respectively33 . there was no significant difference in any of the measurements between the two groups at baseline . table 1table 1 . results of pulmonary function tests ( mean sem ) between the experimental and control groupsparametersgroupsvaluesgainsbefore testingafter testing % change ( before and after training ) % change ( eg vs. cg ) fvc ( l ) eg5 .00.25.60.212.212.5 cg4 .90.35.00.21.6 fev1 ( l ) eg4 .10.14.60.111.59.2 cg4 .00.34.20.25.2 pef ( l / second ) eg8 .40.49.80.415.613.4 cg8 .30.88.60.63.4 significant difference between conditions before and after testing ( p 0.05 ) in the same group . fvc : forced vital capacity ; fev1 : forced expiratory volume in 1 second ; pef : peak expiratory flow ; eg : experimental group ; cg : control group presents the differences in respiratory measurements before and after exercise training . fvc improved by 12.2 % ( p 0.05 ) ( 5.060.2 l pretraining vs. 5.680.2 l posttraining ) in the eg , while it remained unchanged in the cg ( 4.970.3 l pretraining vs. 5.050.2 l posttraining ) . after training , there was a significant increase in fev1 ( 12.5 % ) with aa significant difference between pre - and posttraining fev1 was observed ( 11.5 % , from 4.140.1 l to 4.620.1 l ) in the eg as compared with the cg ( 5.2 % , 4.020.3 l and 4.230.2 l ) . after 6 weeks of training , fev1 was 9.2 % higher on average ( p 0.05 ) in the eg than in the cg . there was a significant increase of 15.6 % in pef ( from 8.490.4 l / second at baseline to 9.820.4 l / second at the end of training ) in the eg compared with the cg ( 3.4 % , from 8.370.8 l / second pretraining to 8.660.6 l / second posttraining ) . after 6 weeks of training , pef was 13.4 % greater in the eg than in the cg . significant difference between conditions before and after testing ( p 0.05 ) in the same group . fvc : forced vital capacity ; fev1 : forced expiratory volume in 1 second ; pef : peak expiratory flow ; eg : experimental group ; cg : control group table 2table 2 . results of functional tests ( mean sem ) between the experimental and control groupsvaluesgainsparametersgroupsbefore trainingafter training % change ( before and after training ) % change ( eg vs. cg ) acsm curl - up ( cadence ) test ( number of repetitions ) eg40 .01.054.01.134.325.6 cg39 .02.843.03.48.1 fms ( a.u. ) eg11 .40.616.50.544.741.0 cg11 .00.311.70.46.3 significant difference between before and after condition ( p 0.05 ) inside the same group . significant difference between groups post - training ( p 0.05 ) . acsm : american college of sports medicine ; eg : experimental group ; cg : control group ; fms : functional movement screen reports the mean functional test scores of subjects before and after training . the eg improved by 34.3 % , from 401.01 to 541.1 ( p 0.05 ) on the acsm curl - up ( cadence ) test , whereas the increase in the number of repetitions was lower in the cg ( 392.8 to 433.4 ; p 0.05 ) . after 6 weeks of training , there was a significant difference of + 25.6 % ( p 0.05 ) with athere was a significant difference in the fms scores ( 112.6 arbitrary unit au , pretraining vs. 162.0 au posttraining ; p 0.05 ) in the eg as compared with the cg , in which improvements were smaller ( 11.00.3 au pretraining vs. 11.70.4 au posttraining ) . a significant increase of + 41 % ( p 0.05 ) with a largeeffect size ( 0.13 ) was seen in the eg as compared with the cg . significant difference between before and after condition ( p 0.05 ) inside the same group . acsm : american college of sports medicine ; eg : experimental group ; cg : control group ; fms : functional movement screenthe main finding of this study is that , compared with traditional exercises , a program including core exercises performed with a focus on muscular chain stretching and breathing techniques can lead to greater improvement in respiratory function , abdominal muscle endurance , and movement efficiency . furthermore , the results suggest that a series of core exercises performed with a vocal sound emission can be a valid strategy to enhance proper diaphragmatic breathing patterns and deep internal abdominal activation30 , 31 much more than in traditional abdominal routines in which people tend to hold their breath or use chest wall respiration34 . in agreement with published data , our results show that , while traditional core exercises can improve pulmonary function , improvements are greater with muscular chain stretching in combination with breathing techniques . this difference was expected because the exercises were specifically designed to train the respiratory muscles and the diaphragmatic breathing pattern in particular . indeed , greater improvement in lung function parameters but also in fitness test scores was observed in the eg . in both groups , the baseline acsm curl - up ( cadence ) test and fms scores were in line with normative data , whereas after training , the scores on both tests were in the above - normal average only in the eg24 , 35 . specifically , the raw scores of the fms test , whole body stability and balance patterns , as evaluated for the parameters rotary stability and trunk stability push up , improved from 1.3 au to 2 au in the eg , indicating improved body control due to a better respiratory pattern . in shoulder mobility , the eg improved from a medium to the highest score ( 2.4 au before , 3 au after training ) , whereas the cg remained unchanged with a medium score ( 2.5 au before , and 2.6 au after training ) . the same trend was noted on the active straight leg raise test . concerning whole body patterns ( deep squat , hurdle step , in line lunge ) , the eg improved from a low to a medium score on each of the three patterns ( 1.62.5 au , 1.42 au , and 1.62.4 au , respectively ) , whereas most values remained unchanged in the cg . as reported in previous studies , proper diaphragmatic breathing is directly linked to better functional movement17 , but combining proper breathing with global stretching postures can produce a greater effect on such functional parameters , as measured on mobility , stability , and whole body pattern tests . regarding the biomechanical aspects of breathing , the expiration phase promotes active recruitment of the abdominal muscles , contrasting the natural elevation of the rib cage ( induced by raising the arms overhead ) ; to the contrary , elevating the arms raises the anterior chest wall , makes the thoracolumbar column hyperlordotic , and puts the diaphragm in an oblique position that inhibits its proper function . during exhalation , the thoracolumbar spine returns to a more neutral position ( opposing the previous hyperlordosis ) , and the diaphragm is more horizontal without posterior pelvic tilt34 . the subject should inhale to expand the lower portion of the abdominal region , the side and back parts of the abdomen and lower ribs , keeping the spine aligned and the chest relaxed . using a correct diaphragmatic breathing pattern promotes co - contraction of the abdominal muscles in the so - called bracing technique , which provides trunk stiffness and stability36 , 37 . when focusing on diaphragmatic breathing , it is important not only to reestablish a correct respiratory pattern but also to ensure lumbar spine stabilization by increasing intra - abdominal pressure38 ,39,40,41 and activation of the core structures to transfer forces from the center of the body to the lower extremities . to produce an economic breathing pattern , all joints must be centered in a stable position to involve all muscular chains . the head , eyes , and spinal curves should all be aligned with the pelvis and the hips down to the knees and feet . this can be achieved with proper diaphragmatic breathing and adequate muscle tone distribution ( as can be trained with eg exercises ) 18 , 19 . the combined eg exercises may offer several other advantages : first , recruitment of the deep abdominals increases intra - abdominal pressure and coactivation of the entire abdominal wall34 , which has a fundamental role in providing adequate support for spine and trunk stiffness42 , 43 . second , in contrast with crunches , there are no repeated flexions that could be injurious to the vertebrae7 ,8,9 . third , the spine remains in a neutral posture34 , so the abdominals can be trained in an elongated and normal position . in sports or activities of dailyliving , people rarely flex the rib cage to the pelvis , thus shortening the rectus abdominis9 . the sample size was small , and the subjects did not belong to a specific population . in addition , electromyographic assessment of the abdominal muscles was not performed . in conclusion , eg exercises that incorporate correct breathing patterns and body flexibility offer an alternative to traditional abdominal exercises . as such , they may be useful for coaches or physical therapists when selecting core exercises to improve overall abdominal fitness and pulmonary function and to retrain correct diaphragmatic breathing and whole body movements . further research is needed to compare abdominal breathing with other core exercises in order to clarify the combination of breath and abdominal exercises in treating painful disorders ( low back pain , neck pain ) and improving motor control in fitness and rehabilitation programs .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] this study determined the effects a new modality of core stabilization exercises based on diaphragmatic breathing on pulmonary function , abdominal fitness , and movement efficiency . [ subjects ] thirty - two physically active , healthy males were randomly assigned to an experimental group ( n = 16 ) and a control group ( n = 16 ) . [ methods ] the experimental group combined diaphragmatic breathing exercises with global stretching postures , and the control group performed common abdominal exercises ( e.g. , crunch , plank , sit - up ) , both for 15 minutes twice weekly for 6 weeks . pulmonary function ( measured by forced vital capacity , forced expiratory volume in 1 second , and peak expiratory flow ) and abdominal fitness ( measured with the american college of sports medicine curl - up [ cadence ] test and the functional movement screentm ) were evaluated before and after the intervention . [ results ] significant changes in curl - up ( cadence ) test scores , functional movement screen scores , and all pulmonary parameters were recorded in the experimental group at the posttraining assessment , whereas in the control group , no significant differences over baseline were observed in any parameters . [ conclusion ] compared with traditional abdominal exercises , core stabilization exercises based on breathing and global stretching postures are more effective in improving pulmonary function and abdominal fitness ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: promoting physical activity for older adults is especially important , because this population is the least physically active of any age group1 , 2 . although no amount of physical activity can stop the biological aging process , regular exercise may minimize the physiological effects of a sedentary lifestyle and increase active life expectancy by limiting the development and progression of chronic diseases and disabling conditions3 , 4 . in the decadesince the publication of the first edition of the american college of sports medicine ( acsm ) position stand entitled exercise and physical activity for older adults , a substantial body of evidence regarding the benefits of regular exercise and physical activity for older adults has been reported . in addition to new evidence regarding the importance of exercise and physical activity for healthy older adults , a growing body of knowledge supports the prescription of exercise and physical activity for older adults with chronic diseases and disabilities2 , 3 . motivation and compliance play significant roles in the success or failure of exercise programs for older adults5 , 6 . conducted a meta - analysis of 15 related studies , eight of which included attendance continuity data ; the mean attendance rate was 78.2 % of sessions , ranging from a median of 62 % in a community - based class program . also report that the frequency of exercise was most commonly 3 days per week ( 12 of 15 studies ) , with a frequency of twice per week in one study , and once per week in another7 . personal characteristics are the most important determining factor when designing an exercise plan for older adults . they identified biomedical status , past exercise participation , and education in order of decreasing priority as the most important factors for the initiation phase8 . another meta - analysis by trost et al . confirms the influence of several factors known to be correlates of sociodemographics that is social factors affecting physical activity , such as changes in marital status , obesity , smoking , lack of time , and past exercise behavior9 . in order to create an exercise program to which older adults will continuously adhere , health professionals must have a greater understanding of the determinants and factors that influence long - term exercise benefits and how healthcare practitioners can maximize those benefits for this age group . although adults aged 65 years and older gain substantial health benefits from regular physical activity , few studies have identified factors affecting the degree to which older adults benefit from exercise . therefore , this study determined the effects of age , participation , and gender on several parameters indicative of exercise benefits for older adults . this study was as a single - blind , prospective , community - based clinical study . the participants were recruited from among older adults living in the region of balova municipality in izmir , turkey . the address records of adults aged 65 years and older were obtained from the local administrations of each district of the balova municipality with the permission of the governorship . all subjects were visited at their given addresses and given information about the study . the inclusion criteria were as follows : between 65 and 90 years old , physically independent ( i.e. , able to walk 20 m without assistance or resting ) , no cognitive disorders or dementia , and at least 24 points ( for educated participants ) or 18 points ( for uneducated participants ) on the mini mental state assessment10 . older adults who were blind or deaf , were recovering from an acute illness , or had any cardiac problems such as resting angina , recurrent heart failure , recurrent and uncontrolled arrhythmia , and recent uncontrolled hypertension were excluded . a total of 3,939 older adults were visited at their homes and given information about this study . at these home visits ,673 older adults were recorded as volunteers . among them , 261 visited the clinic for pre - exercise assessment . owing to recent health status changes , 32 participants were excluded prior to assessment , resulting in 229 participants being assessed pre - exercise . from this group ,104 older adults participated in the 6 - month supervised group exercise program , and 93 of them came to the post - exercise assessment after completing the program . after the participants were informed about the assessments and 6 - month supervised group exercise program , demographic characteristics including age , gender , and chronic illness status were recorded . all assessments were conducted before and after the exercise program by the same physiotherapist . body mass index ( bmi , kg / m ) was calculated as a measure of body composition . the assessments used included the chair sit - and - reach test for lower - body flexibility , 8 - foot up - and - go test for functional mobility , and the 6 - minute walk test for aerobic endurance ; all assessments were performed as described in the senior fitness test by rikli and jones11 ,12,13 ; the intra - class reliability values for these test items were 0.89 ( 0.790.93 ) , 0.95 ( 0.920.97 ) , and 0.94 ( 0.900.96 ) , respectively14 . balance was assessed by measuring how long the participants could perform right and left one - legged standing and tandem standing ( up to 30 seconds , eyes open and closed ) . all tests were repeated three times , and the mean value ( in seconds ) was recorded for analysis15 , 16 . the reliability coefficients for one - legged standing for non - disabled and disables participants were 0.75 and 0.85 , respectively17 . the berg balance scale ( bbs ) was also used as the gold standard assessment of balance . the bbs includes tasks such as standing with eyes closed , reaching , standing on one foot , and picking up objects from the floor . retest reliability ( intraclass correlation coefficient = 0.91 ) and intra - rater reliability ( intraclass correlation coefficient = 0.97 ) among community - dwelling older adults18 as well as excellent correlation with the dynamic gait index ( r = 0.67 ) 19 . basal metabolic rate was determined by a body fat analyzer ( biodynamics b1a 310e bioimpedance analyzer , shoreline , wa , usa ) and recorded as kcal / day . bioimpedance analysis has been established as an appropriate method for estimating body composition in the elderly20 , 21 . the strength of the right shoulder flexors and knee extensors was measured by computer - based manual muscle testing ( tracker ii , jtech medical , salt lake city , ut , usa ) . the right arm was positioned with 90 shoulder flexion and the elbow in full extension to measure the strength of the shoulder flexors ; for lower - extremity strength measurement , the knee was kept at 30 flexion22 , 23 . reliable information can be obtained by raters using a portable manual muscle testing device if the examiners receive intensive training24 . position sense was assessed by using a goniometer for the right knee and an inclinometer ( dual inclinometer tracker ii , jtech medical , salt lake city , ut , usa ) for the lumbar region , available as part of the tracker system mentioned above . a knee flexion angle of 60 and 50 % of participants individual range of lumbar flexion motion were chosen as reference points for position sense assessment . the error between the angle that the participant reproduced and reference angles was recorded . the sequence of assessments was randomized for each participant , and 510 minutes rest was given between assessments . the supervised exercise program ( table 1table 1 . supervised exercise programwarm - up ( walking and flexibility exercises * ) 5 minutesposture exercises40 minuteshead flexion extension , lateral flexion , and rotationshoulder circumductionwand exercisespectoral muscles ** balance and coordination exercisesfeet together *** tandem standing *** one leg standing *** heel and toe rising *** weight shifting between right and left feet , between toes and heels , and combination of both directionsrhythmic anterior posterior lateral steppinganterior posterior lateral stepping and weight shiftingwhile standing with feet together , reaching out anteriorly and laterallyclapping hands while stepping forward with alternating left and right footalternating between reciprocal shoulder flexion and abductionstrengthening exercises ( theraband / free weights ) *** sitting positionabdominal strengthening knee extension bicep curlshoulder flexionabduction external rotation ( pnf pattern ) standing positionhip abduction , extension , flexion , and adductionfunctional activitiesmini squatstepping upcool - down ( slow walking and flexibility exercises * ) 5 minutesresting when necessary10 minutestotal60 minutes * shoulder and trunk flexibility , gastrocnemius and quadriceps stretching , and hip adductor and hamstring stretching in the sitting position . * * beginning with arms in the reverse t position , the arms are closed ; the arms are then moved together by putting the forearms together in front of the head until they touch and then opened again . * * * progression : eyes open to eyes closed , fixed head - to - head rotation . ** * * progression : 6 repetitions of 2 sets to 10 repetitions of 3 sets with 10 seconds of rest between each repetition and 1 minute of rest between sets . ) was led by the same physiotherapist for 2 days per week over 6 months . the exercise program included strengthening exercises in sitting and standing positions as well as posture , balance , coordination , and functional activities . the same exercise program was applied to all participants , although there were some individual differences such as the resistance strength of the theraband or the size of the free weights used . group exercise sessions were held in the gymnasium facility of balova municipality , and the municipality s service buses provided transportation for participants . * shoulder and trunk flexibility , gastrocnemius and quadriceps stretching , and hip adductor and hamstring stretching in the sitting position . * * beginning with arms in the reverse t position , the arms are closed ; the arms are then moved together by putting the forearms together in front of the head until they touch and then opened again . * * * progression : eyes open to eyes closed , fixed head - to - head rotation . * * * * progression : 6 repetitions of 2 sets to 10 repetitions of 3 sets with 10 seconds of rest between each repetition and 1 minute of rest between sets . continuous dependent variables were evaluated for normality by using the kolmogorov - smirnov test with a lilliefors significance correction . the arithmetic mean ( x ) and standard error ( se ) were used for the data analysis . other demographic characteristics are presented as numbers and percentages . repeated - measures anova ( 32 ) was performed with gender , age , and exercise participation as dependent inter - subject factors and independent time of measurement ( pre - / post - exercise ) as the intra - subject factor . the mean values of age and exercise participation were calculated in order to categorize these variables for inclusion in the analysis . participants were categorized as young - old ( 6569 years old ) or old - old ( 70 years ) and higher participated ( 29.88 sessions ) or ( 29.88 sessions ) according to the mean number of sessions that the overall study sample participated in ( 29.881.29 sessions ) . significant main effects and interactions were determined at an level of 0.05 for all ach analyses . continuous dependent variables were evaluated for normality by using the kolmogorov - smirnov test with a lilliefors significance correction . the arithmetic mean ( x ) and standard error ( se ) were used for the data analysis . other demographic characteristics are presented as numbers and percentages . repeated - measures anova ( 32 ) was performed with gender , age , and exercise participation as dependent inter - subject factors and independent time of measurement ( pre - / post - exercise ) as the intra - subject factor . the mean values of age and exercise participation were calculated in order to categorize these variables for inclusion in the analysis . participants were categorized as young - old ( 6569 years old ) or old - old ( 70 years ) and higher participated ( 29.88 sessions ) or ( 29.88 sessions ) according to the mean number of sessions that the overall study sample participated in ( 29.881.29 sessions ) . significant main effects and interactions were determined at an level of 0.05 for all ach analyses . data from 85 participants ( 37 women and 48 men ) were used for analysis . their mean age was 690.44 years ( range : 6584 years ) . the participants characteristics are summarized in table 2table 2 . participants demographic characteristicsn % age ( years ) genderfemale ( n ) 3743.5 male ( n ) 4856.5 chronic health problems ( n ) ( musculoskeletal , cardiovascular , respiratory , diabetes mellitus , digestive system , renal bladder and urinary system , neurological , mental or emotional , hematologic , ocular ) 01214.111517.622023.532124.741720.0 . the participants participated in a mean of 29.881.29 exercise sessions ( 57 % ; range : 552 sessions ) in 6 months . table 3table 3 . parameters before and after exercise shows the outcomes before and immediately after the 6 - month supervised group exercise program . measures of flexibility , balance , functional mobility , position sense , and strength pre - and post - intervention showed a significant main effect for time ( p 0.05 ) ( table 3 ) , whereas the pre - / post - intervention comparison of 6 - minute walking distance , bmi , and metabolic rate did not show significant main effects ( p 0.05 ) . there were significant associations between gender and right shoulder flexion strength ( f = 17.02 , p = 0.000 ) and knee extension strength ( f = 12.66 , p = 0.001 ) . the main effect of age interaction was not significant for any measurement ( p 0.05 ) . there was no effect of age ( i.e. , young - old vs. old - old ) on exercise benefits . the main effect of participation interaction was non - significant for all parameters ( p 0.05 ) . there was no significant interaction between age and gender for flexibility , balance , functional mobility , position sense , or measures of strength ( p 0.05 ) . there was a significant interaction between gender and participation for pre - / post - intervention measures of functional mobility ( f = 4.10 , p = 0.046 ) . higher participated males showed greater improvement in functional mobility than higher participated females . there was a significant interaction between age and participation for flexibility ( f = 4.37 , p = 0.040 ) . higher - participated old - old in comparison to lower - participated young - old group showed greater improvements in flexibility . the interactions among participation , age , and gender were non - significant for flexibility , balance , functional mobility , or measures of position sense or strength ( p 0.05 ) . the 6 - minute walking test , bmi , and metabolic rate did not show a significant main effect of time , exercise participation , age , gender , or any of the other interactions ( p 0.05 ) ( table 4 table 4 . age , gender , and participation interaction for pre - and post - exercise measurements ) . community - based physical activity programs are effective for significantly improving performance measures including strength , flexibility , and balance among others4 , 7 , 29,30,31 . the influences of general factors and personal characteristics on exercise behavior and participation have been studied mostly in the elderly population5 , 8 , 32,33,34 . however , the most appropriate exercise program structure ( i.e. , number of sessions , duration , etc . ) and factors that may affect the benefits of exercise in older adults have not been established . therefore , this study aimed to determine the effects of age , gender , and participation on the benefits of a 6 - month supervised exercise program for older adults . eighty - five community - dwelling older adults were evaluated before and after the 6 - month supervised exercise program . the participants participated in 57 % of the sessions ( mean : 29.881.29 sessions , range : 552 sessions ) . after 6 months of exercise , there were significant improvements in flexibility , balance , functional mobility , position sense , and strength . however , there were no improvements in the 6 - minute walking distance , bmi , or metabolic rate . it is well known that bmi , metabolic rate , and aerobic capacity can be affected by nutrition and aerobic activity ; however , our intervention included neither . in addition , in their meta - analysis , baker et al . concluded that multi - modal exercise programs , even those including aerobic exercise , may not result in a significant increase in 6 - minute walking distance7 . these two facts may explain the lack of statistically significant improvements in bmi , metabolic rate , and 6 - minute walking distance in the present study . in this studysimilarly , in a study by beneka et al . , males demonstrated greater improvement of knee extension power than females35 . this demonstrates that there is a gender - strength interaction and that strength improvement in older males is greater than that in older females after exercise intervention . in addition , the greatest improvement in functional mobility was observed in males with higher exercise participation , whereas males who participated less showed no change or a slight decrease . the greatest improvement in flexibility was observed in young - old adults even in those who participated less and old - old adults with higher participation in the exercise program . this may be attributable to a lower baseline level of flexibility in the young - old who participated less and the old - old who participated more than that in the young - old who participated more and the old - old who participated less . it is likely that the participants initial level of flexibility also had an important effect on the benefits of exercise . in addition , it can be speculated that the old - old elderly may improve their flexibility with greater participation in the exercise program , whereas the young - old elderly benefit from the exercise program regardless of participation . the main effect of age alone was non - significant for all parameters in the present study ; the young - old and old - old elderly showed similar improvements . similarly , in a community - based elderly study by toraman and sahin , exercise induced significant increases in all functional fitness tests ( i.e. , chair sit - and - reach , arm curls , chair stand , and 6 - minute walk test scores ) in both the younger and older elderly groups ; the rate of restoration of function was approximately equivalent in both groups as well36 . report that older age and female gender do not seem to negatively affect functional balance from a high - intensity functional weight - bearing exercise program37 . they conclude that regardless of gender or age , older adults can benefit from exercise intervention and they need encouragement to attend any activity . similarly , our results show that the age - gender interaction did not affect balance , functional mobility , or position sense . hence , regardless of age or gender , elderly people may benefit from participating in an exercise program . the main effect of participation alone was non - significant on the parameters that improved significantly ; older adults showed similar improvements in all parameters regardless of participation . report that a simple exercise program for older adults under the instruction of a physiotherapist provides improvements in the functional reach test and balance tests regardless of participation38 . participating in a regular exercise program improves older adults health profile , even with lower participation rates . in other words , any kind of activity or exercise participation can result in some improvements in older adults ; therefore , encouraging elderly people to perform any activity or exercise is vital , because interventions , especially those aiming to promote participation , also improve social integration and quality of life as reported by kim et al39 . one of the strengths of this study is that all participants lived in the same region of a municipality in izmir , turkey and therefore had similar socioeconomic status . although pre - and post - exercise assessments were performed in different seasons because of the duration of the exercise program , they were performed in the same closed environmental conditions . furthermore , with a duration of 6 months , the community - based supervised exercise program used in this study is one of the longest reported in the literature . although the region selected for this study has a large population of older adults , the number of older adults analyzed was much less than expected because of the drop outs and missing data . willingness to participate in the study was limited even though the municipality provided transportation to participants as needed . therefore , the results of this study are limited by the small sample size . in conclusion , first , old - old elderly should be encouraged to participate in exercise programs in order to improve flexibility . muscle strength improves after suitable exercise in both genders , although the improvement is greater in males than females . although older males showed improvements in functional mobility , their functional mobility was worse than that in older females ; therefore , males should participate more in exercise programs to improve their functional mobility . hence , a 6 - month supervised exercise program involving posture , strengthening , balance , and coordination exercises and functional activities can improve strength , flexibility , balance , functional mobility , and position sense in community - living older adults regardless of gender , age , or participation ; however , they may not see improvements in bmi , aerobic capacity , or metabolic rate . the same design as that used herein could be applied to a larger sample performing an unsupervised home exercise program . measurements could be repeated at the beginning , mid - point , and end of the exercise program in order to determine the long - term effects of age , gender , and participation on the benefits of a 6 - month supervised exercise program in older adults .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] this study determined the effects of age , gender , and participation on the benefits of a 6 - month supervised exercise program on older adults . [ subjects and methods ] eighty - five ( 37 women , 48 men ) community - dwelling older adults participated . the chair sit - and - reach test , the 8 - foot up - and - go test , the 6 - minute walk test , the berg balance scale , lower - body flexibility , dynamic balance , aerobic endurance , balance , metabolic rate , muscle strength , and position sense were evaluated . repeated - measures of analysis of variance was performed including dependent variables of age , gender , and participation in the exercise program as dependent inter - subject factors and time of assessment as an intra - subject factor . [ results ] mean exercise participation was 29.88 1.29 sessions . flexibility , balance , position sense , and strength showed a significant main effect of time . there was a significant gender interaction for right shoulder flexion strength and knee extension strength , a significant gender - participation interaction for pre - / post - intervention measures of functional mobility , and a significant age - participation interaction for flexibility . [ conclusion ] exercise training improved outcomes after 6 months of supervised exercise , but the changes were similar regardless of participation level . changes in strength were more pronounced in men than women ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: toll - like receptors ( tlrs ) are type i transmembrane receptors that are expressed on the cell membrane and are critical for the induction of downstream signals during innate immune responses to bacterial components . tlr4 is expressed in many cells , including endothelial cells , keratinocytes , epithelial cells , macrophages , neutrophils , and dendritic cells . previous evidences demonstrated that platelet tlr4 expression modulates lipopolysaccharide - ( lps - ) stimulated platelet aggregation and tumor necrosis factor - alpha ( tnf - ) production . in addition , circulating platelet counts decrease precipitously during sepsis and the degree of thrombocytopenia associates with the serious consequence of sepsis . furthermore , platelet counts decreased under sepsis because of well - established migration into the liver and lungs . demonstrated that platelet tlr4 is essential for platelet migration into the lungs in mice with lps - induced sepsis . lps accelerates collagen - or thrombin - induced aggregation in platelets in in vitro study ; this acceleration is associated with expression of tlr4 . it has been reported that the function of platelet tlr4 is to activate neutrophil extracellular traps in septic blood , and histones may promote the generation of thrombin via platelet tlr4 . thus , scientists proposed that platelet tlr4 has important roles in platelet migration , adhesion , destruction , and attraction . although the evidence indicates that tlr4 not only regulates platelet migration and shape change but also indirectly affects their aggregation , it remains to be explored whether tlr4 expression directly affects platelet aggregation and blood coagulation . previous studies demonstrated that the level of tlr4 expression on cells is associated with the early outcome of patients undergoing major surgery . in 2002 , dybdahl et al . demonstrated that open heart surgery induces an inflammatory response and the release of heat - shock protein 70 via tlr4 signalingrecently , our group demonstrated that the level of tlr4 expression on monocytes is associated with early outcomes in coronary artery bypass graft ( cabg ) surgery patients . it remains unclear whether the platelets regulate both blood coagulation and systemic inflammation in surgery and the expression of tlr4 on platelets is affected by the type of cardiac surgery , which may be associated with a patient 's early outcome in hospital . cabg with conventional cardiopulmonary bypass ( cpb ) is widely used in cardiovascular surgery . although stopping the heart and temporarily replacing its function with the heart - lung machine has associated risks , conventional cpb permits surgeons to perform coronary revascularization on a still , bloodless heart . however , evidence suggests that platelet count , aggregation , and shape change significantly decreased after conventional cpb . platelet activation and platelet injury are well - recognized phenomena occurring after cardiac surgery with cpb that may contribute to pathological postoperative bleeding and systemic oxidative stress / inflammation . to control the systemic oxidative stress and inflammatory responses as well as decrease the occurrence of postoperative complications , cardiac surgeons have devoted their efforts to developing various surgical processes , such as the off - pump technique or beating - heart cpb technique for coronary surgery . although the previous literatures indicated that off - pump technique has become an established and feasible procedure and offers a great benefit in cabg patients , the other studies also hold contrary opinion . regardless of the technique of coronary surgery , clarifying the actual molecular mechanisms of impact of the platelet function is the only way to promote the patients ' outcomes . it is well known that calpain plays important roles in the physiological activation of platelets . calpain activation regulates snares ( proteins involved in the degranulation of platelets ) and serca - 2 ( an intracellular pump required for ca signaling in platelets ) . previous evidences demonstrated that cardiac surgery induces oxidative stress , and oxidative stress may inhibit calpain activity . based on our evidence , the calpain - myosin 9 - rab7b axis is responsible for the regulation of tlr4 in activated platelets , which is involved in platelets function . therefore , we evaluated the platelet tlr4 expression in patients who underwent cabg surgery with conventional cpb or off - pump technique and analyzed the correlation between platelet calpain activation , tlr4 expression , and drainage loss in hospital . additionally , in order to confirm the critical role of tlr4 on platelets function , we analyzed the coagulation in c57bl / 6 and c57bl / 6 - tlr mice . this study was approved by the ethics committee at tri - service general hospital . written informed consent was obtained from 23 patients undergoing elective cabg surgery . the patients were assigned to the off - pump technique and conventional cardiopulmonary bypass ( cpb ) groups . cpb and off - pump technique was used in 17 and 6 patients , respectively . patients would not be included if they experienced a decreased cardiac ejection fraction ( low than 50 % ) , had undergone cardiac surgery , had a history of cardiogenic shock , had used extracorporeal membrane oxygenation ( ecmo ) , received an intra - aortic balloon pump ( iabp ) , or placed on a ventilator before surgery . additionally , patients with chronic bronchitis , autoimmune diseases , cancer , asthma , or rheumatoid arthritis or who were receiving anti - inflammatory drugs administration were excluded . the blood pressure was monitored using an arterial catheter . upon discontinuation of the cpb circuit or completion of proximal anastomoses , the blood samples were collected at two time points : ( 1 ) preincision and ( 2 ) at the end of the operation . whole blood samples were collected from all patients at the indicated time points and analyzed immediately . fluorescein isothiocyanate - ( fitc - ) conjugated mouse anti - human cd41a antibodies ( becton dickinson , san jose , ca , usa ) and phycoerythrin - ( pe - ) conjugated monoclonal mouse anti - human tlr4 antibodies ( clone : hta125 ; biolegend , san diego , ca , usa ) were added to 50 l whole blood and incubated in the dark for 20 min . the cd41a - positive cells were separated and detected using a bd facscanto ii flow cytometer ( bd biosciences , mountain view , ca , usa ) with bd facsdiva software ( becton dickinson immunocytometry systems , san jose , ca , usa ) . a total of 310 cd41a - positive cells were gated for the analysis of membrane tlr4 expression . western blot analysis was performed using 50 g samples of protein to evaluate calpain - 1 expression . the protein was electrophoretically transferred to polyvinylidene difluoride membrane and then blocked with 5 % milk in tris - buffered saline solution ( 20 mm tris - hcl ph 7.5 , 138 mm nacl , and 0.2 % np - 40 ) containing 0.2 % tween - 20 . the membranes were probed using monoclonal rabbit anti - human calpain antibody ( clone : hpr3319 ; epitomics co. , burlingame , ca , usa ) , incubated with horseradishperoxidase - conjugated anti - rabbit igg ( amersham , arlington heights , il , usa ) , and developed using the enzyme - linked chemiluminescence detection reagents ( millipore , bedford , mass . - actin was used as a loading control ; the monoclonal mouse anti - human - actin antibody ( clone : actn05 / c4 ) was obtained from genetex co. ( irvine , ca , usa ) . six male c57bl / b6 mice were purchased from biolasco co. , ltd . , ( yi - lan , taiwan ) . six male c57bl / 6 - tlr mice ( a tlr4 - knockout mouse homozygous for the defective lps - response deletion allele tlr4 ) were purchased from the jackson laboratory ( jax , 003752 , bar harbor , me , usa ) . this study was carried out in strict accordance with the recommendations in the guide for the care and use of laboratory animals of the national institutes of health ( nih publication number 85 - 23 , revised 1996 ) . the protocol was approved by the committee on the ethics of animal experiments of the taipei medical university ( permit number : lac - 100 - 0056 ) . all mice were kept in microisolator cages on a 12 - h day / night cycle and fed a commercial mouse chow diet ( scientific diet services , essex , uk ) with water ad libitum . the blood samples for biochemical measurements were collected without sedation from the mandibular artery in sodium citrate - containing tubes and separated by centrifugation . whole blood was collected from the mice through cheek - pouch bleeds and anticoagulated with 3.8 % sodium citrate . platelet - rich plasma ( prp ) was obtained from the collected blood by centrifugation at 280 g for 8 min . the prp was gently transferred to a fresh tube , and the centrifugation was repeated at 280 g for 4 min . the platelets were isolated by filtering the resulting prp through a sepharose 2b column ( sigma - aldrich , st . the washed platelets were counted using an automated blood cell counter kx - 21n ( sysmex , kobe , japan ) . platelet aggregation was performed using the turbidimetric method with a chrono - log model 560 - ca dual sample lumi - ionize calcium aggregometer ( chrono - log , havertown , pa , usa ) . approximately 500 l of a washed platelet solution containing 310 platelets / l in ca - free tyrode 's buffer was added to a silicon - treated glass cuvette for each experiment . platelet aggregation was measured for 5 minutes following the addition of 0.1 u / ml thrombin . the percent aggregation was calculated using aggro / link software ( chrono - log , havertown , pa , usa ) . all buffers were prewarmed before use and platelets were kept warm at 37c all along the study . in accordance with previous studies , two rotem analyses were performed within minutes after the sample was collected , as indicated by the manufacturer 's instructions ( pentapharm , munich , germany ) . we performed both an extrinsically activated assay using recombinant tissue factor ( extem ) and an extrinsically activated test using recombinant tissue factor with cytochalasin d added ( fibtem ) . the following parameters were measured using rotem : clotting time ( ct , the time from the start of the assay to clot formation with an amplitude of 2 mm ) , clot formation time ( cft , the time from the end of ct ( amplitude of 2 mm ) to a clot firmness of 20 mm ) , maximum clot firmness ( mcf , the peak strength of the clot ) , and maximum clot elasticity ( mce , which is commonly used to assess clot strength ) . the platelet component of clot strength was calculated using the following equation : mcfplatelet = mcfextem mcffibtem , mceplatelet = mceextem mcefibtem , and mce = ( mcf 100 ) / 100 mcf . statistical comparisons between groups were computed using student 's t - tests and one - way anova followed by the dunnett 's test . for all statistical evaluations , differences in data with p values of 0.05 all analyses were performed using the spss 16 statistical package ( spss inc . , chicago , il , usa ) . the preoperative characteristics of the two groups were similar , including in age , body weight , height , hypertension , hypercholesterolemia , and peripheral vascular disease . the percentages of ef in the conventional cpb and off - pump technique groups were 59.79.2 % and 63.58.3 % , respectively . none of the patients in the off - pump group had diabetes mellitus or peripheral vascular disease . in addition , no patient who underwent elective cabg with conventional cpb had previously experienced stroke or myocardial infarction . for patients in the cpb group , the mean total cpb time was 119.112.4 min , the aortic clamping ( ischemia ) time was 65.65.2 min , and the minimal esophageal temperature was maintained at 26.10.4 c . additionally , the patients in the conventional cpb group received 30476.21708.0 units of heparin . the patients who underwent the off - pump technique maintained a minimal esophageal temperature of 35.80.3 c and were administered 28142.94532.6 units of heparin . there were no significant differences in the number of grafts or amount of heparin used between the two groups . the percentages of circulating lymphocytes , monocytes , basophils , and neutrophils were not significantly different between the conventional cpb and off - pump technique groups before surgery . the percentages of neutrophil numbers increased significantly in both the conventional cpb group ( from a basal level of 60.99.2 % to 85.93.6 % ) and the off - pump technique group ( from a basal level of 64.78.0 % to 86.24.3 % ) . the number of lymphocytes decreased significantly after coronary surgery with conventional cpb ( from a basal level of 28.39.2 % to 7.53.2 % , resp . ) and with the off - pump technique ( from a basal level of 26.17.7 % to 6.82.7 % , resp . ) . the eosinophils , basophils , and monocytes did not significantly differ between the two groups after surgery . biochemical analyses indicated that liver function ( levels of glutamate oxaloacetate transaminase , ast , and glutamic pyruvic transaminase , alt ) , kidney function ( levels of blood urea nitrogen , bun , and creatinine ) , and inflammation ( level of c - reactive protein , crp ) indices did not deteriorate after cardiac surgery . patients who underwent conventional cpb exhibited higher levels of troponin i after surgery , compared with the off - pump technique group . however , the mean value of creatine kinase - mb isoform ( ck - mb ) was not significantly different between the conventional cpb and off - pump technique groups . washed platelets were isolated from all patients . flow cytometry was performed to analyze the tlr4 expression , and western blot analysis was used to analyze the calpain activity . table 4 indicates that patients in the conventional cpb group possessed lower tlr4 expression ( cpb : 68.485.64 % of preincision versus off - pump technique : 89.04.8 % of preincision , p 0.05 ) , less drainage loss ( cpb : 68.55.6 % of preincision versus off - pump technique : 89.04.8 % of preincision , p 0.001 ) , and higher prbc transfusion volume ( cpb : 5.50.5 units versus off - pump technique : 1.11.1 units , p = 0.001 ) compared with the off - pump technique group . the platelet transfusion volume , duration of icu stay , and duration of fever were not significantly different between the conventional cpb and off - pump technique groups after cabg surgery . according to our recent results , tlr4 expression on platelets is mediated by the activity of calpain . figure 1 shows the calpain activity in all patients before and after the cabg surgery was performed . in general , inactivated calpain appears as a 80 kda of single band ; in contrast , calpain has a higher mobility 78 kda band resulted from autolysis under activated situation , which is believed to be the more active form of calpain . before cabg surgery , all patients in both the off - pump technique and conventional cpb groups expressed active calpain . while undergoing cabg surgery , all patients in the off - pump technique group continued to express active calpain . in contrast , 76.47 % of patients ( patient numbers 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 10 , 11 , 13 , 15 , and 17 ) in the conventional cpb group expressed inactive calpain after cabg surgery . additionally , the ratio of platelets tlr4 expression after surgery was demonstrated in figure 1 . combined with the data of tr4 expression and calpain expression ( figure 1 ) , the information shown in table 5 indicates that patients in the conventional cpb group with active calpain possessed higher levels of tlr4 on platelets , less drainage loss , lower platelet transfusion volumes , shorter icu stay durations , and shorter fever duration after cabg surgery ( g1 versus g2 , p 0.05 were considered statistically significant ) . although the calpain remained in an active state , the amounts of platelet transfusion were reduced in the off - pump technique group compared with the conventional cpb group ( g1 versus g3 , p 0.05 , considered statistically significant ) . interestingly , compared with patients who underwent the off - pump technique , the patients possessed