Datasets:

clinicalnlplab

/

PubmedSumm_train

like 0

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a number of glues have been used in pediatric surgery because of tissue fragility , and to protect reconstructive repair of injured organs . they have also been used to prevent in a small child a major surgery , which is usually associated with a high risk of mortality or morbidity . glues , such as fibrin glue , have been shown to lack durability and impermeability to bacteria or fluid . however , a new cyanoacrylate glue ( glubran 2 , gem , ) , which is fda approved , has opened a new horizon in reconstructive and minimally invasive surgeries . it may be used either internal or externally , and has an easy application , high adhesive properties , antiseptic barrier , and total impermeability to liquid . the present study describes our experience with using cyanoacrylate glue in the treatment and prevention of fistulas in pediatric surgery . the study was performed at , a teaching hospital associated with shiraz university of medical sciences , from january through december 2008 . the new polymerized cyanoacrylate glue was used during operation for the reinforcement or prevention of reoperation in fistula closure in pediatric surgery . the objectives of the study and likely risks involved were described to patients ' parents , and written parental consents were obtained before using the product . the trial included five cases with tracheoesophageal fistula , one case of penoscrotal hypospadias , one case of urethocutanouse fistula and two cases of extrophy complex with vesicocutanouse fistula .1 - cases with tracheosophageal fistula the glue was used in five cases of tracheoesophageal atresia and fistula ( tef ) . in a 2 - day - old girlthe glue was used to cover the native esophagus and fistula to minimize the incidence of reopening due to fragile tissue . three of the patients ( with an age range of two to eight months ) had recurrent fistula following the esophageal dilatation . in such patients , under endoscopic guidance , the fistulas were first de - epithelialzed with a bugbee diathermy electrode ( 5 - 15 w ) , and then were sealed with the glue completely . antibiotic ( cefexime [ tolid daro , ] at 50 mg / kg / day ) were used during the treatment . the closure of the fistula was checked by bronchoscopy four weeks later ( figure 1 ) . we also used the glue in a premature 5 - day - old girl who had a very low birth weight and pneumonia . she underwent temporary sealing of the large carinal fistula with bronchoscope , for stabilizing her before the definitive operation . the posterior aspect of the closure of recurrent tracheoes the postoperative recurrent tef were closed by transbrochoscopic glue injection within 4 weeks . one tef case with a fragile anastomosis was protected by covering the anastomosis with glue , which prevented anastomosis leakage . the unstable tef case with pneumonia , which had a temporary fistula closure , underwent a definitive operation later and survived .2 - pediatric urological cases two pediatric urological cases were also used to examine the effectiveness of the glue . one was a two - year - old boy , who was a case of penoscrotal hypospadias , and the other was a 4 - year - old boy with urethocutanouse fistula . both underwent glue coverage after surgery using a thin layer of glue on suture line of urethroplasty , and a thick layer of glue between dartus flap and skin coverage ( figure 2,3 ) . the thick layer of glue , which was used between dartus flap and skin in the two cases of hypospadias caused necrosis of skin ; therefore , the necrosis of skin was repaired again . a thin layer of glue on urethroplasty , not only caused the dehiscence of urethroplasty , but also helped the neourethra from collapsing after the removal of the temporary stent . fibrin glue has been widely used for tissue repair , but compared to a new generation of cyanoacrylate without cyanide toxicity , it has disadvantage of permeability and easy degradability . the privilege of new polymer of glue is that when it comes in contact with living tissues in a moist environment , it polymerizes rapidly to create a thin elastic film , and is not impaired by blood or organic fluids . moreover , the glue has the advantage that it does not cause tissue necrosis or adverse reaction when it is used as a protective layer or an easier way of the treatment for postoperative complications . a dissected urethrocutanouse fistula in hypospadias , which was reinforced by glubran open surgical approaches for recurrent tracheoesophageal fistulas have been associated with substantial rates of morbidity and mortality . the outcomes of the present cases suggest that compared to a number of previous studies , we had a lower mortality and a high rate of cure outcome . . however , high durability and impermeability of new cyanoacrylate glue was helpful in protecting the wounds from bacteria and dehiscence . the findings of the present study suggest that it might be possible to recommend glubran 2 glue whenever there is a need for a safe material as a sealant , or a protective layer to obviate a major surgery for fistula closure .\noutput:\n" }, { "from": "agent", "value": "surgical glues have been used in pediatric surgery because of the fragility of tissue , and to prevent major surgeries . the present report describes our experience with using a new cyanoacrylate glubran 2 ( viareggio , italy ) in the treatment of five cases of tracheoesophageal atresia with fistula ( one fistula protection , three recurrent fistula , and one unstable patients ) , two cases of hypospadias , one case of vesicutanouse fistula after bladder extrophy , and one case of cloacal extrophy from january december 2008 . three cases of recurrent tracheoesophageal atresia with fistula were treated by bronchoscpic glue injection . the other two cases benefited from glue through its ability to plug the fistula and to act as a protecting layer on anastomosis . in two cases with hypospadias excessive use of the glue caused skin necrosis , which was repaired . the wounds of cloacal extrophy were protected from nearby colostomy contamination and infection , and the vesicocutanouse fistula was closed by deepithelialization and sealing with glue . based on the outcomes of the cases , it may be possible to suggest that glubran 2 may be used safely in pediatric surgery as a sealant for the prevention and treatment of fistulas ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: epigenetics is currently defined as the heritable changes in gene expression without alterations in dna sequence . in particular , abnormal histone tail modifications such as acetylation have been linked to tumor progression . histone acetylation is modulated by two families of enzymes : histone deacetylases ( hdacs ) and histone acetyltransferase ( hats ) . irregular patterns of histone acetylation have been hypothesized to silence tumor suppressor genes in human cancer cells . consequently , restoring the normal complement of gene expression has become a therapeutic goal . the hdac inhibitors ( hdaci ) are a structurally diverse family of anticancer drugs that target these abnormal histone acetylations by inhibiting hdac enzymes . in mammalian systems , eleven hdac enzymes are grouped into four classes based on structural and functional characteristics . consequently , the hdaci compounds are often categorized based on their ability to inhibit various hdac classes . the approval of vorinostat ( suberoylanilide hydroxamic acid ( saha ) ) , a pan - hdac inhibitor , by the u.s . food and drug administration for treatment of cutaneous t - cell lymphoma was a recent major milestone in validating the clinical utility of this class of compounds . this success has encouraged the preclinical and clinical developments of dozens of other hdaci . one such compound is pci - 24781 ( formerly known as cra - 024781 ) , a novel , orally dosed hdaci . like vorinostat , pci - 24781 is a hydroxamic acid , and can inhibit all class i and class ii hdac isoforms , although it is reported to be a more potent inhibitor of hdacs 1 and 3 at low concentrations . assessment of in vitro activity against tumor cell lines revealed growth inhibition of multiple solid tumor lines including colon , breast , lung , prostate , ovarian , hodgkins lymphoma , and non - hodgkins lymphoma . only one published study has probed the mechanism of cell death induced by pci - 24781 in a series of lymphoma lines and reported caspase activation and generation of reactive oxygen species , consistent with the mechanism of cytoxicity of other hdaci . tumor inhibition and histone acetylationwere also noted in vivo in glioma , colon , and lung tumor xenograft models . our current study seeks to extend these mechanistic studies to acute leukemia cells and to clarify the specific role of caspase - 8 and the adaptor molecule fas - associated death domain ( fadd ) in the mechanism of apoptosis induced by pci - 24781 . effects on acetylation of histone h3 by pci - 24781 were also examined in acute lymphocytic leukemia ( all ) cells and in variants lacking caspase - 8 or fadd , and revealed a lower degree of histone h3 acetylation in the latter lines . this surprising result highlights the importance of these two components of the fas receptor pathway in conferring sensitivity to pci - 24781 in acute lymphocytic leukemia cells . jurkat , i2 .1 ( fadd deficient jurkat cells ) and cem human leukemia cell lines were acquired from american type culture collection ( manassas , va ) . i9 .2 ( caspase - 8 deficient jurkat cells ) were provided by dr . michael andreeff ( the university of texas m. d. anderson cancer center ( utmdacc ) , houston , tx ) . all cells were grown in a humidified incubator with 5 % co2 at 37c and cultured in rpmi 1640 with 10 % ( v / v ) heat - inactivation fetal bovine serum ( hyclone , logan , ut ) , 2 mm l - glutamine , 100 u / ml penicillin , and 100 g / ml streptomycin ( sigma st . ( sunnydale , ca ) . trypsin - ethylenediaminetetraacetic acid ( edta ) , propidium iodide ( pi ) , n - acetyl cysteine ( nac ) , buthionine sulfoximine ( bso ) , and triton x-100dye for the detection of intracellular superoxide ( dihydroethidium [ het ] ) was purchased from molecular probes ( eugene , or ) . caspase - 3 substrate , devd - amc , was purchased from biomol international , lp ( plymouth meeting , pa ) . the caspase inhibitors zvad - fmk and ietd - fmk were purchased from calbiochem ( san diego , ca ) . antibodies were purchased for caspase - 3 ( cell signaling , san diego , ca ) , polyclonal anti - acetyl - histone h3 ( abcam , inc . annexin v - fluorescein isothiocyanate ( annexin v - fitc ) was purchased from bd bioscience ( franklin lakes , nj ) . apoptosis was assessed by determining the percentage of subdiploid cells using pi staining followed by flow cytometric analysis as previously described . the cells were incubated for 24 hours , centrifuged , and resuspended in 500 l of pi solution ( 50 g / ml pi , 0.1 % triton x-100 , and 0.1 % sodium citrate in pbs ) . samples were assessed by flow cytometry on the fl - 3 channel ( facscalibur , becton , dickinson , franklin lakes nj ) . cellquest software was used for the analysis of the data ( bd bioscience , franklin lakes nj ) . phosphatidylserine was measured by annexin v - fitc staining according to the manufacturer 's protocol . cem cells were pretreated with 5 m qvd - oph ( a pan caspase inhibitor ) and treated with 0.5 m pci - 24781 for 30 hours , washed twice in cold pbs , resuspended in 1 x binding buffer ( 0.01 m hepes , ph 7.4 ; 0.14 m nacl ; 2.5 mm cacl2 ) , and incubated for 30 minutes in the dark at room temperature with 5 l annexin v - fitc and 10 l of 50 g / ml pi . samples were analyzed by flow cytometry on the fl - 1 ( for fitc ) and fl - 3 ( for pi ) channels and analyzed using cellquest software . the intracellular superoxide level was measured using the cell - permeable het dye as previously described . cells were centrifuged and resuspended in 1 ml of phosphate buffered saline ( pbs ) containing 10 m het . fluorescence intensity was assessed by flow cytometer on the fl - 3 ( for het ) channel and analyzed by cellquest software . cells were centrifuged , resuspended in 100 l pbs and lysed by freezing and thawing . to each well , 50 l of lysate and 150 l of 50 m devd - amc in devd buffer ( 10 % sucrose , 0.001 % igepal , 0.1 % chaps , 5 mm hepes , ph 7.25 ) were added in duplicates on a 96 - well plate . the release of fluorescence ( amc ) generated from the cleavage of devd - amc was measured using a spectrofluorometer ( spectramax gemini em , molecular devices , sunnyvale , ca ) using an excitation of 355 nm and emission of 460 nm . after treatment , jurkat cells ( 510 ) were resuspended in lysis buffer ( 1 % triton x-100 , 150 mm nacl , 5 mm edta , 20 mm sodium phosphate , ph 7.4 ) . aliquots of protein lysates ( 30 g ) were loaded on 12 % sodium dodecyl sulfate - ( sds ) polyacrylamide gels , transferred to nitrocellulose membranes , and blocked overnight at 4c with 5 % nonfat dry milk in tris - buffered saline 0.05 % tween - 20 ( tbs - t ) . membranes were probed with 1 : 1000 dilution of primary antibody in 5 % milk in tbs - t . the bound antibodies were detected using enhanced chemiluminescence , ecl plus western blotting detection system ( amerham bioscience , uk limited , little chalfont buckinghamshire , england ) . for each condition , multiple experiments were performed , and the results are presented as the mean standard deviation ( s.d ) . the differences between two group conditions were analyzed using independent , two - tailed t - tests ( microsoft excel software , redmond , wa ) . previous research indicated that pci - 24781 is cytotoxic in multiple solid tumor lines , however the study of this drug in hematopoetic cells is limited to one study conducted in hodgkins lymphoma and non - hodgkins lymphoma cell lines . to extend these mechanistic studies to leukemia cellsjurkat cells were treated with a range of pci - 24781 doses ( 0.01 m10 m ) , incubated for 24 hours and 36 hours , and percent viability was quantified by trypan blue exclusion . as seen in figure 1 ( a ) , there was a significant reduction in jurkat cell viability beginning at the 0.25 m and 0.75 m dose of pci - 24781 after exposure for 24 or 36 hours , respectively , ( p - value .05 ) . having identified doses at which pci - 24781 is cytotoxic to all cells , the next step was to examine whether the observed cell death was due to apoptosis . dna fragmentation is a well - defined characteristic of apoptosis and can be quantified by measuring the increase in the percentage of cells containing subdiploid amounts of dna by staining cells with pi . jurkat cells were treated with a range of pci - 24781 doses ( 0.01 m10 m ) , incubated for 24 hours , stained with pi and assessed by flow cytometry . figure 1 ( b ) shows that a 24 - hour exposure to pci - 24781 led to a dose - dependent increase in dna fragmentation beginning at the 0.1 m dose ( p - value .05 ) . having demonstrated that the cytotoxic effects of pci - 24781 in all cells involve dna fragmentation , we next investigated if a caspase - dependent apoptotic pathway was activated . jurkat cells were pretreated with 10 m zvad - fmk ( a pan caspase inhibitor ) for 30 minutes and then treated with 5 m pci - 24781 for 24 hours , followed by pi staining and flow cytometry . as shown in figure 2 ( a ) , the pan - caspase inhibitor alone had no effect on dna fragmentation . however , apoptotic dna fragmentation induced by pci - 24781 was significantly reduced when caspase activity was blocked ( p - value .05 ) . since caspase - 3 activation induces apoptotic dna fragmentation , this end point was specifically examined in jurkat cells in response to treatment with pci - 24781 . caspase -3-like activity was measured by monitoring fluorescence levels generated from the hydrolysis of the devd - amc fluorogenic substrate . jurkat cells were pretreated with zvad - fmk for 30 minutes , and then treated with 5 m pci - 24781 for 16 hours . figure 2 ( b ) shows that 5 m pci - 24781 increased caspase -3-like activity by 7-fold as compared with control . in addition , pretreatment with the pan caspase inhibitor , zvad - fmk , successfully abrogated the increase of caspase -3-like activity induced by 5 m pci - 24781 ( p - value .05 ) . although caspase -3-like activity was higher with the 0.5 m dose compared to 5 m pci - 24781 , these results most likely reflect that the higher dose ( 5 m ) is peaking at an early time point . this idea is supported by figure 3 ( d ) , in which a time course with 5 m revealed that maximum levels are reached at 14 hours and begin to decline after this time point . analysis of later time points , after 16 hours , most likely will further support this idea . devd - amc has been criticized as a nonspecific substrate for caspase - 3 , because it can detect caspase - 3 and / or caspase - 7 activities . caspase activation can also be measured by western blotting to visualize the cleavage of the large and small subunits of the caspase . to investigate if pci - 24781 specifically results in caspase - 3 activation , cleaved caspase - 3the 19 - kda and 17 - kda cleaved products were evident after treatment with 5 m pci - 24781 , but there was no caspase - 3 cleavage when the drug was combined with zvad - fmk pretreatment ( figure 2 ( c ) ) , verifying that caspase - 3 activation is a consequence of pci - 24781 treatment . in order to further validate the results in jurkat cells , apoptosis was measured in a different all cell line ( cem ) and by detection of a different biochemical event that occurs during apoptotic cell death . annexin v binds to phosphatidylserine displayed on the cell membrane , which is required for efficient disposal of the apoptotic cell . cem cells were pretreated with 5 m qvd - oph and treated with 0.2 m pci - 24781 for 30 hours . as expected , in cem cells , the percentage of annexin v positive cells increases with pci - 24781 treatment and decreases when caspase activation is inhibited in pci - 24781 treated cells ( figure 2 ( d ) ) . ros have been shown to induce apoptosis by the release of cytochrome c from the mitochondria , which activates the caspase cascade . previous studies have shown that many cancer cells have higher ros levels compared to normal cells . therefore , one therapeutic approach is to use ros generating anticancer agents that push intracellular ros levels beyond a critical threshold and induce apoptosis . various anticancer drugs like hdac inhibitors have been shown to increase intracellular ros levels as a single agent . since we observed caspase - 3 activation in all cells treated with pci - 24781 , we sought to determine the role of ros by measuring intracellular superoxide levels . jurkat cells were treated with 5 m of pci - 24781 , incubated for various times spanning 222 hours , stained with dihydroethidium , and analyzed by flow cytometry . as shown in figure 3 ( a ) , ros increased in a time - dependent manner beginning at 16 hours ( p - value .01 ) and peaks at 20 hours . figure 3 ( b ) shows that ros also increases in a dose - dependent manner with pci - 24781 treatment , beginning at 0.5 m at both 16 hours and 20 hours time points ( p - value .05 ) . thus , so far our findings indicate that pci - 24781 induces apoptosis , which can be linked to ros generation and / or caspase activation . the next step was to determine if ros generation precedes or follows caspase activation . superoxide levels were measured after exposure to 5 m pci - 24781 , with or without pretreatment of zvad - fmk . figure 3 ( c ) shows that when caspase activity is blocked , pci - 24781 induced ros generation is blunted ( p - value = .03 ) . therefore , caspase activation plays a role in the increase of ros levels seen with pci - 24781 treatment . jurkat cells treated with 5 m pci - 24781 were incubated between 4 and 16 hours , and caspase -3-like activity was measured using devd - amc as a substrate ( figure 3 ( d ) ) . since no ros generation was observed at 8 hours of exposure to the same dose of pci - 24781 ( data not shown ) , these results demonstrate that caspase activation occurs first , followed by ros generation . a single study has examined the molecular mechanism of apoptosis induction by pci - 24781 and reported that both caspase - 8 and -9 are cleaved and activated by the hdaci in lymphoma lines . in order to morecarefully examine the role of caspase - 8 in pci - 24781 induced cell death , we used various peptide - based caspase inhibitors . jurkat cells were treated with 0.5 m and 5 m pci - 24781 , with or without pretreatment with either zvad - fmk ( a pan caspase inhibitor ) or an inhibitor of caspase - 8 ( ietd - fmk ) . after 16 hours the cells were stained with pi reagent and dna fragmentation was assessed by flow cytometer as shown in figure 3 ( e ) . since 0.5 m represents a potentially less toxic and more clinically relevant dose , we decided to combine the lower dose ( 0.5 m ) with the caspase inhibitors . dna fragmentation by pci - 24781 was significantly reduced in the presence of ietd - fmk , suggesting that caspase - 8 is involved in the induction of apoptosis by pci - 24781 . to validate this result , i9 .2 cells ( a caspase - 8 deficient jurkat variant ) were treated with 0.5 m pci - 24781 for 16 hours . figure 3 ( f ) shows a significant decrease of dna fragmentation in i9 .2 cells treated with the hdaci as compared with wildtype jurkat cells , demonstrating again the importance of caspase - 8 in pci - 24781 induction of apoptosis . activation of caspase - 8 requires participation of an adaptor molecule which links the death receptor ( fas in this case ) with caspase activation . a second jurkat cell variant , this one lacking fadd ( i2 .1 ) , was used to further probe the functionality of the fas pathway . the primary mechanism of action of hdac inhibitors is to prevent abnormal deacetylation of histones by antagonizing hdac enzymes . this mechanism has been hypothesized to increase expression of tumor - suppressor genes . in order to test whether pci - 24781 induced histone acetylation is linked to the apoptotic pathway and generation of ros , jurkat cells were treated with 0.5 m of pci - 24781 , with or without pretreatment of nac ( an antioxidant that works by increasing levels of the most abundant intracellular antioxidant , glutathione ( gsh ) ) , bso ( an agent that depletes gsh ) zvad - fmk ( the pan - caspase inhibitor ) , or ietd - fmk ( caspase - 8 inhibitor ) , for 30 minutes . after 16 hours of incubation , acetylated histone h3 ( ac h3 ) and total histone h3 ( total h3 ) were measured by western blot . results show that , as expected , pci - 24781 exposure leads to an increase in acetylated histone h3 protein levels ( figures 4 ( a ) , 4 ( b ) and 4 ( c ) ) . neither nac nor bso changed the increase in ac h3 ( figures 4 ( a ) and 4 ( b ) ) , indicating that boosting or depleting gsh , respectively , has no effect on pci - 24781 's ability to hyperacetylate histone h3 . consistent with this result , bso depletion of gsh did not promote further dna fragmentation induction by pci - 24781 when the two compounds were combined ( figure 4 ( b ) ) . in contrast , inhibition of caspase activation with ietd - fmk or zvad - fmk blocked the increase in ac h3 protein levels ( figure 4 ( c ) ) , implicating caspases in elevated levels of acetylated histone h3 . to confirm the results obtained with the caspase - 8 inhibitor , ietd - fmk , we examined the effects of pci - 24781 exposure on histone h3 acetylation in i9 .2 cells . our findings indicate that there was less of an increase in ac h3 protein levels in caspase - 8 deficient i9 .2 cells as compared to jurkat cells ( figure 4 ( d ) ) . similar results were obtained using fadd deficient i2 .1 cells , supporting a role for fadd in the mechanism of pci -24781-mediated histone h3 acetylation ( figure 4 ( e ) ) . the difference between i2 .1 and wildtype jurkat cells was more apparent at the lower ( 250 nm ) dose of pci - 24781 , indicating that dose escalation could overcome the effect of fadd deficiency . the current study focuses on the cytotoxic effects of a hydroxamic acid hdaci , pci - 24781 , in leukemia cells . using jurkat cell variants that lack caspase - 8 ( i9 .2 ) or fadd ( i2 .1 ) , we show that apoptosis induction and histone acetylation by this hdaci are dependent upon these two proapoptotic molecules . in particular , the effects of fadd deficiency are suggestive of a role for the extrinsic apoptotic pathway triggered by fas / fas ligand interactions in these cells . data showing that inhibition of caspase activation by zvad - fmk or a lack of fadd or caspase - 8 decreases the total and acetylated protein levels of histone h3 induced by pci - 24781 was unexpected and interesting ( figures 4 ( c ) 4 ( e ) ) . previous work in our laboratory has shown hyperacetylation of histone h3 in caspase - 8 deficient cells when treated with a different hdaci , ms / sndx - 275 , indicating that pci - 24781 may be unique in this regard . however , a broader array of hdaci would need to be tested in order to determine if caspase - 8 dependent acetylation is a feature exclusive to pci - 24781 . interestingly , this caspase - 8 and fadd dependent protection against dna fragmentation and histone alterations , however , appears to be surmountable by increased doses of pci - 24781 . as shown in figure 3 ( e ) , both the 0.5 m and 5 m doses of pci - 24781 induce similar amounts of dna fragmentation as assessed by the percent subdiploid population . however , in comparing the degree of protection conferred by fadd deficiency for the two doses ( figure 3 ( g ) ) , it is apparent that the higher dose ( 5 m ) of pci - 24781 is less protected than the lower ( 0.5 m ) dose . a similar pattern is observed when histone h3 acetylation by pci - 24781 is examined in fadd deficient cells ( figure 4 ( d ) ) , which further supports the relationship between apoptosis induction and histone h3 acetylation . the exact mechanism linking caspase - 8 or fadd to histone h3 acetylation is currently under investigation in our lab . both hdac dependent and independent scenarios are being considered . for hdac dependent molecular explanations , it has been reported that caspase cleavage of hdacs can occur , resulting in their inactivation and histone h3 hyperacteylation . an hdac - independent mechanism could explain increased histone h3 acetylation and total histone h3 levels if apoptotic dna fragmentation ( mediated by caspases ) was causing release of histones from dna . in this case , free histone h3 ( some acetylated and some unacetylated ) would be detected in triton soluble lysates to a lesser degree when caspases are inhibited . our results also address a role for oxidative stress in the mechanism of action of pci - 24781 . several structurally diverse hdaci are reported to heighten intracellular levels of superoxide and peroxide , and similar results were obtained for pci - 24781 by others in lymphoma lines and by us in leukemia lines ( figures 3 ( a ) 3 ( c ) ) . this oxidative stress appears caspase dependent since zvad - fmk has a statistically significant , albeit modest effect ( figure 3 ( c ) ) . however , the antioxidant , nac , which effectively blunts ros production by pci - 24781 ( data not shown ) did not alter histone h3 acetylation by pci - 24781 ( figure 4 ( a ) ) . since nac possesses potent antiapoptotic effects , this result supports the notion that the histone h3 effects observed in the caspase - 8 deficient and fadd deficient results are due to an hdac dependent effect rather than a generalized apoptosis - mediated effect . given reports from other groups that caspases can cleave specific hdac family members rendering them inactive , and our results indicating that a pan - caspase inhibitor as well as a caspase - 8 specific inhibitor can reverse acetylation changes by pci - 24781 ( figure 4 ( b ) ) , this possibility will be further explored . the most widely cited mechanism of action for nac 's antioxidant effects is by bolstering total cellular gsh levels . we used bso , a chemical inhibitor of the pathway critical for gsh synthesis , to determine if depletion of gsh would promote apoptosis and histone h3 acetylation by pci - 24781 . it did not ( figure 4 ( b ) ) , and together with the lack of effect of nac on pci - induced hyperacetylation , indicate that modulating gsh levels does not alter the drug 's acetylation effects . a role fordeath receptor induced apoptotic pathways involving trail and fas has been investigated in the mechanism of action of hdaci other than pci - 24781 such as trichostatin a , ms / sndx - 275 , valproic acid , and vorinostat alone and in combination with other agents such as proteasome inhibitors . caspase - 8 activation has been described in a handful of these studies , however , components and regulators of the death inducing signaling complex ( disc ) which ultimately result in caspase - 8 activation have only been addressed in two hdac related papers . one study proposes that depsipeptide , ( also called fr901228 ) can upregulate fasl at the mrna level in osteosarcoma cells resulting in caspase - 8 and -3 activation . the same investigators also reported in a subsequent paper that in fas resistant osteosarcoma cells , depsipeptide causes downregulation of c - flip . since c - flip confers resistance to fas - mediated apoptosis , lowering levels of c - flip is able to overcome resistance and promote caspase - 8 activation . whether these mechanisms will hold true for pci - 24781 's effects in leukemia cells remains to be determined . despite the plethora of studies ( including ours ) citing caspase activation as a conserved event during hdaci induced cell death , numerous reports describe autophagic cell death as a consequence of treatment with this class of compounds . however , a recent paper examined the caspase - 8 and caspase - 9 dependence of two hydroxamic acid hdaci : laq824 and lbh589 . these investigators used a genetically tractable in vivo myc driven lymphoma model in which death receptor signaling was compromised due to overexpression of crma , a viral caspase - 8 inhibitor , or due to deficiency of trail . interestingly , none of these approaches to block caspase activation were able to prevent cell death by the two hdaci in the long term with morphological features of autophagy emerging . a caveat of these hdaci , though , is that unlike pci - 24781 , these two compounds are reported to inhibit hdac6 , an hdac family member which appears to regulate aggresome formation and autophagy . in contrast , pci - 24781 displays the greatest potency for hdac1 with no apparent selectivity for hdac6 as compared to the remainder of the hdac family . our work is the first to implicate the adaptor protein fadd specifically in the mechanism of action of an hdac inhibitor . compellingly , in addition to its function in the cytoplasm proximal to the fas receptor , fadd is reported to be localized to the nucleus of resting cells . using an internalization defective fas mutant lymphoma cell line , foger et al . found that fadd retaines its ability to translocate from nuclei to cytoplasm and suggest that a caspase - 8 dependent feedback loop regulates fadd trafficking . this model raises interesting possibilities regarding an endogenous role for nuclear fadd in transcriptional complexes that routinely contain hdac family members . a molecular connection between hdacs and fadd offers insight into our novel observation that fadd deficiency is a determinant of sensitivity to pci - 24781 . thus , extrapolating our findings to other hdaci and to other cancer models may contribute to efforts to maximize the therapeutic efficacy of this interesting and versatile class of agents .\noutput:\n" }, { "from": "agent", "value": "histone deacetylase inhibitors ( hdaci ) have become a promising new avenue for cancer therapy , and many are currently in phase i / ii clinical trials for various tumor types . in the present study , we show that apoptosis induction and histone alterations by pci - 24781 , a novel hydroxamic acid - based hdac inhibitor , require caspase - 8 and the adaptor molecule , fas - associated death domain ( fadd ) , in acute leukemia cells . pci - 24781 treatment also causes an increase in superoxide levels , which has been reported for other hdaci . however , an antioxidant does not reverse histone alterations caused by pci - 24781 , indicating that ros generation is likely downstream of the effects that pci - 24781 exerts on histone h3 . taken together , these results provide insight into the mechanism of apoptosis induction by pci - 24781 in leukemia by highlighting the roles of caspase - 8 , fadd and increased superoxide levels ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a study developed by american cancer society estimates that between one in eight and one in twelve will be diagnosed with breast cancer in their life time . mostly , 25 % of all cases of breast cancer deaths occur if women were diagnosed between the age of 40 and 49 . although breast cancer incidence has increased over the last decade , breast cancer mortality has declined among women of all ages , thanks to the development of both breast cancer treatment and mammography screening . among the different imaging modalities used for the detection of breast cancer , demonstrate that the ratio of breast tumor detection in vermont ( usa ) , when applying screening mammography , increased from 2 % to 36 % between 1995 and 1999 . nowadays , the digital mammography gives the opportunity of increasing the use of the cad systems in order to help the expert radiologists in the interpretation and diagnosis of mammograms . however , the rapid improvement of full digital mammography has been accompanied by natural increase of such systems . the cad is a set of tools developed to help radiologists in the detection and interpretation of mammographic images . back in 2001 , freer and ulissey have proposed an algorithm using substantial dataset containing 12,860 cases and have concluded that the application of cad in the analysis of screening mammograms may increase the malignancies detection at an early stage . the main disadvantage of existent cad systems is the lack of general algorithms producing good results for all cases and images . we will focus in this paper on mass - related lesions . in order to develop an improved computer - aided clinical decision classifying the tumor and identifying the stage of the cancer , we must ensure whether it is an area which contains a mass or not . our work focuses on classification of the tissue of the breast as mass or mass free . so , mass detection system is able to assist health professionals in finding out mass abnormalities in mammograms . however , some recent approaches have used multiple views , but this has three main drawbacks.image views must be properly registered to allow a correct comparison of regions.gray level values must also be correctly registered . there are some cases where comparison is not possible , because no correspondance between pixels can be done ( e.g. , the case of patients which have suffered from a previous breast surgery ) . there are some cases where comparison is not possible , because no correspondance between pixels can be done ( e.g. , the case of patients which have suffered from a previous breast surgery ) . it is important to note that algorithms typically working with one view can always be applied to multiple views . textural information has already been used to solve this problem and has been introduced in several works . results have indicated that the use of lbp and its extensions has been promising in different comparative studies and has been applied in different texture analysis tasks . however , lbp descriptors are not able to model mammogram texture because they are mapping only the differences of pixel gray level values . so , we will work here on a new approach taking into consideration the texture whole information , the local difference and local gray values as features , namely , gray level and local difference features ( glld ) . accordingly , we intend to investigate the efficiency of the glld based approach as a method of feature extraction . we perform our experiments on a set of 1000 rois obtained from the ddsm database . this paper , using a single view , proposes a new cad methodology in order to achieve better performances in terms of false negative and false positive using glld operator . section 2 shows some related works on mass detection in mammogram images . in section 3 , we present a brief review of lbp operator and an analysis of our glld based approach . in section 4 , a brief description of a set of classification methods is given , namely , support vector machine ( svm ) , k - nearest neighbors ( knns ) , and artificial neural network . section 5 is reserved to the validation of the glld proposed technique simulation , and results and discussion are conducted . in the last section , we summarize the paper contribution and end our work by some concluding remarks and future work . several image processing techniques have been formulated as tools that can assist early automatic mass detection . algorithms for mammographic mass detection using a single image view are based on a characteristic classifier scheme : for a given database consisting of known cases , the decision making system learns how to distinguish between the two kinds of rois ( mass and nonmass roi ) . thereafter , once the given system has been trained , a new roi can be rightly classified . among all these detection algorithmsthe first one includes the algorithms which extract features usually related to their texture from the roi and then trains a classifier . each new roi is compared to all the remaining roi images obtained from the database in order to be finally classified as mass or nonmass . table 2 shows different approaches applying this strategy . on the one hand , qian et al . have analyzed the implementation of an adaptive cad to develop a fully automatic procedure for mass segmentation and classification which consists in training a novel kalman - filtering neural network to classify features extracted from wavelet decomposition . on the other hand , christoyianni et al . have extracted features based on independent component analysis ( ica ) , gray level and texture , in order to train the ann as a classifier . furthermore , they have applied the principal component analysis ( pca ) for the preprocessing step to overcome the problem of complexity and of increasing dimensionality . the latter is based on the translation of eigenfaces approach for face detection / classification problems to the mass detection one . as result of such transformation , they have obtained a vector which describes the contribution of each eigenrau for the representation of the corresponding image . they have used these vectors in the construction of the models for the step of training . in , oliveret al . have extended their proposed method based on pca by using the two - dimensional pca ( 2dpca ) technique . varela et al . have proposed a methodology based on extracting gray level as well as morphological features and classifying , using ann , the new roi . leonardo et al . have proposed an algorithm for the detection of masses in mammographic images . the technique is based on the use of textural and shape measures for k - means clustering algorithm and the svm , aiming at detecting masses in mammographic images . as shown in table 2 , the proposed approach of chang et al . and tourassi et al . they have proposed for classification purposes to undertake a comparison of the new roi with the remaining rois in the database composed of rois depicting masses . the difference between these works appears in the similarity measure function . as indicated in table 2 , there are only limited publications trying to detect masses using template - matching based methods . from the two tables , we can conclude that one of the main dissimilarity among these recent works is the ratio between the rois depicting abnormality and the total number of cropped images . it is important to note that when the number of normal rois increases , the number of rois wrongly classified is likely to increase . one should remember that the purpose of this work is the classification of mammographic masses and normal breast tissue . all the developed methods allow the tradeoff between the reduction of false positive fraction and the increase of false negative fraction . such trade off can be ensured when using the receiver operating characteristics ( roc ) in the performance evaluation step . the roc curve is a graphical curve representing the true positive rate ( sensitivity ) versus the false positive rate ( 100 specificity ) , extensively used in classifier performance evaluation . points representing roc curve correspond to sensitivity / specificity pair representing a particular decision threshold . the auc ( known as az ) is an information about the overall performance of the approach . furthermore , the latter is a metric which can be used to compare different features , and it allows the reduction of the roc curve to a single value summarizing expected performance . most of the approaches in the first strategy have the drawback that a large number of features need to be calculated but only the most discriminant will be selected . besides , for the second strategy , the used similarity function measure for classifying needs to be recomputed for each element . in our paper , to overcome such limitations , the lbp operator has been investigated with the idea of performing gray scale invariant texture analysis . the latter has proved to be relevant in many applicationsknowing that the gray level information is of great importance in mammography , our approach will add to lbp absolute gray level information rather than gray level difference . we will focus in our approach on making use of small size feature vector as well as possible . in the following section , we will introduce our mass detection methodology based on the glld for the extraction of texture features obtained from the rois . texture classification is nowadays a challenging problem . it is an active topic in computer vision research . early methods of texture classification are based on statistical analysis of images with different textures . the most representative ones are the cooccurrence matrix method and filtering for texture - classification methods . at an early stage , exploratory models were developed to investigate rotation invariance in texture classification , such as hidden markov model and gaussian markov random field . varma and zisserman have proposed to learn from a training set a rotation invariant texton and to classify the obtained texture according to its texton distribution . varma and zisserman have later proposed to use the image patch in order to represent features directly . some recently proposed works have been developed for scale as well as affine invariant texture classification . later , ojala et al . have proposed the lbp histogram application in order to achieve a rotation invariant texture classification . it is worth noting that the lbp is efficient in describing local image pattern and its performance in computer vision and pattern recognition is promising . however , it still needs to be improved for mammography texture modeling . in order to generate texton , ojala et al . have applied the absolute gray level difference ( agld ) between each pixel and its neighbors . . then , ojala et al . have proposed the lbp using the sign of the difference for the representation of local patterns . in , ojala et al . suggested to use signed gray level difference ( sgld ) and its multidimensional distribution for the description of texture and considered lbp as a simplification of sgld . with such variants of lbp , there still remain questions that need answering , such as what information is lost in the considered code ? how to represent the missing information to obtain better texture modeling ? here , we propose a new feature extractor to improve the system performance , based on glld features . the lbp operator used eight neighboring pixels when considering the center gray value as threshold . this operator generates 1 if the considered neighbor value is greater or equal to that of the center . otherwise , it generates 0 . accordingly and referring to figure 1 , lbp code may be computed as follows : ( 2 ) lbpp , r =p = 0p1s ( gpgc ) 2p , s ( x ) = { 1 , x00 , x 0 , where gc corresponds to the gray value of the central pixel , gp corresponds to the value of its neighbors , and ( p = 0,1 , p 1 ) and p , r correspond to the number of neighbors and to the radius of the neighborhood , respectively . gp coordinates are ( ( r cos ( 2p / p ) and r sin ( 2p / p ) ) . if neighbors are not in the image grids , their gray values may be estimated by interpolation . after identifying lbp pattern of each pixel ( i , j ) , we associate lbp histogram to the whole image , with a given image size ( n1n2 ) as ( 3 ) hlbp ( k ) = i = 1 n1j = 1n2f ( lbpp , r ( i , j ) , k ) , k [ 0 , k ] , f ( x , y ) = { 1 , x = y0 , otherwise , where k corresponds to the maximum gray level value . let u be a function corresponding to the value of an lbp pattern , it is defined as the number of transitions ( i.e. , change from 0 to 1 or 1 to 0 ) in the following pattern : ( 4 ) u ( lbpp , r ) = | s ( gp1gc ) s ( g0gc ) | + p = 1p1 | s ( gpgc ) s ( gp1gc ) | . patterns corresponding to limited transitions or discontinuities are with u 2 , in a binary presentation . the mapping from the original lbpp , r to lbpp , r , knowing that the superscript u2 refers to uniform patterns , may be implemented using a look - up table containing 2 elements . a local rotation invariant pattern is defined as follows : ( 5 ) lbpp , rriu2 = { p = 0p1 | s ( gpgc ) | if u ( lbpp , r ) 2p +1 otherwise . the mapping from lbpp , r to lbpp , r , knowing that the superscript riu2 corresponds to rotation invariant uniform patterns , may be implemented using a look up table . the main limitation using lbp code is that it may give the same results with two completely different gray levels when the differences with the neighbors are the same . knowing that for mammographic images , the gray level information is directly related to the breast tissue density , gray level and local difference are two important features of the texture which must be used together in order to have more accurate results . in our approach , we propose to calculate the average for each 33 neighborhood and to attribute it to the central pixel . given the new value of the central pixel gc mean and its p circularly symmetric neighbor ( see figure 2 ) , the substraction of the value of gc mean is presented as follows : ( 6 ) t = t ( gc mean , g0gc mean , thus , the difference between gc mean and gp may be represented as diffp = gp gc mean and the local difference may be represented with a vector noted diffp knowing that diffp = [ diff0 , , diffp1 ] , diffp describes the local image structure around the gc mean . because of its robustness and efficiency , the obtained vector diffp is decomposed of sign and modulus components in order to achieve much better performance in texture classification . in our proposal , sp corresponds to the sign of the differences , and it is obtained by thresholding with respect to the value of gc mean as expressed in ( 8 ) . however , mp corresponds to the absolute value of diffp as expressed in ( 9 ) . we obtain , also , two vectors , the sign vector [ s0 , , sp1 ] and the modulus vector [ m0 , , mp1 ] , with ( 7 ) diffp = mpsp , knowing that ( 8 ) sp = { 1 , diffp01 , diffp 0 , ( 9 ) mp = | diffp | . aiming at recognizing robustly and efficiently the texture patterns , we should extract both absolute and relative features from pixel gray levels . the modulus component provides discriminant information to the sign component ; the intensity value of the central pixel corresponding to the mean value of its neighbors may also give us useful information . it will also be seen that by coding the sign , the modulus , and the central gray level features into rotation invariant binary codes and fusing them , results may provide much better performance in mammogram texture classification than using each one by itself . this fusion provides useful information about local gray level which is so important in the stage of mass detection in mammographic images . in this subsection , we present the gray level and local difference ( glld ) different processing steps to explore the proposed three features , which are illustrated in figure 4 . after that , in the selected roi , each central gray level corresponds to the mean of its neighbors and its local difference . the latter is decomposed into sign and modulus components as expressed in ( 7 ) . given a pixel in the image , the sign coding component is noted as ( sglld ) and is computed by comparing it with the values of its neighbors as follows : ( 10 ) sglldp , r =p = 0p1s ( gpgc mean ) 2p , where s ( x ) is defined by ( 11 ) s ( x ) = { 1 , x01 , x 0 , where gc mean is the average value of the central pixel and its neighbors . inspired by the method of coding ( sglld ) , the coding of the magnitude component is noted as ( mglld ) and is defined as follows : ( 12 ) mglldp , r =p = 0p1t ( mp , c ) 2p , ( 13 ) t ( x , c ) = { 1 , xc0 , x c , where c corresponds to a global gray level threshold which is determined adaptively . the new value of the central pixel , which expresses the gray level of the image , represents also a discriminant information . so , to make it consistent with the two previous operators sglld and mglld , we code it as ( 14 ) cglldp , r = t ( gc mean , ci ) , where t is already defined in ( 13 ) , ci corresponds to the threshold and is set as the mean gray level of the whole input image . figure 5 illustrates the image results after the application of the three operators and their fusion . for the three obtained codes , the rotation invariant version is defined to achieve rotation invariant classification . each code carries specific texture information , that is why we concatenate them to build the glld feature , which corresponds to a vector . the procedure consists in using the glld in order to build local descriptor of the obtained rois knowing that the concatenation leads to global description and the obtained global and local glld texture descriptor are , then , used as features for mass detection . the following images ( figure 7 ) illustrate the obtained histogram for differents rois . in this figure , we have considered three trivial examples as well as three challenging examples which were misclassified by a radiologist . all of the six roi examples where correctly classified by our glld texture features . in a further section , the last step of our proposal is mass classification . for the sake of generality and for doing a best choice of the classifier , an investigation of three classifiers will be undertaken , namely , support vector machine ( svm ) , k - nearest neighbors ( knns ) and artificial neural network . it learns how to discriminate between positive and negativ ( in our case mass and non mass ) , by finding a hyperplane as a decision surface separating the classes . the svm uses an optimization method identifying the support vectors si , the weights ai , and the bias b which are used for the classification of the vectors x according to the following equation : ( 15 ) c ( x ) = iai ( si , x ) + b , where corresponds to a kernel function . then , if c 0 , x is classified as a member belonging to the first class . otherwise , it is classified as a member belonging to the second class . since knn is memory based , no models need to be trained . for a given instance x , the knn first finds the k closest training points with respect to a particular distance metric . then , it uses its labels in order to classify the instance x by majority vote . in this study , we use the euclidian distance to determine the nearest neighbors of the query element , and k is used as a training parameter . for each elementx , the output score corresponds to the ratio of the winning class elements among the total number of neighborhood in the corresponding dataset . ann has been widely used in many applications where the expert knowledge is not clearly defined . the idea of the ann has been inspired from the biological nervous system and has been successfully applied in medical imaging . this technique is based on the adjustment of weights between the neurons for any input - output function approximation . therefore ann , has been widely used in digital mammography to mimic this computational power and the perception capabilities of human brain . two basic types of ann , the multilayer perceptron ( mlp ) as well as the radial basis function network ( rbf ) , are frequently used in recent works . on the one hand , multilayer perceptrons ( mlps ) their principal advantage is the ease of use and the approximation capability of any input / output map . on the other hand , radial basis function ( rbf ) networks are nonlinear hybrid networks containing a single hidden layer of processing elements . this type of ann is in generally used when the number of samples is so small ( 100 ) . so , the limitation of the rbf neural network is that it is very sensitive to the dimensionality and has more and more difficulties if the number of units is large . based on this assumption , and knowing that the glld feature size is of 1352 , we intend to investigate the mlp to exploit the results using the ann . let us consider x = ( x1 , x2 , , xd ) the input vector , = ( 1 , 2 , , d ) , the weight vector , and g ( x ) = ( 1 + e ) the activation function which corresponds to a sigmoid function , and the network output is thus defined as follows : ( 16 ) y = g ( txb ) = g ( i = 1dixib ) . for each roi sample , glld features are computed and used in the classification step as inputs of the neural network . the evaluation of the effectiveness of the training is based on the measure of the network relative error as follows : ( 17 ) e = i = 1n ( yt ) number of applied samples , where y is the roi corresponding to masses or nonmasses resulting from ann and t corresponds to the target . after the training step , generalization errors may be evaluated for various features and network conditions . figure 9 maps the different steps of the proposed method . in the following section , the obtained results for ann , svm , and knn classifiers will be illustrated for comparison purposes . we then do an investigation of the feature relevance , by using each of the proposed features ( sglld , mglld , cglld ) separately as input vector to the classifier . in further step , we made the classifier input a concatenated vector made up with different feature vectors . finally , a comparative study of our proposal to those in the state - of - the - art will be done for a fair evaluation . our approach has been evaluated based on publicly available database taken from the ddsm database . a case is the collection of all information to the mammography exam of one patient . each case in the ddsm database contains two images , of each breast , that is , in each case the mammograms include a craniocaudal and mediolateral oblique view ( cc and mlo , resp . ) . the ddsm database provides the metadata ( date of study , breast density , assessment categories , etc . ) of each abnormality using the breast imaging reporting and data system ( bi - rads ) lexicon , it provides , also , the corresponding chain codes of the suspicious regions . with these chain codes , the outlines of the abnormalities may be identified . the ddsm provide delineations of mass regions . however , precision of such delineations is not adequate for validation in our approach , since it was done on downscaled images of ddsm database ( by factor of 8 ) , see section 2 . therefore , we wore based in the extraction of roi 's on manual segmentation entertained by two expert radiologists of more than 30 years of clinical experience from the farabi imaging . we should also notice that all the considered masses in ddsm are biopsy proven ones . these rois were randomly selected and separated into two sets : 500 samples for training and 500 samples for tests . in the training set as well as in the setting setthe evaluation of our mass detection algorithm is performed by applying a leave - one - out methodology , where the input roi is classified by using the appropriate classification method and the procedure is reapplied for all the remaining rois used as input . from the results presented in table 4 , we can conclude that with ( p , r ) = ( 24,3 ) , the area under curve for the glld is increased from 0.93 to 0.95 . , glld24 ,3 will be used . from the comparative study , as shown in table 5 , we note that the ann provides the best results . as illustrated in figure 10 and table 6 the cad system achieves better performance ( az = 0.93 ) when using the sign component than the modulus component . however , their fusion may provide much better results in texture classification than using either sign or modulus ( az = 0.95 ) . the auc of the glld24 ,3 after the fusion of the three operators sglld24 ,3 , mglld24 ,3 , and cglld24 ,3 using the ann as classifier is about ( az = 0.95 ) for the experimental set . as can be noted from table 6 , the glld24 ,3 feature provides useful information about local gray level which is the most significant one for mass detection in mammographic images . based on the size of the lesion , we use six different group of roi images , which is an important aspect for the correct classification of the masses . these classes correspond to the following specified mass sizes intervals : size 1 : 10 mm , size 2 : ( 1060 ) mm , size 3 : ( 60120 ) mm , size 4 : ( 120190 ) mm , size 5 : ( 190,270 ) mm , and size 6 : 270 mm . however , the used numbers of masses in each class size were , respectively , 28 , 32 , 37 , 57 , 69 , and 33 masses . table 7 illustrates the az values for each class of roi image sizes and the obtained mean az values . we include in this table a quantitative comparison with the work of oliver et al . have used our database of roi ratio ( 1/3 ) , the same specified mass size intervals , and the same number of masses in each class size . the results presented in table 7 have shown that the glld24 ,3 features are effective for mass detection at different roi image sizes , and the latter is an important aspect for correct classification of the masses . our method proves its performance in the most difficult case , which correspond to the smaller masses . note that for this proposed ratio , better results are obtained for all the size intervals . table 8 shows the different az performance values for different approaches in the state - of - the - art presented in section 2 . such which were represented comparison demonstrates the effectiveness of the proposed glld operator in mass detection . for instance , , which used ratio ( 1/1 ) the same as in our cases , obtained az values 0.83 , 0.90 , and 0.81 , respectively , as our obtained az = 0.95 . cad systems have been used and gained greater utility in recent years , as a second virtual reader for the medical images , contributing to increase an early detecting of breast cancer . the combined descriptors are , respectively , sglld24 ,3 , mglld24 ,3 , and cglld24 ,3 providing a final texture feature descriptor named glld , which will be used to classify the rois to masses and mass free . the ann classifier gives better performances in term of classification owing to its higher function approximation . such comparison illustrates that our proposed method leads to the best performance az = 0.95 . the specialists who i have collaborated with found that the proposed cad improved the sensitivity of mammography screening . in fact , cad system is useful in situations where there is a high interobserver variability , lack of trained observers , or impossibility to perform the double reading with two or more radiologists as stated in the birads categories . future work will be focused in the classification of masses into the four breast imaging - reporting and data system ( bi - rads ) categories .