a lower level of tlr4 , higher volumes of drainage loss , and prbc / platelet transfusion as well as longer icu stay duration and shorter fever duration in the conventional cpb group with inactive calpain ( g2 versus g3 , p 0.05 , considered statistically significant ) . these results indicate that in cabg surgery with either off - pump technique or conventional cpb , patients with higher level of tlr4 may experience better early outcomes ( duration of icu stay and fever , volume of drainage loss , and prbc / platelet transfusion ) in hospital than the patients with lower level of tlr4 , which may be mediated by activation of calpain on platelets . a previous study demonstrated that platelet tlr4 modulates coagulation by recognizing extracellular histones that promote thrombin generation . additionally , tables 15 indicate that calpain and tlr4 expression in platelets are associated with patients ' drainage loss in cardiac surgery . therefore , we further explored whether the tlr4 on platelets is associated with coagulation in mice . the wild - type c57bl / 6 , c57bl / 6 - tlr , and c57bl / 6 - tlr mice were used in this study . the endogenous level of tlr4 expression in the mouse plateletswas first measured using western blot analysis and flow cytometry ( figure 2 ( a ) ) . incubating wild - type c57bl / 6 mouse platelets with 0.1 u / ml thrombin resulted in approximately 47.45.4 % aggregation within 10 minutes , whereas treating platelets with pbs did not induce aggregation ( figure 2 ( b ) ) . interestingly , platelets from c57bl / 6 - tlr or c57bl / 6 - tlr mice had reduced aggregation abilities after thrombin stimulation compared with those from wild - type mice ( 28.13.7 % for c57bl / 6 - tlr and 18.52.5 % for c57bl / 6 - tlr ) . in recent years , rotem has been used to provide a comprehensive overview of the entire clotting process by measuring the coagulation function of platelets . an extrinsically activated assay using recombinant tissue factor ( extem ) indicated no significant differences in the coagulation time or clot formation time between c57bl / 6 , c57bl / 6 - tlr , and c57bl / 6 - tlr mice . the amplitude at 5 to 30 minutes and mcf were significantly lower in c57bl / 6 - tlr compared with c57bl / 6 ( table 6 ) . an extrinsically activated test using recombinant tissue factor plus cytochalasin d ( fibtem ) demonstrated that c57bl / 6 - tlr mice have a lower coagulation time , lower amplitude at 15 to 30 minutes , and lower mcf than c57bl / 6 mice ( table 7 ) . according to a previous report , mcf and mce are commonly used to assess the platelet component of clot strength . table 8 demonstrates that both c57bl / 6 - tlr and c57bl / 6 - tlr mice have significantly lower mcfs ( 48.803.27 mm and 48.503.00 mm , resp . ) and mces ( 190.8920.79 mm and 218.3719.54 mm , resp . ) than c57bl / 6 mice ( mcf : 58.804.67 mm ; mce : 290.8510.99 mm ) . these results suggest that platelet tlr4 is associated with aggregation and clot strength in c57bl / 6 mice . tlr4 plays important role in platelet migration , adhesion , destruction , and attraction . in 2005 , andonegui et al . first determined that platelets express tlr4 on their surfaces and that this phenomenon is associated with the occurrence of thrombocytopenia , indicating that the tlr4 - mediated signaling pathway is involved in the cellular function of platelets . additionally , platelets may respond to endotoxin and ensnare bacteria through tlr4 to activate neutrophil extracellular traps , promote migration into the lung or liver , and decrease the production of rantes , angiogenin , and pdgf - ab from platelets in severe septic blood . although previous investigators demonstrated that platelets regulate inflammation via tlr4 surface expression , few studies investigated the relationship between platelet tlr4 and coagulation . explored adp - induced heat shock protein ( hsp ) 27 secretion and phosphorylation from granules in platelets , which mediates platelet aggregation . moreoverinterestingly , lps did not increase human platelet aggregation in vitro ; nevertheless , lps accelerates the collagen / thrombin - stimulated aggregation of platelets . this mechanism was mediated by tlr4 expression on platelets , and the effect of lps on platelets was indirect . in addition to tlr4 , platelets also express downstream components of the tlr4 - related signaling pathway complex , including tlr4 / md2 and myeloid differentiation primary response gene ( myd ) 88 . through the production of interleukin - ( il - ) 6 , prostaglandin e2 , and tumor necrosis factor ( tnf ) - , lps induces platelet aggregation mediated by tlr4 / md2 / myd88 complex formation , mitogen - activated protein kinases ( mapks ) , nuclear factor - kappa b ( nf - b ) activation , and cgmp production . although many reports speculated that tlr4 affects platelet aggregation and regulates platelet function , we are the first group to indicate that the calpain - myosin 9 - rab7b axis is liable to the regulation of tlr4 - containing - granule trafficking in thrombin - induced platelets . furthermore , we demonstrated the differences of platelet function in c57bl / 6 , c57bl / 6 - tlr , and c57bl / 6 - tlr mice in this text , indicating the critical roles of tlr4 in platelets . we speculate that the probable mechanisms of the impact of tlr4 on clot strength in animal experiments may be mediated by hsp27 or others , and we are currently investigating the cellular and molecular mechanisms involved in this phenomena . in clinic , patients who underwent cabg surgery with inactive calpain and lower platelet tlr4 expression experienced worse early outcomes in hospital than those with active calpain and higher platelet tlr4 expression . these results indicate that the levels of tlr4 and calpain play pivotal roles in platelets function . oxidative stress - mediated cytokines production was considered to be the main factor causing inflammation after cardiac surgery . the expression of many cytokines , including tnf - , il - 6 , and monocyte chemotactic protein - ( mcp - ) 1 , increased during and after cpb . except for cytokine production , stimulations such as aortic - clamping ischemia , ischemia - reperfusion injury , blood cell attachment to the foreign surfaces of the oxygenator / cpb tube , and artificial surgical trauma may play important roles in postoperative inflammation ; therefore , off - pump bypass graft operation significantly reduces oxidative stress and inflammation . although clinicians still have differences of opinion on the advantages / disadvantages of the off - pump technique and conventional cpb for patients who undergo cardiac surgery , at least , the patients in both the conventional cpb and off - pump groups had good early outcomes ( little drainage loss , short icu stay , and fever durations ) in hospital as long as they expressed the active form of calpain after cabg surgery rather than the inactive form of calpain . this indeed indicates that maintaining active calpain is an important factor in patient recovery after cardiac surgery . in contrast , the patients with active calpain in the conventional cpb group still required larger blood transfusion volumes than the patients in the off - pump technique group , which may result from the cessation of pumping blood cells . recently , we also undertook to distinguish the influences of foreign surface contamination by the cpb tube and oxygenator , surgical incisive trauma , and cardiac ischemia by comparing cytokine production and early outcome during conventional cpb technique and the off - pump technique in patients . however , cpb - associated immune suppression results from the changes in tlr4 capacity on monocytes and neutrophils . it is still remained to be elucidated that the causes result in tlr4 downregulation in platelets . during the process of cardiac surgery with cpb , mechanical force ( pressure from rolling pump ) therefore , the transfusion of prbc and fresh platelet is essential for the patients who are undergoing cpb . according to the results in table 5 , patients with cpb really receipted more transfusion of prbc and platelet comparing to patients in off - pump technique group . interestingly , patients with activated calpain in cpb group had similar level of early outcomes and platelet tlr4 expression to the patients in off - pump technique group . in contrast , even though the patients with inactivated calpain in cpb group receipted more platelet and prbc transfusion , they also had worse early outcomes comparing to patients with activated calpain . therefore , we can not exclude the importance and effects of blood transfusion for patients with cardiac surgery in this study , and we still have the opinion that the calpain activation and tlr4 expression in platelets are associated with early outcomes . hyperglycemia and diabetes mellitus really induce oxidative stress which result in complex complications in many sickle situations . the major finding of the previous study is that diabetes mellitus is associated with the activation of calpain . however , the opposite evidence demonstrated that cardiac surgery induces oxidative stress , and oxidative stress may inhibit calpain activity . in our results , mellitus patients ( patient numbers 3 , 5 , and 10 ) also have inactive form of calpain after cpb . although diabetes mellitus may be associated with patient 's postsurgical outcomes , we also speculate that diabetes mellitus may not be a factor in regulation of platelets calpain activity in cpb . calpain is responsible for platelet shape change , clotting , and aggregation , which are mediated by the activation of cytoskeleton proteins . previous report demonstrated calpain with the important roles in regulating cytoskeletal signaling in vwf - activated platelets . calpain also regulates the activation of the extracellular fibrinogen - binding function of iib3 and the platelet aggregation resulting in cleavage of integrin 3 . platelet - derived growth factor may suppress oxidative stress induced calpain activation in neurons . presently , the causes of inactive calpain in the majority of patients ( 82.35 % ) treated with conventional cpb are unknown ; it is also unclear why 17.64 % of the patients undergo calpain activation . there are many proteases with critical roles in the stability and assembly of cytoskeletal signaling complexes that may result in the phosphorylation of proteins , association of the receptor with the cytoskeleton , and a consequent increase in the calpain activity . whether the pressure force of pumping , aortic - clamping ischemia , ischemia - reperfusion injury , or attachment of the foreign cpb circuit during conventional cpb disrupts these normal conditions in platelets remains to be elucidated . through further studies , we expect that patients ' early outcomes may be improved and promoted by adjusting the activation of calpain in platelets after cardiac surgery with conventional cpb . our results highlight the important roles of tlr4 in blood coagulation and platelet function in clinic and in c57bl / 6 mouse . of clinical relevance , we also explored novel roles for calpain and tlr4 in platelets , which are associated with patients ' early outcomes in cardiac surgery . these results also provide a basis for further controlling calpain activation and tlr4 expression as a therapeutic strategy to avoid coagulopathic and thrombocytic disorders after cardiac surgery .\noutput:\n" }, { "from": "agent", "value": "human platelets express toll - like receptors ( tlr ) 4 . however , the mechanism by which tlr4 directly affects platelet aggregation and blood coagulation remains to be explored . therefore , in this study , we evaluated the platelet tlr4 expression in patients who underwent cabg surgery ; we explored the correlation between platelet tlr4 expression and the early outcomes in hospital of patients . additionally , c57bl / 6 and c57bl / 6 - tlrlps / mice were used to explore the roles of platelet tlr4 in coagulation by platelet aggregometry and rotation thromboelastometry . in conclusion , our results highlight the important roles of tlr4 in blood coagulation and platelet function . of clinical relevance , we also explored novel roles for platelet tlr4 that are associated with early outcomes in cardiac surgery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: globally , respiratory syncytial virus ( rsv ) is a major cause of hospital admission in infants 1 year of age . mortality data demonstrate that rsv kills more infants in this age group than any other single pathogen with the exception of malaria . environmental factors and individual characteristics carrying increased risk of rsv - associated acute respiratory tract infections include low birth weight , being a member of a multiple birth , smoking during pregnancy , having siblings , day care attendance ( or sibling attendance ) , living in a crowded household , low parental education , second - hand smoke exposure , history of atopy and lack of breastfeeding . certain high - risk groups including premature infants , infants with bronchopulmonary dysplasia ( more commonly referred to as chronic lung disease of prematurity ) and those with congenital heart disease are particularly vulnerable to severe rsv disease . rsv is more likely to progress to the lower respiratory tract and cause more serious disease in these high - risk children compared with otherwise healthy term children . furthermore , the course of illness tends to be more severe in these children versus otherwise healthy term children , and is associated with higher rates of hospitalization , intensive care unit admission , mechanical ventilation and death . the rsv burden of disease is relatively well characterized in western europe ; however , there are limited epidemiologic data available for central and eastern europe ( cee ) and the developing world . mortality data are especially difficult to ascertain as the majority of children in developing countries die outside of the hospital setting . characterization of children with severe rsv disease is critically important to inform health care authorities to target interventions that maximize population health . the present study aimed to characterize rsv disease incidence and severity among premature and term children in cee . we evaluated the severity of rsv - associated lower respiratory tract infection ( lrti ) disease in children 1 year of age during the 20092010 and 20102011 rsv seasons and investigated the influence of gestational age ( ga ) on the treatment , complications and outcomes of rsv lrti hospitalization . this retrospective , epidemiologic , cohort survey included children 1 year of age hospitalized with an lrti during the periods october 2009 to april 2010 and october 2010 to april 2011 . patients were hospitalized in the pediatric intensive care units and pediatrics wards of general , university , pediatric or other types of hospitals at 48 study sites across 12 cee countries ( estonia , lithuania , hungary , slovenia , croatia , serbia , bosnia / herzegovina , bulgaria , czech republic , slovakia , romania , and ukraine ) . data collection was performed on day of hospital discharge or during first checkup visit after lrti hospitalization . the study was conducted in compliance with any applicable national or institutional ethical and / or regulatory requirements . all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1964 . local law requirements for monitoring , notification / submission of an epidemiologic survey to the responsible ethics committee and / or regulatory body were followed , and ethical approval was obtained in the participating countries according to national legislation . the patient s parent , guardian or legal representative provided oral / written authorization to the investigator to use and / or disclose personal and / or health data . the primary endpoint was to evaluate the severity of rsv - associated lrti disease in premature and term children . primary outcomes included duration of hospitalization and the incidence , duration and risk of intensive care unit ( icu ) hospitalization . secondary endpoints included the assessment of the influence of ga on the treatment , complications and outcomes of rsv lrti hospitalization . secondary outcomes included the use of supplemental oxygen administration , use of bronchodilators , duration of hospitalization , the incidence and duration of icu hospitalization and death . lrti was defined as a diagnosis of pneumonia and / or bronchiolitis according to individual hospital / physician procedures . rsv - positive children were defined as all children who had an lrti hospitalization with rsv - positivity confirmed by the rsv rapid diagnostic test . because rsv testing was not standardized across the study sites , inter - site quality analysis was not performed within the study group . rsv - positive children with a known ga 36 weeks were defined as premature . rsv - positive children with a known ga 37 weeks and no other risk factors ( congenital heart disease , bronchopulmonary dysplasia , down syndrome or neuromuscular disease ) were defined as term children . gestational age was categorized into subgroups , based on world health organization criteria , for further analysis of the impact of preterm birth on outcomes : extremely preterm ( 28 weeks ) , very preterm ( 28 to 32 weeks ) and moderate preterm ( 3236 completed weeks of gestation ) . congenital heart disease , bronchopulmonary dysplasia , down syndrome and neuromuscular disease were not uniformly defined or standardized in the protocol . diagnoses of these conditions were based on the individual physician s experience and local practice guidelines . standard descriptive statistics were used to describe the data : counts and percentages for categorical data , mean and standard deviation for continuous data , and absolute frequency for incidence of cases . the denominator used to determine the incidence of icu hospitalization and death was the total population of children 1 year of age hospitalized with an lrti at participating sites during the study periods . calculation of incidence did not include compensation for the use of seasonal data versus year - round data . the type of admission diagnosis was compared between groups via two - sided chi - square tests on a 5 % level of significance . duration of hospitalization and duration of supplemental oxygen administration was compared between groups by means of two - sided t tests on a 5 % level of significance . the influence of admission diagnosis on the observed effects was investigated by means of two - sided t tests on a 5 % level of significance [ equivalent to a one - way analysis of variance ( anova ) with group in the model ] with admission diagnosis as an additional factor . duration of hospitalization and duration of supplemental oxygen administration were compared between groups ( rsv - positive and rsv - negative , rsv - positive premature and rsv - negative premature , rsv - positive premature and rsv - positive term ) . to adjust for the influence of admission diagnosis , this model was extended to a two - factor anova with group and admission diagnosis in the model . in large study populations such as these , the two - sided t test ( one - way anova ) and two - factor anova are robust against deviations from the normality of assumption and homogeneity of variances assumption . for the endpoint of icu hospitalization , the relative risk and associated two - sided asymptotic 95 % cisa chi - square test was performed to compare the occurrence of icu hospitalizations between groups at a 5 % level of significance . a cochran mantel haenszel test was used post hoc to adjust for admission diagnosis differences between groups . a chi - square test , cochran mantelhaenszel test and relative risk with associated two - sided asymptotic 95 % cis were also performed for the occurrence of supplemental oxygen administration and death . the influence of ga at birth on admission diagnosis , icu hospitalization , use of bronchodilators and oxygen administration was compared between groups using two - sided chi - square tests at a 5 % level of significance . the influence of ga at birth on the duration of hospitalization , duration of icu hospitalization and duration of oxygen administration was assessed using analysis of variance at the 5 % level of significance . all statistical analyses were carried out by means of the sas package ( version 9.2 ) ( gkm gesellschaft fr therapieforschung mbh , munich , germany ) . this retrospective , epidemiologic , cohort survey included children 1 year of age hospitalized with an lrti during the periods october 2009 to april 2010 and october 2010 to april 2011 . patients were hospitalized in the pediatric intensive care units and pediatrics wards of general , university , pediatric or other types of hospitals at 48 study sites across 12 cee countries ( estonia , lithuania , hungary , slovenia , croatia , serbia , bosnia / herzegovina , bulgaria , czech republic , slovakia , romania , and ukraine ) . data collection was performed on day of hospital discharge or during first checkup visit after lrti hospitalization . the study was conducted in compliance with any applicable national or institutional ethical and / or regulatory requirements . all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1964 . local law requirements for monitoring , notification / submission of an epidemiologic survey to the responsible ethics committee and / or regulatory body were followed , and ethical approval was obtained in the participating countries according to national legislation . the patient s parent , guardian or legal representative provided oral / written authorization to the investigator to use and / or disclose personal and / or health data . the primary endpoint was to evaluate the severity of rsv - associated lrti disease in premature and term children . primary outcomes included duration of hospitalization and the incidence , duration and risk of intensive care unit ( icu ) hospitalization . secondary endpoints included the assessment of the influence of ga on the treatment , complications and outcomes of rsv lrti hospitalization . secondary outcomes included the use of supplemental oxygen administration , use of bronchodilators , duration of hospitalization , the incidence and duration of icu hospitalization and death . lrti was defined as a diagnosis of pneumonia and / or bronchiolitis according to individual hospital / physician procedures . rsv - positive children were defined as all children who had an lrti hospitalization with rsv - positivity confirmed by the rsv rapid diagnostic test . because rsv testing was not standardized across the study sites , inter - site quality analysis was not performed within the study group . rsv - positive children with a known ga 36 weeks were defined as premature . rsv - positive children with a known ga 37 weeks and no other risk factors ( congenital heart disease , bronchopulmonary dysplasia , down syndrome or neuromuscular disease ) were defined as term children . gestational age was categorized into subgroups , based on world health organization criteria , for further analysis of the impact of preterm birth on outcomes : extremely preterm ( 28 weeks ) , very preterm ( 28 to 32 weeks ) and moderate preterm ( 3236 completed weeks of gestation ) . congenital heart disease , bronchopulmonary dysplasia , down syndrome and neuromuscular disease were not uniformly defined or standardized in the protocol . diagnoses of these conditions were based on the individual physician s experience and local practice guidelines . standard descriptive statistics were used to describe the data : counts and percentages for categorical data , mean and standard deviation for continuous data , and absolute frequency for incidence of cases . the denominator used to determine the incidence of icu hospitalization and death was the total population of children 1 year of age hospitalized with an lrti at participating sites during the study periods . calculation of incidence did not include compensation for the use of seasonal data versus year - round data . the type of admission diagnosis was compared between groups via two - sided chi - square tests on a 5 % level of significance . duration of hospitalization and duration of supplemental oxygen administration was compared between groups by means of two - sided t tests on a 5 % level of significance . the influence of admission diagnosis on the observed effects was investigated by means of two - sided t tests on a 5 % level of significance [ equivalent to a one - way analysis of variance ( anova ) with group in the model ] with admission diagnosis as an additional factor . duration of hospitalization and duration of supplemental oxygen administration were compared between groups ( rsv - positive and rsv - negative , rsv - positive premature and rsv - negative premature , rsv - positive premature and rsv - positive term ) . to adjust for the influence of admission diagnosis , this model was extended to a two - factor anova with group and admission diagnosis in the model . in large study populations such as these , the two - sided t test ( one - way anova ) and two - factor anova are robust against deviations from the normality of assumption and homogeneity of variances assumption . for the endpoint of icu hospitalization , the relative risk and associated two - sided asymptotic 95 % cisa chi - square test was performed to compare the occurrence of icu hospitalizations between groups at a 5 % level of significance . a cochran mantel haenszel test was used post hoc to adjust for admission diagnosis differences between groups . a chi - square test , cochran mantelhaenszel test and relative risk with associated two - sided asymptotic 95 % cis were also performed for the occurrence of supplemental oxygen administration and death . the influence of ga at birth on admission diagnosis , icu hospitalization , use of bronchodilators and oxygen administration was compared between groups using two - sided chi - square tests at a 5 % level of significance . the influence of ga at birth on the duration of hospitalization , duration of icu hospitalization and duration of oxygen administration was assessed using analysis of variance at the 5 % level of significance . all statistical analyses were carried out by means of the sas package ( version 9.2 ) ( gkm gesellschaft fr therapieforschung mbh , munich , germany ) . during the study period of october 2009april 2010 and october 2010april 2011 , overall , 3841 records were collected from 48 sites across 12 cee countries . among them , 3474 children ( 90.4 % ) fulfilled the case definition of a documented hospitalized lrti and were enrolled in the study ( fig . 1 ) . of the 3474 evaluable children , 757 children ( 21.8 % ) were premature ( 36 weeks ga ) and 2679 ( 77.1 % ) were term . the majority of the population was male ( 58.3 % ) and younger than 6 months ( 69.1 % ) at the time of admission . rsv prophylaxis had been administered in 2 % ( n = 68 ) of the entire cohort . demographic and clinical characteristics of the study cohort are summarized in table 1 . fig . * children who met the case definition had to be 1 year of age and hospitalized with a diagnosis of bronchiolitis and / or pneumonia within the observational periods october 2009 through april 2010 or october 2010 through april 2011 . ga gestational age , rsv respiratory syncytial virustable 1demographics and clinical characteristics of the study populationcharacteristicstudy population ( n = 3474 ) sex , n ( % ) male2024 ( 58.3 ) female1409 ( 40.6 ) unknown41 ( 1.2 ) age at admission , month , mean ( sd ) 5 ( 3 ) age category at admission , month , n ( % ) 062400 ( 69.1 ) 6121074 ( 30.9 ) gestational age , week , mean ( sd ) 36 ( 2 ) gestational age categories , week , n ( % ) 29121 ( 3.5 ) 2932233 ( 6.7 ) 3336403 ( 11.6 ) 362679 ( 77.1 ) unknown38 ( 1.1 ) bw , g , mean ( sd ) 2998 ( 841 ) bw categories , g , n ( % ) extremely low bw ( bw 1000 g ) 101 ( 2.9 ) very low bw ( 1000 g bw 1500 g ) 176 ( 5.1 ) low bw ( 1500 g bw 2500 g ) 482 ( 13.9 ) normal bw ( 2500 g bw 4200 g ) 2592 ( 74.6 ) high bw ( bw 4200 g ) 114 ( 3.3 ) unknown9 ( 0.3 ) diagnosis at admission , n ( % ) bronchiolitis only1983 ( 57.1 ) pneumonia only1183 ( 34.1 ) bronchiolitis and pneumonia308 ( 8.9 ) rsv diagnosis , n ( % ) rsv - positive1423 ( 42.4 ) rsv - negative1820 ( 54.3 ) unknown111 ( 3.3 ) risk factors for severe rsv infection , n ( % ) premature ( ga 36 week ) 757 ( 21.8 ) congenital heart disease166 ( 4.8 ) bronchopulmonary dysplasia145 ( 4.2 ) neuromuscular disease108 ( 3.1 ) duration of hospitalization , day , mean ( 95 % ci ) 10.8 ( 10.411.2 ) hospital duration categories , day , n ( % ) 13224 ( 6.4 ) 471360 ( 39.1 ) 8141408 ( 40.5 ) 15470 ( 13.5 ) unknown12 ( 0.3 ) icu hospitalization , n ( % ) 671 ( 19.3 ) length of icu stay , day , mean ( 95 % ci ) 11.0 ( 9.912.1 ) supplemental oxygen use , n ( % ) 1563 ( 45.0 ) duration of supplemental oxygen use , day , mean ( 95 % ci ) 6.4 ( 5.96.9 ) bronchodilator use , n ( % ) 2698 ( 77.7 ) duration of bronchodilator use , day , mean ( 95 % ci ) 7.4 ( 7.17.6 ) patient outcome at discharge , n ( % ) complete recovery1623 ( 46.7 ) improvement1782 ( 51.3 ) death30 ( 0.9 ) transfer to another hospital21 ( 0.6 ) unknown18 ( 0.5 ) bw birth weight , ga gestational age , icu intensive care unit , rsv respiratory syncytial virus age was recorded on the case report form . the mean calculation category 06 months was analyzed as 3 months ; the age category 612 months was analyzed as 9 months gestational age was recorded on the case report form percentages were calculated on 3354 cases with rsv rapid tests only for patients who were hospitalized only for patients who used oxygen only for patients who used bronchodilators disposition of study population . * children who met the case definition had to be 1 year of age and hospitalized with a diagnosis of bronchiolitis and / or pneumonia within the observational periods october 2009 through april 2010 or october 2010 through april 2011 . ga gestational age , rsv respiratory syncytial virus demographics and clinical characteristics of the study population bw birth weight , ga gestational age , icu intensive care unit , rsv respiratory syncytial virus age was recorded on the case report form . the mean calculation category 06 months was analyzed as 3 months ; the age category 612 months was analyzed as 9 months gestational age was recorded on the case report form percentages were calculated on 3354 cases with rsv rapid tests only for patients who were hospitalized only for patients who used oxygen only for patients who used bronchodilators a rapid rsv test was performed in 3354 ( 96.5 % ) cases and rsv tests were positive in 1423 ( 42.4 % ) . of the rsv - positive cases ,266 ( 18.7 % ) were premature children and 1034 ( 72.7 % ) were term children with no risk factors or chronic diseases . rsv prophylaxis had been administered in 11 rsv - positive cases , among them 9 children with ga 33 weeks and 2 term children . a comparison of the baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between premature and term children is illustrated in table 2 . table 2baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between premature and term childrencharacteristicpremature ( n = 266 ) term ( n = 1034 ) p valuesex , n ( % ) nd male147 ( 55.3 ) 591 ( 57.2 ) female114 ( 42.9 ) 426 ( 41.2 ) unknown5 ( 1.9 ) 17 ( 1.6 ) age at admission , n ( % ) nd 06 months203 ( 76.3 ) 770 ( 74.5 ) 612 months63 ( 23.7 ) 264 ( 25.5 ) presence of chronic diseases at admission , n ( % ) nd any chronic disease91 ( 34.2 ) 0 congenital heart disease27 ( 10.2 ) 0 bronchopulmonary dysplasia41 ( 15.4 ) 0 neuromuscular disease18 ( 6.8 ) 0 other chronic diseases42 ( 15.8 ) 0rsv prophylaxis , n ( % ) 9 ( 3.4 ) 2 ( 0.2 ) nddiagnosis at admission , n ( % ) 0.001 * bronchiolitis only129 ( 48.5 ) 736 ( 71.2 ) pneumonia only100 ( 37.6 ) 207 ( 20.0 ) both diagnoses37 ( 13.9 ) 91 ( 8.8 ) duration of hospitalization , day , mean ( sd ) 17 ( 20 ) 8 ( 5 ) 0.001 icu hospitalization , n ( % ) 110 ( 41.4 ) 130 ( 12.6 ) ndlength of icu stay , day , mean ( sd ) 13 ( 15 ) 6 ( 5 ) 0.001 supplemental oxygen use , n ( % ) 194 ( 72.9 ) 479 ( 46.3 ) ndduration of supplemental oxygen use , day , mean ( sd ) 9 ( 12 ) 4 ( 3 ) 0.001 outcome at discharge , n ( % ) nd complete recovery122 ( 45.9 ) 418 ( 40.4 ) improved132 ( 49.6 ) 601 ( 58.1 ) death7 ( 2.6 ) 3 ( 0.3 ) transfer to other hospital3 ( 1.1 ) 6 ( 0.6 ) unknown2 ( 0.8 ) 6 ( 0.6 ) icu intensive care unit , lrti lower respiratory tract infection , nd not determined , rsv respiratory syncytial virus * statistical significance was determined using two - sided chi - square tests on a 5 % level of significance statistical significance was determined using analysis of variance on a 5 % level of significance baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between premature and term children icu intensive care unit , lrti lower respiratory tract infection , nd not determined , rsv respiratory syncytial virus * statistical significance was determined using two - sided chi - square tests on a 5 % level of significance statistical significance was determined using analysis of variance on a 5 % level of significance significant differences in the diagnosis at admission were observed between premature and term children . premature children were more frequently hospitalized due to pneumonia ( 37.6 % vs 20.0 % ) and term children were more frequently hospitalized due to bronchiolitis ( 48.5 % vs 71.2 % ; p 0.001 ) . hospital stays were significantly longer for premature children compared with term children ( 17 vs 8 days ; p 0.001 ; p value adjusted for admission diagnosis : 0.001 ) . premature children had a 3.3-fold ( 95 % ci : 2.66 , 4.09 ) increased risk for icu hospitalization compared with term children ( p 0.001 ) ; after adjustment for admission diagnosis ( including only those admitted with a diagnosis of either pneumonia or bronchiolitis ) , risk was increased 2.8-fold ( 95 % ci : 2.23 , 3.47 ; p 0.001 ) . icu hospitalizations were more frequent for premature children ( 41.4 % vs 12.6 % ; p value not determined ) , and icu stays were longer ( 13 vs 6 days ; p premature children had a 1.6-fold ( 95 % ci : 1.43 , 1.74 ) increased risk of receiving supplemental oxygen compared with term children ( p 0.001 ) ; after adjustment for admission diagnosis , risk was 1.6-fold greater ( 95 % ci : 1.44 , 1.78 ; p 0.001 ) . compared with term children , oxygen was administered in premature children markedly more frequently ( 72.9 % vs 46.3 % ; p value not determined ) and for a significantly longer mean duration ( 9 vs 4 days ; p 0.001 ; p value adjusted for admission diagnosis : 0.001 ) . ga was reported for 1412 ( 99.2 % ) children hospitalized for rsv lrti hospitalized children . a comparison of the baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between the ga strata is illustrated in table 3 . the proportion of children with an admission diagnosis of bronchiolitis ( with or without pneumonia ) significantly increased through the ga strata , ranging from 34.3 % in the 28 - week stratum to 78.9 % in the 37 - week stratum ( p 0.001 ) . the mean duration of hospitalization decreased significantly through the ga strata , ranging from 29 days in the 28 - week stratum to 9 days in the 37 - week stratum ( p 0.001 ) . table 3baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between gestational age at birthrsv - positive casesgestational age p value28 weeks ( n = 35 ) 2932 weeks ( n = 86 ) 3336 weeks ( n = 145 ) 37 weeks ( n = 1146 ) sex , n ( % ) nd male15 ( 42.9 ) 60 ( 69.8 ) 72 ( 49.7 ) 663 ( 57.9 ) female20 ( 57.1 ) 26 ( 30.2 ) 68 ( 46.9 ) 465 ( 40.6 ) unknown005 ( 3.4 ) 18 ( 1.6 ) age at admission , n ( % ) nd 06 months27 ( 77.1 ) 70 ( 81.4 ) 106 ( 73.1 ) 857 ( 74.8 ) 612 months8 ( 22.9 ) 16 ( 18.6 ) 39 ( 26.9 ) 289 ( 25.2 ) diagnosis at admission , n ( % ) 0.001 * bronchiolitis only12 ( 34.3 ) 37 ( 43.0 ) 80 ( 55.2 ) 788 ( 68.8 ) pneumonia only23 ( 65.7 ) 41 ( 47.7 ) 36 ( 24.8 ) 241 ( 21.0 ) both diagnoses08 ( 9.3 ) 29 ( 20.0 ) 117 ( 10.2 ) chronic diseases at admission , n ( % ) nd any chronic disease16 ( 45.7 ) 44 ( 51.2 ) 31 ( 21.4 ) 107 ( 9.3 ) congenital heart disease4 ( 11.4 ) 9 ( 10.5 ) 14 ( 9.7 ) 34 ( 3.0 ) bronchopulmonary dysplasia12 ( 34.3 ) 25 ( 29.1 ) 4 ( 2.8 ) 0 neuromuscular disease2 ( 5.7 ) 11 ( 12.8 ) 5 ( 3.4 ) 18 ( 1.6 ) other chronic diseases7 ( 20.0 ) 17 ( 19.8 ) 18 ( 12.4 ) 76 ( 6.6 ) rsv prophylaxis , n ( % ) 6 ( 17.1 ) 3 ( 3.5 ) 02 ( 0.2 ) ndduration of hospitalization , day , mean ( sd ) 29 ( 34 ) 24 ( 21 ) 11 ( 10 ) 9 ( 7 ) 0.00113 , n ( % ) 1 ( 2.9 ) 1 ( 1.2 ) 8 ( 5.5 ) 93 ( 8.1 ) 47 , n ( % ) 8 ( 22.9 ) 11 ( 12.8 ) 44 ( 30.3 ) 494 ( 43.1 ) 814 , n ( % ) 11 ( 31.4 ) 26 ( 30.2 ) 68 ( 46.9 ) 466 ( 40.7 ) 15 , n ( % ) 15 ( 42.9 ) 48 ( 55.8 ) 23 ( 15.9 ) 91 ( 7.9 ) icu hospitalization , n ( % ) 19 ( 54.3 ) 42 ( 48.8 ) 49 ( 33.8 ) 162 ( 14.1 ) 0.001 * length of stay in icu , day , mean ( sd ) 19 ( 21 ) 17 ( 18 ) 7 ( 6 ) 7 ( 6 ) 0.001 supplemental oxygen use , n ( % ) 28 ( 80.0 ) 67 ( 77.9 ) 99 ( 68.3 ) 546 ( 47.6 ) 0.001 * duration of supplemental oxygen use , day , mean ( sd ) 19 ( 23 ) 12 ( 10 ) 5 ( 3 ) 5 ( 5 ) 0.001 use of bronchodilators , n ( % ) 21 ( 60.0 ) 60 ( 69.8 ) 118 ( 81.4 ) 952 ( 83.1 ) outcome at dischargend complete recovery11 ( 31.4 ) 35 ( 40.7 ) 76 ( 52.4 ) 464 ( 40.5 ) improved19 ( 54.3 ) 46 ( 53.5 ) 67 ( 46.2 ) 663 ( 57.9 ) death 3 ( 8.6 ) 3 ( 3.5 ) 1 ( 0.7 ) 5 ( 0.4 ) transfer to other hospital1 ( 2.9 ) 2 ( 2.3 ) 07 ( 0.6 ) unknown1 ( 2.9 ) 01 ( 0.7 ) 7 ( 0.6 ) gestational age was reported for 1412 of the 1423 children with rsv infections icu intensive care unit , lrti lower respiratory tract infection , nd not determined , rsv respiratory syncytial virus * statistical significance was determined using two - sided chi - square tests on a 5 % level of significance statistical significance was determined using analysis of variance on a 5 % level of significance baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between gestational age at birth gestational age was reported for 1412 of the 1423 children with rsv infections icu intensive care unit , lrti lower respiratory tract infection , nd not determined , rsv respiratory syncytial virus * statistical significance was determined using two - sided chi - square tests on a 5 % level of significance statistical significance was determined using analysis of variance on a 5 % level of significance the proportion of cases requiring icu hospitalization decreased significantly through the ga strata , ranging from 54.3 % in the 28 - week stratum to 14.1 % in the 37 - week stratum ( p 0.001 ) . the length of stay in the icu was comparable in the 33 - to 36 - week stratum and the 37 - week stratum ( 7 days for both groups ) ; however , the duration was significantly longer in children with ga 33 weeks ( p 0.001 ; 17 days in the 29 - to 32 - week stratum and 19 days in the 28 - week stratum ) . overall , the observed differences in length of stay in the icu were statistically significant ( p 0.001 ) across the ga strata . the proportion of children requiring supplemental oxygen significantly decreased through the ga strata , ranging from 80.0 % in the 28 - week stratum to 47.6 % in the 37 - week stratum ( p 0.001 ) . duration of supplemental oxygen use also significantly decreased as ga increased , ranging from 19 days in the 28 - week stratum to 5 days in the 37 - week stratum ( p 0.001 ) . the proportion of children treated with bronchodilators increased through the strata , ranging from 60.0 % in the 28 - week stratum to 83.1 % in the 37 - week stratum . regarding outcome at discharge , the proportion of children who recovered completely ranged from 31.4 % in the 28 - week stratum to 52.4 % in the 33 - to 36 - week stratum . there were 12 deaths , with the proportion of deaths decreasing with increasing ga . among them , six premature children ( three deaths in each of the 28 - and 29 - to 32 - week strata , one death in the 33 - to 36 - week stratum ) and five term children died . ga was reported for 1412 ( 99.2 % ) children hospitalized for rsv lrti hospitalized children . a comparison of the baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between the ga strata is illustrated in table 3 . the proportion of children with an admission diagnosis of bronchiolitis ( with or without pneumonia ) significantly increased through the ga strata , ranging from 34.3 % in the 28 - week stratum to 78.9 % in the 37 - week stratum ( p 0.001 ) . the mean duration of hospitalization decreased significantly through the ga strata , ranging from 29 days in the 28 - week stratum to 9 days in the 37 - week stratum ( p 0.001 ) . table 3baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between gestational age at birthrsv - positive casesgestational age p value28 weeks ( n = 35 ) 2932 weeks ( n = 86 ) 3336 weeks ( n = 145 ) 37 weeks ( n = 1146 ) sex , n ( % ) nd male15 ( 42.9 ) 60 ( 69.8 ) 72 ( 49.7 ) 663 ( 57.9 ) female20 ( 57.1 ) 26 ( 30.2 ) 68 ( 46.9 ) 465 ( 40.6 ) unknown005 ( 3.4 ) 18 ( 1.6 ) age at admission , n ( % ) nd 06 months27 ( 77.1 ) 70 ( 81.4 ) 106 ( 73.1 ) 857 ( 74.8 ) 612 months8 ( 22.9 ) 16 ( 18.6 ) 39 ( 26.9 ) 289 ( 25.2 ) diagnosis at admission , n ( % ) 0.001 * bronchiolitis only12 ( 34.3 ) 37 ( 43.0 ) 80 ( 55.2 ) 788 ( 68.8 ) pneumonia only23 ( 65.7 ) 41 ( 47.7 ) 36 ( 24.8 ) 241 ( 21.0 ) both diagnoses08 ( 9.3 ) 29 ( 20.0 ) 117 ( 10.2 ) chronic diseases at admission , n ( % ) nd any chronic disease16 ( 45.7 ) 44 ( 51.2 ) 31 ( 21.4 ) 107 ( 9.3 ) congenital heart disease4 ( 11.4 ) 9 ( 10.5 ) 14 ( 9.7 ) 34 ( 3.0 ) bronchopulmonary dysplasia12 ( 34.3 ) 25 ( 29.1 ) 4 ( 2.8 ) 0 neuromuscular disease2 ( 5.7 ) 11 ( 12.8 ) 5 ( 3.4 ) 18 ( 1.6 ) other chronic diseases7 ( 20.0 ) 17 ( 19.8 ) 18 ( 12.4 ) 76 ( 6.6 ) rsv prophylaxis , n ( % ) 6 ( 17.1 ) 3 ( 3.5 ) 02 ( 0.2 ) ndduration of hospitalization , day , mean ( sd ) 29 ( 34 ) 24 ( 21 ) 11 ( 10 ) 9 ( 7 ) 0.00113 , n ( % ) 1 ( 2.9 ) 1 ( 1.2 ) 8 ( 5.5 ) 93 ( 8.1 ) 47 , n ( % ) 8 ( 22.9 ) 11 ( 12.8 ) 44 ( 30.3 ) 494 ( 43.1 ) 814 , n ( % ) 11 ( 31.4 ) 26 ( 30.2 ) 68 ( 46.9 ) 466 ( 40.7 ) 15 , n ( % ) 15 ( 42.9 ) 48 ( 55.8 ) 23 ( 15.9 ) 91 ( 7.9 ) icu hospitalization , n ( % ) 19 ( 54.3 ) 42 ( 48.8 ) 49 ( 33.8 ) 162 ( 14.1 ) 0.001 * length of stay in icu , day , mean ( sd ) 19 ( 21 ) 17 ( 18 ) 7 ( 6 ) 7 ( 6 ) 0.001 supplemental oxygen use , n ( % ) 28 ( 80.0 ) 67 ( 77.9 ) 99 ( 68.3 ) 546 ( 47.6 ) 0.001 * duration of supplemental oxygen use , day , mean ( sd ) 19 ( 23 ) 12 ( 10 ) 5 ( 3 ) 5 ( 5 ) 0.001 use of bronchodilators , n ( % ) 21 ( 60.0 ) 60 ( 69.8 ) 118 ( 81.4 ) 952 ( 83.1 ) outcome at dischargend complete recovery11 ( 31.4 ) 35 ( 40.7 ) 76 ( 52.4 ) 464 ( 40.5 ) improved19 ( 54.3 ) 46 ( 53.5 ) 67 ( 46.2 ) 663 ( 57.9 ) death 3 ( 8.6 ) 3 ( 3.5 ) 1 ( 0.7 ) 5 ( 0.4 ) transfer to other hospital1 ( 2.9 ) 2 ( 2.3 ) 07 ( 0.6 ) unknown1 ( 2.9 ) 01 ( 0.7 ) 7 ( 0.6 ) gestational age was reported for 1412 of the 1423 children with rsv infectionsicu intensive care unit , lrti lower respiratory tract infection , nd not determined , rsv respiratory syncytial virus * statistical significance was determined using two - sided chi - square tests on a 5 % level of significance statistical significance was determined using analysis of variance on a 5 % level of significance baseline admission demographics , clinical characteristics and outcomes of rsv lrti hospitalization between gestational age at birth gestational age was reported for 1412 of the 1423 children with rsv infectionsicu intensive care unit , lrti lower respiratory tract infection , nd not determined , rsv respiratory syncytial virus * statistical significance was determined using two - sided chi - square tests on a 5 % level of significance statistical significance was determined using analysis of variance on a 5 % level of significance the proportion of cases requiring icu hospitalization decreased significantly through the ga strata , ranging from 54.3 % in the 28 - week stratum to 14.1 % in the 37 - week stratum ( p 0.001 ) . the length of stay in the icu was comparable in the 33 - to 36 - week stratum and the 37 - week stratum ( 7 days for both groups ) ; however , the duration was significantly longer in children with ga 33 weeks ( p 0.001 ; 17 days in the 29 - to 32 - week stratum and 19 days in the 28 - week stratum ) . overall , the observed differences in length of stay in the icu were statistically significant ( p 0.001 ) across the ga strata . the proportion of children requiring supplemental oxygen significantly decreased through the ga strata , ranging from 80.0 % in the 28 - week stratum to 47.6 % in the 37 - week stratum ( p 0.001 ) . duration of supplemental oxygen use also significantly decreased as ga increased , ranging from 19 days in the 28 - week stratum to 5 days in the 37 - week stratum ( p 0.001 ) . the proportion of children treated with bronchodilators increased through the strata , ranging from 60.0 % in the 28 - week stratum to 83.1 % in the 37 - week stratum . regarding outcome at discharge , the proportion of children who recovered completely ranged from 31.4 % in the 28 - week stratum to 52.4 % in the 33 - to 36 - week stratum . there were 12 deaths , with the proportion of deaths decreasing with increasing ga . among them , six premature children ( three deaths in each of the 28 - and 29 - to 32 - week strata , one death in the 33 - to 36 - week stratum ) and five term children died . the main objective of this multinational study was to characterize the severity of rsv - associated lrti disease among premature and term cee children younger than 1 year across two rsv seasons . our analysis of 1423 rsv - positive children demonstrates substantial morbidity in the first year of life among children hospitalized for rsv lrti in cee . consistent with other geographic regions , premature children with chronological age 1 year are at greater risk for a more severe course of rsv disease compared with their term - delivered counterparts . these results provide further evidence that , like exposure to second - hand smoke , being male , and living with siblings , prematurity is a near - universal risk factor for severe rsv - associated infection . premature children were more frequently hospitalized due to pneumonia ( with and without bronchiolitis ) than term children ( 51.5 % vs 28.8 % ; p 0.001 ) . the observed differences in admission diagnosis might reflect different hospitalization strategies for premature and term children . we can not determine from this analysis whether premature and term children presenting with similar symptoms were equally likely to be hospitalized . premature children exhibited longer stays in the hospital , more frequent and longer stays in the icu and more frequent and longer administration of supplemental oxygen than term children ; even after adjusting for the admission diagnosis , the differences remain significant ( p 0.001 ) . in fact , the risk of an icu stay was 2.8 times higher in premature than term children after adjusting for admission diagnosis . furthermore , decreasing ga at birth was found to increase risk for icu hospitalization , prolonged duration of hospitalization , supplemental oxygen administration and death . even among late premature children ( 3336 weeks gestation ) , the course of rsv - positive lrti disease was more severe than that of full - term children . compared with term children , a greater proportion of late premature children ( 3336 weeks gestation ) with rsv lrtiwere hospitalized in the icu ( 33.8 % vs 14.1 % ) , spent 15 days in the hospital ( 1.4 % vs 1.0 % ) and required supplemental oxygen administration ( 68.3 % vs 47.6 % ) . these findings are consistent with previous studies in western europe and the united states that reported a high rate of healthcare utilization for rsv - positive lrti among premature children 3335 weeks gestation . the strength of this study is that it investigates a large multinational cohort of children from a geographical area that has not been previously well characterized . we acknowledge that the study data from the 2009 to 2010 and 2010 to 2011 rsv seasons may not appear current . however , to our knowledge , no substantial developments in the medical practice of prevention or care of these children for rsv lrti , including the use of prophylaxis with palivizumab , have since occurred in cee that would change study results if conducted today . as such , the clinical relevance and severity of rsv - associated lrti disease likely has remained the same . rsv reinfection is a common occurrence and we were not able to account for possible reinfections in this study . in addition , the number of collected cases in our study was affected by factors associated with the recruitment process , such as time resources of the investigators , availability of diagnostic tests , strategies for identifying cases and obtaining consent for study participation . given that data were collected on the day of hospital discharge or during the first checkup visit after lrti hospitalizationthe rsv rapid diagnostic tests that utilize antigen capture technology have a sensitivity and specificity of approximately 90 % . data regarding timing of the rsv rapid test during the course of the disease were not captured . as a result , the true proportion of rsv infections may have been underestimated . use of univariate analyses , instead of multivariate analyses , may have increased the likelihood of an analysis reaching statistical significance by chance . furthermore , the lack of adjustment for potential confounders or other potential risk factors limits the value of the univariate assessment of potential risk factors . however , the primary endpoint was to evaluate the severity of rsv - associated lrti disease in premature and term children . primary outcomes included duration of hospitalization , and the incidence , duration and risk of icu hospitalization . because investigation of the potential risk factors was an additional , exploratory data analysis in the statistical analysis plan and the findingswould not have impacted the primary endpoint of this study , we did not pursue a multivariate analysis of these factors . because diagnosis of lrti was based on individual physician / hospital practice , local or regional differences may also have introduced bias . national and regional differences in treatment practice and healthcare systems , especially the criteria for hospitalization , may have affected our overall risk factor findings and may also affect assessments of congenital heart disease , bronchopulmonary dysplasia , down syndrome and neuromuscular disease , icu admittance and use of supplemental oxygen and bronchodilators . overall , the results of this study demonstrate the importance of rsv as a significant contributor to pediatric morbidity in the first year of life and confirm results from studies outside of cee that show that prematurely born children hospitalized for rsv - related infections have a more severe course of disease than full - term children , as demonstrated by longer stays in the hospital and more frequent and longer stays in the icu than term children without risk factors . olivier van de steen , farzaneh miri , marta gunjaca , vanesa klepac , baerbel gross , gerard notario and colleen m. wegzyn are abbvie employees or were abbvie employees at the time of study conduct and analysis and may hold stocks or options . the study was conducted in compliance with any applicable national or institutional ethical and / or regulatory requirements . all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1964 . the study sponsor , abbvie ( formerly known as abbott ) , vouches for the veracity of the multiple ethical approvals . the patient s parent , guardian or legal representative provided oral authorization to the investigator to use and / or disclose personal and / or health data . this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license ( http://creativecommons.org/licenses/by-nc/4.0/ ) , which permits any noncommercial use , distribution , and reproduction in any medium , provided you give appropriate credit to the original author ( s ) and the source , provide a link to the creative commons license and indicate if changes were made .