\noutput:\n" }, { "from": "agent", "value": "during the last decade , several works have dealt with computer automatic diagnosis ( cad ) of masses in digital mammograms . generally , the main difficulty remains the detection of masses . this work proposes an efficient methodology for mass detection based on a new local feature extraction . local binary pattern ( lbp ) operator and its variants proposed by ojala are a powerful tool for textures classification . however , it has been proved that such operators are not able to model at their own texture masses . we propose in this paper a new local pattern model named gray level and local difference ( glld ) where we take into consideration absolute gray level values as well as local difference as local binary features . artificial neural networks ( anns ) , support vector machine ( svm ) , and k - nearest neighbors ( knns ) are , then , used for classifying masses from nonmasses , illustrating better performance of ann classifier . we have used 1000 regions of interest ( rois ) obtained from the digital database for screening mammography ( ddsm ) . the area under the curve of the corresponding approach has been found to be az = 0.95 for the mass detection step . a comparative study with previous approaches proves that our approach offers the best performances ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the * 2 and * 3 alleles are deficient alleles ,3,4 whereas the * 17 allele , a recently identified allelic variant , is associated with ultra - rapid metabolism of voriconazole .5 because voriconazole is poorly dissolved in aqueous media , vfend ( pfizer inc , new york , ny , usa ) , the currently marketed intravenous formulation of voriconazole , contains sulfobutyl ether beta cyclodextrin sodium ( sbecd ) as a solubilizer . as the clearance ( cl ) of sbecd is decreased in a linear fashion as renal function is diminished , sbecd is accumulated in renally impaired patients .6 in a preclinical study , repeated doses of intravenous sbecd resulted in dose - dependent histologic changes such as renal tubule vacuolation and pulmonary foam cell foci .7 although there is some evidence that these histologic changes do not exert toxic clinical effects in humans ,810 the accumulation of sbecd in patients with impaired renal function may limit the use of intravenous voriconazole in this population .1 syp - 1018 is a novel lyophilized polymeric nanoparticle formulation of voriconazole for intravenous administration developed by samyang biopharmaceuticals corporation ( seoul , republic of korea ) . syp - 1018 is composed of a low molecular weight , biodegradable , amphiphilic diblock copolymer , and methoxypoly ( ethylene glycol ) - blockadditionally , sodium salt of polylactic acid ( d , l - placoona ) is used as a solubilizer instead of sbecd . based on several preclinical studies , drugs containing mpeg - pdlla appear to be safe .1113 furthermore , a polymeric micelle formulation of paclitaxel with mpeg - pdlla ( genexol - pm ) was approved in korea in 2006 , and the clinical data showed that the polymeric micelle formulation was safe and well tolerated .1416 based on this understanding , the present study compared the pharmacokinetic and tolerability profiles of syp - 1018 with those of vfend after a single intravenous administration in healthy subjects . furthermore , the effect of cyp2c19 polymorphism on the pharmacokinetics and bioequivalence of the two formulations of voriconazole was evaluated . a randomized , open - label , two - treatment , two - period , two - sequence , crossover study was performed with a washout period of 7 days . in each period , subjects randomly received a single intravenous dose of syp - 1018 ( voriconazole - loaded polymeric nanoparticle ) or vfend , a reference voriconazole formulation currently available in the market . after written informed consent was obtained , healthy male volunteers of 2045 years underwent screening , which included medical history , physical examination , laboratory tests ( hematology , blood chemistry , coagulation , and urinalysis ) , 12 - lead electrocardiogram ( ecg ) , and vital signs . subjects were excluded if their alanine aminotransferase ( alt ) or aspartate aminotransferase ( ast ) exceeded 1.25 times the upper limit of normal . eligible subjects were admitted to the clinical trials center at seoul national university hospital ( snuh ) , seoul , korea , a day before study drug administration in each period . on the 1st day in each period , subjects received syp - 1018 or vfend at 200 mg intravenously for 1.5 hours according to their randomized sequence . serial blood samples of 4 ml for pharmacokinetic analysis were taken at 0 ( ie , pre - dose ) , 0.25 , 0.5 , 0.75 , 1 , 1.5 , 2 , 3 , 4 , 6 , 8 , 12 , and 24 hours post dose . additionally , 4 ml of blood was collected for genotyping ( period 1 only ) . physical examination , vital signs , laboratory tests , and 12 - lead ecgs were conducted at the study protocol - specified times . this study was conducted in compliance with the declaration of helsinki , good clinical practices , and other regulatory guidelines ( clinicaltrials.gov : nct01657201 ) . the study protocol and informed consent form were approved by the institutional review board at snuh . blood samples were centrifuged at 2,000 g for 10 minutes and the separated plasma were stored below 70c until voriconazole concentration was determined using high performance liquid chromatography ( 1260 series ; agilent technologies , santa clara , ca , usa ) with mass spectrometer ( api4000 qtrap ; sciex , framingham , ma , usa ) . voriconazole - d3 ( santa cruz biotechnology inc , dallas , tx , usa ) was used as an internal standard , and the sample was protein precipitated with acetonitrile . kinetex 2.6 m c18 , 1002.10 mm ( phenomenex , torrance , ca , usa ) was used as the analytical column , and the mobile phase consisted of 0.1 % formic acid in 10 mm ammonium formate and 100 % acetonitrile . the lower limit of quantification ( lloq ) was 25 ng / ml , and the calibration range was 25 ng / ml4 ,000 ng / ml . the intrabatch and interbatch coefficient of variation ( cv ) was less than 2.911 % and 5.609 % , respectively . likewise , the intrabatch and interbatch accuracy ranged between 91.38 % and 105.1 % , and 87.83 % and 97.17 % , respectively . pharmacokinetic parameters were calculated using a noncompartmental method implemented in phoenix winnonlin 6.3 ( certara , st louis , mo , usa ) . maximum plasma concentration ( cmax ) and time to reach cmax ( tmax ) were determined directly from the observed individual time concentration profiles . terminal elimination half - life ( t1 / 2 ) was calculated as the natural logarithm of 2 divided by z , which is the terminal elimination rate constant estimated in the linear decline portion of the natural logarithmic transformed individual plasma concentrations . time curve ( auc ) from dosing to the last quantifiable concentration ( auclast ) was calculated using the linear - up / log - down trapezoidal method , and auc from dosing to infinity ( aucinf ) was calculated as the sum of auclast and clast / z , where clast was the last measurable concentration . various allelic variants for cyp2c19 , such as the * 2 ( 681g . a , rs4244285 , assay i d : c_25986767_70 ) , * 3 ( 636g . a , rs4986893 , assay i d : c_27861809_10 ) , and * 17 ( 806c . t , rs12248560 , assay i d : c_469857_10 ) alleles were genotyped using the taqman allelic discrimination assays on an abi prism 7500 sequence detection system ( thermo fisher scientific ) . based on the genotype analysis , subjects were identified as extensive metabolizers ( ems ) for * 1 / * 1 , intermediate metabolizers ( ims ) for * 1 / * 2 and * 1 / * 3 , or poor metabolizers ( pms ) for * 2 / * 2 , * 2 / * 3 , and * 3 / * 3 . it was estimated that enrolling 52 subjects would yield an 80 % power that the 90 % confidence interval ( ci ) of the geometric mean ratio ( gmr ) for the pharmacokinetic parameters between the two treatments , a ci that falls in the range of ( 0.81.25 ) at a significance level of 0.05 , based on an intrasubject cv of 35 % obtained from a previous study in a korean population ( clinicaltrials.gov , nct01080651 ) . the demographic characteristics according to the sequence of administered study drug were compared using the student s t - test . the gmr and its 90 % ci of syp - 1018 to vfend was derived for cmax , auclast , and aucinf using a linear mixed model , where period , sequence , treatment , and cyp2c19 genotype were fixed effects , and subject nested in sequence was random effect . the interaction term between treatment and cyp2c19 genotypethe pharmacokinetics of syp - 1018 and vfend were considered comparable if the 90 % ci fell entirely within the conventional bioequivalence range of 0.801.25 for both cmax and auclast . the number of subjects with adverse events and frequency of adverse events were compared between treatments using the chi - square test . all the statistical analyses were performed using sas 9.4 ( sas institute , cary , nc , usa ) , and p - values 0.05 were regarded as statistically significant . using the intraindividual variability by genotypes , the number of subjects required to meet the conventional bioequivalence criteria was calculated based on a two one - sided tests procedure .17 a randomized , open - label , two - treatment , two - period , two - sequence , crossover study was performed with a washout period of 7 days . in each period , subjects randomly received a single intravenous dose of syp - 1018 ( voriconazole - loaded polymeric nanoparticle ) or vfend , a reference voriconazole formulation currently available in the market . after written informed consent was obtained , healthy male volunteers of 2045 years underwent screening , which included medical history , physical examination , laboratory tests ( hematology , blood chemistry , coagulation , and urinalysis ) , 12 - lead electrocardiogram ( ecg ) , and vital signs . subjects were excluded if their alanine aminotransferase ( alt ) or aspartate aminotransferase ( ast ) exceeded 1.25 times the upper limit of normal . eligible subjects were admitted to the clinical trials center at seoul national university hospital ( snuh ) , seoul , korea , a day before study drug administration in each period . on the 1st day in each period , subjects received syp - 1018 or vfend at 200 mg intravenously for 1.5 hours according to their randomized sequence . serial blood samples of 4 ml for pharmacokinetic analysis were taken at 0 ( ie , pre - dose ) , 0.25 , 0.5 , 0.75 , 1 , 1.5 , 2 , 3 , 4 , 6 , 8 , 12 , and 24 hours post dose . additionally , 4 ml of blood was collected for genotyping ( period 1 only ) . physical examination , vital signs , laboratory tests , and 12 - lead ecgs were conducted at the study protocol - specified times . this study was conducted in compliance with the declaration of helsinki , good clinical practices , and other regulatory guidelines ( clinicaltrials.gov : nct01657201 ) . the study protocol and informed consent form were approved by the institutional review board at snuh . blood samples were centrifuged at 2,000 g for 10 minutes and the separated plasma were stored below 70c until voriconazole concentration was determined using high performance liquid chromatography ( 1260 series ; agilent technologies , santa clara , ca , usa ) with mass spectrometer ( api4000 qtrap ; sciex , framingham , ma , usa ) . voriconazole - d3 ( santa cruz biotechnology inc , dallas , tx , usa ) was used as an internal standard , and the sample was protein precipitated with acetonitrile . kinetex 2.6 m c18 , 1002.10 mm ( phenomenex , torrance , ca , usa ) was used as the analytical column , and the mobile phase consisted of 0.1 % formic acid in 10 mm ammonium formate and 100 % acetonitrile . the lower limit of quantification ( lloq ) was 25 ng / ml , and the calibration range was 25 ng / ml4 ,000 ng / ml . the intrabatch and interbatch coefficient of variation ( cv ) was less than 2.911 % and 5.609 % , respectively . likewise , the intrabatch and interbatch accuracy ranged between 91.38 % and 105.1 % , and 87.83 % and 97.17 % , respectively . pharmacokinetic parameters were calculated using a noncompartmental method implemented in phoenix winnonlin 6.3 ( certara , st louis , mo , usa ) . maximum plasma concentration ( cmax ) and time to reach cmax ( tmax ) were determined directly from the observed individual time concentration profiles . terminal elimination half - life ( t1 / 2 ) was calculated as the natural logarithm of 2 divided by z , which is the terminal elimination rate constant estimated in the linear decline portion of the natural logarithmic transformed individual plasma concentrations . time curve ( auc ) from dosing to the last quantifiable concentration ( auclast ) was calculated using the linear - up / log - down trapezoidal method , and auc from dosing to infinity ( aucinf ) was calculated as the sum of auclast and clast / z , where clast was the last measurable concentration . various allelic variants for cyp2c19 , such as the * 2 ( 681g . a , rs4244285 , assay i d : c_25986767_70 ) , * 3 ( 636g . a , rs4986893 , assay i d : c_27861809_10 ) , and * 17 ( 806c . t , rs12248560 , assay i d : c_469857_10 ) alleles were genotyped using the taqman allelic discrimination assays on an abi prism 7500 sequence detection system ( thermo fisher scientific ) . based on the genotype analysis , subjects were identified as extensive metabolizers ( ems ) for * 1 / * 1 , intermediate metabolizers ( ims ) for * 1 / * 2 and * 1 / * 3 , or poor metabolizers ( pms ) for * 2 / * 2 , * 2 / * 3 , and * 3 / * 3 . it was estimated that enrolling 52 subjects would yield an 80 % power that the 90 % confidence interval ( ci ) of the geometric mean ratio ( gmr ) for the pharmacokinetic parameters between the two treatments , a ci that falls in the range of ( 0.81.25 ) at a significance level of 0.05 , based on an intrasubject cv of 35 % obtained from a previous study in a korean population ( clinicaltrials.gov , nct01080651 ) . the demographic characteristics according to the sequence of administered study drug were compared using the student s t - test . the gmr and its 90 % ci of syp - 1018 to vfend was derived for cmax , auclast , and aucinf using a linear mixed model , where period , sequence , treatment , and cyp2c19 genotype were fixed effects , and subject nested in sequence was random effect . the interaction term between treatment and cyp2c19 genotype was also entered into the model when analyzed separately for cyp2c19 genotype . the pharmacokinetics of syp - 1018 and vfend were considered comparable if the 90 % ci fell entirely within the conventional bioequivalence range of 0.801.25 for both cmax and auclast . the number of subjects with adverse events and frequency of adverse events were compared between treatments using the chi - square test . all the statistical analyses were performed using sas 9.4 ( sas institute , cary , nc , usa ) , and p - values 0.05 were regarded as statistically significant . using the intraindividual variability by genotypes , the number of subjects required to meet the conventional bioequivalence criteria was calculated based on a two one - sided tests procedure .17 this study enrolled 59 subjects , six of whom were dropped prior to drug administration in period 1 due to withdrawal of consent ( n = 2 ) , pre - treatment events ( n = 3 , two chest discomforts , one eye swelling ) , and a no - show ( n = 1 ) . the remaining 53 subjects received at least one study drug , with 52 subjects completing the study . one subject was dropped because of an adverse event that had occurred in period 1 , after administration of vfend . age , height , and body weight did not significantly differ between the two sequences . of the 52 subjects who completed the study ,51 subjects were genotyped : em ( n = 19 ) , i m ( n = 19 ) , pm ( n = 10 ) , and unclassified ( n = 3 ) , the latter of which included * 1 / * 17 ( n = 1 ) and * 2 / * 17 ( n = 2 ) . the demographic characteristics of the 52 subjects who completed the study are summarized in table 1 , and there were no differences between the two sequences of study drug administration . the pharmacokinetic parameters of voriconazole were similar between syp - 1018 and vfend , which resulted in the 90 % ci for the gmr of syp - 1018 to vfend falling within the conventional bioequivalence range of 0.81.25 for both cmax and auclast ( table 2 ) . the pharmacokinetic comparability between syp - 1018 and vfend was also seen when analyzed separately by cyp2c19 genotype , except for cmax in the pm group , for which the upper bound of the 90 % ci was still very close to 1.25 ( ie , 1.26 , table 3 ) . time profiles of the two formulations overlapped almost entirely when compared to each other ( figure 1 ) . the systemic exposureto voriconazole and its peak as assessed by auclast and cmax , respectively , were greatest in the pm group , followed by the i m group , with the em group having the smallest values ( table 3 ) . for example , the auclast of both syp - 1018 and vfend ( gmr and 90 % ci ) in the pm and i m groups were 2.35 ( 1.982.78 ) and 1.27 ( 1.101.46 ) fold greater , respectively , than that in the em group . the auclast and aucinf in the subject with * 1 / * 17 allelic variant were close to those in the em group ( table 3 ) . on the other hand , subjects with * 2 / * 17 had comparable mean auclast and aucinf values to those in the i m group ( table 3 ) . the intrasubject cv for cmax in the pm and i m groups was 44 % and 22 % larger , respectively , than that in the em group ( table 4 , figure 2 ) . likewise , the intrasubject cv for auclast in the pm and i m groups was 71 % and 135 % larger , respectively , than that in the em group ( table 4 , figure 2 ) . consequently , the number of subjects required to meet the conventional bioequivalence criteria between syp - 1018 and vfend ( ie , two - sided 90 % ci for the gmr of syp - 1018 to vfend falling entirely within the range of [ 0.81.25 ] ) with an 80 % power at a significance level of 0.05 in a 22 crossover study was 80 % and 40 % greater in the pm and i m groups , respectively , for cmax , and 33 % and 100 % greater , respectively , for auclast than in the em group ( table 4 ) . there was no significant difference in the number of drug - related adverse events between the two treatments ( five and nine cases after syp - 1018 and vfend , respectively , p = 0.424 , chi - square test ) . likewise , the number of subjects with at least one drug - related adverse event were five and eight cases for syp - 1018 and vfend , respectively , which was not significantly different , either ( p = 0.555 , chi - square test ) . one subject was dropped after the administration of vfend in period 1 because alt was elevated to 2.7 times the upper limit of normal at 7 days post - dose . all of the adverse events were mild except for one subject , who presented moderate intensity of multiple musculoskeletal pain accompanying erythema , heating sense , and pruritus after infusion of syp - 1018 in period 2 . this case , and the other adverse events , however , resolved spontaneously without any medical intervention . likewise , no clinically significant abnormality was noted in laboratory tests , 12 - lead ecgs , vital signs , or physical examination throughout the entire study period . this study enrolled 59 subjects , six of whom were dropped prior to drug administration in period 1 due to withdrawal of consent ( n = 2 ) , pre - treatment events ( n = 3 , two chest discomforts , one eye swelling ) , and a no - show ( n = 1 ) . the remaining 53 subjects received at least one study drug , with 52 subjects completing the study . one subject was dropped because of an adverse event that had occurred in period 1 , after administration of vfend . age , height , and body weight did not significantly differ between the two sequences . of the 52 subjects who completed the study ,51 subjects were genotyped : em ( n = 19 ) , i m ( n = 19 ) , pm ( n = 10 ) , and unclassified ( n = 3 ) , the latter of which included * 1 / * 17 ( n = 1 ) and * 2 / * 17 ( n = 2 ) . the demographic characteristics of the 52 subjects who completed the study are summarized in table 1 , and there were no differences between the two sequences of study drug administration . the pharmacokinetic parameters of voriconazole were similar between syp - 1018 and vfend , which resulted in the 90 % ci for the gmr of syp - 1018 to vfend falling within the conventional bioequivalence range of 0.81.25 for both cmax and auclast ( table 2 ) . the pharmacokinetic comparability between syp - 1018 and vfend was also seen when analyzed separately by cyp2c19 genotype , except for cmax in the pm group , for which the upper bound of the 90 % ci was still very close to 1.25 ( ie , 1.26 , table 3 ) . time profiles of the two formulations overlapped almost entirely when compared to each other ( figure 1 ) . the systemic exposureto voriconazole and its peak as assessed by auclast and cmax , respectively , were greatest in the pm group , followed by the i m group , with the em group having the smallest values ( table 3 ) . for example , the auclast of both syp - 1018 and vfend ( gmr and 90 % ci ) in the pm and i m groups were 2.35 ( 1.982.78 ) and 1.27 ( 1.101.46 ) fold greater , respectively , than that in the em group . the auclast and aucinf in the subject with * 1 / * 17 allelic variant were close to those in the em group ( table 3 ) . on the other hand , subjects with * 2 / * 17 had comparable mean auclast and aucinf values to those in the i m group ( table 3 ) . the intrasubject cv for cmax in the pm and i m groups was 44 % and 22 % larger , respectively , than that in the em group ( table 4 , figure 2 ) . likewise , the intrasubject cv for auclast in the pm and i m groups was 71 % and 135 % larger , respectively , than that in the em group ( table 4 , figure 2 ) . consequently , the number of subjects required to meet the conventional bioequivalence criteria between syp - 1018 and vfend ( ie , two - sided 90 % ci for the gmr of syp - 1018 to vfend falling entirely within the range of [ 0.81.25 ] ) with an 80 % power at a significance level of 0.05 in a 22 crossover study was 80 % and 40 % greater in the pm and i m groups , respectively , for cmax , and 33 % and 100 % greater , respectively , for auclast than in the em group ( table 4 ) . there was no significant difference in the number of drug - related adverse events between the two treatments ( five and nine cases after syp - 1018 and vfend , respectively , p = 0.424 , chi - square test ) . likewise , the number of subjects with at least one drug - related adverse event were five and eight cases for syp - 1018 and vfend , respectively , which was not significantly different , either ( p = 0.555 , chi - square test ) . one subject was dropped after the administration of vfend in period 1 because alt was elevated to 2.7 times the upper limit of normal at 7 days post - dose . all of the adverse events were mild except for one subject , who presented moderate intensity of multiple musculoskeletal pain accompanying erythema , heating sense , and pruritus after infusion of syp - 1018 in period 2 . this case , and the other adverse events , however , resolved spontaneously without any medical intervention . likewise , no clinically significant abnormality was noted in laboratory tests , 12 - lead ecgs , vital signs , or physical examination throughout the entire study period . this study demonstrated that the pharmacokinetic and tolerability profiles of syp - 1018 were comparable to those of vfend after a single intravenous administration in healthy subjects . the concentrationtime profiles of the two formulations matched almost entirely ( figure 1 ) , and the gmr and its 90 % cis for cmax and auclast satisfied the conventional regulatory criteria of bioequivalence ( table 2 ) . the pharmacokinetic comparability for voriconazole between syp - 1018 and vfend was also noted even when analyzed separately by different cyp2c19 genotype ( table 3 ) , except for cmax in the pm group , which might have been due to the small sample size ( n = 10 ) relative to its large intrasubject cv of 20.8 % ( table 4 ) . there were no newly reported adverse events in the present study , and the frequency of drug - related adverse events was not significantly different between the two formulations . we found that cyp2c19 polymorphism influenced the pharmacokinetics of voriconazole in a similar way as previously reported including korean , caucasian , and chinese subjects ,3,18,19 ie , the systemic exposure to voriconazole was greatest in the pm group , followed by the i m , and then the em groups ( table 3 ) . unlike the * 2 and * 3 alleles of cyp2c19 , which have been known to be associated with nonfunctional poor metabolism , the classification of the * 17 allele is still controversial . for example , subjects with * 1 / * 17 can be regarded as ultra - extensive metabolizers , whereas those with * 2 / * 17 are difficult to classify into any phenotype , because the * 17 allele could be in cis with either the wild type or deficiency allele .20 weiss et al reported the pharmacokinetic profiles of voriconazole in those with * 2 / * 17 allelic variants were perfectly matched with those with * 1 / * 17.4 in contrast , the pharmacokinetic parameters in those with * 2 / * 17 in the present study were more or less close to those in the i m group ( table 3 , figure 2 ) . because only a limited number of subjects were with * 2 / * 17 in the present study ( n = 2 ) , however , no firm conclusion can be drawn about the effect of the * 17 allele on the pharmacokinetics of voriconazole yet , and further studies are warranted . besides cyp2c19 * 2 and * 3 , other alleles such as * 4 and * 8 have also been associated with poor metabolism . however , their allelic frequency is very low compared to * 2 and * 3 alleles in variety of ethnicity .20 furthermore , a complete concordance between phenotype and genotype has been reported previously when using only the * 2 and * 3 alleles in the oriental population .21 therefore , although not tested in the present study , those minor alleles including * 4 and * 8 would unlikely have affected our results . voriconazole has highly variable pharmacokinetics , for which cyp2c19 is a major contributing factor .4 in the present study , not only the extent of exposure to voriconazole , but also intrasubject variability was different among cyp2c19 genotypes . for example , intrasubject cv was greater in the pm and i m groups than in the em group , resulting in a greater number of subjects required to meet the conventional bioequivalence criteria at the same power and significance level ( table 4 ) . greater intrasubject variability in the cyp3a5 pm group than in the em group was reported for tacrolimus .22 in contrast , subjects with no active genes of cyp2d6 showed less intrasubject variability for mirtazapine .23 because the relative frequency of cyp2c19 genotypes can be different among not only various ethnic groups , but also different study populations at hand , information on the composition of cyp2c19 polymorphism and the intrasubject variability by genotype in the study population could be of help in designing a future comparative pharmacokinetic study of voriconazole . although we could not conclude if the comparable pharmacokinetic profile for voriconazole between syp - 1018 and vfend will be maintained after repeated administration , it is very likely so given that the elimination phase pharmacokinetic parameters for voriconazole at steady state are not different from elimination phase pharmacokinetic parameters after a single dose .24 furthermore , it is well known that plasma concentration of voriconazole is closely associated with clinical outcomes .25,26 taken together , syp - 1018 is expected to show a similar efficacy profile to that of vfend after repeated administration in patients with fungal infections , and further studies may be warranted in various populations ( eg , women , elderly , children , etc ) . therefore , syp - 1018 can be further developed as an effective alternative to vfend , particularly for patients with decreased renal function . in conclusion , the pharmacokinetic and tolerability profiles of syp - 1018 were comparable to those of vfend after a single intravenous infusion . cyp2c19 genotype affected not only the pharmacokinetics of voriconazole , but also affected its intrasubject variability . syp - 1018 can be further developed as a clinically effective alternative to vfend , particularly in patients with renal impairment .\noutput:\n" }, { "from": "agent", "value": "purposesyp - 1018 is a lyophilized polymeric nanoparticle formulation of voriconazole that is under development for intravenous dosing . this study compared the pharmacokinetic and tolerability profiles of syp - 1018 with those of vfend , the marketed formulation of voriconazole . the effect of cyp2c19 polymorphism on the voriconazole pharmacokinetics was also evaluated.methodsan open - label , two - treatment , two - period , two - sequence crossover study was conducted in 52 healthy male volunteers , who randomly received a single intravenous infusion of either of the two voriconazole formulations at 200 mg . blood samples were collected up to 24 hours after drug administration for pharmacokinetic analysis . the plasma concentrations of voriconazole were determined using liquid chromatography with tandem mass spectrometry , and the pharmacokinetic parameters were estimated using a noncompartmental method . cyp2c19 genotype was identified in 51 subjects.resultsthe geometric mean ratio ( 90 % confidence interval ) of syp - 1018 to vfend was 0.99 ( 0.931.04 ) for the maximum plasma concentrations ( cmax ) and 0.97 ( 0.921.01 ) for the area under the concentration time curve ( auc ) from dosing to the last quantifiable concentration ( auclast ) . nineteen homozygous extensive metabolizers ( ems , * 1 / * 1 ) , 19 intermediate metabolizers ( ims , * 1 / * 2 or * 1 / * 3 ) , and ten poor metabolizers ( pms , * 2 / * 2 , * 2 / * 3 , or * 3 / * 3 ) were identified , and the pharmacokinetic comparability between syp - 1018 and vfend was also noted when analyzed separately by genotype . the systemic exposure to voriconazole was greatest in the pm group , followed by the i m , and then the em groups . furthermore , the intrasubject variability for cmax and auclast was greater in ims and pms than in ems . no serious adverse event occurred , and both treatments were well tolerated.conclusionsyp - 1018 had comparable pharmacokinetic and tolerability profiles to vfend after a single intravenous infusion . cyp2c19 genotype affected not only the pharmacokinetics of voriconazole , but its intrasubject variability . syp - 1018 can be further developed as a clinically effective alternative to vfend ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a man presented with clinical and radiographic evidence consistent with an acute appendicitis . after an ileocolic resection he was found to have intestinal spirochetosis of the caecum . a 50 - year old - male presented to our institution in november with a three - day history of right lower quadrant abdominal pain associated with nausea . upon assessment in the emergency department , he did not appear ill and was afebrile . his white blood cell count was 12.0 x 10 cells / l . computed tomography abdomen and pelvis revealed a markedly dilated appendix measuring 1.3 cm with fat stranding and enlarged lymph nodes . the clinical impression at the time was consistent with an acute appendicitis with a potential caecal neoplasm . computed tomography images obtained preoperatively . the patient was given intravenous antibiotics and taken to the operating room within 5 hours of his initial presentation . a transverse right lower quadrant incision of the abdomen revealed an enlarged , firm appendix adherent to the lateral peritoneum was identified . the area of caecum surrounding the appendiceal base was firm and adjacent mesentery was oedematous . a neoplasm could not be adequately ruled out in the setting of an emergency operation with difficult anatomical visualization . an ileocolic resection was therefore performed with creation of a standard functional end - to - end ileocolic anastomosis using gastrointestinal staplers . the patient was also placed on a 10 - day course of antibiotics ( ciprofloxacin and metronidazole ) postoperatively as the intra - operative impression was highly suspicious for a contained perforated viscus . at follow - up10 days post - discharge the patient complained of occasional loose bowel movements but was otherwise feeling well . ( h & e staining , light microscopy , magnification x 200 ) ( b ) : caecum . note false brush border ( arrow ) composed of intestinal spirochetosis adhering to caecal mucosal epithelium . ( h & e staining , light microscopy , magnification x 400 ) the patient returned for follow up one month after surgery and was clinically well . at a subsequent visit 3 months later , he had a colonoscopy showing few diveritcula and a significant spasm . to our knowledge , he continues to remain asymptomatic . intestinal spirochetosis ( is ) was first discovered in 1719 by van leeuwenhoek who analyzed his own stool and identified small mobile spiral organisms . ( 1 ) is is a rare disease wherein gram negative bacteria belonging to the spirochetes species infect the gastrointestinal tract . spirochete organisms are classified into 3 groups : spirochaetaceae , leptospiraceae and brachyspiraceae ( 2 ) . two distinct groups have been identified to predominantly colonize human colorectum : brachyspira aalborgi and brachyspira pilosicoli . morphologically , is is characterized by the presence of microorganisms attached to colorectal epithelial cells in a perpendicular fashion . histologically they form a diffuse blue fringe along the border of the epithelial layer ( with hematoxylin - eosin staining ) . although invasion beyond the mucosal border is rare , mast cell and ige plasma cell reactions have been reported . it is suspected that loss of integrity of the mucosal surface may play a role in the mechanism of invasion . ( 1 ) the epidemiology of is was first described in the 20 century . a report published in 1923 in chicago revealed a 28 % prevalence in stools of healthy individuals ( 3 ) . since then , other reports have demonstrated a direct relationship between the incidence of spirochetosis and rapidly growing industrial towns , homosexual men and patients infected with the human immunodeficiency virus ( hiv ) ( 2 ) . prevalence ranges from 1 - 5 % in healthy individuals and within developed countries ( 4 ) to 64.3 % in healthy individuals in a village in india ( 5 ) . difficulty with measuring prevalence resides in the sensitivities of methods of detection , which over the years has encompassed histology , microscopy , pcr , and in - situ - hybridization from fecal and / or tissue specimens . a retrospective study examined the colonoscopic descriptions of 15 patients with biopsies consistent with is . appearance , an erythematous mucosa was noted in one patient , a lesion was noted in one patient and the remaining 6 patients had normal mucosa ( 6 ) . is has been described to involve the mucosa of the colon , rectum and appendix . the severity of clinical manifestation has been correlated with the degree of histological invasion as evidenced by intestinal epithelial injury . however , it must be noted that presence of fecal spirochetes does not coincide with symptomatology . associated symptoms described include blood tinged feces , abdominal pain , constipation and most commonly diarrhea ( 1 ) . a little over ten cases of systemic spirochetemia ( mainly secondary to b. pilosicoli ) have been described in critically ill patients ( 7 ) . few reports in the literature ( amounting to less than 30 patients ) have described patients with intestinal spirochetosis who presented with a clinical and histological picture of acute appendicitis ( 8,9 ) . in 1984 , henrik - nielson and colleagues studied 681 appendiceal specimens and found is to be associated with 12.3 % of clinically suspicious appendicitis that proved to be histologically normal whereas only 0.7 % of is cases had a co - existing confirmed appendicitis on histology ( 8 ) . intestinal spirochetosis in the appendix , therefore , has a spectrum of presentation ranging from asymptomatic to fulminant histologically proven appendicitis . no consensus guidelines for the treatment of intestinal spirochetosis exists as only successful case reports of trial antibiotic regimens have been described . generally , a trial of antibiotic therapy is warranted , especially when the patient is symptomatic and / or histology shows signs of invasion . treatment with metronidazole administered at 500 mg q.i.d . for 10 days has been reported to eradicate symptoms and may lead to negative fecal cultures and improvement in histological features ( 4 ) . at our institutionit is estimated that the prevalence of is in the hiv and in the homosexual population is as high as 54 % ( 1 ) . most of these patients present with a chronic diarrhea and have a delayed diagnosis secondary to prolonged culture growth and low suspicion of this aetiology . in about two thirds of cases , patients with hiv diagnosed with is suffer from severe underlying disease and / or immunosuppression leading to death ( 10 ) . awareness of this disease entity should be heightened among surgeons especially those who treat patients with hiv .\noutput:\n" }, { "from": "agent", "value": "acute appendicitis is a frequent pathology encountered by general surgeons . on the differential of aetiologies that can lead to this diagnosis lies the spectrum of infectious disease . we present a case report of a patient who presented to our institution as a classic acute appendicitis . upon histological analysis it became evident that he had spirochetosis of the cecum and appendix . this paper reviews the literature on this rare infectious aetiology . a synopsis of the microbiology , epidemiology , clinical manifestations and treatments for intestinal spirochetosis is described . at large , the aim of this paper is to heighten awareness of this disease amongst clinicians and specifically surgeons ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: on november 3 , 2013 , the ministry of health of saudi arabia was notified of a suspected case of mers - cov infection in a 43 - year - old male patient at king abdulaziz university hospital in jeddah . the patient had cared for ill camels in his herd of 9 animals starting in early october , when the patient noted respiratory signs of illness with nasal discharge in several animals ; he continued caring for the sick animals until october 27 , the day of onset of his own illness . the patient cared for the animals for 3 hours per day 3 days per week , applying herbal remedies to the animals snouts and nostrils . he did not clean the stables or milk the animals , but he routinely consumed raw , unpasteurized camel milk from the herd . presence of mers - cov rna in the patient was confirmed at jeddah regional laboratory by using reverse transcription pcr ( rt - pcr ) targeting the upe and orfa gene fragments ( 11,12 ) . respiratory swab specimens yielded detectable signal after 28 rt - pcr cycles , indicative of an approximate viral load of 350,000 rna copies per sample . kj556336 ) , confirming the presence of a typical mers - cov whose closest relatives were in the riyadh_3 clade , as defined in ( 2 ) ( phylogeny shown in online technical appendix figure 1 , wwwnc.cdc.gov/eid/article/20/6/14-0402-techapp1.pdf ) . to identify potential sources of infection , on november 9 , the ministry of health investigated 5 close household contacts and the animal attendant on a farm owned by the patient . nasopharyngeal swab samples were taken and tested at jeddah regional laboratory by using rt - pcr . deep nasal swab specimens were taken on the same day from 3 of the 9 camels at the farm . testing of all samples by rt - pcr using the upe assay ( 11,12 ) did not detect mers - cov rna in any of the human patients , but 1 of the 3 camels ( camel g ) tested positive ( cycle threshold [ ct ] = 33 ) . on november 13 , nasal swab samples were obtained from all 9 animals . upe rt - pcr results were positive for camel g ( ct = 38 ) and a second camel ( camel b ; ct = 39 ) . samples from november 13 and a small remaining amount of rna extract from camel g from november 9 were sent to the sanger institute in cambridge , uk , and confirmation of reactivity ( ct 38 ) was obtained for pooled samples with the upe assay from camel g but not for camel b. the result for camel g was confirmed at the institute of virology in bonn , germany , for the same samples by using real - time rt - pcrs targeting the upe and 1a diagnostic target regions . a sequence of 15 % of the camel - derived genome was determined from 8 rt - pcr fragments , 2 of them partially overlapping ( 4,608 nt total ) ( 13 ) . phylogenetic analyses supported the conclusion that transmission occurred between camel and patient , but no direction was implied ( e.g , camel to human vs. human to camel ; online technical appendix figure 1 ) . the human - and camel - derived sequences shared a signature of single nucleotide polymorphisms that occurred in no other known mers - cov sequences ( figure ) . single nucleotide exchanges occurred at nt positions 21945 and 29662 ; these exchanges might have arisen during virus transmission , as described ( 10 ) . however , because of the low rna concentration in the samples , reamplification of the material and investigation of possible pcr - based mutations could not be done . direct comparison of the middle east respiratory syndrome coronavirus ( mers - cov ) jeddah_1_2013 genome sequence , jeddah _ camel1_2013 fragments ( boxes at bottom ) , and representative genomes of other clade viruses : 2 additional genomes from the riyadh_3 clade , riyadh_3_2013 and taif_1_2013 ; and representative genomes from the al - hasa and hafr - al - batin_1 and buraidah_1 clades . a map of the mers - cov genome with the major open reading frames ( orfs ) indicated is shown at the top . nucleotide differences for other genomes from jeddah_1_2013 are shown by vertical colored bars : orange , change to a ; red , change to t ; blue , change to g ; violet , change to c. gaps in all full - genome sequences are indicated in gray . positions according to the mers - cov genome emc / 2012 : fragment 1 , 976710354 ; fragment 2 , 1750718394 ; fragment 3 , 2108922046 ; fragment 4 , 2356924059 ; fragment 5 , 2534926056 ; fragment 6 , 2727628095 ; fragment 7 , 2959629757 . kj556337kj556340 ; others are pending ) . a serum sample taken from camel g during the initial investigation on november 9was tested by recombinant immunofluorescence assay ( ifa ) as described ( 6,14 ) and showed reactivity to mers - cov ( titer 320 ) . to investigate signs of recent mers - cov infection in the group of camels , we obtained blood samples at short intervals from all 9 animals during november 14december 9 , 2013 . all samples were tested by elisa against recombinant mers - cov spike antigen domain s1 fused to human fc fragment , using a formulation as described ( 15 ) . serum samples from all 9 animals showed reactivity to the mers - cov antigen ; serum samples from control animals showed no reactivity ( online technical appendix figure 2 , panel a ) . elisa signals were constant over time in most animals , but a small , yet visible , change of signal over the observation period was noted for camels b and g. to clarify the reasons for this putative signal increase , the first and last serum samples ( obtained on november 14 and december 9 ) from all animals were re - tested by ifa . as summarized in the table , camels b and g showed 4-fold increases of titer for the paired first and last serum samples . in serologic tests that rely on 2-fold endpoint titrations , a titer increase 2 dilution steps is considered a significant sign of recent acute infection . for additional confirmation of rises of titer , sequential samples from camels b and g were compared with sequential samples from camels e and i by using ifa with endpoint titration . these data confirmed the increases of titers for camels b and g ( online technical appendix figure 2 , panel b ) . because bovine cov occurs in camels , we tested for antibodies against bovine cov in camels b and g to exclude potential cross - reactions . using ifa ( 6 ) , we found no bovine cov antibodies in camel g , but camel b showed rising bovine cov antibody titers ( table ) . to obtain further differentiation , we performed neutralization assays against mers - cov and bovine cov ( 7 ) . titers in serum samples from november 14 and december 9 , respectively , were 160 and 320 for camel b and 160 and 160 for camel g. none of the animals showed serum neutralization against bovine cov . for camel g , a sample taken on november 9 was also available and yielded an immunofluorescence titer of 320 . these data add to recent findings showing high similarity of mers - covs carried by humans and camels ( 8,10 ) , supporting the hypothesis that human mers - cov infection may be acquired directly from camels . in addition , both animals that showed signs of recent infection were juvenile , which provides further support to previous findings that mainly young animals are infected by mers - cov ( 7,8 ) . given the synchronized parturition pattern of dromedary camels , with birthing in the winter months , an increase of epizootic activity might be expected after some latency during the first half of each year . antibody titers rose and viral rna concentrations were already on the decline in the camels while the patient was hospitalized with acute symptoms . assuming a time before appearance of antibodies of 1021 days , at least some of the camels would have been actively infected during middle to late october , when some animals showed signs of respiratory illness and the patient acquired his infection . nevertheless , we can not rule out other infectious causes of the animals upper respiratory signs . also , because of the retrospective nature of this investigation , we can not rule out the possibility of a third source of mers - cov infection for camels and humans . maximum - clade credibility tree of 66 human middle east respiratory syndrome coronavirus ( mers - cov ) genomes and 3 camel genomes or genome fragments and results of serologic screening of 9 dromedary camels from jeddah , saudi arabia , 2013 .\noutput:\n" }, { "from": "agent", "value": "we investigated a case of human infection with middle east respiratory syndrome coronavirus ( mers - cov ) after exposure to infected camels . analysis of the whole human - derived virus and 15 % of the camel - derived virus sequence yielded nucleotide polymorphism signatures suggestive of cross - species transmission . camels may act as a direct source of human mers - cov infection ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the retrogradation of starch has been defined as a process which occurs when the molecules comprising gelatinized starch begin to reassociate in an ordered structure . retrogradation can lead to an obvious increase in the firmness of stored baked goods and frozen cooked rice , making them unattractive to consumers . however , in some products , retrogradation can provide a desirable quality such as in the manufacture of rice stick noodles , resistant starch type 3 croutons , and bread crumb . for this reason , numerous studies have been performed to examine the factors affecting the retrogradation of starch . the maximum extent of retrogradation of most starches is attained in starch gels containing 50 % 60 % solids . it was also found that starch gels retrograde faster when stored at 46c . glass transition is a second - order phase transition that occurs over the temperature range at which amorphous solid materials ( glassy materials ) are transformed to a metastable leathery state . a special glass transition temperature , denoted as tg , has been defined as the glass transition of a maximally freeze - concentrated system . tg plays a key role in the quality and storage stability of frozen products because the rate of deteriorative changes in frozen food is closely related to tg . below tg , where the food matrix is in a glassy state , molecular mobility decreases and consequently reduces the rate of deteriorative changes involving molecular mobility . due to the fact that retrogradation of gelatinized starch involves the movement and rearrangement of starch chains to form a junction zone , we hypothesized that the extent of retrogradation process of starch gels at temperatures below and above tg should be different . although there have been some studies on the influence of storage temperatures on the extent of retrogradation , these studies used ambient temperature , refrigeration ( 4 or 5c ) , and frozen storage ( 20c ) but not temperatures in the vicinity of tg . moreover , all of these experiments used samples which were gelatinized in differential scanning calorimeter ( dsc ) pans . this static gelatinization might not mimic the real heating process of starch suspension which usually includes stirring the suspension during application of heat . heating with shear would completely paste the starch suspension while heating without shear might cause incomplete pasting . moreover previous studies have shown that maximum retrogradation occurred in rice starch gels with 40 % 60 % water content . in this paper , we present an alternative method to prepare completely gelatinized starch gels and then limit the water content to 50 % to provide maximum retrogradation . this research will make a contribution toward an improvement in the acceleration or retardation of retrogradation of starch - based products . waxy rice starch was made from thai waxy rice grains ( rd 6 ) , grown in the kalasin province area and aged at least six months . rice kernels were soaked in water for 4 h and then ground with water using a double - disc stone mill . the slurry was centrifuged for 15 min and dried at 45c for 15 h. the flour was ground in a hammer mill and passed through a 100 - mesh sieve ; then it was stored at room temperature in sealed plastic bags . for the isolation of waxy rice starch from waxy rice flour , the method of hogan was used . the sediment was washed with water , neutralized with hydrochloric acid solution , and dried . the rice starch was then ground in a hammer mill and passed through a 100 - mesh sieve . the granule size of was 2.85.1 m with mean diameter of 3.80.7 m . the protein , fat , and ash contents of waxy rice starch were 0.200.00 , 0.050.00 , and 0.030.00 g / 100 g dried solid by the aacc method 46 - 12 , 30 - 25 , and 08 - 01 , respectively . the moisture content was 11.070.10 g / 100 g by the aacc method 44 - 15a . the amylose content of waxy rice starch was 6.490.13 g / 100 g dried solid by the method of juliano . a starch suspension ( 10 % w / w ) was prepared by mixing the waxy rice starch in distilled water and stirring continuously at 250 rpm for 1 h followed by 200 rpm at 95c for 1 h. the gelatinized starch sample was then put in stainless steel dsc pans . water in each sample was allowed to evaporate at room temperature until the final water content was 50 % as determined by weighing . the sealed pans were separated into two sets with one set being used for glass transition determination and the other set being used in the retrogradation study . a pyris - 1 dsc ( perkin elmer , norwalk , ct , usa ) equipped with an intracooler subambient accessory was used . nitrogen gas was used as the purge gas at a flow rate of 20 ml / min during calibration and measurements . an empty pan was used as a reference sample . each sample in a sealed dsc pan was cooled to 60c and then heated to 25c at 5c / min to determine the glass transition temperature of a nonannealed state . for the isothermal annealing treatment , the samples were cooled to 60c and held for 15 min , heated to three different annealing temperatures ( 4 , 7 , and 10c ) in the vicinity of the tg of a nonannealed sample and held at this temperature for 15 min , and cooled back to 60c at 10c / min and reheated to 25c at 5c / min to locate the tg . the tg was indicated by an onset temperature of the heat capacity change , which was determined using the computer software program associated with the perkin elmer instrument . the sealed dsc pans with gelatinized starch were frozen to 30c in a cooling bath and held for 1 h and then immediately stored at 8 , 5 , 3 , 0 , and 4c for 5 days . storage at 8 , 5 , and 3c was done in a cooling bath while the samples at 0 and 4c were kept in a low temperature incubator ( model ipp 400 , memmert , germany ) . after storage , the pans were left to stand for 30 min at room temperature to equilibrate and then heated from 25 to 120c in the dsc at 10c / min to observe the melting peak of the retrograded starch gels . in a system that is allowed to form the maximum amount of ice , the glass transition of this maximally freeze - concentrated matrix occurs at tg and is independent of the initial solids fraction ( before freezing ) . however , if the maximum amount of ice is not formed in the system , the resulting unfrozen matrix will be more dilute . the dsc thermograms showing the tg values of the gelatinized waxy rice starch isothermally annealed at different temperatures are presented in figure 1 . the tg value of the gelatinized waxy rice starch was about 5c in the nonannealed state . at the three different annealing temperatures of 4 , 7 , and 10 c , the tg value of gelatinized waxy rice starch was 4 , 3.5 , and 4.2 c , respectively . the annealing temperature of 7c resulted in the highest tg value and the most clearly detectable among the three annealing temperatures . this might have occurred because this temperature , which was slightly below the tg of the gelatinized waxy rice starch ( 5c ) , was high enough to have sufficient molecular mobility for ice formation and yet also low enough to maintain the amorphous glass matrix as discussed by lim et al . . our tg result of 3.5 c agreed relatively well with slade and levine , roos and karel , and israkarn and charoenrein who found that the tg values of gelatinized wheat starch , gelatinized waxy corn starch , and cooked rice stick noodles were 5 , 6 , and 4c , respectively . in this study , waxy rice starch was selected because it showed a well - defined melting peak of retrograded amylopectin at temperature range of 4075c . the method of gel preparation used in this study included ( 1 ) shearing during heating , which provided a fully gelatinized starch sample , and ( 2 ) control of the water content at 50 % to obtain the maximum retrogradation extent . gelatinized waxy rice starch samples stored at various temperatures in the vicinity of the tg for 5 days showed differences in enthalpy of melting of the retrograded starch gels ( figures 2 and 3 ) . the peak of melting of retrograded starch was large in samples stored at 4 and 0c . samples stored at 3c showed a small peak while a very small peak and no peak were shown in samples stored at 5 and 8c , respectively , which were temperatures below tg ( at 3.5 c ) . this indicated that at temperature below the glass transition temperature , the movement of starch chains to form junction zone of retrogradation was hindered . the results also agreed with baik et al . who reported that waxy rice starch gels stored at subzero temperature ( 12c ) showed a lower degree of recrystallization of starch than those stored at 4cthe onset of tg of the gelatinized waxy rice starch gel annealed at 7c for 15 min was 3.5 c . the results showed that rice starch gels retrograded substantially when stored at 4c for 5 days . decreases in the enthalpy of melting of retrograded starch gel were observed in samples stored at 3 , 5 , and 8c . this was due to the more rigid glass matrix and less molecular mobility at temperatures below tg . these results suggested that the retardation of retrogradation of waxy rice starch gel can be manipulated by a temperature below tg and acceleration could be carried out at temperature above tg .\noutput:\n" }, { "from": "agent", "value": "the retrogradation rate of waxy rice starch gel was investigated during storage at temperatures in the vicinity of the glass transition temperature of a maximally concentrated system ( tg ) , as it was hypothesized that such temperatures might cause different effects on retrogradation . the tg value of fully gelatinized waxy rice starch gel with 50 % water content and the enthalpy of melting retrograded amylopectin in the gels were investigated using differential scanning calorimetry . starch gels were frozen to 30c and stored at 4 , 0 , 3 , 5 , and 8c for 5 days . the results indicated that the tg value of gelatinized starch gel annealed at 7c for 15 min was 3.5 c . waxy rice starch gels retrograded significantly when stored at 4c with a decrease in the enthalpy of melting retrograded starch in samples stored for 5 days at 3 , 5 , and 8c , respectively , perhaps due to the more rigid glass matrix and less molecular mobility facilitating starch chain recrystallization at temperatures below tg . this suggests that retardation of retrogradation of waxy rice starch gel can be achieved at temperature below tg ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: for a long time mental status in patients with chronic prostatitis was a topic for investigation . dean a.l . ( 1954 ) were among the first authors to describe patients with the combination of chronic prostatitis and various mental disorders ( referred to as psychoneurosis ) . sometime later , in 1973 mellan j. et al . coined the term prostatic neurosis to describe this patient population . according to jansen p.l . et al . ( 1983 ) , neurotic disorders , such as sensation of anxiety , insecurity , fear , and depression are present in a significant number of chronic bacterial prostatitis ( cbp ) patients regardless of urological findings . until now , the studies of psychological condition in patients with chronic prostatitis have been uninterrupted . the main mental disorders among the cbp patients have been considered as neurotic and / or psychosomatic disorders accompanied by depression . our aim was to estimate the incidence of mental disorders in patients with cbp , to evaluate the efficacy of their multimodal therapy , and to determine the principles of comprehensive medical aid in patients with such pathology . over the last five years a total of 337 patients with cbp had been observed . the choice of diagnostic and therapeutic methods was made according to approved clinical protocols that adhered to european association of urology guidelines and european psychiatric association guidance , and did not digress from the principles of the local ethical committee . the diagnosis of cbp was confirmed if prostatic fluid contained more than 10 leucocytes per high power microscopic field and a pathogen was concomitantly identified . the intensity of clinical symptoms associated with cbp was measured using the cpsi pain domain score ( 021 ) from the national institute of health chronic prostatitis symptom index ( nih cpsi ) scale . initially , all patients were subjected to multimodal therapy with antibiotics , immunomodulators , and physiotherapy that included prostatic massages . recommendations for diet and lifestyle changes were also expressed , which also included the need to assess patients sexual partner ( s ) and treat if indicated . in cases in which sexually transmitted and / or non specific pathogens were detected , antibacterial therapy was continued until all traces of the pathogen ( s ) were eradicated . pathogens implicated in chronic bacterial prostatitis and the suitable treatment if , after pathogen eradication , psychopathological symptoms dominated over urological and / or lack of efficiency of long term cbpspecific therapy occurred , the patients were referred to psychiatric consultation . for the evaluation of primary mental status and treatment control we used our local as well as standard approved questionnaires included a symptom checklist scale , a diagnostic and statistical manual iv text revision ( dsm iv tr ) , depression inventories : the beck depression inventory ii ( bdi ii ) as a self report scale for depressed mood and the montgomerysberg depression rating scale ( madrs ) as a clinician administered measure for depression and a guide to evaluate recovery . after confirming the mental disorder in our patients , initially 45 sessions of psychotherapy ( rational emotive behavior therapy ( rebt ) ) were arranged upon completion of antibacterial treatment . if psychiatric symptoms still persisted then pharmacotherapy was prescribed on a per case basis according to the diagnosis , dynamics , and severity of symptoms and their regression / progression together with consideration given to the tolerance of adverse effects to drug therapy ( table 2 ) . at the time of cbp primary diagnostics or confirming , different mental disorders were registered in 137 ( 40.7 % ) pts . among them were concomitant psychosomatic disorders at the onset of cbp treatment that were noted in 95 patients ( 28.2 % ) , namely : panic attacks in 44 patients ( 13.1 % ) , irritable bowel syndrome in 35 patients ( 10.4 % ) , paroxysmal tachycardia in 38 ( 11.3 % ) pts . , tension headaches in 29 ( 8.6 % ) , anorexia nervosa in 21 ( 6.2 % ) pts . , hyperhidrosis in 16 ( 4.7 % ) pts . , and multiform parasthesias in 75 ( 22.2 % ) pts . neurotic disorders were registered in 89 ( 26.4 % ) pts . as well independently in 42 ( 12.5 % ) pts . as in combination with psd in 47 ( 13.9 % ) patients . all of the neurotic and psd patients also demonstrated different depressive disorders , which were predominantly mild or moderate with only a few severe cases . after normalization of the parameters of prostatic fluid and urinalysis , eradication of cbp causative pathogens , and 45 sessions of psychotherapy ( rebt ) , the mental status spontaneously returned to normal in 29 pts . with psd ( 30.5 % of this subgroup ) and in 46 pts . with neurotic disorders ( 51.7 % of this subgroup ) this fact demonstrates that the application of rational emotive behavior therapy plays an important role in treatment strategy for patients with cbp and mental disorders . another 66 patients with psd ( 66.3 % of this subgroup ) and 43 patients with neurotic disorders ( 48.3 % of this subgroup ) , after normalization of prostate fluid parameters and a few sessions of rebt , did not demonstrate a subjective response to the standard treatment and required additional specialized treatment . this specialized treatment included the continuation of psychotherapy with possible alteration of its form combined with pharmacotherapy including the use of tranquilizers , antidepressants , and / or neuroleptics ( table 2 ) . in cases of psd we used antidepressants and / or neuroleptics . the effect of such pharmacotherapy usually became evident only after two to three weeks treatment , which is why patients were informed in advance about the necessity the to follow the prescribed drug regimes . tranquilizers were predominantly prescribed in cases of neurotic disorders and sometimes in patients with mild depressions . their effect became subjectively appreciable by the end of the first or second day of use . after application of the abovementioned psychopharmacologic treatment to the 66 patients with refractory psd : 36 ( 54.5 % ) pts . showed significant improvement ( partial or complete elimination of the pathological symptoms ) ; 24 ( 36.4 % ) pts . did not demonstrate a subjective response to the treatment at all and , thus , a severe concomitant psychiatric pathology was appreciated during a more in depth psychiatric assessment ( hypochondria in three pts . , major depressive disorder in two pts . , and schizophrenia in one pt . ) that required prolonged medication therapy and further observation . . showed significant improvement ( partial or complete elimination of the pathological symptoms ) ; 24 ( 36.4 % ) pts . showed moderate improvement ; six ( 9.1 % ) pts . did not demonstrate a subjective response to the treatment at all and , thus , a severe concomitant psychiatric pathology was appreciated during a more in depth psychiatric assessment ( hypochondria in three pts . , major depressive disorder in two pts . , and schizophrenia in one pt . ) that required prolonged medication therapy and further observation . after adding the pharmacotherapy to psychotherapy in 43 treatment resistant patients with cbp and concomitant neurotic disorders , a significant improvement was observed in 31 cases ( 72.1 % of this subgroup ) a finding that supports such a therapeutic approach ( fig .1 ) . efficacy of anti inflammatory treatment combined with psychotherapy ( rebt ) in patients with cbp and mental disorders . the addition of pharmacotherapy to psychotherapy in patients with cbp and mental disorders was found to significantly decrease the manifestation of neurotic disorders ( fig .2 ) . efficacy of previous anti inflammatory treatment followed by psychotherapy and pharmacotherapy in patients with cbp and mental disorders . obtained results reflected by inventory scores are presented in table 3 . efficacy of multimodal treatment in 137 patients with cbp and mental disorders that reflected by inventory scores in 47 pts . before treatment were present both psychosomatic and neurotic disorders however , after anti inflammatory therapy combined with psychotherapy and pharmacotherapy , 30 ( 31.5 % ) pts . with psd and 12 ( 13.5 % ) moreover , both psd and neuroses were registered in eight of them , which required in depth long term psychiatric assistance . a separate subgroup included 114 ( 33.8 % ) pts . with cbp and premature ejaculation . abnormalities of orgasm and ejaculation are among the main symptoms of cbp and appear due to increased tone of alpha1a receptors against the background of prostatic inflammation . patients with premature ejaculation and without cbp were not included into our study because such patients require a different therapeutic strategy . the presence of premature ejaculation more often than not put a patient into a mood of anxiety and could be the trigger factor provoking the development of mental disorders . such disorders have a significant psychological burden on men , their partners , and the male / female relationship . after multimodal anti inflammatory therapy of cbp followed by several sessions of rebt , various prolongations in terms of intercourse time were observed in 69 patients ( 60.5 % ) . another 45 patients ( 39.5 % ) required applications of local anesthetics and / or oral administration of selective serotonin reuptake inhibitors ( ssris ) . by prolonging the intercourse time , these therapeutic options consequently improved the mental status in a large group of patients suffering from both cbp and premature ejaculation . the results presented herein are indicative of a substantial portion of concomitant psd ( 28.2 % ) , neurotic disorders ( 26.4 % ) , and premature ejaculation ( 33.8 % ) in patients with chronic prostatitis . in a large fraction of patients , mental disorders and / or premature ejaculation reverse spontaneously with adequate antibacterial therapy followed by a few sessions of rebt . however , some patients demonstrate resistance to the conventional multimodal treatment for cbp , which challenges the experts to identify other causes of pathological symptoms and their respective treatment . very often in daily practice , urologists encounter the situation in which the application of long term antibacterial therapy in patients with chronic prostatitis does not yield adequate results . some patients still complain of a variety of disorders despite the use of all standard treatment options , some of them even lose faith in the ability to remedy after years of futile treatment . such disappointment hurts the patient 's mentality and even confuses urologists to the point of perplexity , which is why a deeper insight into the essence of the problem is required for a more complete understanding of psychological state of patients with cbp , as well as the mechanisms that influence it . the chronic pain syndrome , caused by antibiotic resistant prostatic inflammation , reduces the working capacity of patients and worsens their quality of life and their ability to interact socially . dysuria , incomplete bladder emptying , and especially lengthy pain syndrome with frequent exacerbations deplete the psyche of patients with cbp , contributing to a negative impact on the patient 's quality of life that may trigger the development of mental disorders . almost a third of men experiencing urogenital pain or prostatitis like symptoms would be less than satisfied if this was to be ongoing for the rest of their life . the symptoms of chronic prostatitis are strongly associated with psychosocial risk factors such as pain catastrophizing , depression , and anxiety . according to keltikangasjrvinen l. et al . ( 1982 ) , there is a correlation between the duration of somatic irritative symptoms and the intensity of psychiatric manifestations . ( 2007 ) have also registered that there is a close correlation between the severity of psychological symptoms and the clinical symptoms in patients with chronic prostatitis . . symptoms of depression in patients with chronic prostatitis are closely associated with clinical symptom intensity . according to jiang s. et al . ( 2012 ) , pain or discomfort in the genital area and urination disorders have an impact on symptoms and total score in the nih cpsi scale . these authors showed a significant positive correlation of the nih cpsi score with the symptoms of depression with a simultaneously negative correlation with erectile function in patients with chronic prostatitis ( r = 0.32 , 0.31 , 0.35 , 0.38 , and 0.36 , p 0.05 ) . . intellectualization , redefinition , and flexibility in healthy individuals are higher in frequency in descending order comparing to prostatitis patients fatalism , externalization , and self pity are correspondingly lower in frequency . patients with chronic prostatitis often suffer from depression , anxiety , and a higher perception of stress . in particular , these disorders were closely related to the pain and subsequently decreased the quality of life in such patients . the manifestations of complex neuroendocrine abnormalities are usually present in patients with cbp that exert a remarkable negative influence . statistically significant changes of serum cortisol levels were found in patients with chronic prostatitis / chronic pelvic pain syndrome . patients with chronic prostatitis have abnormally high levels of progesterone and androstenedione , and abnormally low levels of corticosterone , aldosterone , and 11deoxycortisol compared to healthy volunteers . furthermore , lower levels of cortisol and higher levels of aldosterone were associated with higher pain and cpsi scores . the above mentioned systemic hormonal violations objectively have a bad affect on a patient 's behavior and resistance in stressful situations . a significant part of mental disorders in our cbp patients was presented by psychosomatic disorders , which are a group of somatic diseases or conditions in which the predominant role belongs to psychoemotional factors ( imagination , emotions , and fantasies ) . franz alexander , considered that classical psds include the following conditions : peptic ulcers of stomach and duodenum , bronchial asthma , hypertension , rheumatoid arthritis , neurodermitis , hyperthyroidism , and ulcerative colitis . this list is currently expanded by the inclusion of erosive bulbitis , cystalgia , irritable bowel syndrome , paroxysmal tachycardia , and tension headaches among others . the complaints of somatic origin are interpreted as manifestations of the symbolic language of internal organs , reflecting the occult libido related trends , displaced complexes , and negative emotions ( anger , jealousy , hatred , remorse etc . ) . depending on the type of emotions and their duration and intensity , disturbances of certain organs and systems occur . according to prof . f. alexander , the development of psd requires three preconditions : the patient should have a psychological conflict specific attitude ; a certain specific situation serves as a psd trigger ; e.g. , peptic ulcer disease is frequently caused by a loss of the patient 's significant other ; the patient must have a constitutional mental vulnerability and a certain biological x factor increasing the propensity to psd.the developments of a hypochondriac personality with the projection of fear upon various bodily functions also facilitate the development of psd . the patient 's perceptions of multiform paresthesias and / or premature ejaculation , typical for chronic prostatitis , are extremely harmful ; the patients usually focus excessive attention upon such disorders . the concomitant psychogenic erectile dysfunction that often develops by the vicious circle mechanism in patients with cbpthe patient should have a psychological conflict specific attitude ; a certain specific situation serves as a psd trigger ; e.g. , peptic ulcer disease is frequently caused by a loss of the patient 's significant other ; the patient must have a constitutional mental vulnerability and a certain biological x factor increasing the propensity to psd . the presence of a traumatic factor ( situation ) and the patient 's predisposition to psd are decisive factors in psd development . since the presentation of chronic prostatitis is directly associated with the genital area and sexual behavior disorders , this condition is a powerful traumatic factor in patients prone to psd psychosomatic disorders in cbp are noted for their particular intensity and duration . the verified fact of prostatitis and / or std being diagnosed can affect emotional balance and become a trigger of negative changes in the patient 's mental status , thereby inducing the development of the subsequent mental disorder . the risk of psychosomatic or another mental disorder development and progression depends on : duration and intensity of the traumatic factor ; presence or absence of patient 's predisposition to mental disorders ; inducibility of mental disorders as a result of communication with doctors and other patients ; incorrect interpretation of information obtained from the internet and / or literature ; duration and intensity of the traumatic factor ; presence or absence of patient 's predisposition to mental disorders ; inducibility of mental disorders as a result of communication with doctors and other patients ; incorrect interpretation of information obtained from the internet and / or literature ; in turn , a patient 's propensity to develop of mental disorders is increased under the following circumstances : unfavorable heredity ; unstable social status ; the presence of any form of addictive behavior ( drug and alcohol abuse , addiction to gambling etc . ) ; orthe presence of concomitant psychiatric and severe somatic disorders . unfavorable heredity ; unstable social status ; the presence of any form of addictive behavior ( drug and alcohol abuse , addiction to gambling etc . ) ; or the presence of concomitant psychiatric and severe somatic disorders . based on our experience and the results obtained from inventories , we believe that a mental disorder should be suspected in a patient if , in addition to the typical clinical presentation of cbp , the following signs and / or symptoms are present : distinctive signs of psychological discomfort : complaints of irrational anxiety , insomnia , nervous breakdowns , and accelerated or slow speech ; signs of social maladjustment ( it is important to pay close attention to the patient 's history and appearance ) ; intense and lasting negative emotions in the patient ; changes in eating preferences , such as reducing / absence of appetite or on the contrary overeating ; patients are often uneasy with their surroundings and their opinion of the way they look ; discrepancy between usual clinical manifestations of the disease and somatic symptoms described by patient ; patients are avoiding mirrors or quite the opposite , constantly checking themselves in a mirror ; patient 's propensity to describe symptoms in figurative terms ( goose skin , wobbly feet , mist in the eyes , etc . ) that are pronounced with pained facial expressions ; lengthy and ineffective treatment with medical professionals of various specialties the patient demands multiple diagnostic tests to be performed and then treats the test results as collectibles ; the patient has a profound knowledge of his condition and frequently engages in disputes with his urologist , during which he subconsciously seeks to gain an advantage ; he also commonly considers that his doctor has made a mistake by wrongfully diagnosing the real disease and cause of his disturbing symptoms ; etiotropic and pathogenesis targeted therapies produce brief and / or controversial effects , the most effective agents eliminatingorganic symptoms being psychotropic remedies , tranquilizers , and / or antidepressants ; temporary relief is produced by either alternative therapies ( sorcerers , acupuncture , homeopathy , modern computer treatment technologies , etc . ) or sometimes different minimally invasive procedures . distinctive signs of psychological discomfort : complaints of irrational anxiety , insomnia , nervous breakdowns , and accelerated or slow speech ; signs of social maladjustment ( it is important to pay close attention to the patient 's history and appearance ) ; intense and lasting negative emotions in the patient ; changes in eating preferences , such as reducing / absence of appetite or on the contrary overeating ; patients are often uneasy with their surroundings and their opinion of the way they look ; discrepancy between usual clinical manifestations of the disease and somatic symptoms described by patient ; patients are avoiding mirrors or quite the opposite , constantly checking themselves in a mirror ; patient 's propensity to describe symptoms in figurative terms ( goose skin , wobbly feet , mist in the eyes , etc . ) that are pronounced with pained facial expressions ; lengthy and ineffective treatment with medical professionals of various specialties the patient demands multiple diagnostic tests to be performed and then treats the test results ascollectibles ; the patient has a profound knowledge of his condition and frequently engages in disputes with his urologist , during which he subconsciously seeks to gain an advantage ; he also commonly considers that his doctor has made a mistake by wrongfully diagnosing the real disease and cause of his disturbing symptoms ; etiotropic and pathogenesis targeted therapies produce brief and / or controversial effects , the most effective agents eliminating organic symptoms being psychotropic remedies , tranquilizers , and / or antidepressants ; temporary relief is produced by either alternative therapies ( sorcerers , acupuncture , homeopathy , modern computer treatment technologies , etc . ) or sometimes different minimally invasive procedures . as long as one or more of the abovementioned signs are found in a patient by the urologist , a meticulous comparison of the clinical presentation and the intensity of the symptoms described should be performed . then , upon consideration of patient 's history , the patient should be referred to a psychiatrist or a qualified psychotherapist for validation of the complete diagnosis . out of deontological considerations , a single appropriate way of persuading the importance of psychiatric consultation should be carefully selected for each patient with suspected mental disorder . keeping in mind the fragile psyche typical of most patients with cbp , the use of the following wording is recommended during conversation : psychoneurologist , psychotherapist , and / or neurologist . this is because the patient is likely to be biased against being referred to asoviet society , and may cause rejection in a patient and , thus , affecting the impartiality of his decisions concerning further assessment and treatment . in our opinion to preserve mental health , the patient should adhere to certain practices during the therapy of cbp : first of all , the treatment should be aimed at eliminating the manifestations of the disease ( such as urethral discharge and genital rash ) and subjective symptoms that bother the patient ( pain , itching , dysuria , concomitant ed , and / or premature ejaculation etc . ) . if the findings of tests improve in the course of treatment without the elimination of the abnormal symptoms , the patient may develop distrust in his physician and may be inclined to partake in inadequate alternative therapies.sufficient attention should be paid to each patient since trusting the doctor is an important factor of recovery and could influence the appearance of psycho emotional complications in the future.taking into consideration the high degree of trust to the physician , during communications with neurotic patients the urologist should convey his / her confidence in positive treatment outcomes whenever treatment is feasible and its success can be confidently predicted . conversely , if achievement of expected treatment results is dubious , the patient should not be given vain hopes since this will eventually cause mistrust of the physician and may provoke the emergence of exacerbated mental disorders.for effective treatment , all patients with cbp should be informed of the necessity to assess and treat sexual partners as needed.in cases in which psychopathological manifestations dominate over urological symptoms , the patients should be referred to a psychiatrist for consultation . first of all , the treatment should be aimed at eliminating the manifestations of the disease ( such as urethral discharge and genital rash ) and subjective symptoms that bother the patient ( pain , itching , dysuria , concomitant ed , and / or premature ejaculation etc . ) . if the findings of tests improve in the course of treatment without the elimination of the abnormal symptoms , the patient may develop distrust in his physician and may be inclined to partake in inadequate alternative therapies . sufficient attention should be paid to each patient since trusting the doctor is an important factor of recovery and could influence the appearance of psycho emotional complications in the future . taking into consideration the high degree of trust to the physician , during communications with neurotic patients the urologist should convey his / her confidence in positive treatment outcomes whenever treatment is feasible and its success can be confidently predicted . conversely , if achievement of expected treatment results is dubious , the patient should not be given vain hopes since this will eventually cause mistrust of the physician and may provoke the emergence of exacerbated mental disorders . for effective treatment , all patients with cbp should be informed of the necessity to assess and treat sexual partners as needed . in cases in which psychopathological manifestations dominate over urological symptomsthe population of patients with cbp and mental disorders is heterogeneous in their personality traits . in terms of personality traitsthe prostatic problems are of a secondary nature with the primary disruptions being those of the nervous system ; alexithymic type . the patients are unable to adequately verbalize their emotions , concerns , and complaints ; borderline type , between neurotic type ( health related anxiety and depression ) and psychotic type ( delusional symptoms , persistent demands for frequent additional assessments ; developing their own theories concerning the origin and treatment of cbp ) ; narcissistic type ( self admiration with attention increasingly focused on bodily sensations and physiological manifestations , such as urination , urethral discharges , urethral itching , etc . ) . psychosomatic type . the prostatic problems are of a secondary nature with the primary disruptions being those of the nervous system ; alexithymic type . the patients are unable to adequately verbalize their emotions , concerns , and complaints ; borderline type , between neurotic type ( health related anxiety and depression ) and psychotic type ( delusional symptoms , persistent demands for frequent additional assessments ; developing their own theories concerning the origin and treatment of cbp ) ; narcissistic type ( self admiration with attention increasingly focused on bodily sensations and physiological manifestations , such as urination , urethral discharges , urethral itching , etc . ) . each patient with mental disorder requires a customized individual therapeutic approach ; however , the general direction of psychological correction during psychotherapy should be chosen considering the above types of aberrant personalities . in diagnosis of mental disorder and selection of therapeutic tactics , it should be taken into consideration that such patients predominantly have concomitant depression ( with anxiety , occult or neurosis like ) , as well as other pathologic mental conditions , which may require additional long term psychotherapy and pharmacotherapy . there are some publications on the efficacy of antidepressants in the treatment of symptoms of chronic prostatitis / chronic pelvic pain syndrome in patients who are resistant to conventional anti inflammatory therapytaking into consideration the obtained results and the abovementioned opinions of authorities , it is certain that pathologic manifestations and hormonal violations in patients with chronic prostatitis , especially when long lasting , are capable of a negative influence on their mental status . on the other hand , a part of cbp patients are presented by persons with different mental disorders at the time of visiting their urologist . this is why the institution of long tern antibacterial treatment with prostatic massages must be revised carefully in treatment resistant patients . the timely reappraisal of diagnosis should be appropriate by making up a psychiatric investigation before the changes in mental status and their complications may become irreversible . in cases in which the pathogen is fully eradicated , but cbp patient 's condition has not improved by a prolonged treatment , it is contraindicated to continue antibiotics use and prostatic massages . such patient should be thoroughly examined by a psychiatrist to exclude / confirm mental disorders with subsequent treatment considered thereafter . according to our data , the frequency of concomitant psychosomatic disorders in patients with chronic bacterial prostatitis is 28.2 % neurotic disorders were registered in 26.4 % pts . among the neurotic and psd patients , mild or moderate depressive disordersadequate antibacterial and anti inflammatory therapy followed by a few sessions of psychotherapy decreased the manifestations of psychosomatic disorders in 30.5 % , neurotic disorders in 51.7 % , and premature ejaculation in 60.5 % patients with cbp . a substantial portion of patients with cbp required in depth psychiatric assistance with pharmacotherapy . when the signs of such disorders are present , the patient with chronic prostatitis must be examined by a psychiatrist .\noutput:\n" }, { "from": "agent", "value": "introductionchronic prostatitis is a widespread urological disease with a lengthy course and a propensity to frequent recurrences . adequate response to anti inflammatory therapy is lacking in a high percentage of patients , which causes them to seek medical advice from different doctors . thus , the physicians are challenged to look for other reasons causing the pathological symptoms.material and methodswe have reviewed the patients with treatment resistant chronic bacterial prostatitis ( cbp ) from the perspective of psychosomatic medicine . for the evaluation of primary mental status and treatment control we used standard approved questionnaires . all 337 cbp patients initially underwent therapy aimed at pathogen eradication . if psychopathological symptoms were evident and dominated over urological ones , the patients were referred to psychiatric evaluation and treatment.resultsthe frequency of concomitant psychosomatic disorders ( psd ) in patients with cbp was 28.2 % and neurotic disorders 26.4 % . adequate multimodal anti inflammatory therapy followed by a few sessions of psychotherapy decreased the manifestations of psd in 30.5 % , neurotic disorders in 51.7 % , and premature ejaculation in 60.5 % of patients with cbp . the addition of pharmacotherapy to psychotherapy is effective in treatment resistant cases . however , after multimodal treatment , 31.5 % of pts . with psd and 13.5 % of pts . with neurotic disorders still remain treatment resistant and required in depth long term psychiatric care.conclusionsa significant portion of cbp patients were diagnosed with neurotic , psychosomatic , and / or depressive disorders.antibacterial and anti inflammatory therapy , when followed by appropriate psychotherapy and pharmacotherapy , significantly decrease the manifestations of mental disorders in cbp patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although there is consensus ( apa , 1994 ) about dsm iv criteria for children and adolescents with autistic disorder and asperger s disorder , the largest category , pddnos , remains difficult to classify . the latter is even more true for adult patients since the dsm - iv criteria are not formulated with adult age in mind ( gillberg , 1998 ; tamtam , 1991 ; vermeulen , 2002 ) . the autism diagnostic interview revised ( adi - r , lord , rutter , & le couteur , 1994 ) and the autism diagnostic observation schedule - generic ( ados - g ; lord et al . , 2000 ) follow - up studies of adolescents and adults with autism indicate that a slow decrease in symptoms across time occurs in a small group , particularly the less severely affected patients ( seltzer , shattuck , abedutto , & greenberg , 2004 ) . however , there is a lack of knowledge about adults with mild asd , i.e. , asperger s disorder and pddnos . in light of this limited knowledge on symptom presentation in adults , the present paper reports on a pilot research - project that was done with two aims : ( a ) to test the autism spectrum quotient ( aq ; baron - cohen , wheelwright , skinner , martin , & clubley , 2001 ) as an instrument for screening adult non - mentally retarded patients for asd . we hypothesised that scores would be higher for an asd group than for two non - asd comparison groups ; ( b ) there is a clinical feeling that mild asd symptoms often mix with other disorders ( e.g. , obsessive compulsive disorder or schizoid personality disorder ) . therefore , in patients referred to an asd expertise - centre , prevalences of axis i and ii comorbid disorders were estimated to test the hypothesis that certain diagnoses are more prevalent among asd patients than non - asd patients . two groups of patients were investigated ; the first group ( n = 36 ) consisted of patients referred to the autism team north netherlands ( atn ) . the atn is the asd outpatient center of expertise for the three northern provinces of the netherlands ( 1.5 million inhabitants ) . on a yearly basis , about 80 new adult patients are referred for diagnostic evaluation and ( advice for ) treatment . since the atn is acenter of expertise , all patients were referred by psychiatrists and psychologists , working in the field of adult ( but not forensic ) psychiatry . only patients with parents who were able to give the required information were included in the present study . they were 18 years or older , with an estimated iq higher than 80 . over a span of 10 months from february 2003 through october 2003 ,60 eligible patients were asked to participate , of which 35 patients and their parents consented . the patients were randomly assigned to two experienced ( child ) psychiatrists ( ck or eh ) for diagnostic assessment . the second group ( n = 369 ) consisted of patients from the same region , who were referred in this same period to the general outpatient psychiatric clinic of the university medical centre groningen . this group from the general outpatient clinic ( goc ) enabled us to compare the scores on the aq screening instrument . the clinical standardized diagnostic protocol that was used in the intake of atn - referred patients consisted of a semi - structured interview ( taken from at least one of the parents ) , and observations from the adi - r , ados - g , as well as clinical experience . actual asd symptoms were translated in the interview as much as possible to the adult - world situation . questions about the past were used to reconstruct the developmental history of the patient as adequately as possible . the information derived from the diagnostic protocol was subsequently used to score the dsm - iv criteria on asd . intelligence was assessed by using a short version of the groninger intelligentie test ( git , luteijn , 1966 ) . for classification of pddnos , the minimal amount of positive dsm - iv criteria was two , of which at least one derived from the social interaction domain . for asperger s disorder at least two items on the social domain and at least one item on the stereotypic domain needed to be present with no early delay of language . for high functioning autismat least six items were needed to be present , with at least two items on the social domain and at least one positive item on each of the other two domains , with onset of abnormal functioning before the age of three years . the reliability of the diagnostic protocol was tested by assessing a series of seven patients simultaneously by two experienced ( child ) psychiatrists ( ck and eh ) . these independent classifications differed only on one patient ( pddnos versus non - asd ) . the seven patients were not included in the present study , which started after having determined diagnostic reliability . the aq was translated in dutch and was named aq - d ( dutch ) . this self - report screening questionnaire has 50 items , which score on 5 domains of behavior : social skill , attention switching , attention to detail , communication , and imagination . each domain has a maximum score of 10 ( for details on this instrument , see baron - cohen et al . , 2001 ) internal consistency reliability estimates ( cronbach s ) for aq subscales were acceptable for the asd - group but somewhat on the lower side for the non - asd groups . averaged across the five subscales cronbach s was .67 for the asd group , .62 for the non - asd group referred to the atn , and .59 for the goc group . for the total scale internal consistency reliability was acceptable in all three groups : i.e. , .85 , .82 , and .79 , respectively . present and life - time comorbidity were assessed by using the schedules for clinical assessment in neuropsychiatry ( scan - 2.1 , giel & nienhuis , 1996 ; world health organisation , 1992 ) and the international personality disorder examination ( ipde , loranger et al . , 1994 ) . iq , scan and ipde assessments were done by a psychologist ( jb ) who was blind to the outcome of the asd psychiatric diagnosis . chi - square tests and analyses of variance were conducted to analyze possible differences between the groups . two groups of patients were investigated ; the first group ( n = 36 ) consisted of patients referred to the autism team north netherlands ( atn ) . the atn is the asd outpatient center of expertise for the three northern provinces of the netherlands ( 1.5 million inhabitants ) . on a yearly basis , about 80 new adult patients are referred for diagnostic evaluation and ( advice for ) treatment . since the atn is acenter of expertise , all patients were referred by psychiatrists and psychologists , working in the field of adult ( but not forensic ) psychiatry . only patients with parents who were able to give the required information were included in the present study . they were 18 years or older , with an estimated iq higher than 80 . over a span of 10 months from february 2003 through october 2003 ,60 eligible patients were asked to participate , of which 35 patients and their parents consented . the patients were randomly assigned to two experienced ( child ) psychiatrists ( ck or eh ) for diagnostic assessment . the second group ( n = 369 ) consisted of patients from the same region , who were referred in this same period to the general outpatient psychiatric clinic of the university medical centre groningen . this group from the general outpatient clinic ( goc ) enabled us to compare the scores on the aq screening instrument . the clinical standardized diagnostic protocol that was used in the intake of atn - referred patients consisted of a semi - structured interview ( taken from at least one of the parents ) , and observations from the adi - r , ados - g , as well as clinical experience . actual asd symptoms were translated in the interview as much as possible to the adult - world situation . questions about the past were used to reconstruct the developmental history of the patient as adequately as possible . the information derived from the diagnostic protocol was subsequently used to score the dsm - iv criteria on asd . intelligence was assessed by using a short version of the groninger intelligentie test ( git , luteijn , 1966 ) . for classification of pddnos , the minimal amount of positive dsm - iv criteria was two , of which at least one derived from the social interaction domain . for asperger s disorder at least two items on the social domain and at least one item on the stereotypic domain needed to be present with no early delay of language . for high functioning autismat least six items were needed to be present , with at least two items on the social domain and at least one positive item on each of the other two domains , with onset of abnormal functioning before the age of three years . the reliability of the diagnostic protocol was tested by assessing a series of seven patients simultaneously by two experienced ( child ) psychiatrists ( ck and eh ) . these independent classifications differed only on one patient ( pddnos versus non - asd ) . the seven patients were not included in the present study , which started after having determined diagnostic reliability . the aq was translated in dutch and was named aq - d ( dutch ) . this self - report screening questionnaire has 50 items , which score on 5 domains of behavior : social skill , attention switching , attention to detail , communication , and imagination . each domain has a maximum score of 10 ( for details on this instrument , see baron - cohen et al . , 2001 ) the aq - d was completed by the patient before the clinical procedure started . internal consistency reliability estimates ( cronbach s ) for aq subscales were acceptable for the asd - group but somewhat on the lower side for the non - asd groups . averaged across the five subscales cronbach s was .67 for the asd group , .62 for the non - asd group referred to the atn , and .59 for the goc group . for the total scale internal consistency reliability was acceptable in all three groups : i.e. , .85 , .82 , and .79 , respectively . present and life - time comorbidity were assessed by using the schedules for clinical assessment in neuropsychiatry ( scan - 2.1 , giel & nienhuis , 1996 ; world health organisation , 1992 ) and the international personality disorder examination ( ipde , loranger et al . , 1994 ) . iq , scan and ipde assessments were done by a psychologist ( jb ) who was blind to the outcome of the asd psychiatric diagnosis . chi - square tests and analyses of variance were conducted to analyze possible differences between the groups . fifteen of the 36 patients were diagnosed with asd . in this asd - group ,10 patients classified as pddnos , 4 patients as asperger s disorder and 1 patient as high functioning autism . the number of positive dsm - iv items ranged from 2 to 8 , with an average score of 3.8 . table 1 shows gender , age , and iq of asd and non - asd patients . the significant differences between the groups were ( a ) the younger age of the asd patients relative to the other patients groups ; ( b ) the younger age of the non - asd group referred to the atn relative to the goc patients ; and ( c ) the predominance of males in the atn - referred patients compared with the goc patients . table 1characteristics of participantsdiagnosisasd ( n = 15 ) no asd ( n = 21 ) general outpatient clinic ( n = 369 ) male / femalem = 12 , f = 3 m = 18 , f = 3 m = 180 , f = 189 average age ( range , sd ) 22 years ( 1824 , 5 ) 27 years ( 1855 , 9 ) 35 years ( 1473 , 11 ) mean iq ( sd ) 104 ( 10 ) 105 ( 12 ) difference between goc group and non - asd group ( chi - square = 14.2 , df = 1 , p 0.0001 ) ; difference between goc group and asd group ( chi - square = 5.8 , df = 1 , p 0.05 ) ; no difference between asd group and non - asd groupgoc group differs from non - asd group ( p 0.01 ) and from asd group ( p 0.0001 ) ; no difference between asd group and non - asd group characteristics of participants difference between goc group and non - asd group ( chi - square = 14.2 , df = 1 , p 0.0001 ) ; difference between goc group and asd group ( chi - square = 5.8 , df = 1 , p 0.05 ) ; no difference between asd group and non - asd group goc group differs from non - asd group ( p 0.01 ) and from asd group ( p 0.0001 ) ; no difference between asd group and non - asd group table 2 shows aq - d sub - domain and total scores for the three groups . the one significant difference was on the sub - domain communication between the asd group and the general outpatient group . further , within the asd group , average aq - d scores varied with the severity of asd : high functioning autism : 31 ( n = 1 ) ; asperger s disorder : 24 ( n = 4 ) , and pddnos : 21 ( n = 10 ) . in light of the small sample sizes the latter differences were not tested for statistical significance . table 2mean scores aq - d ( sd ) and anova tests for differences in mean scoresasd ( n = 15 ) no asd ( n = 21 ) general outpatient clinic ( n = 369 ) social skill5 .0 ( 2.8 ) 4.2 ( 2.6 ) 4.1 ( 2.6 ) attention switching5 .1 ( 2.6 ) 5.3 ( 2.4 ) 5.3 ( 2.3 ) attention to detail3 .5 ( 2.3 ) 4.4 ( 2.2 ) 4.2 ( 2.3 ) communication * 4.5 ( 2.1 ) 3.5 ( 2.2 ) 2.8 ( 1.8 ) imagination4 .4 ( 2.4 ) 4.3 ( 2.0 ) 3.5 ( 1.9 ) total22 .5 ( 8.4 ) 21.8 ( 7.6 ) 19.9 ( 7.0 ) * significant difference between asd group and goc group at p 0.01 mean scores aq - d ( sd ) and anova tests for differences in mean scores * significant difference between asd group and goc group at p 0.01 table 3 reports axis i diagnoses in asd and non - asd patients as assessed by the scan . with one exception , there were no differences in either axis i or axis ii diagnoses between the two groups . the one exception was that more patients were diagnosed with actual psychotic disorder nos in the non - asd group than in the asd group . when we aggregated separate categories into more broad diagnostic categories , i.e. , anxiety disorders , psychotic disorders , and mood disorders , there were no differences between the two groups in past - month or lifetime diagnoses either , except for actual psychotic disorders ( results not shown ) . table 3scan - derived actual ( past month ) dsm iv axis i diagnosesasd ( n = 15 ) n ( % ) no asd ( n = 21 ) n ( % ) no disorder7 ( 47 ) 7 ( 33 ) mood disorder with psychotic symptoms2 ( 13 ) mood disorder without psychotic symptoms2 ( 13 ) 3 ( 14 ) substance abuse 3 ( 20 ) 2 ( 10 ) sleep disorders4 ( 27 ) 6 ( 29 ) psychotic disorder nos4 ( 19 ) * schizophreniasocial phobia3 ( 20 ) 4 ( 19 ) panic attacks / agoraphobia2 ( 13 ) 1 ( 5 ) other anxiety disorders1 ( 7 ) obsessive compulsive disorders1 ( 7 ) 1 ( 5 ) other disorders1 ( 7 ) 2 ( 10 ) * significant difference between asd group and no asd group at p 0.05 scan - derived actual ( past month ) dsm iv axis i diagnoses * significant difference between asd group and no asd group at p 0.05 table 4 reports axis ii diagnoses as assessed by the ipde . also , when we tested whether asd and non - asd groups differed with regard to the total number of patients with any complete , partial , or either of these two , axis 2 disorders ( bottom two rows , table 4 ) , we found no difference between the two groups . table 4ipde derived axis ii diagnoses by asd statusasd ( n = 15 ) no asd ( n = 21 ) completen ( % ) partialn ( % ) completen ( % ) partialn ( % ) paranod1 ( 5 ) schizod 1 ( 7 ) 2 ( 13 ) 1 ( 5 ) 1 ( 5 ) schizotypical1 ( 7 ) antisocial1 ( 7 ) borderline 1 ( 7 ) 1 ( 5 ) avoidant 1 ( 7 ) 1 ( 7 ) 2 ( 10 ) obsessive compulsive3 ( 14 ) 1 ( 5 ) personality disorder nos1 ( 7 ) 2 ( 13 ) 3 ( 14 ) 1 ( 5 ) any personality disorder3 ( 20 ) 6 ( 40 ) 8 ( 38 ) 3 ( 14 ) any personality disorder partial or complete7 ( 47 ) 10 ( 48 ) ipde derived axis ii diagnoses by asd statusthus far , publications about screening instruments for adult asd use the autism - spectrum quotient ( aq ; baron - cohen et al . , 2001 ) or the autism spectrum disorder in adults screening questionnaire ( asdasq ; nylander & gillberg , 2001 ) . with the help of the latter instrument , nylander & gillberg ( 2001 ) and chang et al . ( 2003 ) estimated a 1.4 and 0.6 % asd prevalence in a general psychiatry outpatient clinic for adults . the aq was investigated by baron - cohen in 2001 in asperger s disorder or high functioning autism patients and compared with several subgroups in the general population , and was tested again in 2005 at the national diagnostic clinic for asperger s disorder ( woodbury - smith , robinson , wheelwright , & baron - cohen , 2005 ) . the aq differentiated the asd patients adequately from healthy controls , and asd patients from non - asd patients . however , our results showed that the aq - d did not differentiate between an asd group ( predominantly pddnos ) and two non - asd patient groups . only for the communication domain , the asd patients had higher scores relative to the general outpatient group . it is of interest to mention here that this domain was also one of the two domains that differentiated parents of autistic patients from healthy controls ( bishop et al . , 2004 ) . the most probable explanation of this discrepant outcome is the fact that the dutch patients were less severely affected than the british patients . the asd patients but also the non - asd patients in the baron - cohen papers had higher total mean scores on the aq ( for asd : 35.8 and 35.6 and for non - asd : 26.2 ) than our patients ( asd : 22.5 , non - asd and general outpatients : 21.8 and 19.9 ) . by comparison , british , non - psychiatric , control groups typically have total scores of around 1617 ( baron - cohen et al . , 2001 ) . interestingly , the mean score on the recent japanese version of the aq was 29.4 in asd patients and 22.2 in non - psychiatric controls ( kurita , koyoma , & osada , 2005 ) . the japanese authors , like we , reasoned that part of the japanese patients may have been less severely affected relative to the british patients . they also argued that it is possible that autistic related behavior as assessed by the aq is more prevalent in the japanese population than in the british . in the absence of the actual diagnoses of the non - asd patients in both the british and one of the dutch samples , it remains difficult to pinpoint why scores between the british and dutch non - asd patients ( 26.2 and 21.8 / 19.9 , respectively ) differ . the absence of differences between scores of the aq - d in the present study suggests that there might be asd - like symptoms , as felt by the patients themselves , present in the non - asd patients in the atn - referred group and in the patients of the general outpatient clinic , and revealed by self - report . indeed , the individuals in the non - asd group were referred to the atn for the possible presence of an asd diagnosis , so asd - like symptoms must have been voiced by these patients even if these could not be diagnosed as such on the basis of the standardized diagnostic protocol . in sum , although there are still many open questions , for example about differences in scores cross - culturally , the present data suggest that self - report questionnaires are not adequate for differentiating less severe asd patients from other patient groups . another study is needed to investigate the merits of an alternative approach to this problem ; i.e. , a parents / caregivers questionnaire as a screening tool for adult asd . our second aim was to look into possible differences in comorbidity of axis i and axis ii dsm iv classifications in asd and non - asd groups . this because of the notion that mild asd symptoms often mix with symptoms of other disorders such as obsessive compulsive disorder or schizoid personality disorder . there is a scarcity of research on this topic . for example , ( comorbid ) diagnoses of the british patients were not reported in the paper of woodbury - smith et al . for the dutch , atn - referred group , however , we took a systematic approach to diagnosing dsm iv axis i and ii disorders . the results indicated that , except for psychotic disorder nos which was diagnosed in roughly 20 % of the non - asd group and not in the asd group , there were no significant differences in the pattern of diagnoses between the asd and non - asd patients . possibly , the difference in psychotic disorder partly accounts for the referral to the atn and for the asd - like symptoms in these patients as discussed in the above paragraph . however , the general picture indicated by our data is that clinical accounts of a relatively high prevalence and / or a specific profile of comorbid disorders in the asd group relative to the non - asd group could not be confirmed . there are important limitations to this study , among which is the small number of patients in the atn - referred group . this major drawback precludes any definite conclusions . of note is further that the asd patients in this investigation belonged to the less - severe side of the spectrum . this makes it difficult to compare results with the investigations by baron - cohen and collegues . clinical experience indicates that asd patients , compared to non - asd patients , benefit more from treatment by structuring , long - term repetitive treatment , and adaptations of the environment . this may hold even more when comorbid conditions are present . since the prevalence of patients with less severe asd is relatively high compared to the more severe asd categories , efficient and valid screening of this group and charting possiblethe present study provided a modest contribution in improving our knowledge in this direction ; clearly , much more research is needed .\noutput:\n" }, { "from": "agent", "value": "while knowledge about symptom presentation of adults with mild asd , including comorbid psychopathology , is limited , referral of adults with suspected mild pdd is increasing . we report on pilot research investigating whether patients diagnosed with mild asd ( n = 15 ) and patients who were not diagnosed with asd ( n = 21 ) differed in terms of ( a ) aq scores and ( b ) axis i and ii disorders , assessed by the scan and the ipde . additionally , aq scores were compared with those from non - asd patients referred to a general outpatient clinic ( n = 369 ) . the results showed very few differences between asd patients and non - asd patients . self - report may not differentiate mild asd patients from non - asd patients and axis i and ii disorders seem equally prevalent among these two groups ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: delayed , rather than immediate intervention is preferred as it is associated with better clinical outcomes . there is a shift to less invasive interventions such as minimally invasive surgical necrosectomy and endoscopic drainage and necrosectomy , with open laparotomy reserved as a salvage procedure . we report a case of infected walled off pancreatic necrosis that initially underwent open laparotomy and surgical necrosectomy . the patient subsequently underwent successful endoscopic ultrasound ( eus ) - guided insertion of a large diameter fully covered self - expandable metallic stent ( sems ) , followed by endoscopic necrosectomy . this case highlights the utility of eus - guided drainage as a salvage procedure even after surgical necrosectomy . he underwent laparotomy , adhesiolysis , pancreatic necrosectomy and open cholecystectomy 3 weeks later in order to control on - going sepsis . postoperatively intraabdominal bleeding occurred from gastroduodenal artery pseudoaneurysm necessitating repeat laparotomy and on table mesenteric angiogram and embolization . the postoperative course was also complicated by enterocutaneous fistula . after a protracted hospital stay , however , he was readmitted 3 days later due to increased discharge from the enterocutaneous fistula . he was septic , with a maximum temperature of 39 celsius and serum c - reactive protein was 185.7 mg / dl ( normal : 3 mg / dl ) . computed tomography ( ct ) of the abdomen revealed interval development of a loculated collection about 6 cm in maximum diameter at the site of the previous pancreatic necrosectomy in the pancreatic body and tail region [ figure 1 ] . endoscopic retrograde pancreatography demonstrated pancreatic duct leak [ figure 2 ] and pancreatic duct stenting was performed [ figure 3 ] . subsequently eus - guided transgastric drainage of the collection was performed . using a therapeutic linear echoendoscope , the walled off necrotic collection was visualized [ figure 4 ] and a 19 - guage fine needle aspiration needle ( echotip ; cook medical , winston - salem , usa ) was used to puncture the collection , followed by insertion of a 0.035 guide wire , and graded dilatation of the puncture tract using a 6 fr then 7 fr co - axial dilator ( soehendra dilator , cook endoscopy , winston - salem , usa ) . a balloon dilator ( cre balloon , boston scientific , natick , usa ) was then used to dilate the tract to 8 mm , followed by insertion of a 16 mm diameter 30 mm long fully covered sems specifically designed for drainage of walled off pancreatic fluid collections ( nagi sems ; taewoong - medical co. , seoul , south korea ) [ figure 5 ] . a gastroscope was inserted across the sems into the cavity of the collection the next day . the minimal necrotic debris present [ figure 6 ] was removed with irrigation and endoscopic suctioning . the sems was easily removed after 8 days using rat - tooth forceps during upper gastrointestinal endoscopy . the pancreatic stent was removed after 6 weeks , and the patient remained well on outpatient follow - up 3 months after sems removal . computed tomography image of infected walled off pancreatic necrosis endoscopic retrograde pancreatography demonstrated pancreatic duct leak pancreatic duct stenting was performed endoscopic ultrasound image of the infected collection endoscopic view of the deployed nagi self - expandable metallic stent endoscopic view within the necrotic cavityendoscopic ultrasound - guided endoscopic drainage of pseudocysts has been shown to be superior to non - eus - guided endoscopic drainage and equivalent to surgery in terms of efficacy but at lower costs and with lower patient morbidity . endoscopic management of pseudocysts involves transmural insertion of single or multiple double pigtail stents for internal drainage . however , this type of drainage is usually inadequate in the context of infected walled off pancreatic necrosis , and to increase the success rate of endoscopic therapy , endoscopic necrosectomy is often required . this involved dilatation of the size of the cystogastrostoma to at least 15 mm using balloon dilators to facilitate insertion of a gastroscope for endoscopic necrosectomy . it usually requires more than one treatment session and frequently there is a need to repeat dilatation of the cystogastrostoma , as the opening tends to narrow with time . in addition , the angulation of the opening may pose a challenge for repeat insertion of an endoscope into the necrotic cavity . as an alternative to a standard plastic double pigtail stent which has a maximum inner diameter of only 3.3 mm ( 10 fr ) , recent publications have explored the use of sems which are larger in diameter and more effective for drainage . these were initially adopted from enteral sems , but that gave rise to the problem of stent migrations because these sems had straight configurations . sems specially designed for drainage purpose characterized by short lengths and anti - migration features have been introduced . the axios stent ( xlumena , california , usa ) is a fully covered sems with two large flanges to hold the tissue layers together and a large diameter for effective drainage . the nagi covered sems , which was used in this case report , is another specially designed sems with a 10 , 12 or 16 mm diameter in the center and 20 mm ends which can reduce the risk of migration . the advantages of sems are a larger drainage orifice ( 16 mm in our case example ) and ease of insertion of gastroscope into the cavity of the infected necrosis for endoscopic necrosectomy . in fact , with a larger drainage orifice , it is easier for loose necrotic debris to flow out spontaneously , thus reducing the need for aggressive endoscopic debridement . long - term clinical follow - up is important in order to monitor for reaccumulation of fluid collections , especially in the context of pancreatic duct disruption . the issue of pancreatic duct disruption must be addressed , in order to prevent recurrence of fluid collections . a period of pancreatic duct stenting , first it affirms the utility of sems in the treatment of infected walled off pancreatic necrosis . second it highlights that even after surgical necrosectomy eus - guided drainage can still be considered as a complementary therapeutic procedure .