\noutput:\n" }, { "from": "agent", "value": "introductionglobally , respiratory syncytial virus ( rsv ) is the most common cause of serious lower respiratory tract infections ( lrtis ) in young children , and is a major cause of hospital admission in children < 1 year of age . the study evaluated the severity of rsv - associated lrti disease among premature ( < 36 weeks gestational age ( ga ) ) and term children < 1 year of age and assessed the influence of ga on outcomes of rsv lrti hospitalization in central and eastern europe ( cee ) . methodsretrospective cohort survey of children < 1 year of age hospitalized with an lrti during the periods of october 2009 to april 2010 or october 2010 to april 2011 in 12 cee countries.resultsacross two rsv seasons , 3474 evaluable children were hospitalized because of lrti ; 757 ( 21.8 % ) were premature and 2679 ( 77.1 % ) were term . rsv tests were positive in 1423 ( 42.4 % ) cases , of which 266 ( 18.7 % ) were premature and 1034 ( 72.7 % ) were term children . among the rsv - positive patients , premature children had a significantly longer hospital stay ( 17 vs 8 days ; p < 0.001 ) , were more frequently hospitalized in the intensive care unit ( icu ) ( 41.4 % vs 12.6 % ) and remained in the icu significantly longer ( 13 vs 6 days ; p < 0.001 ) compared with term children . premature children had a 3.3-fold ( 95 % ci , 2.664.09 ) increased risk for icu hospitalization compared with term children ( p < 0.001 ) . icu hospitalization , prolonged hospital stay , supplemental oxygen administration and death occurred significantly more frequently among children with lower vs higher ga.conclusionrsv infection is associated with substantial morbidity in cee among premature and term children . the attributable morbidity , however , is significantly greater among premature children compared with term children , including longer hospital stays and more frequent and longer stays in the icu . these findings are consistent with previously published data outside of cee , demonstrating prematurity as a significant and independent predictor for severe rsv disease.fundingabbvie inc ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the outbreak was reported in july 2010 in bom jesus do tocantins county ( 5260s , 483636w ) , par state , in the amazon region of brazil ( figure 1 , appendix ) . bom jesus do tocantins county ( black ) in par state ( gray ) , brazil , where an outbreak of bovine vaccinia occurred in 2010 . dairy cattle and workers were affected . however , the source ( index case ) of this outbreak was not identified . at the study site ,44 lactating dairy cows became sick and had painful vesicular lesions on teats , udders , and inner thighs that rapidly progressed to ulcerative lesions and scabs ( figure 2 , panels b and d ) . two animals had extensive necrosis because of secondary infections , which led to loss of teats . lesions were also observed on lips , muzzles , oral cavities , and tongues of calves ( figure 2 , panel d ) . three dairy workers became sick during the outbreak after direct contact with sick animals and had typical orthopoxvirus ( opv ) lesions on their hands , forearms , and abdomen ( figure 2 , panel a ) . pain in the lesion region , fever , and fatigue were also reported by sick patients . b and d ) typical lesions on teats and udder of a dairy cow infected by vacv at different stages , ranging from ulceration to scabs . c ) lesions on a calf s muzzle probably caused by vacv infection during suckling . we collected 4 scabs and 44 serum samples from the 44 sick animals and 3 serum samples from the 3 dairy workers . serum samples were tested by using 50 % plaque reduction neutralization tests as described ( 8 ) . neutralizing antibodies were detected in 40 ( 90.0 % ) bovine and in 3 ( 100 % ) human samples , and titers ranged from 20 to 640 neutralizing units / ml . supernatants were diluted 1:100 in phosphate - buffered saline and used in a nested pcr specific for the c11r viral growth factor gene as described ( 9,10 ) . we isolated virus from 1 of the samples that was positive for viral growth factor by nested pcr . negative results for vacv by pcr and virus isolation might have been caused by loss of virus titers and dna degradation during sample transportation . after a typical poxvirus cytopathic effect was observed , virus was plaque purified and placed on vero cell monolayers for viral amplification . this new vacv isolate was named par virus ( parv ) . to investigate the relationship between parv and bav , virus gene a56r ( hemagglutinin ) was amplified and sequenced ( 11 ) . the a56r gene is traditionally used for phylogenetic analysis . in addition , parv a26l ( a - type inclusion body ) was also sequenced ( 12 ) . the pcr fragments obtained were directly sequenced in both orientations and in triplicate by using a mega - bace 1000 sequencer ) ( ge healthcare , little chalfont , uk ) . sequences were aligned with opv sequences from genbank by using clustalw ( www.ncbi.nlm.nih.gov/pmc/articles/pmc308517 ) , and alignments were manually checked with mega version 4.0 software ( arizona state university , phoenix , az , usa ) . optimal alignment of the a56r gene showed high identity among parv and several group 1 vacv - br isolates ( average identity 99.8 % ) , including vacv - to ca ( gu322359 ) ( identity 99.9 % ) , an amplicon obtained from blood of an amazon monkey in tocantins state , brazil , in 2002 ( figure 3 ) . parv also showed a signature deletion of 18 nt that was also present in a56r sequences of other group 1 vacv - br isolates phylogenetic trees based on orthopoxvirus nucleotide sequences of a56r ( a ) and a26l ( b ) genes of vaccinia virus ( vacv ) , par state , brazil . phylogenetic analysis showed that parv ( black dots ) clustered in the vacv - br - g1 clade and that bean58058 virus ( bav ) clustered in the vacv - br - g2 clade . trees were constructed by using the neighbor - joining method , the tamura - nei model of nucleotide substitutions , and bootstrap of 1,000 replicates in mega version 4.0 software ( arizona state university , phoenix , az , usa ) . in panelgp2v , guarani p2 virus ; murv , muriae virus ; ctgv , cantagalo virus ; carv , carangola virus ; marv , mariana virus ; arav , araatuba virus ; hspv , horsepox virus ; gp1v , guarani p1 virus ; mpxv , monkeypox virus ; pstv , passatempo ; cpxv , cowpox virus ; varv , variola virus . phylogenetic trees of the a56r ( figure 3 , panel a ) or a26l ( figure 3 , panel b ) genes were constructed by using the neighbor - joining method , 1,000 bootstrap replicates , and the tamura 3 - parameter model ( mega version 4 ) . parv sequences clustered with several group 1 vacv - brs isolated during several bovine vaccinia outbreaks in brazil . in both trees , parv clustered in group 1 vacv - br , whereas bav clustered in group 2 . our results confirm circulation of a new group 1 vacv - br isolate in par state in the amazon region of brazil in the same location where bav ( group 2 vacv - br ) was isolated ( 6,7 ) . in recent years , bovine vaccinia outbreaks in southeastern brazil rapidly spread to neighboring states ( 1 ) . epidemiologic studies suggest that movement of sick humans and the animal trade are the main causes of this circulation ( 1 ) . the relevance of vacv circulation in the context of bovine vaccinia outbreaks has been discussed ( 13 ) . several isolates belong to group 1 , which is most commonly isolated from sick cattle or cow milkers ; some isolates were detected in peridomestic rodents and wild monkeys ( 8,13 ) . therefore , although our data demonstrated that parv does not cluster with bav , it is not possible to phylogenetically define which group 1 isolate specifically generated parv or caused the outbreak because of limited number of available gene sequences from vacv - br isolates . nevertheless , we believe the presence of this new isolate in par state likely resulted from virus spread from tocantins , maranho , or mato grosso , 3 neighboring states of par state , which had bovine vaccinia outbreaks in recent years , and not from reemergence of bav ( 1 ) . although group 2 vacv - br isolates , including bav , have not been detected in the amazon region of brazil in recent years , we believe that these viruses may be silently circulating or associated with bovine vaccinia outbreaks . as in other regions in brazil , vacv outbreaks are underreported in the amazon region because of its large size and the natural complexity involved in surveillance of zoonotic diseases . our results reinforce the need for studies on vacv diversity and its transmission chain , which would be useful for the amazon region in brazil .\noutput:\n" }, { "from": "agent", "value": "in 2010 , vaccinia virus caused an outbreak of bovine vaccinia that affected dairy cattle and rural workers in par state , brazil . genetic analyses identified the virus as distinct from bean58058 vaccinia virus ( identified in 1960s ) and from smallpox vaccine virus strains . these findings suggest spread of autochthonous group 1 vaccinia virus in this region ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: podocytic infolding glomerulopathy ( pig ) has recently been proposed as a possible new pathological entity . in pig , microspheres or microtubular structures , or both , are associated with the infolding of cytoplasmic processes of podocytes into the glomerular basement membrane ( gbm ) . it is not known whether this lesion indicates a new disease entity or a transient morphological finding of a well - known disease . however , several cases with an apparently unique microstructure showing podocytic infolding have been reported as pig . although most cases were diagnosed as lupus nephritis or another primary glomerulonephritis , based on light microscopic findings , 4 cases were diagnosed as a minor glomerular abnormality ( mga ) . we report a case of pig with microspheres in the gbm that were diagnosed as mga based on light microscopic findings . after 3 years , the patient had a nephrotic - range proteinuria and was diagnosed by a second renal biopsy as having focal segmental glomerulosclerosis ( fsgs ) with pig . this is the first report of a case of pig that was diagnosed as mga based on the first light microscopic findings and , 3 years later , as complicated with fsgs . a 14 - year - old girl was referred to our institution as an inpatient because of proteinuria . when she was 9 years old , she had urinary protein ( up ) detected during a school physical examination and she was followed in the pediatrics department of our hospital . her up gradually increased to a level of 1.9 g / day , and at 14 years , she was referred to our division . laboratory tests showed a up level of 2.35 g / day , negative results for urinary sedimentation , and creatinine clearance of 111.9 ml / min / 1.73 m. no cytopenia , hypocomplementemia , or elevated liver enzymes were found ( table 1 ) . light microscopy of her first renal biopsy specimens showed a total of 14 glomeruli , 1 of which had global sclerosis ; the others were mgas . however , under light microscopy at a higher magnification under periodic acid methenamine silver ( pam ) staining , the glomeruli had a bubbling appearance of diffuse glomerular loops ( fig . electron microscopy revealed microspheres in the gbm , which were sparse but global ( fig . the microstructures took various forms , and almost all of them were encircled with a unit membrane . there was no direct consecutive podocytic infolding in the gbm , nor any mesangial interposition . however , her up level gradually increased to the nephrotic range by 16 years , and at 17 years of age , she underwent a second renal biopsy . laboratory tests showed a up level of 3.06 g / day , negative results for urinary sedimentation , and creatinine clearance of 156.5 ml / min / 1.73 m. antinuclear antibodies had changed to positive and the double - stranded deoxyribonucleic acid ( dsdna ) level was elevated at 14 iu / ml . serum total protein level was 5.5 g / dl and serum albumin level was 3.4 g / dl . no cytopenia , hypocomplementemia , or physical findings indicative of collagen disease were found ( table 1 ) . light microscopy of the second renal biopsy specimens revealed 31 glomeruli , of which 4 had global sclerosis , 2 had segmental sclerosis with cellular variant , while the remainder were mga . the bubbling appearance of glomerular loops was detected at higher magnification on pam staining , as in the first biopsy , although their number had markedly decreased . immunofluorescent staining was positive for igm , c3 , and c1q in the segmental sclerosis lesions , whereas all were negative in the other lesions . electron microscopy revealed endothelial cell swelling and endocapillary cell proliferation in the segmental sclerotic lesions . the microspheres observed in the gbm were sparser than in the first biopsy ( fig . prednisolone 40 mg / day ( 0.7 mg / kg ) was prescribed , and the up level gradually decreased . this case exhibited microspheres in the gbm on the electron microscopic findings at the first renal biopsy , although light microscopy showed only mga . joh et al . reported 25 cases with microspheres and microtubular structures in the gbm as pig . the light microscopic findings of pig reveal a bubbling or stipple formation in association with an occasional spike formation on pam staining . on electron microscopy , cytoplasmic processes of podocytes infold into the gbm , which involves thickening of the lamina densa . these microspheres or microtubular structures have a unit membrane and may be equivalent to a cytoplasmic membrane . on the first biopsy , this case showed mga in the light microscopic findings . in previous reports , of which 2 were diagnosed as rheumatoid arthritis and mixed connective tissue disease , and 1 exhibited lupus - like characteristics , immunofluorescent staining revealed immunoglobulin deposition . the other case was diagnosed as minimal change nephrotic syndrome and pig complicated by sjgren 's syndrome ; immunoglobulin and complement were negative on immunofluorescent staining , and podocytic infolding and foot process effacement were found on electron microscopy . our case was different from the former 3 cases because immunoglobulin and complement were both negative , and from the latter case because of the clinical findings and scattered foot process effacement . the second biopsy in our case showed pig complicated by fsgs with fewer findings of podocytic infolding . previous reports include 4 cases of pig complicated by fsgs . one of them , who had serial biopsies , was diagnosed after the first biopsy as having pig and fsgs associated with vesico - ureteral reflux ( vur ) . after a urethral catheter had been in place for a year , the second biopsy revealed findings indicative of fsgs and the disappearance of almost all podocytic infolding . there is the possibility that on the initial biopsy our patient had fsgs that could not be detected by renal biopsy because of the small number of lesions . the fact that the first biopsy revealed scattered foot process effacement and one global sclerosis has indicated the possibility of fsgs at the initial biopsy . therefore , our case might have been diagnosed as pig and fsgs at the first biopsy . however , in the pig case with fsgs due to vur , the second biopsy showed less podocytic infolding than the first , as the up decreased with improving vur . therefore , in pig complicated with fsgs , the amount of podocytic infolding would be in proportion to up level . on the other hand , our case showed less podocytic infolding at the second biopsy even though the up increased . this would be compatible with our case having had pig without fsgs , rather than complicated with fsgs at the first biopsy . moreover , it is more important to make clear whether podocyte infolding is a morphological phenomenon or a finding of a new disease entity . especially in fsgs in which podocyte injury is evaluated as fundamental damage , podocyte infolding may be caused by a morphological phenomenon of fsgs . however , because of a decrease of these lesions despite an increased up level at the second biopsy , the podocyte infolding may be a new disease entity such as pig which trends to associate with fsgs and collagen disease . if the podocytic infolding is a morphological phenomenon of fsgs , the podocytic infolding would be increased in proportion to increased up . some of the cases with podocyte infoldings , which until now have been believed to be a morphological phenomenon with other glomerulonephritis , would be a new disease entity . to discuss whether this lesion is pig or a morphological phenomenon , however , in collagen disease - associated pig , the mechanism might involve antibody complement - mediated factors , which might be related to the role of special types of complement activation in situ on the microstructures , as developed on immune electron microscopic analysis . however , some of these cases were negative for immunoglobulin and complement in the immunofluorescence findings . further cases of pig need to be analyzed in order to determine whether pig is a new disease entity or a transient morphological finding of a well - known disease .\noutput:\n" }, { "from": "agent", "value": "podocytic infolding glomerulopathy ( pig ) has been proposed as a new disease entity . a 14 - year - old girl underwent renal biopsy at our institution because of a chance finding of proteinuria . light microscopic findings revealed a minor glomerular abnormality , but under a higher magnification , after periodic acid methenamine silver staining , a bubbling appearance in the glomerular basement membrane ( gbm ) was observed . an electron microscopic examination revealed microspheres in the gbm , which were sparse but global . the patient was diagnosed as having pig . after 3 years , her urinary protein had increased and a second biopsy was performed , showing focal segmental glomerulosclerosis in addition to a lesser degree of podocytic infolding than at the first biopsy . this is the first report of a case complicated by a different type of glomerulonephritis after being diagnosed as pig . a few cases of pig are complicated by focal segmental glomerulosclerosis , suggesting several mechanisms for the disorder ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is important in conveying the daily cycle of light and darkness to the body , thus regulating circadian rhythms . in addition to its regulatory role , melatonin has antioxidative capacity , immunomodulatory potency , and also appears to be protective against certain types of cancers . type 1 diabetes mellitus ( t1 dm ) is a t cell - mediated autoimmune disease characterized by excess inflammation , independent of adiposity and glycemic control . the incidence of t1 dm diabetes is increasing at 3 - 5 % per year worldwide , and this increase can not be accounted for by known genetic factors . it has been well known that both oxidative stress and inflammatory activity play crucial roles in the pathogenesis of t1 dm . little information is available on the different patterns of type 1 diabetes progression following diagnosis , particularly in the pediatric population . the relation between melatonin and t1 dm in children and adolescents was not investigated before . forty children and adolescents with t1 dm ( 18 boys and 22 girls , mean age 10.433.25 years ) and 30 healthy control subjects ( 17 boys and 13 girls , mean age 9.834.36 years ) participated in the study . all patients followed in pediatric endocrinology and metabolism unit of gaziantep university faculty of medicine and also control subjects had no hypertension , obesity , hyperlipidemia , anemia , and infection . patients with other forms of diabetes ( type 2 , maturity - onset diabetes of the young , thiamine responsive megaloblastic anemia ) were not included in the study . in the present study we enrolled only children who fulfilled the following eligibility criteria for control group : 1 ) prepubertal and pubertal age ; 2 ) absence of acute or chronic inflammatory and autoimmune diseases ; 3 ) lack of diabetes mellitus , primary hyperlipidemia , hypertension , anemia and obesity ; and 4 ) no current regular medications . antropometric data included height , body weight , body mass index ( bmi ) , and blood pressure . bmi was calculated using measured weight ( kilograms ) , hemoglobin , hematocrit , white blood cell count , free thyroxine , thyroid stimulating hormone and antithyroid peroxidase antibody levels were divided by measured height ( meters ) squared . blood samples were collected during routine analysis , after overnight fasting between 08:30 and 09:00 a.m. after separation , serum samples were immediately stored at -70 c until analyzed for measuring melatonin . serum glucose , total cholesterol , high - density lipoprotein , low - density lipoprotein , triglyceride evaluated by chemical immunoassay method in patients and controls . glycosylated hemoglobulin ( hba1c ) was measured as a marker of glycemic control in diabetic patients . hba1c levels were mathematically standardized to the diabetes control and complications trial reference range of 4.05 - 6.05 % using multiple of the mean transformation . hba1c was not measured in control group because there were no diabetic patients in control group . thyroid peroxidase antibodies were defined as positive if higher than 40 u / ml ( antibody titer ) . the diagnosis of hashimoto thyroiditis was established by demonstrating high level of antithyroid peroxidase antibody levels . tissue transglutaminase antibody level was analysed by enzyme - linked immunosorbent assay ( elisa ) . celiac disease was suspected if tissue transglutaminase antibody level were higher than 15 u. in this study , melatonin levels were detected with a sandwich enzyme - linked immonosorbent assay ( elisa ) . the assay procedure follows the basic principle of competitive elisa whereby there is competition between a biotinylated and a non - biotinylated antigen for a fixed number of antibody - binding sites . the amount of biotinylated antigen bound to the antibody is inversely proportional to the analyzed concentration of the sample . the differences between groups were tested by the t - test for independent samples with normal data distribution or by the mann - whitney non - parametric test . the differences between groups were tested by the t - test for independent samples with normal data distribution or by the mann - whitney non - parametric test . the mean diabetic duration was 2.892.69 years and the mean age of diabetes was 10.493.23 years . there was no obesity , hyperlipidemia , hypertension , thyroid dysfunction , anemia , and infection in diabetic patients . there was no obesity , hypertension , hyperglycemia , hyperlipidemia , thyroid dysfunction , hashimoto thyroiditis , celiac disease , anemia , and infection in controls . characteristics of the patients and controls in the study population there were no statistically significant differences in age , sex , bmi distribution between diabetic group and control group ( p 0.05 ) . mean melatonin level in diabetic group was 6.753.52 pg / ml and mean melatonin level in control group was 11.514.74 pg / ml . melatonin levels were significantly lower in diabetic group compared to controls ( p 0.01 ) [ table 1 ] . the present study looked for clues for preventing complications related with t1 dm by investigating melatonin level in these patients . there are extra - pineal sites of melatonin production , such as the retina , skin , bone marrow , lymphocytes and the gut , from where it may influence other physiological functions . melatonin is synthesized from its precursor , the essential amino acid tryptophan ( trp ) in a series of four enzymatic steps . the rate of melatonin formation depends on the activity of enzymes - arylalkylamine - n - acetyltransferase and to a lesser extent , tryptophan hydroxylase . if intake of trp is severely restricted , synthesis of melatonin is significantly reduced in humans . several vitamins and minerals like folate , b6 vitamin , and b12 vitamin act as co - factors in these processes . pineal melatonin levels begin increasing in the late evening , reaching the maximum in the early hours between 2:00 and 4:00 a.m. , followed by a slow decline to lower daytime levels . endogenous nocturnal melatonin production has been estimated to be about 10 - 80 g per night , daytime production being significantly less . the following physiological variables attain peak levels during sleep : tsh , prolactin , melatonin , acth , fsh , lh , cortisol , and lymphocyte and eosinophil counts . circadian rhythms are generated by suprachiasmatic nucleus in the hypothalamus and are influenced by a variety of factors . disruption of the circadian rhythm and sleep - wake cycles are considered risk factors for a variety of health problems including obesity and cardiovascular disease . several preclinical studies have identified dietary components , such as glucose , sodium , ethanol , or caffeine being capable of phase - shifting circadian rhythms by modifying the expression of genetic components of the biological clock , i.e. clock genes . we estimate that alterations in metabolism like t1 dm are able to entrain physiological clocks , resulting in changes to the rhythms . this study showed that melatonin levels were significantly lower in diabetic group compared to controls . even though melatonin levels were not at peak level and single blood sample in the morning may be insufficient to estimate total melatonin levels over a 24 - hour period the conditions were the same for diabetic group and control group . despite these limitationsinvestigations showed that hyperinsulinemic goto - kakizaki rats , which are a rat model of type 2 diabetic rats , and humans have decreased melatonin plasma levels , whereas a streptozotocin - induced rat model of diabetes developed reduced insulin levels combined with increased melatonin levels . this finding is supported by the other study in goto - kakizaki rats that an increase of plasma insulin was combined with a decrease of plasma noradrenaline ( norepinephrine ) , the most important activator of melatonin synthesis . melatonin is anabolic hormone like insulin and it relates to the promotion of restorative or anabolic physiological processes . in humans , elevated melatonin levels have been associated with reduced core temperature , increased heat loss , decreased cardiovascular output , reduced alertness , and enhanced immune responsiveness ; therefore , insulin treatment may affect melatonin secretion . exogenous melatonin has been used for the treatment of sleep disorders of circadian origin such as jet lag and delayed sleep phase syndrome and as a complement of other therapeutic drugs for the treatment of numerous diseases including glaucoma , irritable bowel disease , and certain types of cancers mainly to either enhance the therapeutic effect of conventional drug therapy or to reduce their toxicity thus ameliorating the side - effects . in addition to melatonin 's role as an endogenous synchronizer , growing evidence suggests its anti - oxidative activity as well as its having a role in modulating immune responses . it is well known that oxidative stress is thought to be involved in both development of t1 dm and its further complications . melatonin protects pancreatic - cells and several diabetes - affected organs including kidney , brain , retina and vasculature system from the associated nitro - oxidative stress . this preliminary study raises the possibility that exogenous melatonin treatment may play role in preventing process of inflammation and oxidative stress patients with t1 dm because melatonin levels were significantly lower in diabetic group .\noutput:\n" }, { "from": "agent", "value": "objective : melatonin is an indolamine hormone , synthesized from tryptophan in the pineal gland primarily . melatonin exerts both antioxidative and immunoregulatory roles but little is known about melatonin secretion in patients with type 1 diabetes mellitus ( t1 dm ) . the aim of this study was to measure serum melatonin levels in patients with t1 dm and investigates their relationship with type 1 diabetes mellitus.materials and methods : forty children and adolescents with t1 dm ( 18 boys and 22 girls ) and 30 healthy control subjects ( 17 boys and 13 girls ) participated in the study . all patients followed in pediatric endocrinology and metabolism unit of gaziantep university faculty of medicine and also control subjects had no hypertension , obesity , hyperlipidemia , anemia , and infection . blood samples were collected during routine analysis , after overnight fasting . serum melatonin levels were analyzed with elisa.results : there were no statistically significant differences related with age , sex , bmi distribution between diabetic group and control group . mean diabetic duration was 2.89 2.69 years . the variables were in the equation . mean melatonin level in diabetic group was 6.75 3.52 pg / ml and mean melatonin level in control group was 11.51 4.74 pg / ml . melatonin levels were significantly lower in diabetic group compared to controls ( p < 0.01 ) . conclusions : melatonin was associated with type 1 diabetes mellitus significantly . because of the varied roles of melatonin in human metabolic rhythms , these results suggest a role of melatonin in maintaining normal rhythmicity . melatonin may play role in preventing process of inflammation and oxidative stress ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we used an updated version of the hiv synthesis transmission model , an individual - based stochastic model of hiv transmission and infection progression and treatment among heterosexuals that has been previously described . the model includes an age structure , and sexual risk behavior is modeled as the number of short - term partners with whom sex is condomless and the presence of a long - term partner with whom sex is condomless in each period . in any given period , the probability of an hiv - negative person having condomless sex with a partner who is hiv - positive depends on the number of sex partners of the hiv - negative partner and on the prevalence of hiv among the sex partners , accounting for patterns of age mixing . given exposure to an hiv - positive sex partner , the probability of transmission depends on the viral load of the partner ( obtained by sampling from the distribution of viral loads in partnerships formed by hiv - positive people , accounting for gender and age ) , on the estimated risk of transmission at that viral load , on the presence of a concurrent sexually transmitted infection , and on gender . for people who have become infected with hiv , the variables modeled include their viral load and cd4 t - cell count , whether resistance mutations are present in their viral population , their risk of aids and death , whether they have tested positive for hiv , whether they are linked to care , whether they are remaining in care , and whether they are receiving treatment , if eligible . the model of progression of hiv and the effect of art has been shown to provide a generally close fit to observed data relating to the natural progression of hiv infection and the effect of art . so that observed trends in testing and the proportion of infected individuals receiving a diagnosis can be mimicked , people within the model who have not tested positive for hiv and who have access to hiv testing have an increasing chance over calendar years to be tested for hiv . updates to the model presented here , compared with the version of the model previously published , include age and gender - specific rates of first - time and repeat testing , including self - testing , and calibration to reflect hiv prevalence and age - specific and gender - specific levels of testing observed in zimbabwe ( supplementary materials ) . the model was programmed in sas software , version 9.3 ( sas institute , cary , north carolina ) . the hiv epidemic in zimbabwe is simulated until 2015 on the basis of existing data on hiv prevalence and hiv testing . from 2015 , we compare two possible base case scenarios : a reference scenario , in which self - testing is not introduced and there is continued reliance on phtc alone , and the self - testing scenario , in which self - testing is made available to the general population aged 1565 years from 2015 onward . in the reference scenario , the rates of first - time and repeat testing increase linearly by 0.5 % per year ( the proportion tested for hiv in the last year is 39 % in 2015 , increasing up to 48 % in 2035 ) , and the rates of being linked to care , being retained in pre - art care , and initiating art , if eligible , remain the same as they were before 2015 . one single simulation run was performed up to 2015 , while several hundred runs were simulated for the two scenarios from 2015 through 2035 , with means taken to limit stochastic effects ( the extent of uncertainty due to stochastic effects is conveyed by providing 95 % confidence limits ) . the introduction of self - testing is assumed to have 3 main effects : ( 1 ) halving of the population unwilling to receive an hiv test ( from 5 % to 2.5 % ) , ( 2 ) substituting 10 % of first - time and 30 % of repeat phtc with self - tests , and ( 3 ) increasing the rate of first - time and repeat testing by 20 % , owing to the availability of self - testing . the availability of self - testing is not assumed to affect phtc in antenatal care settings . these assumptions are based on limited current evidence but , overall , are believed to be conservative in estimating the potential benefits of self - testing . the sensitivity and specificity of self - testing were assumed to be 92 % and 99 % , respectively , as observed in the studies leading to fda approval of the oraquick in - home hiv test . variability across studies has been observed in the sensitivity of the oraquick in - home hiv test , mainly reflecting the models and approaches used for hiv self - testing and the population of individuals who tested for hiv . high accuracy ( 99.2 % ) has been found both in studies that offered supervised self - testing and studies characterized by a lower level of supervision . to our knowledge , only one study reported a lower accuracy than that identified in the oraquick fda studies , and this was due to the lack of information given on how to interpret a faint positive result and to the fact that people receiving art were self - testing . it is known that art may decrease the overall sensitivity of oral fluid - based self - testing . in this analysis , we assumed that only people who had an unknown hiv status ( and were therefore not receiving art ) could use self - testing . phtc was considered more accurate , with a sensitivity estimated to be 98 % and a specificity of 100 % ( given confirmatory testing , when a person is found to be hiv positive , it is unlikely that a person receives a diagnosis of hiv infection if they are not infected ) . once a person receives a positive self - test result , a confirmatory phtc was assumed to be necessary to consider a person as having a diagnosis of hiv infection , as well as the possibility of linking that person to care ( ie , where they receive an art - eligibility assessment ) and eventually initiating art . the probability of a confirmatory phtc by 1 year following a positive self - test result was assumed to be 0.8 , based on evidence that , in the context of supervised self - testing , most people disclose to their counselor . once the person receives a diagnosis ( following a positive phtc result ) , the probability of being linked to care was assumed to be 0.6 within 1 year after diagnosis , regardless of whether they initially underwent self - testing or phtc . no change in the frequency of condomless sex among people who tested negative for hiv was assumed , whereas those who tested positive for hiv reduced the frequency of condomless sex with casual partners by 17 % in the first 6 months ( and by 9 % afterward ) and by 13 % with long - term partners , regardless of the type of hiv test . in the context of vct , there is evidence that this is the case , and in the base case we assume that this holds for self - testing , although we are assuming quite a small effect . people were assumed to be eligible for art when their cd4 t - cell count decreased to below 500 cells / mm in the base case , in line with guidelines in zimbabwe and from the who . implementation of prevention of mother - to - child - transmission option b + ( ie , provision of lifelong art for pregnant and breast - feeding women ) was not taken into account . the two scenarios ( the reference scenario and the self - testing scenario ) were compared on the basis of their costs and health outcomes , which are both discounted to present values at 3 % per annum , from a healthcare perspective . costs were estimated on the basis of resource use ( eg , number of tests and number of clinic visits ) and associated unit costs . the fully loaded cost of a phtc was assumed to be $ 9 for a negative test result and $ 25 for a positive test result or a confirmatory test following a positive self - test result , so that the average cost was around $ 10 . the fully loaded cost of self - testing was assumed to be $ 3 per unit . health outcomes were summarized in the form of disability - adjusted life - years ( dalys ) averted , which captures changes in both mortality and morbidity , including the impact on onward hiv transmission ( supplementary materials ) . results are presented across a range of cost - effectiveness thresholds ( cets ) from $ 0 ( an extreme case , implying a health system would only be concerned with reducing costs ) to $ 10000 ( a relatively high threshold only likely to be relevant in well - financed health systems with full coverage of interventions offering health gains at less than this amount ) . costs and health outcomes were rescaled to provide figures relevant to the entire adult population ( 1565 years old ) of zimbabwe . because of the stochastic variation inherent in the model , a high number of simulations were required , so figures are presented on a discrete scale , rather than a continuous scale . the following parameters were varied in univariate sensitivity analyses : the cost of self - testing , the sensitivity of self - testing , the probability of phtc as a direct consequence of a positive self - test , the probability of being linked to care by 1 year after a positive phtc result ( whether prompted by a self - testing or not ) , and the reduction in the frequency of condomless sex for those receiving a diagnosis on the basis of a positive self - test result , eligibility criteria to initiate art , the magnitude of the increase in the rates of first and repeat testing due to the introduction of self - testing , and the level of substitution of self - testing for phtc . we used an updated version of the hiv synthesis transmission model , an individual - based stochastic model of hiv transmission and infection progression and treatment among heterosexuals that has been previously described . the model includes an age structure , and sexual risk behavior is modeled as the number of short - term partners with whom sex is condomless and the presence of a long - term partner with whom sex is condomless in each period . in any given period , the probability of an hiv - negative person having condomless sex with a partner who is hiv - positive depends on the number of sex partners of the hiv - negative partner and on the prevalence of hiv among the sex partners , accounting for patterns of age mixing . given exposure to an hiv - positive sex partner , the probability of transmission depends on the viral load of the partner ( obtained by sampling from the distribution of viral loads in partnerships formed by hiv - positive people , accounting for gender and age ) , on the estimated risk of transmission at that viral load , on the presence of a concurrent sexually transmitted infection , and on gender . for people who have become infected with hiv , the variables modeled include their viral load and cd4 t - cell count , whether resistance mutations are present in their viral population , their risk of aids and death , whether they have tested positive for hiv , whether they are linked to care , whether they are remaining in care , and whether they are receiving treatment , if eligible . the model of progression of hiv and the effect of art has been shown to provide a generally close fit to observed data relating to the natural progression of hiv infection and the effect of art . so that observed trends in testing and the proportion of infected individuals receiving a diagnosis can be mimicked , people within the model who have not tested positive for hiv and who have access to hiv testing have an increasing chance over calendar years to be tested for hiv . updates to the model presented here , compared with the version of the model previously published , include age and gender - specific rates of first - time and repeat testing , including self - testing , and calibration to reflect hiv prevalence and age - specific and gender - specific levels of testing observed in zimbabwe ( supplementary materials ) . the model was programmed in sas software , version 9.3 ( sas institute , cary , north carolina ) . the hiv epidemic in zimbabwe is simulated until 2015 on the basis of existing data on hiv prevalence and hiv testing . from 2015 , we compare two possible base case scenarios : a reference scenario , in which self - testing is not introduced and there is continued reliance on phtc alone , and the self - testing scenario , in which self - testing is made available to the general population aged 1565 years from 2015 onward . in the reference scenario , the rates of first - time and repeat testing increase linearly by 0.5 % per year ( the proportion tested for hiv in the last year is 39 % in 2015 , increasing up to 48 % in 2035 ) , and the rates of being linked to care , being retained in pre - art care , and initiating art , if eligible , remain the same as they were before 2015 . one single simulation run was performed up to 2015 , while several hundred runs were simulated for the two scenarios from 2015 through 2035 , with means taken to limit stochastic effects ( the extent of uncertainty due to stochastic effects is conveyed by providing 95 % confidence limits ) . the introduction of self - testing is assumed to have 3 main effects : ( 1 ) halving of the population unwilling to receive an hiv test ( from 5 % to 2.5 % ) , ( 2 ) substituting 10 % of first - time and 30 % of repeat phtc with self - tests , and ( 3 ) increasing the rate of first - time and repeat testing by 20 % , owing to the availability of self - testing . the availability of self - testing is not assumed to affect phtc in antenatal care settings . these assumptions are based on limited current evidence but , overall , are believed to be conservative in estimating the potential benefits of self - testing . the sensitivity and specificity of self - testing were assumed to be 92 % and 99 % , respectively , as observed in the studies leading to fda approval of the oraquick in - home hiv test . variability across studies has been observed in the sensitivity of the oraquick in - home hiv test , mainly reflecting the models and approaches used for hiv self - testing and the population of individuals who tested for hiv . high accuracy ( 99.2 % ) has been found both in studies that offered supervised self - testing and studies characterized by a lower level of supervision . to our knowledge , only one study reported a lower accuracy than that identified in the oraquick fda studies , and this was due to the lack of information given on how to interpret a faint positive result and to the fact that people receiving art were self - testing . it is known that art may decrease the overall sensitivity of oral fluid - based self - testing . in this analysis , we assumed that only people who had an unknown hiv status ( and were therefore not receiving art ) could use self - testing . phtc was considered more accurate , with a sensitivity estimated to be 98 % and a specificity of 100 % ( given confirmatory testing , when a person is found to be hiv positive , it is unlikely that a person receives a diagnosis of hiv infection if they are not infected ) . once a person receives a positive self - test result , a confirmatory phtc was assumed to be necessary to consider a person as having a diagnosis of hiv infection , as well as the possibility of linking that person to care ( ie , where they receive an art - eligibility assessment ) and eventually initiating art . the probability of a confirmatory phtc by 1 year following a positive self - test result was assumed to be 0.8 , based on evidence that , in the context of supervised self - testing , most people disclose to their counselor . once the person receives a diagnosis ( following a positive phtc result ) , the probability of being linked to care was assumed to be 0.6 within 1 year after diagnosis , regardless of whether they initially underwent self - testing or phtc . no change in the frequency of condomless sex among people who tested negative for hiv was assumed , whereas those who tested positive for hiv reduced the frequency of condomless sex with casual partners by 17 % in the first 6 months ( and by 9 % afterward ) and by 13 % with long - term partners , regardless of the type of hiv test . in the context of vct , there is evidence that this is the case , and in the base case we assume that this holds for self - testing , although we are assuming quite a small effect . people were assumed to be eligible for art when their cd4 t - cell count decreased to below 500 cells / mm in the base case , in line with guidelines in zimbabwe and from the who . implementation of prevention of mother - to - child - transmission option b + ( ie , provision of lifelong art for pregnant and breast - feeding women ) was not taken into account . the two scenarios ( the reference scenario and the self - testing scenario ) were compared on the basis of their costs and health outcomes , which are both discounted to present values at 3 % per annum , from a healthcare perspective . costs were estimated on the basis of resource use ( eg , number of tests and number of clinic visits ) and associated unit costs . the fully loaded cost of a phtc was assumed to be $ 9 for a negative test result and $ 25 for a positive test result or a confirmatory test following a positive self - test result , so that the average cost was around $ 10 . the fully loaded cost of self - testing was assumed to be $ 3 per unit . health outcomes were summarized in the form of disability - adjusted life - years ( dalys ) averted , which captures changes in both mortality and morbidity , including the impact on onward hiv transmission ( supplementary materials ) . results are presented across a range of cost - effectiveness thresholds ( cets ) from $ 0 ( an extreme case , implying a health system would only be concerned with reducing costs ) to $ 10000 ( a relatively high threshold only likely to be relevant in well - financed health systems with full coverage of interventions offering health gains at less than this amount ) . costs and health outcomeswere rescaled to provide figures relevant to the entire adult population ( 1565 years old ) of zimbabwe . because of the stochastic variation inherent in the model , a high number of simulations were required , so figures are presented on a discrete scale , rather than a continuous scale . the following parameters were varied in univariate sensitivity analyses : the cost of self - testing , the sensitivity of self - testing , the probability of phtc as a direct consequence of a positive self - test , the probability of being linked to care by 1 year after a positive phtc result ( whether prompted by a self - testing or not ) , and the reduction in the frequency of condomless sex for those receiving a diagnosis on the basis of a positive self - test result , eligibility criteria to initiate art , the magnitude of the increase in the rates of first and repeat testing due to the introduction of self - testing , and the level of substitution of self - testing for phtc . introduction of self - testing , as assumed in the base case scenario , led in 2035 to a 7 % higher proportion tested for hiv in the past year , compared with the reference scenario ( 57 % vs 50 % ; table 1 ) . the total discounted costs over 20 years for hiv testing and resulting hiv care and art under the reference scenario base case assumptions is estimated to be almost $ 3.1 billion ( figure 1 ) . of this , 40 % is attributable to the cost of antiretroviral drugs , around a quarter to the cost of clinic visits , and 24 % to the cost of phtc . over a 20 - year period , the self - testing scenario is predicted to lead to savings of $ 75 million ( 95 % confidence interval [ ci ] , $ 73 million $ 77 million ) , for a cost reduction of 2.6 % , due primarily to lower testing costs . the introduction of self - testing would also result in health gains , with approximately 7000 dalys averted ( 95 % ci , 70013000 dalys averted ; table 2 ) . table 1 . predictions over time in the reference scenario and the self - testing scenariovariable2011 dhs datamodel estimatebaselinereference scenarioself - testing scenario20152025203520252035hiv prevalence , % 1513107107ever tested for hiv , % 506677798083tested for hiv in the past year , % 283948505457received hiv infection