\noutput:\n" }, { "from": "agent", "value": "a 39 - year - old man developed severe necrotizing gallstone pancreatitis complicated by infected pancreatic necrosis . surgical necrosectomy was performed to control the on - going sepsis . subsequently , there was a recurrence of an infected necrotic collection at the site of surgical necrosectomy , in the region of the pancreatic body and tail . he did not respond to conservative treatment with intravenous antibiotics . pancreatic duct stenting was performed to treat pancreatic duct leak , followed by endoscopic ultrasound guided insertion of a large diameter fully covered self - expandable metallic stent to drain the infected collection . there was rapid and complete clinical recovery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: stds are transmitted from someone to another through sexual activities and close touch ( vaginal , rectal and oral ) . among the most common stds are chlamydia , gonorrhea , trachoma , herpes , syphilis and hiv . american diseases prevention and control center ( 2010 ) reported prevalence of chlamydia , gonorrhea , syphilis ( 0 % with no change ) and congenital syphilis as 8 % , 4 % and 7 % , respectively . this center estimated that about 20 million new cases of such diseases occur annually in usa , among which 50 % occur in individuals aged 15 - 24 years . the highest prevalence of std was observed in age group 20 - 24 years ( 38 % ) . in iran , the incidence of std increased by 8 folds from 1999 till 2006 , and on the average , the number of the patients with std increased by 17 % in 2008 . these diseases are one of the most important causes of maternal death at their fertility age . these diseases not only lead to risky complications such as infections , abortion and early delivery , but also result in long term complications in maternal health including infertility , cervix cancer , pelvic chronic inflammatory diseases , ectopic pregnancy and inappropriate outcomes of pregnancy , and also an increase in the risk of acquired immune deficiency syndrome ( aids ) transmission . among the risk factors in transmission of std , biologicalresearch showed that vulnerable women are one of the major groups , predisposed to the risk and transmission of std . they include addicted women living with an addicted spouse , history of prisoning among the spouses , and the women with either several sexual partners or with sexual relations out of the family frames as well as the sexually hyperactive women or those with several sexual partners . vulnerable women are categorized into sexually high risk behaviors groups who can be drug abusers . they are from the most underpriviledged groups from emotional and psychological support and many of them are prone to daily violence , contempt , stigma and various physical , psychological , verbal discriminations either by their families , or those with whom they are in touch as well as the society . they are mostly from lower classes of the society , have low education and have been raped or forced to have intercourse with no condom , violence or use a shared contaminated syringe . ( 2012 ) in tehran showed that 82 % of the vulnerable women may accept their sexual partners suggestions in any circumstances . specifications such as education and low awareness , addiction , living in a deprived area , family disintegration , feeling of disability and no support are among the factors forcing them to accept all of their sexual partners requests . vulnerable women are more predisposed to high risk behaviors due to their special condition , which can lead to contamination of the diseases in the society and irreparable complications . the results of gelberg et al. s study ( 2008 ) showed that women with a sexual partner compared with multiple sex partners used fewer condoms . in studies in iran , the use of condoms is different among high - risk groups . in the study of ye ( 2007 ) , the prevalence of using condom , among vulnerable women under 25 years ( 59 % ) and older ( 52 % ) , respectively was researched . in another study , ( 2011 ) showed that among the prisoned women , the most common high risk behaviors include history of prostitution , temporary marriage , addiction through injection , consumption of alcohol , narcotic materials , cigarette and hookah . the vulnerable women from the group mostly deprived from emotional and psychological support are mostly from lower classes of the society with low education . ( 2010 ) with the aim of determination of the knowledge and attitudes towards aids in groups with high - risk injections and sexual behavior showed that the majority of respondents had a negative attitude towards aids . this problem indicates discrimination against aids patients and is due to poor awareness of aids . the study of mohme ( 2008 ) with the aim of sexually transmitted diseases in iran showed that women with high - risk behaviors due to poor health behaviors are prone to sexually transmitted diseases . lack of proper training provided for these women leads to an increased prevalence of sexually transmitted diseases in the community as a serious threat to people s health . ( 2014 ) with the aim of the history of sexually transmitted diseases among lesbians in toronto showed that women with sexual deviations ( homosexual ) are prone to sexually transmitted diseases due to lack of awareness about sanitation during sexual relations . logie emphasized the need to develop appropriate and effective strategies to prevent the disease in accordance with the needs of the women . due to their special circumstances , incurability of the diseases and lack of vaccines for some sexually transmitted diseases such as hiv / aids , the only way to deal with these diseases is prevention of infection through health education to the community , especially vulnerable women . the first step in health education is the awareness of the community for behavior change . since the purpose of behavior change is modification of maladaptive and destructive behaviors and behavior change formation . the correct application and effective interventions should be based on vulnearable women s needs , level of previous learning experiences , lifestyles and attitudes among the patients . therfore , this study aimed to determine the vulnerable women s self - care needs in domains of knowledge , attitude and practice with regard to std and their association with some personal characteristics and high risk behaviors . this is a cross - sectional - descriptive study , conducted on the women referring to vulnerable women s counseling centers , affiliated to the health and well - being organization in isfahan , iran . this study was done in 2014 and 120 subjects were selected by rationing sampling from 4 centers , 30 person randomly from each center . inclusion criteria were addicted woman , woman under treatment with methadone , prostitutes , and the homeless ones . exclusion criteria included absence in more than 2 sessions of classes , unwillingness to continue research , imprisonment , no psychotropic drugs consumption , being interested to participate in the study , age group 18 - 47 years , and education level of at least primary school . data were collected through questioning and also a researcher - made questionnaire including information on personal characteristics ( age , education , occupation and marital status ) and high risk behavior ( history of prostitution and addiction ) and self care needs questionnaire in domains of knowledge ( 8 items ) , attitude ( 8 items ) and practice ( 5 items ) concerning std diseases . the items were scores between 1 - 8 points in self - care needs ( in domains of knowledge and attitude ) . score 1 showed the first priority and score 8 showed the last priority . in section of self - care needs in the domain of practice , each item had priorities of 1 - 5 ( 1 showed the first and 5 the last priority ) . to make the content of the questionnaire , firstly the researcher attended these centers for 8 consecutive weeks to get familiar with the research environment of vulnerable women , and then review the references , texts , articles and consult with the experts in this context . content validity of the questionnaire was established by 43 experts ( social doctor , medical education , social worker , nurse and midwife ) . the questionnaire was distributed among 20 vulnerable women to confirm the reliability ; its reliability in section of self - care needs in the domain of knowledge , attitude and practice was confirmed by cranach alpha of 0.79 , 0.87 and 0.89 , respectively . researcher referred to vulnerable women s counseling centers and well - being organization supportive centers after obtaining a written consent from vice chancellery for research in isfahan university of medical sciences , ethics committee and vice chancellery for health and isfahan well - being organization . she explained the research goals , obtained the written consent from the subjects and conducted rationing sampling . the sample size was calculated as at least 96 through n = z.s / d formula ( z = confidence index 95 % ( 1.96 ) , s = estimation of need score sd in domains of health deviation & d = accuracy rate ( 0.2 s ) .120 subjects , meeting inclusion criteria , were selected to complete the questionnaires , and the questionnaires were filled out in a private place . after the data were collected , they were analyzed using spss 20 . in this phase of the study , main descriptive statistics including mean , standard deviation ( sd ) , and spearman & pearson correlation coefficient , independent t - test and anova analysis were used . prior to the study , the approval of the research ethics committee ( 393677 ) of isfahan university of medical sciences and the relevant authorities were obtained , and necessary arrangements were made . objectives of the study , test methods , confidentiality of the personal information , and voluntary participation in the study were explained to the study subjects and their written consents were obtained . prior to the study , the approval of the research ethics committee ( 393677 ) of isfahan university of medical sciences and the relevant authorities were obtained , and necessary arrangements were made . objectives of the study , test methods , confidentiality of the personal information , and voluntary participation in the study were explained to the study subjects and their written consents were obtained . most of them ( 40.5 % ) had a primary education , 85.1 % were housewives , 49.6 % were married , 60.3 % have the history of practicing prostitution and 74.4 % of them have the history of addiction ( table 1 ) . characteristics of the vulnerable women with regard to the subjects self - care needs , the results showed that most of the subjects selected familiarization with the type and the ways of std contamination with ( 57.9 % ) in domain of knowledge as their first priority . furthermore , the results showed that subjects of familiarization with types of infections and the ways of their transmission through men s genital system ( 55.4 % ) , familiarization with structure of men s genital system ( internal and external ) with 54.5 % , after rape interventions concerning venereal diseases ( 47.9 % ) , familiarization with the structure of women s genital system and function ( internal and external ) ( 45.5 % ) , sexual behavior ( healthy and risky ) ( 44.6 % ) , familiarization with diagnosis of venereal diseases ( signs , physical examination and laboratory tests ) ( 31.4 % ) and familiarization with care and treatment of venereal diseases ( 30.6 % ) were ranked as the subjects priorities and educational needs respectively in the domain of knowledge with regard to std ( table 2 ) . frequency distribution of priorities of self - care needs in the domain of knowledge toward std with regard to self - care needs , the results showed that most of the subjects selected diagnosis of venereal infection only brings about anxiety with ( 24.8 % ) as their first priority in the domain of attitude . furthermore , the results showed that the subjects in the case of men s or women s involvement in infection , it should be honestly told to the sexual partner with 24 % , use of condom is unpleasant for the women when infection exists with 15.7 % , as venereal diseases are shameful , i do not refer to health centers with 14.9 % , physical examination and sampling from women s secretions cause suffering for the women with 14.9 % , timely treatment of venereal infections brings about health for one , his / her spouse or his / her sexual partner with 12.4 % , type , number , and length of sexual relations have no effect on venereal infection transmission with 11.6 % andwere ranked as the subject priorities and educational needs respectively in the domain of attitude with regard to std ( table 3 ) . frequency distribution of priorities of self - care needs in domain of attitude toward std with regard to self - care needs , the results showed that most of the subjects selected methods of rinsing the genital area during urination and defecation , and before and after intercourse with ( 41.3 % ) as their first priority in the domain of practice . furthermore , the results showed that the subjects referring to health centers for women s periodical physical examinations with 34.7 % , genital system hygiene during intercourse , menstruation and in travel with 28.9 % , conditions of having a sexual relationship during menstruation , involvement in venereal diseases , treatment and pregnancy with 27.3 % and necessary interventions in the case of probable venereal diseases infection of the sexual partner with 26.4 % were ranked as the subject priorities and educational needs respectively in the domain of practice with regard to std ( table 4 ) . frequency distribution of priorities of self - care needs in the functional domain toward std the results of spearman correlation test showed that there was a direct correlation between the self - care needs in the domain of knowledge and education level ( p 0.001 , r = 0.4 ) . the results of analysis of variance ( anova ) showed that there was a direct correlation between the self - care needs in the domain of knowledge and marital status ( p = 0.005 ) . the results of independent t - test showed a significant difference between the self - care needs in the domain of knowledge and history of addiction ( p = 0.005 ) and prostitution ( p 0.001 ) . but , the results of pearson correlation test showed that there was no significant association between these needs and age ( p = 0.26 , r = 0.1 ) . the results of anova revealed no significant association between these needs and occupation ( p = 0.62 ) . the results of spearman correlation test showed that there was a direct correlation between the self - care needs in the domain of attitude and education level ( p 0.001 , r = 0.3 ) . the results of anova showed that there was a direct correlation between the self - care needs in the domain of attitude and marital status ( p = 0.003 ) . the results of independent t - test showed a significant difference between the self - care needs in the domain of attitude and history of addiction ( p 0.001 ) . but , the results of pearson correlation test showed that there was no significant association between these needs and age ( p = 0.23 , r = 0.11 ) . the results of anova did not show a significant association between these needs and occupation ( p = 0.27 ) . moreover , independent t - test showed no significant difference between these needs and prostitution ( p = 0.26 ) . the results of spearman correlation test showed that there was a direct correlation between the self - care needs in the domain of practice and education level ( p 0.001 , r = 0.3 ) . also , the results of anova showed that there was a direct correlation between the self - care needs in the domain of practice and marital status ( p 0.001 ( . a significant difference was observed between the self - care needs in the domain of practice and history of addiction ( p = 0.005 ) and prostitution ( p = 0.003 ) . however , the results of pearson correlation test showed that there was no significant association between these needs and age ( p = 0.63 , r = 0.07 ) . the present study highlighted the importance of detection of these women s self - care needs . the results showed that women selected familiarization with the types and the ways of std contamination as their first priority in the domain of knowledge . in a study , rahimi movaghar ( 2011 ) reported that addicted women , especially those with drug injection , lived in poor health conditions and were deprived from necessary education on aids , hepatitis transmission and these diseases prevention methods that increased their risk of std . they pointed out the lack of necessary knowledge as an obstacle for the prostitutes to use health services and have a safe sexual relationship that shows their educational needs in this domain ; this is consistent with the results of the present study . our results showed that women selected diagnosis of venereal infection only brings about anxiety as their first priority and concern about these diseases . the results showed that the most important causes to avoid pap smear test were lack of knowledge , believing in no risk of cancer , any current problem , fear of being afflicted with cancer , shyness and fear of its painful procedure . frank et al . , in their study in kenia , reported feeling of shyness and fear as one of the barriers in health care follow ups concerning genital system infection . therefore , with regard to the obtained results of the present study as well as those of the other studies , there should be a safe atmosphere in health care centers of vulnerable women to eliminate their fear of stigma of std and high risk sexual behaviors , causing their negative attitude and resulting in their fewer referrals . in addition , the results showed that the method of rinsing the genital area after urination and defecation and before and after intercourse was selected as the most important educational needs in the domain of practice . findings of studies showed that women with high risk behaviors are prone to be contaminated with std due to their poor health behavior . it has been reported that women with sexual corruption ( lesbians ) are prone to std due to lack of knowledge about health principles during their sexual relationship . they emphasized the need for designing appropriate and efficient strategies to prevent these diseases based on their needs . the results showed that among majority of women , there were moderate knowledge and attitude about sexual health , sexually transmitted diseases , aids and family planning . research showed that these women are prone to std due to their poor knowledge , attitude and practice in genital system hygiene . the present study showed a significant association between the subjects marital status , education and history of addiction , and their self - care needs in three domains of knowledge , attitude and practice . a study conducted on vulnerable and high risk women in tehran province reported that the majority of women had the history of prostitution and addiction , education level of junior high school and divorce . the results showed that the women prone to aid reported that the majority of women had married and then were divorced , and had an education level of primary school and middle school ( and were mostly poor and homeless . their findings showed that the participants experiences were in relation with environmental and social barriers in the use of condom in four concepts of poor support , poverty and economic factors , socio - cultural values and drug abuse . also , our results showed a significant association between addiction and self - care needs in domains of knowledge and practice . as shown , high risk sexual behavior is considered to be a process by which knowledge , attitudes , values , beliefs , and social norms about sexuality are acquired . the study of adolescent risk behavior has been motivated by public health concerns such as the prevention of pregnancy and sexually transmitted infections ( stds ) . in an analytical - descriptive study on individuals , aged 40 or older with coronary artery disease , it was shown that factors including sex , age , occupation , education and income level did nt have a significant relationship with self - care ability . finally , it should be noted that the subjects were more prone to contamination and transmission of std to other individuals in the society due to their special conditions . therefore , the researcher paved the way toward planning and reducing such diseases in the society through extraction of women s self - care needs concerning std . vulnerable women s limitation and fear concerning expression of their problems clearly , their inconvenient availability and inadequate participation were among the limitations of the present study . their most important needs in the domain of knowledge , attitude change and modification of practice are the ways and methods of std transmission , modification of their attitude about diagnosis of venereal infection and the health care of genital system hygiene before and after intercourse . based on the results obtained , more efficient and larger interventions to prevent std through better education of women stherefore , ongoing education of women about std and their outcomes by associated experts in this context based on their self - care needs can be an efficient step . conflict of interest : none declared .\noutput:\n" }, { "from": "agent", "value": "background : vulnerable women are prone to sexually transmitted diseases ( std ) due to their special conditions and poor knowledge about these diseases in the society . therefore , the present study aimed to determine the vulnerable women s self - care needs in knowledge , attitude and practice concerning std.methods : this is a cross - sectional - descriptive study conducted in 2014 . the data collection was carried out using a self - administered structured questionnaire . 120 vulnerable women referring to centers affiliated to health and well - being center in isfahan participated in this study . they were selected through proportional rationing sampling and filled out a researcher developed questionnaire containing information on personal characteristics , self - care knowledge , attitude , and practice needs toward the std . the data were analyzed using statistical methods including spearman & pearson correlation co - efficient , independent t - test and anova . all analyses were carried out using spss , 20 . results : based on the results , most of the subjects mentioned that their priorities of self - care needs in domains of knowledge , attitude and practice were familiarization with the types and contamination ways of sexually transmitted diseases ( 57.9 % ) ; diagnosis of std only makes us anxious ( 24.8 ) , and the method of washing the genital area before and after intercourse 41.3 % ) , respectively . there was a significant association among marital status , education , history of addiction , and self - care needs in domains of knowledge , attitude and practice ( p < 0.05 ) . conclusion : results showed that vulnerable women not only knew their need about std , but also paid attention to their attitude and practice needs toward std . therefore , educational programs should be designed and administrated by the experts , based on vulnerable women s self - care needs concerning their knowledge , attitude and practice to prevent and control std in vulnerable individuals ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: i d was known as mental retardation earlier , and we have used these terms interchangeably in manuscript . the prevalence of epilepsy increases with the severity of i d , which approaches 7 % in people with mild to moderate i d , 67 % in people with severe i d , and 50 - 82 % in people with profound i d . dodson reported that children with epilepsy have an intelligence quotient ( iq ) score that is 10 points lower than their healthy , age - matched peers . epilepsy can affect a person 's education , career , general health , mental health , and marriage , among other things . for example , epilepsy affects their health - related quality of life outcomes and their ability to function normally . children with both epilepsy and intellectual disabilities experience psychiatric disorders in 50 - 59 % of cases . epilepsy does not only affect the individual but it also negatively affects an individual 's family members . in a review article , bowley and kerr reported that having i d along with epilepsy affects a person 's physical morbidity , which in turn leads to increased mortality and a greater burden on their family . the risk of death is five times higher in children with epilepsy compared with children without epilepsy . this risk is even higher in children with i d that also have neurological disorders . because epilepsy is a known neurological disorder , it follows that children who have low iq scores and epilepsy have an even higher death risk . given these correlations , a strong relationship seems to exist between epilepsy and low iq , but very few studies have investigated the nature of this relationship . if the relationship was linear within the i d population , one would potentially be able to predict how a person 's iq score relates to their likelihood of having or developing epilepsy . this organization is located in one of the poorest districts of india , in barwani . a total of 53 % of the population in this district lives below the poverty line . the district has both a tribal population ( 68 % ) and a nontribal population ( 32 % ) . the tribal population is more disadvantaged in terms of health , education , and employment compared with the nontribal population . agt implemented a community - based rehabilitation project in 63 villages of the barwani block with financial help from action aid india . a total of 63 villages were surveyed door - to - door , and a total of 262 children were identified as having intellectual disabilities . consent to test for epilepsy and receive comprehensive rehabilitation services as part of the cbr project was obtained from the children 's parents or grandparents . initially , two tests a developmental screening test ( dst ) and an indian adaptation of the vineland social maturity scale ( vsms ) were used to determine each child 's iq score . the average of development quotient obtained from dst and social quotient from vsms makes iq . on place of other standardized test malins intelligence scale for indian children , an adaptation of wechsler intelligence scale , dst and vsmswere preferred because these tests can be administered with less time even in nonclinical settings on nonschool going children . children were also administered other standardized intelligence tests as needed . all children diagnosed with i dwere referred to psychiatrists and physicians to assess and treat , respectively , any medical condition , including epilepsy . while taking case history , professional asked for any symptoms of epilepsy , if there was any symptom than that case was referred for medical evaluation for epilepsy . then , the child underwent an electroencephalogram ( eeg ) administered by the psychiatrist or a general physician . eeg was administered for 20 - 30 min to record brain activities in awaken condition . the eeg results were used to support a positive diagnosis but were not used to rule out epilepsy . clinicians heavily relied on the clinical history that was obtained from parents or any other eye witness family member . if available , reports from previous consultations were reviewed and taken into account before making each diagnosis . statistical software for social science ( spss version 21 ) was used for statistical analysis . spearman 's correlation used to examine association of epilepsy with iqs and age of the study participants . x statistics is used for gender , severity of i d , socioeconomic status , cerebral palsy , down syndrome , behavior problems , coexisting disorders , and family history of mental illness , mental retardation , and epilepsy . this organization is located in one of the poorest districts of india , in barwani . a total of 53 % of the population in this district lives below the poverty line . the district has both a tribal population ( 68 % ) and a nontribal population ( 32 % ) . the tribal population is more disadvantaged in terms of health , education , and employment compared with the nontribal population . agt implemented a community - based rehabilitation project in 63 villages of the barwani block with financial help from action aid india . a total of 63 villages were surveyed door - to - door , and a total of 262 children were identified as having intellectual disabilities . consent to test for epilepsy and receive comprehensive rehabilitation services as part of the cbr project was obtained from the children 's parents or grandparents . mental retardation professionals ( including the author ) assessed children using standard diagnostic tests . initially , two tests a developmental screening test ( dst ) and an indian adaptation of the vineland social maturity scale ( vsms ) were used to determine each child 's iq score . the average of development quotient obtained from dst and social quotient from vsms makes iq . on place of other standardized test malins intelligence scale for indian children , an adaptation of wechsler intelligence scale , dst and vsmswere preferred because these tests can be administered with less time even in nonclinical settings on nonschool going children . all children diagnosed with i d were referred to psychiatrists and physicians to assess and treat , respectively , any medical condition , including epilepsy . while taking case history , professional asked for any symptoms of epilepsy , if there was any symptom than that case was referred for medical evaluation for epilepsy . then , the child underwent an electroencephalogram ( eeg ) administered by the psychiatrist or a general physician . eeg was administered for 20 - 30 min to record brain activities in awaken condition . the eeg results were used to support a positive diagnosis but were not used to rule out epilepsy . clinicians heavily relied on the clinical history that was obtained from parents or any other eye witness family member . if available , reports from previous consultations were reviewed and taken into account before making each diagnosis . statistical software for social science ( spss version 21 ) was used for statistical analysis . spearman 's correlation used to examine association of epilepsy with iqs and age of the study participants . x statistics is used for gender , severity of i d , socioeconomic status , cerebral palsy , down syndrome , behavior problems , coexisting disorders , and family history of mental illness , mental retardation , and epilepsy . we found epilepsy highly associated with male gender than female ( x 7.399 , p = 0.005 ) and not equally distributed with severity of i d ( x 57.21 , p = 0.001 ) . epilepsy found strongly associated with the children those have family history of mental illness ( x 7.389 , p = 0.007 ) , mental retardation ( x 9.42 , p = 0.003 ) , and epilepsy ( x 53.2 , p = 0.001 ) . except psychiatric disorders and down 's syndrome , epilepsy is found more among i d children those had cerebral palsy ( x 33.97 , p = 0.001 ) , and behavior disorders ( x 5.709 , p = 0.01 ) . the occurrence of epilepsy is not different in population groups ( x 0.742 , p = 0.427 ) , and among socioeconomic groups ( x 2.608 , p = 0.456 ) [ table 1 ] . the association of epilepsy with different variables : gender , socioeconomic status , population type , severity of intellectual disability , family history of mental illness , mental retardation , epilepsy , and coexisting disorder . values are given for x statistics and their corresponding p values table 2 it expresses spearman 's rho statistics of epilepsy with the ordinal variables age and intelligence quotient . epilepsy had inverse correlation with age ( p = 0.683 ) , and intelligence quotient ( p = 0.605 ) among children with intellectual disability . graphs demonstrate that prevalence of epilepsy decreases with the age [ figure 1 ] and intelligence quotient [ figure 2 ] of intellectual disability children . spearman correlation rho ( p ) of prevalence of epilepsy with age and intelligence quotient in children with intellectual disability graph showing prevalence of epilepsy with the age of intellectual disability children graph showing prevalence of epilepsy with the intelligence quotient of intellectual disability childrenspearman 's p demonstrates that lower iq scores are correlated with epilepsy in children with i d . a case - control study conducted in north india demonstrated that children with generalized epilepsy have lower iq scores than their controls with not epilepsy . a linear decline in iqepilepsy also found more associated with male gender and that was consistent with our study . children with i d those had family history of mental illness , mental retardation and epilepsy shown higher chances of having epilepsy . it is already known that people with i d have higher rates of epilepsy . further inferring from findings , we can say that people with i d are on higher risk than non - id and this risk of epilepsy goes further higher among i d as their iq score lowers . thus , professionals should use extra caution to detect epilepsy as early as person with i d come in their contact so that person can receive early diagnosis and treatment in order to protect from diminishing their cognitive abilities further . i d person those do not have epilepsy also need regular attention by professionals in order to check for any symptom of it , so that immediate care can be offered . this is a cross - sectional study that demonstrates the relationship between iq scores , age , and the occurrence of epilepsy in our study group . however , because of its limited design , the study could not be used to determine a causative relationship . in addition , epilepsy has several categories , which were not differentiated in this study . this is a cross - sectional study that demonstrates the relationship between iq scores , age , and the occurrence of epilepsy in our study group . however , because of its limited design , the study could not be used to determine a causative relationship . in addition , epilepsy has several categories , which were not differentiated in this study . despite the limitations , this study adds knowledge to the existing scientific literature by describing that a person 's likelihood of suffering from epilepsy increases as iq scores drop in children with i d . thus , we can say that children with low iq have a higher chance of displaying epilepsy and , therefore , should be routinely tested for the condition .\noutput:\n" }, { "from": "agent", "value": "background : epilepsy is a disorder that is commonly found in people with intellectual disability ( i d ) . the prevalence of epilepsy increases with the severity of i d . the objective of this study was to determine if there is an association between intelligence quotient ( iq ) and epilepsy in children with id.materials and methods : a total of 262 children , aged 3 - 18 years , with i d were identified as part of a community - based rehabilitation project . these children were examined for epilepsy and diagnosed by a psychiatrist and physicians based on results of electroencephalogram tests . a spearman 's correlation ( ) was used to determine if there was an association between iq scores and the occurrence of epilepsy . x2 statistics used to examine the relationship of epilepsy with gender , socioeconomic status , population type , severity of i d , family history of mental illness , mental retardation , epilepsy , and coexisting disorder.results : spearman 's rho 0.605 demonstrates inverse association of iq with epilepsy . x2 demonstrates statistically significant association ( p < 0.05 ) with gender , severity of i d , cerebral palsy , behavior problems , and family history of mental illness , mental retardation , and epilepsy.conclusions : lower iq score in children with i d has association with occurrence of epilepsy . epilepsy is also found highly associated with male gender and lower age ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ectomesenchymal chondromyxoid tumor ( ecmt ) is a benign tumor , a rare entity which has recently been added to the group of lesions affecting the tongue . the uniqueness of this lesion lies in the fact that it mostly affects the anterior dorsum of the tongue usually occurring as a submucosal swelling on the anterior third of the dorsum of the tongue . ecmt was first described by smith et al . following review of all myxoid , chondromyxoid , and myoepithelialtongue lesions from the files of the armed forces institute of pathology in 24 - year period and only 40 cases have been reported until date . the reason for the limited reported cases of ecmt is probably because it is being misinterpreted as other similar chondromyxoid lesions such as focal mucinosis , ossifying fibromyxoid tumor , pleomorphic adenoma , myxoma , myoepithelioma etc . clinically , ecmt presents as a slow growing asymptomatic swelling usually seen on the anterior dorsum of the tongue , however , 2 cases presenting on the posterior tongue have also been documented . in addition , a case of ecmt on the hard palate has been reported but due to lack of appropriate supporting documentation , its diagnosis has been the subject of controversy . the size of the lesion usually varies from 0.3 cm to 2.0 cm and the age ranges from 9 years to 78 years , with a mean age of 39 years . the diagnosis of ecmt is based on the clinical as well as histopathological and immunohistochemical confirmations . a 7 - year - old female came to the cancer research institute , ahmedabad , gujarat with a painless swelling on the anterior dorsum of the tongue . her medical history was non relevant . on oral examination , a solitary well - defined nodule , since birth and currently measuring 5.0 cm 3.0 cm 3.0 cm was located on the left dorsum of the anterior two - third of the tongue , involving the tip of the tongue . on palpation , the nodule was sessile , firm in consistency , mobile and nontender . provisional diagnosis of granular cell tumor / fibroma of tongue was given [ figure 1 ] . the sessile painless mass , pale , pink in color following the clinical examination , fine needle aspiration cytology was done which was suggestive of a granular cell tumor . subsequently , surgical excision was performed , following which it was submitted for further histopathological examination . on gross examination , the specimen was smooth surfaced , firm in consistency measuring 5.0 cm 3.0 cm 3.0 cm . the lesional cells were arranged in the form of cords and strands in a net - like pattern within a myxoid background . thin bands of collagen fibers separated the lesional tissue giving it a lobular appearance [ figure 2 ] . for the conclusion , immunohistochemistry was performed , and the tumor cells were found to be positive for vimentin confirming the mesenchymal origin of the lesional cells . therefore , a final diagnosis of ecmt was given on the basis of histopathological and immunohistochemical evaluation with the correlavancy to the clinical history of the patient [ figure 3 ] . ectomesenchymal chondromyxoid tumor of the tongue is a rare benign neoplasm that was initially described by smith et al . clinically , ecmt presents as a slow growing , painless , firm , well - circumscribed submucosal swelling and size of the lesion usually varies from 0.3 cm to 2.0 cm . its occurence has been noted in a wide range from 9 years to 78 years ; however , most cases have been reported in adults with no gender predilection . histopathologically , the lesion usually presented as a well circumscribed and unencapsulated lesion showing a lobular growth pattern and the neoplastic cells were separated from the overlying epithelium by a thin layer of loosely compressed connective tissue . the cells were arranged in the form of cords and strands in a net - like pattern against a chondroid / chondromyxoid background with round to oval nuclei , showing vesiculation to hyperchromasia . microscopic features of this case paralleled to the finding of other reported cases of ecmts . the presence of myxoid areas always raise the suspicion of the other myxoid lesions such as myoepithelioma , oral focal mucinosis , soft tissue myxoma , glial choriostoma , myxolipoma and nerve sheath myxoma , which need to be considered in the differential diagnosis . the uniqueness of our case lies in the fact that it is presented in a 7 year old girl which is a rare finding as most of the cases of ecmt are reported until date in adults , with only 5/40 cases of ecmt reported in first two decades of life and secondarily about the size of the lesion , as the usual size is found to be 0.3 - 2.0 cm , while in our patient the size of the lesion was 5.0 cm , which is furthermore rare . our patient was also treated by surgical excision and is on follow - up for the prognosis of the surgically treated site [ figure 4 ] . a recent postoperative follow - upectomesenchymal chondromyxoid tumor is an uncommon intraoral asymptomatic mesenchymal soft tissue neoplasm located on the dorsum of the tongue . this case adds to the limited literature on ecmt and emphasizes the need for this rarely occurring tumor to be considered in the differential diagnosis of nodular lesions affecting the tongue . this emphasizes the importance of recognizing this entity when presented with a similar clinical scenario . immunohistochemical expression of vimentin and smooth muscle actin is very helpful in confirming diagnosis , suggesting a probable mesenchymal and neural origin of this rare entity .\noutput:\n" }, { "from": "agent", "value": "ectomesenchymal chondromyxoid tumor ( ecmt ) is a rare benign neoplasm of uncertain histogenesis , which exclusively involves the oral cavity , particularly the tongue . clinically , it presents as slow growing , painless , firm , submucosal swelling exclusively occurring on the anterior dorsum of the tongue . histopathologically , it comprised well circumscribed , unencapsulated lobular proliferation of fusiform and polygonal cells , with varying degree of cellularity , with neoplastic cells often seen in a myxoid , chondroid or hyalinized background . until date , only 40 cases have been reported in the literature . most documented lesions involve anterior tongue , however 2 cases in posterior tongue and one palatal tumor has been described . here , we present a rare case diagnosed clinically and histopathologically as ( ecmt ) in a 7 - year - old girl with the size of the lesion 5.0 cm making this case even rarer and throwing some light on this distinct entity ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: diabetic macrovascular complications are the leading cause of death and disability causing 7080 % of deaths in diabetic patients . at present , there are many theories about the pathogenesis of diabetic vascular diseases , including insulin resistance , oxidative stress , lipid metabolism disorder , and inflammation theory . according to these theories , many medications have been developed to treat diabetic vascular diseases . however , these medications are not good enough with the limited effect or adverse effect ; therefore we used the traditional chinese medicine to treat this disease . we have found that ddd combined with oral hypoglycemic agents significantly increases the diastolic rate of brachial artery blood flow as well as serum no expression and decreases plasma et - 1 levels , therefore repairing endothelial cell injury and delaying the progress of vascular disease in diabetic patients . in another study , we confirmed that early intervention with ddd can significantly increase the serum levels of il - 4 and il - 3 and reduce the expression of tnf - , mcp - 1 , cd68 , and e - selectin in the aorta , thereby inhibiting the inflammatory injury and delaying the development of diabetic vascular disease in type 2 diabetic rats . this study investigated the effect ddd on the permeability of vascular endothelial cells when used early and discusses its roles in improving endothelial cell damage and its promise in the prevention of diabetic macrovascular complications . streptozotocin ( stz ) was obtained from sigma ( usa ) ; glucometer and blood glucose test strips were obtained from accu - chek performa ; real time pcr kits were obtained from beijing cwbio co. ltd . raw ddd herbs including 6 g rhubarb ,10 g leech , 10 g peach seed , and 10 g gadflies were purchased from the pharmacy department of the first teaching hospital of tianjin university of traditional chinese medicine . according to the traditional preparation of a water decoction , all the herbs were boiled in water for 1 hour , 3 times ; the filtrates were collected and concentrated to 1 g / ml ( rude herbs ) under reduced pressure and then stored at 4c .150 healthy sprague dawley ( sd ) male rats aged one month ( body weight 195.99 g 15.10 g ) were provided by the tianjin experimental animal center ( qualification certificate number scxk army 2014 - 0001 ) ; after one week of adaptive feeding , 150 sd male rats were randomly divided into control ( 20 rats ) and diabetic ( 130 rats ) groups . the rats in the control group were feed with a normal chaw diet , whereas rats in the diabetic groups were feed with a high - fat diet . after 12 weeks , blood from the angular vein was taken , and fasting blood glucose ( fbg ) and serum insulin ( ins ) were determined . the insulin resistance index ( isi ) was calculated by using the following steady state model evaluation method ; isi = ln [ ( fbg ) ( fins ) ] . after the appearance of insulin resistance , all rats in the diabetic groups were injected intravenously with 30 mg / kg streptozotocin ( stz ) to induce diabetes , whereas rats in the normal control group were injected with the same dose of citric acid buffer . diabetes was determined to be successfully established if the blood glucose level was higher than 16.7 mmol / l 3 days after stz injection . diabetes was induced successfully in 108 rats ( 80 % ) . except for rats in the ddd early - phase intervening group , all other diabetic rats were randomly subdivided into diabetic nonintervening , simvastatin , ddd mid - phase intervening , or ddd late - phase intervening groups . ddd was initiated 4 weeks before diabetes was induced in the ddd early - phase intervening group . ddd was initiated upon induction of diabetes in rats in the ddd mid - phase intervening group . ddd was initiated 4 weeks after diabetes was induced in the ddd late - phase intervening group . the dosage of ddd was 2.3 g / ( kgd ) based on the equivalent dose for humans . rats in the simvastatin group were administered 0.16 g / ( kgd ) simvastatin calculated according to 6.3 times of the human clinical dose ; rats in the control group and the diabetic nonintervening group were given the same amount of sterile water . the expression level of myosin light chain kinase ( mlck ) and cyclic adenosine monophosphate ( camp - 1 ) of the thoracic aorta was detected using western blot analysis . rat aortic tissue was collected , centrifuged , washed , and cleaned with a cleaning solution . the proteins were separated by denaturation gel electrophoresis and then incubated with primary antibody ( mlck antibody dilution was 1 : 300 and loading control dilution was 1 : 1000 ; camp - 1 antibody dilution was 1 : 500 and loading control dilution was 1 : 800 ) and horseradish peroxidase labeled second antibody ( dilution was 1 : 3000 ) . - actin expression was evaluated to confirm equal amounts of loading control using a mouse monoclonal anti- - actin antibody . real time pcr was used to detect mrna levels of protein kinase c ( pkc ) and protein kinase a ( pka ) . the sequence of pcr primers is listed as follows : pkc : the length of the amplified fragment was 133 bp , upstream 5tggcaaggtcatgctctcag3 , downstream 5ggaagcaggaatggagctga3 ; pka : the length of the amplified fragment was 80 bp , upstream 5cgtacttggaccttgtgtg3 , downstream 5cagccatctcgtagatga3 . the pcr products were separated by agarose gel electrophoresis and then quantified by gel image analysis . using an abi 7500 fluorescence quantitative pcr instrument , we analyzed the relative quantitative data using the 2 method . the expression levels of mlck and pkc of the thoracic aorta were detected by the immunohistochemical method . the aortic endothelium of rats in experimental group and control group was fixed , encased , sliced , dewaxed , and so forth . then the images of the positive and negative structure were collected and read under the microscope . the ultrastructure of the endothelial cells and endothelial intercellular connection were observed under the electron microscope . all data are expressed as the mean and the standard deviation ( mean sd ) . the difference between the 7 groups was analyzed by the single factor analysis of variance ( anova one - way ) ; difference between two groups was analyzed by the lsd method if the homogeneity of variance was satisfied , and dunnett 's t3 method was used if the homogeneity of variance was not satisfied ; the test level was = 0.05 . as shown in figure 2 , at 12 weeks , compared with the control group , rats in the diabetic groups had significantly higher levels of blood glucose ( p 0.05 ) but lower levels of the insulin sensitivity index ( p 0.05 ) . the results of blood glucose are shown in figure 3 and no significant differences were found in blood glucose levels between diabetic groups ( p 0.05 ) . as shown in figures 1 and 4 , compared with the control group , the expression of camp - 1 and pka was decreased in all diabetic groups , whereas the expression of mlck and pkc was increased ( p 0.05 ) . compared with the t2 dm nonintervening group , the expression of camp - 1 and pka was increased , but the expressions of mlck and pkc were decreased in the early - and mid - phase ddd - intervening groups ( p 0.01 ) ; the expressions of pka , mlck , pkc , and camp - 1 in the early - phase ddd - intervening group were better than those of the late - phase ddd - intervening group ( p 0.05 ) . as shown in figures 5 and 6 , compared with the t2 dm nonintervening group , the expression of mlck and pkc was decreased in ddd - intervening groups ( p 0.01 ) . compared with the late - phase ddd - intervening group , the expression of mlck and pkc was decreased in early - phase ddd - intervening group ( p 0.05 ) . the results of electron microscopy for the control group show a smooth cord - like connection between endothelial cells . the connection in the early - phase ddd - intervening group and the simvastatin group was continuous and compact , significantly better than those in the other diabetic groups . in the diabetic group , the density of the cell membrane on both sides was decreased , the cell profile was not clear , and the nuclei were loose to different degrees . macrovascular disease is one of the main complications of type 2 diabetes , and atherosclerosis is the main pathological change . our previous study has found that ddd is efficient in the treatment of diabetic patients . this study investigated the effect of early intervention with ddd on the expression of mlck , camp - 1 , pkc , and pka and gene expression in vascular endothelial cells of aortas of diabetic rats , to explore the roles of ddd on the permeability of vascular endothelial cells and its relationship with the mlck signaling pathway . the main vascular endothelial cell permeability modulation is contraction caused by the interaction of actin and myosin . when the contraction is greater than the adhesion , vascular endothelial cell permeability is increased . mlck modulates endothelial cell permeability mainly by phosphorylating the myosin light chain ( mlc ) , which then activates the myosin heavy chain atp enzyme . activating the atp enzyme produces the energy to enhance the interaction of myosin and actin , causing cell contraction and cell junction changes , which then leads to increased permeability . recent studies have indicated that protein kinase c ( pkc ) is involved in the regulation of mlck phosphorylation . some studies suggest that pkc phosphorylation may change mlck activity and eventually cause mlc phosphorylation . in addition , pkc plays a role in increasing the level of cgmp and no by the phosphorylation of s1179 in enos . the increased level of cgmp increases the level of cyclic adenosine monophosphate ( camp ) ; however , almost all the effects of camp - 1 in the cell are accomplished by activating pka , which then phosphorylates its substrate protein . it has been shown that increasing the concentration of intracellular camp - 1 can upregulate the activity of pka . the pka phosphorylation site has been confirmed in mlck of endothelial cells ; therefore , camp - 1 can inhibit the activity of mlck by the activation of pka and regulate vascular endothelial permeability . studies have shown that the phosphorylation of myosin light chain induces the concentric contraction of vascular smooth muscle cells , resulting in the increased thickness of the intima of vascular smooth muscle cells and the formation of a large number of foam cells , leading to the occurrence of atherosclerosis . therefore , mlck in arterial endothelial cells and smooth muscle cells plays a key role in the occurrence and development of diabetic macrovascular disease . statins in addition to their lipid - lowering effect can also improve inflammation and oxidative stress , promote angiogenesis formation , improve the bioavailability of the nitric oxide ( no ) , repair the damaged vascular endothelial cells , and stabilize and reverse atherosclerotic plaque . simvastatin is used as the positive control for diabetic vascular disease in this research because of its pleiotropic effects . ddd originates from treatise on cold pathogenic diseases , which is mainly composed of leech , gadfly , and peach seed , and can improve blood circulation and remove obstructions in collaterals , as well as eliminate blood stasis by catharsis . emodin has the effect of anticoagulation and promotion of blood circulation , whereas rheochrysin inhibits platelet aggregation ; both emodin and rheochrysin are in rhubarb . the alcohol extract of peach seed has an anticlotting effect , and its glycerol trioleate has anticoagulant activity . in chinese medicine , diabetic macrovascular disease is classified asthe basic pathogenesis of this disease includes yin deficiency and hot continually thirsty and wasting , disharmony of qi and blood , fluid depletion , and blood stasis , accompanied by blood heat and blood stasis . at this stageas the inner canon of yellow emperor ( one of the four classics of tcm ) said , when a person has beening [ sic ] feel thirsty then began to dig a well or the war has beening [ sic ] begun that the soldiers began to making weapons . it means that something had happened but you have not prepared for it , just like the disease is serious to find a doctor . it is too late to treat diseases such as this , so traditional chinese medicine pays more attention to the prevention of diseases and emphasizes boosting the body 's defense capabilities in the early stages of disease . here , we comply with the principles of the prevention theory and use ddd in the early phase of diabetic macrovascular diseases to explore its improvement of the damaged tissues as well as its protective roles in exempting these tissues from further damage caused by many pathogenic factors . we used high - fat diet followed by the small dose of stz to establish type 2 diabetic animal model in this experiment . the high - fat diet followed by small dose of stz induced the obvious pathological changes in the blood vessel endothelium of diabetic rats . the finding suggested that the traditional chinese medicine ddd intervention , particularly early intervention of ddd , significantly ameliorated the injury of vascular endothelium , regulated intercellular junctions of endothelial cells , changed the permeability of vascular endothelial cells , and eventually prevented vascular atherosclerosis . further mechanisms of investigation indicated that the effect of ddd intervention is related to upregulating the expression of camp - 1 and pka and downregulating the expression level of mlck and pkc . the regulation of cell permeability of vascular endothelial cells is a complex process . in this study , we found a significant improvement of vascular endothelial cell permeability after early intervention with ddd . however , our study has some limitations ; we did not quantify the permeability of endothelial cell ; moreover , further studies need to address the multiple roles and mechanism of ddd in the prevention and treatment of diabetic macrovascular disease .\noutput:\n" }, { "from": "agent", "value": "in the study , type 2 diabetic rat model was established using streptozotocin ( stz ) combined with a high - fat diet , and the rats were divided into control and diabetic groups . diabetic groups were further divided into nonintervening , simvastatin , didang decoction ( ddd ) early - phase intervening , ddd mid - phase intervening , and ddd late - phase intervening groups . the expression level of mlck was detected using western blot analysis , and the levels of cyclic adenosine monophosphate ( camp ) , protein kinase c ( pkc ) , and protein kinase a ( pka ) were examined using real time pcr . under the electron microscope , the cells in the early - ddd - intervention group and the simvastatin group were significantly more continuous and compact than those in the diabetic group . compared with the control group , the expression of camp - 1 and pka was decreased in all diabetic groups , whereas the expression of mlck and pkc was increased in early - and mid - phase ddd - intervening groups ( p < 0.05 ) ; compared with the late - phase ddd - intervening group , the expression of camp - 1 and pka was higher , but the level of mlck and pkc was lower in early - phase ddd - intervening group ( p < 0.05 ) . in conclusion , the early use of ddd improves the permeability of vascular endothelial cells by regulating the mlck signaling pathway ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cryoglobulins are special serum immunoglobulin 's that usually precipitate at a temperature between 0c and 4c and dissolve when re - warmed to 37c . this in vitro phenomenon can be observed in a wide spectrum of infectious diseases , autoimmune disorders and with hematological malignancies . both type i and type ii are associated with lymphoproliferative disorders . during the winters in the north india temperaturesuch cold weather is likely to produce cold - induced symptoms in patients with cryoglobulinemia . as very low temperature is unusual in indian subcontinent , cases of cryoglobulinemia are usually remains symptomless and hence undetected . we encountered an interesting case of cryoglobulinemia in a 68 - year - old - male who presented with cryoglobulinemic manifestations for the last 18 months . a 68 - year - old male patient who was chronic alcoholic presented with complain of headache on and off for the last 18 months before presenting to us in september 2011 . , there was hepatomegaly ( 3 cm below costal margin ) and splenomegaly ( 2 cm below costal margin ) however no palpable lymph nodes are noted . in the past historyhowever , he was not able to get any report since his sample clotted soon after sampling . although , phlebotomist had taken the venous blood sample but it clots itself even in the presence of anticoagulants . following this , patient was called on the next day and sampling was done by maintaining the whole set up temperature at 37c and above . serological investigations for hepatitis b virus , hepatitis c virus , and human immunodeficiency virus infection were performed to exclude any viral infection and no associated infective etiology was found . serum sample for detection of antibodies ( rheumatoid factor , antinuclear antibodies , smooth muscle antibody , anti - mitochondrial antibody ) for any underlying autoimmune disorder was sent for however all the tests came negative . the hemogram showed bicytopenia with hemoglobin of 3.9 / dl and total leucocyte count of 2.910 / l . the marrow was cellular and clotted ; however showed the presence of homogenous pale pink background due to the presence of cryoglobulins [ figure 1b ] . differential nucleated cell count showed extensive increase in lymphocytes ( 73 % ) along with plasma cells ( 8 % ) [ figure 1c ] . the sinusoids were dilated and are filled with pale eosinophillic material ( cryoglobulins ) [ figure 1d ] . immunophenotying was performed on bone marrow sample and that showed expression of cd19 , cd79b along with heterogeneous expression of cd23 [ figure 2 ] . serum protein electrophoresis showed the presence of sharp m band in the gamma region , hence proving monoclonality of disease . on the basis of peripheral blood , bone marrow and flowcytometry findings a diagnosis of lymphoplasmacytic lymphoma was made . the patient was started on prednisolone 1 mg / kg / day and was asked to report weekly . the patient is now in follow - up and show improvement in their symptoms and easy sampling of blood . peripheral blood shows rouleaux formation ( mgg - giemsa , 400 ) ( a ) . bone marrow aspirate shows presence of pink homogenous material due to cryoglobulins ( mgg - giemsa , 200 ) ( b ) . high power view demonstrates increase in numbers of lymphocytes and plasma cells ( mgg - giemsa , 1000 ) ( c ) . dilated sinusoids filled with pale eosinophillic material are seen on trephine biopsy section ( h and e , 100 ) ( d ) panel of scatter plots showing the multicolor immunophenotyping of bone marrow aspirate sample by flow cytometry . the gating of cells in each tube has been done on side scatter - a ( ssc - a ) versus forward scatter - a ( fsc - a ) ( a ) . the cell is lymphoid region p1 were subsequently gated in ssc - a versus cd19 plot with the gated p2 population showing surface cd19 expression ( b ) . the gated cells show heterogeneous expression of cd23 along with homogeneous expression of cd79b ( c and d ) cryoglobulins are proteins that can precipitate at low temperatures ( 4c ) and dissolve when re - warmed to 37c . the cryoglobulin can be defined on the basis of its composition : polyclonal or monoclonal immunoglobulins ; or the presence of rheumatoid activity ( ra ) . three types of cryoglobulinemia have been identified namely : type i includes monoclonal cryoglobulins ( igm , igg and iga ) without any ra ; type ii includes a monoclonal component ( usually igm with ra ) and a polyclonal component ( usually igm / igg ) ; type iii have several polyclonal components and a component with ra ( usually igg / igm ) . type ii and type iii are classically referred to as mixed cryoglobulinemia . in general , cryoglobulinemia regardless of their type are associated with skin manifestations , but may also cause rheumatologic symptoms that involve the kidneys , the peripheral nerves or central nervous system , the lungs , the myocardium and the gastrointestinal tract . interestingtype i cryoglobulinemia is associated with low grade lymphoproliferative disorders such as multiple myeloma , waldenstrom macroglobulinemia , chronic lymphatic leukemia and account for 10 - 15 % of all cases of cryoglobulinemia . type ii cryoglobulinemia is associated not only with lymphoproliferative diseases but also with autoimmune disorders and infective etiologies especially hepatitis . this case is also having lymphoplasmacytic lymphoma and hence can be categorized in to type i cryoglobulinemia . in tropical and subtropical countries like india where the winter is either nonexistent or very brief , most of the patient with cryoglobulinemia did not show any symptoms and remain undetected . in this case , difficulty in processing of sample raises the suspicion of disease which was confirmed by bone marrow examination and by exclusion of other autoimmune etiology along with infective pathology . the diagnosis of lymphoplasmacytic lymphoma on bone marrow aspiration solves the underlying pathogenesis of the cryoglobulinemia . we presented a case of cryoglobulinemia which is very rare in indian subcontinent and was suspected due to the problem in sampling and processing of the blood .\noutput:\n" }, { "from": "agent", "value": "cryoglobulinemias rarely been reported from india even though associated conditions such as hepatitis c infection , rheumatoid arthritis and plasma cell dyscrasias , etc . , are common occurrences . in many regions of the country , temperatures in winter can be conducive to the precipitation of cryoglobulins , yet epidemiology of the disease suggests that it is a common condition in the west . we encountered a 68 - year - old - male patient who presented with a history of headache off and on along with hepatosplenomegaly . the rare occurrence of cryoglobulinemia in our setting can delay the diagnosis , as happened in our case , since the index of suspicion of clinicians and laboratory personnel is low . we are reporting this case because of the rarity and protean clinical manifestations of cryoglobulinemia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cell lines and culture : a chinese hamster ovary cell line ( cho - k1 ) ( riken cell bank , tsukuba , japan ) and ku80 - deficient cho - k1 mutant cell lines ( xrs - 6 ) were cultured as described in a previous study . the xrs - 6 cell line stably expressing chimeric proteins of egfp and the human ku80 ( egfp - ku80 ) or egfp alone was described previously . the xrs - 6 cell line stably expressing egfp - ku80 ( a453h / v454h ) , egfp - ku80 ( k565a / k566a / k568a ) or egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) was described previously . x - irradiation : cells were exposed to x - rays at room temperature , as described previously . x - rays were generated at 200 kvp / 20 ma and filtered through 0.5 mm cu and al filters . western blot analysis : western blot analysis was performed as described previously . the following antibodies were used : a rabbit anti - gfp polyclonal antibody ( fl ) ( santa cruz biotechnology , santa cruz , ca , u.s.a . ) , a mouse anti - ku70 monoclonal antibody ( n3h10 ) ( neomarkers , fremont , ca , u.s.a . ) , a goat anti - ku80 polyclonal antibody ( m - 20 ) ( santa cruz biotechnology ) , a goat anti - xrcc4 polyclonal antibody ( c - 20 ) ( santa cruz biotechnology ) and a mouse anti- - actin monoclonal antibody ( sigma , st . the binding to corresponding proteins was visualized using an ecl western blotting detection system ( ge healthcare bio - sci . piscataway , nj , u.s.a . ) , in accordance with the manufacturer s instructions . fluorescence microscopy : the fluorescence in cells was visualized as previously described . the fixed cells were then blocked using a blocking solution and incubated for 30 min at room temperature with a mouse anti- - h2ax monoclonal antibody ( jbw301 ) ( upstate biotechnology inc . , charlottesville , va , u.s.a . ) . after washing with pbs , antibody bindingwas detected using alexa fluor 568 - conjugated secondary antibodies ( molecular probes , eugene , or , u.s.a . ) . dna was stained with 0.025 g / ml 4,6 - diamino -2-phenylindole ( dapi ) fluorescent dye ( boehringer mannheim , mannheim , germany ) . the cells were examined under an olympus ix70 fluorescence microscope ( olympus , tokyo , japan ) . images were acquired using an fv300 confocal laser scanning microscope ( olympus ) . localized dna damage induction using laser and cell imaging : localized dna damage induction using a laser and confocal imagingbriefly , confocal images of living cells expressing egfp - tagged proteins were obtained using an fv300 confocal scanning laser microscopy system ( olympus ) . a 1 % power scan ( for 1 sec ) from a 405 nm laserclonogenic survival assay : clonogenic survival assay was performed as previously described . ku80 is a key contributor to chemoresistance to anticancer agents , such as etoposide , or radioresistance in cho - k1 cells . first , we confirmed the expression of ku80 in cho - k1 and ku80 - deficient xrs - 6 cells . consistent with previous studies , western blot analysis showed that ku80 was expressed in cho - k1 cells , but not in xrs - 6 cells ( fig . total cell lysates from the cell lines were analyzed by western blotting using an anti - ku70 antibody , an anti - ku80 antibody , an anti - xrcc4 antibody or an anti- - actin antibody . ) . a core - nhej factor xrcc4 as well as - actin was expressed in both cell lines . total cell lysates from the cell lines were analyzed by western blotting using an anti - ku70 antibody , an anti - ku80 antibody , an anti - xrcc4 antibody or an anti- - actin antibody . one dna dsb is sufficient to kill a cell , when it is not repaired . h2ax is a sensitive indicator of dsbs induced by x - irradiation . to confirm the roles of ku80 in h2ax elimination after x - irradiation in cho - k1 cells , we examined x - irradiation - induced h2ax phosphorylation and h2ax elimination in xrs - 6 cells and cho - k1 cells by confocal laser scanning microscopy using the anti-h2ax antibody ( fig . 2fig . the xrs - 6 and cho - k1 cells were irradiated with 1 gy x - rays and immunofluorescence - labeled for h2ax at the indicated times . although h2ax elimination from 1 to 25 hr after x - irradiation was detected in both cell lines , the elimination from xrs - 6 cells was slower than that from the cho - k1 cells . the xrs - 6 and cho - k1 cells were irradiated with 1 gy x - rays and immunofluorescence - labeled for h2ax at the indicated times . previously , we established and characterized stable cell lines expressing egfp - ku80 or egfp in xrs - 6 cells . in addition , we established and characterized cell lines stably expressing egfp - ku80 mutants with point mutations in either or in both the nls and heterodimerization domains [ egfp - ku80 ( k565a / k566a / k568a ) , egfp - ku80 ( a453h / v454h ) or egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) ] using ku80 - deficient xrs - 6 cells . in this study , we reconfirmed that the wild - type ku80 fusion protein or its mutant ku80 fusion proteins were expressed in these transformants by western blot analysis ( fig . 3fig . schematic diagrams of full - length human ku80 protein ( 732 amino acids ) showing the location of nuclear localization signal ( nls : amino acids 561569 ) and the region involved in dimerization with ku70 ( amino acids 374502 ) previously identified . amino acid changes are designated by listing the wild - type residue , the amino acid positions and then the introduced mutant amino acid . ( b ) western blot analysis of untransfected cho - k1 cells , xrs - 6 cells and xrs - 6 cells expressing egfp - ku80 , egfp - ku80 ( a453h / v454h ) , egfp - ku80 ( k565a / k566a / k568a ) or egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) . total cell lysates were separated by 520 % sds - page and analyzed by western blotting using an anti - ku80 antibody , an anti - ku70 antibody , an anti - gfp antibody or an anti- - actin antibody . lane 6 , egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) / xrs - 6 cells . lane 7 , egfp / xrs - 6 cells . ) . we also reconfirmed that hamster ku70 was detected in extracts prepared from the xrs - 6 cells transformed with egfp - ku80 or egfp - ku80 ( k565a / k566a / k568a ) and from the cho - k1 cells , but not in those from the other transformants , confirming that mutations of ku80 at amino acids 453 and 454 affect the interaction of ku80 with hamster ku70 ( fig .3 ) . to determine whether the ku80 point mutations in the 2 domains in ku80 affect the sensitivity of xrs - 6 cells to x - rays , we examined the radiosensitivity of egfp - ku80 / xrs - 6 cells , xrs - 6 cells and the three transformants by colony formation assay .4 . percent survival of xrs - 6 cells transformed with egfp - tagged ku80 mutants following x - irradition . xrs - 6 cells or xrs - 6 cells transformed with egfp - ku80 , egfp - ku80 ( a453h / v454h ) , egfp - ku80 ( k565a / k566a / k568a ) or egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) were plated in triplicate and then exposed to x - rays at a dose of 2 gy and were further incubated for 5 days postirradiation . the cells were subsequently stained , fixed with 2 % methylene blue containing 50 % methanol and visualized under a microscope . the colonies were counted , and the survival rate was calculated by dividing the number of colonies of treated cells by that of the nontreated control ( black circle ) . , the egfp - ku80 / xrs - 6 cells exhibited higher radioresistance than xrs - 6 cells , which is consistent with our previous report . the double mutants with mutations in 2 functional domains were unable to complement the radiosensitivity of xrs - 6 cells ( fig .4 ) , suggesting that these domains of ku80 are important for complementing the radiosensitivity of ku80 - deficient cells . the nls - dysfunctional ku80 transformant egfp - ku80 ( k565a / k566a / k568a ) / xrs - 6 cells exhibited a slightly higher radiosensitivity than the egfp - ku80 / xrs - 6 cells , suggesting that the nls of ku80 is important for ku - dependent radioresistanse . similarly , another domain transformant egfp - ku80 ( a453h / v454h ) / xrs - 6 cells exhibited a slightly higher radiosensitivity than the egfp - ku80 transformants . these findings suggest that both or either of the ku80 point mutations in the 2 domains of ku80 affects the sensitivity of xrs - 6 cells to x - rays . ( a ) schematic diagrams of full - length human ku80 protein ( 732 amino acids ) showing the location of nuclear localization signal ( nls : amino acids 561569 ) and the region involved in dimerization with ku70 ( amino acids 374502 ) previously identified . amino acid changes are designated by listing the wild - type residue , the amino acid positions and then the introduced mutant amino acid . ( b ) western blot analysis of untransfected cho - k1 cells , xrs - 6 cells and xrs - 6 cells expressing egfp - ku80 , egfp - ku80 ( a453h / v454h ) , egfp - ku80 ( k565a / k566a / k568a ) or egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) . total cell lysates were separated by 520 % sds - page and analyzed by western blotting using an anti - ku80 antibody , an anti - ku70 antibody , an anti - gfp antibody or an anti- - actin antibody . lane 6 , egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) / xrs - 6 cells . lane 7 , egfp / xrs - 6 cells . percent survival of xrs - 6 cells transformed with egfp - tagged ku80 mutants following x - irradition . xrs - 6 cells or xrs - 6 cells transformed with egfp - ku80 , egfp - ku80 ( a453h / v454h ) , egfp - ku80 ( k565a / k566a / k568a ) or egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) were plated in triplicate and then exposed to x - rays at a dose of 2 gy and were further incubated for 5 days postirradiation . the cells were subsequently stained , fixed with 2 % methylene blue containing 50 % methanol andthe colonies were counted , and the survival rate was calculated by dividing the number of colonies of treated cells by that of the nontreated control ( black circle ) . previously , we showed that egfp - ku80 accumulation at dsbs began immediately after laser microirradiation in egfp - ku80 / xrs - 6 cells . we examined whether the mutations in both the nls and heterodimerization domains of ku80 affect the accumulation of ku80 at dsbs ( fig .5 . mutations in the two functional domains of ku80 affect the ability to accumulate at microirradiation - induced dsbs . the localization and accumulation of egfp - tagged proteins at dsbs induced by 405 nm laser irradiation were examined ( a ) . live - cell images were taken by confocal laser scanning microscopy before and 30 sec and 90 sec ( b ) or 60 sec ( c , d ) after microirradiation in the egfp - ku80 / xrs - 6 cells ( b ) , egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) / xrs - 6 cells ( c ) and egfp / xrs - 6 cells ( d ) . expectedly , egfp - ku80 was localized in the nucleus and accumulated at microirradiated sites in the living cells ( fig . a453h / v454h / k565a / k566a / k568a ) was observed to be localized in the cytoplasm , and the mutant did not accumulate at dsbs ( fig . , egfp alone was localized in the nucleus and cytoplasm and not accumulated at microirradiated sites . these findings demonstrate that the ku80 point mutations in the 2 domains of ku80 affect the accumulation of ku80 at dsbs . mutations in the two functional domains of ku80 affect the ability to accumulate at microirradiation - induced dsbs . the localization and accumulation of egfp - tagged proteins at dsbs induced by 405 nm laser irradiation were examined ( a ) . live - cell images were taken by confocal laser scanning microscopy before and 30 sec and 90 sec ( b ) or 60 sec ( c , d ) after microirradiation in the egfp - ku80 / xrs - 6 cells ( b ) , egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) / xrs - 6 cells ( c ) and egfp / xrs - 6 cells ( d ) . arrowheads indicate the irradiated sites . it is important to elucidate the molecular mechanisms underlying the radioresistance , as well as the chemoresistance , of human and animal cells in order to develop next - generation medical treatments for cancer . dna repair genes , particularly core - nhej genes , are key players in radioresistance and chemoresistance . we previously identified and characterized the ku70 - binding - site of ku80 and the nls of ku80 . in this study , our findings showed that either or both of the amino acid substitutions in the 2 functional domains of ku80 , i.e. , the ku70 - binding - site mutations ( a453h / v454h ) and nls - dysfunctional mutations ( k565a / k566a / k568a ) , affect the ability to complement x - ray sensitivity . moreover , our findings showed that these mutations affect the ability to repair dna damage of ku80 at microirradiation - induced dsbs . , we demonstrated that egfp - ku80 used in this study complemented not only x - ray sensitivity but also etoposide sensitivity in egfp - ku80 / xrs - 6 cells . others and we demonstrated that the two mutations of ku80 at amino acids 453 and 454 in the ku70 binding domain affect the interaction of ku70 with ku80 . in addition , we showed that the ku70 - binding - site mutations ( a453h / v454h ) of ku80 affected slightly the ability to complement etoposide sensitivity . in this study , ku70 - binding - site mutations ( a453h / v454h ) of ku80 only affected slightly the ability to complement radiosensitivity . another minor dsb repair pathway , such as homologous recombination , may be activated complementarily in egfp - ku80 ( a453h / v454h ) / xrs - 6 cells , although further studies are needed to clarify this . alternatively , we can not completely exclude the possibility that the ku70 binding activity and dna binding activity may remain slightly below the detection sensitivity in vivo . previously , we showed that in addition to ku80 nls , the heterodimerization between ku70 and ku80 is also important for nuclear entry of ku80 . in this study , nls - dysfunctional mutations ( k565a / k566a / k568a ) also only affected slightly the ability to complement radiosensitivity . on the other hand , the double mutants egfp - ku80 ( a453h / v454h / k565a / k566a / k568a ) with mutations in the 2 functional domains were unable to complement the radiosensitivity of xrs - 6 cells . in addition , the mutant was not able to accumulate at dsbs , when the dsbs were induced using our simple live - cell imaging technique with a laser , suggesting that the mutations affect the ability to repair dna damage of ku80 . altogether , we consider that the double mutants were unable to repair dsbs of xrs - 6 cells , since the double mutants were not able to localize and accumulate at dsbs . these findings support the idea that the localization and accumulation mechanism of ku80 at dsbs might play a key role in regulating nhej activity . it has been reported that genetic variations in nhej genes can affect dna repair capacity and confer predisposition to several types of clinical human cancer . this study and further studies will lead to a better understanding of not only the molecular mechanism underlying the cellular response via the nhej pathway to radiation and chemotherapeutic drugs , but also carcinogenesis induced by defects of nhej functions in mammalian cells .\noutput:\n" }, { "from": "agent", "value": "abstractvarious chemotherapeutic drugs , such as etoposide , and ionizing radiation ( ir ) have been clinically applied for the treatment of many types of animal and human malignancies . ir and chemotheraputic drugs kill tumor cells mainly by inducing dna double - strand breaks ( dsbs ) . on the other hand , unrepaired or incorrectly repaired dsbs can lead to chromosomal truncations and translocations , which can contribute to the development of cancer in humans and animals . thus , it is important to clarify the molecular mechanisms underlying the chemosensitivity or radiosensitivity of mammalian cells in order to develop medical treatments and next - generation chemotherapeutic drugs for cancer . previously , we established and analyzed cell lines stably expressing chimeric constructs of egfp and the wild - type ku80 ( xrcc5 ) protein or its mutant protein to which mutations were introduced by the site - directed mutagenesis . we found that the ku70 ( xrcc6 ) - binding - site mutations ( a453h / v454h ) of ku80 and nuclear localization signal ( nls ) - dysfunctional mutations ( k565a / k566a / k568a ) affected the ability to complement etoposide sensitivity . in this study , we examined the radiosensitivity of these cell lines . we found that either or both amino acid substitutions in two functional domains of ku80 , i.e. , ku70 - binding - site mutations ( a453h / v454h ) and nls - dysfunctional mutations ( k565a / k566a / k568a ) , affect the ability to complement radiosensitivity . moreover , these mutations in the two domains of ku80 affect the dsb - sensing ability of ku80 . these information and ku80 mutant cell lines used might be useful for the study of not only the dynamics and function of ku80 , but also the molecular mechanism underlying the cellular response to ir and chemotherapeutic drugs in mammalian cells ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cardiovascular ( cv ) disease is the main cause of morbidity and mortality in patients with end - stage renal disease ( esrd ) . the increased risk is partly due to a higher prevalence of traditional cv risk factors . nevertheless , these patients also present other nontraditional cv risk factors related with the setting of uremic background that result in functional and structural alterations of the arterial wall , leading to an increase in arterial stiffness . as in the general population , arterial stiffening has been described as an independent predictor of both cv and overall mortality in haemodialysis ( hd ) patients . another component that has been proposed to play a role in cv risk is the hd session per se . the dialysis procedure may induce acute functional alterations of the arterial wall through several mechanisms , the most remarkable being the intermittent immunoactivation state induced by dialysis , and the acute intravascular volume drop produced during the hd session . it has been proposed that these acute functional alterations could be detected by noninvasive pulse wave analysis ( pwa ) . aspwa measurements are being increasingly introduced in the clinical setting , the main objective of our study was to separately analyze the acute effects on pwa of bioincompatibility and ultrafiltration ( uf ) during the dialysis session . we separately analyzed the acute effect on pwa of membrane bioincompatibility ( study i , n = 11 ) and ultrafiltration ( study ii , n = 19 ) during the hd session . patients were eligible for entry into the study when ( 1 ) they had been on hd for at least 3 months , ( 2 ) they were in a stable clinical situation , and ( 3 ) they did not suffer cardiovascular instability on dialysis . all selected patients agreed to participate in the study , which was approved by the hospital ethics committee . radial arterial waveform in the nonfistula arm was measured by applanation tonometry with the sphygmocor device , using the pwa software package . studied variables included augmentation index corrected by heart rate ( ai@75 ) , subendocardial viability ratio ( sevr ) , ejection duration ( ed ) , and aortic systolic and diastolic blood pressure . measurements were taken by a single observer in triplicate and averaged . as a biological demonstration of membrane bioincompatibility , successive white blood cell counts in the advia autoanalyzer and c3a generation ( enzyme immunoassay quidel ) were obtained . the analysis was performed by leukocyte count and c3a levels monitored before , at 15 , 30 , 60 minutes , and at the end of the hd session . pwa was performed by sphygmocor system before , at 15 and 30 minutes of starting hd session . all patients were dialyzed with the same cellulose diacetate membrane ( baxter ) with surfaces of 170 or 210 m and dialysate calcium concentrations of 1.5 mm . in order to avoid the effects of intravascular volume changes on pwa , fluid removal was completely avoided ( ultrafiltration = 0 ) during the 30 minutes of pwa monitoring . pwa was performed before and after a conventional hd session with the same cellulose diacetate membrane ( baxter ) and dialysate calcium concentrations than in study i. the procedure was carried out in normal conditions , with programmed uf as clinically needed based on their dry weight . a total of 19 patients were studied , and the mean ultrafiltration was 2.431.12 kg . data are expressed as mean sd . the effect of hd session on the measured variables was tested by means of the paired t - test and repeated measures anova . eleven patients were included in study i , with a mean age of 76.910.5 years , 54.6 % men , with a mean time on dialysis of 33.937.9 months . mean predialysis peripheral blood pressure measured in triplicate and averaged was 135.118.1 / 61.77.5 mmhg . membrane bioincompatibility results related with leukocyte count , c3a , peripheral and central blood pressure and stiffness parameters are displayed in table 1 . a significant decrease in leukocyte count occurred at the beginning of dialysis : 68011186 versus 44121333 at 15 minutes ( p 0.001 ) , while c3a levels sharply increased from 427269 to 35011638 ng / ml at 15 minutes ( p 0.000 ) , both parameters being inversely correlated ( r = 0.74 , p = 0.01 ) . no changes were demonstrated in any of the variables analysed in pwa : ai@75 ( 26.111.1 versus 26.612.4 ) , ed ( 37.15.9 versus 35.85.1 ) , and sevr ( 129.130.3 versus 141.129.5 ) . only aortic systolic bp was lower at 15 minutes : 120.117.7 versus 110.425.8 mmhg ( p = 0.009 ) , in correlation with a reduction of brachial systolic bp : 135.118.1 versus 122.727.4 mmhg ( p = 0.01 ) , without changes in aortic or brachial diastolic bp . nineteen patients were included in study ii , with a mean age of 71.412.2 years , 63.2 % were men , and the mean time on dialysis was 36.247.4 months . important changes in all the pwa parameters evaluated were observed at the end of the haemodialysis session : ai 29.910.1 versus 18.615.0 ( figure 1 ) , ed 37.63.6 versus 32.84.6 , sevr 124.619.9 versus 171.737.1 , central aortic systolic bp 139.825.5 versus 119.428.5 mmhg ( all p 0.00 ) , without changes in aortic diastolic bp 75.813.9 versus 75.117.9 mmhg ( p : ns ) . however , there was no good correlation between the amount ultrafiltered and the changes in pwa parameters ( r = 0.65 ) , suggesting that arterial stiffness improvement was not caused by fluid removal alone . arterial stiffness measurement in esrd patients has gained importance in the last years , especially for its relationship with increased left ventricular hypertrophy and decreased coronary perfusion during diastole . nevertheless , the acute effects of the hd session on arterial stiffness have been sparsely studied . the results of previous publications are controversial , and it is not clear whether hd per se can induce acute functional changes in the arterial wall . this study was designed to separately evaluate the two seemingly and opposite main determinants of arterial stiffness changes during the hd session . in studyi , we demonstrate the existence of immunoactivation assessed by considerable changes in leukocyte count and c3 levels . however , such bioincompatibility was not detectable by pwa , since we did not observe any changes in any arterial stiffness parameters . previous studies have shown changes in vascular function using other functional studies as pulse wave velocity ( pwv ) , flow - mediated dilation , or endothelium - independent vasodilation . to our knowledge , no previous studies have analyzed the effect of the membrane bioincompatibility on ai@75 . when the dialysis procedure was performed with the normal pattern of uf , and pwa was measured at the end of the dialysis session ( study ii ) , a significant effect on arterial stiffness parameters was shown . we observed a decrease in both aortic systolic bp and ai@75 at the end of the hd session . contrary to expected , we found no correlation between changes in arterial stiffness parameters and the magnitude of fluid removal . previous publications have analysed the effect of the hd session on arterial stiffness yielding different results . some of them defend a lack of improvement of arterial stiffness arguing that vascular changes in esrd are structural rather than functional , that oxidative stress counteracts the effect of uf , or that the beneficial effect of acute volume reduction may be obscured by the activation of the rennin - angiotensin system . other studies agreed that pwv remains unchanged as a more structural parameter , while ai@75 decreases with the hd session ( as a more functional one ) . this improvement has mainly been attributed to volume correction , although some authors have already questioned this association . given the lack of association with the uf , we analysed possible relationships with pre - hd brachial or aortic bp , pre - hd ai@75 , bp decrease during hd or dialysis vintage , but we did not find correlation with any of these variables . these discrepancies in the literature can be justified by two main reasons . on the one hand , the large number of variables that can influence during a hd session , not only immunoactivation and intravascular volume drop , but also bp changes , oxidative stress , activation of the rennin - angiotensin system , changes in calcium or magnesium levels during the session , or the differences between patients in intravascular refilling due to individual nutritional status , among others . it is , therefore , very difficult to analyze each of them separately . on the other hand , there is a lack of uniformity in the way arterial stiffness is measured in the different studies . we can conclude that hd procedure with the diacetate cellulose membrane induces a clear immunoactivation effect easily demonstrable by leukocyte cell count and c3a generation that is not detectable by pwa . the improvement of arterial stiffness observed after the hd session assessed by pwa was not related with ultrafiltration nor with changes in bp . further studies with control of the different variables should be carried out in order to determine how each of these factors affects arterial stiffness during the hemodialysis session .\noutput:\n" }, { "from": "agent", "value": "membrane bioincompatibility was demonstrated by successive white blood cell counts and c3a generation . pulse wave analysis was obtained by applanation tonometry ( sphygmocor ) in a sequential way : basal , after 30 minutes with nul ultrafiltration , and after a complete dialysis with ultrafiltration . at 15 minutes of haemodialysis , significant decrease in leukocyte count occurred : 6801 1186 versus 4412 1333 ( p < 0.001 ) , while c3a levels sharply increased from 427 269 to 3501 1638 ng / ml ( p < 0.000 ) . no changes were observed in augmentation index without ultrafiltration : 26.1 11.1 versus 26.6 12.4 . only aortic systolic blood pressure was lower at 15 minutes : 120.1 17.7 versus 110.4 25.8 mmhg ( p = 0.009 ) , in agreement with a reduction in brachial systolic blood pressure : 135.1 18.1 versus 122.7 27.4 mmhg ( p = 0.01 ) , without changes in aortic or brachial diastolic blood pressure . important changes in pulse wave analysis were observed after a complete haemodialysis session : augmentation index 29.9 10.1 versus 18.6 15.0 , aortic systolic blood pressure 139.8 25.5 versus 119.4 28.5 mmhg ( p < 0.00 ) , without changes in aortic diastolic blood pressure . in summary , haemodialysis with cellulose diacetate acutely induced a transient state of immunoactivation due to bioincompatibility , this phenomenon was nondetectable by pulse wave analysis . complete haemodialysis session led to important changes in pulse wave analysis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: inclusion criteria were adolescents ( 13 - 18 years old ) with at least one family member living with hiv , adolescents knowing about the hiv disease of the involved member , intelligence quotient ( iq ) higher than 80 , no learning disorder , no drug abuse and psychosis , yielding informed written consents , no problem that interferes with attending the classes . firstly , the families and the involved members were requested for two informed written consents , based on helsinki ethical code and approval of ethical committee of isfahan university of medical sciences . the sampling method was census sampling by which all adolescents aged 13 - 18 years from the families with one hiv positive member were selected in aids clinics . the 19 samples who did not accept to attend the study , 6 ( 32 % ) of whom were sisters or brothers of the infected member , 8 ( 42 % ) were children of the infected ones who had moved out and their spouses were not available or had not permitted their children to attend the educational classes and five samples ( 26 % ) left the study due to address change and leaving no contact number . in addition , one sample attended only one session and then quited the study , so finally fourteen cases attended all sessions . then , eight weekly sessions ( 90 minutes each ) were held by a child and adolescent psychiatrists . cognitive behavioral stress management training included increase in awareness about stress , relaxation , unhelpful thoughts , cognitive reconstruction , problem solving , assertiveness skills training and anger and time management ( table 1 ) .15 the first 45 minutes of each session were devoted to education and group discussion , then 10 minutes of free discussion and after that there was a break and finally the rest of the time was teaching theoretical and skill materials . at the end of each sessionsubject and outlines of cognitive behavioral stress management training sessions after eight sessions , the first post test was taken and three months after the last session , a booster session was held to review educational sessions , to practice the skills and also to answer the questions . parallel to the sessions of the adolescents , three educational sessions ( parallel to the first , fourth and eighth session ) were held for the parents . information including route of transmission , stage of disease , hepatitis c , substance abuse and cd4 cell was derived from patients recorded documents in clinic . the research measurement tools included demographic data form filled for the infected member and the adolescent , general health questionnare - 28 ( ghq - 28 ) , strengths and difficulties questionnaire ( sdq ) and family assessment device ( fad ) . ghq is one of the most wildly used questionnaires to screen for psychiatric morbidityi and includs 28 questions with 4 subscales of somatic symptoms , anxiety and insomnia , depression and social dysfunction . each question is scored from 0 to 3 , so that the lower the score of each subscale and total ghq , the better the general health .19 this questionnaire had been standardized in tehran psychiatry institute .2021 fad is a self - report instrument developed to measure perception of family function . the version we used was a 60 item questionnaire made by epstein , baldwin and bishop to measure family function based on mcmaster model .22 the questions were scored in form of 7 subscales including problem solving , communication , roles , affective responsiveness , affective involvement , behavior control and general function .2324 this tool has a good reliability in each of its sub scales .23 each question was scored from one to four . it was so that the lower the score of any subscale , the better family functions . sdq is a structured questionnaire which is commonly used for behavioral and emotional problems as well as children and adolescents relationship . this questionnaire was designed by goodman in 1997 and includes 25 questions with 5 subscales of emotional problems , hyperactivity , peer problems , conduct problems or pro - social behavior , in which five items are included .25 each item was given a score of 0 to 2 . the total score of each subscale was from 0 to 10 classified to three categories ( normal - borderline and abnormal ) and it is available on the internet at www.sdqinfo.com . total problem score was calculated by adding the first four subscales ranking from 0 to 40.25 this questionnaire has three forms for parents , teachers and self report for adolescents over 11 years of age . tehranidoost et al evaluated this test and reported that it to have an acceptable reliability and validity in iranian population .26 in the present study , social interactions have been evaluated based on subscales of pro social behavior and peer relationship sdq . self report and parent report sdq , ghq - 28 and fad were used before ( t1 ) , after the end of intervention ( t2 ) and three months after last session ( t3 ) . the data were analyzed by descriptive statistics ( frequency distribution , mean and sd ) and analytical statistics of repeated measure with option of green house - geisser to compare mean scores of outcomes such as fad , ghq and sdq ( self and parent report ) using spss ( version 18 ) . bonferroni test was used to assess any significant difference between t1 and t2 , t1 and t3 , and t2 and t3 . fifteen adolescents aged 13 - 18 years from families with one hiv positive member at tended this study . nine of them were male ( 60 % ) and 6 were female ( 40 % ) . mean age of the adolescents was 15.91.9 and mean age of their parents was 42.58.7 . frequency and percentage distribution of some characteristics of children and families with hiv positive members number , percentage , borderline and abnormal values of each subscale and total scores of impact score before , after and three months after cognitive behavioral stress management intervention based on sdq self report and parents report have been presented in table 3 . the most abnormalities in subscale of emotional problem were for self report in sdq ( 40 % ) and conduct problem ( 33.3 % ) respectively . total problem and subscales scores of self report and parent report strengths and difficulties questionnaire ( sdq ) indicators of the mean sd and median of general health questionnare - 28 ( ghq - 28 ) and family assessment device ( fad ) and their subscales based on self and parent report of strengths and difficulties questionnaire ( sdq ) before , just after and 3 month after intervention in parent report sdq , the highest abnormalities were for subscales of conduct problems ( 53 % ) and peer relation and emotional problems ( 40 % ) . based on the study analysis , mean scores of mental health ( mean sd ) obtained by ghq questionnaire , family function obtained by fad questionnaire and social interactions obtained by sdq questionnaire , before intervention ( t1 ) , after the intervention ( t2 ) and three months after the intervention ( t3 ) were calculated and presented in table 3 . there were significant differences between t1 , t2 and t1 , t3 ghq - 28 mean scores ( p 0.001 ) . however , there was no significant difference between just post intervention ( t2 ) and three months after the intervention ( t3 ) mean scores ( p = 0.4 ) . there was a significant difference between mean scores of family function based on fad in t1 and t2 and between t1 and t3 ( p 0.001 ) , but there was no significant difference between mean scores t2 and t3 ( p = 0.12 ) . also , there was no significant difference between mean scores of pro social behavior based on sdq ( self report and parents report forms ) in all three stages ( p 0.05 ) . there was a significant difference between mean scores of peers relationship based on sdq ( self report and parents report forms ) before and after intervention and also between pre and three months post intervention ( p = 0.021 and p = 0.003 , respectively ) , but there was no significant difference between mean scores of post and three months post intervention . the findings of this study showed that there were affective and emotional problems among the samples so that cognitive behavioral stress management intervention had a helpful effect , which lasted for three months . since most of them ( 42 % ) were from the families in which the spouse had left with the children after the diagnosis of hiv in the infected member or they were not available for the treatment or rejected to join . the second group ( 32 % ) was the brothers or sisters of those involved , who rejected the treatment and did not have any cooperation to solve any problem related to the involved member . this fact also reflects the stigma as a result of the disease and cultural problems . the rest ( 26 % ) about 41 % of the qualified persons finished the ( educational ) sessions successfully . in a study conducted by rotheram - borus et al ( 2001 ) in new york , 10.7 % of the adolescents parents rejected the treatment and 15.2 % were not available .27 both these values are less than those obtained by the present study possibly as a result of cultural differences , better health system for follow - ups and more awareness of the families . in the present study , the highest abnormalities were for self report sdq questionnaire subscale , emotional problems ( 40 % ) and conduct problems ( 33.3 % ) , which are consistent with doku 's study ( 2009 ) carried out in ghana reporting the highest abnormalities for emotional problems ( 43 % ) and conduct problems ( 20 % ) respectively .28 in the present study , cognitive behavioral stress management training in qualified families was effective on their mental health status based on ghq and sdq ( self report and parents report form ) and sustained for three months . mental problems especially major depressive disorder ( mdd ) in hiv infected persons occur frequently ,2930 and if they are a parent , that can affect their children 's mental health .31 this fact shows the importance of detecting people at risk and conducting early intervention . jemmott et al ( 2000 ) showed that skill - building cognitive behavioral intervention , like other hiv related interventions , has been successful in adolescents .32 rotheram - borus et al reported that intensive intervention ( including coping with stigma , emotional reaction to aids and their anxiety about their welfare ) was significantly effective on decreasing emotional distress , conduct problems , multiple problem behaviors and increase of self - esteem2733 . in another study conducted by them ( 2004 ) , a six year skill based intervention diminished psychosomatic symptoms , high risk behavior ( drinking and smoking ) and caused better problem solving in adolescents34 . kessler ( 2000 ) reported that stress management in adolescents aged 11 - 18 years , reduced a broad range of psychiatric symptoms .35 in the present study , the intervention based on fad questionnaire was effective on family function and the effect lasted for three months . in a study , conducted in new york in 2001 , intensive interventions reduced the stressors related to the families .27 in the present study , social interactions have been evaluated based on subscales of pro social behavior and peer relationship sdq . mean scores of pro social behavior before , after and three months after intervention showed no change , which could possibly be the result of low percentage of abnormal social behavior from the very beginning of the study with no change by intervention . in doku 's study , abnormality percentage of this subscale was low .28 but in rotheram - borus study , intervention made personal benefits and more positive social trajectories .34 intervention was effective on subscale of peer group problem in sdq questionnaire ( both forms of self and parent report ) before and after intervention and three months after that . kerig showed that intervention in adolescents of these families could promote the quality of relationships and problem solving .36 this ability can reduce peer group problems . the limitation of this study included low number of participants and unavailability of those people having no file in aids clinic . lack of a control group as a result of the low number of qualified people was another limitation to the study . in conclusion , present results demonstrate that stress management training are effective in adolescent living with parents infected with hiv / aids , but still further studies and researches are needed to confirm the results . mk and sa carried out the design and coordinated the sessions of adolescents and parents , completed the questionnaires , collected data and prepared the manuscript .\noutput:\n" }, { "from": "agent", "value": "background : this study evaluated stress management training to improve mental health , social interaction and family function among adolescents of families with one human immunodeficiency virus ( hiv ) positive member.methods : there were 34 adolescents ( 13 - 18 years old ) with at least one family member living with hiv from whom finally 15 attended the study and participated in 8 weekly sessions of stress management training . the tests used in this study were : strengths and difficulties questionnaire ( self and parent report ) , general health questionnare - 28 ( ghq - 28 ) and family assessment device ( fad ) , conducted before , after and three months after the intervention . the collected data were analyzed by repeated measure test using spss software ( version 18.0 ) . results : adolescents with one hiv positive family member showed high level of emotional problem ( 40 % ) and conduct problem ( 33.3 % ) . there was a significant difference between before , after and 3 months after intervention based on ghq - 28 mean scores and fad mean sores ( p < 0.001 ) . there was a significant difference between mean scores of peers relationship based on sdq ( self report and parents report forms ) before and after intervention , but there was no significant difference between mean scores of pro social behavior based on sdq ( self report and parents report forms ) in all three stages ( before , after and three months after intervention ) . conclusions : stress management training is effective in improving mental health , family function and social interaction among adolescents living with parents infected with hiv / aids ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: various simple mastectomy procedures were introduced during the nineteenth century , but none was able to cure the disease or achieve adequate disease control . the modern era of surgical treatment for primary breast cancer began in the 1890s with the introduction of radical mastectomy by halsted and meyer . william stewart halsted reported his work briefly in 1890 and published his more extensive experience of patients treated at johns hopkins hospital , baltimore , in november 1894 . some of halsted and meyer 's patients were cured of their disease , so for the first time , physicians had an effective treatment for breast cancer , and radical mastectomy quickly became the standard of care for the disease . radical mastectomy was based on the idea that at first , breast cancer spread only locally orcentrifugally by first invading contiguous tissue and then spreading though lymph ducts to close - by lymph nodes , where the cells were trapped for some time . haematic spread of tumour cells giving rise to distant metastases was considered to occur at a later stage . radical mastectomy involves the removal of all breast tissue , overlying skin , and both pectoralis muscles , together with complete en bloc removal of the axillary lymph nodes . skin was removed because the disease often involved the skin ; in fact , the skin was often ulcerated on presentation . the pectoralis muscles were removed not simply because the chest wall was often involved , but because it was considered essential to remove the transpectoral lymphatic pathways that run directly through the pectoralis major to rotter 's nodes between the pectoralis major and pectoralis minor . at that time , it was also considered anatomically impossible to do a complete axillary dissection without removing the pectoralis muscles . halsted achieved a three - year local recurrence rate of 3 % and locoregional recurrence rate of 20 % with no perioperative mortality . five - year survival was 40 % twice that of untreated patients . however , morbidity after the operation was great , because the large wounds were left to heal by granulation , lymphedema was near universal , and arm movement was severely restricted ( due to pectoralis muscle removal and damage to axilla nerves ) . for these reasons , chronic pain was also an important sequela . over a century ago , surgeons were faced with large breast cancers that seemed to require drastic treatment to have some chance of cure : patients ' quality of life was not a consideration . nevertheless , thanks to halsted and meyer , at last , it became possible to cure breast cancer in some cases , and systematic knowledge of the disease began to accumulate , standardized treatments started being applied , and controlled long - term studies would eventually be conducted . it also became apparent that some women with advanced disease did not benefit from surgical treatment , and as the twentieth century advanced , the concepts of operability and inoperability were developed , largely by haagensen and stout . from 1930onward , orthovoltage radiotherapy was added to mastectomy in many treatment centers although the radiation dose and size and location of treatment fields varied considerably . according to the halsted - meyer theory the most important pathway for breast cancer dissemination was through the lymphatic ducts . the implication was that chances of cure were increased by performing wider ( and ever more mutilating ) surgical resections that removed more lymph nodes . from 1920onwards , samson handley employed an extended radical mastectomy that included removal of the lymph nodes of the internal mammary chain . he also implanted radium needles into the anterior intercostal spaces in order to treat internal mammary nodes . richard handley , samson handley 's son , studied internal mammary chain nodal involvement in breast cancer , demonstrating that 33 % of 150 breast cancer patients had internal mammary chain involvement at the time of surgery . in denmark and margottini in italy performed extrapleural dissection of the internal mammary nodes , while wangensteen in the usa performed supraclavicular and internal mammary node dissection through a sternal approach . urban , at the memorial sloan - kettering hospital of new york , performed a massive 4 - 5 hour operation that combined radical mastectomy with resection of the internal mammary chain en bloc with costal cartilages and intercostal muscles ; defects were made good with a fascia lata graft . the centrifugal spread idea held sway throughout the first half of the 20th century , and progress in breast cancer treatment was considered , at least by some , to depend on even more radical ablations . but perhaps the first indication that extended radical mastectomies were not necessary came from a study by gray published in 1940 , which showed that the dermis was rich in lymphatic vessels and likely to be a plane of ready cancer spread , while the fascia underlying the breast was practically devoid of lymphatic vessels , which for this reason was unlikely to be a major plane of cancer spread . these findings encouraged some surgeons to remove more skin ; however , patey and dyson experimented with a reduced mastectomy that preserved the pectoralis major : in their 1948 paper , they reviewed mastectomies performed between 1930 and 1943 , comparing their operation ( which spared the pectoralis major ) with the standard radical mastectomy . patey wrote until an efficient general agent for the treatment of carcinoma of the breast is developed , a high proportion of cases are doomed to die of the disease whatever combination of local treatment by surgery and irradiation is used , because in such a high proportion of cases the disease has passed outside the field of local attack when the patient first comes for treatment . in 1972 , madden and colleagues presented results of a consecutive series of patients treated by their modifiedradical mastectomy , in which both the pectoralis major and the pectoralis minor were preserved . patey argued that complete axillary dissection was not possible if the pectoralis minor was preserved . it was also argued that the pectoralis minor 's nerve and blood supply were not conserved , leaving the muscle useless . auchincloss also presented data in favour of the modified radical mastectomy that conserved the pectoralis minor . auchincloss also questioned the need to perform complete axillary dissection , suggesting that the apical nodes ( berg level iii ) should only be removed when evidently invaded . crile went further and suggested that axillary dissection should not be performed immediately if the axilla was not evidently involved , at least in patients with stage i breast cancer , but only subsequently if axillary involvement developed . survival rates following delayed axillary dissection were equal to or better than following prophylactic lymph node dissection . another objection to preservation of the pectoralis minor was that the interpectoral lymphatic ( rotter ) nodes could be a source of disease recurrence . however , recurrence at this site is unusual , and even if it occurs , muscle invasion is uncommon . the simple mastectomy was first developed by kennedy and miller , based on indications that radical mastectomy was not always necessary in women with breast cancer . simple mastectomy is a fairly rapid operation in which the pectoral fascia is removed in bloc with the breast , but neither the pectoralis muscles nor the axillary lymph nodes are removed . kaae and johansen compared simple mastectomy plus postoperative radiotherapy with extended radical mastectomy plus radiotherapy and found that overall survival rates were similar in both . the controversy between extended and reduced mastectomies crystallized in the 1970s when bernard fisher marshalled evidence that breast cancer was a systemic disease from the outset and that distant metastases were present well before diagnosis in most cases . however , fisher also cited evidence that debulking the tumor mass might stimulate the body to destroy remnant tumor cells by immunologic and other mechanisms , perhaps in combination with systemic cytotoxic agents . these ideas stimulated surgeons to experiment with breast - conserving treatments for breast cancer , variably combined with elective axillary dissection , radiotherapy to the residual breast , and chemotherapy . the first major clinical trials investigating breast conservation began in the 1970s , in coincidence with more widespread use of mammography to identify small lesions and permit diagnosis of breast cancer at an earlier stage . the first to trial to publish five - year results was that of veronesi 's group in milan . this trial compared quadrantectomy plus radiotherapy plus axillary dissection with radical mastectomy and found no difference between the two treatments . subsequently , fisher et al . published five - year results of their trial comparing lumpectomy withtotal mastectomy that removed the entire breast , pectoral fascia , and axillary contents en bloc . twenty - year follow - up of both these landmark studies confirmed that conservative breast surgery is equivalent to mastectomy as a treatment for breast cancer . this was an important advance , as the mutilation that went with mastectomy was considerably reduced by the conservative approach . today the standard of care for patients with stage i / ii breast cancer is lumpectomy or a more extended resection like quadrantectomy , followed by whole breast irradiation . however , for more advanced disease , and a number of other indications , such as inflammatory breast cancer , intraepithelial neoplasia not amenable to breast - conserving surgery , or local recurrence after breast conserving surgery , mastectomy is necessary . at the same time , the mastectomy operation continues to undergo modification as part of the shift to less extensive but oncologically adequate procedures that are more technically demanding than the traditional mastectomy procedures . mastectomy with skin preservation was first applied by freeman to two patients with benign breast disease . toth and lappert were the first to report a skin - preserving mastectomy for breast cancer that required considerable preoperative planning of the incisions in order to maximize skin preservation , and thereby facilitate breast reconstruction whose aesthetic outcome depends considerably on the quantity of breast skin remaining . their operation consisted of breast gland removal , removal of the nipple - areola complex , biopsy scar , and skin overlying the cancer ( if superficial ) with preservation of remaining skin and inframammary fold . the benefits of skin - sparing mastectomy are that it reduces postmastectomy deformity , allows better breast shape after reconstruction , minimizes residual scarring , and reduces the area of skin necessary on myocutaneous flaps . doubts remain about oncological safety of skin - sparing mastectomy , particularly since randomized controlled studies have not been conducted , and residual breast tissue often remains in the skin envelope . however , even in cases undergoing conventional mastectomy , residual breast tissue is present on the skin flaps ( excluding nipple - areola complex ) in around 23 % of cases . furthermore , retrospective studies with followup ranging from 35 to 70 months suggest no differences in recurrence or survival rates between patients undergoing skin - sparing mastectomy with reconstruction and those undergoing conventional mastectomy . the most common complications of skin - sparing mastectomy are skin necrosis , infection , and hematoma . skin flap necrosis occurs in about 11 % of cases when there are no risk factors . other factors that increase the risk of necrosis are previous breast irradiation , diabetes , and high body mass index . these complications do not usually delay the administration of adjuvant therapies . reduced skin sensitivity occurs in around 65 % of patients . indications for skin - sparing mastectomy are brca1 / 2 mutation , intraepithelial neoplasia ( din or lin ) , particularly when the lesion is extensive , multicentric or recurrent , and early - stage breast cancer for which breast - conserving therapy is not suitable . some of studies support the use of skin - sparing mastectomy following neoadjuvant treatment , for recurrence after breast - conserving surgery , and malignancy after additive mammoplasty . relative contraindications are adjuvant radiotherapy , smoking , previous irradiation , high body mass index , and delayed reconstruction . nipple - sparing mastectomy is a refinement of skin - sparing mastectomy in which the nipple - areolar complex is spared . once again , its aim is to improve the aesthetic outcome of the reconstruction , which is usually performed immediately . nipple sparing mastectomy can be associated with intraoperative radiotherapy to the nipple - areolar complex . one intraoperative irradiation technique ( eliot ) employs electrons at a dose of 16 gy directly to the nipple - areolar complex . a combined aluminium and lead disc is placed under the complex and over the chest to protect the chest wall . contraindications for nipple - sparing mastectomy are central quadrant tumours , clinical evidence of nipple - areolar complex involvement , bloody nipple discharge , palpable tumours less than 1 cm from the nipple , and micro - calcifications or other radiological alterations near the nipple . frozen retroareolar tissue is examined intraoperatively and if positive for malignancy nipple sparing is not performed . . reported on 289 patients who underwent nipple - sparing mastectomy with intraoperative radiotherapy ( eliot ) to the nipple - areolar complex . three percent of their patients had total necrosis of the nipple - areolar complex , an additional 9.5 % had partial necrosis , and the entire complex had to be removed in 4.6 % . after 1 year of followup , cosmetic outcomes were rated good by 82.3 % of patients and by 84.8 % of surgeons . no local recurrence occurred beneath the preserved nipple - areolar complex although followup was short . as with skin - sparing mastectomy , there is concern that retaining the nipple - areolar complex increases the likelihood of disease recurrence ; however , the available experience suggests that this is not the case . to achieve optimal cosmetic results with oncologic safety , nipple - sparing mastectomy should be performed on only carefully selected patients . five - to - ten percent of breast cancers occur in women with a deleterious mutation in brca1 , brca2 , or other breast cancer - associated genes . brca1 and brca2 mutations are quite penetrating : the cumulative risk of breast cancer is about 65 % in brca1 - mutation carriers ( by age 70 ) and about 45 % in brca2 - mutation carriers . mastectomy has long been proposed as a means of avoiding breast cancer in women with brca1 and brca2 mutations . studied the oncological results of risk - reduction mastectomy in 139 persons with these mutations , randomizing them to breast cancer screening or reducing risk mastectomy . after an average followup of 3.0 years , breast cancers occurred in 8 screening group women but in none of the mastectomy group . however , mastectomy does not completely eliminate the risk of breast cancer . deleterious mutation carriers considering prophylactic mastectomy should be evaluated by a multidisciplinary team consisting of geneticist , oncologist , breast surgeon , plastic surgeon , and psychologist . options for breast reconstruction after mastectomy consist of autologous transplants , implants , and combinations of both . local pedicle flaps are latissimus dorsi flaps and transverse rectus abdominis myocutaneous ( tram ) flaps . free flaps include the deep inferior epigastric perforator ( diep ) , free tram flaps , and gluteal artery perforator ( gap ) flaps . the latissimus dorsi flap was introduced by schneiders in 1977 and produces satisfactory aesthetic results . the diep flap , originally proposed by holmstrom in 1979 , makes large - volume transfer possible , with preservation of the abdominal muscles and aponeurotic layers , and reduces complications such as muscular weakness , bulging and hernia ; however , the operating time is longer than for other breast reconstructions . patients report high levels of aesthetic satisfaction with this technique . however , donor site complications occur more frequently than with diep flap . the free superior gluteal artery perforator ( s - gap ) flap was first used for breast reconstruction in 1995 . the introduction of anatomically profiled implants improved this type of reconstruction so that good breast volume , shape , and symmetry are routinely achieved with low complication rates . the choice of breast reconstruction technique depends on the anatomical characteristics of the patient and the skill and experience of the plastic surgeon . the risk of reconstruction failure is higher in smokers , obese patients and , those with large breast . mastectomy has evolved from the frankly mutilating but often effective halsted radical mastectomy to the technically more demanding skin - sparing and nipple - sparing approaches that are increasingly used today . these new mastectomies provide results that are oncologically equivalent to the older operations but make it easier to perform immediate breast reconstructions that achieve good aesthetic results and reduce psychological morbidity . at the same time , mastectomy has been supplanted by surgical approaches that conserve the breast for a large fraction of breast cancer patients in western countries , in part because breast cancer is diagnosed at a much earlier stage . there is no sign yet that surgery for breast cancer will be supplanted by noninvasive treatments , so the way forward seems to be the development of increasingly sophisticated and demanding surgical procedures that are ever more precisely tailored to the individual patient and typically require the skills of a plastic surgeon as well as the breast surgeon and multidisciplinary team . it seems important to develop ways of reducing the failure and complication rates for the breast reconstruction procedures facilitated by the new mastectomies .