diagnosis , % 5666696669model estimates are median values of all simulations.abbreviations : art , antiretroviral therapy ; hiv , human immunodeficiency virus . table 2.cost - effectiveness for the self - testing scenario ( sts ) and reference scenario ( rs ) under base case assumptions and alternative assumptions and according to cost - effectiveness thresholdvariablecost - effectiveness threshold , $ total discounted change in costs , $ 1 million , compared with rs ( 95 % ci ) discounted dalys averted , 1000 , compared with rs ( 95 % ci ) 05001000500010000base casestsstsstsstssts75 ( 77 to 73 ) 7 ( .713 ) cost of st , $ 9 ( base case : $ 3 ) rsrsrsrsrs136 ( 134137 ) 7 ( .713 ) sensitivity of st , 0.55 ( base case : 0.92 ) stsstsstsstsrs81 ( 84 to 79 ) 11 ( 22 to .5 ) probability of phtc as a direct consequence of a positive st , 0.37 ( base case : 0.8 ) stsstsstsstssts87 ( 90 to 84 ) 0.1 ( 11 to 11 ) linkage to care following diagnosis for those who had a st of 0.4 by 1 y ( base case : 0.6 ) stsstsstsrsrs105 ( 112 to 97 ) 19 ( 32 to 6 ) art initiation at cd4350 cells / mm ( base case : cd4350 cells / mm without introduction of st ) stsstsstsrsrs69 ( 74 to 64 ) 21 ( 40 to 2 ) no reduction in condomless sex following a positive st ( base case : as phtc ) stsstsstsstssts74 ( 77 ; 70 ) 19 ( 633 ) increase in rate of first test due to st ( base case : 20 % ) 2.5 % stsstsstsstssts82 ( 85 to 79 ) 10 ( .6 to 20 ) 7.5 % stsstsstsstssts81 ( 85 to 78 ) 13 ( .6 to 26 ) increase in rate of repeat test due to st ( base case : 20 % ) 2.5 % stsstsstsstssts102 ( 105 to 994 ( 6 to 14 ) 7.5 % stsstsstsstssts82 ( 86 to 78 ) 13 ( 1 to 26 ) substitution ( base case : 30 % for repeat test , 10 % for first test ) 5 % for repeat test , 2 % for first testrsrsstsstssts38 ( 3441 ) 39 ( 2057 ) 15 % for repeat test , 5 % for first teststsstsstsstssts12 ( 17 to 7 ) 22 ( 539 ) 25 % for repeat test , 8 % for first teststsstsstsstssts52 ( 57 to 47 ) 20 ( .539 ) the discounted total cost of the rs over 20 years from 2015 is $ 3168 million.abbreviations : art , antiretroviral therapy ; cd4 , cd4 t - cell count ; ci , confidence interval ; daly , disability - adjusted life - year ; phtc , provider - delivered human immunodeficiency virus testing and counseling ; st , self - testing . abbreviations : art , antiretroviral therapy ; cd4 , cd4 t - cell count ; ctx , cotrimoxazole ; phtc , provider - delivered human immunodeficiency virus testing and counseling ; rs , reference scenario ; st , self - testing ; sts , self - testing scenario ; who 3/4 , treatment of world health organization stage 3 and 4 human immunodeficiency virus disease . predictions over time in the reference scenario and the self - testing scenario model estimates are median values of all simulations . cost - effectiveness for the self - testing scenario ( sts ) and reference scenario ( rs ) under base case assumptions and alternative assumptions and according to cost - effectiveness threshold the discounted total cost of the rs over 20 years from 2015 is $ 3168 million . abbreviations : art , antiretroviral therapy ; cd4 , cd4 t - cell count ; ci , confidence interval ; daly , disability - adjusted life - year ; phtc , provider - delivered human immunodeficiency virus testing and counseling ; st , self - testing . abbreviations : art , antiretroviral therapy ; cd4 , cd4 t - cell count ; ctx , cotrimoxazole ; phtc , provider - delivered human immunodeficiency virus testing and counseling ; rs , reference scenario ; st , self - testing ; sts , self - testing scenario ; who 3/4 , treatment of world health organization stage 3 and 4 human immunodeficiency virus disease . table 2 summarizes increments in total discounted costs and total discounted dalys averted with the self - testing scenario , compared with the reference scenario , along with the cost - effectiveness of self - testing , under the base case and alternative assumptions in sensitivity analyses . this is provided for different cets . in general , for any scenario in which dalys are averted , the probability that self - testing is cost - effective will increase with increasing cets , because at some point the cost of the dalys averted becomes affordable . in contrast , for scenarios that lead to a loss in dalys , self - testing is less likely to be cost - effective with increasing cets because at some point the money saved from the self - testing scenario is not worth the loss in dalys . if the cost of self - testing is the same as that of a negative result of a phtc - associated test ( $ 9 ) , it is not cost - effective at a cet of $ 10000 per daly averted or less because it results in higher costs ( $ 136 million more than under the reference scenario ) but relatively small health gains . if , however , self - testing were to cost $ 4 or less , then the self - testing scenario would be cost - effective even at a cet of $ 500 , keeping other base case assumptions fixed ( figures 3 and 4 ) . figure 2.cost - effective scenario under different assumptions of substitution and probability of provider - delivered human immunodeficiency virus testing and counseling ( phtc ) as a direct consequence of a positive self - testing ( st ) . abbreviations : cet , cost - effectiveness threshold ; f , substitution of phtc with self - testing during first test ; r , substitution of phtc with self - testing during repeat test . figure 3.cost - effective scenario under different assumptions of substitution and cost of self - testing ( st ) . abbreviations : cet , cost - effectiveness threshold ; f , substitution of provider - delivered human immunodeficiency virus testing and counseling with self - testing during first test ; r , substitution of provider - delivered human immunodeficiency virus testing and counseling with st during repeat test . figure 4.cost - effective scenario under different assumed increases in the rates of first test and repeat test and cost of self - testing ( st ) . cost - effective scenario under different assumptions of substitution and probability of provider - delivered human immunodeficiency virus testing and counseling ( phtc ) as a direct consequence of a positive self - testing ( st ) . abbreviations : cet , cost - effectiveness threshold ; f , substitution of phtc with self - testing during first test ; r , substitution of phtc with self - testing during repeat test . cost - effective scenario under different assumptions of substitution and cost of self - testing ( st ) . abbreviations : cet , cost - effectiveness threshold ; f , substitution of provider - delivered human immunodeficiency virus testing and counseling with self - testing during first test ; r , substitution of provider - delivered human immunodeficiency virus testing and counseling with st during repeat test . cost - effective scenario under different assumed increases in the rates of first test and repeat test and cost of self - testing ( st ) . the level of substitution of phtc with self - testing affects the results in a slightly counterintuitive way ( figure 2 ) . at all cets considered ( $ 1 $ 1000 ) , the lower cost self - testing is preferred even when the probability of phtc following a positive self - test result ( and therefore the chance of receiving a diagnosis ) is low ; this is the case even at relatively high cets , because even if the probability of phtc as a direct consequence of a positive self - test is low and the level of substitution high , the cost savings outweighs the loss in health . self - testing is clearly more likely to be cost - effective as the cost of self - testing decreases ( figures 3 and 4 ) . regarding the levels of increase in the frequencies of undergoing an initial test and a repeat test due to the availability of self - testing ( figure 4 ) , we found that the greater the levels of increase , the greater the total cost ; however , this is counterbalanced by the dramatic cost savings due to the partial substitution of phtc with self - testing . it may enable some people to test who would not otherwise choose phtc because of stigma , confidentiality , cost , or other barriers to access . it may also increase the overall frequency of testing in the population , owing to greater convenience . as the basis for affirming hiv status , leading to linkage to care and receipt of art for those eligible , as well as prompting individuals who learn they are hiv - positive to reduce the risks of onward hiv transmission to others , the potential health gains from self - testing are clear . what is more , self - testing may also reduce costs , enabling savings in hiv testing programs that can be reinvested in further expansion of testing or in delivery of other hiv - and healthcare - related interventions . overall , under our base case assumptions , we estimate that the introduction of self - testing will allow savings of around $ 75 million over 20 years in zimbabwe , with a low number of dalys averted ( 7000 , in the context of an adult population of 7.5 million in mid-2013 ) . if these assumptions hold in other settings , self - testing should always be introduced , regardless of how poorly or well resourced a health system is , because it leads to a win - win situation involving better health outcomes at reduced cost . if we assume a cet of $ 500 ( similar to zimbabwe 's gross domestic product per capita in 2012 ) , the $ 75 million savings could be used to avert at least 150000 dalys by introduction of interventions with incremental cost - effectiveness ratios of $ 500 or less per daly averted . the monetary value of introducing self - testing to zimbabwe ( ie , the net monetary benefit , calculated as follows : [ health gains cet ] + cost savings ) would be $ 78.5 million over 20 years , indicating huge benefits associated with supporting the availability of self - testing in the country . however , the population costs and health effects of self - testing depend on a range of complex and interacting factors , and there are plausible scenarios with characteristics such as an inadequate cascade of care following self - testing that would result in worse outcomes than those of the reference scenario . our sensitivity analyses provide insight into what determines the magnitude of population health gains and suggest what programmatic recommendations may support optimal implementation of self - testing . first , the cost of self - testing relative to that of phtc appears to be the most important factor determining cost - effectiveness , particularly at lower cets . the oraquick hiv test kit designed for clinical use was sold for $ 4 in low - income countries in 2005 . lower - cost alternatives to self - testing would lead to additional gains if these were to become available . the cost of distributing self - tests can not be ignored , but it is expected to be significantly lower than the cost of providing phtc . to the best of our knowledge , data on the cost of rolling out self - testing are not currently available , and the only study conducted in sub - saharan africa evaluating the uptake of self - testing distributed the kit through community counselors . second , we evaluated the impact of introducing self - testing in addition to phtc in a setting such as zimbabwe , with a high level of hiv diagnosis and art coverage ; in 2015 , before the introduction of self - testing , an estimated 85 % of people with hiv receive a diagnosis . it is likely that the impact of introducing self - testing would be even greater as the proportion of people with hiv infection that is undiagnosed increases . third , in some circumstances , self - testing may lead to improved health outcomes but also to higher costs , compared with the reference scenario , if the overall level of testing ( ie , the increase in the rate of first - time and repeat testing ) increases dramatically because of the availability of self - testing . the few studies conducted so far on uptake of self - testing have found it to be extremely acceptable . studies in malawi , for example , have shown that 76 % of adults avail themselves of self - testing by 12 months following its introduction . in settings with higher cets , the potential for health improvement will usually outweigh higher costs . appropriate targeting of self - testing , for example , to populations afflicted by a higher hiv prevalence or that are known to be less likely to test for hiv , such as men in many countries , is likely to be necessary in such situations . there is also a risk in some circumstances that self - testing may lead to worse health outcomes , such as at cets of $ 5000 or more , if art initiation occurs at a cd4 t - cell count of 350 cells / l or if the linkage to care following a diagnosis prompted by a positive self - test is low . this suggests that , to be translated into health gains , self - testing needs to be accompanied by proactive interventions to support a continuum of care following diagnosis . a study in malawi investigated one scheme that could provide complementary benefits offering art initiation at home among people who self - test and found that this significantly increased the probability of initiating art within 6 months . finally , there is always potential for unintended adverse consequences associated with any public health intervention , so countries should closely monitor their experiences with introducing self - testing . linkage to care , promoting counseling services , and reporting of test outcomes need to be strengthened in support of such public health interventions . in conclusion , our results suggest that the introduction of self - testing may not only be cost - effective , but also may be cost saving under the assumptions described in the base case scenario . under these assumptions , self - testing should be made available even in settings where resource - constraints are greatest . notably , in some circumstances , it may be necessary to target self - testing to individuals who have certain risk factors . supplementary materials consist of data provided by the author that are published to benefit the reader .\noutput:\n" }, { "from": "agent", "value": "backgroundstudies have demonstrated that self - testing for human immunodeficiency virus ( hiv ) is highly acceptable among individuals and could allow cost savings , compared with provider - delivered hiv testing and counseling ( phtc ) , although the longer - term population - level effects are uncertain . we evaluated the cost - effectiveness of introducing self - testing in 2015 over a 20 - year time frame in a country such as zimbabwe.methodsthe hiv synthesis model was used . two scenarios were considered . in the reference scenario , self - testing is not available , and the rate of first - time and repeat phtc is assumed to increase from 2015 onward , in line with past trends . in the intervention scenario , self - testing is introduced at a unit cost of $ 3 . resultswe predict that the introduction of self - testing would lead to modest savings in healthcare costs of $ 75 million , while averting around 7000 disability - adjusted life - years over 20 years . findings were robust to most variations in assumptions ; however , higher cost of self - testing , lower linkage to care for people whose diagnosis is a consequence of a positive self - test result , and lower threshold for antiretroviral therapy eligibility criteria could lead to situations in which self - testing is not cost - effective.conclusionsthis analysis suggests that introducing self - testing offers some health benefits and may well save costs ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: conventional single - tensor models , however , are limited to the depiction of only a portion of the entire tract . in addition , fiber tracking is difficult in brain regions where several fiber bundles are crossing . in such casesthe diffusion tensor in these areas may even have an oblate disk - shape form , and the direction of the principle vector may be undefined . in such cases , the common second - order diffusion - tensor model is no longer valid , and the single - tensor approach can not correctly estimate the brain fibers . recent advances in image acquisition and postprocessing techniques allow the resolution of fibers crossing within a voxel . this is achieved by using images obtained by diffusion - sensitizing gradients in multiple orientations ( typically over 30 axes ) with a high b value , typically over 3,000 s / mm . these high - angular resolution diffusion imaging ( hardi ) techniques tend to require an extended data acquisition time , which may hamper their use in the clinical setting . thus , hardi studies have so far focused only on methodological development and have not been applied to clinical practice . in order to make this tool clinically feasible , a low b value is necessary , since this will help to maintain a high image signal to noise ratio ( snr ) . at low b values , however , the angular dependency of the signal profile is relatively small , and the fiber orientation density function reconstruction is noise sensitive . at high b values , on the other hand , the angular dependency is more pronounced , but the signal attenuation is so large that the noise begins to predominate . as our aim was to investigate the possibility of resolving crossing fibers in clinical setting , we tested the b values used for standard magnetic resonance ( mr ) imaging at 1.5 t. we investigated the effect of b value on structures that are known to have decussation , i.e. , the optic chiasm and decussation of superior cerebellar peduncle ( dscp ) . for example , approximately half of the fibers within the optic nerve decussate to the contralateral optic tract via the optic chiasm . similarly , the dscp is reconstituted by fibers from the ipsilateral superior cerebellar peduncle , which travels to the area around the contralateral red nucleus . our study population comprised 10 healthy volunteers ( five men and five women ; mean age , 26.3 years ; age range , 2232 years ) without any history of neurologic injury or psychiatric disease . all images were obtained using a 1.5 - t whole body scanner ( gyroscan intera ; philips medical systems , best , the netherlands ) with a six - channel phased - array head coil . single - shot echo - planar imaging was used for diffusion - tensor imaging ( dti ) ( repetition time , 5,000 ms ; echo times ( tes ) , 55 , 65 , 72 , and 78 ms ) with a motion - probing gradient in 32 orientations and b values of 700 , 1,400 , 2,100 , and 2,800 s / mm . we only imaged the optic chiasm , superior cerebellar peduncle , and red nucleus to minimize the scan duration . the scan durations for each b value were kept constant ( 3 min ) , since the aim of the study was to find the optimum b value to be used within a clinically feasible time frame . these 3 - min dti protocols were repeated twice , and the data were averaged after image reconstruction in order to increase the snr . a parallel imaging technique was used to record 12837 data points , which could be reconstructed into images equivalent to 7676 resolution . a total of 12 slices with a thickness of 3.0 mm each were obtained without interslice gaps . the field of view was 230230 mm ; thus , the size of a voxel was 3.03.03.0 mm . the diffusion - weighted imaging ( dwi ) data were transferred to an offline workstation for registration , averaging , and analysis ( precision 530 ; dell , round rock , tx , usa ) . pride software ( philips medical systems , best , the netherlands ) written in interactive data language ( rsi , inc . , a total of 32 acquisitions using different diffusion - sensitizing gradients were performed , which were registered with respect to the b = 0 measurement using the method of netsch et al . . this was done to remove distortion and possible head motion over various slices and scans . , the data of the 32 directional apparent diffusion coefficients were fitted to a two - tensor model . this two - tensor model is best described by equation 12 presented in the paper by frank . both the orientations of each tensor ( 6 degrees of freedom for each tensor ) and the relative volume fractions were obtained in this manner . the three diffusivities ( 1 , 2 , and 3 ) of each tensor were restricted to a range of i min and i max , so that they would reflect highly oriented fibers . these were set to 1.2 / 1.8 , 0.2 / 0.7 , and 0.2 / 0.7 ( 10 mm / s ) for the three diffusivities ( 1 , 2 , and 3 ) , respectively . these diffusivity values are close to those found in highly oriented white matter , such as the spinal cord and corpus callosum . thus , in our model , we assumed that a voxel with crossing fibers consists of two individual fibers that have highly oriented diffusion patterns . to trace the optic chiasm , a pair of regions of interest ( rois ) was placed over the optic nerve and ipsi - / contralateral optic tract . to trace the dscp , a pair of rois was placed over the red nucleus and contralateral superior cerebellar peduncle . the red nucleus was identified by the low signal region for the transaxial plane of the b0 image . the locations of these rois were determined by the consensus of two board - certified neuroradiologists . the tractographic portrayal of fiber tracts between the two rois was evaluated by a consensus of two neuroradiologists . the optic nerve was graded on the axial section , and the dscp was graded on both the axial section and the sagittal section . the scoring system used in assessing fiber tractography was as follows : grade 3 ( excellent , i.e. , the depicted fiber tracts were of sufficient volumes ) , grade 2 ( moderate ) , grade 1 ( poor , i.e. , the fibers were barely depicted ) , and grade 0 ( none , i.e. , not visible ) ( fig . 1 ) . the scoring system is as follows : grade 3 ( excellent ) , grade 2 ( moderate ) , grade 1 ( poor ) , and grade 0 ( none ) . a tractographic images of optic pathway superimposed on axial color map viewed from caudal aspect . b tractographic images of the decussation of superior cerebellar peduncles superimposed on axial color map viewed from caudal aspect scoring system for fiber tract depiction ( grades 0 to 3 ) . the scoring system is as follows : grade 3 ( excellent ) , grade 2 ( moderate ) , grade 1 ( poor ) , and grade 0 ( none ) . a tractographic images of optic pathway superimposed on axial color map viewed from caudal aspect . b tractographic images of the decussation of superior cerebellar peduncles superimposed on axial color map viewed from caudal aspect the snr of dwi was calculated from two separate mr examinations . calculation was performed using the following equation : \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ hbox { snr } } = \\ surd 2 { \\ hbox { s } } { { \\ hbox { i } } _ { \\ rm { first } } } / { \\ hbox { s } } { { \\ hbox { d } } _ { \\ rm { sub } } } , $ $ \\ end { document } where sifirst is the signal intensity of the roi placed on the first dwi , and sdsub is the standard deviation of the subtraction images from the first and second scans . the rois were placed upon the brainstem at the levels of the midbrain and pons . the wilcoxon signed rank test was applied to examine the difference in the ability of the b value to assess the depiction of the fiber . non - parametric wilcoxon signed rank test was used to analyze the depiction of crossing versus non - crossing fibers . we used jmp version 6.0.0 software ( sas campus drive , cary , nc , usa ) . for all statistical analyses , p all images were obtained using a 1.5 - t whole body scanner ( gyroscan intera ; philips medical systems , best , the netherlands ) with a six - channel phased - array head coil . single - shot echo - planar imaging was used for diffusion - tensor imaging ( dti ) ( repetition time , 5,000 ms ; echo times ( tes ) , 55 , 65 , 72 , and 78 ms ) with a motion - probing gradient in 32 orientations and b values of 700 , 1,400 , 2,100 , and 2,800 s / mm . we only imaged the optic chiasm , superior cerebellar peduncle , and red nucleus to minimize the scan duration . the scan durations for each b value were kept constant ( 3 min ) , since the aim of the study was to find the optimum b value to be used within a clinically feasible time frame . these 3 - min dti protocols were repeated twice , and the data were averaged after image reconstruction in order to increase the snr . a parallel imaging technique was used to record 12837 data points , which could be reconstructed into images equivalent to 7676 resolution . a total of 12 slices with a thickness of 3.0 mm each were obtained without interslice gaps . the field of view was 230230 mm ; thus , the size of a voxel was 3.03.03.0 mm . the diffusion - weighted imaging ( dwi ) data were transferred to an offline workstation for registration , averaging , and analysis ( precision 530 ; dell , round rock , tx , usa ) . pride software ( philips medical systems , best , the netherlands ) written in interactive data language ( rsi , inc . , a total of 32 acquisitions using different diffusion - sensitizing gradients were performed , which were registered with respect to the b = 0 measurement using the method of netsch et al . . this was done to remove distortion and possible head motion over various slices and scans . for the multi - tensor analysis , the data of the 32 directional apparent diffusion coefficients were fitted to a two - tensor model . this two - tensor model is best described by equation 12 presented in the paper by frank . both the orientations of each tensor ( 6 degrees of freedom for each tensor ) and the relative volume fractions were obtained in this manner . the three diffusivities ( 1 , 2 , and 3 ) of each tensor were restricted to a range of i min and i max , so that they would reflect highly oriented fibers . mm / s ) for the three diffusivities ( 1 , 2 , and 3 ) , respectively . these diffusivity values are close to those found in highly oriented white matter , such as the spinal cord and corpus callosum . thus , in our model , we assumed that a voxel with crossing fibers consists of two individual fibers that have highly oriented diffusion patterns . to trace the optic chiasm , a pair of regions of interest ( rois ) was placed over the optic nerve and ipsi - / contralateral optic tract . to trace the dscp , a pair of rois was placed over the red nucleus and contralateral superior cerebellar peduncle . the red nucleus was identified by the low signal region for the transaxial plane of the b0 image . the locations of these rois were determined by the consensus of two board - certified neuroradiologists . the tractographic portrayal of fiber tracts between the two rois was evaluated by a consensus of two neuroradiologists . the optic nerve was graded on the axial section , and the dscp was graded on both the axial section and the sagittal section . the scoring system used in assessing fiber tractography was as follows : grade 3 ( excellent , i.e. , the depicted fiber tracts were of sufficient volumes ) , grade 2 ( moderate ) , grade 1 ( poor , i.e. , the fibers were barely depicted ) , and grade 0 ( none , i.e. , not visible ) ( fig . 1 ) . the scoring system is as follows : grade 3 ( excellent ) , grade 2 ( moderate ) , grade 1 ( poor ) , and grade 0 ( none ) . a tractographic images of optic pathway superimposed on axial color map viewed from caudal aspect . b tractographic images of the decussation of superior cerebellar peduncles superimposed on axial color map viewed from caudal aspect scoring system for fiber tract depiction ( grades 0 to 3 ) . the scoring system is as follows : grade 3 ( excellent ) , grade 2 ( moderate ) , grade 1 ( poor ) , and grade 0 ( none ) . a tractographic images of optic pathway superimposed on axial color map viewed from caudal aspect . b tractographic images of the decussation of superior cerebellar peduncles superimposed on axial color map viewed from caudal aspectcalculation was performed using the following equation : \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ hbox { snr } } = \\ surd 2 { \\ hbox { s } } { { \\ hbox { i } } _ { \\ rm { first } } } / { \\ hbox { s } } { { \\ hbox { d } } _ { \\ rm { sub } } } , $ $ \\ end { document } where sifirst is the signal intensity of the roi placed on the first dwi , and sdsub is the standard deviation of the subtraction images from the first and second scans . the rois were placed upon the brainstem at the levels of the midbrain and pons . the wilcoxon signed rank test was applied to examine the difference in the ability of the b value to assess the depiction of the fiber . non - parametric wilcoxon signed rank test was used to analyze the depiction of crossing versus non - crossing fibers . we used jmp version 6.0.0 software ( sas campus drive , cary , nc , usa ) . for all statistical analyses , p 0.05 was considered a significant difference . the crossing fibers of each subject were treated as separate fiber bundles for the analysis , and thus , there were 20 fibers for the optic chiasm and the dscp , respectively . the majority of these crossing fibers were successfully depicted with at least one of the b values ( 80 % and 95 % , respectively ) . there were crossing fibers that were not depicted using any of the b values ; these subjects were excluded from the final analysis ( four subjects for the optic chiasm and one for the dscp ) . the subjects images that were excluded from analysis appeared degraded by motion artifact or distortion due to a technical problem during data acquisition . we thus examined a total of 16 optic chiasm fiber tracts \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ left ( { 16 \\ ;{ \\ hbox { fibers } } \\ times 4 \\ ; b \\ ;{ \\ hbox { values } } = 64 \\ ;{ \\ hbox { data } } \\ ;{ \\ hbox { sets } } } \\ right ) $ $ \\ end { document } and 19 dscps \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ left ( { 19 \\ ;{ \\ hbox { fibers } } \\ times 4 \\ ; b \\ ;{ \\ hbox { values } } = 76 \\ ;{ \\ hbox { data } } \\ ;{ \\ hbox { sets } } } \\ right ) $ $ \\ end { document } . depiction of crossing fibers did not differ significantly by b value for either the optic chiasm or the dscp ( fig . 2 ) . when depiction of non - crossing fibers was compared with crossing fibers at the optic chiasm , there was a significantly better delineation of the non - crossing fibers ( fig .3 ) as compared to the crossing fibers ( p 0.0001 ) . fig .2 grade of the fiber tract depiction at optic chiasm and decussation of superior cerebellar peduncle ( dscp ) for each b value . depiction of crossing fiber does not differ significantly by b values , neither at the optic chiasm nor at the dscp . the breadth of each green rhomboid shows the number of cases in the group , the height shows the 95 % confidence interval , the middle line shows the average of the group , and the horizontal lines in the upper and lower parts show the overlap marks . the overlap marks of each of the four groups are not separated in these figures , indicating that there is no significant difference between each groupfig .3 depiction of the grade of fiber tract at tractography for crossing and non - crossing fibers of the optic chiasm . the overlap marks of the two groups are completely separated in this figure , which indicates that there is a substantial difference between the two groups ( p 0.0001 ) grade of the fiber tract depiction at optic chiasm and decussation of superior cerebellar peduncle ( dscp ) for each b value . depiction of crossing fiber does not differ significantly by b values , neither at the optic chiasm nor at the dscp . the breadth of each green rhomboid shows the number of cases in the group , the height shows the 95 % confidence interval , the middle line shows the average of the group , and the horizontal lines in the upper and lower parts show the overlap marks . the overlap marks of each of the four groups are not separated in these figures , indicating that there is no significant difference between each group depiction of the grade of fiber tract at tractography for crossing and non - crossing fibers of the optic chiasm . the overlap marks of the two groups are completely separated in this figure , which indicates that there is a substantial difference between the two groups ( p 0.0001 ) the snr of diffusion - weighted images were 14.04.9 , 6.81.7 , 4.10.88 , and 2.40.6 using b values of 700 , 1,400 , 2,100 , and 2,800 s / mm , respectively ( fig . 4 ) . the angles formed by the fibers of the optic chiasm were 6317 , and the angles formed by the fibers of the dscp were 8914 . fig . each data point and error bar represent the mean of snr and standard deviation at each b value , respectively . the snr deteriorates as the b value increases , and the snr at b = 2,800 images decreases to 17 % of the b = 700 images correlation between the b value and the signal to noise ratio ( snr ) . each data point and error bar represent the mean of snr and standard deviation at each b value , respectively . the snr deteriorates as the b value increases , and the snr at b = 2,800 images decreases to 17 % of the b = 700 imagesprevious studies have suggested that the hardi technique can better portray crossing fibers at higher b values . the trade - off , however , in using a high b value is a substantial reduction in snr by the elongation of te . a previous study has indicated that the snr of b = 3,000 images are reduced to 45 % of the snr achieved when using b = 1,000 . the b = 2,800 images had 17 % of the snr of b = 700 images . if one attempts to compensate for this signal loss , the excitation has to be increased by a factor of 5 . in clinical practice , if the patient remains in the scanner for too long , the images will be degraded by motion artifact . given that scan timeis limited , our aim was to determine the optimum b value to solve the crossing fiber problem using a fixed scan time . we have shown that resolution of crossing fibers is independent on b values in the range of 700 to 2,800 s / mm . thus , the optimum b value within this range would be the lowest due to the higher snr at the lowest b value . our results are not surprising in light of a previous simulation study that suggested that the ability to portray crossing fibers is independent of b values ranging from 1,000 to 3,000 . this simulation study used b values at incremental steps of 1,000 s / mm from 1,000 to 5,000 s / mm . using approximately similar scanning techniques to ours ( i.e. , snr = 2.414 , diffusion encoding orientations = 32 ) , their simulation data indicated that separation of two crossing fibers is imperfect at b values between 1,000 and 2,000 s / mm . therefore , both sets of data have shown that there is no merit in using b values smaller than 3,000 . future development in the mr hardware , including increased magnetic field strength , gradient power , and multiple phased - array receiver coils , could allow much higher b values routinely . then , the higher b value dti or multi - tensor tractography would better reflect the clinical situation . when such hardware improvement becomes available for clinical use , one has to keep in mind that a b value of no less than 3,000 should be considered . first , some of the subjects had to be eliminated from the final analysis because their images failed to demonstrate any fibers . the optic chiasm is an especially challenging location to perform dti because of the susceptibility artifacts from the paranasal sinuses . there are areas with less susceptibility artifact , such as the corona radiata or forceps minor . these regions are , however , not ideal locations for assessing crossing fibers , as their architecture is more complex compared to the optic chiasm or dscps . second , we did not compare the results of different b values at similar snr . it would be interesting to confirm previous simulation data by performing a study with identical snr across different b values . this was not attempted in the present study , however , since it was thought to be clinically inapplicable to perform scans that take five times longer than the routine scan time . further study with higher b values ( over 3,000 s / mm ) would be necessary to elucidate the positive trend of better fiber depiction with increasing b values . the results of our study , however , may suggest that a small - scale alteration of b values above 2,800 may not have substantial impact upon the depiction of crossing fiber . since the 3 - t magnets imaging is now becoming a standard equipment of choice for neuroimaging , hardi at 1.5 - t magnets may have less impact , and thus optimization on 3 - t magnets will be necessary in the future . it is our hope that the results of this study can be extrapolated to the following study using 3 - t magnets . we have shown that the depiction of crossing fiber by hardi - based multi - tensor tractography is not substantially influenced by b values ranging from 700 to 2,800 s / mm . thus , the optimum b value within this range may be the lowest one considering the advantage of higher snr .\noutput:\n" }, { "from": "agent", "value": "introductionwe sought to investigate the optimum b value for resolving crossing fiber using high - angular resolution diffusion imaging ( hardi ) - based multi - tensor tractography . the study tested the standard b values that are commonly used in the routine clinical setting.methodsten normal volunteers ( five men and five women ) with a mean age of 26.3 years ( range , 2232 years ) were scanned using a 1.5 - t clinical magnetic resonance unit . single - shot echo - planar imaging was used for diffusion - weighted imaging with a diffusion - sensitizing gradient in 32 orientations . the b values of 700 , 1,400 , 2,100 , and 2,800 s / m2 were used . data postprocessing was performed using multi - tensor methods . the depiction of the optic nerves , optic tracts , and decussation of superior cerebellar peduncles were assessed.resultsthe depictions of the nerve fibers were independent of the b values tested.conclusionthe depiction of crossing fibers by hardi - based multi - tensor tractography is not substantially influenced by b values ranging from 700 to 2,800 s / m2 . thus , the optimum b value within this range may be the lowest one considering the higher signal to noise ratio ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: treatment - resistant depression ( trd ) is a relatively common condition presenting with substantial challenges to both the clinician and researcher . in fact , despite a progressively higher number of available antidepressant therapies , trd occurs frequently in clinical practice , and is associated with profound psychosocial disability , personal suffering and economic cost burden . between one and two thirds of major depressive disorder ( mdd ) patientswill not respond to the first antidepressant prescribed and 15 to 33 percent will resist to multiple interventions , including non - pharmacological therapies . increasing the burden associated with mdd , its high prevalence : world health organization ( who ) estimated that 5 - 10 % of the population at any given time is suffering from identifiable depression needing psychiatric or psychosocial intervention , while the life - time risk of developing depression is 10 - 20 % in females and slightly less in males . prevalence estimates for trd are available from several sources , including large clinical trials , large meta - analyses , or naturalistic studies [ 6 - 8 ] . for example , in the first level of the sequenced treatment alternatives to relieve depression ( star * d ) trial , only about 30 % of patients were in remission following up to 12 weeks of therapy with the selective serotonin reuptake inhibitor ( ssri ) citalopram . in addition , 15.8 % of patients developed an intolerable adverse event , 38.6 % moderate - to - severe impairment due to an adverse event , 8.6 % discontinued treatment due to adverse events , and 4 % developed a serious adverse event , findings that underscore efficacy and tolerability limitations of treatment with a typical first - line antidepressant agent . papakostas and fava reviewed 163 randomized , double - blind , placebo - controlled trials involving the use of antidepressants for mdd . approximately 53.4 % of patients responded following treatment with an antidepressant , compared to 36.6 % of patients who responded following the administration of a placebo pill . corey - lisle and colleagues reported that approximately 22 % of patients who received treatment for depression by their primary - care physicians remitted following 6 months of treatment , 32 % were partial responders , while 45 % were non - responders . similarly , rush and colleagues reported an 11 % remission rate and 26.3 % response rate among depressed outpatients following 12 months of treatment of depression in one of several public - sector community clinics . petersen and colleagues report a 50.4 % remission rate among outpatients with mdd enrolled in 1 of 2 hospital - based , academically affiliated depression specialty clinics ( massachusetts general hospital , an affiliate of harvard medical school and rhode island hospital , an affiliate of brown university ) following an average of 25.8 weeks of treatment . finally , it is also worth noting that while partial or non - response are common , residual symptoms among remitters are also highly prevalent , being usually associated with poorer psychosocial functioning as well as an increased relapse rates , higher suicidal ideation and attempts , higher number of lifetime hospitalizations , more frequent healthcare resources utilization , general practitioner consultation , job loss and social retirement . attempts at overcoming treatment resistance in major depression begin with the clinical controversies in defining it . currently , there are no universally accepted operational definitions of trd . since more effective treatment approaches are needed for treating trd , regardless on how it is defined , the purpose of this narrative review is to assess current major definitions of trd and to briefly discuss its putative bipolar diathesis for some of the affected patients . actual definition and clinical classification of trd represent debated issues : while some literature evidences tend to progressively suggest to revise its current nosology , others tend to be more conservative , actually making trd a resistant clinical controversy . according to research practice , a lack of response ( not necessarily trd per se ) is usually defined by failure to reduce of at least 50 % in the hamilton depression ( ham - d ) total score or as failure in reducing below a specific cut - off while less objective trd clinical definitions include failure in symptoms resolution or the more accepted failure to respond to 2 or more adequate antidepressant trials . the definition of an adequate treatment trial of antidepressant medication varied widely over the years , as the corresponding definitions of treatment resistance did . in actuality , trd patients present with histories of varying degrees of treatment adequacy . a high proportion of cases referred to university settings specifically for evaluation and treatment of \" refractory \" depressions have not received even a single adequate anti - depressant trial . clinical controversies related to trd refer not only to its definition but also to the way this latter is conceived : the adequacy of a trial as well the definition of non response seem to be misleading concepts . there are 3 major treatment - resistance classification systems : a 5 - stages classification ( stages get up depending on the number of previously failed adequate trials , with fifth one proposing bi - temporal electroconvulsive therapy - ect ) , the national institute for clinical excellence ( nice ) guidelines ( providing a short algorithm ) and the multi - level structured massachusetts general hospital ( mgh ) criteria . about the adequacy of a trial , there is no absolutely correct dosage for a specific antidepressant , since dosage requirements vary depending on factors such as age , weight , general health , concomitant medication usage , and tolerance of a particular medication . confirmation of treatment adequacy by more objective means ( e.g. , serial plasma drug levels ) is not the rule in clinical practice , and valid plasma level response relationships are limited to only a subgroup of the tricyclic antidepressants ( tcas ) and lithium salts . conventionally , adequate trials should last at least for 8 - weeks , considering full antidepressant doses ( e.g. 20 - 60 mg / day for the ssri fluoxetine or 150 - 300 mg / day for the tca clomipramine ) when needed . yet , 8 - weeks is just the average rcts follow - up , with clinical practice often requiring more prolonged exposure time . remission usually takes up to 6 months of mdd antidepressant therapy , while recovery with substantial symptoms resolution usually requires at least a 12 months follow - up . remarkably , most of antidepressant medications have a lag - phase of at least 3 - 4 weeks prior exhibiting any substantial clinical response , thus making hyper - dosing a rational strategy if response observed by weeks 5 or 6 is insufficient , while a too praecox pharmacological switch should be avoided in all the cases . with respect to psychotherapy , adequacy of treatment may depend on the number of sessions , the expertise of the practitioner , the therapist 's adherence to a particular form of therapy , and / or the interaction of the patient therapist dyad . ect may be gauged by the total number of treatments , the use of bilateral electrode placement , and the verification of seizure time by electroencephalographic monitoring . therefore , the terms \" relative \" and \" absolute \" treatment resistance may best describe lesser and greater degrees of certainty about the adequacy of a specific treatment trial . the most common response criteria in clinical trials are a rating of at least \" much improved \" on the clinical global impressions ( cgi ) scale , a pre - specified level of improvement on a depression symptom rating scale ( e.g. , 50 % reduction in hamilton depression rating scale scores ) , a final absolute score on a symptom measure , or some combination of the above . both the use of composite outcome criteria and documentation of persistent improvement ( e.g. , for 2 weeks or longer ) may improve reliability and validity of classification . at least a 50 % reduction in depressive symptom severity generally corresponds to the clinician 's global clinical impression of a moderate level of improvement . however , some patients meeting this commonly used response definition continue to have considerable residual symptomatology . residual symptoms convey a higher risk of relapse during continuation treatment and likely contribute to suboptimal restoration of vocational or interpersonal functioning . the term remission describes a response in which a formerly depressed person 's level of residual symptomatology is essentially indistinguishable from someone who has never been depressed . with respect to standardized scales , a score of 6 or less on the 17 - item hamilton rating scale for depression is often used to define a remission . as for response , non - response quantification may vary ( ham - d1775 % = remission ; 50 % - 74 % = response ; 25 % - 49 % = partial response ; 25 % = non - response ) , withtreatment - non - response being also defined as poor response to a single adequate antidepressant trial and treatment - resistant depression and chronic - resistant depression if resistance lasts for at least 12 months despite 2 or more adequate antidepressant trials ( including augmentation strategies ) . as further confounding variable , the fact that trd itself sometimes receives different appellations ( e.g. treatment - refractory or therapy - resistant depression ) as no univocal definition of the adequacy of an antidepressant trial does exist , making a desirable revision of current trd nosology a difficult , resistant , process . first step should be an appropriate anamnesis , eventually integrating validated instruments as the antidepressant treatment history questionnaire ( atrq ) . the recognition of depression subtypes ( particularly melancholic , psychotic , atypical , and seasonal ) is an important element in the evaluation and management of trd because individuals with different subtypes of depression may respond in somewhat different ways to the available therapies , or eventually predict a soft bipolar diathesis ( e.g. in case of seasonal or atypical features ) . additionally , resistance to treatment may also be related to differential diagnosis mistakes as misdiagnosis of a unipolar mdd in patients with declared ( full - threshold ) or undeclared ( sub - threshold ) bd . patients with bd present in the depressive phase 2 to 3 times more often than they do in the manic state and it is estimated that bd i is undetected in 35 % to 45 % of patients . it is important to evaluate patients with trd specifically for a history of manic or hypomanic episodes to rule out bipolar spectrum disorders since depressive episodes may be the ( only ) clinical presentation of bipolar disorders ( bds ) for many years . treatment should become ineffective if too much retarded : only 60 % of persons with depression are treated for the disorder . an appropriate evaluation of psychiatric and medical comorbidities as well a careful acknowledgement of current major depressive episode ( mde ) features is mandatory . as mentioned , many of trd cases show - up with psychotic or atypical features , often requiring more personalized therapies ; for example , treating with ssris instead of mono - amino - oxidase inhibitors ( mao - i ) or tcas a mde with atypical features may lead to pseudo - resistance instead of a true resistance phenomenon ( 1999 ) reported up to 3.2 % ( p 0.001 ) panic disorders , social phobia 2.1 % ; ( p 0.008 ) , other anxiety disorders 2.6 % ( p 0.001 ) and axis - ii dsm - iv - defined personality disorders 1.7 % ( p 0.049 ) . remarkably , early age of onset ( 18 years ) 1.7 % ( p 0.009 ) and current dsm - iv - defined melancholic features 1.5 % ( p 0.018 ) were a frequent trd association . also , most trd cases have multiple co - morbidities and this further increases the burden load , reducing the chance of a substantial inter - episodic depressive symptoms resolution , therefore increasing the risk for relapse . one of the most important set of comorbidities that contributes to inadequate treatment response in mdd and other disorders is substance ( including alcohol ) use disorders and it may be carefully considered too when treatment resistance arises in mdd patients since this may require specific treatment approaches and eventually be in favor of a bipolar diathesis . trd comorbid psychiatric disorders are often missed or are sub - optimally treated , and they can confound both the evaluation and the management of depression . trd - associated biological factors include a reduction in frontal cortex and hippocampal volumes , increase in ventricular volume and amygdala hyperactivity with poor inhibition by prefrontal - cortex , contributing in making most trd patients hypersensitive to environmental stressors . nonetheless , currently proposed biomarkers for trd still require further evidences as false positives cases could occur . frequent trd medical co - morbidities include infective diseases ( e.g. hiv and borna virus ) and endocrine disorders as hypothyroidism or hpa - axis imbalances ( up to 50 % of trd cases present a non - suppression with the dexamethasone test due to hpa hyperactivity ) . yet , a major medical comorbidities for most trd cases is represented by cardiovascular disease and diabetes . the implication for treatment is to address these conditions simultaneously , if possible , to avoid consolidating treatment resistance . what if trd persists despite repetitive adequate trials and accurate considerations of the potential confounding or concomitant factors ? to date , the star * d study represents the broadest , multi - centric clinical trial ever conducted on mdd assessment . star * d lasted for 7 years ( oct 1999 - sept 2006 ) involving both primary care and psychiatric facilities and adopting minimum exclusion criteria ( real world ) , withremarkably , 2876 patients ( 4041 enrolled ) had at least one axis - i co - morbidity at baseline . unfortunately , despite a multi - level algorithm including switches and augmentation strategies with different antidepressant classes , lithium , thyroid hormones and cognitive behavioral therapy ( cbt ) , remission rates were almost equivalent for stages i vs. ii ( 32.9 % vs. 30.6 % ) and stages iii vs. iv ( final ) , ( 13.6 % vs. 14.7 % ) ; authors concluded that no specific antidepressant treatment was superior to any other one , with cbt role remaining a debated issue . while popular clinical augmentation or switch strategies for trd include a broad number of compounds ( e.g. , thyroid hormones , estrogen , lithium , pindolol , atypical antipsychotics , stimulants , inositol , omega - 3 fatty acids , da - agonists , herbal supplements , lamotrigine , etc ) most of them are not accounted inofficial trd guidelines . also , meta - analyses data tend to suggest the switch strategy versus the augmentation one , with lithium and atypical antipsychotic medication as more favored choice . remarkably , lithium and atypical antipsychotics use is much more consolidated for bipolar disorders rather than unipolar depression . also , it is interesting to observe how a considerable number of trd cases show - up with atypical - mdes or have an earlier age of onset compared non - resistant mdds ? ( 2005 ) tried to answer at some of these questions investigating 69 patients diagnosed with treatment resistant - mdd ( failure to respond to 2 or more adequate clinical trials ) at a local mood clinic ; when patients were retested using the structured clinical interview for axis - i disorders ( scid - i ) 35 % of them were diagnosed as bipolar . the whole sample , was re - tested 1 year later , showing 41 % mdd , 3 % bp - i , 43 % bp - ii , 13 % bipolar - nos . interestingly , most of former - mdd - trds significantly improved in clinical global impression ( cgi ) total score when switched from antidepressants to mood - stabilizers . indeed , trd cases presented a rapid pop - up on antidepressant , frequent motor agitation , somatic symptoms and fatigue and a history of polypharmacy , which may be accounted as a potential iatrogenic phenomenon for mixed states and cyclicity among those with a supposed bipolar diathesis . further evidences suggesting that some trd - mdd patients may have ( or acquire ) a bipolar diathesis , have been also provided by the french national naturalistic epidep study , which major outcomes included the evaluation of bipolar patients using also temperamental instruments ( as the temperament evaluation of the memphis , pisa , paris , and san diego auto - questionnaire temps - a ) . cyclothymic - sensitive and depressive temperaments , along with motor agitation , greater severity of current depressive episode , scored significantly higher among those with bp - trd . the adoption of less restrictive diagnostic criteria ( e.g. 2 days of hypomania vs. the arbitrary dsm - iv 4 days duration one ) and the use of sensitive ( yet acceptable in sensitivity ) instruments ( e.g. hypomania check - list 32 - itemshcl - 32 ) may lead to a prompter recognition of sub - threshold resistance clusters ( e.g. depressive mixed stateswhile no data support the evidence that all trd cases should follow a bipolar diathesis , neither they support the opposite . it is interesting to observe how most recent evidences tend to suggest a bipolar diathesis in a subgroup of dsm - iv - defined unipolar depressed patients and how significantly should the clinical outcome be influenced by different therapeutic implications ( as pointed out by preliminary systematic treatment enhancement program for bipolar disorderfinally , when trd lasts for a very long time ( despite repetitive adequate trials ) , it should be prudent to promptly revise diagnosis and / or therapeutic choices . in fact , prolonged antidepressant treatments may induce bipolar phenomena as rapid cyclicity and mixed states as well as antidepressant - resistance in some patients and their over - prescription should therefore be avoided , preferring lithium and atypical antipsychotics , as indicated by the bp - trd algorhythm recently proposed by pacchiarotti et al . . also , while a bipolar hypothesis for some trd cases is definitely not a novel approach , it appears to become a gradually more popular remark , especially considering that further insights are progressively acquired about a potential bipolar diathesis for some of the features sometimes associated with trd too : just to mention one , a history of substance abuse is today almost widely accepted as a strong bipolar feature . in conclusion , directions for future research on trd should nt apart from a substantial revision of the way trd itself is defined . adopting widely accepted criteria for the adequacy of a trial as well for the concept of resistance is mandatory in order to allow researchers to give rise to a hoped international collaborative group . specifically , more attention should be placed on a plausible bipolar diathesis for some of the trd cases as a progressively greater number of latest literature evidences tend to support this view . otherwise , till a consistent revision of current boundaries of trd nosology will be performed , we ll have no opportunity to fully overcome the resistance phenomenon . trd : as treatment resistant depression ; mdd : as major depressive disorder ; bp : as bipolar disorder .