\noutput:\n" }, { "from": "agent", "value": "breast cancer is the most common cancer in women . primary treatment is surgery , with mastectomy as the main treatment for most of the twentieth century . however , over that time , the extent of the procedure varied , and less extensive mastectomies are employed today compared to those used in the past , as excessively mutilating procedures did not improve survival . today , many women receive breast - conserving surgery , usually with radiotherapy to the residual breast , instead of mastectomy , as it has been shown to be as effective as mastectomy in early disease . the relatively new skin - sparing mastectomy , often with immediate breast reconstruction , improves aesthetic outcomes and is oncologically safe . nipple - sparing mastectomy is newer and used increasingly , with better acceptance by patients , and again appears to be oncologically safe . breast reconstruction is an important adjunct to mastectomy , as it has a positive psychological impact on the patient , contributing to improved quality of life ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: gram - positive anaerobic cocci ( gpac ) account for approximately 2530 % of all isolated anaerobic bacteria from clinical specimens . gpac are the part of the commensal flora , but they often can become opportunistic pathogens . gpac can be isolated from a wide variety of sites such as blood , abscesses , and infections of skin and soft tissue , joints and bones , mouth , respiratory tract , gut , and urogenital tract . the taxonomy of this heterogeneous group has undergone extensive changes in the last decades due to the development and application of molecular identification methods , including pcr and the sequencing of the 16s rrna gene . a new method has been recently introduced for bacterial identification , matrix - assisted laser desorption ionization time of flight mass spectrometry ( maldi - tof ms ) . this rapid , precise , and cost - effective technology has been successfully implemented for accurately identifying gpac . since 1998 , the genus peptostreptococcus has been reclassified into several new genera and species . at present , the important genera of gpac that are commonly isolated from clinical material are peptostreptococcus ( mainly pe . anaerobius ) , peptoniphilus ( pt . harei ) , anaerococcus ( a. vaginalis ) , finegoldia magna , and parvimonas micra . however , they can also be isolated in a pure culture , especially f. magna . gpac have variable resistance to penicillin ( 710 % ) , clindamycin ( 720 % ) , and metronidazole ( 510 % ) . owing to the differences in antibiotic susceptibility among gpac species , it is very important to correctly identify isolates and test their susceptibility in order to administer effective antibacterial therapy . the aims of this study were to determine the species diversity of gpac isolated from cancer patients with infectious complications , analyse the sensitivity of these anaerobes to antibiotics , and calculate the resistance levels in our hospital . the study was performed at the 1,500 - bed n. n. blokhin cancer research center , which treats adults and children in moscow , russia , under auspices of the department of health . all clinical specimens included in this study were collected between june 2004 and october 2014 from patients with various malignancies . the clinical samples were transported within two hours of collection to a laboratory without the use of special anaerobic transport systems . they were inoculated onto schaedler agar ( biomerieux , france ) , supplemented with hemin , menadione , and 5 % blood . furthermore , they were placed in a thioglycollate broth ( biomerieux , france ) for enrichment . all plates were incubated anaerobically using the jar and anaerogen systems ( oxoid , uk ) at 37c for 48 hours . the primary plates were reincubated anaerobically while the subcultures were incubated aerobically to detect any bacteria that were not strictly anaerobic . identification of strains isolated until 2012 ( when it was still impossible to use the maldi - tof ms device ) was done by using gram staining and the rapid i d 32a ( biomerieux , france ) , vitek 2 ( biomerieux , france ) , or microscan walkaway ( siemens , uk ) systems . the gpac strains were stored in 20 % skim milk at 70c until their use in this study . in order to ensure final identification of isolates at the species level , the matrix - assisted laser desorption ionization time of flight mass spectrometry ( maldi - tof ms ) was employed . pure cultures of each frozen strain were subcultured twice on a blood agar anaerobically and analysed based on the direct transfer method . single or few colonies were smeared directly onto a metallic target plate in a thin film using an inoculation needle . all spots were overlaid with 1 l of an - cyano -4-hydroxycinnamic acid matrix solution in an organic solvent ( 50 % acetonitrile and 2,5 % trifluoroacetic acid ) . escherichia coli ribosomal proteins ( bacterial test standard , bruker daltonik , germany ) were used as a positive control and calibration standard . mass spectra were obtained using microflex lt mass spectrometer ( bruker daltonik , germany ) and then analysed with biotyper 3.0 software within the flexcontrol program . for bacterial identification , the peak list for an unknown isolate is compared with the reference library of spectra . the maldi - tof biotyper output is a log ( score ) in the range of 0 to 3.0 . according to the criteria proposed by the manufacturer , a log ( score ) between 1.7 and 1.99 indicates genus level identification , while a log ( score ) 2 indicates species level identification . evaluator ( m.i.c.e . ) , a new gradient endpoint device ( oxoid , england ) . strip operates on a principle similar to that of the original e - test device . eight antimicrobial agents were tested : metronidazole , amoxicillin / clavulanate , imipenem , penicillin g , vancomycin , linezolid , ciprofloxacin , and levofloxacin . the inoculum for each isolate was prepared in a saline solution at a density equivalent to the 1.0 mcfarland standard . after the inoculation of the brucella blood agar plates , strips for each agent were placed onto the plates according to the manufacturer 's instructions . mic was recorded at the point where the elliptical zone intersected with the strip . since m.i.c.e . strips sometimes may lead to false results in comparison with reference agar method , all resistant strains have been retested twice . the mic data was interpreted according to eucast breakpoints . in each batch a quality control for susceptibility was performed using b. fragilis atcc 25285 . the 81 strains of gpac were isolated from 72 clinical samples , obtained from the head and neck , lung , abdomen , bone and joint , and soft tissue infections of cancer patients . in nine clinical samples , a total of 74 isolates ( 91,4 % ) were correctly identified at the species level by maldi - tof ms and had scores greater than 2.0 . three isolates ( finegoldia magna , peptoniphilus harei , and anaerococcus vaginalis ) were identified to genus with a score between 1.8 and 2.0 . four strains ( one strain of finegoldia magna , two strains of anaerococcus vaginalis , and one strain of peptoniphilus gorbachii ) could not be reliably identified and had scores below 1.7 . the distribution of gpac is shown in table 1 . peptoniphilus harei ( pt . harei ) was the second most frequently isolated species , followed by parvimonas micra ( pa . micra ) and peptostreptococcus anaerobius ( pe . anaerobius ) , respectively . the most common sources of isolation of all gpac were skin and soft tissue and gastrointestinal and genitourinary tracts . none of the gpac species were isolated from blood samples during this study . amongst gpac , f. magna is the most pathogenic organism , which was most frequently isolated in a pure culture from various clinical infection sites . in our study , f. magna was isolated in a pure culture in seven clinical samples ( 18,4 % of all f. magna isolates and 8,6 % of total gpac ) . as a sole etiological agent , f. magna was isolated from patients with bone cancer after orthopedic surgery ( three cases ) , from surgical wounds ( three cases ) , and from a patient with cancer of the mediastinum ( one case ) . f. magna was mainly isolated from surgical wounds ( 45 % ) , body fluids ( 29 % ) , and abscesses ( 24 % ) . harei was recovered from a variety of infection sources in approximately equal proportions ( table 1 ) . harei frequently was isolated from clinical samples such as the body fluids ( 43 % ) and surgical wounds ( 39 % ) and rarely from abscesses ( 13 % ) . harei were correctly identified at the species level by maldi - tof ms . in the past , pt . asaccharolyticus , since these two species have the same biochemical characteristics and could not be differentiated from each other phenotypically . anaerobius was most frequently isolated from infections of the skin and soft tissues , as well as infections of the genitourinary tract . four isolates of anaerococcus vaginalis were obtained from skin and soft tissue infections , as well as wounds ( n = 3 ) and subcutaneous abscess ( n = 1 ) . identification of the two strains was not reliable , as species vaginalis / hydrogenalis of genus anaerococcus have very similar patterns . therefore , distinguishing their species is difficult . this was a new species of gpac described in 2007 . in a european study on antimicrobial susceptibility among 299gpac isolates , mainly from skin and soft tissue infections , the majority of isolates were identified as f. magna ( 37,1 % ) , pa . our data on the species diversity of gpac is in agreement with the study , which was conducted in 10 european countries . however , there are differences in the percentage ratio of various species , in particular pa . harei , possibly owing to the more diverse sources of isolation for gpac in our study . the mic distributions of antimicrobial agents tested against gpac isolates are presented in table 2 . all isolates were susceptible to imipenem , vancomycin , and linezolid ; the mic ranges were 0.0040.12 , 0.030.5 , and 0.54.0 , respectively . susceptibility to penicillin g , amoxicillin / clavulanate , metronidazole , ciprofloxacin , and levofloxacin varied for different species . in our hospital , metronidazole is the drug of choice for prevention and treatment of anaerobic infections . this drug had the highest in vitro activity compared with imipenem and beta - lactam / beta - lactamase inhibitor combinations , in particular amoxicillin / clavulanate . for most gpac isolates , the mic ranges for metronidazole were 0,251 , 0 g / ml . one f. magna strain isolated in pure culture from a decaying mediastinal tumor was resistant to metronidazole ( 32 g / ml ) . this strain was also resistant to penicillin g ( 32 g / ml ) , ciprofloxacin ( 32 g / ml ) , and levofloxacin ( 32 g / ml ) while demonstrating intermediate resistance to amoxicillin / clavulanate ( 8 g / ml ) . eight cases of postoperative mediastinitis due to f. magna have been described in literature , three of which were monomicrobial . however , isolated strains have been susceptible to regular antibiotics . f. magna isolates showed the highest mic values for penicillin ( 0.12 g / ml ) , amoxicillin / clavulanate ( 0.060.12 g / ml ) , and imipenem ( 0.030.06 g / ml ) as compared to other gpac . nonetheless , all strains were susceptible to these antibiotics with the exception of one multidrug - resistant strain ( table 2 ) . a total of 26 ( 68 % ) and 27 ( 71 % ) isolates of f. magna were resistant to ciprofloxacin ( 32 g / ml ) and levofloxacin ( 32 g / ml ) , respectively . one strain with reduced susceptibility to levofloxacin ( 8 g / ml ) was isolated . fluoroquinolone resistance among gpac has been reported with 14 % and 27 % resistance to ciprofloxacin and levofloxacin , respectively . harei showed the highest mic values for ciprofloxacin ( 1 - 2 g / ml ) and levofloxacin ( 48 g / ml ) as compared to other gpac species . one isolate was resistant to ciprofloxacin ( 32 g / ml ) while one strain demonstrated intermediate resistance ( 8 g / ml ) . a total of 12 isolates ( 52 % ) were resistant or showed intermediate resistance to levofloxacin ( mic 832 g / ml ) . with the exception of fluoroquinolones , pt . micra , two isolates were highly resistant to metronidazole ( mic 256 g / ml ) and were sensitive to other tested antibiotics . two isolates had reduced susceptibility to metronidazole ( 4 g / ml ) , as well as reduced susceptibility to penicillin ( 0,5 g / ml ) . furthermore , pa . micra strains showed the lowest mic values for amoxicillin / clavulanate ( 0.0150.03 g / ml ) and imipenem ( 0.0040.008 g / ml ) as compared to other gpac species ( table 2 ) . five isolates had mic values for penicillin 0.0040.015 g / ml , while two isolates had intermediate resistance ( 0.5 g / ml ) and one strain was resistant to penicillin ( 32 g / ml ) . this latter strain was also resistant to levofloxacin ( 32 g / ml ) and had reduced susceptibility to ciprofloxacin ( 8 g / ml ) . one strain was resistant to penicillin ( 1 g / ml ) , as well as ciprofloxacin and levofloxacin ( 32 g / ml for each ) . the second strain was only resistant to penicillin ( 32 g / ml ) . all pe . anaerobius isolates were susceptible to metronidazole , amoxicillin / clavulanate , and imipenem . however , three strains were resistant to ciprofloxacin and levofloxacin ( 32 g / ml ) . the combination of amoxicillin / clavulanic acid has been reported as being less effective against pe . all a. vaginalis isolates were resistant to ciprofloxacin and levofloxacin ( 32 g / ml ) but were sensitive to other tested antibiotics . gorbachii isolate was susceptible to all drugs , with the exception of levofloxacin ( 16 g / ml ) . the resistance of a. vaginalis and pt . gorbachii isolates to levofloxacin was noted by other authors . in conclusion , correct identification of gpac to species level and their susceptibility to antimicrobial agents is necessary in order to administer effective antibiotic therapy , as such data can vary substantially in different clinics . furthermore , much consideration must be given to the reduced susceptibility of gpac to penicillin , as well as frequent reports of resistance to metronidazole , which are often used in empirical antimicrobial therapy of infections caused by gpac .\noutput:\n" }, { "from": "agent", "value": "in total , 81 nonduplicate gram - positive anaerobic cocci ( gpac ) were involved in this study . the gpac were isolated from samples collected from cancer patients between 2004 and 2014 . species identification was carried out by matrix - assisted laser desorption ionization time of flight mass spectrometry ( maldi - tof ms ) . the majority of isolates were identified as finegoldia magna ( 47 % ) and peptoniphilus harei ( 28 % ) . the susceptibility of six species of gpac was determined for eight antibiotics according to e - test methodology . furthermore , all isolates were susceptible to imipenem , vancomycin , and linezolid . susceptibility to penicillin g , amoxicillin / clavulanate , metronidazole , ciprofloxacin , and levofloxacin varied for different species . one finegoldia magna isolate was multidrug - resistant ( i.e. , parallel resistance to five antimicrobial agents , including metronidazole , was observed ) . two parvimonas micra isolates were highly resistant to metronidazole ( mic 256 g / ml ) but were sensitive to other tested antibiotics ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: intracranial hemorrhage from moyamoya disease has been infrequently reported during pregnancy , and is exceptional in a caucasian pregnant woman . the intensive care management is also complicated as the patient may present both ischemic or hemorrhagic complications . we present a case with a favorable outcome despite a low glasgow coma score ( gcs ) on admission and refractory high intracranial pressure . a 26 - year - old caucasian pregnant woman at 36 weeks of gestation presented to the emergency department of a first hospital for a severe headache . soon after admission , she developed generalized tonic - clonic seizures with a gcs at 3 immediately after seizure . a caesarian section was performed without any delay under general anesthesia and mechanical ventilation . the brain computerized tomography ( ct ) performed immediately after revealed extensive bilateral intraventricular hemorrhage and a large hematoma in the splenium of the corpus callosum . an external ventricular drain was inserted bilaterally . despite bilateral ventricular drainage and intensive care management , intracranial pressure ( icp ) the patient was transferred to the university hospital on day 8 . on admission , gcs was 3/15 with abolition of brainstem reflexes . as the eeg showed burst suppression , barbiturate overdose was suspected and continuous infusion was stopped . however , high intracranial pressure persisted above 40 mm hg . on brain ct ( fig .1 ) , the size of the intraventricular hemorrhage had decreased on the left but not on the right side and the sulci were diffusely obliterated , confirming the intracranial hypertension . the right drain was impinged in the ventricular clot and was ineffective , even after the in loco infusion of a fibrinolytic agent ( 5 mg rt - pa ) , leading to refractory high intracranial pressure . endoscopic removal of the right ventricular clots was first tried , but it was necessary to perform a larger right frontal craniotomy . intracranial pressure decreased postoperatively but the gcs remained at 3/15 with absence of brainstem reflexes . a brain magnetic resonance imaging ( mri ) performed on day 20 showed the partial removal of the intraventricular clot with decreased ventricular size and reopening of the sulci . mr - angiography disclosed extensive arterial anomalies with occlusion of the right internal carotid artery ( ica ) , severe stenosis of the left ica and of the m1 segment of the left middle cerebral arteries ( mca ) , occlusion of the left posterior cerebral artery , collaterals arising from the external carotid arteries , and an extensive abnormal vascular network appearing as multiple small collateral vessels developed mainly in basal cisterna and in the thalami ( fig . this pattern evoked a moyamoya syndrome that occurred very early in age as demonstrated by the hypoplastic right bony carotid canal ( fig . perfusion - weighted mri showed moderate hemodynamic disturbances in both hemispheres , predominant on the left side , with delayed time - to - peak , prolonged mean - transit time and a compensatory increased cerebral blood volume . the patient was monitored in the neurosurgical intensive care unit ( nicu ) by a continuous measurement of jugular bulb venous oxygen saturation ( svjo2 ) . while normal values are in the range of 6065 % , values ranging from 5055 % were obtained in our patient . these values were considered as relatively low in a patient who was mildly hypothermic ( 35c ) and who had a remaining barbiturate impregnation as assessed by the eeg pattern and by the determination of serum thiopental concentration ( 28.5 g / ml ) . other factors that could have lowered svjo2 were ruled out ( hypoxia or hypercapnia ) . cerebral perfusion pressure ( cpp ) was maintained higher than 70 mm hg by a continuous norepinephrine infusion , with pao2100 mm hg , paco2 30 mm hg , and hemoglobin concentration above 12 g / dl , with svjo2 values reaching 60 % as a result . on day 16 , brainstem reflexes reappeared and gcs was 6 ( e1 , v1 , m4 ) , improving to e4 , v1 , m5 two days later . the patient was discharged from the nicu on day 40 with a gcs of 11/15 . intracranial hemorrhage during pregnancy is , in most cases , caused by cerebral aneurysms , arteriovenous malformation , and rarely by moyamoya disease . moyamoya disease is characterized by the formation of an abnormal vascular network , known asmoyamoya vessels , secondary to the progressive stenosis or occlusion of the distal icas and proximal aspects of the main cerebral arteries . its etiology is unknown and the clinical presentation of this rare condition is usually characterized by recurrent ischemic strokes . different possible causes of intracranial hemorrhage in moyamoya disease were debated : rupture of saccular aneurysm in the circle of willis or small peripheral pseudoaneurysm , usually arising from the perforating arteries or choroidal arteries or rupture of fragile moyamoya vessels in the basal ganglia . intracranial hemorrhage at atypical sites such as callosal body and mesencephalon should raise suspicion of moyamoya disease . in the present case , the origin of the intraventricular bleeding was likely a rupture of fragile moyamoya vessels in the corpus callosum . we excluded moyamoya syndrome secondary to irradiation of the head , down syndrome , brain tumor , neurofibromatosis and meningitis . intracranial hemorrhage from moyamoya disease has been infrequently reported during pregnancy , and is exceptional in a caucasian pregnant woman in comparison with asian women . there is no firm evidence that pregnancy in patients with moyamoya disease is a risk factor for intracranial hemorrhage or cerebral ischemia . our patient had an uneventful pregnancy and delivery 3 years before . however , it appears logical that intracranial hemorrhage usually occurs in and after the second trimester related to hemodynamic changes during pregnancy . the maternal prognosis of such bleeding is usually poor . in a recent fatal case similar to our observation , a 29 - year - old female developed intraventricular hemorrhage at 14 weeks of gestation , together with repeated bilateral cerebral infarction . the possibility of arterial vasospasm after intraventricular bleeding due to moyamoya disease is still debated . vasospasm is observed not only after subarachnoid hemorrhage , but also in patients with ruptured arteriovenous malformations resulting in intraventricular hemorrhage without subarachnoid clot . in moyamoya disease , the patient 's brain appears particularly vulnerable to ischemic conditions for several reasons : stenosis or occlusion of one or more major cerebral arteries , reduced caliber of the moyamoya vessels , and possible vasospasm . the intensive care management of the patients presenting simultaneously with ischemic and hemorrhagic complications from moyamoya disease appears difficult , particularly when high intracranial pressure is also present . the first objective is to obtain an adequate control of intracranial pressure ( icp ) . hemodynamic reserve for changes of intracranial perfusion pressure may be severely impaired in patients with moyamoya disease . intraventricular hemorrhage results in hydrocephalus , followed by increased icp . because hemodynamic insufficiency and an increase in icp may cause irreversible ischemia , resolution of increased icp is critical for patients with moyamoya disease in terms of cerebral hemodynamics . ventricular drainage is the first measure , but may be ineffective when clots become obstructive . there are insufficient data to recommend the local use of fibrinolytic agents , even if in some series they seemed to enhance clot lysis . endoscopic removal of the hematoma during ventriculostomy is a surgical option , or even , as in the present case , thrombectomy after craniotomy . hyperventilation is deleterious in moyamoya patients , showing that the abnormal vessels are hypersensitive to some physiologic parameters such as pco2 . the continuous monitoring of jugular bulb svjo2 is extensively used for detecting episodes of cerebral hypoxia / ischemia . it is determined by oxygen arterial saturation ( sao2 ) , hemoglobin concentration , cerebral blood flow , and cerebral metabolic rate of oxygen . in patients with traumatic brain injury , the ischemic threshold for svjo2 is less than 50 % , but the value for other conditions is not precisely known . in the present case , svjo2 values of 50 % were considered as low in a patient who was mildly hypothermic and still under the influence of barbiturates . as ischemic lesions were demonstrated on the brain ct , we tried to optimize oxygen delivery by maintaining the cpp at 70 mm hg , with also a special attention to respiratory parameters and to hemoglobin concentration . however , we agree that there are no literature data confirming that the therapy should be directly oriented to obtain svjo2 values higher than 60 % . in conclusion , intraventricular hemorrhage following moyamoya disease is a rare entity during pregnancy , particularly in caucasian women . as some patients may have experienced a previous pregnancy without complication , it remains difficult to establish the risk factor directly related to pregnancy . the prognosis , usually poor , could be influenced by surgical removal of the clot , in case of refractory high icp , and by the adequate management of hemodynamic and respiratory parameters , particularly in the type with both hemorrhagic and ischemic complications . vasospasm is a possible complication that can not be easily demonstrated in this particular setting . the question if a revascularization procedure is effective to prevent rebleeding is not yet fully answered .\noutput:\n" }, { "from": "agent", "value": "intraventricular hemorrhage during pregnancy is usually followed by a poor recovery . when caused by moyamoya disease , ischemic or hemorrhagic episodes may complicate the management of high intracranial pressure . a 26 - year - old caucasian woman presented with generalized seizures and a glasgow coma score ( gcs ) of 3 during the 36th week of pregnancy . the fetus was delivered by caesarean section . the brain ct in the mother revealed bilateral intraventricular hemorrhage , a callosal hematoma , hydrocephalus and right frontal ischemia . refractory high intracranial pressure developed and required bilateral ventricular drainage and intensive care treatment with barbiturates and hypothermia . magnetic resonance imaging and cerebral angiography revealed a moyamoya syndrome with rupture of the abnormal collateral vascular network as the cause of the hemorrhage . intracranial pressure could only be controlled after the surgical removal of the clots after a large opening of the right ventricle . despite an initially low gcs , this patient made a good functional recovery at one year follow - up . management of refractory high intracranial pressure following moyamoya related intraventricular bleeding should require optimal removal of ventricular clots and appropriate control of cerebral hemodynamics to avoid ischemic or hemorrhagic complications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a substantial proportion of patients who repeatedly present to hospitals with symptoms for which conventional pathology can not be identified , show evidence of psychological distress that is either not expressed or is unrecognized in the general practice consultation . the phenomena has two aspects : the expression of psychological illness through physical symptoms , and repeated medical help - seeking for multiple medical symptoms without organic disease . somatization diagnosis is a prevalent , expensive , and a difficult - to - treat problem for general practitioners . it is also reported that some cultures stigmatize psychological disorder more than others . to overcome the confusion around the term somatization , neither somatized mental distress nor somatization disorders adequately account for most patients seen with mups . patients show up at hospitals with symptoms for a variety of reasons , including the disruption caused by the severity of the symptoms and the patients concerns about what they mean . there was a paucity of studies done on mups in kerala , a south indian state . the objective of this study was to examine the sociodemographic and other clinical variables associated with mups . the clinical sample was taken from the general / internal medicine outpatient clinic of the government medical college , thrissur , kerala , india . the medical doctor , with psychiatry experience , saw the potential patients together with the physicians on mondays in the clinic . the referred cases meeting the criteria for mups were enrolled for the study , for approximately three years . the medical doctor discussed the cases with the consultant psychiatrist ( pk - second author ) and confirmed the diagnosis . the criteria for mups were one or more physical symptoms after appropriate investigation , which could not be explained by a general medical condition , and the symptoms caused clinically significant distress or impairment in social and occupational functioning , in excess of what would be expected from the history and physical examination and laboratory findings . the medical doctor with psychiatry experience completed the questionnaire , which included the sociodemographic profile , with details regarding frequency of physical complaints , duration of symptoms , the number of visits to the doctor , investigations done , psychosocial and environmental stressors , and personality disorder . the symptoms were assessed using the symptom enquiry checklist used in the world health organization international study on somatoform disorders ( 1994 ) , which had 73 questions . in this cross - sectional study , we provide descriptive information on the sociodemographic variables , summarized in table 1 , and clinical variables , summarized in tables 2 and 3 , of 48 participants enrolled in this exploratory study . there were a total of 274 symptoms , which is an average of 5.7 symptoms per patient . in contrast to the female - to - male ratio of 5 : 1 ( dsm - iv - tr ) , we found a female - to - male ratio of 7 : 1 . this may be because of the difference in the western population versus the indian population . the medical knowledge of urban people may be discouraging them from reporting psychological distress as a physical disease . consistent with dsm - iv - tr , our study also showed that avoidant and obsessive compulsive personality disorders were commonly associated with mups . in contrast , we did not find an association between mups and paranoid , histrionic , and antisocial personalities . the preponderance of females in this study is not consistent with the usual hospital data in india . in conditions where community data shows a higher prevalence of females , hospital data shows male predominance . however , the findings were contrary in case of mups in this study . for physical manifestations arising from psychological distress , . the severity , chronic nature , and social acceptance of symptoms may be the reasons for this discrepancy . it may be that the predominance of adults in this study reflects the usual hospital patient population . seeking out treatmenthowever , in the eca study done in us , in 3,132 community respondents with somatization disorder , the majority was unmarried or divorced , which is consistent with the western culture . in india , women may be bearing the strain of marital conflict , expressing it through culturally acceptable physical symptoms . this has been reported in a study from the neighboring state of tamil nadu , another southern state in india . consistent with our results , headache was the most common symptom and obsession scores were also high in the quoted study done in tamil nadu . a medical doctor in india has relatively insignificant exposure in psychiatry during the medical school / college training period . after the training they practically have no avenues to get further exposure to psychiatry as a mental health professional 's work , in isolation . hence , a physician who is not a psychiatrist is without adequate confidence to diagnose a psychiatric syndrome . the more the patient is investigated , the more a patient is convinced about the physical basis . on account of the psychogenic etiopathophysiology , although it has been estimated that 5 % of the patients in general practice present with severe forms of somatization , this disorder is clearly underdiagnosed , and on many occasions physicians tend to repeatedly pursue an organic etiology for the patients complaints , using multiple test procedures , medication , and surgical operations instead of recognizing a somatization disorder . finally , patients with a somatization disorder tend to withdraw from pleasurable activities and have less productivity because of discomfort , fatigue or fear of exacerbation of their symptoms . in a review on somatizing and psychologizing patients , there were no consistent differences between people with psychiatric disorders , who presented with psychological symptoms versus who presented with physical symptoms . although 25 % of the affected patients present with only psychological symptoms , the remainder may accept the possibility of a psychosocial component to their physical symptoms , even if they do not volunteer it during the consultation . practical reasons , such as lack of time , or a sense that problems are not relevant or amenable to treatment , seem more important than failure to recognize their own mental distress , which may explain why patients choose not to disclose psychological problems during consultations . one of the few longitudinal studies identified a pattern whereby symptoms occurring at a time of newly increased stress tended to be attributed to stress . patients came to doctors with mups only if the stress persisted . in our study , a medical doctor with psychiatry experience who was not a psychiatrist easily elicited the stressors . lack of time is not a restraining factor to elicit stressors / stress , only an orientation and an inclination for it is required . patients may often perceive doctors as denying the validity of their symptoms . even as doctors have medical models of illnesses ; patients also have lay models , which are complex and broadly consistent . these include the name of the condition and its symptoms , the personal consequences of it , how long will it last , and the extent to which it can be controlled or cured . there are eight dimensions proposed : four on the etiology ( stress , environment , lifestyle , and weak constitution ) , three concerning mechanism ( wearing out , internal structure , and internal function ) , and a final dimension of concern raised by the symptom proposed . patients are able to accept a medical opinion when doctors develop non - blaming models of conditions with their patients and form constructive alliances against the illness . illness belief models explore how patients see illness as threatening . the doctors seek to reduce that threat through treatment and reassurance . unfortunately , reassurance is not always effective ; between a third and half of the patients report a continuing concern about serious illness after normal cardiac ultrasound or angiography . psychological models of threat reduction suggest two separate processes : emotional - heuristic ( calming , protecting , and threat - avoiding ) , and cognitive - systematic ( information - seeking and threat - analyzing ) . although emotional , threat avoiding , verbal and non - verbal reassurance may be effective in alleviating distress in the short term , it may not be effective to weaken illness representations . if symptoms recur , repeated reassurance is likely to produce a cycle of reassurance seeking and giving that is self - perpetuating . in contrast , the cognitive model of threat analyzing is more threatening for patients in the short term , but more likely to produce long - term changes , which in turn , may be associated with improvement . the physician tends to be initially concerned to rule out treatable medical conditions , and when none are found , leads to excessive help - seeking behavior . patient relationship , as the patients sense that their doctor has lost interest in them or view them as bothersome . although many physicians are eager to refer the patient for psychiatric evaluation and treatment , patients might see the referral as their doctor 's way of questioning the reality of their symptoms . this challenge has encouraged the development of treatment approaches for somatization disorder that meet the different demands of the patient and the referring physician . kaiser - permanente , a us health maintenance program has shown that somatizing patients could bankrupt the healthcare financing system and these patients can be helped leading to reduced healthcare costs . the affective cognitive behavioral therapy is recommended for physicians , for the treatment of mups , which includes the following : providing continuity of care , avoiding unnecessary tests and procedures , providing frequent , brief , and regular office visits , always performing a physical examination , avoiding making disparaging comments like , your symptoms are all in your head , setting reasonable therapeutic goals like maintaining the functioning despite ongoing pain . in a review on human psychoneuroimmunology studies , authors found that immune modulation by psychosocial stressors or interventions could lead to actual health changes . the major strength of this study is the large sample size ( n = 48 ) in an indian population . one more strength is the unique clinical sample having the features of both a rural setting and a tertiary care hospital . in our study , we could not calculate the prevalence , because we did not have the total number of patients who showed up at the medicine clinic on mondays . our study included subjects with mups and not with a dsm - iv - tr diagnosis of somatization or somatoform disorder . however , somatization disorder terminology will be changed to simple and complex somatic symptom disorders in dsm - v . another limitation of this study was that we could not analyze an association between mups and comorbid psychiatric diagnoses . in the hospital where this study was done , the patients presenting to the clinics had only their prescriptions , without a documented diagnosis . to our knowledge this is the first psychosocioeconomic study of mups done in kerala , india . more studies are warranted focusing on non - pharmacological treatment and psycho - education on mindfuture studies should also shed light on specific cytokines associated with mups for personalized management , which is a national institute of mental health mission and priority . there is also a need for studies to examine the effect of a combination of antidepressants and cognitive behavioral therapy on mups .\noutput:\n" }, { "from": "agent", "value": "background : there is a paucity of studies done on medically unexplained physical symptoms ( mups ) in kerala , india . the objective of this study was to examine the sociodemographic and other clinical variables associated with this condition.materials and methods : the clinical sample was taken from the general medicine clinic of a tertiary care hospital , in kerala . the referred cases meeting the criteria ( n = 48 ) for medically unexplained physical symptoms were enrolled for this cross - sectional study . the medical doctor with experience in psychiatry completed the questionnaire.results : most of the patients were middle - aged females from rural areas . the most common symptom reported was headache . most of the patients had symptoms for five years or more and had seen two - to - five consultants . a majority of the patients had undergone special investigations and a few had expensive and invasive investigations . cluster c personality disorders were the most common associated personality disorders with medically unexplained physical symptoms.conclusions : to our knowledge this is the first psychosocioeconomic study on medically unexplained physical symptoms , done in kerala , india . medically unexplained physical symptoms cause loss of productivity and economic burden and are a major public health problem . future studies are warranted focusing on non - pharmacological treatment , psycho - education on mind body association , and medical models on specific cytokines associated with medically unexplained physical symptoms for personalized management , and to examine the effect of a combination of pharmacotherapy and cognitive behavioral therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ehlers - danlos syndrome ( eds ) is a heterogeneous group of heritable connective tissue disorders characterized by skin hyperextensibility , joint hypermobility , easy bruising , and tissue fragility . as 1 of 6 major types of eds , vascular eds ( veds ) collagens provide structure and strength to connective tissue , which is mostly found in skin , blood vessels , and internal organs . veds is the most rare form of eds ( 5 % of all eds patients ) but the most severe because of complications related to the vascular system , which can result in arterial rupture in young adults . such complications are dramatic and unexpected , often presenting as sudden death , acute abdomen , retroperitoneal hemorrhage , uterine rupture at time of delivery , and / or shock . therefore , establishing a correct diagnosis of veds is extremely important because the timing of diagnosis can influence prognosis . hypermobility of the large joints and skin hyperextensibility , characteristic of the more common eds forms , are unusual in veds ; thus , colonic perforation or aneurysm rupture may be the first presentation of the disease . veds is typified by a number of characteristic facial features ( eg , large eyes , small chin , sunken cheeks , thin nose and lips , lobeless ears ) . here , we describe veds lacking these characteristic facial attributes in a healthy man . in december 2012 , a 24 - year - old healthy japanese man with abdominal pain was admitted to the emergency room . , we learned his mother had a history of extensive bruising since childhood , idiopathic hematothorax , and aortic dissection in youth . on admission , he showed stable vital signs but presented with thin translucent skin , extensive bruising , and toe - joint hypermobility . on examination , hypermobility of the small joints and subcutaneous hemorrhage were also detected ( figure 1 ) . however , we did not observe hypertelorism , bifid uvula , or cleft palate , which are features of loeys dietz syndrome . enhanced computed tomography revealed free air , diverticula , and perforation in the sigmoid colon . the lesion of the sigmoid colon perforation was removed , and hartmann procedure was performed because of severe contamination in the emergency operation . during the surgery , the control of bleeding was required because of the vascular fragility of the patient . the patient had skin necrosis on day 12 but was discharged from the hospital 1 month post - operatively . he was asked to avoid hard labor since veds was suspected based on the major clinical criteria of thin skin with visible veins , colon rupture , and easy bruising . the characteristic facial features of this condition ( eg , large eyes , small chin , sunken cheeks , thin nose and lips , lobeless ears ) were not observed ( figure 2 ) . reversal of the hartmann procedure was performed 4 months later . to confirm the diagnosis of vedsthe patient showed none of the characteristic facial features ( eg , large eyes , small chin , sunken cheeks , thin nose and lips , lobeless ears ) of vascular ehlers - danlos syndrome . dermal fibroblasts were obtained from explants of a skin biopsy specimen taken from the upper arm of the patient and a sex - and age - matched control , after appropriate informed consent had been given . the cultures were maintained in dulbecco modified eagle medium containing 10 % fetal bovine serum in a co2 incubator at 37 c . the study was approved by the ethical committee of dokkyo medical university , school of medicine ( japan ) . collagen synthesis in the cultured dermal fibroblasts was assessed to determine whether the production of type iii collagen was reduced in the patient . after the fibroblasts were cultured with [ h ] proline , type iii collagen and type i collagen [ 1 ( i ) + 2 ( i ) ] were isolated from the cultured dermal fibroblasts of the patient and sex - and age - matched control . afterwards , they were separated using sodium dodecyl sulfate - polyacrylamide gel electrophoresis and imaged using fluorography . the amount of the 1 chain of type iii collagen secreted into the culture medium significantly decreased compared with that secreted from the control ( figure 3 ) . cultured fibroblasts were pulse - labeled with [ h ] proline in fresh medium , and the secreted proteins were separated by sodium dodecyl sulfate - polyacrylamide gel electrophoresis under normal ( ) or reducing ( + ) conditions . the synthesis of type i collagen in this patient was the same as in controls . however , the synthesis of type iii collagen was reduced compared with the normal control values ( inside circle ) . n , normal control ; p , patient with vascular ehlers - danlos syndrome . based on the reduction in the 1 chain of type iii collagen , we directly amplified and sequenced the col3a1 gene from genomic dna and detected a single base - pair change ( g t ) predicted to convert a glycine to a cysteine in the encoded protein . subsequently , total cellular ribonucleic acid was extracted from cultured dermal fibroblasts , and a complementary dna of the col3a1 gene was synthesized by priming with random hexamers . after the amplification products from a polymerase chain reaction were directly sequenced , we identified the same heterozygous mutation within exon 32 of the col3a1 gene in proband c. 2221 ( g t , gly cys ) ( figure 4 ) . a heterozygous mutation was found within exon 32 of the col3a1 gene in proband c. 2221 ( g t , gly cys ) . subsequently , the patient was diagnosed with veds based on reduced type iii collagen synthesis and identification of a mutation in the col3a1 gene . after confirmed diagnosis , the patient and mother were prescribed oral celiprolol ( beta blocker ) . dermal fibroblasts were obtained from explants of a skin biopsy specimen taken from the upper arm of the patient and a sex - and age - matched control , after appropriate informed consent had been given . the cultures were maintained in dulbecco modified eagle medium containing 10 % fetal bovine serum in a co2 incubator at 37 c . the study was approved by the ethical committee of dokkyo medical university , school of medicine ( japan ) . collagen synthesis in the cultured dermal fibroblasts was assessed to determine whether the production of type iii collagen was reduced in the patient . after the fibroblasts were cultured with [ h ] proline , type iii collagen and type i collagen [ 1 ( i ) + 2 ( i ) ] were isolated from the cultured dermal fibroblasts of the patient and sex - and age - matched control . afterwards , they were separated using sodium dodecyl sulfate - polyacrylamide gel electrophoresis and imaged using fluorography . the amount of the 1 chain of type iii collagen secreted into the culture medium significantly decreased compared with that secreted from the control ( figure 3 ) . cultured fibroblasts were pulse - labeled with [ h ] proline in fresh medium , and the secreted proteins were separated by sodium dodecyl sulfate - polyacrylamide gel electrophoresis under normal ( ) or reducing ( + ) conditions . the synthesis of type i collagen in this patient was the same as in controls . however , the synthesis of type iii collagen was reduced compared with the normal control values ( inside circle ) . based on the reduction in the 1 chain of type iii collagen , we directly amplified and sequenced the col3a1 gene from genomic dna and detected a single base - pair change ( g t ) predicted to convert a glycine to a cysteine in the encoded protein . subsequently , total cellular ribonucleic acid was extracted from cultured dermal fibroblasts , and a complementary dna of the col3a1 gene was synthesized by priming with random hexamers . after the amplification products from a polymerase chain reaction were directly sequenced , we identified the same heterozygous mutation within exon 32 of the col3a1 gene in proband c. 2221 ( g t , gly cys ) ( figure 4 ) . a heterozygous mutation was found within exon 32 of the col3a1 gene in proband c. 2221 ( g t , gly cys ) . subsequently , the patient was diagnosed with veds based on reduced type iii collagen synthesis and identification of a mutation in the col3a1 gene . after confirmed diagnosis , the patient and mother were prescribed oral celiprolol ( beta blocker ) . we describe here the treatment of a patient with veds lacking the typical characteristic facial attributes of this condition and identified a previously undocumented mutation in the col3a1 gene . no standardized procedure for colonic perforation in veds patients has been developed . here , we performed reversal of the hartmann procedure , as in most previous cases . however , some cases have been managed with subtotal colectomy as the first - line management because colonic reperforation has been reported . thus , conducting genetic assays to confirm diagnosis could be important for determining the operative technique or in saving relatives through treatment with beta blockers . in the present case , the patient and his mother were prescribed the 1 - adrenoceptor - antagonist celiprolol . in a recent randomized multicenter trial , treatment with celiprololwas shown to result in a threefold decrease in the number of arterial events ( rupture or dissection ) during a mean follow - up of 47 months , and therefore might delay the need for invasive treatment . in the present case , the overall life expectancy of patients with veds is dramatically shortened , largely as a result of vascular rupture , with a median life span of 48 years ( range , 673 years ) . in addition , the prognosis after treatment is still poor . in particular , previous reports have observed that the mortality rate ranged from 29 to 50 % . thus , close outpatient follow - up and appropriate guidance to the patient and family ( eg , encouragement to contact the doctor when the patient suddenly notices unexplained pain ) should be provided . in addition , the patient should carry a medical attention bracelet and papers noting information on the condition and blood group . our case illustrates an awareness of the clinical characteristics of veds and the family history is important because of high mortality even in young people . the mutation in our case has not been previously documented and might explain the non - characteristic facial appearance . thus , genetic assays could help in determining the surgical procedure and offer benefits to relatives , since this condition is inherited in an autosomal dominant manner .