\noutput:\n" }, { "from": "agent", "value": "treatment - resistant depression ( trd ) represents a source of ongoing clinical and nosological controversy and confusion . while no univocal consensus on its definition and specific correlation with major mood disorders has been reached to date , a progressively greater number of evidences tend to suggest a revision of current clinical nosology . since a better assessment of trd should be considered mandatory in order to achieve the most appropriate clinical management , this narrative review aims to briefly present current most accepted definitions of the phenomenon , speculating on its putative bipolar diathesis for some of the cases originally assessed as unipolar depression ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the region around the knee is the most common presenting site for the development of a pseudoaneurysm . common causes of pseudoaneurysms around the knee include blunt trauma , penetrating trauma , fractures , previous surgical procedures , infections , and in rare cases osteochondromas . the presentation of a pseudoaneurysm mimicking a musculoskeletal tumor is very rare [ 1 - 3 ] . in this study , we report a case of a pseudoaneurysm of the popliteal artery insinuating into the intramedullary cavity of the tibia , mimicking a bone tumor or a soft tissue sarcoma . a 65 - year - old man presented with severe pain , decreased sensory , and motor weakness of the left lower leg for one day . his medical history included surgery for an ipsilateral knee due to trauma several years previous , but he did not have any recent history of trauma before pain . he had been diagnosed with hypertension 3 months prior and had no history of diabetes mellitus . from physical examination , the left lower leg below the knee was pale and cold . the clinical diagnosis was acute occlusion of the popliteal artery , and thereupon computed tomography ( ct ) angiography was performed by multidetector computed tomography ( mdct ) ( somatom sensation 16 , siemens , forchheim , germany ) . from mdct angiography , the left popliteal artery at the femoral condylar level had an eccentric nonenhancing portion , representing intraluminal thrombus ( fig . at the tibial plateau level , instead of normal intravascular enhancement , a lobulated mass obscured the popliteal artery and insinuated into the adjacent cortex and medullary cavity of the tibia , resulting in an intraosseous mass with erosion and surrounding sclerosis ( fig . anteriorly , an obliquely oriented radio - dense line projecting into the intraosseous mass was seen , representing a prior screw fixation site ( fig . the differential diagnoses of the findings of mdct angiography were a series of popliteal mass with involvement of the popliteal artery and adjacent bone , such as a popliteal pseudoaneurysm with thrombus formation , soft tissue sarcoma , or a primary malignant bone tumor . considering the evidence of prior transfixation of a screw , and the finding of a thin sclerotic rim of tibia representing pressure erosion , the radiologist suggested a pseudoaneurysm of popliteal artery with erosion into adjacent tibia along the tract of the screw fixation was more likely than soft tissue sarcoma or a primary malignant bone tumor . the pulse of the popliteal artery of the patient became progressively weaker , and the surgeon thus decided to perform an emergency mass excision and recanalization of the popliteal artery . after spinal anesthesia , a roughly 10 cm sized longitudinal incision was made at the popliteal fossa . the surgeon attempted to excise the mass but it showed severe adhesion with a neurovascular bundle along with luminal narrowing . the surgeon thus decided to perform a two - step operation composed of a thromboembolectomy to restore the arterial pulse as the first step and total mass excision in elective surgery time as the second step . after making a short incision in the inguinal region , catheterization of the common femoral artery was performed using a 3 - fr forgaty catheter ( edwards lifesciences llc , irvine , ca , usa ) . after a large amount of non - however , the catheter did not pass into the distal level of the popliteal artery and the pulse again became weaker over time . a small incision at the distal level of the popliteal artery was hence made and further embolectomy was performed . however , the catheter did not pass into the tibioperoneal trunk and the pulse of the posterior tibial artery was not restored . after confirmation that the pulse of the dorsalis pedis artery had been restored , the incision of the popliteal artery was closed . the next day , a second operation was performed for removal of mass and bypass surgery anastomosis for the popliteal artery . after administration of spinal anesthesia , a vertical incision was made at the left popliteal fossa , exposing the popliteal artery . the mid - and distal level of the popliteal artery was displaced posteriorly by the mass with adhesion . a section of the saphenous vein about 10 cm in length was harvested . after clamping at the proximal level of the popliteal artery , the mid - level of the popliteal artery was incised . an approximately 75 mmsized oval shaped intimal defect was seen at the anterior surface of the popliteal artery , insinuating into the posterior surface of the tibia . via the intimal defect , a thrombosed pseudoaneurysm was observed ( fig . curettage was performed at the organized thrombus in the pseudoaneurysmal sac . instead of bypass anastomosis , patchy closure and angioplasty were performed at the intimal defect using the harvested lesser saphenous vein , because the native popliteal arterial lumen was relatively intact and the dimension of the harvested vein was too small . follow - up ct angiographies on post - operative day one showed restored arterial flow in the left lower leg and no residual pseudoaneurysm . the patient was free of symptoms and the pulse of the dorsalis pedis was intact . after one month , his pain and sensory and motor deficit had almost disappeared and good dorsalis and posterior tibial pulses were confirmed . from follow - upct angiographies performed after one year , mild fusiform dilatation of the popliteal artery was noted but the distal run - off arteries were still intact . pseudoaneurysms result from arterial wall disruptions with hematoma into the surrounding tissues and containment by a reactive fibrous capsule . the center of the hematoma undergoes organization and recanalization , resulting in direct continuity with the vessel lumen . pseudoaneurysms are usually progressive and have complications , including thrombosis , embolization , and rupture . in the present case study , the intraluminal thrombus secondary pseudoaneurysm caused complete occlusion into the popliteal artery , necessitating immediate surgery . the diagnosis of a pseudoaneurysm is more straightforward in the setting of a pulsatile popliteal mass with bruit , and reduced ankle pulse . however , pulsation can not be detected in some instance and a bruit is generally only associated with recent penetrating trauma . doppler ultrasonography is most commonly used in the diagnosis of pseudoaneurysms , as it can depict the characteristic blood flow pattern . meanwhile , conventional angiography is known to be the most sensitive radiological method for the diagnosis and detection of pseudoaneurysms of arterial origin . in the present case , mdct angiography has many benefits , including being rapid , accurate , and relatively operator independent , and accordingly is suitable for emergency situations such as the present case . , mdct angiography had a sensitivity of 95.1 % and a specificity of 98.7 % in the detection of vascular lesions , including pseudoaneurysms , of the proximal parts of the extremities . gantz et al . reported a pseudoaneurysm at the cruris mimicking a malignant soft - tissue tumor with osseous changes at the fibula . erler et al . reported a case of a distal femoral arterial pseudoaneurysm with an intraosseous component mimicking a malignant mesenchymal tumor . correct diagnosis is essential , as these unusual features of pseudoaneurysms can lead to different evaluation algorithms , such as an orthopedic oncological approach and inappropriate treatment , as in the case report of erler et al . . although vertebral erosion caused by an aortic pseudoaneurysm was reported , in other locations , especially for a popliteal arterial pseudoaneurysm , there have been few cases with adjacent bony erosion , because the popoliteal artery is relatively distant from adjacent bone in comparison with the aorta . according to bilottaet al . , the diagnosis of an aneurysm should be considered if an enlarging mass is identified at a site typical for aneurysm formation . in particular , the feature of arterial encasement , which is uncommon for sarcomas , can be utilized for the diagnosis . in our case , arterial encasement and a pressure erosion pattern of bony change led to a correct diagnosis , corresponding to the findings of bilotta et al . . the treatment of a pseudoaneurysm is generally surgical , such as resection and evacuation of the pseudoaneurysm with repair of the damaged artery , which may include ligation and grafting . recently , for iatrogenic and small pseudoaneurysms , ultrasound - guided thrombin injection has gained popularity . the present case emphasizes the importance of considering a pseudoaneurysm in the differential diagnosis of an apparent soft tissue mass with pressure erosion in adjacent bone . identification of factors including a site that is typical for aneurysm formation , arterial encasement , and a pressure erosion pattern of bony change may help achieve the correct diagnosis and surgical treatment is indicated as usual .\noutput:\n" }, { "from": "agent", "value": "diagnosing pseudoaneurysms of the popliteal artery is usually straightforward in physical examinations and imaging findings . however , when a pseudoaneurysm shows a soft tissue mass with adjacent osseous change , it can mimic a bone tumor or a soft tissue sarcoma . we present a case of a 65 - year - old man who had a pseudoaneurysm of the popliteal artery showing soft tissue mass and insinuating into the intramedullary cavity of the tibia . this presented case emphasizes the importance of considering pseudoaneurysms in the differential diagnosis of an apparent soft tissue mass with pressure erosion in adjacent bone ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: high intensity interval treadmill training ( hiitt ) is gaining popularity in the fitness industry and as a promising stroke rehabilitation protocol to improve cardiovascular and motor outcomes . it involves short bursts of high effort alternated with longer recovery periods to maximize efficacy of training . treadmill training at high speeds results in improved overground gait speeds , facilitates a more normal walking pattern , and improves cardiovascular efficiency . although previous studies have examined the effects of hiitt on gait parameters and cardiovascular outcomes after stroke , no study has examined the effects of hiitt on corticomotor excitability after stroke . despite the promising effects of hiitt ( noted above ) this is an important question to answer because people with stroke have a high reported incidence of central fatigue . insufficient central drive and an imbalance of between - hemisphere symmetry of corticomotor exitability ( cme ) are a well - established benchmark after stroke . people with stroke exercising at a high intensity may develop central neural fatigue that could compromise their ability to drive descending motor output . hence , the primary purpose of this study was to examine the short - term changes in cme of the lower limb m1 following a single session of hiitt . we hypothesized that a single session of hiitt would decrease cme of paretic lower limb muscles and create a further imbalance of between - hemisphere cortical excitability in stroke survivors . we also wanted to know if increasing lower limb corticomotor excitability prior to a session of hiitt could mitigate these changes . we chose transcranial direct current stimulation ( tdcs ) combined with a visuomotor ankle - tracking task that we had previously demonstrated to be a robust facilitator of lower limb skill acquisition and cme assessed in the paretic limb tibialis anterior ( ta ) muscle . at the risk of limiting the conclusions that could be drawn from the study , we did not include additional sessions of skill acquisition alone and tdcs alone for this group of people with stroke and included two sessions : hiitt alone and hiitt plus anodal tdcs enhanced with ankle - tracking ( e - tdcs + hiitt ) . the goal of the present study was , therefore , to provide preliminary data to inform future research that would examine in more detail whether the physiological and functional benefits of hiitt are limited by the induction of central fatigue . eleven individuals with chronic stroke participated in the study ( see table 1 for demographics ) . this was a carefully selected homogenous sample as these individuals had participated in a previous nonintervention study in the laboratory . these individuals were selected because transcranial magentic stimulaion ( tms ) induced motor evoked potentials ( meps ) could be induced in their paretic leg muscles and demonstrated 5 degrees or more of active paretic ankle dorsiflexion necessary to perform our tdcs - enhanced ankle motor task . in addition , participants were able to walk independently ( with or without an assistive device ) for at least 10 minutes , a criterion necessary to fully participate in hiitt . participants did not have contraindications to tms , such as metallic implants in the head region , a history of seizures , implanted cardiac pacemakers , and medications known to alter central nervous system excitability . the mini mental state examination ( mmse ) was used to assess cognitive impairment , and those with a score of less than 24 ( out of 30 ) were excluded . all the participants signed a written informed consent form approved by the institutional review board of the university of illinois at chicago . each individual participated in two treadmill training sessions , hiitt alone and e - tdcs + hiitt , the sessions being one week apart and pseudorandomized to avoid order effects . prior to and at the end of each session , participants performed two trials of the overground 10 - meter fast walking test ( using their walking aid , e.g. , cane and ankle foot orthosis if required ) . baseline ( pre - ) and post - training corticomotor excitability measures were obtained for ta muscles bilaterally using single - pulse tms . during the e - tdcs + hiitt session , participants received anodal tdcs over the lesioned lower limb m1 prior to treadmill training . during anodal tdcs , participants performed a visuomotor tracking task with their paretic ankle for 15 minutes while receiving tdcs . in order to match the e - tdcs + hiitt session duration with the hiitt only session , participants in the latter were asked to remain seated quietly for fifteen minutes prior to treadmill training . blood pressure ( bp ) and heart rate ( hr ) were monitored during the fifteen minutes of tdcs and during the fifteen minutes of rest . muscle activity was recorded bilaterally from the ta using surface ag / agcl electrodes ( delsys bagnoli 8 , ma , usa ) placed over the muscle belly after standard skin preparation . two maximum voluntary isometric contractions ( mvic ) were obtained for each muscle with the participants seated on a chair with knee flexed to 90 and the ankle in the neutral position and stabilized by a metal bar placed firmly and comfortably over the foot and secured to a wooden board to prevent movement of the foot . pre - and post - training tms measures were obtained , while participants produced a target emg contraction corresponding to 10 % mvic for each muscle . emg data were sampled at 2000 hz , with a gain of 1000 , and band - pass filtered ( 10500 hz ) . spike2 software ( cambridge electronic design , cambridge , uk ) was used to collect the emg data . single - pulse tms at 0.25 hz was delivered using a magstim 200 stimulator ( magstim , dyfed , wales , uk ) via a double - cone coil ( diameter 110 mm ) oriented to induce a posterior - anterior current flow in the cortex . spike2 software was used to trigger the stimulator and also to record the trigger pulses . tms was used to generate meps with the coil positioned contralateral to the ta muscle being tested ( the nonparetic ta was tested first ) . a tightly fitted linen cap was placed on the participant 's head and the position of the vertex ( intersection of the lines connecting the nasion - inion and the two tragi ) was marked . the tms coil was placed on the cap at the vertex and then moved systematically to determine the hotspot for each muscle . the location of the hotspot for each ta was marked on the cap and the position was checked constantly by the experimenter during data collection to ensure that the coil was in the same position throughout . during tms , participants were given visual feedback of muscle activity and asked to maintain a tonic contraction of the ta that represented 10 % of mvic . active motor threshold ( amt ) was determined as the stimulus intensity resulting in identifiable meps of at least 0.4 mv peak - to - peak in 50 % of ten successive trials from the contralateral ta . responses were obtained at seven tms intensities corresponding to 80140 % of amt ( randomized order ) to generate a recruitment curve for each ta muscle . the same intensities were used to collect post - training responses ( five minutes after treadmill training ) . for the e - tdcs + hiitt session , the hotspot of the paretic ta was first determined by placing the tms coil directly over the scalp . the active tdcs electrode was then placed on the scalp , over which the cap was tightly fixed , and the hotspot procedure repeated . tdcs was delivered using a constant current stimulator ( chattanooga iontophoresis system , hixon , tn , usa ) via an 8 cm oblong saline - soaked sponge anode placed directly on the scalp over the hotspot for the paretic leg m1 and a self - adhesive carbonized reference cathode ( 35 cm ) placed on the forehead above the contralateral orbit . a 1 ma current was applied for fifteen minutes , while the participant performed the motor training task . for the motor training task , participants performed visuomotor tracking with their paretic ankle . details of the motor training task have been previously reported . in brief , participants were required to track , as accurately as possible , a computer - generated sinusoidal waveform using a voltage generated by an electrogoniometer attached to their paretic ankle , while they performed continuous ankle dorsiflexion and plantarflexion movements for 15 minutes . our previous study found that tdcs strongly facilitated corticomotor excitability and enhanced fine motor control of the ankle approximately 3-fold compared with tracking practice alone . this finding is supported by other research that demonstrated that tdcs during a motor task is more effective in increasing corticomotor excitability than tdcs administered during rest . the protocol consisted of 40 minutes ( 5 minutes warm - up , 30 minutes walking , and 5 minutes cooldown ) of treadmill walking with a structured increase in walking speed . the treadmill was set at 0 % incline and participants were fitted in a harness for safety with no body weight support . heart rate ( hr ) and rate of perceived exertion ( rpe ) using the modified borg scale were continuously monitored . age - predicted hr was determined using the formula ( 220 age ) and 80 % of the age - predicted hr was set as the upper cut - off safety limit while increasing the belt speed . the maximum overground walking speed was determined from the 10 m fast walking test performed at the start of each session . the participants then conducted a five - minute warm - up on the treadmill at a speed half of their maximum overground walking speed . after the warm - up , the first speed - dependent training interval began . during a period of 2 minutes , the belt speed was increased , within the participant 's tolerance , to the highest speed at which the participant could walk safely and without stumbling . at the end of the two - minute interval , this was followed by a recovery period when the participant walked at the warm - up speed until a time at which the participant 's hr and rpe returned to the levels reached during the warm - up phase . if the participant maintained the speed and felt safe during the ten seconds at the end of the first - training interval , the speed was then increased by 10 % during the next interval . this speed was again held for ten seconds at the end of the second interval and followed by another recovery period . during any fast walking phase , if the participant was unable to maintain the speed and felt unsafe , or the hr reached the cut - off safety limit , the speed was reduced by 10 % for the next interval . at the end of thirty minutes ofthe participants performed the training similarly during hiitt and e - tdcs + hiitt sessions and were able to increase their speed by a factor of 3 to 5 during each session . after the forty minutes of treadmill training , participants were given five minutes to rest before tms measures were taken . an example of one participant 's treadmill training speeds , distance walked , and heart rate is provided in figure 1 . an average pre - and post - training gait speed was calculated from the two pre - and two post-10 m fast trials for each participant for each session . a mep window was established for each muscle for each participant , for the pre - and post - training tms trial during each session , by finding the onset and offset latencies of a large mep in response to the highest tms intensity ( 140 % amt ) . a window of identical width was set prior to the tms stimulus to measure the tonic background contraction . the same mep and background windows were then applied to analyze all the meps within a given session . mep amplitude was calculated as the peak - to - peak magnitude of emg activity within the mep window and averaged across the six meps for each tms intensity , each trial ( pre and post ) , each muscle , and participant . the average mep response was plotted against the corresponding stimulus intensity , and a linear function was used to fit this recruitment curve . the slope of this recruitment curve was calculated and a change in cme ( gain ) was determined for the nonparetic ( np ) and paretic ( p ) ta muscles using the following equation : ( 1 ) percent change in cme = postslopepreslopepreslope100 . a physiological measure of interhemispheric symmetry of corticomotor excitability was calculated as follows : paretic slope / nonparetic slope . this ratio yields a value between 0 and 1 where values close to 1 indicate well - balanced interhemispheric symmetry and as values decrease towards zero , they indicate increasing levels of asymmetry . spss software ( ibm software version 22 , armonk , ny ) was used to perform all statistical analyses . a two - way repeated - measures anova ( session by time ) was used to compare rpe , hr , and overground gait speeds between the two sessions . four levels of time ( warm - up , during training , cooldown , and after training ) were analyzed for rpe and hr . two levels of time ( pre and post ) were analyzed for overground gait speeds . paired two - tailed t - tests were performed to compare differences between the baseline mep slopes of the two sessions for each limb . intraclass correlations ( icc ) were also performed to examine test - retest reliability of baseline mep slopes of the two sessions for each limb . a two - way repeated - measures anova ( session by limb ) was used to examine changes in cme as an effect of the training session on the two limbs ( paretic and nonparetic ) . significant main effects and interactions were followed up with t - tests corrected for multiple comparisons . participants were classified as responders based on change in the paretic ta cme after training . a participant who showed a change of + 5 % compared to baselinewas considered as a responder and the number of responders for each session are reported . a correlation analysis between change in cme of the p ta during the e - tdcs - hiitt and hiitt sessionswas conducted to determine whether a relationship between the extent of response to hiitt alone was related to the extent of change during e - tdcs - hiitt . , participants started at a treadmill belt speed of 2.00.12 mph and most were able to increase and / or maintain their speeds for 57 intervals . details of treadmill speeds , number of intervals , and distance covered by each participant are provided in table 2 . two - way repeated - measures anova on rpe revealed a significant interaction for rpe ( f3 ,24 = 4.24 , p = 0.015 ) . paired t - tests for rpe at each level of time to compare the two sessions revealed a significant difference ( p = 0.05 ) during cooldown ( figure 2 ( b ) ) . on average , the rpe remained slightly elevated at 4.62 for the hiitt session compared to 3.04 for the e - tdcs + hiitt session . two - way repeated - measures anova on hr revealed a significant main effect of time for hr . hr changed similarly across both sessions and was found to be significantly different between the four time points ( f3 ,27 = 101.768 , p 0.0001 , figure 2 ( a ) ) . all participants were able to complete their treadmill training sessions without a need to discontinue . baseline gait speeds were similar for both sessions and a trend for improvement ( change of 0.04 m / s ) was noted after treadmill training ( table 3 ) . no significant differences were noted for the baseline mep slopes for the np ta ( p = 0.38 ) and p ta ( p = 0.43 ) between the two sessions . differences were found between the baseline slopes for the np and p ta within each session . the mean baseline np ta slope was significantly steeper than the mean p ta slope for the hiitt ( 73 % , p = 0.016 ) and e - tdcs + hiitt ( 79 % , p = 0.013 ) sessions . excellent icc values were found between the baseline values of the np ta ( r = 0.83 , p 0.05 ) and the p ta ( r = 0.94 , p 0.05 ) between both sessions . the average interhemispheric symmetry ratio for both baseline sessions was 0.490.36 , establishing a tendency towards an imbalance in interhemispheric symmetry for all participants . the two - way anova revealed a significant session limb interaction ( f1 ,10 = 5.647 , p = 0.039 ) . post hoc analyses with corrected paired t - tests to compare the two sessions within each limb revealed significant effects for both the np ta ( p = 0.04 ) and p ta ( p = 0.05 ) ( figure 3 ) . for the np ta , a decrease in cme was revealed following the e - tdcs + hiitt session ( 197 % ) compared to the increase in cme for the hiitt session ( 511 % ) . there was an increase in cme for the p ta following the e - tdcs + hiitt session ( 2914 % ) compared to a decrease in the hiitt session ( 937 % ) . single sample t - tests were used to check whether cme means differed from zero . the change in cme for the np ta and p ta in the e - tdcs + hiitt group differed significantly from zero ( p = 0.027 and 0.023 , resp . ) . , small changes in means were accompanied by large variances ( np ta 511 % ; p ta 937 % ) . inspection of data revealed that only 2 of 11 participants had increased their p ta cme after hiitt , while the remaining 9 had decreased p ta cme . the mean reduction for the p ta for these 9 participants was 226 % , which differed from zero ( p = 0.004 ) . in the e - tdcs + hiitt group , 8 outthe mean increase for the p ta for these 8 participants was 4813 % , which differed from zero ( p 0.005 ) . with all participants ' data included , there was a negative correlation between reduced p ta cme during hiitt alone and change in cme during e - tdcs + hiitt ( r = 0.34 , p = 0.05 ) ( figure 4 ) . the objective of this study was to investigate the short - term effects of a single session of hiitt on corticomotor excitability in individuals with chronic stroke , and whether this modulation is affected by priming the motor cortex with tdcs and an ankle - tracking task prior to the exercise . hiitt alone resulted in small mean decreases in cme of the paretic ta and small mean increases in cme of the nonparetic ta , but the changes were not statistically significant . however , hiitt alone decreased cme in the majority of participants ( 9 of 11 ) . when hiitt was preceded by the priming protocol ( e - tdcs + hiitt ) , significant modulation was observed . after training , e - tdcs + hiitt induced an increase in cme of the paretic ta and a corresponding decrease in cme of the nonparetic ta . interestingly , the correlation analysis revealed that participants with a greater cme downregulation also upregulated cme to a greater extent following priming with e - tdcs , indicating a possible shared neuroplastic mechanism . both hiitt and e - tdcs + hiitt sessions showed a trend towards improved overground gait speeds ( change of 0.03 and 0.09 m / s , resp . ) after training . however , the change in gait speeds did not differ statistically between the two sessions . this is the first study to examine the effects of hiitt on corticomotor excitability after stroke . independently investigated the effects of training at high treadmill velocities and demonstrated significant improvements in overground walking speeds with speed - dependent treadmill training compared to conventional therapy or at slow speeds . faster speeds have also been shown to facilitate a more normal walking pattern after stroke without concomitant increases in common gait compensations , such as circumduction . walking at progressively higher speeds not only requires increased cardiovascular activity but also increases neuromuscular demands to maintain the continuous stepping . another finding of this study is that cme of the paretic lower limb was augmented following e - tdcs + hiitt compared to hiitt alone . the fact that these changes were observed with a single session of training is promising and adds to the literature that forms the basis for investigating the effects of long - term training using cortical priming . an increase in cme of the p ta muscle was revealed following cortical stimulation - enhanced treadmill training . interestingly , this increase in paretic ta cme was most evident in those who responded to hiitt with a downregulation of their paretic ta cme . the finding could indicate that exercise - induced neuroplastic mechanisms in some individuals make them candidates for motor priming protocols such as tdcs . whether this acute increased neural drive is a predictor for long - term functional improvementthe upregulation of cme in the e - tdcs + hiitt group was also accompanied by a decrease in cme of the np ta . these results are consistent with previous studies that have revealed downregulation of the nonlesioned hemisphere along with an upregulation of the lesioned hemisphere . there is support for the idea that upregulation of cme in the lesioned hemisphere is associated with a concomitant downregulation of the nonlesioned hemisphere via interhemispheric inhibition . therefore , many upper limb studies have used noninvasive brain stimulation to suppress the nonlesioned hemisphere to produce an opposite modulation in the lesioned hemisphere ( see for review ) . however , in this pilot study , we did not provide behavioral data to support that the increase in paretic ta and decrease in the nonparetic ta are a positive functional outcome . our hypothesis is supported by previous studies which have shown that a balanced cme is associated with less impairment and better function in stroke survivors . the increase in neural excitability was not associated with a concomitant increase in gait speed . this is not surprising as it is unlikely that a single session of treadmill training would produce significant improvements in overground walking . nevertheless , the trend towards improvement in gait speed is concurrent with other long - term training studies that have reported improvements in gait speeds with treadmill training . rpe during cooldown from e - tdcs + hiitt was observed to be significantly lower than rpe from hiitt alone . the time course of rpe changes from warm - up to cooldown were similar for hiitt and e - tdcs + hiitt sessions . the slightly lower cooldown rpe mean for e - tdcs + hiitt may indicate a more rapid decrease in rpe for the e - tdcs + hiitt than the hiitt session . further elegant physiological studies are needed to corroborate this finding because the primary outcome measure of this study is related to cme . because this was a preliminary studyfirst , a homogenous sample that we had previously found to have meps in the paretic ta was recruited . in addition , the people in this sample of stroke survivors were relatively fast ambulators ( average gait speed of 0.93 m / s ) who had the necessary strength and endurance to complete the hiit protocol . second , the sample size was small ( n = 11 ) and only a subset of this sample provided support for our hypothesis . another study with a larger sample size would be necessary to confirm our results , and the inclusion of a measure of oxygen consumption may answer the question not addressed in the present study of whether the suppression of cme we observed in some of our participants was the result of greater physiological effort . third , to avoid making the study unwieldy , we chose to compare the effects of hiitt alone with our robust tdcs + tracking task . the absence of tdcs - only and tracking - only control conditions prevents us from understanding which element of the intervention promoted the reduction in asymmetry of between - hemisphere cme . fourth , we did not compare our results with other excitability boosting priming paradigms or to a standard form of therapy . regardless of these limitations , our results are intriguing and can be used to support future studies that explore the impact on stroke survivors ' motor function that might result from a hiitt - induced suppression of corticomotor excitability . this is the first study to report that a single session of hiitt has the potential to exacerbate suppressed corticomotor excitability of paretic lower limb muscle representations in some individuals with stroke . future studies are needed in order to optimize gait rehabilitation by examining the effectiveness of repetitive long - term hiitt with and without the inclusion of cortical excitability enhancing protocols .\noutput:\n" }, { "from": "agent", "value": "objective . high intensity interval treadmill training ( hiitt ) has been gaining popularity for gait rehabilitation after stroke . in this study , we examined the changes in excitability of the lower limb motor cortical representation ( m1 ) in chronic stroke survivors following a single session of hiitt . we also determined whether exercise - induced changes in excitability could be modulated by transcranial direct current stimulation ( tdcs ) enhanced with a paretic ankle skill acquisition task . methods . eleven individuals with chronic stroke participated in two 40 - minute treadmill - training sessions : hiitt alone and hitt preceded by anodal tdcs enhanced with a skill acquisition task ( e - tdcs + hiitt ) . transcranial magnetic stimulation ( tms ) was used to assess corticomotor excitability of paretic and nonparetic tibialis anterior ( ta ) muscles . results . hiit alone reduced paretic ta m1 excitability in 7 of 11 participants by 10 % . e - tdcs + hiitt increased paretic ta m1 excitability and decreased nonparetic ta m1 excitability . conclusions . hiitt suppresses corticomotor excitability in some people with chronic stroke . when hiitt is preceded by tdcs in combination with a skill acquisition task , the asymmetry of between - hemisphere corticomotor excitability is reduced . significance . this study provides preliminary data indicating that the cardiovascular benefits of hiitt may be achieved without suppressing motor excitability in some stroke survivors ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the isoniazid - monoresistant and multidrug - resistant tuberculosis ( mdr - tb ) isolates were obtained from the patients ' source hospital or mru . all isolates were identified as belonging to the same strain of m. tuberculosis ( rapet or is6110 typing ) , and all drug - susceptibility testing was carried out at mru according to standard procedures . the wildtype control isolate used for these studies was m. tuberculosis , h37rv ( atcc , 9360 national collection of type culture , london , uk ) . three isolates , 018 , 483 , and 915 , were from patients in whom mdr - tb developed as a result of poor compliance with therapy , whereas isolates 604 , t7 , and 371 were from patients who contracted primary mdr - tb . dna was prepared from the 6 isolates of m. tuberculosis by emulsifying 23 colonies in 400 l tris - edta buffer and heating the suspension in a water bath for 40 min at 80c . polymerase chain reaction ( pcr ) was performed on the extracted dna with 6 sets of primers designed to amplify 6 overlapping fragments of the rpob gene from the 6 m. tuberculosis isolates ( table ) . ten microliters of dna was added to the pcr mix containing 81.4 l pcr - quality water , 10 l potassium chloride buffer ( bioline ltd . , london , uk ) , 0.4 l of each primer ( 100 mmol ) ( sigma - genosys ltd . , haverhill , uk ) , 3 l deoxynucleoside triphosphates ( 5 mmol ) , and 1 l taq ( bioline ) . the amplification was performed on a techgene thermal cycler ( techne , princeton , nj , usa ) . pcr products were separated by gel electrophoresis on a 1.5 % agarose gel , and dna bands were stained with ethidium bromide . primers and excess nucleotides were removed from the amplified dna with a pcr clean - up kit ( qiagen , inc . , the amount of dna in the cleaned - up product was quantified by comparing the intensity of the band to bands of known intensity in a hyperladder marker ( bioline ) . * denotes a primer position in the sequence before the start ( ) or after the end ( + ) of the rpob gene sequence . forward andreverse cycle sequencing reactions were performed with the big dye terminator cycle sequencing ready reaction dna sequencing kit ( applied biosystems , inc . , foster city , ca , usa ) . briefly , 40 ng of cleaned - up dna was added to 10.8 l pcr - quality water , 3 l buffer , 3.2 l of forward or reverse 1 mmol primer , and 1 l of cycle sequencing ready reaction mix . the labeled dna was precipitated by adding 14.5 l pcr - quality water , 62.5 l 95 % ethanol , and 3 l sodium acetate solution ( 2.3 mol / l ) and centrifuging ( 13,000 g , 15 min , 4c ) . the supernatant was removed with a fine - tipped pipette , and the pellet was cleaned with 200 l 70 % ethanol and then recentrifuged ( 13,000 g , 15 min , 4c ) . againthe supernatant was removed , and the pellet was dried at 37c for 30 min . four microliters of formamide and 1 l of dextran loading buffer were added to each pellet , and 1.5 l of sample was added to each well of the sequencing gel . the 6 fragments of the rpob gene from each of the 6 isolates were then sequenced with an abi 377 applied biosystems sequencer . the sequences obtained from each isolate were joined together to form a continuous whole gene sequence , aligned with clustalw ( http://www.ebi.ac.uk/clustalw/ ) and compared to the wildtype to identify base - pair mismatches . in addition , all 6 isolates were tested with a line probe resistance determining hybridization assay , inno - lipa ( innogenetics belgium ) , as described in the manufacturer 's instructions . briefly , an 81 - bp region of the rpob gene was amplified with biotinylated primers , which yielded a biotinylated target sequence , and hybridized with specific oligonucleotide probes immobilized on a parallel strip . inno - lipa consists of 10 oligonucleotide probes ( 1923 bases in length ) , encompassing the 81 - bp region ( rrdr ) of the rpob gene . one is specific for m. tuberculosis complex , whereas the other 5 partially overlapping wildtype probes ( s1s5 ) cover the region from positions 507 to 534 of the rpob gene . these s - probes hybridize to the wildtype ( rifampicin - sensitive ) dna sequence . failure of any of these s - probes to hybridize indicates that a mutation has occurred . four other probes ( r2 , r4a , r4b , and r5 ) are specific for amplicons carrying the most common rpob mutation that confers rifampicin resistance . the results of the inno - lipa assay showed 5 of the 6 isolates , which were phenotypically rifampicin - resistant , were negative . the target dna hybridized to all 5 wildtype s - probes and none of the r - probes , which demonstrated that the assay failed to detect rifampicin resistance in these 5 isolates . failure to detect rare mutations within the rrdr may be caused by nonspecific hybridization of the wildtype s - probes because of slight fluctuations in temperature during the hybridization process . isolate 483 showed a weak dna hybridization reaction with the s4 probe , indicating that a mutation was present on codon 451 ( codon 526 in escherichia coli ) . analysis of the sequence data identified specific mutations in rpob in all 6 strains studied ( figure 1 ) . three had mutations within the rrdr , and of these , 2 were c - to - g mutations at codon 456 , inducing a serine to tryptophan amino acid conversion ( s456w ) . the third was an a - to - g mutation at codon 451 , resulting in a change from histidine to arginine ( h451r ) ( figure 1 ) . no other mutations were identified in the dna sequences outside the rrdr in these 3 isolates . the 3 other isolates had the mutation g to t at codon 176 , outside the rrdr , which caused a change from valine to phenylalanine ( v176f ) . neither rrdr mutations nor any other mutations were found in the rpob gene sequences of these 3 isolates . wt , wildtype ; t7 , 018 , 604 v176f ( g to t , highlighted in blue ) ; 483 , h526r ( a to g , highlighted in yellow ) ; 915 , 317 , s531w ( c to g , highlighted in pink ) . of the mutations found within the rrdr , h526r occurs in 4 % , and s531w occurs in 1.4 % of all rifampicin - resistant isolates , respectively ( 7 ) . mutations outside the rrdr account for 4 % of rifampicin resistance , and few have been described ( 79 ) . in a previous study ( 7 ) , v176f was found in 5 of 18 isolates with no mutations in the rrdr from asia ( 9,10 ) and africa ( 11,12 ) . to our knowledge , this is the first time this type of mutation has been detected in strains isolated in the united kingdom . three different mutations in the rpob gene , v176f , h526r and s531w , were detected in the isolates associated with the isoniazid - resistant outbreak . given that all the mutations found in this study are rare and that mdr - tb developed during treatment in 3 patients ( 018 , 483 , and 915 ) ( figure 2 ) , the rifampicin - resistance mutations observed in these 3 patients likely occurred on 3 independent occasions , as a result of poor compliance with therapy . two of these patients , 018 and 915 , were contacts of the 3 patients who subsequently had primary mdr - tb ( patients t7 and 604 [ v176f ] and 317 [ s531w ] ) ( figure 2 ) . suggested epidemiologic relationship between 6 cases of multidrug - resistant tuberculosis ( mdr - tb ) . resistance to rifampicin developed in patients 018 , 483 , and 915 while on therapy , whereas patients t7 , 604 , and 317 contracted primary mdr - tb . the type of mutation present in each patient 's strain of mdr - tb is highlighted in bold . our study highlights problems associated with using a line probe hybridization assay to detect rifampicin resistance in m. tuberculosis . the inno - lipa assay can not detect mutations outside the rrdr , and failure to detect rare mutations within the rrdr may be caused by nonspecific hybridization of the wildtype s - probes because of slight fluctuations in temperature during the hybridization process . in this study , all the rare mutations , inside and outside the rrdr , were detected by sequencing the entire rpob gene . the inability to identify mdr - tb isolates results in treatment failure and increased risk for transmission of resistant disease in the community . we recommend that , when the index of suspicion for mdr - tb is high and the line probe assays fail to detect mutations conferring rifampicin resistance , the entire rpob gene should be sequenced to prevent unnecessary delay in diagnosing mdr - tb .\noutput:\n" }, { "from": "agent", "value": "mycobacterium tuberculosis isolates cultured from 6 patients associated with an isoniazid - resistant m. tuberculosis outbreak acquired rifampicin resistance . the rpob gene sequence showed that resistance was associated with rare mutations in each isolate . three isolates had a mutation outside the rifampicin resistance determining region ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: an innovative aerosol foam formulation of a fixed combination of calcipotriol 50 g / g ( as hydrate ) and betamethasone 0.5 mg / g ( as dipropionate ) has been developed to provide a highly effective topical psoriasis treatment delivered in a more patient - acceptable vehicle.this aerosol foam formulation demonstrated a significant improvement in clinical signs of psoriatic lesions compared with the fixed combination ointment , betamethasone aerosol foam and aerosol foam vehicle alone.the aerosol foam formulation may represent a more efficacious alternative to current first - line topical treatment options for patients with psoriasis vulgaris . psoriasis vulgaris ( plaque psoriasis ) is a chronic , inflammatory disorder , typically with well - demarcated , erythematous , thickened , scaly plaques on the body and scalp . the world health organization ( who ) recognizes that psoriasis is a painful and debilitating disease associated with serious co - morbidities , such as cardiovascular disease , diabetes mellitus and psoriatic arthritis , as well as a number of psychosocial disorders , including depression . as such , the negative impact of psoriasis on patients quality of life can be considerable . topical therapy remains the mainstay of psoriasis treatment , with more than 80 % of patients being able to manage their psoriasis with topicals alone . guidelines recommend the topical use of corticosteroids and vitamin d analogues ( be it as monotherapies used in combination or as fixed combinations ) as first - line treatment for psoriasis . the fixed combination of calcipotriol 50 g / g ( as hydrate ; cal ) and betamethasone 0.5 mg / g ( as dipropionate ; bd ) has demonstrated increased efficacy and reduced side effects compared with either of the active ingredients when used as monotherapies . furthermore , the presence of calcipotriol may also provide an additive , steroid - sparing effect on betamethasone dipropionate . this combination is currently available in gel or ointment formulations ( taclonex / daivobet / dovobet ) , both of which are first - line treatment options for patients with mild - to - moderate psoriasis vulgaris . an innovative aerosol foam formulation of the cal / bd fixed combination has now been developed to improve topical treatment of psoriasis vulgaris . in this exploratory study , the antipsoriatic effect of cal / bd aerosol foamwas compared with that of the established fixed combination cal / bd ointment , as well as bd aerosol foam and cal / bd aerosol foam vehicle , using a modified version of the psoriatic plaque test developed by dumas and scholtz . patients were at least 18 years of age , diagnosed with psoriasis vulgaris of the body with psoriatic plaques of a total size suitable for application of four different treatments . patients were required to have stable disease and plaques with a total clinical score [ tcs ; sum of scores of erythema , scaling and lesional thickness ( each scored from 0 to 3 ) ] of 49 inclusive and a score for each individual component of 1 . disease stability was based on tcs component scores measured at a screening visit ( within 3 weeks of start of treatment ) and baseline ; disease was considered stable if the change in score for any single symptom was 1 point . exclusion criteria included : treatment with etanercept within 4 weeks , adalimumab , alefacept or infliximab within 2 months , or ustekinumab within 4 months ; any other biological or systemic therapy within 4 weeks or five half - lives ( whichever was longer ) ; psoralen combined with ultraviolet a or grenz ray therapy within 4 weeks or ultraviolet b therapy within 2 weeks ; potent or very potent ( who class iiitopical antipsoriatic treatment of the scalp and / or facial psoriasis with who class i ii corticosteroids was allowed within 2 weeks of start of study treatment . this was a single - centre , investigator - blinded , vehicle - controlled , 4 - week exploratory study ( clinicaltrials.gov identifier : nct01347255 ) with intra - individual comparison , in which the following investigational products were assessed : cal / bd aerosol foam ( leo pharma , denmark ) , cal / bd ointment ( taclonex / daivobet / dovobet ; leo pharma , denmark ) , bd aerosol foam and cal / bd aerosol foam vehicle . each patient received simultaneous application ( by a study nurse / assistant ) of all investigational products to four predetermined target plaques on their arms , legs or trunk , applied once daily ( 6 days per week , excluding sundays ) for 4 weeks . per patient , test sites ( 5 cm ) were delimited with a disposable circular adhesive ( replaced twice a week ) and outlined using an indelible marker . for application of the aerosol foam products , 50 mg of product was sprayed directly onto the appropriate test site , using a circular template . cal / bd ointment was applied using an eppendorf combitip ( eppendorf ag , hamburg , germany ) . each product was gently massaged into the test sites with gloved fingers and then non - occlusive gauze was applied until the next treatment application . the study was conducted in accordance with the ethical principles of the declaration of helsinki and good clinical practice guidelines . the primary objective was to evaluate the antipsoriatic effect of cal / bd aerosol foam compared with cal / bd ointment , bd aerosol foam and cal / bd aerosol foam vehicle , using the modified psoriasis plaque test . the secondary objective was to obtain information on adverse events ( aes ) for all investigational products . clinical and safety assessments were performed at baseline and then twice weekly on days 4 , 8 , 11 , 15 , 18 , 22 , 25 and 29 . test site severity of erythema , scaling and lesional thickness ( using a 03 half - point grading scale ) was assessed by the investigator after removal of the non - occlusive gauze and prior to treatment reapplication ; a single investigator performed all clinical assessments . ultrasound measurements were performed at baseline and once weekly ( days 8 , 15 , 22 and 29 ) using a b scanner equipped with a 20 - mhz transducer . at each time point , three b scans were made per test site . safety and tolerability were assessed throughout the study by evaluating aes and adverse drug reactions ( adrs ) . twenty - four patients were required to achieve 80 % power of rejecting the null hypothesis with a 5 % significance level . the primary efficacy response was the change in tcs ( range 09 ) from baseline to week 4 . secondary efficacy responses included change from baseline in tcs and its individual components ( erythema , scaling and lesional thickness ) , and ultrasound - determined total skin thickness and echo - poor band thickness ( a measure of superficial dermis inflammation ) , by visit . efficacy endpoints were analysed by a two - way analysis of variance and are described using summary statistics . all significance tests are reported as two - sided with a 95 % confidence interval ( ci ) . all patients who received at least one dose of study treatment were included in the full ( intent - to - treat ) and safety analysis sets . patients were at least 18 years of age , diagnosed with psoriasis vulgaris of the body with psoriatic plaques of a total size suitable for application of four different treatments . patients were required to have stable disease and plaques with a total clinical score [ tcs ; sum of scores of erythema , scaling and lesional thickness ( each scored from 0 to 3 ) ] of 49 inclusive and a score for each individual component of 1 . disease stability was based on tcs component scores measured at a screening visit ( within 3 weeks of start of treatment ) and baseline ; disease was considered stable if the change in score for any single symptom was 1 point . exclusion criteria included : treatment with etanercept within 4 weeks , adalimumab , alefacept or infliximab within 2 months , or ustekinumab within 4 months ; any other biological or systemic therapy within 4 weeks or five half - lives ( whichever was longer ) ; psoralen combined with ultraviolet a or grenz ray therapy within 4 weeks or ultraviolet b therapy within 2 weeks ; potent or very potent ( who class iiitopical antipsoriatic treatment of the scalp and / or facial psoriasis with who class i ii corticosteroids was allowed within 2 weeks of start of study treatment . this was a single - centre , investigator - blinded , vehicle - controlled , 4 - week exploratory study ( clinicaltrials.gov identifier : nct01347255 ) with intra - individual comparison , in which the following investigational products were assessed : cal / bd aerosol foam ( leo pharma , denmark ) , cal / bd ointment ( taclonex / daivobet / dovobet ; leo pharma , denmark ) , bd aerosol foam and cal / bd aerosol foam vehicle . each patient received simultaneous application ( by a study nurse / assistant ) of all investigational products to four predetermined target plaques on their arms , legs or trunk , applied once daily ( 6 days per week , excluding sundays ) for 4 weeks . per patient , test sites ( 5 cm ) were delimited with a disposable circular adhesive ( replaced twice a week ) and outlined using an indelible marker . for application of the aerosol foam products , 50 mg of product was sprayed directly onto the appropriate test site , using a circular template . cal / bd ointment was applied using an eppendorf combitip ( eppendorf ag , hamburg , germany ) . each product was gently massaged into the test sites with gloved fingers and then non - occlusive gauze was applied until the next treatment application . the study was conducted in accordance with the ethical principles of the declaration of helsinki and good clinical practice guidelines . the primary objective was to evaluate the antipsoriatic effect of cal / bd aerosol foam compared with cal / bd ointment , bd aerosol foam and cal / bd aerosol foam vehicle , using the modified psoriasis plaque test . the secondary objective was to obtain information on adverse events ( aes ) for all investigational products . clinical and safety assessments were performed at baseline and then twice weekly on days 4 , 8 , 11 , 15 , 18 , 22 , 25 and 29 . test site severity of erythema , scaling and lesional thickness ( using a 03 half - point grading scale ) was assessed by the investigator after removal of the non - occlusive gauze and prior to treatment reapplication ; a single investigator performed all clinical assessments . ultrasound measurements were performed at baseline and once weekly ( days 8 , 15 , 22 and 29 ) using a b scanner equipped with a 20 - mhz transducer . at each time point , three b scans were made per test site . safety and tolerability were assessed throughout the study by evaluating aes and adverse drug reactions ( adrs ) . twenty - four patients were required to achieve 80 % power of rejecting the null hypothesis with a 5 % significance level . the primary efficacy response was the change in tcs ( range 09 ) from baseline to week 4 . secondary efficacy responses included change from baseline in tcs and its individual components ( erythema , scaling and lesional thickness ) , and ultrasound - determined total skin thickness and echo - poor band thickness ( a measure of superficial dermis inflammation ) , by visit . efficacy endpoints were analysed by a two - way analysis of variance and are described using summary statistics . all significance tests are reported as two - sided with a 95 % confidence interval ( ci ) . all patients who received at least one dose of study treatment were included in the full ( intent - to - treat ) and safety analysis sets . between may and june 2011 , 24 patients were enrolled in this study , two - thirds of whom were male ( table 1 ) . all patients were exposed to all four investigational products , completed the study , and were included in the full and safety analysis sets.table 1patient demographics and baseline characteristicscharacteristicvaluenumber of patients24median ( range ) age , years52 .5 ( 2175 ) males , n ( % ) 16 ( 66.7 ) fitzpatrick skin type , n ( % ) type ii1 ( 4.2 ) type iii23 ( 95.8 ) median ( range ) disease duration , years19 .5 ( 349 ) mean standard deviation total clinical score 7.070.78 type ii : white , always burns , tans minimally ; type iii : white , burns moderately , tans gradually ( light brown ) sum of three scores ( erythema , scaling , lesional thickness ) patient demographics and baseline characteristics type ii : white , always burns , tans minimally ; type iii : white , burns moderately , tans gradually ( light brown ) sum of three scores ( erythema , scaling , lesional thickness ) at week 4 , there was a significantly larger decrease in mean [ standard deviation ( sd ) ] tcs for those test sites treated with cal / bd aerosol foam ( 6.001.27 ) compared with those treated with cal / bd ointment ( 5.251.78 ; difference 0.75 ; 95 % ci 1.46 to 0.04 ; p = 0.038 ) , bd aerosol foam ( 4.961.85 ; difference 1.04 ; 95 % ci 1.75 to 0.33 ; p = 0.005 ) or cal / bd aerosol foam vehicle ( 1.881.12 ; difference 4.13 ; 95 % ci 4.83 to 3.42 ; p 0.001 ) . a continuous improvement in tcs was observed for all active treatments throughout the study , with the mean decrease in tcs being consistently larger with cal / bd aerosol foam compared with all other products , from the second on - treatment assessment time point ( day 8 ) until the end of the study ( fig . similarly , mean changes ( sd ) in the tcs components from baseline to week 4 were also found to be higher for those test sites treated with cal / bd aerosol foam ( erythema 1.750.71 ; scaling 2.130.47 ; lesional thickness 2.130.45 ) than for those treated with cal / bd ointment ( 1.500.66 ; 2.020.56 ; 1.730.82 , respectively ) , bd aerosol foam ( 1.440.78 ; 2.020.58 ; 1.500.77 ) and cal / bd aerosol foam vehicle ( 0.560.47 ; 0.900.47 ; 0.420.43 ; fig . 1b d ) . fig .1 change from baseline ( mean standard deviation ) in a tcs , and its components b erythema , c scaling , and d lesional thickness , to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) , tcs total clinical score change from baseline ( mean standard deviation ) in a tcs , and its components b erythema , c scaling , and d lesional thickness , to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) , tcs total clinical score throughout this study , reductions in total skin thickness and echo - poor band thickness were consistently greater with cal / bd aerosol foam treatment compared with all other treatments . at week 4 , treatment with cal / bd aerosol foam reduced the mean total skin thickness ( sd ) to a greater extent ( 0.810.41 mm ) , although not significantly so , than with cal / bd ointment ( 0.620.37 mm ; difference , 0.19 mm ; 95 % ci 0.40 to 0.03 ;p = 0.088 ) or bd aerosol foam ( 0.660.42 mm ; difference , 0.14 mm ; 95 % ci 0.36 to 0.07 ; p = 0.190 ) , and significantly greater compared with cal / bd aerosol foam vehicle ( 0.230.30 mm ; difference , 0.58 mm ; 95 % ci 0.79 to 0.36 ; p 0.001 ; fig . 2 ) . similarly , the mean reduction in echo - poor band thickness at week 4 was consistently greater ( but again not significantly so ) following treatment with cal / bd aerosol foam ( 0.570.21 mm ) than with cal / bd ointment ( 0.460.21 mm ; difference 0.11 mm ; 95 % ci 0.22 to 0.00 ; p = 0.052 ) , and was significantly greater compared with bd aerosol foam ( 0.450.25 mm ; difference 0.12 mm ; 95 % ci 0.23 to 0.01 ; p = 0.037 ) and cal / bd aerosol foam vehicle ( 0.120.20 mm ; difference 0.44 mm ; 95 % ci 0.55 to 0.33 ; p 0.001 ; fig . 3 ) . fig .2 change from baseline ( mean standard deviation ) in total skin thickness ( assessed by ultrasonographic imagery ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) fig .3 change from baseline ( mean standard deviation ) in echo - poor band thickness ( assessed by ultrasonography ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) change from baseline ( mean standard deviation ) in total skin thickness ( assessed by ultrasonographic imagery ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) change from baseline ( mean standard deviation ) in echo - poor band thickness ( assessed by ultrasonography ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) seventeen aes were reported by 11 patients during this study , with the most common being headache ( n = 5 ) and arthralgia ( n = 3 ) ( table 2 ) . there were no reports of serious aes or adrs and no withdrawals due to aes.table 2adverse events according to the medical dictionary for regulatory activities ( meddra ) primary system organ class and preferred termadverse eventpatients , n ( % ) nervous system disorders6 ( 25.0 ) headache5 ( 20.8 ) sciatica1 ( 4.2 ) musculoskeletal and connective tissue disorders4 ( 16.7 ) arthralgia3 ( 12.5 ) back pain1 ( 4.2 ) gastrointestinal disorders3 ( 12.5 ) diarrhoea1 ( 4.2 ) toothache2 ( 8.3 ) infections and infestations2 ( 8.3 ) gastroenteritis1 ( 4.2 ) nasopharyngitis1 ( 4.2 ) eye disorders1 ( 4.2 ) conjunctivitis1 ( 4.2 ) general disorders and administration site conditions1 ( 4.2 ) pyrexia1 ( 4.2 ) classification according to meddra version 6.1 patients may have had more than one adverse event adverse events according to the medical dictionary for regulatory activities ( meddra ) primary system organ class and preferred term classification according to meddra version 6.1 patients may have had more than one adverse eventbetween may and june 2011 , 24 patients were enrolled in this study , two - thirds of whom were male ( table 1 ) . all patients were exposed to all four investigational products , completed the study , and were included in the full and safety analysis sets.table 1patient demographics and baseline characteristicscharacteristicvaluenumber of patients24median ( range ) age , years52 .5 ( 2175 ) males , n ( % ) 16 ( 66.7 ) fitzpatrick skin type , n ( % ) type ii1 ( 4.2 ) type iii23 ( 95.8 ) median ( range ) disease duration , years19 .5 ( 349 ) mean standard deviation total clinical score 7.070.78 type ii : white , always burns , tans minimally ; type iii : white , burns moderately , tans gradually ( light brown ) sum of three scores ( erythema , scaling , lesional thickness ) patient demographics and baseline characteristics type ii : white , always burns , tans minimally ; type iii : white , burns moderately , tans gradually ( light brown ) sum of three scores ( erythema , scaling , lesional thickness ) at week 4 , there was a significantly larger decrease in mean [ standard deviation ( sd ) ] tcs for those test sites treated with cal / bd aerosol foam ( 6.001.27 ) compared with those treated with cal / bd ointment ( 5.251.78 ; difference 0.75 ; 95 % ci 1.46 to 0.04 ; p = 0.038 ) , bd aerosol foam ( 4.961.85 ; difference 1.04 ; 95 % ci 1.75 to 0.33 ; p = 0.005 ) or cal / bd aerosol foam vehicle ( 1.881.12 ; difference 4.13 ; 95 % ci 4.83 to 3.42 ; p 0.001 ) . a continuous improvement in tcs was observed for all active treatments throughout the study , with the mean decrease in tcs being consistently larger with cal / bd aerosol foam compared with all other products , from the second on - treatment assessment time point ( day 8 ) until the end of the study ( fig . similarly , mean changes ( sd ) in the tcs components from baseline to week 4 were also found to be higher for those test sites treated with cal / bd aerosol foam ( erythema 1.750.71 ; scaling 2.130.47 ; lesional thickness 2.130.45 ) than for those treated with cal / bd ointment ( 1.500.66 ; 2.020.56 ; 1.730.82 , respectively ) , bd aerosol foam ( 1.440.78 ; 2.020.58 ; 1.500.77 ) and cal / bd aerosol foam vehicle ( 0.560.47 ; 0.900.47 ; 0.420.43 ; fig .1 change from baseline ( mean standard deviation ) in a tcs , and its components b erythema , c scaling , and d lesional thickness , to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) , tcs total clinical score change from baseline ( mean standard deviation ) in a tcs , and its components b erythema , c scaling , and d lesional thickness , to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) , tcs total clinical score throughout this study , reductions in total skin thickness and echo - poor band thickness were consistently greater with cal / bd aerosol foam treatment compared with all other treatments . at week 4 , treatment with cal / bd aerosol foam reduced the mean total skin thickness ( sd ) to a greater extent ( 0.810.41 mm ) , although not significantly so , than with cal / bd ointment ( 0.620.37 mm ; difference , 0.19 mm ; 95 % ci 0.40 to 0.03 ; p = 0.088 ) or bd aerosol foam ( 0.660.42 mm ; difference , 0.14 mm ; 95 % ci 0.36 to 0.07 ; p = 0.190 ) , and significantly greater compared with cal / bd aerosol foam vehicle ( 0.230.30 mm ; difference , 0.58 mm ; 95 % ci 0.79 to 0.36 ; p 0.001 ; fig . 2 ) . similarly , the mean reduction in echo - poor band thickness at week 4 was consistently greater ( but again not significantly so ) following treatment with cal / bd aerosol foam ( 0.570.21 mm ) than with cal / bd ointment ( 0.460.21 mm ; difference 0.11 mm ; 95 % ci 0.22 to 0.00 ; p = 0.052 ) , and was significantly greater compared with bd aerosol foam ( 0.450.25 mm ; difference 0.12 mm ; 95 % ci 0.23 to 0.01 ; p = 0.037 ) and cal / bd aerosol foam vehicle ( 0.120.20 mm ; difference 0.44 mm ; 95 % ci 0.55 to 0.33 ; p 0.001 ; fig . 3 ) . fig .2 change from baseline ( mean standard deviation ) in total skin thickness ( assessed by ultrasonographic imagery ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) fig .3 change from baseline ( mean standard deviation ) in echo - poor band thickness ( assessed by ultrasonography ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) change from baseline ( mean standard deviation ) in total skin thickness ( assessed by ultrasonographic imagery ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) change from baseline ( mean standard deviation ) in echo - poor band thickness ( assessed by ultrasonography ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) at week 4 , there was a significantly larger decrease in mean [ standard deviation ( sd ) ] tcs for those test sites treated with cal / bd aerosol foam ( 6.001.27 ) compared with those treated with cal / bd ointment ( 5.251.78 ; difference 0.75 ; 95 % ci 1.46 to 0.04 ; p = 0.038 ) , bd aerosol foam ( 4.961.85 ; difference 1.04 ; 95 % ci 1.75 to 0.33 ; p = 0.005 ) or cal / bd aerosol foam vehicle ( 1.881.12 ; difference 4.13 ; 95 % ci 4.83 to 3.42 ; p 0.001 ) . a continuous improvement in tcs was observed for all active treatments throughout the study , with the mean decrease in tcs being consistently larger with cal / bd aerosol foam compared with all other products , from the second on - treatment assessment time point ( day 8 ) until the end of the study ( fig . similarly , mean changes ( sd ) in the tcs components from baseline to week 4 were also found to be higher for those test sites treated with cal / bd aerosol foam ( erythema 1.750.71 ; scaling 2.130.47 ; lesional thickness 2.130.45 ) than for those treated with cal / bd ointment ( 1.500.66 ; 2.020.56 ; 1.730.82 , respectively ) , bd aerosol foam ( 1.440.78 ; 2.020.58 ; 1.500.77 ) and cal / bd aerosol foam vehicle ( 0.560.47 ; 0.900.47 ; 0.420.43 ; fig .1 change from baseline ( mean standard deviation ) in a tcs , and its components b erythema , c scaling , and d lesional thickness , to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) , tcs total clinical score change from baseline ( mean standard deviation ) in a tcs , and its components b erythema , c scaling , and d lesional thickness , to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) , tcs total clinical scorethroughout this study , reductions in total skin thickness and echo - poor band thickness were consistently greater with cal / bd aerosol foam treatment compared with all other treatments . at week 4 , treatment with cal / bd aerosol foam reduced the mean total skin thickness ( sd ) to a greater extent ( 0.810.41 mm ) , although not significantly so , than with cal / bd ointment ( 0.620.37 mm ; difference , 0.19 mm ; 95 % ci 0.40 to 0.03 ;p = 0.088 ) or bd aerosol foam ( 0.660.42 mm ; difference , 0.14 mm ; 95 % ci 0.36 to 0.07 ; p = 0.190 ) , and significantly greater compared with cal / bd aerosol foam vehicle ( 0.230.30 mm ; difference , 0.58 mm ; 95 % ci 0.79 to 0.36 ; p 0.001 ; fig . 2 ) . similarly , the mean reduction in echo - poor band thickness at week 4 was consistently greater ( but again not significantly so ) following treatment with cal / bd aerosol foam ( 0.570.21 mm ) than with cal / bd ointment ( 0.460.21 mm ; difference 0.11 mm ; 95 % ci 0.22 to 0.00 ; p = 0.052 ) , and was significantly greater compared with bd aerosol foam ( 0.450.25 mm ; difference 0.12 mm ; 95 % ci 0.23 to 0.01 ; p = 0.037 ) and cal / bd aerosol foam vehicle ( 0.120.20 mm ; difference 0.44 mm ; 95 % ci 0.55 to 0.33 ; p 0.001 ; fig . 3 ) . fig .2 change from baseline ( mean standard deviation ) in total skin thickness ( assessed by ultrasonographic imagery ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) fig .3 change from baseline ( mean standard deviation ) in echo - poor band thickness ( assessed by ultrasonography ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) change from baseline ( mean standard deviation ) in total skin thickness ( assessed by ultrasonographic imagery ) to end of treatment . ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) change from baseline ( mean standard deviation ) in echo - poor band thickness ( assessed by ultrasonography ) to end of treatment . bd betamethasone 0.5 mg / g ( as dipropionate ) , cal calcipotriol 50 g / g ( as hydrate ) seventeen aes were reported by 11 patients during this study , with the most common being headache ( n = 5 ) and arthralgia ( n = 3 ) ( table 2 ) . there were no reports of serious aes or adrs and no withdrawals due to aes.table 2adverse events according to the medical dictionary for regulatory activities ( meddra ) primary system organ class and preferred termadverse eventpatients , n ( % ) nervous system disorders6 ( 25.0 ) headache5 ( 20.8 ) sciatica1 ( 4.2 ) musculoskeletal and connective tissue disorders4 ( 16.7 ) arthralgia3 ( 12.5 ) back pain1 ( 4.2 ) gastrointestinal disorders3 ( 12.5 ) diarrhoea1 ( 4.2 ) toothache2 ( 8.3 ) infections and infestations2 ( 8.3 ) gastroenteritis1 ( 4.2 ) nasopharyngitis1 ( 4.2 ) eye disorders1 ( 4.2 ) conjunctivitis1 ( 4.2 ) general disorders and administration site conditions1 ( 4.2 ) pyrexia1 ( 4.2 ) classification according to meddra version 6.1 patients may have had more than one adverse event adverse events according to the medical dictionary for regulatory activities ( meddra ) primary system organ class and preferred term classification according to meddra version 6.1 patients may have had more than one adverse eventthis 4 - week exploratory study demonstrated significant improvement in antipsoriatic effect with the novel cal / bd aerosol foam formulation compared with the cal / bd ointment formulation , bd aerosol foam and cal / bd aerosol foam vehicle . the modified version of the psoriasis plaque test employed in this study is a quick , safe , information - rich and relatively low - cost method to evaluate the antipsoriatic effect of psoriasis treatments . it enables intra - individual comparisons and increases the probability of detection of clinically relevant differences despite the relatively short study period and limited sample size . the improved efficacy of other foam preparations over conventional formulations of topical treatments in psoriasis has been demonstrated in several studies . for example , clobetasol propionate in a foam formulation is more effective than the cream and solution formulations in decreasing psoriasis area and severity index score . similarly , betamethasone valerate is more effective in improving psoriasis symptoms when delivered as foam versus lotion . in addition to their application advantage , foam vehicles have unique characteristics and properties that can be engineered to enhance topical drug delivery . foam formulations of clobetasol propionate and betamethasone valerate absorb more rapidly into the skin , with greater total skin absorption than their respective comparison formulations , namely , clobetasol propionate solution and betamethasone valerate lotion . furthermore , using an in vitro skin permeation model , huang et al . showed that foam vehicle delivers more clobetasol propionate than other formulations ( solution , cream and lotion ) and does so more efficiently . consistent with these findings , an in vitro study assessing skin penetration of the cal / bd aerosol foam demonstrated that the levels of diffusion of each active ingredient into a skin model were consistently higher for cal / bd aerosol foam , with significantly higher steady - state levels of cal and bd , than cal / bd ointment . as well as providing a highly effective treatment , optimizing drug delivery to the skin , the vehicle has also been designed to provide a better user experience to be a more cosmetically acceptable preparation than current formulations . treatment non - adherence has been recognized as an important and complex issue in disease management . for psoriasis treatment , the patient s preference for certain formulations and their perception of the efficacy of their treatmentpsoriasis patients are less willing to adhere to their topical treatment if they find application to be cumbersome and time consuming , and comparisons of treatment vehicles have shown that patients prefer more cosmetically elegant formulations , such as foam vehicles , which are convenient and easy to use , thereby minimizing impact on daily life . in conclusion , this exploratory study has demonstrated a superior antipsoriatic effect with cal / bd aerosol foam compared with cal / bd ointment , bd aerosol foam and cal / bd aerosol foam vehicle . the aerosol foam formulation may represent a more efficacious and acceptable alternative to well - established , conventional formulations of cal / bd . mo was an employee of leo pharma a / s at the time of this study .\noutput:\n" }, { "from": "agent", "value": "background and objectivethe antipsoriatic effect of an innovative aerosol foam formulation of fixed combination calcipotriol 50 g / g ( as hydrate ; cal ) and betamethasone 0.5 mg / g ( as dipropionate ; bd ) was explored in order to compare the effect with that of the first - line treatment cal / bd ointment.methodsthis was a phase iia , single - centre , investigator - blinded , exploratory study , with intra - individual comparison using a modified psoriasis plaque test . patients were treated once daily ( 6 days / week ) for 4 weeks with cal / bd foam , cal / bd ointment , bd foam and cal / bd foam vehicle , randomized to four plaque test sites ( 5 cm2 each ) . the primary efficacy endpoint was change in total clinical score ( tcs ; sum of erythema , scaling and lesional thickness ) . secondary endpoints included ultrasonographic changes in total skin thickness and echo - poor band thickness , and adverse events.resultstwenty - four patients , median age 52.5 years ( range 2175 ) , completed this study . at week 4 , test sites treated with cal / bd foam had a significantly greater decrease in mean ( sd ) tcs ( 6.00 1.27 ) versus those treated with cal / bd ointment ( 5.25 1.78 ; difference 0.75 ; 95 % ci 1.46 to 0.04 ; p = 0.038 ) , bd foam ( 4.96 1.85 ; difference 1.04 ; 95 % ci 1.75 to 0.33 ; p = 0.005 ) or foam vehicle ( 1.88 1.12 ; difference 4.13 ; 95 % ci 4.83 to 3.42 ; p < 0.001 ) . total skin thickness and echo - poor band thickness of cal / bd foam - treated sites were reduced to a greater extent than those treated with comparators . eleven patients reported 17 adverse events , the most frequent being headache ( five patients ) . there were no lesional / perilesional adverse events or adverse drug - related events.conclusionscal / bd foam demonstrated a significant improvement in antipsoriatic effect over cal / bd ointment , bd foam and foam vehicle alone ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tumor protein 52 ( tp53 ) gene , which encodes transcription factor p53 , maps to chromosome 17pl 3.1 , spanning around 20 kilobase ( kb ) pairs , and comprises 11 exons . the p53 gene is well - suited to mutational spectrum analysis for several reasons . since p53 mutations are common in many human cancers , its modest size ( 11 exons , 393 amino acids ) permits study of the entire coding region . it is highly conserved in vertebrates , allowing extrapolation of data from animal models . structural features the human p53 protein contains 393 amino acids , and has been divided structurally and functionally into four domains . the first 42 amino acids at the n - terminus constitute a transcriptional activation domain that interacts with the basal transcriptional machinery in positively regulating gene expression . amino acids 1323 in the p53 protein are identical in a number of diverse species . the sequence - specific dna - binding domain of p53 is localized between amino acid residues 102 and 292 . this domain folds into a four - stranded and five - stranded antiparallel sheet that in turn is a scaffold for two - helical loops that interact directly with the dna . the c - terminal 26 amino acids form an open protease sensitive domain composed of nine basic amino acid residues that bind to dna and rna readily with some sequence or structural preferences . the first is located 100 to 250 bp upstream of the noncoding first exon , and the second , a stronger promoter , is located within the first intron . it has two transcriptional start sites in exon 1 , and alternative splicing occurs in intron 2 and between exons 9 and 10 . two common polymorphic variants of p53 exist , arising from a single base - pair substitution at codon 72 , encoding either a proline or an arginine residue . although both polymorphic forms share similar growth - suppressive activities , recent studies suggesting subtle differences in their regulation and potency may be reflected in increased cancer susceptibility in some individuals . presence of single nucleotide polymorphism ( snp ) in the mdm2 promoter has been associated with earlier tumor genesis in patients with li fraumeni syndrome , as well as decreased survival in patients with chronic lymphocytic leukemia ( cll ) . in addition , cells homozygous [ g / g ] for snp 309 were found to have 10-fold increased resistance to topoisomerase ii inhibiting drugs . the p73 gene has been mapped to chromosome 1p36 .3 , a locus that is deleted in neuroblastoma and some other human cancers . the p73 gene encodes at least four distinct isoforms ; the full - length version , which gives rise to the protein called p73 , and three splice variants , which encode proteins referred to as p73 , and . p73 has been shown to mediate at least some functions in common with p53 , including apoptosis , transcriptional transactivation of p21waf1 / cip1 , a known target of p53 , and suppression of cell growth . but unfortunately , a contribution of p63 to tumor suppression has not yet been established . wild - type tp53 functions in checkpoint control after dna damage , resulting in either a delay in cell cycle progression at the g / s border to allow dna repair or apoptosis . tp53 has also been implicated directly in dna repair and in g2 arrest . under normal conditions , p53 is a short - lived protein that is present in cells at a barely detectable level . upon exposure of cells to various forms of exogenous stress , such as dna damage , heat shock , hypoxia , and etc . , there is a stabilization of p53 , which is responsible for an ensuing cascade of events , resulting in either cell cycle arrest or in apoptosis . further functions of p53 include senescence , and angiogenesis , centrosome duplication , adhesion and metastasis . a role for p53 in preventing malignant progression was subsequently demonstrated by the observations that transfection of p53 into cultured cells inhibited transformation by a number of oncogenes , and that mice lacking the p53 gene rapidly developed tumors with high incidence . although mice deleted of the p53 gene show a high incidence of cancer , nevertheless their viability and relatively normal development indicated that p53 function is not essential for cell growth and differentiation . both the death - receptor - associated pathways and the apaf -1-dependentapoptotic pathway ( apoptotic protease activating factor 1 ) have been shown to be involved in mediating p53 - dependent cell death . other potential apoptotic transcriptional targets of p53 include insulin - like growth factor - binding protein 3 ( igfbp - 3 ) and p53 - activated gene ( pag608 ) . the adenovirus eia , human papillomaviruses ( hpv e7 ) and sv40 huge t proteins bind to retinoblastoma protein ( prb ) , and thereby inactivate prb s ability to restrain cell division . the human papilloma virus genome encodes the e6 oncogene product to bind to p53 and degrade it . the expression of e7 in the same cells but in a p53 - / - mouse results in a reduced frequency of apoptosis and an increased frequency of development of retinal tumors . transcriptional activation by p53 accumulation of p53 in cells induces the p21 mediated inhibition of cyclin d / cdk4 and cycline / cdk2 , resulting in cell cycle arrest in g1 . the growth arrest and dna damage 45 ( gadd45 ) gene is a member of a group of growth arrest and dna damage - inducible genes ( gadd ) , and is induced by ionizing radiation in many cell types containing wt p53 . the gene pa26 , another novel p53 target gene that belongs to the gadd family play a role in growth regulation . seven in absentia homolog ( siah - 1 ) has also been shown to play a role in p53 - dependent cell - cycle arrest , and the 14 - 3 - 3 protein has been shown to be a potent p53 - mediated regulator of g2m progression . apoptotic cellular changes have been shown to involve a family of cysteine proteases called caspases ( ice / ced - 3 proteases ) , which can be activated through two main pathways , one involving the activation of death receptors , such as fas / apo1 and dr5 at the cell surface , and the other involving cytochrome - c dependent activation of the adaptor protein , apaf - 1 . transcriptional repression by p53 in addition to activating genes with p53 - binding sites , p53 can also repress promoters that lack the p53 - binding element . a number of genes , including interleukin - 6 , nuclear factor - kb rela ( nf kb ) , cyclin a , proliferating cell nuclear antigen ( pcna ) , and a number of metastasis - related genes , have been shown to be transcriptionally repressed by p53 in this way . additionally , both rna polymerase ii and iii transcription can be repressed by p53 . germline tp53 mutations mutant p53 protein can also inhibit the normal function of wild type p53 protein . approximately 50 % of all human tumors carry a p53 mutation , and at least 52 different types of tumor have p53 mutations . point mutations which alter p53 function are distributed over a large region of the molecule . at the molecular level , 53 % of germ line p53 mutationsare g : c to a : t transitions at cpg , which are naturally occurring sites of methylation in the genome . recently mutations of the oligomerization domain have been isolated from an lfs and an lfl family affecting respectively codon 344 ( leu to pro ) and 337 ( arg to cys ) . although the mutations spread over essentially the entire gene , nevertheless there is considerable clustering of mutations within the central region of the protein . the majority of mutations are missense , with alterations at only five codons representing 25 % of all known mutations ( codons 175 , 245 , 248 , 249 and 273 ) . mutations in codons 248 , 273 , 245 , 175 , and 282 are the most common in both sporadic tumors and the germline , although their ranking is somewhat different sporadic tumors and the germ line . in addition , mutant p53 gene may have a role in the persistence of cancer cells and development of basal and squamous cell carcinomas . mutations of chk1 and chk2 in lfs checkpoint kinase 2 ( chk2 ) is a dna damage - activated protein kinase that lies downstream of atm in this pathway . heterozygous germ line mutations in chk2 have been identified in a subset of patients with li - fraumeni syndrome , a highly penetrant familial cancer phenotype , suggesting that chk2 is a tumor suppressor gene . these two are essential for prevention of neoplastic transformation . several proteins involved in this pathway including p53 , breast cancer type 2 suceptibility ( brca1 ) , and ataxia telangiectasia mutated ( atm ) are frequently mutated in human cancer . in a kindred with li - fraumeni syndrome ( lfs ) without an inherited tp53 mutation , previously has been reported a truncating mutation ( 1100delc ) in checkpoint kinase 2 ( chk2 ) , encoding a kinase that phosphorylates p53 on ser20 . and also chk2 missense mutation ( r145w ) has been reported in another lfs family . both 1100delc and r145w germ - line mutations in chk2 are associated with loss of the wild - type allele in the corresponding tumor specimens , and neither tumor harbors a somatic tp53 mutation . the cell cycle checkpoint kinases chk1 and chk2 act upstream of p53 in dna damage responses . chk2 is a human homologue of cds1 in schizosaccharomyces pombe and rad53 in saccharomyces cerevisiae , and chk1 is a human homologue of the s. pombe checkpoint kinase chk1 . mdm2 : a master regulator of p53 stability and activity mdm2 was originally identified as an amplified gene on double minute chromosomes in spontaneously transformed 3t3 cells . its human counterpart , the human homologue of murine ( hdm2 ) encodes a 90 - kda ( 491 amino acids ) nuclear phosphoprotein that is over expressed in several types of human tumors . the hdm2 gene spans f33 kb of genomic dna and also consists of 12 exons . in normal cells , mdm2 and p53murine double minute directly binds to residues within the n - terminal transactivation domain of p53 , a p53 target and e3 ligase that promotes the degradation of p53 through the proteasome pathway . following stress , stabilization of p53 activates numerous pathways triggering a cellular response that can lead to growth arrest , senescence , differentiation , or apoptosis . dna - damage - induced phosphorylation of p53 promotes a further conformational change , which is catalyzed by the prolyl isomerase pin1 . this leads to detachment of mdm2 from p53 and to its consequent stabilization and increase of dna - binding and transactivation activities . p53 mutants are unable to activate the expression of mdm2 , and are therefore , usually stable and expressed at high levels . down regulation of mdm2 using an sirna approach has recently provided evidence for a new role of mdm2 in the p53 response , by modulating the inhibition of the cyclindependent kinase 2 ( cdk2 ) by p21 . regulation of p53 by mdm2 murine double minute regulates p53 in three different ways . murine double minute binds to the p53 transactivation domain and inhibits its transcriptional activity ; exports p53 out of the nucleus , promoting its degradation and rendering it inaccessible to the target genes ; and promotes proteasome - mediated degradation of p53 by functioning as an e3 ubiquitin ligase . therefore , in the presence of mdm2 , the p53 protein is inactivated and does not stimulate the expression of genes involved in apoptosis , cell cycle arrest , or dna repair . in some tumors where mdm2 is over expressed , p53 is constantly inhibited and tumor growth is favored . the inactivation of mdm2 in these tumors should activate the p53 pathway and as a possible consequence should activate apoptosis . strategies to target mdm2 in tumors antisense oligonucleotides should decrease the cellular levels of mdm2 ( strategy 1 ) . compounds that inhibit the ubiquitin ligase activity of mdm2 could prevent p53 degradation ( strategy 2 ) . p14rf ( an alternate reading frame product of the cyclin - dependent kinase inhibitor 2a ( cdkn2a ) locus ) acts by blocking mdm2 - dependent degradation and transcriptional silencing of p53 . inhibitors of the p53 - mdm2 interaction should release p53 from mdm2 and as a consequence should activate p53 tumor suppressor activity ( strategy 4 ) . the stability of the p53 protein in mammals is primarily regulated in non - transformed cells by the interplay of two proteins , hdm2 and p14arf in humans . in addition to p53 , mdm2 has been reported to promote the degradation of p21 , mdmx , retinoblastoma protein ( prb ) , mtbp , ecadherin , homeodomain - interacting protein kinase 2 ( hipk2 ) , junction mediating and regulatory protein ( imy ) . targeting the mdm2 - p53 interaction for cancer therapy because the interaction between mdm2 and p53 is a primary mechanism for inhibition of the p53 function in cancers retaining wild - type p53 , targeting the mdm2 - p53 interaction by small molecules to reactivate p53 has emerged as a promising new cancer therapeutic strategy , small - molecule mdm2 inhibitors , known as nutlins , was reported in 2004 . the mdm2 - p53 interaction is mediated by a well - defined hydrophobic surface pocket in mdm2 and four key hydrophobic residues in p53 , namely phe19 , leu22 , trp23 , and leu26 . this well - defined interaction has provided the basis for the design of nonpeptide , drug - like small - molecule inhibitors of the mdm2 - p53 interaction to reactivate p53 . restoration of p53 by a genetic approach in the absence of mdm2 results in severe pathologic damage to radiosensitive mouse tissues and the death of all animals within five days . in contrast , both nutlin - 3 , and mi - 219 , show little toxicity to animals at therapeutically efficacious dose - schedules . furthermore , a whole range of small drugs is available , which act on different aspects of mutant p53 activities . these drugs are now ready to move into clinical trials , either alone or in combination with classical therapeutic approaches . in the next 10 years , such molecules are expected to contribute in an important way to the large panel of specific drugs that will be required to deliver the promises of evidence - based and personalized medicine . link between p53 and microrna micrornas , which silence the expression of target genes through the rna interference pathway , are commonly down regulated in human cancers . micrornas have emerged as key post - transcriptional regulators of gene expression , involved in diverse physiological and pathological processes . although mirnas can function as both tumor suppressors and oncogenes in tumor development , a widespread down regulation of mirnas is commonly observed in human cancers . p53 enhances the post - transcriptional maturation of several mirnas with growth - suppressive function , including microrna 16 - 1 ( mir - 1 ) , mir - 143 and mir - 145 in response to dna damage . expression of mir - 34 induces cell cycle arrest , and thereby acts together with other effectors of the p53 tumor suppressor network to inhibit inappropriate cell proliferation . another group independently demonstrated that mir - 34 is upregulated by p53 upon dna damage and promotes apoptosis . although p53 is not a typical cancer - specific antigen , its main role in the control of cell growth and apoptosis and frequent mutations in tumors make p53 a unique target for cancer therapy . activation of the p53 tumor suppressor pathway in malignant tumors has been considered an attractive approach to cancer therapy , but its clinical potential is still unknown . the first potent and selective inhibitors of the p53mdm2 interaction , the nutlins , have been identified . future studies of mdm2 inhibitors in the clinical setting are necessary to address their utility and possible advantages over the current standard therapy .