\noutput:\n" }, { "from": "agent", "value": "abstractas a type of ehlers - danlos syndrome ( eds ) , vascular eds ( veds ) is typified by a number of characteristic facial features ( eg , large eyes , small chin , sunken cheeks , thin nose and lips , lobeless ears ) . however , veds does not typically display hypermobility of the large joints and skin hyperextensibility , which are features typical of the more common forms of eds . thus , colonic perforation or aneurysm rupture may be the first presentation of the disease . because both complications are associated with a reduced life expectancy for individuals with this condition , an awareness of the clinical features of veds is important.here , we describe the treatment of veds lacking the characteristic facial attributes in a 24 - year - old healthy man who presented to the emergency room with abdominal pain . enhanced computed tomography revealed diverticula and perforation in the sigmoid colon . the lesion of the sigmoid colon perforation was removed , and hartmann procedure was performed . during the surgery , the control of bleeding was required because of vascular fragility . subsequent molecular and genetic analysis was performed based on the suspected diagnosis of veds . these analyses revealed reduced type iii collagen synthesis in cultured skin fibroblasts and identified a previously undocumented mutation in the gene for a1 type iii collagen , confirming the diagnosis of veds . after eliciting a detailed medical profile , we learned his mother had a history of extensive bruising since childhood and idiopathic hematothorax . both were prescribed oral celiprolol . one year after admission , the patient was free of recurrent perforation.this case illustrates an awareness of the clinical characteristics of veds and the family history is important because of the high mortality from this condition even in young people . importantly , genetic assays could help in determining the surgical procedure and offer benefits to relatives since this condition is inherited in an autosomal dominant manner ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: combined sewer overflows ( csos ) are present in the united states , europe and other parts of the world . flow in these combined systems can exceed the capacity of wwtps ( wastewater treatment plants ) during stormflows so that mixtures of untreated sewage and stormwater runoff are released to receiving waters . in the us , over 700 cities have csos , and they are most commonly located on the east coast , great lakes , and pacific northwest . csos have been identified as important sources of polycyclic aromatic hydrocarbons , organochlorine compounds , nutrients , and chemical oxygen demand . recent studies have identified csos as a potential source of wastewater micropollutants ( wmps ) to receiving waters , with substantially elevated wmp concentrations occurring in urban waters following cso discharges . for example , caffeine concentrations in urban streams in switzerland were higher than in treated wwtp effluent , and stream concentrations were highest during stormflow conditions and lowest during baseflow conditions . loads for ibuprofen have been found to be up to 100 times greater in cso discharges than in treated effluents . patterns in the enantiomer fraction of the chiral pharmaceutical propranolol in several freshwater sites and a coastal bay indicated that cso discharges and bypass flows were the largest source of propranolol to coastal waters . furthermore , csos constitute a more important source of bacteria than treated wwtp discharges . benotti and brownawell s model of csos as a source of wmps to an urban estuary indicates that cso discharges can have concentrations 10 or more times greater than treated wastewater . this model predicts that lack of treatment is a more important factor than dilution by rainfall runoff for compounds with high removal efficiencies ; thus , this model predicts that for compounds with high removal efficiencies , higher concentrations can be expected in cso flows compared to treated wwtp flows . conversely , for compounds that are not efficiently removed by wwtp processes , cso discharge concentrations should be more similar to treated discharge concentrations , as dilution by runoff should be a more important factor than the lack of treatment . although this model assumes constant removal rates by a wwtp , removal rates can be expected to decrease for caffeine , propranolol , and estrogens , as flows increase ( and residence times decrease ) through a wwtp because of greater water - volume inputs during storms . thus , hormones and other wmps that are efficiently removed by treatment during normal flows ( resulting in low or nondetectable concentrations in treated effluent ) might have substantially elevated concentrations in both cso bypass and treated effluent flows during storms due to high flow rates . consistent with these expectations , concentrations of caffeine and other compounds , which were generally efficiently removed during wastewater treatment , were greater in cso bypass flows and during stormflow in urban streams receiving cso discharge than in treated effluents in burlington , vermont , usa . in contrast to efficiently removed compounds , the highest concentrations for galaxolide ( a poorly removed compound ) occurred in treated effluents , with lower concentrations in cso discharges . the presence of estrogens in cso discharges has been suggested as a cause of endocrine disruption in fish , but this study did not directly measure estrogen concentrations . little is known about the relative contribution of cso discharges to hormone loads in the environment , although the occurrence of peak concentrations of estrone ( e1 ) and 17 - estradiol ( e2 ) in an urban stream during stormflows has been attributed to cso discharges . limited attention has been paid to characterizing the importance of csos as a source of hormones to the aquatic environment despite increasing documentation describing the sources and effects of estrogens on biologic populations . in part , this is due to difficulties in collecting representative samples and measuring flows during these short - duration , highly variable discharges . the few studies that have included direct sampling of cso flows have relied on data obtained from a limited number of grab samples . quantitative assessment of loads from cso discharges requires collection of flow data for cso and the treated effluent and flow - weighted samples collected over the duration of rainstorms . this study assesses the relative contribution of cso bypass flows and treated wastewater effluents to the load of steroid hormones and other wmps from a wwtp to a lake and relates these contributions to the removal efficiency by wwtp processes over a range of flows . comparison of annual loads from treated wastewater with respect to removal efficiencies provides a quantitative assessment of the relation between degree of removal and the importance of cso discharges as an environmental source of individual hormones and wmps . the effect of higher flows on removal efficiencies in the wwtp are also assessed , along with implications for high flows as a disproportionate source of compounds from treated effluents . concentration data are based on two methods for unfiltered samples : a hormone method and an organic wastewater compound ( owc ) method . the hormone method determines 20 analytes including estrogens , androgens , and additional compounds . reporting levels of 100 ng / l for bisphenol a ( bpa ) and 2000ng / l for 3 - beta - coprostanol ( cop ) and cholesterol ( cho ) were adjusted because of laboratory blank limitations . twelve hormone method compounds with sufficient detection frequency ( 55 % or greater ) to allow computation of cso bypass loads are discussed in this paper : three estrogens , e1 , e2 , and estriol ( e3 ) ; six androgens , 11 - keto testosterone ( 11 - k ) , androstenedione ( adsd ) , cis - androsterone ( cand ) , dihydrotestosterone ( dht ) , epitesosterone ( epi ) , and testosterone ( tes ) ; two sterols , cop and cho , and bpa ( table s2 in supporting information ) . mean method recoveries from spike reagent water for the estrogens and androgens discussed in this paper were between 90 and 115 % , with relative standard deviations ( rsds ) from 10 to 18 % ( table s2 ) . mean recoveries for cho and cop in these reagent - water spikes were higher ( about 168 % ) , as were rsds ( about 38 % ) and were the result of unusually low ( 10 % for most ) cholesterol - d7 isotope - dilution standard recoveries in reagent - water only matrices ( including blank samples ) as discussed in foreman and others and the supporting information . two analytes analyzed using the hormone method were detected in one or more of the 23 field blanks at concentrations above the detection limit : cop in two blanks at 2600ng / l and cho in four blanks at 6000 ng / l . all concentrations of cop 5000 ng / l and concentrations of cho 12,000 ng / l were censored in field samples . the median relative percent difference in analyte concentrations was 14 % for the 18 replicate samples analyzed using the hormone method . extracts are analyzed for 69 compounds by gas chromatography with electron impact mass spectrometry operated in full scan mode . six analytes from the owc method had sufficient detection frequency to allow computation of loads and are discussed in this paper : benzophenone ( bep ) , beta - sitosterol ( sit ) , caffeine ( caf ) , galaxolide ( gal ) , tris ( 2 - butoxyethyl ) phosphate ( tbep ) , and triclosan ( tcs ) . reporting levels applied in this study to these compounds are 200 ng / l , except for sit ( 800 ng / l ) . the six compounds analyzed by the owc method along with cop , cho , and bpa are collectively referred to as wmps in the remainder of this paper to help distinguish them from estrogens and androgens . the six compounds analyzed using the owc method had median spike recoveries of 80 % and median rsd ( relative standard deviations ) of 8.5 % for reagent , surface , and groundwater spikes . recoveries for these spikes ranged from 62 to 105 % , with rsds between 5 and 16 % . recoveries for sit were generally lower ( median of 55 % ) and more variable ( median rsd = 22 % ) than the other five compounds included in the owc method . none of the compounds analyzed using the owc method had a detection reported in any of the seven blank samples collected during the study . median relative percent difference for the six replicates collected during the study was 13 % . additional details on quality assurance and method performance data for this method are available in the supporting information . samples were collected from the main burlington wwtp in burlington , vermont , usa , between november 2007 and december 2008 in order to characterize the concentrations of hormones and wmps during wet - and dry - weather conditions . this wwtp serves approximately 30,000 people and has a design capacity of 0.2 m / s . when the capacity of this wwtp is exceeded during stormflows , untreated flows are discharged to the receiving waters ; such flows are referred to as cso bypass flows . the availability of flow data for both cso bypass flows and treated plant effluent flow at this wwtp allowed collection of flow - weighted samples required for calculating annual loads for target analytes . samples collected from the plant effluent ( pe ; n = 22 ) represent water discharged from the plant following all physical , biological , and chemical treatment steps ( figure s1 ) at this wwtp . pe samples were used to calculate treated plant effluent loads as indicated below . samples of untreated wastewater were collected from two sites plant influent ( pi ) and combined sewer effluent ( cse ) . unlike pe samples , samples from pi and cse sites receive no biological treatment and minimal physical treatment . pi samples ( n = 18 ) were collected between the grit removal and primary settling treatment steps ( figure s1 ) . cse samples ( n = 10 ) represent cso bypass flow from the wwtp during cso events ; treatment of these flows is limited to vortex separation for large particle removal and disinfection . cso bypass loads are based on data from all cse samples and data from select pi samples as explained below . for the period december 1 , 2007 through november 30 , 2008 , cso bypass occurred on 37 days in response to daily precipitation ranging from 0.2 to 4.1 cm . treated plant effluent flow over this period ranged from 116 l / s to 516 l / s and averaged 202 l / s . cso bypass flows represented 10 % of the total annual flow ( sum of treated plant effluent plus cso bypass flows ) discharged from this plant during this period . samples were collected during both stormflow and baseflow ( nonstorm ) conditions from november 2007 through december 2008 approximately every four to six weeks , depending on the occurrence of stormflows . sample information including dates , collection method , duration of composite collection , flow rates , and analytical methods used are provided in table s1 . the location of sample sites can be found in the supporting information ( figure s1 ) . rapid changes in flow that can occur during stormflows and diurnal variability in analyte concentrations require the collection of flow - weighted samples for all sample types . most of the pe and pi samples were collected as flow - weighted composites of 241 - l samples collected hourly over a day . pe sample collection lagged pi sample collection by the hydraulic residence time of the wwtp ( 4 h ) , thus it was possible to compute removal efficiency of the compounds by comparison of concentrations in the pe and pi samples ( as detailed in the supporting information ) . cse samples were generally flow - weighted composites of 1 - l samples collected every 1530 min over the duration of storm events ; these events ranged from 1 h to nearly 6 h. composites for all sample sites were based on flow proportional volumes taken from each individual 1 - l sample . this approach is similar to sampling frequencies and approaches that have been shown to result in low ( 10 % ) variation due to sampling for compounds such as caffeine that are commonly used and excreted . this approach is suitable for this study due to the widespread use / and or excretion of the hormones and other compounds included in this study . samples were kept chilled on ice or frozen ( hormones ) until processing , and samples collected downstream of chemical treatment for disinfection were treated with ascorbic acid ( see analytical methods section in the si ) . concentration data from both the pi and cse samples were used for load calculations of cso bypass because the pi samples were collected over a wider range of flows than the cse samples and so are essential for representing concentrations over the entire range of cso bypass flows . cso bypass flow loads were calculated for all 18 compounds discussed in this paper . treated plant effluent loads were calculated for all of these compounds except the five compounds ( e2 , 11 - k , dht , epi , tes ) that had detection frequencies for pe samples less than 50 % . treatment removal efficiencies for all 18 compounds were computed by comparing concentrations in pi samples with pe samples , as detailed in the supporting information . a 4 h lag time was used for all storms because the actual change in hydraulic retention time was not known until the end of sampling . use of the 4 h lag likely resulted in including a greater proportion of water for the pe samples from the end of the event . calculations indicate this lag resulted in around 10 % of the total sample volume composite shifting from the early part of the event to the latter portion for the highest treated effluent flows sampled . thus , the removal efficiencies for stormflows may be biased somewhat high , and differences in removal efficiencies between baseflow and stormflow may be greater than indicated in these results . load estimates are not affected by a constant lag because loads are estimated on concentration - discharge relations , which are not affected by the lag between pi and pe samples , as they reflect the concentration corresponding to the flows that occurred over the sample period . concentration - discharge relations were used to calculate treated plant effluent and cso bypass loads using a tobit regression . tobit regression was used due to the large degree of censored ( nondetected ) data for some of the compounds . details on samples and approaches used to determine loads are available in the supporting information , as are the tobit regression statistical results for treated plant effluent and cso bypass loads ( table s4a , s4b ) . as suggested by the benotti and brownawell model , all 12 compounds ( 11 - k , adsd , cand , caf , cho , cop , dht , e2 , e3 , epi , sit , tes ) with high removal efficiencies ( 90 % ) had higher concentrations in cse and pi samples compared to pe samples ( kruskal wallis test , p 0.05 ; figures 1 , 2 , s5 ) . concentrations in cse and pi samples generally range from 1 to 10 ng / l for e2 and 10100 ng / l for e3 , whereas concentrations in pe samples usually are 0.5 ng / l for e2 and 2 ng / l for e3 . androgen concentrations in cse and pi samples are generally 10 times greater than in pe samples ; adsd and cand concentrations are highest in cse and pi samples ( generally ranging from 50 to 500ng / l ) but typically low ( 5 ng / l ) in pe samples . concentrations of the hormones in these samples and estimated removal efficiencies are similar to those previously reported . the high removal efficiencies for estrogens reflect the 1012 day solid retention time ( srt ) maintained at the wwtp ; comparable removal efficiencies have been reported for other activated sludge wwtps operated under similar srts . concentrations of compounds in samples collected from main burlington wastewater treatment plant november 2007 to december 2008 . an asterisk following the name of a compound indicates that median concentrations for the two types of samples are significantly different by the nonparametric kruskal , the x - axis corresponds to a concentration equal to half of the reporting level ; nondetected values are plotted at this level . for some analytes , median percent removal and percent of total load from combined sewer overflow bypass flow from main burlington vermont wastewater treatment plant samples , 20072008 . an open circle denotes those compounds that had a treated plant effluent load calculated using 1/2 of the reporting level as the concentration for all samples because the compound was not detected above the method reporting level in treated plant effluent samples frequently enough to compute loads . the remaining six compounds ( bep , bpa , e1 , gal , tbep , and tcs ) had 90 % median removal efficiencies ; for most of these compounds , concentrations in cse and pi samples are not significantly different from pe samples ( kruskal - wallace test , p 0.05 ; figures 1 , 2 , s5 ) ; this finding is also consistent with the benotti and brownawell model . the only exception to this generalization is for e1 and tcs ; median removal efficiencies for e1 and tcs are higher ( around 80 % ) and less variable than the removals of bep , bpa , gal , and tbep ( 3477 % median removal ; figure 2 ) . e1 concentrations in cse and pi samples generally range from 5 to 20 ng / l , and those in pe samples range from 2 to 10 ng / l . e1 is a known metabolite of e2 in activated sludge systems ; so concurrent production and degradation of e1 would result in higher e1 concentrations in pe samples relative to cse and pi samples than for e2 or e3 . removal efficiencies for e1 during treatment reportedly are lower than for other estrogens . concentrations in these samples and removal efficiencies for tcs and gal are similar to those reported elsewhere . hormone and wmp concentrations in cse and pi samples generally decreased with increasing discharge ( figures 3 , s2a , s2b ) , reflecting that dilution of wastewater by storm runoff is the main process controlling concentrations of these compounds in cse and pi samples . this is similar to the pattern of decreasing total kjeldahl nitrogen concentration with increasing flow observed in a cso study ; this decrease was attributed to the dilution of untreated sewage with storm runoff . a concentration - discharge relation that is controlled solely by the dilution of untreated wastewater by stormflow runoff ( assuming that the compound is not present in the stormwater ) will have a slope of 1 . five compounds ( tes , e2 , bpa , caf , and tcs ) in the current study have slopes between 0.8 and 1.2 ( tables s4a , s4b ) , suggesting that the major factor controlling the concentrations of these compounds in cse and pi samples is dilution of untreated sewage by stormflow runoff . concentration as a function of discharge for select hormones and wastewater micropollutants in main burlington vermont wastewater treatment plant samples november 2007 to december 2008 . these lines are tobit regression lines used to determine loads from combined sewer overflow bypass and treated plant effluent discharges . for all analytes except caffeine , nondetected values are plotted along the x - axis at a value corresponding to 1/2 of the reporting level concentration . for caffeine , nondetections are plotted at 100 ng / l ( 1/2 of the reporting level ) . seven compounds ( tbep , bep , cho , cop , gal , cand , and sit ) , however , have concentration - discharge slopes of 0.7 for cse and pi samples ( tables s4a , s4b ) , indicating that their concentrations at higher flows are greater than predicted by stormwater dilution . this group includes all four compounds ( cho , cop , gal , and sit ) that have high log kow values ( 6 ) . patterns of tss transport in csos reflects a complex mixture of solids derived from wastewater , solids stored in sewage pipes , and solids derived from storm runoff . during stormflows , the proportion of flow from wastewater is diminished , and the proportion of flow from road runoff increases . solids deposited in the sewer system during low flows have been found to be mobilized by high flows , resulting in enhanced transport of hydrophobic compounds by cso discharges . the results of the current study are consistent with the hypothesis that solids stored in sewers between events are mobilized during stormflow , resulting in the observed lack of dilution of the four compounds with high log kow values during cso discharges . although the cause of the lack of dilution for the compounds in this group that have log kow 6 is unclear , other factors may result in the observed lack of dilution . the lack of dilution for sit might also partially reflect contributions of this plant sterol from terrestrial plant debris washed into the storm sewer system . transport associated with sediment particles is not as likely for tbep ( log kow = 3.0 ) , yet tbep is used in synthetic rubber and plastics production and has been detected in snow . thus , the low degree of dilution for tbep may reflect the contribution of road surface runoff containing tbep that occurs during stormflows . the lack of substantial dilution ( regression slope of 0.34 ; figure s2a , table s4b ) of cand in cse and pi samples with increasing discharge is not clear . one possibility is that the amount of cand associated with suspended particles contributed from storm runoff might be greater than predicted from its octanolanother possibility is that cand is being formed , for example , by oxidation of 17 - or - isomers of 5 - androstane -3,17-diol ( not determined in this study but present in urinary excretions ) via enzymatic processes comparable to those that form e1 from e2 . several androgens ( 11 - k , adsd , epi , dht ) and two estrogens ( e1 and e3 ) have cse and pi sample concentrations that are lower than predicted by dilution at higher flows ( concentration - discharge slopes 1.2 ; table s4b ) . the reason for this is not clear , but for androgens may be because these compounds are degradation products of other androgens ( especially testosterone ) that might not be formed as effectively during high flow conditions as they are during low flow conditions . by contrast , concentrations of compounds in pe samples are not affected by dilution , as concentrations of many of these compounds significantly increase with flows ( figures 3 , s2a , s2b ) . in general , the slope of the concentration - discharge curve for pe samples is more positive for compounds with high removal efficiencies ( including caf , cand , cop , sit , cho ) than for compounds with low removal efficiencies ( bep , gal , bpa , tbep ) . a significant increase in concentration with increasing flows occurs for many compounds for treated flows ( see table s4a ) despite the decrease in concentration observed for untreated ( cse and pi ) samples with increasing discharge ( table s4b ) . the observed lack of dilution in pe samples reflects the importance of decreased treatment efficiency ( figures s6a , s6b ) that occurs for many compounds with increasing flows . this decreased treatment efficiency probably reflects less efficient biological treatment that occurs when hydraulic retention times lessen during higher flows . loads calculated using these data show that cso bypass flow contributes a substantial proportion of total annual load for many hormones and wmps ( figures 2 , s5 ) , particularly for those that are efficiently removed during wastewater treatment . total annual load from this wwtp is equal to the sum of the load for the treated plant effluent and the load from the cso flow bypass . caf and cand , compounds with the highest median removal efficiencies ( 9899 % ) , also had the highest proportion of total annual load from cso bypass flow ( 81 and 93 % , respectively ) . the other five compounds ( sit , cho , cop , adsd , and e3 ) having high removal efficiencies and sufficient detection frequency for treated load estimates had cso bypass loads representing 4361 % of the total annual loads . these proportions are much higher than the proportion of total annual water discharge as cso bypass flow ( 10 % ) . the finding that most of the annual load ( 80 % ) of caffeine from this wwtp is attributable to cso bypass flows supports the hypothesis that csos can be a major source of caffeine to receiving waters . these results demonstrate the importance of quantifying concentrations of hormones and other compounds in bypass flows to provide a more accurate assessment of contaminant loads from csos relative to the contributions from wwtp discharges . assessment of the importance of cso bypass loads for five compounds with high removal efficiencies ( epi , e2 , 11 - k , dht , tes ) was hampered by their low ( 50 % ) detection frequency in treated samples ( figure 1 ; table s2 ) . consequently , treated plant effluent load estimates for these compounds are based on using a concentration equal to 50 % of the reporting level . this load estimate should be considered an upper bound on treated plant effluent loads and is used only to give a general comparison between cso bypass loads and treated plant effluent loads ; it is likely that the fraction of annual load discharged by cso discharges for these five compounds is substantially greater than depicted in figures 2 and s5 . median removals for epi , e2 , and 11 - k range from 9096 % , and the estimate of total load from cso bypass flows ranges from 1729 % ( figure 2 ) . median removal amounts for dht and tes were higher ( 96 % and 99 % , respectively ) , as was the proportion of total annual load from cso bypass flows ( 35 % and 70 % , respectively ) . thus , even for compounds with conservative ( high ) treated plant effluent load estimates , cso bypass flows appear to contribute disproportionally to the total annual load discharged from the main burlington wwtp to lake champlain . cso bypass flows are not as important for annual loads for compounds that are poorly removed during wastewater treatment . the remaining six compounds included in this study ( bep , bpa , e1 , gal , tbep , and tcs ) had 90 % median removal efficiencies , and all but tcs ( 19 % ) had 10 % contributions of total annual load from cso bypass flows ( figure 2 ) . these findings are in agreement with the benotti and brownawell model and observations in germany that untreated discharges resulting from cso events contribute a disproportionate load for compounds that are efficiently removed by wastewater treatment but are less important for compounds that are not efficiently removed . csos have been shown to adversely affect water quality , and discharges of nutrients , pathogens , and other contaminants during cso events have been linked to acute water - quality issues such as fish kills and to chronic water - quality issues in urban streams . for the main burlington wwtp , there were 37 cso bypass flow discharges over the year studied , with discharges lasting from around 1 to 10 h. although these flows are sporadic and of short duration , results of the current study show that concentrations of hormones and many wmps in cso bypass flows were up to 10 times higher than those from treated plant effluent and contribute a substantial portion of the total mass discharged to the receiving water . thus , models of wwtp discharge that do not account for cso discharges can severely underestimate the environmental occurrence of certain emerging contaminants . this is particularly true for hormones and other wmps that are effectively removed during wastewater treatment . the importance of hormone and wmp discharges from cso bypass flows is dependent on the characteristics of the receiving waters . in settings such as lake champlain , where a cso bypass flow discharges into a large body of water with a high degree of mixing , ecological effects might be mitigated by rapid dilution compared to other settings . biota in urban estuaries , such as jamaica bay in new york , or other locations with receiving waters having comparatively small volume and limited mixing potential might be substantially affected by cso discharges . in such settings , high - concentration pulses of hormones discharged to the receiving water after a cso event might adversely affect fish reproduction , especially if they occur during key spawning or growth development periods . in addition , cso pulses can be a major source of endocrine - disrupting compounds to sediments in receiving waters , and so may affect fish reproduction and enter the food chain through benthic organisms . concentrations of individual estrogens in cso bypass flows in this study commonly range from 2 to 20 ng / l ( figure 1 ) , well within the range of concentrations ( around 1 ngother sources of untreated wastewater may have similar effects as cso bypass flow ; interconnections between sewer pipes and storm drains and leaky sewer pipes also are potential sources of untreated wastewater to streams . based on these results , assessments of sources and ecological effects of hormones and wmps should consider cso bypass discharges and other sources of untreated wastewater . previous studies have shown lower removal efficiencies for hormones and other wmps with decreased hydraulic residence time in a wwtp . indeed , removal efficiencies significantly decreased with increasing pe flow for nine ( cop , sit , caf , cho , cand , e3 , gal , tbep , tcs ) of the thirteen compounds having sufficient data to allow for this comparison ( figures s6a , s6b ) . reduced hydraulic residence times during storm events have at least two possible influences on removal efficiency : decreased exposure time for degradation by the activated sludge ( as appears the case for caffeine ) and decreased removal of solids material ( as appears the case for cho , cop , and sit , which can be expected to have substantial particle - phase concentrations ) . during high flows , the main burlington wwtp operates in contact stabilization mode in order to reduce the amount of solids lost from the system . this is done to maintain the 10 to 12 day srt that the plant operates in during high flow events . although tss concentrations in pe samples increase with flows from around 1 to 10 mg / l , concentrations are still far less than the 100200 mg / l concentrations associated with untreated sewage samples ( figure s3 ) . although days with treated plant effluent flows greater than the wwtp s design capacity ( 325 l / s ) only constitute around 11 % of the annual treated plant water discharge , these high flows make a disproportionate contribution to annual treated plant loads for several compounds . the proportion of annual treated plant load represented by high flows ( 325 l / s ) ranged from 20 to 45 % for several compounds ( e3 , cand , cop , sit , caf , cho , and tbep ; figure s7 ) . the higher proportions of treated plant effluent loads associated with high flows reflect the substantial decrease in removal efficiency with increasing flows ; all these compounds have a slope 1 for the log log relation between concentration and plant effluent flow ( table s4a , s4b ) . these results demonstrate that even if cso bypass flows did not occur at this wwtp , a disproportionate amount of the annual load of some hormones and wmps would occur at higher flows due to decreased removal efficiencies .\noutput:\n" }, { "from": "agent", "value": "data were collected at a wastewater treatment plant ( wwtp ) in burlington , vermont , usa , ( serving 30,000 people ) to assess the relative contribution of cso ( combined sewer overflow ) bypass flows and treated wastewater effluent to the load of steroid hormones and other wastewater micropollutants ( wmps ) from a wwtp to a lake . flow - weighted composite samples were collected over a 13 month period at this wwtp from cso bypass flows or plant influent flows ( n = 28 ) and treated effluent discharges ( n = 22 ) . although cso discharges represent 10 % of the total annual water discharge ( cso plus treated plant effluent discharges ) from the wwtp , cso discharges contribute 4090 % of the annual load for hormones and wmps with high ( > 90 % ) wastewater treatment removal efficiency . by contrast , compounds with low removal efficiencies ( < 90 % ) have less than 10 % of annual load contributed by cso discharges . concentrations of estrogens , androgens , and wmps generally are 10 times higher in cso discharges compared to treated wastewater discharges . compound concentrations in samples of cso discharges generally decrease with increasing flow because of wastewater dilution by rainfall runoff . by contrast , concentrations of hormones and many wmps in samples from treated discharges can increase with increasing flow due to decreasing removal efficiency ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: diabetic patients , who consume vacor ( n -3-pyridylmethyl - n - p - nitrophenylurea , mw272 ) , experience microangiopathy causing retinopathy and nephropathy . the width of the capillary basement membrane in these patients thickens significantly compared to normal controls after 6 years of vacor ingestion , on average . a number of animal models of diabetes have suggested that hyperglycemia can produce microangiopathic changes . rodents made hyperglycemic with streptozotocin ( stz ) or alloxan developed glomerular changes that were similar to , but not strictly comparable to , those of humans . vacor - induced diabetic rats developed acute glomerulopathy within a few months and the glomerulus revealed prominent thickening of the basement membrane . the glomerular filtration barrier consists of complex matrix constituents interposed between the glomerular endothelial and epithelial cells , which constitute the lining of the glomerular capillaries . they include collagen ( mostly type iv ) , laminin , polyanionic proteoglycans ( mostly heparan sulfate ) , fibronectin , entactin and several other glycoproteins . these individual components of glomerular basement membrane ( gbm ) were immunohistochemically tagged using specific monoclonal antibodies and observed by light and electron microscopy . changes of four major components of gbm , ( type iv collagen , laminin , fibronectin and proteoglycan ) , were studied in vacor - induced diabetic rats in this study . adult male wistar rats ( n = 42 ) , weight 200250 g , were used for this study . a single dose of vacor , 80 mg / kg of body weight , was administered to the experimental animals by an orogastric canule , while distilled water was given to controls . the experimental animals were sacrificed 0.5 , 1 , 3 , 7 , 14 , 28 and 56 days after the administration of vacor . animals were perfused through the jugular vein with 300 ml of physiologic saline followed by an equal amount of 10 % buffered formalin . both kidneys were taken , and then routine formalin - fixed , paraffin - embedded tissue blocks were made for the immunohistochemical studies of glomerular basement membrane ( gbm ) components . tissue sections , 4 m in thickness , were obtained , and stained with hematoxylin - eosin ( h & e ) and periodic acid schiff ( pas ) stain . for immunohistochemical studies of the gbm components , monoclonal antibodies for collagen type iv ( monosan , netherlands ) , laminin ( monosan , netherlands ) , fibronectin ( sigma bioscience , u.s.a . ) and proteogylcan chondroitin sulfate ( cspg , biogenesis , u.k . ) were used . deparaffined sections were soaked in absolute methanol containing 0.3 % hydrogen peroxide for 30 minutes at room temperature in order to block endogenous peroxidase activity . after washing , the sections were incubated with 0.4 % pepsin ( sigma ) in 0.01 n hci for 1 hour at 37c , then treated with 0.05 % protease type vii ( sigma ) in phosphate - buffered saline ( pbs ) , ph 7.2 , for 15 minutes at 37c . with these enzyme pretreatments , after further washing in pbs , the sections were exposed to 1:20 diluted normal swine serum ( dako - immunoglobulins ltd . , . then sections were incubated with each primary antibody at a dilution of 1 : 500 overnight at 4c . after washing with pbs , treatment followed with anti - rabbit igg swine serum ( at a dilution of 1:20 , dako ) , and pap solution ( at a dilution of 1:80 , dako ) , for 30 minutes , respectively , at room temperature . finally , the sections were soaked in 0.05 m tris - hci buffer , ph 7.6 , containing 3,3 - diaminobenzidine hydrochloride ( 40 mg / 100 ml ) and hydrogen peroxide ( 0.015 % ) for 10 minutes , and counterstained with hematoxylin . vascular walls and renal tubules in the specimens served as positive controls for the primary antibodies . as the negative control , the glomeruli in control animals revealed patent capillary loops demarcated by a thin , delicate glomerular basement membrane . the basement membrane and mesangium were positively stained by pas stain . in the experimental groups , mild thickening of the gbm was evident at 7 days by h & e and pas stains . increased thickening of the gbm and mesangial widening were noted at 14 to 56 days by pas and h & e stains ( fig . the width of the gbm had more than doubled at 28 and 56 days compared with normal controls . focal nodular proliferation of both glomerular endothelial and mesangial cells in the glomerulus was observed ( fig . the glomeruli in control animals show thin linear staining along the gbm after immunohistochemical staining for collagen type iv and laminin ( fig .3 ) . fibronectin and proteoglycan were also identified along the gbm , but they stained more faintly than collagen type iv and laminin . immunohistochemical staining for collagen type iv was the most sensitive way to demonstrate gbm thickening , evident 3 days after a single , large dose ( 80 mg / kg ) of vacor treatment . the gbm was moderately thickened at 7 days , and was maximally thickened 28 to 56 days after the treatment by collagen type iv immunohistochemistry . the pattern was initially focal and global from the gbm peripheral loop , and became subsequently diffuse ( fig .3 ) . moderately thickened immunoreactivity with collagen type iv was noted after as many as 56 days . laminin in the gbm also thickened after vacor treatment , and behaved similarly to collagen type iv ( fig .4 ) . fibronectin in the gbm appeared faintly at 12 hours and 1 day after vacor treatment . mild , focal and segmental thickening of fibronectin was evident at 3 days . from 7 days after vacor treatment , the fibronectin presence in the gbm began to resemble that of collagen type iv and laminin ( fig . chondroitin sulfate proteoglycan ( cspg ) in the gbm did not change so prominently as type iv collagen , laminin and fibronectin . only a mild focal thickening of cspg was noted along the gbm at 3 to 7 days after vacor treatment . no identifiable changes of proteoglycan in the gbm were noted from 14 to 56 days after vacor treatment ( fig . the glomeruli in control animals revealed patent capillary loops demarcated by a thin , delicate glomerular basement membrane . the basement membrane and mesangium were positively stained by pas stain . in the experimental groups , mild thickening of the gbm was evident at 7 days by h & e and pas stains . increased thickening of the gbm and mesangial widening were noted at 14 to 56 days by pas and h & e stains ( fig . the width of the gbm had more than doubled at 28 and 56 days compared with normal controls . focal nodular proliferation of both glomerular endothelial and mesangial cells in the glomerulus was observed ( fig . the glomeruli in control animals show thin linear staining along the gbm after immunohistochemical staining for collagen type iv and laminin ( fig .3 ) . fibronectin and proteoglycan were also identified along the gbm , but they stained more faintly than collagen type iv and laminin . immunohistochemical staining for collagen type iv was the most sensitive way to demonstrate gbm thickening , evident 3 days after a single , large dose ( 80 mg / kg ) of vacor treatment . the gbm was moderately thickened at 7 days , and was maximally thickened 28 to 56 days after the treatment by collagen type iv immunohistochemistry . the pattern was initially focal and global from the gbm peripheral loop , and became subsequently diffuse ( fig .3 ) . moderately thickened immunoreactivity with collagen type iv was noted after as many as 56 days . laminin in the gbm also thickened after vacor treatment , and behaved similarly to collagen type iv ( fig .4 ) . fibronectin in the gbm appeared faintly at 12 hours and 1 day after vacor treatment . mild , focal and segmental thickening of fibronectin was evident at 3 days . from 7 days after vacor treatment , the fibronectin presence in the gbm began to resemble that of collagen type iv and laminin ( fig . chondroitin sulfate proteoglycan ( cspg ) in the gbm did not change so prominently as type iv collagen , laminin and fibronectin . only a mild focal thickening of cspg was noted along the gbm at 3 to 7 days after vacor treatment . no identifiable changes of proteoglycan in the gbm were noted from 14 to 56 days after vacor treatment ( fig . in humans , characteristic morphological changes of the glomeruli in diabetes mellitus include gbm thickening , diffuse glomerulosclerosis and nodular glomerulosclerosis . diffuse thickening of the gbm occurs in virtually all diabetics , irrespective of the presence of proteinuria , and constitutes a part of diabetic microangiopathy . careful morphometric studies demonstrate that this thickening begins as early as 2 years after the onset of type i diabetes and , by 5 years , develops to about a 30 % increase . diffuse and nodular glomerulosclerosis are late events for diabetics , and become pronounced after 10 to 20 years of diabetes . in vacor - treated rats , the glomeruli reveal prominent thickening of the gbm within a short period . the width of the gbm is more than twice that of normal controls , 28 and 56 days after vacor administration . increased expressions of collagen iv , laminin , fibronectin and neutral mucopolysaccharide engendered the thickening of the gbm in this study . proteoglycan immunoreactivity was not significantly different between vacor - treated and normal control groups . in a study of human diabetic diffuse glomeruloscleosis , the enlarged mesangial matrix also revealed increased staining reactions for collagen iv , v , laminin and fibronectin , whereas the staining pattern for heparan sulfate proteoglycan ( hspg ) was markedly reduced . these data suggest that vacor - induced glomerulopathy in rats can provide a useful experimental model to study human diabetic glomerulopathy . expression of type iv collagen and its mrna in glomeruli and the interstitium of diabetic rats increased at 3 , 7 and 14 days after streptozotocin ( stz ) administration . the expression was associated with up - regulation of transforming growth factor ( tgf ) - . administration of tgf - increased collagen synthesis in normal rat glomeruli in a dose - dependent manner up to 5 ng / ml . these data indicate a regulatory role for tgf - in renal glomerular collagen synthesis in normal and diabetic rats . inhibition of tgf - and type iv collagen expression by insulin treatment suggests that they may be useful structural markers for determining the efficacy of therapeutic intervention during early diabetic nephropathy . concomitant increased staining patterns for laminin and type iv collagen have been reported in human diabetic glomerular lesions and experimental diabetic nephropathy . over - expression of tgf - was also partly associated with the up - regulation of glomerular laminin gene expression in diabetic mice . the occurrence of collagen type iii in late diffuse glomerulosclerosis could be interpreted as an irreversible change in glomerular structure . fibronectin also increases in the gbm and mesangial matrix in human diabetic nephropathy and stz - induced diabetic rats . fibronectin is a multifunctional matrix protein important in wound healing , and is markedly increased in glomerular crescents . there are two phases of fibronectin metabolism in anti - gbm models of rapidly progressive glomerulonephritis ( rpgn ) in the rabbit . phase i is associated with increased glomerular fibronectin content from plasma , and phase ii with increased fibronectin mrna in glomeruli at days 7 to 14 . this finding suggests that fibronectin synthesis may take place in glomeruli and that it may also be a molecule regulating glomerular cell proliferation and fibrosis . two types of proteoglycan , hspg and basement membrane - specific cspg , have been studied in human diabetes and diabetic rats . the expression of hspg decreases in the gbm and other capillaries in diabetes , while cspg increases in stz - diabetic rats . a mildly increased expression of cspg was noted only after 3 to 7 days of vacor administration in this experiment . other studies suggest that changes of cspg displace the capillary endothelial cells from the gbm causing loss of fenestrae , while loss of the hspg results in alteration of gbm charge - selectivity . the abnormal levels of type iv collagen , laminin , fibronectin and proteoglycan may , in part , be the cause of diabetic nephropathy induced by vacor administration . to elucidate the biochemical component changes in the gbm in vacor - induced diabetic glomerulopathy , immunohistochemical analyses of type iv collagen , laminin , fibronectin and cspg were performed in adult male wistar rats . mild thickening of the gbm was evident 7 days after vacor administration , and the width of the gbm was more than twice that of normal controls at 28 and 56 days . significantly increased expressions of type iv collagen , laminin , fibronectin and neutral polysaccharide in the thickened gbm was noted 14 to 56 days after the administration , and the mildly increased expression of cspg was present after 3 to 7 days . these abnormal levels of gbm components might , in part , be the cause of diabetic nephropathy induced by vacor administration .\noutput:\n" }, { "from": "agent", "value": "objectivesthe thickening of the glomerular basement membrane in rats after vacor ingestion was examined by electron microscopy . this study was performed to elucidate which biochemical components changed in the glomerular basement membrane after vacor - induced diabetic glomerulopathy.methodsimmunohistochemical analyses of type iv collagen , laminin , fibronectin and chondroitin sulfate proteoglycan were performed . a single dose of vacor ( molecular weight 272 ) , 80 mg / kg , was administered to adult male wistar rats by orogastric canule , and the animals were sacrificed at 0.5 , 1 , 3 , 7 , 14 , 28 and 56 days after administration.resultsmild thickening of the glomerular basement membrane was evident 7 days after vacor administration , and the width of the glomerular basement membrane was more than twice that of normal controls at 28 and 56 days . significantly increased expressions of type iv collagen , laminin , fibronectin and neutral polysaccharide in the thickened glomerular basement membrane were noted 14 to 56 days after administration , and a mildly increased expression of chondroitin sulfate proteoglycan appeared between 3 to 7 days.conclusionthese abnormally increased glomerular basement membrane components might be part of what causes diabetic nephropathy after vacor administration" } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the procedures used during the study were in accordance with the guidelines of the helsinki declaration on human experimentation and those of the good clinical practice guidelines . the study was approved by the institutional review boards of the magna graecia and federico ii universities of catanzaro and naples , italy , respectively . the study protocol was explained carefully to each woman , and written consent was obtained from each participant before entry into the study . between february 2004 and april 2006 , 50 consecutive women with pcos , who had been referred as outpatients to the two academic departments for the treatment of oligomenorrhoea , were enrolled in a prospective nonrandomized placebo - controlled double - blind clinical study . the patients were allocated to one of two study groups and were matched for age and bmi . there were 25 participants ( control subjects ) who received metformin and a placebo , whereas the remaining 25 patients ( the experimental group ) received the experimental treatment . the diagnosis of pcos was based on the national institutes of health ( nih ) criteria ( 8 ) . the following general exclusion criteria were considered : age 18 or 35 years ; bmi 35 kg / m ; neoplastic , metabolic , endocrine , hepatic , renal or cardiovascular disorders , or other concurrent medical illnesses ; glucose intolerance ; malabsorptive disorders ; folate or vitamin b12 deficiency ; current or previous ( within the last 6 months ) use of hormonal , antidiabetic , or anti - obesity drugs ; and intention to adopt a diet and / or a specific physical activity program . all participants had a normal level of physical activity and were nonsmokers ; none were known to abuse alcohol . all participants ( experimental and control groups ) received metformin from the third day of a progesterone - induced withdrawal bleeding ( 100 mg natural progesterone intramuscularly ) at a starting dose of 850 mg ( one tablet daily before lunch ) for the first week . the dose rose to 1,700 mg / day thereafter ( two tablets daily , one before lunch and one before dinner ) . the experimental group also received 400 g folic acid daily ( one tablet / day ) , whereas the control group received an inert cellulose powder placebo ( one tablet / day ) . both folic acid and placebo tabletspatients were blinded to the treatment allocation ( experimental or control group ) . throughout the study , no lifestyle modification was implemented ; indeed , participants were instructed to follow their usual diet and physical activity . each patient was also advised to use barrier contraception throughout the study . at entry into the study and after 6 months of treatment , all participants underwent clinical and biochemical evaluations and a cardiovascular examination . clinical assessment consisted of anthropometric measurements , which included height , weight , bmi ( ratio between the weight and the square of the height ) , and waist - to - hip ratio ( ratio between the waist and the circumference of the hip ) , and an assessment of the ferriman - gallwey score . measurements of heart rate , systolic blood pressure , and diastolic blood pressure were also obtained . the systolic and diastolic blood pressure levels were measured in the right arm by standard methods with the participants in a relaxed sitting position , using a mercury sphygmomanometer . the average of six measurements taken by two independent examiners ( each took three sets of measurements ) was used . transvaginal ultrasonography was performed on each participant during the same baseline visit by an experienced operator ( t.r . ) . daily physical activity was evaluated for each participant with the use of a leisure - time physical activity questionnaire and a calculation of the weekly energy expenditure score ( total leisure - time physical activity level ) in metabolic equivalents per hour per week . diet and caloric intake were assessed by an experienced clinical dietitian using a self - administered semiquantitative validated food - frequency questionnaire and software designed for the analysis of food habits and the estimation of nutrient and caloric intake ( winfood , release 1.5 ; medimatica , martinsicuro , teramo , italy ) . all participants were instructed to record in a personal daily diary the onset of any adverse events , specifying their characteristics ( severity , duration , and possible cause - effect relationship with drug administration ) , the characteristics of their menstrual cycles ( length and quantity ) , the number of skipped tablets , and any changes in diet , physical activity , or weight . during the study , however , ovulation was detected by a plasma progesterone assay ( 10 ng / ml , si : 32 nmol / l ) performed 7 days before the expected menses . during the early proliferative phase ( second to third day ) of the progesterone - induced uterine withdrawal bleeding , a venous blood sample was taken from each participant between 8:00 and 9:00 a.m. after fasting for 12 h and resting in bed , to assess a complete hormonal profile , lipid pattern , serum et - 1 , glucose and insulin ( at fasting and after a 2 - h oral glucose tolerance test ) , hcy , folate , and vitamin b12 levels . in each participant , the homeostasis model of assessment ( homa ) , the fasting glucose - to - insulin ratio ( gir ) ( mg / 10 units ) , the area under the curve ( auc ) for glucose ( aucglucose ) and insulin ( aucinsulin ) , and the free androgen index were calculated . serum levels of et - 1 were measured by an enzyme - linked immunosorbent assay ( biomedica gesellschft , wien , austria ) with a sensitivity of 0.05 pmol / l and intra - and interassay coefficients of variation ( cvs ) of 4.5 and 6.9 % , respectively ( 1,2 ) . serum hcy levels were measured by high - pressure liquid chromatography ( hplc ) ( 9 ) . the sensitivity of the assay for hcy was 0.25 mol / l serum , and the intra - and interassay cvs were 1 and 2 % , respectively . the levels of vitamin b12 and folate were analyzed by capillary electrophoresis ( p / ace 5000 system , beckman coulter ) ( 9 ) . the intra - and interassay cvs for the vitamin b12 assay were 6.7 and 7.4 % , respectively , and 4.2 and 4.1 % , respectively , for the folate assay . all participants were studied during the same visit in a comfortable supine position in a quiet room , having fasted for at least 812 h and been at rest for at least 46 h before the examination . brachial artery reactivity and the imt of the common carotid arteries were studied using a color doppler ultrasound system by an experienced ultrasonographer ( f.g . ) . scans for the analysis of brachial reactivity were taken over the dominant brachial artery in a longitudinal orientation just proximal to the antecubital fossa using a high - resolution 7.5 - mhz linear transducer . blood flow to the limbwas occluded by inflating a standard sphygmomanometry cuff on the upper arm ( 40 mmhg above systolic blood pressure for 4 min ) to induce ischemia . the bad - rh was measured at 30 s , 1 , 2 , 3 , and 4 min after the subsequent deflation of the cuff . in all studies , blood pressure in the contralateral brachial arterywas recorded at regular intervals , and the electrocardiogram was monitored continuously ( 1,2 ) . brachial artery fmd was calculated as the percentage change in brachial artery diameter from baseline to 4 min after deflation of the cuff . in our studies , the intra - and inter - observer cvs for the repeated measurements of the resting arterial diameter were 2.3 and 5.6 % , respectively ( 1,2 ) . longitudinal ultrasonographic scans of the carotid artery were obtained using a high - resolution 10 - mhz linear probe . all women were examined in the supine position with the head hyperextended and turned away from the side being scanned . images were obtained from the distal portion of both common carotid arteries , 12 cm proximal to the carotid bulb and immediately proximal to the origin of the bifurcation ( 1,2 ) . the imt of the posterior wall of both common carotid arteries was measured as the distance between the junction of the lumen and intima and the junction of the media and adventitia at the end of diastole from the b - mode screen . the mean imt for each side was calculated as the average of 10 measurements made of the right and left carotid arteries using electronic calipers . in our studies , the intra - and inter - observer cvs for the repeated measurements of imt were 7.0 and 12.0 % , respectively ( 1,2 ) . the sample size was calculated on the assumption that a difference of 0.1 mm in imt is clinically relevant because it predicts a 1015 % reduction in the risk of future myocardial infarction and a 1318 % reduction in the risk of future stroke ( 10 ) . given that a mean imt of 0.530.09 ( mm sd ) has been observed in patients with pcos ( 1,2 ) , we needed to enroll at least 23 patients in each group to yield a statistically significant result with a power of 90 % . to allow for an unpredictable number of withdrawals , we decided to enroll a total of 50 patients with the expectation that at least 23 patients would be left in each group . the test was two - tailed , which means that an effect in either direction would be interpreted . the power analysis and the sample size calculation were performed using samplepower release 2.0 ( spss , chicago , il ) . considering the experimental study design and the expected dropout rate , data were analyzed by a per - protocol analysis on the basis of the treatment received and not on the treatment assignment . in fact , we decided to study the real effect of the treatments only in the subjects who took their allocated therapy . for categorical variables , pearson 's test was performed ; fisher 's exact test was required when 20 % of the expected values in the frequency tables were below 5.0 . the normal distribution of the data for continuous variables was evaluated with the kolmogrov - smirnov test . these data were expressed as means sd and analyzed with an unpaired student 's t test and the general linear model ( glm ) for a repeated measures analysis , with the bonferroni test for post hoc analysis as required . bivariate two - tailed correlations were performed when calculating the spearman 's coefficient ( spearman 's rho , r ) , and the significance of the correlation was set at the 0.05 level to study the relationships between the variations ( ) in hcy levels ( - hcy ) , in insulin sensitivity indexes ( - homa , - gir , - aucinsulin / aucglucose ) , and in imt ( - imt ) . the statistics package for the social sciences ( spss 14.0.1 ; spss , chicago , il ) was used for all statistical analyses . between february 2004 and april 2006 , 50 consecutive women with pcos , who had been referred as outpatients to the two academic departments for the treatment of oligomenorrhoea , were enrolled in a prospective nonrandomized placebo - controlled double - blind clinical study . the patients were allocated to one of two study groups and were matched for age and bmi . there were 25 participants ( control subjects ) who received metformin and a