\noutput:\n" }, { "from": "agent", "value": "the gene tp53 ( also known as protein 53 or tumor protein 53 ) , encoding transcription factor p53 , is mutated or deleted in half of human cancers , demonstrating the crucial role of p53 in tumor suppression . there are reports of nearly 250 independent germ line tp53 mutations in over 100 publications . the p53 protein has the structure of a transcription factor and , is made up of several domains . the main function of p53 is to organize cell defense against cancerous transformation . p53 is a potent transcription factor that is activated in response to diverse stresses , leading to the induction of cell cycle arrest , apoptosis or senescence . the p53 tumor suppressor is negatively regulated in cells by the murine double minute 2 ( mdm2 ) protein . murine double minute 2 favors its nuclear export , and stimulates its degradation . inhibitors of the p53 - mdm2 interaction might be attractive new anticancer agents that could be used to activate wild - type p53 in tumors . down regulation of mdm2 using an small interfering rna ( sirna ) approach has recently provided evidence for a new role of mdm2 in the p53 response , by modulating the inhibition of the cyclindependent kinase 2 ( cdk2 ) by p21 / waf1 ( also known as cyclin - dependent kinase inhibitor 1 or cdk - interacting protein 1 ) ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a summary of the implementation issues identified in the session was provided by joanne lupton to start the discussion . she reviewed the codex definition for dietary fiber as adopted by the codex alimentarius commission in 2009 ( 1 ) , and noted that despite the adoption of the definition denoting a significant step forward for a global consensus on the nature and identity of dietary fiber , the following elements of the definition would benefit from further debate : footnote 2 to the definition , which leaves the inclusion of undigestible carbohydrates with degrees of polymerization ( dp ) in the range of 3 and 9 to the discretion of national authorities.the absence of a list of beneficial physiological effects and appropriate criteria for their substantiation for the purpose of compliance with the definition.the analytical methodology by which fiber in food is to be quantified.various aspects of these issues were the subject of discussion during the remaining part of session 10 . footnote 2 to the definition , which leaves the inclusion of undigestible carbohydrates with degrees of polymerization ( dp ) in the range of 3 and 9 to the discretion of national authorities . the absence of a list of beneficial physiological effects and appropriate criteria for their substantiation for the purpose of compliance with the definition . the analytical methodology by which fiber in food is to be quantified . debate about the exclusion or inclusion of carbohydrates with dps in the range of 3 to 9 was focused on two major areas : ( 1 ) the lack of scientific support for differences in physiological effects between those oligomers with dp 39 and those with a higher dp and the absence of readily applicable methods that could clearly distinguish between them ; and ( 2 ) the fact that the coexistence of regulations allowing two different standards for the same definition would undermine the validity of the definition . all those who spoke regarding the physiological aspects argued that there was no basis for distinguishing between carbohydrates with a dp 10 and those with dp 9 because there were carbohydrates both above and below this cutoff point that exhibited one or more beneficial physiological effect ( s ) generally associated with fiber . the view was expressed that carbohydrates exhibiting beneficial physiological effects are distributed along a continuous spectrum of chain lengths with no clear differentiation at any particular dp . similarly , all those who spoke about methodological aspects were of the view that a universal cutoff point at a dp of 10 and above did not reflect methodological capability . among those who spoke , there was a view that historically the cutoff point of dp 101 had gained currency in the mistaken belief that it was consistently applicable to all carbohydrates in the frame for consideration as dietary fibers through precipitation in alcohol . in practice , this is not the case and methodology provides no reliable basis for imposing a distinction between carbohydrates with or without fiber - like properties on the basis of chain length alone . in addition , many contributors to the debate were of the view that to provide a discretionary approach at the national level to excluding or including carbohydrate fractions within the scope of the definition was undesirable . for nutrition research and assessment , the absence of a common definition creates difficulties for the comparison of fiber intakes across different geographic regions and in the interpretation of studies assessing possible beneficial physiological effects where datasets are drawn from different regions . for consumers and food manufacturers , the application of different interpretations ofwhat constitutes dietary fiber can result in a confusing nutrition messages for consumers , demand differences in food labeling of the same food marketed in different countries , and create difficulties for food manufacturers seeking to formulate products for a global market . nevertheless , if there had been a necessity for compromise in order to achieve agreement on a definition , then it would have been preferable to default to a position that included carbohydrates with dps in the range of 3 to 9 within the body of the definition , with discretion included in the footnote for those who disagreed , rather than in the opposite manner as is currently in the codex definition . if structured in this way , the default form of the definition would have been fully inclusive , more aligned with other existing definitions , and would have more accurately reflected the majority of opinion in the scientific community . in summary , there was a strong consensus among contributors that there is no sound scientific basis for a cutoff point at a dp 10 . the difficulty of achieving a reconsideration of this issue within the codex alimentarius was acknowledged . it was suggested that the reaffirmation of the existing scientific agreement on the issue would provide better , practical support to national authorities in their implementation . initiating the discussion of beneficial physiological effects , joanne lupton drew attention to the three categories of dietary fiber differentiated within the codex definition by their source : those occurring naturally in food as consumed ; those obtained from food raw material by physical , enzymatic , or chemical means ; and those that are synthetic in origin . of the three categories , the definition requires that the latter two must be shown to have a physiological benefit to health , while for those occurring naturally in food as consumed , no such beneficial effect is required to be demonstrated . at the same time , the definition provides no description of what constitutes a beneficial physiological effect so , to the extent that this remains open to interpretation , it provides no clear indication of the qualifying features of fibers falling within the last two categories . there is a diverse list of beneficial effects in common use in academia and by institutes , agencies , and authorities worldwide . until the 2008 session of the codex committee on nutrition and foods for special dietary uses ( ccnfsdu ) where the current definition was recommended for adoption , the codex definition of dietary fiber itself had been presented in conjunction with an illustrative list of relevant beneficial physiological effects and had met with a clear majority of support among participating governments and observer organizations ( 2 ) . the list was removed during the 2008 ccnfsdu session to simplify the definition ( 3 ) , but the list 's removal potentially leads to risks of higher levels of confusion as beneficial physiological effects are now open for different interpretations at the national level . lupton suggested that progress might be made by attempting to characterize effects in relation to three levels of agreement on the certainty of their validation : well - established beneficial effectsprobable beneficial effectspossible beneficial effectsin this way , an agreed core list of beneficial effects could be drawn up to provide a working basis for the definition but , at the same time , the list could remain open to additions as emerging science provided sufficient validation . well - established beneficial effects probable beneficial effects possible beneficial effects during a discussion , the following physiological effects received support : reduced blood total and / or ldl cholesterol levelsattenuation of postprandial glycemia / insulinemiareduced blood pressureincreased fecal bulk / laxationdecreased transit timeincreased colonic fermentation / short chain fatty acid productionpositive modulation of colonic microfloraweight loss / reduction in adiposityincreased satietysupport was not unequivocal in every case . the occurrence of most of the effects was considered to be well established for fibers in general but the health impact of some effects was the subject of discussion . while in a few cases ( reduced blood total cholesterol , reduced blood pressure ) there were considered to be clear associations between the endpoints measured and the reduction of disease risk , in other cases ( increased colonic fermentability , attenuation of postprandial glycemia / insulinemia , increased satiety ) the relevance of the endpoint measured was considered by some to be indeterminate . it was also noted that there is an ongoing discussion about relevant methods and the interpretation of the magnitude of effect from the perspective of a contribution to health . furthermore , it was pointed out that an agreement of the substantiation of the beneficial nature of any proposed effects is a case - by - case process . reduced blood total and / or ldl cholesterol levels attenuation of postprandial glycemia / insulinemia reduced blood pressure increased fecal bulk / laxation decreased transit time increased colonic fermentation / short chain fatty acid production positive modulation of colonic microflora weight loss / reduction in adiposity the view was expressed that in considering beneficial effects in the context of a definition for dietary fiber and resultant nutrient content claims , it is important to keep in mind the consumption of fibers of all types . the total fiber content of the diet contributes several different effects simultaneously and the overall benefit , however achieved mechanistically , derives primarily from the fact that fiber is not digested in the small intestine and passes to the colon intact . the beneficial outcomes of individual fiber types in individual foods should be seen in terms of their contribution to the overall benefit achieved through their contribution to total dietary fiber intake as reflected in nutrient content claims . this is in contrast to health claims made in relation to individual components where the claim is product specific and requires substantiation on a case - by - case basis in relation to the individual food ingredient . the distinction between these two circumstances is reflected in the nature of the claims made . in the case of fiber content claims , the primary consideration of beneficial effect is in relation to the total fiber content of the diet and the value to consumers of an awareness of the importance of maintaining an adequate intake of dietary fiber from a variety of sources . in the case of health claims , the consideration is entirely product - specific with the objective of making an on - pack claim , in a language understood by consumers for products containing the effective amount of the specific component . overall , there was enthusiasm for agreeing on a core list of beneficial physiological effects . at the suggestion of the audience , participants were invited to express their views by survey on whether or not carbohydrates with dps in the range of 3 to 9 should be included in the definition of dietary fiber and , if a list of beneficial physiological effects were to be compiled , to express their preferences for the effects that should be included . seventy - five responses to the survey questionnaire were received and summarized three persons declined to answer the question dp 39 on grounds of insufficient information to allow a decision and five persons left the answer to the question concerning dp 39 blank . debate about the exclusion or inclusion of carbohydrates with dps in the range of 3 to 9 was focused on two major areas : ( 1 ) the lack of scientific support for differences in physiological effects between those oligomers with dp 39 and those with a higher dp and the absence of readily applicable methods that could clearly distinguish between them ; and ( 2 ) the fact that the coexistence of regulations allowing two different standards for the same definition would undermine the validity of the definition . all those who spoke regarding the physiological aspects argued that there was no basis for distinguishing between carbohydrates with a dp 10 and those with dp 9 because there were carbohydrates both above and below this cutoff point that exhibited one or more beneficial physiological effect ( s ) generally associated with fiber . the view was expressed that carbohydrates exhibiting beneficial physiological effects are distributed along a continuous spectrum of chain lengths with no clear differentiation at any particular dp . similarly , all those who spoke about methodological aspects were of the view that a universal cutoff point at a dp of 10 and above did not reflect methodological capability . among those who spoke , there was a view that historically the cutoff point of dp 101 had gained currency in the mistaken belief that it was consistently applicable to all carbohydrates in the frame for consideration as dietary fibers through precipitation in alcohol . in practice , this is not the case and methodology provides no reliable basis for imposing a distinction between carbohydrates with or without fiber - like properties on the basis of chain length alone . in addition , many contributors to the debate were of the view that to provide a discretionary approach at the national level to excluding or including carbohydrate fractions within the scope of the definition was undesirable . for nutrition research and assessment , the absence of a common definition creates difficulties for the comparison of fiber intakes across different geographic regions and in the interpretation of studies assessing possible beneficial physiological effects where datasets are drawn from different regions . for consumers and food manufacturers , the application of different interpretations of what constitutes dietary fiber can result in a confusing nutrition messages for consumers , demand differences in food labeling of the same food marketed in different countries , and create difficulties for food manufacturers seeking to formulate products for a global marketnevertheless , if there had been a necessity for compromise in order to achieve agreement on a definition , then it would have been preferable to default to a position that included carbohydrates with dps in the range of 3 to 9 within the body of the definition , with discretion included in the footnote for those who disagreed , rather than in the opposite manner as is currently in the codex definition . if structured in this way , the default form of the definition would have been fully inclusive , more aligned with other existing definitions , and would have more accurately reflected the majority of opinion in the scientific community . in summary , there was a strong consensus among contributors that there is no sound scientific basis for a cutoff point at a dp 10 . the difficulty of achieving a reconsideration of this issue within the codex alimentarius was acknowledged . it was suggested that the reaffirmation of the existing scientific agreement on the issue would provide better , practical support to national authorities in their implementation . initiating the discussion of beneficial physiological effects , joanne lupton drew attention to the three categories of dietary fiber differentiated within the codex definition by their source : those occurring naturally in food as consumed ; those obtained from food raw material by physical , enzymatic , or chemical means ; and those that are synthetic in origin . of the three categories , the definition requires that the latter two must be shown to have a physiological benefit to health , while for those occurring naturally in food as consumed , no such beneficial effect is required to be demonstrated . at the same time , the definition provides no description of what constitutes a beneficial physiological effect so , to the extent that this remains open to interpretation , it provides no clear indication of the qualifying features of fibers falling within the last two categories . there is a diverse list of beneficial effects in common use in academia and by institutes , agencies , and authorities worldwide . until the 2008 session of the codex committee on nutrition and foods for special dietary uses ( ccnfsdu ) where the current definition was recommended for adoption , the codex definition of dietary fiber itself had been presented in conjunction with an illustrative list of relevant beneficial physiological effects and had met with a clear majority of support among participating governments and observer organizations ( 2 ) . the list was removed during the 2008 ccnfsdu session to simplify the definition ( 3 ) , but the list 's removal potentially leads to risks of higher levels of confusion as beneficial physiological effects are now open for different interpretations at the national level . lupton suggested that progress might be made by attempting to characterize effects in relation to three levels of agreement on the certainty of their validation : well - established beneficial effectsprobable beneficial effectspossible beneficial effectsin this way , an agreed core list of beneficial effects could be drawn up to provide a working basis for the definition but , at the same time , the list could remain open to additions as emerging science provided sufficient validation . well - established beneficial effects probable beneficial effects possible beneficial effects during a discussion , the following physiological effects received support : reduced blood total and / or ldl cholesterol levelsattenuation of postprandial glycemia / insulinemiareduced blood pressureincreased fecal bulk / laxationdecreased transit timeincreased colonic fermentation / short chain fatty acid productionpositive modulation of colonic microfloraweight loss / reduction in adiposityincreased satietysupport was not unequivocal in every case . the occurrence of most of the effects was considered to be well established for fibers in general but the health impact of some effects was the subject of discussion . while in a few cases ( reduced blood total cholesterol , reduced blood pressure ) there were considered to be clear associations between the endpoints measured and the reduction of disease risk , in other cases ( increased colonic fermentability , attenuation of postprandial glycemia / insulinemia , increased satiety ) the relevance of the endpoint measured was considered by some to be indeterminate . it was also noted that there is an ongoing discussion about relevant methods and the interpretation of the magnitude of effect from the perspective of a contribution to health . furthermore , it was pointed out that an agreement of the substantiation of the beneficial nature of any proposed effects is a case - by - case process . reduced blood total and / or ldl cholesterol levels attenuation of postprandial glycemia / insulinemia reduced blood pressure increased fecal bulk / laxation decreased transit time increased colonic fermentation / short chain fatty acid production positive modulation of colonic microflora weight loss / reduction in adiposity the view was expressed that in considering beneficial effects in the context of a definition for dietary fiber and resultant nutrient content claims , it is important to keep in mind the consumption of fibers of all types . the total fiber content of the diet contributes several different effects simultaneously and the overall benefit , however achieved mechanistically , derives primarily from the fact that fiber is not digested in the small intestine and passes to the colon intact . the beneficial outcomes of individual fiber types in individual foods should be seen in terms of their contribution to the overall benefit achieved through their contribution to total dietary fiber intake as reflected in nutrient content claims . this is in contrast to health claims made in relation to individual components where the claim is product specific and requires substantiation on a case - by - case basis in relation to the individual food ingredient . the distinction between these two circumstances is reflected in the nature of the claims made . in the case offiber content claims , the primary consideration of beneficial effect is in relation to the total fiber content of the diet and the value to consumers of an awareness of the importance of maintaining an adequate intake of dietary fiber from a variety of sources . in the case of health claims , the consideration is entirely product - specific with the objective of making an on - pack claim , in a language understood by consumers for products containing the effective amount of the specific component . overall , there was enthusiasm for agreeing on a core list of beneficial physiological effects . at the suggestion of the audience , participants were invited to express their views by survey on whether or not carbohydrates with dps in the range of 3 to 9 should be included in the definition of dietary fiber and , if a list of beneficial physiological effects were to be compiled , to express their preferences for the effects that should be included . seventy - five responses to the survey questionnaire were received and summarized three persons declined to answer the question dp 39 on grounds of insufficient information to allow a decision and five persons left the answer to the question concerning dp 39 blank . there was overwhelming support among the participants during discussion in the session for the inclusion in the definition for dietary fiber of carbohydrate polymers with dps in the range of 3 to 9 and of the responses to the survey , 86 % were in favor of including them and 3 % were opposed . for reasonsunknown , 11 % of respondents did not address the question . taken together , the discussion during the session and the level of support shown by the survey indicates a convincing level of agreement among experts in the field that the science supports the inclusion of carbohydrate polymers with dps in the range of 3 to 9 and provides a rationale for science - based decision making by national authorities in their implementation of the codex definition . in a discussion during the session , there was clear support for the establishment of a list of beneficial physiological effects associated with the consumption of dietary fiber . more than 80 % ( and , in the case of the first three , more than 95 % ) of respondents to the survey indicated support for the inclusion of at least the following effects in the list : reduction in blood total and / or ldl cholesterolreduction in postprandial blood glucose and / or insulin levelsincreased stool bulk and / or decreased transit timefermentability by colonic microfloraalmost a third of respondents to the survey ( 30 % ) proposed the inclusion of effects additional to these four . this response would seem to argue strongly for the adoption of an open list of beneficial effects comprising in the first instance the above four listed functions and leaving open the possibility of adding other effects to the list as and when they achieve a similar level of acceptance as a result of developing science . reduction in blood total and / or ldl cholesterol reduction in postprandial blood glucose and / or insulin levels increased stool bulk and / or decreased transit time fermentability by colonic microflora these results are consistent with several previous consensus documents . an international survey of fiber experts ( 4 ) found strong support for inclusion of oligosaccharides that are resistant to hydrolysis by human alimentary enzymes . also , several recent regional expert opinions or definitions include oligosaccharides and / or a similar list of physiological effects ( 58 ) . j.f.h . is an employee of exponent international limited . j.f.h . received an honorarium for the drafting of this paper . v.a.b . is an employee of tate & lyle plc and a member of the ilsi europe dietary carbohydrates task force . s.a.s.c . is an employee of danisco a / s and a member of the ilsi north america technical committee on carbohydrates . a.m. is an employee of ilsi europe , which is partly funded by the food and related industries . j.m.j . is the scientific advisor of the ilsi north america technical committee on carbohydrates and is a consultant for some not - for - profits and some food companies . the vahouny symposium session and writing of this paper was sponsored by both the dietary carbohydrates task force of the european branch and the carbohydrates committee of the north american branch of the international life sciences institute ( ilsi ) . industry members of the dietary carbohydrates task force of ilsi europe are : akzonobel national starch food innovation , cargill , coca - cola europe , collodes naturels international , danisco , danone , kellogg europe , kraft foods , nestl , premier foods , sdzucker / beneo group , syral , and tate & lyle . industry members of the carbohydrates committee of ilsi north america are : archer daniels midland company , beneo group , cargill incorporated , the coca - cola company , corn products international , danisco usa incorporated , dr pepper snapple group incorporated , general mills , the hershey company , kellogg company , kraft foods incorporated , mars incorporated , mcneil nutritionals , mead johnson nutritionals , national starch food innovation , nestl usa incorporated , pepsico incorporated , and tate & lyle . the opinions expressed herein are those of the authors or discussion participants and do not necessarily represent the views of ilsi europe or ilsi north america .\noutput:\n" }, { "from": "agent", "value": "a definition for dietary fiber was adopted in june 2009 by the codex alimentarius commission based on the recommendation for endorsement of the codex committee on nutrition and foods for special dietary uses ( ccnfsdu ) in november 2008 . the definition listed three categories of carbohydrate polymers that are not hydrolyzed by the endogenous enzymes in the small intestine of humans . however , the definition left the inclusion of carbohydrates with degrees of polymerization ( dp ) in the range of 3 and 9 to the discretion of national authorities and left the physiological effect ( s ) of benefit to health as undefined . the ilsi europe and ilsi north america 's committees on dietary carbohydrates organized a forum at the ninth vahouny fiber symposium in 2010 to discuss these implementation issues with the objective of building scientific consensus on how to resolve them . the results of this session are encouraging and indicated that the scientific community agrees on maintaining a worldwide consensus regarding the inclusion of non - digestible carbohydrates with dp3 as dietary fiber and on a core , non - exhaustive list of beneficial physiological effects that dietary fibers have . these results are consistent with previous worldwide agreements ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: deep vein thrombosis ( dvt ) most commonly occurs in calf veins , and its most feared complication is pulmonary thrombo - embolism ( pte ) . the incidence of dvt in the absence of prophylaxis is 16 % , 25 % and 1626 % ( in colorectal surgeries ) . the most common risk factors are major surgical procedures , especially hip replacement , and major abdominal surgeries . the most common symptom of dvt is pain in the calf and the most significant sign is tenderness in the calf with ankle edema . duplex ultrasonography ( usg ) is the investigation of choice to diagnose dvt because it is a noninvasive and hazard - free method . prevention of dvt should begin before the induction of anesthesia , as the thrombotic process begins intraoperatively and even before surgery in those with acute conditions . low molecular weight heparins ( lmwhs ) have replaced unfractionated heparin ( uh ) in many hospitals because of their many advantages over the later , like they have superior or comparable efficacy and safety , they have very less risk of bleeding because of low immunogenicity , they have decreased frequency of thrombocytopenia and osteopenia , they prevent early recurrence of thrombus in the treatment of dvt because they achieve higher quality of anticoagulation in the first hours , they are taken as single daily dose and they do not require activated partial thromboplastin time monitoring . a total of 215 highest - risk patients ( as per risk score assigned to each risk factor by caprini et al . ) undergoing elective and / or emergency general surgeries were recruited with informed written consent from the patients and approval from the hospital ethical committee . three patients were excluded because of low platelet count in two ( 14010 / l ) and abnormal coagulogram in one . the patients were randomly grouped under prophylaxis group ( n = 104 ) and control group without prophylaxis ( n = 108 ) . they were matched properly with respect to age , sex , disease type [ table 2 ] , surgical procedure [ table 3 ] and other risk factors . enoxaparin 0.4 ml ( 4000 iu ) or nadroparin 0.3 ml ( 2850 iu ) were administered subcutaneously in the anterior abdominal wall to all study group patients 12 h before induction of anesthesia and continued once a day till the 7 postoperative day or discharge , whatever was earlier . all the patients were examined daily after surgery and duplex usg was performed on the 7 postoperative day , or on appearance of signs of dvt , by blinded observers . suspicious clinical findings were confirmed by duplex usg and pte by ventilation / perfusion scan ( v / q ratio ) . established dvt was treated by uh in a dose of 80 u / kg intravenous stat followed by 18 u / kg infusion , along with warfarin 5 mg per day till therapeutic inr was achieved ( 22.5 ) . the surgeon blinded to randomization assessed the intraoperative complications , postoperative platelets ( plt s ) and blinded observers performed coagulogram on the 1 , 3 , 5 and 7 postoperative days . besides , the wound site was examined daily for bleeding and hematoma , and the injection site for pain and bruise . data were prospectively analyzed by the use of spss 11.5 and java two - way contingency table system , using yates - corrected chi square test with p - value 0.05 as significant . risk factors for dvt ( n = 212 ) diagnosis in the control and lmwh groups ( n = 212 ) surgical procedures in the lmwh and control groupsthe two groups were matched with respect to their age , sex and other known dvt risk factors [ table 1 ] , diagnosis [ table 2 ] and surgical procedures [ table 3 ] . the mean age in years was 57.29 ( 9.617 ) years and 55.72 ( 10.672 ) years in study group and in the control group , respectively . eight of the 108 control group patients developed duplex usg - proven dvt , while none among the lmwh group did so ( controls ; dvt = 8/108 , lmwh ; dvt = 0/104 , or [ odds ratio ] = 16.64 , p - value = 0.014 ) . dvt was confirmed by duplex usg , and all the patients were symptomatic for dvt . pain with ankle edema was the most common symptom ( 50 % ) and calf tenderness the most common sign ( 87.5 % ) . two of the eight dvt patients died ( 25 % ) because of pte on the 3 postoperative day , which was documented by duplex usg and ventilation perfusion scan , whereas the remaining six patients responded well to the treatment . six of the eight dvt patients were more than 60 years of age , while only two were younger than 60 years ( or = 3.4 , p = 0.247 ) . all the eight dvt patients were among the malignancy cases ( malignancy 8/172 , benign 0/40 , or = 3.90 , p = 0.352 ) . the surgeon who was blinded to the randomization did not perceive more difficulty in the lmwh group as compared with controls during the surgery [ table 4 ] . six patients on lmwh and two in the control group developed minor wound - site hemorrhage in the form of small hematomas and minor ooze ( p = 0.256 ) ; none required blood transfusions , withdrawal of the drug or re - operation . complications and postop hospital stay no significant difference was seen in the type of lmwh used ( enoxaparin n = 60 , dvt = 0 . finally , there was no significant difference in the postoperative hospital stay among the two groups ( lmwh , mean = 11.7 [ 4.1 ] days . as per our study , dvt in the kashmir valley ( jammu and kashmir , india ) occurs at an incidence equal to or greater than that in other parts of asia , but lower than that in the rest of the world . our study included highest - risk patients only , and the incidence of dvt was found to be 7.40 % without prophylaxis , as compared with 0 % in the study group ( controls 8/108 ; lmwh 0/104 ; or = 16.64 . this shows that dvt ( and pte ) was reduced to 0 by the use of lmwh . other studies support our results , showing significant reduction of dvt in general surgical patients by the use of lmwh . yik hong et al . , in a randomized controlled trial on asian patients , found a statistically significant reduction of dvt by the use of enoxaparin as compared with no prophylaxis in high - risk general surgical patients ( 3 % versus 0 % . mismetti et al . in a metaanalysis showed that lmwhs in prophylactic doses provide a 72 % reduction in the risk of dvt as compared with no treatment or placebo . various studies have found lmwh to be effective as uh in the prevention of dvt , but in view of its more convenient way of administration and overall risk benefit ratio , they advocated that lmwhs might be preferred over uh for dvt prophylaxis . all the cases of dvt occurred in cancer patients ( or = 3.90 , p = 0.352 ) . although not statistically significant , this shows that cancer patients had 3.90 - times more risk of developing dvt than benign cases . malignancy is an independent risk factor whereas benign diseases need one or more risk factors to increase the risk of dvt . six of the eight dvt patients were 60 years of age ( or = 3.4 , p = 0.247 ) , showing a higher likelihood of developing dvt after the age of 60 years , consistent with gutt et al . and caprini et al . , who categorized patients more than 60 years of age in the high - risk group for dvt . an incidence of 17.6 % ( four in hemicollectomies , two in abdominoperineal resection / low anterior resection , total 6/34 ) , was found in colorectal surgeries without prophylaxis , matching with that of torgensen et al . and jorgensen et al . , who separately found an incidence of dvt equal to 1626 % among colorectal surgeries in the absence of any prophylaxis . the low incidence of dvt in the asian population has been shown by many studies ; 0.27 % , 4.70 % and 3.0 % , than in the rest of the world . the actual cause of the low dvt incidence in asia is not known ; however , the overall low platelet count of people in the valley has been documented in our study ( 150 x 10 / dl = 40 % ; 151200 x 10 / dl = 40 % ; 201350 x10 / dl = 20 % ) , and its possibility of contributing to the low incidence of dvt needs to be proven in the future . color doppler has been used in many studies for the diagnosis of dvt because of its easy availability , cost - effectiveness and hazard - free and noninvasive nature . pain was the most common symptom in our study ( 75 % ) , consistent with others , and the most common sign was calf tenderness ( 75 % ) , followed by ankle edema ( 50 % ) , consistent with scurr . six of the 104 patients on lmwh ( 5.77 % ) and two of the 108 ( 1.85 % ) patients in the control group developed wound - site hemorrhage in the form of minor ooze and hematoma ( p = 0.256 ) ; none required withdrawal of the drug , blood transfusion or re - operation . kakkar and bergqvist et al . found the incidence of wound hematoma as 3.9 % and 6.7 % , respectively , with none of the patients requiring blood transfusion , re - operation or withdrawal of the drug . also found that there was no significant difference between lmwh and uh in terms of incisional or total blood loss during surgery , postoperative drainage or wound hematoma formation . no patient developed adverse reactions at the injection site in the form of pain , erythema , inflammation and hemorrhage / echymosis , consistent with the observations of bergqvist et al . no patient developed significant ( 140 x 10 / dl ) thrombocytopenia in our study , as shown by warkentin et al . in spite of the low - dvt incidence in asian patients , its prophylaxis should routinely be considered in high - risk general surgical patients in this part of the world because of the increased mortality from pte . and , lmwhs in view of their significant effect , higher benefit to risk ratio and convenience of administration , should preferably be used for this purpose .\noutput:\n" }, { "from": "agent", "value": "background and objectives : deep vein thrombosis ( dvt ) occurs at a lower rate in asia than in the rest of the world . we wanted to study the significance and efficacy of low molecular weight heparin ( lmwh ) in prophylaxis of dvt in major general surgical patients in the kashmir valley ( india , asia ) so as to make it a routine in our patients.patients and methods : this was a prospective study in which the effect of lmwh was compared with no prophylaxis.results : lmwhs are more effective than no prophylaxis in the prevention of dvt and pulmonary thromboembolism in highest - risk general surgical patients ( odds ratio = 16.64 ; 95 % confidence interval = 3.631130.03 ; p - value = 0.014 ) . conclusion : lmwhs have a significant prophylactic effect on dvt in general surgical patients , with a higher benefit to risk ratio , and , in spite of the low incidence of dvt in asia , its prophylaxis should routinely be considered in this part of the world as well , preferably in the form of lmwhs ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: treat to target strategy , with regular monitoring of disease activity and quick adjustments of drugs . although joint assessment remains the gold standard for disease activity , biomarkers may come to play a complementary role . in the treatment of ra , however , it is effective in only 70 % of patients , and an excellent response is seen in only 30 % of patients . a common therapeutic strategy is to start with methotrexate , and patients who do not respond to methotrexate are subsequently shifted to other drugs or combinations ( other dmards or biologicals ) . however , waiting for response to methotrexate may delay institution of other effective therapies in nonresponders and contribute to joint damage . thus , there is a need to identify nonresponders to methotrexate upfront to institute other therapies hence the need for activity and predictive biomarkers . chemokines are small proteins involved in chemoattraction of a variety of cells to site of inflammation , being important in the pathogenesis of ra and may serve as biomarkers . mcp - 2 ( monocytes chemoattractant protein 2 ) or ccl8 ( chemokine c - c motif ligand 8 ) is a chemokine involved in chemoattraction of monocytes , t cells , and nk cells . mpif - 1 ( myeloid progenitor inhibitory factor - 1 ) or ccl23 ( chemokine c - c ligand 23 ) is involved in chemoattraction of resting t cells and monocytes . both ofthese have been shown to be upregulated in a previous study in ra and are potential biomarkers . we wanted to look at their value as biomarkers in a prospective cohort of rheumatoid arthritis patients treated with methotrexate . this study was conducted from july 2011 to march 2012 at a university hospital after approval from the institutional ethics committee . written informed consent was taken from all subjects . this was a prospective study over 12 weeks , which included rheumatoid arthritis patients taking part in another clinical trial which compared starting with 7.5 mg versus 15 mg per week of methotrexate ( trial registry no . inclusion criteria were ( a ) fulfillment of the 1987 american college of rheumatology ( acr ) criteria for rheumatoid arthritis , ( b ) 18 to 65 years of age , ( c ) having high disease activity ( das28 - 3v 5.1 ) , ( d ) not taking methotrexate for 2 months , ( e ) permitted to be on corticosteroids if dose is stable for 1 week and dose of prednisolone equivalent was 10 mg / day , and ( f ) permitted to be on other disease modifying antirheumatic drugs ( dmards ) like sulfasalazine , leflunomide , and hydroxychloroquine , if dosages are stable for 2 weeks . patients were excluded if they were / had ( a ) breast - feeding or pregnant ( in women ) , ( b ) liver disease , ( c ) renal disease , ( d ) active infections or ( e ) hepatitis b or c positive . in addition , 16 age - and gender - matched controls were enrolled from attendants of patients / staff after consent . patients were started on 15 mg per week dose of methotrexate , which was escalated by 2.5 mg biweekly ( maximum 25 mg ) till 12 weeks . in addition , folate supplementation ( 5 mg twice a week = 10 mg / week ) was given . patients were monitored 4 weekly with complete blood counts and liver function tests , and methotrexate was withheld / not increased in case of cytopenias or transaminitis . the modified disease activity score using 3 variables ( das28 - 3v ) was calculated to measure the disease activity . this was calculated using the formula : das28 - 3v = [ 0.56 * ( tender joints ) + 0.28 * ( swollen joints ) + 0.70 * ln ( esr ) ] * 1.08 + 0.16 , where joint count was done on 28 joints and esr was measured using westegren method ( first hour ) . change in disease activity ( das28 - 3 ) was calculated as the difference in das28 - 3 at baseline ( 0 week ) minus final ( 12 weeks ) . patients were stratified into 3 categories of response based on change in disease activity ( das28 - 3 ) . the three categories were good , moderate , and poor responsers , defined as das28 - 31.2 , 0.61.2 , and 0.6 , respectively . in addition , the functional status of the patients was measured using indian health assessment questionnaire at baseline and 12 weeks . blood sample was obtained at baseline and 12 weeks ; serum was separated and stored at 80c . elisa for mpif - 1 and mcp - 2 ( raybio ) was done on the stored samples after completion of original study . minimum detectable limits of mpif - 1 and mcp - 2 were 7 pg / ml and 1.5 pg / ml , respectively . student 's t test was used to compare the chemokine levels between patients and controls . pearson 's correlation was used to look at the correlation between chemokine levels and disease activity . in addition , multivariable linear regression and receiver operator curve ( roc ) analysis were done . this study included 46 patients ( f : m = 35 : 11 ) with rheumatoid arthritis . their mean age was 42.611.3 yrs and duration of disease was 4.74.5 years . baseline disease activity ( das28 - 3v ) was 6.10.8 , haq score was 1.30.7 , and 30 ( 65 % ) were rheumatoid factor positive . at 12 weeks , the mean dose of methotrexate reached was 24.32.0 mg / week and mean ( sd ) change in das28 - 3v and haq was 0.50.6 and 0.30.5 , respectively . baseline level of mpif - 1 was elevated in patients compared to controls ( 1636.71009.7 , 441.2173.8 , p 0.001 ) . however , there was no difference in the mcp - 2 level ( 33.824.0 , 31.411.9 , p = ns ) ( figure 1 ) . on stratifying patients by response to mtx as per das28 - 3v , among different baseline characteristics , only mpif - 1 level was significantly different across groups ( table 1 ) . also , baseline mpif - 1 had a significant though modest correlation with das28 - 3v ( p = 0.04 ) ( figure 2 ) . on multivariate linear regression , only baseline mpif - 1 levels and disease duration were significant predictors of change in das28 - 3v ( r = 0.28 ) . on roc analysis , baseline mpif - 1 had area under curve of 0.68 ( 95 % ci 0.500.87 ) and a level of 946 pg / ml was found to have the best predictive value with a sensitivity and specificity of 55.6 and 81 % to predict good response to mtx . although baseline mpif - 1 was elevated and predicted response , it did not significantly change after 12 weeks ( 1557.41155.4 , p = ns ) . however , mcp - 2 level increased at 12 weeks ( 55.019.2 , pthere was a lack of correlation between change in das28 ( das28 - 3v ) and change in mpif - 1 levels ( mpif - 1 ) ( r = 0.24 , p = 0.1 ) or mcp - 2 levels ( mcp - 2 ) ( r = 0.144 , p = 0.35 ) . this study found serum level of mpif - 1 to be raised in rheumatoid arthritis patients compared to controls . a lower level of mpif - 1 at baseline predicted better response to methotrexate over 12 weeks . this study found mpif - 1 ( myeloid progenitor inhibitory factor - 1 ) levels to be raised 4-fold in serum of rheumatoid arthritis ( ra ) patients compared to controls . this is similar to a previous study that found a 1.3-fold higher level in plasma of patients . higher levels are not surprising , in view of the fact that mpif - 1 is involved in chemoattraction of resting t cells and monocytes . also , its cognate receptor ( ccr1 ) has been shown to be upregulated in synovial tissue of patients with rheumatoid arthritis . lower mpif - 1 levels at baseline were associated with better response to methotrexate at 12 weeks . indeed , mpif - 1 was modestly accurate on roc analysis ( auc = 0.68 ) in identifying patients with good response ( das281 .2 ) . although it had modest predictive ability , as a comparison , a recent prediction model to predict methotrexate response in jia , using snps in 4 genes and esr , could only have an auc of 0.65 . this is the first study to look at mpif - 1 as a predictor for methotrexate response . in general , there is a paucity of biomarkers to predict response to methotrexate , and a systematic review found that predictive criteria were mainly clinical including male gender , low disease activity at baseline , dmard naivety , negative rheumatoid factor , and being nonsmokers . indeed , these clinical parameters are probably markers of severe disease rather than of response to methotrexate . in contrast to our results of mpif - 1 as a predictive biomarker , we did not find it to be a useful biomarker for disease activity and found no change in levels on methotrexate treatment . a previous study also did not find any change in levels after 1 week of anti - tnf treatment , although they did find higher levels in active patients . this study did not find any difference in mcp - 2 levels between patients and controls , similar to a previous study . however , mcp - 2 has been found to be overexpressed in synovial biopsy specimens , and its transcripts are upregulated on tlr2 stimulation of cultured synovial fibroblasts . this study found an increase of mcp - 2 levels posttreatment of rheumatoid arthritis ( with decline in disease activity ) . a previous study , on the contrary , found higher levels in active patients versus quiescent patients . important drawbacks are the limited number of patients and the short followup of only 12 weeks . this short duration was chosen , as 12 weeks is fast emerging as a decision point as per both guidelines and major trials , when other drugs ( including biologicals ) are added in the face of inadequate response to mtx . we preferred to use das28 - 3v score omitting the patient assessment on visual analog scale , as our patients poorly understand the concept of a visual analog scale . to conclude , this study found that mpif - 1 may be a useful biomarker for predicting response to methotrexate in rheumatoid arthritis , with lower levels baseline predicting higher change in das28 - 3v ( better response ) .\noutput:\n" }, { "from": "agent", "value": "background . although the benchmark in the treatment of rheumatoid arthritis remains methotrexate , only 70 % of patients respond . thus , there is a need for predictive biomarkers . this study planned to evaluate serum levels of myeloid progenitor inhibitory factor - 1 ( mpif - 1 ) and monocyte chemoattractant protein 2 ( mcp - 2 ) as biomarkers . methods . patients with rheumatoid arthritis ( ra ) having high disease activity ( das28 - 3v 5.1 ) were treated with oral methotrexate ( mtx ) for 12 weeks . disease activity was measured by das28 - 3v ( modified disease activity score 3 variables ) . serum samples were stored at baseline and 12 weeks . results . this study included 46 patients ( f : m = 35 : 11 ) having mean ( sd ) age of 42.6 11.3 yrs , disease duration of 4.7 4.5 yrs , and das28 - 3v of 6.1 0.8 . serum mpif1 was elevated in patients compared to controls ( 1636.7 1009.7 , 441.2 173.8 pg / ml , p < 0.001 ) , but there was no difference in mcp2 levels ( 31.4 11.9 , 33.8 24.0 pg / ml ) . baseline mpif - 1 level was lower in good responders ( das28 - 3v 1.2 , n = 9 ) compared to poor responders ( das28 - 3v < 0.6 , n = 27 ) ( 1171.0 670.8 , 1816.7 1154.1 pg / ml , p = 0.05 ) . on roc analysis , baseline mpif1 performed reasonably to predict good response ; that is , das28 - 3v 1.2 ( auc 0.68 , 95 % ci 0.500.87 ) . conclusions . lower baseline mpif1 level predicted a good response to methotrexate at 12 weeks ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ecstasy pills belonged to two groups named amphetamines and hallucinogens , which diagnosed by chemical formula as 3,4 - methylenedioxy - methamphetamine ( mdma ) . this drug was introduced by e. merck company in 1914 , and unfortunately it was widely used . however , the use of this substance was banned due to its side effects . these pills have a temporary positive effect such as tendency to communicate with others , escalate awareness , and perceive music . its negative and destructive effects like visual hallucinations , increased heart rate and blood pressure , sleep disturbances , lack of concentration , forgetfulness , anxiety sudden attacks , and increased body temperature are also considerable . ecstasy usage has dramatically increased up to 70 % during 1995 to 2000 across the world , and its consumption is even more than heroin and cocaine , currently . studies conducted in united stated have found that using ecstasy is more prevalent among student compared to other groups , and its use has recently increased among students of universities . a portfolio of studies in different countries shows that ecstasy consumption rate is approximately 4 % , 4 % , 8.4 % , 2.8 % , and 7 % in turkey , france , brazil , italia , and united state , respectively . more than 40000 people in iran used ecstasy in 2001 , that the vast majority of them included students and youths . ecstasy consumption among male students of rasht universities , qazvin university of medical science , gilan province students , gilan universities of medical science , and tehran students was 7.25 % , 1.5 % , 4.2 % , 2.05 % , and 0.7 % , respectively . the health belief model ( hbm ) is presented as the organizing theoretical framework for this research , which is also one of the oldest theories of health behavior . numerous behavioral sciences scholars applied this model in terms of designing and assessment of behavioral intervention . health belief model , in fact , authorize us to study people effective beliefs toward decision - making process . executing this modelmake it possible for respondent 's beliefs , perceived benefits , and barriers to be more diagnosed . this model , in brief , is likely to be effective in educational designing of ecstasy preventive manner . therefore , lack of researches in terms of ecstasy consumption among isfahan university of medical science has necessitate scholars to execute this paper to determine student performance of isfahan university of medical science about ecstasy use based on health belief model . according to effectiveness of model - based education about prevention of ecstasy consumption , the result of this model can likely be beneficial in designing of attuned educational approaches in prevention of ecstasy use as this efficacy has been proven in various studies . we executed a cross - sectional study . to obtain samples , 267 students of isfahan university of medical sciencewere selected through random classify sampling who were studying in colleges including medical , health and nutrition , management and rehabilitation , nursing and midwifery and dental . to gathering data , a triplet questionnaire based on the parameters of the health belief model that was designed and confirmed by some of health education specialiststhe first part comprised demographic information including age , gender , marital condition , parent 's education , residence , and the number of family . the second section consisted of health belief model constructs , including perceived susceptibility ( 4 questions ) , perceived severity ( 9 questions ) , perceived benefits ( 6 questions ) , and cues to action ( 3 questions ) . model constructs reliability for perceived susceptibility , perceived severity , perceived benefits , and perceived barriers was 0.65 , 0.72 , 0.80 , and 0.69 , respectively . questionnaire scoring method was implemented ; this method that model constructs were vetted using three point likert scale ( agree , no comment , and disagree ) and were scored from 0 to 2 . besides that , performance was also assessed using yes and no items and scoring from 0 to 1 . data analysis was conducted with spss 14.0 using parametric and non - parametric tests of association . questionnaires were completely filled through public health specialist and attending to different campus . from the outset , individuals were informed towards study aims and ensured them that all private information will keep confidentiality . in total , 267 eligible individuals from different colleges of isfahan university of medical science took part in this study . the mean age of students was 20.951.61 years [ range 18 - 30 years ] . less than half the samples were male [ 39.3 % , n = 105 ] , and over half of the subjects [ 60.7 % , n = 162 ] were female .242 ( 90.6 % ) of subjects were single , and 25 ( 9.4 % ) of samples were married . it seems that the statistics of parents literacy of students be approximately similar in such a way that 32.6 % of fathers and 35.2 % of mothers had diploma . in terms of residence , 127 ( 47.6 % ) of studentswere lived with their family , 132 ( 49.5 % ) of individuals were resided in dormitory , and 105 ( 39.3 ) of them were lived in rental homes . in addition , the mean number of family was also 4.841.64.6 ( 2.2 % ) of students have eaten these pills that shows in table 1 based on gender , as well . the mean of model constructs for perceived susceptibility , perceived severity , perceived benefits , and perceived barrier was 72.7519.68 , 84.5816.96 , 80.4323.49 , and 81.6518.53 , respectively . about perceived susceptibility , 88 % of subjects believed that they were not getting involved with complications due to knowledge acquisition toward procedure and consumption rate of ecstasy . in terms of perceived severity , 83.5 % of individuals believed that using ecstasy will lead consequently to death , 83.9 % of students demonstrated that ecstasy consumption will result in poisoning , and 81.3 % also thought that its consumption has probably increased their contingency risk of aids and hepatitis . consistent with perceived benefits , 67.4 % of respondents also revealed that lack of consumption will lead to a healthy body , and 66.7 % , as a whole , pointed out that lack of use will result in stable conditions , mentally .82.5 % and 77.9 % of people illustrated that lack of parent 's supervision and lack of adequate knowledge are perceived as barriers , as well . the frequency of students ecstasy consumption based on gender the mean and standard deviation of health belief model constructs based on gender results have revealed that there is a significant relationship between ecstasy consumption with perceived severity and benefits ( p 0.001 ) . however , there is no significant relationship between ecstasy consumption with perceived susceptibility and barriers ( p = 0.076 , p = 0.554 ) . kruskal - wallis statistic test showed that there is a significant relationship between ecstasy consumption and parents education ( p 0.001 ) in such a way that students having parents under diploma are more likely inclined to ecstasy consumption . independent t - test also not indicated the significant relationship between ecstasy and age ( p = 0.455 ) . some of guiding sources introduced by students included 41 ( 15.4 % ) educational programs , 231 ( 86.5 % ) radio and television , finally , 131 ( 49.1 % ) newspaper ( figure 1 ) . the frequency of the most important information source 229 ( 85.8 % ) of subjects said that they were not provided adequately with information , and 227 ( 85 % ) of individuals were interested to be more aware of ecstasy pills . drawing on the aim of this study that planned to assess practice of isfahan university of medical science students regarding using ecstasy based on health belief model , as a direct result , shows that frequency of ecstasy consumption among students was 2.2 % compared to birjand university 3.4 % and gilan university of medical science 2.05 % . these statistics shows a smaller percentage compared to executed surveys in united states and england . it seems that pills consumption rate in isfahan university of medical science is partly less than other universities , its reason may be attributed to greater knowledge of students toward these pills . consistent with this survey , the average score of perceived severity is partly more than other constructs of model and is associated with performance , as well . in terms of perceived severity , most subjects believed that ecstasy consumption will lead to poisoning and even death . moreover , they identified that ecstasy consumption make them more susceptible to be at risk of aids and hepatitis . high average rate of perceived severity means students are roughly aware of ecstasy implications ; however , they think that they are not supposed to be at risk . as 86.5 % of students portrayed radio and television as mains cues to action , thus , regarding these media , seems majority of educations are in accordance with side effects of ecstasy consumption and making attempt to augment perceived susceptibility is not their point of view . in current study , it was existed a significant relationship between perceived benefits and practice in such a way that 67.4 % mentioned that lack of use will lead to a healthier body . it seems that informing individuals in terms of physical ramifications of ecstasy will cause increased perceived benefits and will result consequently in decreased usage . in khosravi investigation that was done on arak university students , the mean of perceived susceptibility was more than other components of model and had a relation with performance as well , which is not commensurate with this survey . in this implemented survey , although 66.7 % of people were women compared to 33.3 % men , there was no significant relationship between two sex ( p = 0.167 ) ; however , in other similar studies , consumption rate among men was higher outlive women . moreover , in this investigation , 66.7 % of participants who consumed pills were single , and there was no significant relationship between both single and married groups . on the other hand , in homa zarabi survey , consumption rate was more highlighted among married group . a portfolio of other factors that seems be effective in ecstasy consumption are residing in dormitory and rental homes . in this study , consumption rate was also high among students residing in dormitory that supported by consistent surveys . according to these results , it seems that dormitory students must firstly be prioritized and we must turn our attention , especially to them .229 ( 85.8 % ) of individuals mentioned that they had not provided adequately with information and 85 % of people are also motivated by getting more information in this issues . it will necessitate executing attuned educational programs for university of medical science students . since people who used radio and television programs were more than subjects who used writing media including journals , besides , as their most important and beneficial source of information was television . hence , television 's essential role must be considered for elevating knowledge of students , and we must strive to formulate and deliver attuned educational programs , timely and appropriately . high average rate of health belief model constructs in both sexes indicates low rate reason of ecstasy use among students . as mentioned above , diminish of ecstasy consumption can be partly achieved using increased perceived susceptibility , severity and benefits and decreased perceived barriers . in other studies , education based on this model will also lead to changing in model construct mean , and it will result finally in decreased dangerous behaviors , in this regard , sharifirad and karimi study is mentionable . in brief , essential to the success of prevention of ecstasy consumption using health belief model will be the attention significantly to perceived susceptibility . framing interventions toward susceptibility to the individual may be the most appropriate avenue in this population . moreover , radio and television must play a pivotal role in this process , and they should nt be neglected as essential cues to action .\noutput:\n" }, { "from": "agent", "value": "introduction : ecstasy consumption has increased 70 % worldwide , and its use is currently outweighed heroin and cocaine . conducted survey found that students more than other groups used ecstasy pills . ecstasy usage has recently augmented in students . therefore , this study aims to determine practice of isfahan university of medical science students about using ecstasy based on health belief model in 2011 . materials and methods : a cross - sectional study was conducted on 267 students of isfahan university of medical science . data were collected by a validated and reliable questionnaire in 3 parts ( demographic information , h.b.m constructs , and practice ) . to analyze , spss software ( ver .18 ) and statistical test including t - test and kruskal - wallis were used.results : the mean score of age was 20.95 1.61 years , and 39.3 % of men and 90.6 % of women were single . 2.2 % of students have used ecstasy pills . the mean score of h.b.m constructs was perceived susceptibility ( 72.75 19.68 ) , perceived severity ( 84.58 16.98 ) , and perceived benefits ( 80.43 23.49 ) . the finding presented that there was significant differences between the using ecstasy and perceived severity and perceived benefits ( p 0.001 ) , but there was no significant statistical relationship between the using ecstasy and perceived susceptibility and perceived barriers ( p = 0.076 , p = 0.554 ) . in terms of cues to action , students suggested that radio and tv are most significance cues.conclusion : according to results , to prevent ecstasy usage among isfahan university of medical science students based on health belief model , we should improve perceived susceptibility . besides , radio and tv rules as the most important cues should not also be denied . moreover , newly identified susceptibility indicates the need for quantitative research and behavioral trials ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sirolimus ( rapamycin ) is a macrolide lactone that was approved for use as an immunosuppressant in 1999 , but not for use in liver transplantation . it suppresses the t - cell response to interleukin - 2 by binding to and inhibiting the mammalian target of rapamycin ( m - tor ) . there are reports of benefits and risks for the use of sirolimus ( srl ) , in liver transplantation . investigators have reported an increase in renal failure , hepatic artery thrombosis , and overall post - transplant mortality compared to the use of calcineurin inhibitors ( cnis ) . in contrast , other studies report good outcomes and that srl has a renal - sparing effect . our center has routinely used srl for immunosuppression following liver transplantation . we have used srl as primary therapy along with a cni in the early post - operative period starting in january 2000 until it received a black boxafter that , we converted patients to srl therapy at various time points after discharge from the hospital . internal review of our database showed no increase in morbidity and / or mortality in our srl patients compared to a standard therapy of cni + enteric - coated mycophenolate sodium ( mps ) . our preliminary data suggested that srl can reduce donor graft rejection and could ameliorate renal injury secondary to increased use of cni . this study seeks to determine if there is an increase risk of complications associated with the use of srl in the first year after liver transplantation . we collected data from all patients who had received srl in the first year after liver transplant . because of previously reported markers of poor outcome associated with the use of srl , this study included overall patient mortality , donor graft loss , and renal function . further , because our previous data suggested that srl may decrease the incidence of rejection , we measured the rates of acute cellular rejection ( acr ) and steroid resistant rejection ( srr ) in our patient population . we retrospectively reviewed the university of colorado denver transplant database and collected data on all patients who received a liver transplant between january 2000 and november 2009 . this included 688 patients . an independent investigator extracted data from both electronic and paper files . the pattern of immunosuppressant use allowed us to construct five study categories from the 688 patients in the database . patients were assigned to one of the five categories according the immunosuppressive therapy given during the first year following transplantation . patients received a cni + mps at time of discharge ( primary therapy ) and through the first year of therapy . patients received a cni + mps at time of discharge ; srl was added within the first 6 months and continued through the first year . patients received a cni + mps at time of discharge ; srl was added within the first 6 months and discontinued before the first year . srl was started as primary immunosuppression before discharge from hospital after transplantation combined with other varying therapies including a cni and continued for the first year . srl was started as primary immunosuppression before discharge from hospital after transplantation combined with other varying therapies including a cni and discontinued before the first year . primary endpoints graft failure rate ( time to graft failure / death ) . mortality rate ( survival time ) . graft failure rate ( time to graft failure / death ) . mortality rate ( survival time ) . graft failure rate ( time to graft failure / death ) . mortality rate ( survival time ) . secondary endpoints acute cellular rejection rate ( proven by biopsy or clinical parameters ) . steroid resistant rejection ( biopsy proven and treated with thymoglobulin or okt3 ) . graft rejection was diagnosed by liver biopsy or by elevation of liver function test in the absence of other causes of graft dysfunction . if the liver function tests were still elevated after treatment with pulse dose steroids and the patient had not received a biopsy , one was performed . acr that was not responsive to pulse dose steroids and had biopsy proven rejection was then deemed srr and treated with thymoglobulin or okt3 . ( 3 ) renal function as defined by gfr was recorded at discharge , 1 month , 6 months , and 1 year . acute cellular rejection rate ( proven by biopsy or clinical parameters ) . steroid resistant rejection ( biopsy proven and treated with thymoglobulin or okt3 ) . graft rejection was diagnosed by liver biopsy or by elevation of liver function test in the absence of other causes of graft dysfunction . if the liver function tests were still elevated after treatment with pulse dose steroids and the patient had not received a biopsy , one was performed . acr that was not responsive to pulse dose steroids and had biopsy proven rejection was then deemed srr and treated with thymoglobulin or okt3 . ( 3 ) renal function as defined by gfr was recorded at discharge , 1 month , 6 months , and 1 yearrenal function as defined by gfr was recorded at discharge , 1 month , 6 months , and 1 year . univariate : we computed the p values for graft failure ( failure - free survival ) and mortality ( patient survival ) rate comparisons using the log rank test . the event - free ( survival ) curves were computed using the kaplan - meier method . for graft failure , mortality , and rejection events , the event rate in any group was computed as ( 1 ) event rate = 1000 ( total number of eventstotal personmonths followup ) . this rate is in units of events per 1000 person - months ( p - mos ) of followup and is a summary statistic for the corresponding time to event curve . rate ratios are also reported where the denominator is the rate in the reference control group and the numerator is the rate in the group being compared to the control group . the p values for comparing failure rates and mortality rates are computed using the log rank test . for rejection rate comparisons , this assumption was made ( in part ) since the time to each acute rejection episode was not available . analysis of deviance results showed that the poisson model is a good fit to the data . a one - way anova was used to compare means for continuous variables at baseline including gfr across the five groups after confirming that a parametric model was appropriate for each on the original scale . the chi - square test / fisher test was used to compute p values for comparing binary variables such as gender , hypertension , diabetes , and any particular diagnosis such as hepatocellular carcinoma ( hcc ) or hepatitis c virus ( hcv ) . the p value for comparing race / ethnicity was also computed using the chi - square test . the five groups of patients are listed with the patient demographics listed in table 1 . the demographic features of patients in groups 2 to 5 were comparable to the control group 1 . however , patients differed in their meld score and warm ischemic time ( wit ) . patients in groups 4 and 5 ( primary treatment group ) had lower meld score ( 18 versus 22 ) . wit was longer in group 4 patients compared to controls ; however , this was not statistically significant . the conversion groups ( 2 and 3 ) had a lower pre - transplant gfr compared to the control group 1 . there were fewer transplants done for hcv in group 4 and less for etoh in group 3 patients . graft survival figure 1 depicts plots and tables of graft survival across the five groups represented by failure rates per 1000 person - months followup . there was no statistical difference in graft survival among the five groups of patients . figure 1 depicts plots and tables of graft survival across the five groups represented by failure rates per 1000 person - months followup . there was no statistical difference in graft survival among the five groups of patients . patient survival figure 2 depicts plots and tables of patient survival across the five patient groups represented by failure rates per 1000 person - months follow up . figure 2 depicts plots and tables of patient survival across the five patient groups represented by failure rates per 1000 person - months follow up . acute cellular rejection table 2 depicts acr rates per 1000 person - months of followup . acr rates in the groups 4 and 5 ( primary treatment group ) where srl was started before discharge ( p value .0001 and .0007 ) are about 50 % less than the control group 1 and patients in the conversion group . acr rates in the groups 4 and 5 ( primary treatment group ) where srl was started before discharge ( p value .0001 and .0007 ) are about 50 % less than the control group 1 and patients in the conversion group . steroid resistant rejection table 3 depicts ssr rates per 1000 person - months of followup and reflects the results from acr . the incidence of acr in the primary treatment groups ( 4 and 5 ) ( p value = .0004 and .038 ) was about 50 % less than the control group 1 . since acr and srr rates show clinically and statistically significant differences , the adjusted rates were also computed using poisson regression as above with all 20 covariates included in the model . the 20 covariates were : recipient age , meld score , pre - transplant gfr , bmi , donor age , cit , wit , male gender , ethnicity , cadaveric donor , pre - transplant diabetes , pre - transplant hypertension , hcc , hcv , psc , laennec 's cirrhosis , hbv , aih , nash , and pbc . the adjusted rate ratios are similar to the unadjusted rate ratios showing that the primary treatment group had about half the rejection rate compared to the control group . table 3 depicts ssr rates per 1000 person - months of followup and reflects the results from acr . the incidence of acr in the primary treatment groups ( 4 and 5 ) ( p value = .0004 and .038 ) was about 50 % less than the control group 1 . since acr and srr rates show clinically and statistically significant differences , the adjusted rates were also computed using poisson regression as above with all 20 covariates included in the model . the 20 covariates were : recipient age , meld score , pre - transplant gfr , bmi , donor age , cit , wit , male gender , ethnicity , cadaveric donor , pre - transplant diabetes , pre - transplant hypertension , hcc , hcv , psc , laennec 's cirrhosis , hbv , aih , nash , and pbc . the adjusted rate ratios are similar to the unadjusted rate ratios showing that the primary treatment group had about half the rejection rate compared to the control group . glomerular filtration rate figure 3 depicts the glomerular filtration rate ( gfr ) ( ml / min ) for the five groups of patients at the times of hospital discharge , 6 months , and 1 year . as seen in table 2 , the median pre - transplant gfr of the conversion groups ( 2 and 3 ) ( p value = .0136 and .074 ) was significantly less compared to the control group 1 at time of transplantation . in figure 3 , the percent change in gfr was calculated from pre - transplant value to the value for gfr that was obtained at 1 year after transplantation . at 6 months , patients in categories 2 and 4 had a drop in mean gfr ( pvalue = .0793 and .0465 ) that was significantly more than the corresponding drop in controls . at one year , only group 4 had a significantly worse grf than the control group with a change in grf of 17.3 % ( p value = .0320 ) . while the behavior in group 5 is similar to group 4 , the sample size is lower , making the p value larger.at one year , 46 of the original 328 persons in the control group were missing , including 17 who died or were re - transplanted . we assumed that the missing patients had outcomes that were worse than those who remained in the databank . thus , the apparent mean of 6.54 ml / min decrease in gfr in the control group could be an underestimate . the decrease in gfr is likely more than the observed 6.54 ml / min if we included those patients lost to followup . so , the one year mean gfr difference between the control group and the 14 ml / min drop in category 4 patients ( srl kept ) is likely smaller than the results shown . figure 3 depicts the glomerular filtration rate ( gfr ) ( ml / min ) for the five groups of patients at the times of hospital discharge , 6 months , and 1 year . as seen in table 2 , the median pre - transplant gfr of the conversion groups ( 2 and 3 ) ( p value = .0136 and .074 ) was significantly less compared to the control group 1 at time of transplantation . in figure 3 , the percent change in gfr was calculated from pre - transplant value to the value for gfr that was obtained at 1 year after transplantation . at 6 months , patients in categories 2 and 4 had a drop in mean gfr ( pvalue = .0793 and .0465 ) that was significantly more than the corresponding drop in controls . at one year , only group 4 had a significantly worse grf than the control group with a change in grf of 17.3 % ( p value = .0320 ) . while the behavior in group 5 is similar to group 4 , the sample size is lower , making the p value larger . at one year , 46 of the original 328 persons in the control group were missing , including 17 who died or were re - transplanted . we assumed that the missing patients had outcomes that were worse than those who remained in the databank . thus , the apparent mean of 6.54 ml / min decrease in gfr in the control group could be an underestimate . the decrease in gfr is likely more than the observed 6.54 ml / min if we included those patients lost to followup . so , the one year mean gfr difference between the control group and the 14 ml / min drop in category 4 patients ( srl kept ) is likely smaller than the results shown . only group 2 patients were significantly less than the control group 1 ( p value = .0011 ) . all groups at 1 year had a mean level less than 6.0 ( ng / ml ) . our data shows that there is no increase in patient death or donor graft loss when srl is used as primary therapy or when patients are converted to srl following therapy with other immunosuppressants . further , we have no evidence that suggests srl has deleterious effects upon renal function . in contrast , our data suggests that primary therapy with srl , but not conversion to srl , reduced the incidence of acute and steroid resistant rejection in transplant recipients . sirolimus has been widely used in renal transplantation but is not currently approved for use in liver transplantation . there are reports that srl has negative effects on outcome including hat , delayed wound healing , and increased mortality compared to standard immunotherapy . our center has used srl therapy after liver transplantation at a number of different time points . few other centers have this large experience using srl in liver transplantation coupled with a nearly complete data set . data from our previous publicationsdid not support claims that the use of srl is associated with negative outcomes . rather , our previous data suggested that mtor inhibitors are safe when used as single therapy or in addition to cni after liver transplant . we observed this when srl was used as a primary immunotherapy or if srl was added later . we administered srl to patients in two regiments : we gave srl immediately after liver transplant or added / substituted srl within the first year following transplantation . there was a range of reasons for different combinations of therapies over the first year mostly from evolving protocols . the conversion and primary treatment groups represents a more heterogeneous collection of immunotherapies and must be interpreted with caution . however , comparison between the categories of patients within both groups did not show significant differences . we did not find differences between patient and / or donor graft survival between our patients who received srl compared to those who received cni + mps . similarly , there were no differences in patient and graft outcome that were related to whether srl was primary or conversion therapy . patients that received srl as primary immunosuppression , defined as srl administered before discharge from the hospital after liver transplant , had less acr and srr rejection . this was true for patients that stayed on srl for one year and for patients that stopped using srl before one year . this finding was statistically significant , and the rates of rejection were 50 % less than the control of cni + mps . finally , we reviewed our data to see if there is a difference in renal function when srl is used . srl has been used to reduce the level of cni , thus , protecting the kidney . first , since some patients die or are re - transplanted before 6 months or 1 year , their corresponding missing gfr values create a survival biases . thus , the estimates of mean gfr at one year in particular may be biased because sicker patients that have a high mortality and also a greater reduction in gfr . second , as seen in figure 3 , our center keeps the tacrolimus levels in all groups at one year less than six . thus , the lower levels of cni may independently ameliorate the negative effects upon renal function . first , it is a retrospective study and the conversion and primary treatment groups contain a heterogeneous group of practices . however , this data is almost 100 % complete and accurately describes our practice patterns and subsequent outcome when using srl in a variety of combinations during the first year . secondly , because it is retrospective and we only reviewed our practice patterns for the first year , our groups are not set up to adequately assess long - term renal outcome . rather , we can only predict kidney function within the first year of transplantation . finally , we do not routinely perform protocol biopsies to diagnose acr , so we could have overestimated the actual incidence of acr in our patient population . however , the same diagnostic criteria were applied to all categories of patients that we studied . therefore , it is unlikely that our diagnostic approach favored the diagnosis of acr in one category of patient compared to another . in conclusion , our goals for this study were to determine if our use of srl during the first year after liver transplant increased mortality or morbidity . surprisingly , srl use as a primary therapy decreased our rates of both acr and srr . based on this review , we will continue to use srl in liver transplant recipients . with the introduction of new mtor inhibitors , such as everolimus ,\noutput:\n" }, { "from": "agent", "value": "some studies suggest that sirolimus ( srl ) is associated with an increased risk of death in liver transplant recipients compared to treatment with calcineurin inhibitors ( cnis ) . we compared patients who received srl or cni in the first year after liver transplant . our database included 688 patients who received a liver transplant . the patients were divided into groups . ( 1 ) cni + mps ( mycophenolate sodium ) at time of discharge . ( 2 ) cni + mps at time of discharge ; srl was added within the first 6 months and continued through the first year . ( 3 ) cni + mps at time of discharge ; srl was added within the first 6 months and discontinued before the first year . ( 4 ) srl as primary immunosuppression . ( 5 ) srl as primary immunosuppression and discontinued before the first year . we used mortality and graft loss as the primary measures of outcome . we also quantified renal function using the change in glomerular filtration rate ( gfr ) , the presence of biopsy proven acute cellular reject ( acr ) , and steroid - resistant rejection ( srr ) . there were no significant differences in mortality or graft loss . there was no difference in patient or graft survival . patients that received srl as primary immunosuppression had 50 % less rejection compared to controls ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we adopted the experimental marine medaka , oryzias dancena . because the marine medaka is gaining attention as an experimental animal in the aquaculture . this fish is a truly euryhaline teleost , with a great capacity for hypo - and hyperosmoregulation . it also has a short interval between generations , with spawning possibilities just 60 days after hatching . most of its physiological attributes are similar across a wide spectrum of salinities , ranging from complete freshwater to normal seawater ( inoue & takei , 2003 ; kang et al . , 2008 ; cho et al . , 2010 ) . much attention has been directed toward extending the utility of functional transgenic marine medaka strains for ornamental purposes because they can be used at most naturally occurring salinities ( cho et al . , 2011 ) . the induction of triploidy has been achieved in a number of different freshwater and marine fish species ( felip et al . , 2001 ) . sterility allows organisms to avoid the metabolic costs of sexual maturation , resulting in continued somatic growths of triploid fish , with maintenance of flesh quality during the period when the diploids sexually mature . in addition , sterility prevents fish mortality related to spawning ( benfey , 1999 ) . because of these advantages , the induction and rearing of triploid fish have been practiced in the aquaculture of several economically relevant species ( hulata , 2001 ) . furthermore , sterile triploid fish are unable to breed and contribute to the local gene pool if they escape from the confinement . by conferring in the desired introduction of exotic fish species for limited purposes , triploidy can serve as an effective method by which to reduce or eliminate the environmental risks of genetically modified organisms ( dunham & devlin , 1999 ) . induced triploid by blocking the second meiosis has been proposed as one approach for the generation of transgenic fish with depressed reproductive capacities ( piferrer et al . , 2009 ) . induced triploid fish have impaired gametogenesis and investments in somatic growth may not be hindered by the metabolic costs of sexual maturation . additionally , sterility of induced triploid may be the means to prevent the decline in flesh quality associated with sexual maturation , and it also addresses concerns regarding the environmental impact of farmed escapees ( peruzzi et al . , 2004 ) . an important consequence of increased nuclear and / or cellular volume in triploid fish is the decreased ratio of surface area to volume . this could affect processes limited by the surface area , such as nutrient and metabolite exchanges , passive and active ion exchanges , and membrane binding of hormones and other messengers . due to decreased cell numbers , this decreased ratio of surface to volume also applies to whole tissues and organs ( benfey , 1999 ) . a second important consequence of increased nuclear and / or cellular volume is that , depending on the shape of the cell and its nucleus , the internal transport and diffusion distance may be increased . this could affect processes such as signal transduction from the cell surface to the nucleus , as well as the resultant production and movement of rna and proteins within and outside the nucleus and cell ( benfey , 1999 ) . some of these potential disadvantages of triploid cells may be offset by energetic advantages arising from reduced production and maintenance of cellular membranes and from the smaller relative surface area across where the ionic and osmotic gradients must be maintained ( benfey , 1999 ) . futhermore , there are numerous studies in the literature which have investigated various aspects of induced triploid fish identification methodology including analysis of the measurement of erythrocyte and nuclear size , the distinction of nucleolar number , the measurement of cell number , and the measurement of cell and nuclear size in different tissues ( benfey , 1999 ; park & kim , 2000 ) . for this reason , the purpose of this study is to determine and to compare whether diploid and induced triploid marine medaka are different in terms of main hematological and histological characteristics . experimental group of diploid marine medaka , oryzias dancena in this study were reared by methods of park et al . , the one hundred fishes were quarantined by the male and female categories and habituated in the 100 l glass aquariums for 3 days . the sex ratio of males and females was 60 males and 40 females . for collecting eggs , the fish whose standard length were over 25 mm used in this experiment and 35 males and 15 females of marine medaka were placed in each of two aquariums , and 1,000 fertilized eggs were collected immediately by net . the fertilized eggs of diploid experi - mental group ( n = 500 ) were reared in 100 l glass aquarium . induced triploid was induced in the marine medaka by the cold shock treatment ( 4c ) of fertilized eggs for two minutes after fertilization of 45 minutes ( ko , 2013 ) . induced triploid was confirmed with chromosomal and erythrocyte measurements and also the flow - cytometric analyses by using flow cytometry ( pa - ii , partec , germany ) . we extracted the eye , kidney and midgut epithelium needed for histological observations from each species . each sample was fixed in bouin 's solution during the day and washed with flowing water . for decalcification , they were processed in decalcification solution for 24 hrs , and then , washed again . next , in the order of 70 % alcohol , 80 % alcohol , 90 % alcohol and 100 % alcohol used for dehydration of 1 hour each . clearing the xylene for impregnation , they were treated with both soft paraffin and hard paraffin . after impregnation , samples were embedded , trimmed and cut . at this time , each barbell of the upper , central and lower parts were by a 6 m thickness across and longitudinally . we took pictures with an optical microscope camera ( axiocam mr , carl zeiss , germany ) after scrutinizing by optical microscopy ( axiostar plus , carl zeiss , germany ) . using an eyepiece micrometer under an optical microscope ( 2006 ) to measure the thickness of the retina ; the epithelial layer ( el ) , the rod and cone layer ( rcl ) , the outer limiting membrane layer ( olm ) , the inner nuclear layer ( inl ) , the inner plexiform layer ( ipl ) , and the ganglion cell layer ( gcl ) . to analyze the development of the kidney and midgut epithelium , we used the axioskop 4.1 image analysis software ( carl zeiss , germany ) to measure the areas and volumes of the cells and nuclei with the following formulae : surface area = 1/4 ab , and volume = 4/3 ( a / 2 ) ( b / 2 ) , where a is the major axis of the cell or nucleus ; and b is the minor axis of the cell or nucleus ( park & kim , 2000 ) . the experiment was performed in triplicate and the results are reported as means of sd ( n = 30 ) , unless otherwise stated . the data were analyzed by one - way anova when using the spss statistical package ( spss 9.0 , spss inc . , means were compared by using duncan 's multiple range test , and were considered to be significantly different at p 0.05 . experimental group of diploid marine medaka , oryzias dancena in this study were reared by methods of park et al . , the one hundred fishes were quarantined by the male and female categories and habituated in the 100 l glass aquariums for 3 days . the sex ratio of males and females was 60 males and 40 females . for collecting eggs , the fish whose standard length were over 25 mm used in this experiment and 35 males and 15 females of marine medaka were placed in each of two aquariums , and 1,000 fertilized eggs were collected immediately by net . the fertilized eggs of diploid experi - mental group ( n = 500 ) were reared in 100 l glass aquarium . induced triploid was induced in the marine medaka by the cold shock treatment ( 4c ) of fertilized eggs for two minutes after fertilization of 45 minutes ( ko , 2013 ) . induced triploid was confirmed with chromosomal and erythrocyte measurements and also the flow - cytometric analyses by using flow cytometry ( pa - ii , partec , germany ) . we extracted the eye , kidney and midgut epithelium needed for histological observations from each species . each sample was fixed in bouin 's solution during the day and washed with flowing water . for decalcification , they were processed in decalcification solution for 24 hrs , and then , washed again . next , in the order of 70 % alcohol , 80 % alcohol , 90 % alcohol and 100 % alcohol used for dehydration of 1 hour each . clearing the xylene for impregnation , they were treated with both soft paraffin and hard paraffin . after impregnation , samples were embedded , trimmed and cut . at this time , each barbell of the upper , central and lower parts were by a 6 m thickness across and longitudinally . we took pictures with an optical microscope camera ( axiocam mr , carl zeiss , germany ) after scrutinizing by optical microscopy ( axiostar plus , carl zeiss , germany ) . using an eyepiece micrometer under an optical microscope ( 2006 ) to measure the thickness of the retina ; the epithelial layer ( el ) , the rod and cone layer ( rcl ) , the outer limiting membrane layer ( olm ) , the inner nuclear layer ( inl ) , the inner plexiform layer ( ipl ) , and the ganglion cell layer ( gcl ) . to analyze the development of the kidney and midgut epithelium , we used the axioskop 4.1 image analysis software ( carl zeiss , germany ) to measure the areas and volumes of the cells and nuclei with the following formulae : surface area = 1/4 ab , and volume = 4/3 ( a / 2 ) ( b / 2 ) , where a is the major axis of the cell or nucleus ; and b is the minor axis of the cell or nucleus ( park & kim , 2000 ) . the experiment was performed in triplicate and the results are reported as means of sd ( n = 30 ) , unless otherwise stated . the data were analyzed by one - way anova when using the spss statistical package ( spss 9.0 , spss inc . , means were compared by using duncan 's multiple range test , and were considered to be significantly different at p 0.05 . the ratio of the length was different for each layer , but triploid was measured to be longer than diploid from all layers . outer limiting membrane ( olm ) consists of cone photo - receptors with a shorter tapered outer segment , larger ovoid ellipsoids containing an oil droplet , and nuclei . it has a network - like structure and is situated at the base of the rods and cones . outer nuclear layer ( onl ) there was also a difference in the cellular structure between triploids and diploids . in triploids , the outer nuclear layer consisted of two strata of nuclei , while in diploids , the same layer consisted of three strata of nuclei . outer plexiform layer ( opl ) is organized as a thin reticular tissue . . ganglion cell layer ( gcl ) contains the perikarya of ganglion cells and dis - placed amacrine cells . optic nerve fiber layer ( onfl ) consists of the nerve fibers leading to the optic tract ( park et al . , 2006 ) . retina forned layer of cells along the inside lining of the eye . induced triploid thickness of retina are smaller than diploids , and induced triploid ratio of retina olm was 1.22 times , onl was 0.98 times , opl was 1.07 times , inl was 1.22 times , ipl was 1.01 times , gcl was 1.19 times , onfl was 1.12 times larger than diploid measured trends ( table 1 ) . outer nuclear layer ( * 1 ) , horizontal cell nucleus ( * 2 ) in inner nuclear layer . epithelium layer ( el ) , ganglion cell layer ( gcl ) , inner nuclear layer ( inl ) , inner plexiform layer ( ipl ) , outer limiting membrane ( olm ) , optic nerve fiber layer ( onfl ) , outer nuclear layer ( onl ) , outer plexiform layer ( opl ) and rod and cone layer ( rcl ) . bars indicate 25 m . thickness in each component layer and the numbers of outer nuclear layer of retina in diploid and induced triploid marine medaka , oryzias dancena * each values are the means standard deviation of triplicated groups . means in rows with the different superscript letter are significantly different ( p 0.05 ) , ratios of means = induced triploid / diploid . horizontal cell nucleus in the inner nuclear layer of retina major axis , minor axis , surface area and volume were each 1.10 , 1.21 , 1.33 and 1.60 times larger than diploid , and appeared to be significantly different ( table 2 ) ( p 0.05 ) . also , ganglion cell nucleus in the ganglion cell layer of retina major axis , minor axis , surface area and volume were each larger than 1.29 , 1.24 , 1.60 and 2.00 times of diploid , and appeared to be significantly different ( table 2 ) ( p 0.05 ) . on the other hand , induced triploid horizontal cell nucleus and ganglion cell nucleus show lower density than diploid ( fig .1 ) . nuclear size for horizontal cell and ganglion cell of retina and neuronal cell of optic tectum in diploid and induced triploid marine medaka , oryzias dancena * each values are the means standard deviation of triplicated groups . means in rows with the different superscript letter are significantly different ( p 0.05 ) , ratios of means = induced triploid / diploid . surface area = 1/4 ab and volume = 4/3 ( a / 2 ) ( b / 2 ) 2 ( where a = the major axis of a cell or nucleus ; b = the minor axis of a cell or nucleus ; after park and kim , 2000 ) . we observed histological sections for proximal tubule cell of kidney , hepatocytes of liver and midgut epithelium . from observed results , the histological structure of marine medaka liver and intestine major axis ratios of diploid and induced triploid of kidney were 1.19 times , and the surface area was 1.74 times where the major axis and minor axis ratios of hepatocytes were 1.29 times and 1.52 times . ratios on nuclear height of midgut epithelium appeared to be 1.20 times ( table 3 ) . each of induced triploid cell and nucleus size are shown to be bigger than diploid , but the induced triploid cell and nucleus appeared as low density ( p 0.05 ) . histological sections of kidney , liver , and intestine in diploid and induced triploid marine medaka , oryzias dancena . kidney of diploid ( a ) and induced triploid ( b ) , liver of diploid ( c ) and induced triploid ( d ) , intestine of diploid ( e ) , and induced triploid ( f ) . bars indicate 25 m . size of proximal tubule cell in kidney , hepatocytes in liver and nuclear height of midgut epithelium in diploid and induced triploid marine medaka , oryzias dancena * each values are the means standard deviation of triplicated groups . means in rows with the different superscript letter are significantly different ( p 0.05 ) , ratios of means = induced triploid / diploid . surface area = 1/4 ab and volume = 4/3 ( a / 2 ) ( b / 2 ) ( where a = the major axis of a cell or nucleus ; b = the minor axis of a cell or nucleus ; after park and kim , 2000 ) . we took blood and tissues ( kidney , liver , intestine and retina ) samples of marine medaka , oryzias dancena , and then each of diploid and induced triploid cells were compared . method of induced triploid fish was well known with chemical treatment such as colchicine and cytochalasin b , or temperature treatment to fertilization of eggs or physical treatments that were applied with pressure . chemical treatments are often used in plants and shellfish , physical treatments are used in fishes ( thorgaard , 1986 ) . we have experimented with physical treatments in this study . although the triploid fish appeared to be 1.5 times with chromosome increased and bigger cell size phenomenon than diploid , but the body size did not present gigantism . this phenomenon reported by swarup ( 1959b ) , the triploid stickleback , gasterosteus aculeatus , cartilage , blood and neuron cell and nuclear size increased as compared to diploid , but these results not affect body size gigantism . triploid has red blood cells and nuclear sizes bigger than diploids while the triploid number of red blood cells decreased more than diploid , this reason offsets the body size gigantism effect , and triploid fish which causes red blood cell enzyme activity reductions , and lowers oxygen transport ( ueno , 1984 ; sezaki et al . , 1988 ; park & park , 1995 ) . the number of outer nuclear layer was three in diploid , while two appeared in triploid . these result observed other species , stickleback , gasterosteus aculeatus and sweet fish , plecoglossus altivelis ( swarup , 1959a ; aliah et al . , triploid thickness of outer nuclear layer percentage was smaller than diploid , and also retina thickness was small as compared to diploid . in induced triploid , the rod and cone layer percentage for thickness of retina was 1.08 times bigger than diploid , and similar results which appeared in triploid sweet fish increased when compared to diploid sweet fish ( aliah et al . , 1990 ) . in case of diploid , the sweet fish nuclear number of rod and cone layer was much more than triploid sweet fish . for this reason , the induced triploid sweet fish indicated low accuracy of visual as compared to diploid ( aliah et al . ,1990 ) . also , the adverse aspects of induced triploid showed rainbow trout , oncorhynchus mykiss , where induced triploid rainbow trout easily feels stress . during mix breeding , the induced triploid rainbow trout is turned over for feeding competition as compared to diploid ( aliah et al . , 1990 ; triploid horizontal cell nucleus found in the inner nuclear layer of retina major axis , minor axis , surface area and volume and ganglion cell nucleus in ganglion cell layer of retina major axis , minor axis , surface area and volume all increased due to chromosome haploid increases ( thorgaard , 1986 ; aliah et al . , 1990 ) . measured hepatocytes , the largest ratio value of diploid and induced triploid are minor axis , which is 1.52 times . overall , induced triploid fish is bigger than diploid fish and ratio values are a variety of distribution . thus , we can find the percentage differences of diploid and induced triploid tissues . in previous studies , many organs and tissues have larger but fewer cells in induced triploids , including the brain , muscle , retina , liver and kidney ( benfey , 1999 ) . this arises due to the extra set of chromosomes dictating an increase in cell nucleus dimensions which affects overall cell size . as a result , this dissertation suggests that some tissues of induced triploid are larger than those of diploid in cells and muscles . sterile induced triploid used less energy in the gonad maturity ( cal et al . , 2006 ) . therefore , the fish meat quality is high and of good taste because of the energy used growth . therefore , industry of induced triploidization of high quality fish such as salmon , and flounder is a common trend ( kim & nam , 2001 ) . from this trendour results can be used in the future as the baseline data for measuring the histological comparisons of diploid and induced triploid tissues in fish . in this study , induced triploid marine medaka showed increased sizes in red blood cell and nuclear , horizontal cell nucleus in inner nuclear layer of retina major axis , minor axis , surface area and volume and ganglion cell nucleus in ganglion cell layers of retina major axis , minor axis , surface area and volume . on the other hand , the number of outer nuclear layers in retina and nucleus number in proximal tubule of kidney decreased like other triploid fish . the increased size of cell and nucleus and the decreased number of cell and nucleus in some tissue phenomenon are useful for indicating the use of ploidy distinctions .\noutput:\n" }, { "from": "agent", "value": "the influence of triploidization on cell and nucleus size characteristics of the same tissues of erythrocyte , retina , kidney , hepatocyte and midgut epithelium in marine medaka , oryzias dancena has been determined histologically . induced triploid fish are produced by cold shock treatments . likewise , the size of horizontal cell nucleus in inner nuclear layer of retina , ganglion cell nucleus in ganglion cell layer of retina , proximal tubule cell of kidney , hepatocytes and nuclear height of midgut epithelium all appear to be significantly larger than diploid ( p < 0.05 ) . on the other hand , retina thickness is larger in diploid than induced triploid ( p < 0.05 ) . induced triploid shows low density of cell number . results of this study suggest that same characteristics in the induced triploid exhibiting larger cells and nucleus sizes with fewer number of cells than the diploid can be useful criteria for the distinction between diploid and induced triploid , and also the ploidy level in marine medaka ." } ]