placebo , whereas the remaining 25 patients ( the experimental group ) received the experimental treatment . the diagnosis of pcos was based on the national institutes of health ( nih ) criteria ( 8 ) . the following general exclusion criteria were considered : age 18 or 35 years ; bmi 35 kg / m ; neoplastic , metabolic , endocrine , hepatic , renal or cardiovascular disorders , or other concurrent medical illnesses ; glucose intolerance ; malabsorptive disorders ; folate or vitamin b12 deficiency ; current or previous ( within the last 6 months ) use of hormonal , antidiabetic , or anti - obesity drugs ; and intention to adopt a diet and / or a specific physical activity program . all participants had a normal level of physical activity and were nonsmokers ; none were known to abuse alcohol . all participants ( experimental and control groups ) received metformin from the third day of a progesterone - induced withdrawal bleeding ( 100 mg natural progesterone intramuscularly ) at a starting dose of 850 mg ( one tablet daily before lunch ) for the first week . the dose rose to 1,700 mg / day thereafter ( two tablets daily , one before lunch and one before dinner ) . the experimental group also received 400 g folic acid daily ( one tablet / day ) , whereas the control group received an inert cellulose powder placebo ( one tablet / day ) . both folic acid and placebo tabletspatients were blinded to the treatment allocation ( experimental or control group ) . throughout the study , no lifestyle modification was implemented ; indeed , participants were instructed to follow their usual diet and physical activity . each patient was also advised to use barrier contraception throughout the study . at entry into the study and after 6 months of treatment , all participants underwent clinical and biochemical evaluations and a cardiovascular examination . clinical assessment consisted of anthropometric measurements , which included height , weight , bmi ( ratio between the weight and the square of the height ) , and waist - to - hip ratio ( ratio between the waist and the circumference of the hip ) , and an assessment of the ferriman - gallwey score . measurements of heart rate , systolic blood pressure , and diastolic blood pressure were also obtained . the systolic and diastolic blood pressure levels were measured in the right arm by standard methods with the participants in a relaxed sitting position , using a mercury sphygmomanometer . the average of six measurements taken by two independent examiners ( each took three sets of measurements ) was used . transvaginal ultrasonography was performed on each participant during the same baseline visit by an experienced operator ( t.r . ) . daily physical activity was evaluated for each participant with the use of a leisure - time physical activity questionnaire and a calculation of the weekly energy expenditure score ( total leisure - time physical activity level ) in metabolic equivalents per hour per week . diet and caloric intake were assessed by an experienced clinical dietitian using a self - administered semiquantitative validated food - frequency questionnaire and software designed for the analysis of food habits and the estimation of nutrient and caloric intake ( winfood , release 1.5 ; medimatica , martinsicuro , teramo , italy ) . all participants were instructed to record in a personal daily diary the onset of any adverse events , specifying their characteristics ( severity , duration , and possible cause - effect relationship with drug administration ) , the characteristics of their menstrual cycles ( length and quantity ) , the number of skipped tablets , and any changes in diet , physical activity , or weight . during the study , however , ovulation was detected by a plasma progesterone assay ( 10 ng / ml , si : 32 nmol / l ) performed 7 days before the expected menses . during the early proliferative phase ( second to third day ) of the progesterone - induced uterine withdrawal bleeding , a venous blood sample was taken from each participant between 8:00 and 9:00 a.m. after fasting for 12 h and resting in bed , to assess a complete hormonal profile , lipid pattern , serum et - 1 , glucose and insulin ( at fasting and after a 2 - h oral glucose tolerance test ) , hcy , folate , and vitamin b12 levels . in each participant , the homeostasis model of assessment ( homa ) , the fasting glucose - to - insulin ratio ( gir ) ( mg / 10 units ) , the area under the curve ( auc ) for glucose ( aucglucose ) and insulin ( aucinsulin ) , and the free androgen index were calculated . serum levels of et - 1 were measured by an enzyme - linked immunosorbent assay ( biomedica gesellschft , wien , austria ) with a sensitivity of 0.05 pmol / l and intra - and interassay coefficients of variation ( cvs ) of 4.5 and 6.9 % , respectively ( 1,2 ) . serum hcy levels were measured by high - pressure liquid chromatography ( hplc ) ( 9 ) . the sensitivity of the assay for hcy was 0.25 mol / l serum , and the intra - and interassay cvs were 1 and 2 % , respectively . the levels of vitamin b12 and folate were analyzed by capillary electrophoresis ( p / ace 5000 system , beckman coulter ) ( 9 ) . the intra - and interassay cvs for the vitamin b12 assay were 6.7 and 7.4 % , respectively , and 4.2 and 4.1 % , respectively , for the folate assay . all participants were studied during the same visit in a comfortable supine position in a quiet room , having fasted for at least 812 h and been at rest for at least 46 h before the examination . brachial artery reactivity and the imt of the common carotid arteries were studied using a color doppler ultrasound system by an experienced ultrasonographer ( f.g . ) . scans for the analysis of brachial reactivity were taken over the dominant brachial artery in a longitudinal orientation just proximal to the antecubital fossa using a high - resolution 7.5 - mhz linear transducer . blood flow to the limb was occluded by inflating a standard sphygmomanometry cuff on the upper arm ( 40 mmhg above systolic blood pressure for 4 min ) to induce ischemia . the bad - rh was measured at 30 s , 1 , 2 , 3 , and 4 min after the subsequent deflation of the cuff . in all studies , blood pressure in the contralateral brachial arterywas recorded at regular intervals , and the electrocardiogram was monitored continuously ( 1,2 ) . brachial artery fmd was calculated as the percentage change in brachial artery diameter from baseline to 4 min after deflation of the cuff . in our studies , the intra - and inter - observer cvs for the repeated measurements of the resting arterial diameter were 2.3 and 5.6 % , respectively ( 1,2 ) . longitudinal ultrasonographic scans of the carotid artery were obtained using a high - resolution 10 - mhz linear probe . all women were examined in the supine position with the head hyperextended and turned away from the side being scanned . images were obtained from the distal portion of both common carotid arteries , 12 cm proximal to the carotid bulb and immediately proximal to the origin of the bifurcation ( 1,2 ) . the imt of the posterior wall of both common carotid arteries was measured as the distance between the junction of the lumen and intima and the junction of the media and adventitia at the end of diastole from the b - mode screen . the mean imt for each side was calculated as the average of 10 measurements made of the right and left carotid arteries using electronic calipers . in our studies , the intra - and inter - observer cvs for the repeated measurements of imt were 7.0 and 12.0 % , respectively ( 1,2 ) . the sample size was calculated on the assumption that a difference of 0.1 mm in imt is clinically relevant because it predicts a 1015 % reduction in the risk of future myocardial infarction and a 1318 % reduction in the risk of future stroke ( 10 ) . given that a mean imt of 0.530.09 ( mm sd ) has been observed in patients with pcos ( 1,2 ) , we needed to enroll at least 23 patients in each group to yield a statistically significant result with a power of 90 % . to allow for an unpredictable number of withdrawals , we decided to enroll a total of 50 patients with the expectation that at least 23 patients would be left in each group . the test was two - tailed , which means that an effect in either direction would be interpreted . the power analysis and the sample size calculation were performed using samplepower release 2.0 ( spss , chicago , il ) . considering the experimental study design and the expected dropout rate , data were analyzed by a per - protocol analysis on the basis of the treatment received and not on the treatment assignment . in fact , we decided to study the real effect of the treatments only in the subjects who took their allocated therapy . for categorical variables , pearson 's test was performed ; fisher 's exact test was required when 20 % of the expected values in the frequency tables were below 5.0 . the normal distribution of the data for continuous variables was evaluated with the kolmogrov - smirnov test . these data were expressed as means sd and analyzed with an unpaired student 's t test and the general linear model ( glm ) for a repeated measures analysis , with the bonferroni test for post hoc analysis as required . bivariate two - tailed correlations were performed when calculating the spearman 's coefficient ( spearman 's rho , r ) , and the significance of the correlation was set at the 0.05 level to study the relationships between the variations ( ) in hcy levels ( - hcy ) , in insulin sensitivity indexes ( - homa , - gir , - aucinsulin / aucglucose ) , and in imt ( - imt ) . the statistics package for the social sciences ( spss 14.0.1 ; spss , chicago , il ) was used for all statistical analyses . all patients studied had a full - blown pcos phenotype , which consisted of hyperandrogenism , oligo - anovulation , and polycystic ovaries ( 11 ) . this was confirmed by the identification of polycystic ovaries during transvaginal ultrasonography in all of the participants ( 11 ) . during the study , the two treatments were tolerated well , and the total incidence of adverse events was not significantly different between the two groups . the rate of withdrawal was similar in the two groups ( two subjects in the experimental group and one in the control group ) . these three patients were excluded because they were not compliant with the treatment , and their data were not considered in the final analysis . table 1 shows the clinical , hormonal , and metabolic data at the baseline and after 6 months of treatment in both groups . the proportion of lean ( no patients in either group ) , normal - weight ( 7/23 [ 30.4 % ] vs. 9/24 [ 37.5 % ] ) , overweight ( 11/23 [ 47.8 % ] vs. 10/24 [ 41.7 % ] ) , and obese ( 5/23 [ 21.7 % ] vs. 5/24 [ 20.8 % ] ) patients was not different between the groups ( p = 0.756 ) . clinical , hormonal , and metabolic data in pcos patients treated with metformin plus supplementation with folate ( experimental group ) or metformin plus placebo ( control group ) at study entry and after 6 months of treatment data are means sd or n ( % ) . * p 0.05 vs. baseline . p 0.05 vs. experimental group . the leisure - time physical activity level was graded into four categories : 1 ) no leisure - time physical activity ; 2 ) light leisure - time physical activity most of the week ; 3 ) moderate leisure - time physical activity ( large increase in heart rate , breathing , and perspiration ) for at least 20 min once or twice a week ; and 4 ) strenuous leisure - time physical activity for at least 20 min three times a week or more . significant ( p 0.05 ) changes were observed in both groups , without a difference between them with respect to the levels of serum testosterone and sex - hormone binding globulin and for the free androgen index compared with baseline values ( table 1 ) . similarly , a significant ( p 0.05 ) reduction in the levels of insulin , homa , aucinsulin , aucglucose aucinsulin , and ldl cholesterol and a significant increase in gir were detected after 6 months of treatment in both groups , with no difference between the two treatment arms ( table 1 ) . in the control group , serum hcy levels were significantly ( p 0.05 ) higher after treatment than the baseline values , whereas no significant change from baseline was observed in the experimental group ( table 1 ) . in addition , a significant ( p 0.05 ) difference in serum hcy levels was detected between the groups after treatment ( table 1 ) . at the end of the study , no significant difference had been observed in the length , frequency , or quantity of menstruation between the two groups ( data not shown ) . in addition , no difference was found between groups with regard to the rate of ovulatory cycles ( 89/138 [ 64.5 % ] vs. 90/144 [ 62.5 % ] ; p = 0.728 ) . no further difference in any clinical , hormonal , or metabolic parametertable 2 depicts the parameters of endothelial structure and function that were observed at baseline and after 6 months of treatment in the two groups . no significant difference in any endothelial parameter was observed between the two groups at baseline . after 6 months of treatment , a significant ( p 0.05 ) reduction in the levels of bad - b , bad - rh , imt , and serum et - 1 , and a significant ( p 0.05 ) increase in fmd , were observed in the two groups in comparison with the baseline values ( table 2 ) . in addition , significant ( p 0.05 ) differences between the two groups were detected for all these parameters ( table 2 ) . endothelial parameters in pcos patients treated with metformin plus supplementation with folate ( experimental group ) or metformin plus placebo ( control group ) at study entry and after 6 months of treatment * p 0.05 vs. baseline . p 0.05 vs. experimental group . in both groups , no significant correlation was detected between - hcy and - homa ( r = 0.632 , p = 0.233 , and r = 0.704 , p = 0.412 , for the experimental and control groups , respectively ) , - gir ( r = 0.587 , p = 0.189 , and r = 0.604 , p = 0.242 , for the experimental and control groups , respectively ) , or aucglucose aucinsulin ( r = 0.765 , p = 0.654 , and r = 0.678 , p = 0.547 , for the experimental and control groups , respectively ) . conversely , a significant correlation was observed between - hcy and - imt in both the experimental ( r = 0.504 , p = 0.042 ) and control ( r = 0.632 , p = 0.039 ) groups . administration of metformin exerted beneficial effects on the traditional cardiovascular risk factors and reduced the morbidity and mortality from cardiovascular events in patients with type 2 diabetes ( 12 ) . however , metformin also reduced serum levels of folate and vitamin b12 and increased serum hcy levels in patients with diabetes ( 13,14 ) , even after only a short period ( 5 ) . long - term administration of metformin was shown to result in malabsorption of vitamin b12 ( 15 ) , although the correlation between serum hcy levels and absorption of folate or vitamin b12 was not clear . unexpectedly , the improved sensitivity to insulin associated with metformin may increase plasma hcy concentrations in obese patients with diabetes ( 6 ) or without diabetes ( 16 ) . unlike the levels of serum hcy in patients with diabetes , the response of serum hcy levels to the administration of metformin in women affected by pcos was unclear , probably because of the heterogeneity of the studied populations ( 1719 ) . in agreement with previous data ( 17,19 ) , the results of the study described herein showed a significant increase in serum hcy levels after 6 months of metformin treatment in a heterogeneous population with pcos . our findings were not confirmed by yilmaz et al . ( 18 ) , who observed that there was no change in the concentration of plasma hcy after the administration of metformin in lean patients with pcos . however , even if the cohort studied in the latter trial was comprised of a well - selected sample , they did not represent the broad spectrum of patients who have pcos . our findings demonstrated that the increase in plasma hcy concentrations that was attributable to metformin treatment was not associated with any significant effect on the level of serum folate or vitamin b12 . in addition , no significant relationship was detected between - hcy and changes in the indexes of insulin sensitivity , including - homa , - gir , and aucglucose aucinsulin . these data suggest that the increase in plasma hcy can be explained by factors that act in addition to metformin treatment to improve insulin sensitivity . in fact , the administration of rosiglitazone , which is an insulin - sensitizing drug that improves insulin sensitivity more significantly than metformin , resulted in the opposite physiological effect to metformin because it decreased serum hcy levels ( 5 ) . in agreement with our previous data ( 1,2 ) , the current study confirmed the beneficial effect of metformin on the structure and function of the vascular endothelium in young patients with pcos . after 6 months of treatment , bad - b , bad - rh , imt , and serum et - 1 levels were significantly lower than the baseline values , whereas a significant increase in fmd was detected . the results of folic acid supplementation in patients with pcos who also received metformin were very interesting . a previous underpoweredrandomized controlled study ( 20 ) showed that serum hcy levels were reduced by 21.2 % after the administration of folic acid and by 8.3 % after the administration of b - group vitamins in patients affected by pcos who had also been treated for 12 weeks with metformin . our results confirmed the significant reduction in serum hcy levels after supplementation of metformin treatment with 400 g folic acid daily , in comparison with subjects who had received a placebo . this represents a potential beneficial effect in terms of reducing the incidence of long - term adverse cardiovascular events in patients with pcos . the effects of a reduction in serum hcy levels on the vascular endothelium in patients affected by pcos have not been demonstrated previously . in the current study , we reported a significant correlation between the variation in hcy levels and changes in the imt after treatment with metformin and folic acid . to our knowledge , this is the first study to investigate the effects of supplementation with folate in patients with pcos who are being treated with metformin . after 6 months of metformin treatment with supplementation with folic acid , a significant improvement was observed in all the markers of structure and function of the vascular endothelium . more interestingly , the extent of improvement in the structure and function of the endothelium was significantly different between patients who received supplementation with folic acid and subjects who received the placebo . in fact , significant differences were observed in the values for bad - b , bad - rh , fmd , imt , and serum et - 1 . the mechanisms that underlie these beneficial effects related to supplementation of metformin treatment with folic acid are not understood completely . in fact , the well - known physiological effect of folic acid is a reduction in the level of hcy in serum . regard , folic acid has been shown in several clinical studies to improve endothelial function independently of the reduction of hcy levels ( 21,22 ) . thus , although serum folate levels showed a nonsignificant increase in the current study , a direct effect of folic acid on the endothelium can not be excluded and could explain , at least partially , our findings . on the other hand , no beneficial or adverse effects were reported on the incidence of major cardiovascular events after supplementation with folic acid and vitamin b complex in a high - risk population of women over 7.3 years of follow - up ( 23 ) . a recent study ( 24 ) showed that long - term treatment with b vitamins in an attempt to reduce the level of hcy did not reduce imt or increase fmd in patients who had suffered strokes , even though a modest increase in fmd without any improvement in the structure of the vascular endothelium was observed after short - term treatment with b vitamins . conversely , treatment of patients affected by type 2 diabetes with high doses of metformin and folic acid to reduce serum hcy levels resulted in improved elasticity of small arteries , which suggested that folic acid has an additional beneficial effect on the vascular system ( 14 ) . in fact , the power analysis was based on previous data from a meta - analysis , which showed a hazard risk for myocardial infarction and stroke of up to 1.15 ( 95 % ci 1.121.17 ) and 1.18 ( 1.161.21 ) , respectively , for a reduction of 0.1 mm in imt in the general population ( 10 ) . in this regard , we consider that a difference in imt 0.1 mm between experimental and control treatments is most likely to be related to a clinically significant reduction of long - term risk , although this can only be proven over a long - term follow - upfirst , this is a preliminary clinical study conducted on a heterogeneous italian population with pcos . second , to define any short - and long - term results that are significant clinically , patients should be treated and followed for a longer period of time . third , further studies are needed before a clear indication can be obtained of the dose and regimen of supplementation with folic acid that is required to optimize the vascular benefits of the administration of metformin .\noutput:\n" }, { "from": "agent", "value": "objectiveto evaluate whether the administration of metformin exerts any effects on serum homocysteine ( hcy ) levels in patients with polycystic ovary syndrome ( pcos ) and whether supplementation with folate enhances the positive effects of metformin on the structure and function of the vascular endothelium.research design and methodsa total of 50 patients affected by pcos , without additional metabolic or cardiovascular diseases , were enrolled in a prospective nonrandomized placebo - controlled double - blind clinical study . they were grouped into two treatment arms that were matched for age and bmi . patients were treated with a 6 - month course of metformin ( 1,700 mg daily ) plus folic acid ( 400 g daily ; experimental group , n = 25 ) or placebo ( control group , n = 25 ) . complete hormonal and metabolic patterns , serum hcy , folate , vitamin b12 , endothelin - 1 levels , brachial artery diameter at the baseline ( bad - b ) and after reactive hyperemia ( bad - rh ) , flow - mediated dilation , and intima - media thickness in both common carotid arteries were evaluated.resultsafter treatment , a significant increase in serum hcy levels was observed in the control group compared with the baseline values and the experimental group . a beneficial effect was observed in the concentrations of bad - b , bad - rh , flow - mediated dilation , intima - media thickness , and serum endothelin - 1 in both groups . however , the results were improved more significantly in the experimental group than in the control subjects.conclusionsmetformin exerts a slight but significant deleterious effect on serum hcy levels in patients with pcos , and supplementation with folate is useful to increase the beneficial effect of metformin on the vascular endothelium ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: multiple endocrine neoplasia type 1 ( men1 ; mim 131100 ) is an autosomal dominant disease that predisposes individuals to develop parathyroid tumors ( 100 % penetrance by age 50 ) , pancreatic islet cells tumors ( 3075 % ) , and pituitary adenoma ( 1060 % ) ( 1 ) . some patients may also develop adrenal cortical tumors , carcinoid tumors , facial angiofibromas , collagenomas and lipomas . they can also develop a variable combination of more than 20 endocrine and nonendocrine tumors ( table 1 ) ( 2 ) , ( 3 ) . a diagnosis of men1 should be considered when two of the three principal men1 tumors affecting the parathyroids , pancreatic islets , or anterior pituitary are present . familial men1 is diagnosed when at least one other first - degree relative has one of the three main men1 tumors ( 4 ) . men1 is a rare disease ( the prevalence has been estimated at 23/100 ,000 ) caused by a mutation in the men1 gene ( menin , mim 613733 ) located on chromosome 11q13 and is characterized by a high penetrance ( 94 % by the fifth decade ) , high mortality , and no clear genotype - phenotype correlation compared with men2 . de novo mutations have been described in up to 10 % of cases ( 5 ) ( 9 ) . the men1 gene consists of 10 exons that encode a 610 - amino acid protein , menin , a nuclear protein that is ubiquitously expressed . menin is a tumor suppressor protein and also plays a role in maintaining dna stability and gene regulation . the model for tumorigenesis in familial men1 , according to knudson 's two hits theory , is that a mutated copy of men1 is inherited at the germline level from an affected parent ( first hit ) , whereas the wild - type copy , which is inherited from the healthy parent , is lost at the somatic level ( second hit ) , thereby resulting in a tumor . this mechanism is supported by the observation that heterozygosity is lost , or allelic loss occurs , when tumor dna is compared with constitutive dna ( 2 ) . genetic studies should be offered to patients who meet the clinical criteria for men1 ( sporadic or familial ) , their asymptomatic relatives , and patients who do not meet men1 criteria but have suspicious / atypical features that are suggestive of men1 . genetic testing has enabled the confirmation of clinical diagnosis , identification of asymptomatic carriers who require screening for tumor detection and early treatment and identification of family members who do not have the men1 mutation and , therefore , do not require further clinical examinations ( 10 ) . parathyroid tumors are the first manifestation of men1 in more than 87 % of patients ; however , other tumors , like pancreatic or pituitary adenoma , have also been reported as the first manifestation ( 7 ) . physical examination for dermal tumors should start in childhood and be carried out periodically . annual biochemical screening is recommended after five years of age , and tumor imaging should be performed less frequently ( table 2 ) ( 4 ) . we started men1 genetic testing in 2001 , initially with one family , and then helped other researchers in chile . we gathered 22 patients from four families and three sporadic cases , who were the youngest and the oldest patients included ( two patients ) . genetic testing was performed on two families ( 30 individuals ) , which identified 13 members with the ivs9 + 1g a mutation and three members with the ivs6 + 1g a mutation . regarding hyperparathyroidism ( hpt ) , all three of the unaffected individuals were younger than 24 years and the diagnosis was confirmed by genetic testing . of the 22 other hpt individuals , the mean age at onset was 39 years ( 1986 years ) and two patients were also diagnosed with concomitant parathyroid carcinoma ( at ages of 31 and 75 years ) . with regard to the other manifestations of men , their prevalence does not differ significantly from other published studies , with the exception of carcinoid tumors , which our data indicate are more frequent even though all of these cases occurred in the same family ( 7 ) . regarding cutaneous manifestations , we observed collagenoma , lipomas , and angiofibromas , but not all patients were meticulously examined ; therefore , definitive conclusions can not be reached . men type 2 ( men2 ) is an autosomal dominant syndrome that affects approximately one in 30,000 individuals ( 4 ) , ( 12 ) ( 14 ) . the major components of the syndrome are medullary thyroid carcinoma ( mtc ) , pheochromocytoma ( pheo ) and hpt . germline mutations in the proto - oncogene ret ( mim 164761 ) , located on chromosome 10q11 .2 , are responsible for the three subtypes : men2a ( 80 % ; mim 171400 ) , men2b ( 5 % ; mim 162300 ) and familial mtc ( fmtc , 15 % ; mim 155240 ) . mtc commonly presents alongside the three subtypes , and the risk of developing mtc is nearly 100 % . patients with men2a / 2b have a 3050 % risk of developing pheo , especially those who harbor mutations in codon 634 , codon a883f , and m918 t ( 12 ) ( 15 ) . diverse features differentiate both subtypes : on one hand , only patients with men2a are at risk of developing hpt and cutaneous lichen amyloidosis ( cla ) ( 1030 % and 12 % , respectively ) and only patients with men2b have marfanoid habitus , mucosal neuromas on the tongue , lips and subconjunctival areas and diffuse ganglioneuromas of the gastrointestinal tract ( 14 ) . in fmtc , affected patients suffer exclusively from mtc ; to prove that a particular member of a family has fmtc , it is necessary to demonstrate the absence of pheo and hpt in two or more generations within a family or provide evidence of an identified ret mutation in families with fmtc ( american thyroid association ) ( 13 ) . rarely , families with both men2 and hirschsprung 's disease have been found to have men2 - specific codons 609 , 611 , 618 , and 620 while also presenting with the men2a or fmtc subtypes ( 15 ) , ( 16 ) . mtc , when presenting along with men2b , develops earlier and has a more aggressive course than mtc in the other two subtypes . during the first year of life , the classic features of men2b may be lacking , so physicians must recognize the more subtle features of this condition , such as the inability to cry and constipation ( 17 ) . straightforward genotype - phenotype correlations in men2 have also been described , and , as expected , the aggressiveness of mtc is influenced by the specific ret mutation . for instance , mtc has been confirmed using thyroidectomy specimens collected from men2a patients as young as 15 months and in a 9 - month - old child with men2b ( m918 t ) ; their conditions progressed to n1 ( tnm staging ajcc 2002 ) at 5 and 2.7 years old , respectively ( 12 ) , ( 18 ) ( 20 ) . therefore , identification of the specific ret mutation that is present in at - risk patients allows for effective clinical screening and optimal clinical and surgical management . in 2009 , after extensive review of the literature , the american thyroid association ( ata ) replaced the consensus guidelines for diagnosis that were released in 2001 and developed a categorization system based on new evidence in order to offer age - based recommendations for performing prophylactic thyroidectomy , predict phenotypes and to establish who should be screened for pheo and hpt . we started ret genetic testing in 1997 and the most important findings have been published ( 16 ) , ( 21 ) , ( 22 ) . sequencing of the ret proto - oncogene was carried out in 60 sporadic mtc patients and 15 families with the men2 phenotype , totaling almost 200 individuals . in one family , , we found three new men2 ( probably fmtc ) individuals ( 5 % ) , one with codon 618 , one with codon v804 m , and another with codon s891a . this percentage is within the range of occurrence of apparently sporadic hereditary cases ( 47 % ) ( 23 ) , ( 24 ) . men2a accounted for 73 % of all cases , while fmtc and men2b account for 21 % and 6 % of cases , respectively . the female - male ratio was 1.271 . for patients who received genetic testing ( 61 out of 63 ) , the most common mutation was located in exon 11 ( 62 % ) , followed by exon 10 ( 25 % ) , exon 16 ( 6 % ) , exon 14 ( 3.5 % ) , and exon 15 ( 3.5 % ) . in our population , the c634w mutation was the most common ( 28 % ) , followed by mutations on exon 10 at codon c620r ( 21 % ) and the c634r mutation ( 18 % ) . these frequencies differ from the largest published series , where c634r is the reported as the most common mutation ( 13 ) , ( 15 ) . we identified 56 patients with mtc , with a median age of 28.5 years ( range : 173 years ) , and seven patients with cch , with a median age of 7 years ( range : 428 years ) . interestingly , a v804 m carrier who was operated on at 28 years of age showed only cch , demonstrating that this mutation may have low penetrance in some cases ( 12 ) , ( 14 ) . the median preoperatory serum calcitonin level was 11 pg / ml ( range : 2.927 pg / ml ) in patients with cch and 149 pg / ml ( range : 135549 pg / ml ) in patients with mtc . there was a high correlation between the preoperatory serum calcitonin level and tumor size and stage ( 0.79 and 0.69 respectively , p 0.005 ) . table 6 shows clinical outcomes and compares biochemical cure , persistent disease , and death with the method of diagnosis ( e.g. , genetic testing or clinical diagnosis ) : 14 patients died in total , and of these three died from hypertensive crisis , two from surgical complications ( one was diagnosed by genetic testing ) and nine from distant metastases ( including two out of the four patients with men2b ) . forty - nine patients are still alive : 36 are biochemically cured , 10 have persistent disease , two have not been operated on yet and one has unknown condition that is affecting his postoperatory calcitonin level . as expected , patients who were prophylactically operated on were more likely to be biochemical cured and demonstrated less persistent disease states than those who were operated on after clinical diagnosis . regarding the other main features , pheo was present in 27 % of patients , which presented bilaterally in most patients with pheo ( 70 % ) , and the patients who developed pheo had a median age of 34 years ( range : 2647 years ) . hpt was very uncommon ( 3 % ) and only seen in two patients with the c634r mutation , as has been reported in other studies ( 13 ) , ( 14 ) , ( 25 ) . cla was seen in three patients with the c634w mutation , which is in agreement with other reports in the literature ( 12 ) , ( 13 ) , ( 26 ) . we did not find any cases of hirschsprung 's disease , a rarely associated condition that has been described in patients with mutations in exon 10 ( 16 ) , ( 27 ) , ( 28 ) . we found four patients with the men2b phenotype ; de novo mutation was present in two of these patients and , retrospectively , both displayed the precocious symptoms of the inability to cry and constipation during the first year of life . in summary , the various types of men are inherited autosomal dominant syndromes . molecular biology techniques have made it possible to identify the genes responsible for causing men1 and 2 . the identification of the carriers of mutant men1 and 2 genes who are at risk of developing these syndromes requires frequent biochemical screening for the development of endocrine tumors . the identification of those who are negative will save resources and reassure both the patient and the family . carriers of the genes responsible for men2 should be advised to have thyroidectomy in childhood , according with the ata risk level of the patient . some cases of sporadic mtc are determined to actually be men2 following ret proto - oncogene testing ; therefore , the routine application of this test is recommended in all cases of apparent sporadic mtc .\noutput:\n" }, { "from": "agent", "value": "multiple endocrine neoplasia ( men ) types 1 and 2 are genetic diseases that are inherited as autosomal traits . the major clinical manifestations of multiple endocrine neoplasia type 1 include the so - called 3 p 's : parathyroid , pituitary , and pancreatic tumors , including gastroenteroneuroendocrine tumors . genetic testing can be performed on patients and the potential carriers of the menin gene mutation , but the genotype - phenotype correlation in multiple endocrine neoplasia type 1 is less straightforward than multiple endocrine neoplasia type 2 . most likely , the main advantage of genetic testing in men1 is to exclude from further studies those who are negative for the genetic mutation if they belong to a family with a known history of men1 . in chile , we started with rearranged during transfection proto - oncogene genetic testing ( men2 ) 15 years ago . we carried out a prophylactic total thyroidectomy to prevent medullary thyroid carcinoma in a three - year - old girl who presented with microscopic medullary thyroid carcinoma . more than 90 % of the individuals who tested positive using a genetic test achieved a biochemical cure compared with only 27 % of patients who receive a clinical diagnosis . mutations are mainly located in exon 11 ; the most common is c634w , rather than c634r . hypertensive crisis was the cause of death in three patients , and extensive distant metastases occurred in nine ( including two patients with multiple endocrine neoplasia type 2b ) of 14 patients . earlier recognition of medullary thyroid carcinoma and the other features of the disease , especially pheochromocytoma , will improve the survival rate of patients with multiple endocrine neoplasia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the world of public biological databases is constantly evolving , as attested by the ever - growing size of the nucleic acids research ( nar ) annual database issue and online molecular biology database collection , as well as by the creation of a new journal dedicated to databases and biocuration , database ( 1,2 ) . a wealth of new technologies is responsible for the exponential increase in the quantity , complexity and diversity of data generated in the life sciences . the need to store and share this data helps explain the explosion in the number and variety of resources that cater to the needs of biological research . many researchers have commented that this increased volume of data has not yet yielded proportional improvements in biological knowledge ( 35 ) . to a great extentthis is owing to the widespread and unconnected distribution of data through databases scattered around the world . clearly , adherence to open standards , as well as powerful and reliable tools , have become a necessity to support data sharing , integration and analysis ( 6 ) . the available databases can be broadly placed into three categories : ( i ) archival repositories , ( ii ) curated resources , hence the rise of biocuration described in ( 7 ) , and ( iii ) data integration warehouses . all three offer a range of querying and mining tools to explore the data and enable knowledge discovery . in addition , databases range from well - established repositories to burgeoning , innovative resources that cover emerging scientific areas or use novel technologies . while some databases are intended as long - term , consistently maintained community resources , others are intentionally temporary in nature , their existence being limited to the lifetime of the underlying grant or research project . as in any emerging field , standardization across the biological databasesconsequently , there is still unnecessary and costly duplication of efforts , poor interoperability between resources and loss of valuable data and annotations when a resource is no longer supported . most critically , the large number and variety of resources available are major hurdles for users , who are often unable to locate the resource ( s ) that best fits their specific needs . even when appropriate resources are located , combining data from different resources can be a very difficult task . having a uniform system for describing biological databases available in a single , centralized location would benefit both users and database providers : it would be much easier for users to find appropriate resources , while publicizing specialized resources and lesser known functionality of established databases more widely . to address some of these issues we propose the adoption of a community - defined , uniform , generic description of thesuch minimum information checklists are now being developed for a wide range of data types . for example , the mibbi ( minimum information for biological and biomedical investigations ) portal [ http://mibbi.org ; ( 8 ) ] contains over 30 mi checklists . the goals of the proposed biodbcore checklist are to : gather the necessary information to provide a general overview of the database landscape , and compare and contrast the various resources.encourage consistency and interoperability between resources.promote the uptake and use of semantic and syntactic standards.provide guidance for users when evaluating the scope and relevance of a resource , as well as details of the data access methods supported.ensure that the collective impact of these resources is maximized . gather the necessary information to provide a general overview of the database landscape , and compare and contrast the various resources . encourage consistency and interoperability between resources . promote the uptake and use of semantic and syntactic standards . provide guidance for users when evaluating the scope and relevance of a resource , as well as details of the data access methods supported . ensure that the collective impact of these resources is maximized . this working group is open to all interested parties , and has started to collect a list of attributes of the biodbcore checklist . biodbcore is registered with mibbi , the umbrella organization that works to promote minimal information reporting in biomedical and biological research ( 8 ) . table 1 . proposed core descriptors for inclusion in the biodbcore specificationproposed core descriptors for a biological database ( 1 ) database name ( 2 ) main resource url ( 3 ) contact information ( e - mail ; postal mail ) ( 4 ) date resource established ( year ) ( 5 ) conditions of use ( free , or type of license ) ( 6 ) scope : data types captured , curation policy , standards used ( 7 ) standards : mis , data formats , terminologies ( 8 ) taxonomic coverage ( 9 ) data accessibility / output options ( 10 ) data release frequency ( 11 ) versioning policy and access to historical files ( 12 ) documentation available ( 13 ) user support options ( 14 ) data submission policy ( 15 ) relevant publications ( 16 ) resource s wikipedia url ( 17 ) tools availablethe biodbcore will be used to collect information about databases for use in online browsing , searching and classification . the current specification can be found as an online survey and users are encouraged to join the project and leave feedback ( http://biocurator.org/biodbcore.shtml ; figure 1 ) . proposed core descriptors for inclusion in the biodbcore specification the biodbcore will be used to collect information about databases for use in online browsing , searching and classification . the current specification can be found as an online survey and users are encouraged to join the project and leave feedback ( http://biocurator.org/biodbcore.shtml ; figure 1 ) . to achieve widespread uptake and adoption of the biobdcore guidelines , these recommendations must be developed as a community effort . to get the initiative started , we have formed a working group encompassing representatives from a wide range of existing life sciences resources . this includes representatives from mibbi , editors from key journals publishing database descriptions , staff from model organism , sequences and protein databases , members of the asia - pacific bioinformatics network ( apbionet , http://www.apbionet.org/ ) , the bioinformatics links directory ( http://www.bioinformatics.ca/links_directory/ ) ( 9 ) , developers from the elixir survey of european databases and leaders of the database description framework ( ddf ) from the casimir project ( 10 ) . one of the working group participants , apbionet , has developed a framework for minimum information about a bioinformatics investigation ( miabi ) ( 11 ) that aims to cover all aspects of bioinformatics studies . this is an important opportunity to build a combined framework for advancing bioinformatics standards in a coordinated manner . the biodbcore checklist is overseen by the international society for biocuration ( isb ) ( http://biocurator.org/ ) , in collaboration with the biosharing forum [ http://www.biosharing.org/ , ( 12 ) ] . the isb was created in 2009 to promote and support the work of biocurators and bio - programmers . one of its goals is to foster interactions between these professionals to maximize the usefulness of all resources by encouraging the interoperability of databases and supporting data sharing . the biosharing forum works at the global level to build stable linkages between funders , implementing data - sharing policies , and well - constituted standardization efforts in the biosciences domain to expedite communication and achieve harmonization and mutual support . one - stop shop portal is under development for those seeking data sharing policy documents and information about the standards ( checklists , ontologies and file - formats ) , linking to exiting resources , such as mibbi . with this editorial , we announce the launch of this initiative and present for discussion an initial draft version of the specification of information to be captured . we welcome and encourage representatives of resources , included those listed in this nar database issue , nar molecular biology database collection ( 1 ) and the database journal to actively participate in the development of biodbcore . the biodbcore implementation will take place in three phases : ( i ) consultation with interested parties ; ( ii ) collaborative development of the minimal information list . to help establish requirements , some examples can be found on the biodbcore page of the isb , and moreover the apbionet 's biodb100 initiative will be used to develop further working examples ( 11 ) and ( iii ) in the longer term , completion of stable guidelines and their implementation as a public submission website that will allow data entry and easy update by database providers , in collaboration with the existing database collections and the biosharing standards portal to reduce duplication of effort . many of the members of the biodbcore working group have experience and expertise in establishing such services . we are aware that the adoption of this specification requires significant effort from all participating groups . however , the long - term benefits , both for the specific adopters and for the community as a whole , provides considerable compensation for this effort . the complete , uniform and centralized descriptions of databases should benefit both users and data providers by providing easy access to the scope of each resource . this will be particularly valuable for specialized resources that are only used within with a restricted research community . we envisage that having such rich information readily available may facilitate collaboration between resources currently outside each other 's immediate networks . we expect the biodbcore guideline to be useful not only to users of life sciences resources , but also to drive the evolution of databases themselves . for example , the initial version of biodbcore includes a field to describe data - submission policies . we hope that by including such a field in biodbcore , they will be encouraged to develop them . a longer term application of the information captured by biodbcore is to allow bird 's eye views of the database world to emerge by drawing connections between them into a resource network , showing the flow of data between different sites and how each complements the other . figure 1 . a screenshot of the biodbcore discussion page on the isb web site ( http://biocurator.org/biodbcore.shtml ) . a screenshot of the biodbcore discussion page on the isb web site ( http://biocurator.org/biodbcore.shtml ) .\noutput:\n" }, { "from": "agent", "value": "the present article proposes the adoption of a community - defined , uniform , generic description of the core attributes of biological databases , biodbcore . the goals of these attributes are to provide a general overview of the database landscape , to encourage consistency and interoperability between resources and to promote the use of semantic and syntactic standards . biodbcore will make it easier for users to evaluate the scope and relevance of available resources . this new resource will increase the collective impact of the information present in biological databases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: subarachnoid hemorrhage ( sah ) due to ruptured aneurysm occurs in 700,000 individuals a year , with nearly 40,000 of those cases occurring in the united states . the mortality rate associated with the occurrence of sah appears to have improved over the last 50 years , though it still remains that nearly half of all patients with a sah will die within one month of the initial bleed . cerebral vasospasm can occur in a majority of patients and is associated with poor outcome . despite having been recorded in patients treated for aneurysmal subarachnoid hemorrhage in 1951 , cerebral vasospasm ( cvs ) the occurrence of secondary ischemia and delayed ischemic neurologic deficits ( dind ) is common sequelae in vasospasm and often leads to poor long - term outcomes . the diagnosis and treatment of cvs are made complicated by the heterogeneity of presentation and ambiguous etiology . cerebral vasospasm is defined both clinically and angiographically , though these definitions are not mutually inclusive . the occurrence of vasospasm is biphasic with an acute phase that has been reported to begin 10 minutes to 3 - 4 hours after the initial bleed . the cause of vasospasm , whether angiographic or clinical , is still a source of debate . the inflammatory response to sah does appear to contribute to the etiology of cerebral vasospasm , specifically the role of leukocytes in releasing oxyhemoglobin after lysing extravasated erythrocytes in the subarachnoid space . platelet aggregation has also been indicated in the etiology of cvs , indicating a link between a patient 's fisher grade upon presentation and the incidence of cvs . effective interventions providing protection from cvs as well as improved outcomes post - cvs have lagged behind the treatment of sah . among the current treatment modalities for cerebral vasospasm , much interest has been placed in the use of calcium antagonists to prevent the contraction of smooth muscle in the cerebral arteries . the divalent inorganic cation magnesium is one such calcium antagonist and has been the subject of a large body of research . magnesium is one of the most common cations in the body and is required for many physiologic processes . it has been shown to cross the blood brain barrier in humans and animals , though serum levels are not reliable measure of cerebrospinal fluid ( csf ) magnesium levels . magnesium administration in humans has been shown to be well tolerated but can lead to hypotension , bradycardia , and subsequent poor outcomes if serum concentrations rise too high . in terms of a therapeutic role for magnesium in vasospasm , its function as a physiologic calcium antagonist and thus a potent vasodilator has been of most interest , though some neuroprotective effects have also been observed . magnesium antagonizes the function of calcium by acting on and competing for the n - methyl d - aspartate ( nmda ) receptors , causing an inhibition of excitatory postsynaptic potentials . magnesium also directly affects the physiologic function of calcium by serving as an intracellular noncompetitive inhibitor of the ip3-gated calcium channel and a noncompetitive antagonist of voltage - dependent calcium channels . furthermore , magnesium appears to inhibit the formation of free radicals after tissue injury . the protection afforded to the neurovascular unit or to neuronal functioning is most likely due to the attenuation of the glutamate surge in a postischemic setting . this prevents a postischemia excitotoxic phase from occurring and preserves brain parenchyma from further harm . due to its ubiquitous functionality in the body , magnesium has been used in obstetrics to treat preeclampsia and in cardiology to treat acute myocardial infarctions . when considering cvs , research into the use of magnesium as a therapeutic tool has focused mainly on its role in prophylaxis and its ability to treat or ameliorate established vasospasm . intuitively , its use is indicated by the serum profile of patients who present with sah . hypomagnesemia occurs in approximately 10 % of hospitalized patients , though this proportion rises sharply when other electrolyte deficiencies are present and has been linked to poor outcomes and secondary ischemia when occurring after sah . the goal of this review is to assess the current state of research regarding magnesium , specifically its role as both a calcium antagonist and neuroprotective agent when used to treat cerebral vasospasm . to date , research on this topic has focused mainly on two domains : ( 1 ) experimental animal models and ( 2 ) human clinical trials . these two domains will be the main focus of this review , as they provide the greatest wealth of data to direct future studies . magnesium has been well documented to have an effect on cerebral vasculature both in vitro and in animal models . these studies are fairly heterogeneous in their methods and outcome measurements , though a trend can be seen towards improved outcome in treatment groups . b. t. altura and b. m. altura showed that excised basilar arteries ( ba ) displayed a contractile response to the removal of extracellular magnesium , and contrapositively , a dilatory response upon exposure to a high extracellular magnesium concentration . many of the current studies use the dilation of the basilar artery ( ba ) , vertebral arteries ( va ) , and superior cerebellar artery ( sca ) as indicators of efficacy . additionally , a study by ha et al . observed that vasospasm induced by surgical manipulation ( axial tension ) in rats was attenuated by topical application of magnesium on the affected arteries ; though this study does not involve the cerebral vasculature , surgical treatment of aneurysms can replicate this type of tension in the brain and therefore may respond similarly . in their review of animal models of sah and pharmacologic treatment , zoerle et al . reported that translation from animal models to clinical practice has proven challenging , an effect possibly due to publication bias , methodological flaws , or variability among studies . they further report that intravenous magnesium sulfate administration was the only treatment to produce no reduction in angiographic cvs , whereas all other pharmacologic treatment modalities produced improved results . upon further analysis , zoerle et al . only included one study ( conducted by macdonald et al . ) , involving the use of magnesium as a treatment in primates . to identify the role of magnesium in animal models , we have summarized several studies in table 1 , demonstrating magnesium 's dilatory effects on vertebral arteries after established sah and observed cvs . of the seven studies published , only one failed to observe the dilatory effects of magnesium on cerebral vasculature . one study exclusively assessed the neuroprotective effects of magnesium sulfate after sah , reporting a reduction in the size of post - sabh ischemic damage . in summary , it appears that intracisternal injection , as well as topical treatment of mgso4 , is successful in dilating cerebral vasculature . intravenous injection of mgso4 appears to be less efficacious as a treatment , data that are in agreement with previous reports of the nonlinear transfer of mg between serum and csf . doses of 0.5 ml / kg of 15 mmol mgso4 appear to produce a profound effect when injected directly into the csf ; these data are in agreement with a dose - finding study , in which mori et al . found that in order to produce a significant effect on cerebral vasculature , csf levels of mg needed to be greater than 3the role of magnesium as a potential neuroprotective agent is more difficult to elucidate as only one study attempted to specifically assess this function , while other studies either provided a cursory mention or no mention of this function . using a rat model of sah , van den bergh et al . set out to address the potential protective effects of magnesium when given prior to induced sah . in their treated subjects , it was observed that magnesium reduced the total ischemic damage , potentially by attenuating the duration of neuronal depolarizations . 's data reporting that administration of magnesium decreases the excitotoxic glutamate overload following ischemia . studies assessing the role of magnesium therapy in sah and subsequent cvs have been hindered by inconsistencies across various clinical practices and a lack of large , multicenter studies . in both cases , several studies have yielded conflicting results , calling into question the quality of current data . multiple variables account for the heterogeneity of the current state of magnesium therapy literature , including a variety of methods involving : ( a ) aneurysm treatment , ( b ) vasospasm surveillance , ( c ) magnesium administration times , ( d ) magnesium doses , and ( e ) outcome measures . all of these variables complicate the integration of data . a 2008 cochrane review aimed to determine whether calcium antagonists , specifically magnesium , improved outcome in patients with aneurysmal sah . all included studies were randomized controlled trials comparing calcium antagonists and / or a second calcium antagonist versus control . the final results yielded 3,361 total patients over 16 studies , three studies evaluating magnesium sulphate in addition to nimodipine . for magnesium in addition to standard nimodipine treatment , the relative risk was 0.75 for a poor outcome and 0.66 for clinical signs of ischemia . the authors concluded that magnesium is a promising new agent ; however , more information is needed to draw definitive conclusions . four retrospective analyses were identified that analyzed the treatment of cvs with magnesium sulfate , though important clinical outcome data were not collected or omitted in two studies . in the other two , no significant difference in neurologic outcome was found in the treatment versus placebo groups . aneurysm treatment modality was found to not have an effect on incidence of cvs , a finding that has been supported by a 600 patient study conducted by alaraj et al . . overall , the general findings throughout the retrospective studies were that of slight neuroprotection offered by magnesium therapy as well as a trend towards decreased incidence of cvs . these data should be interpreted cautiously , however , especially after taking into account the prospective randomized controlled trials ( rct ) . there were eleven prospective studies identified for analysis in this review , including nine rcts . pilot studies indicate a possible benefit from the use of magnesium to prevent or treat cvs , though their results are mainly inconclusive . one study by schmid - elsaesser et al . did not administer magnesium as an adjunct to the established calcium channel antagonist , nimodipine , instead of comparing the outcomes when each was administered separately . only one study by muroi et al . reported a majority of adverse side effects from the administration of magnesium . similarly to the retrospective studies , a general trend can be elucidated : there is a progression towards decreased incidence of cvs in the magnesium group , though this is not always statistically significant . reports from the prospective studies do present conflicting information , and many call for a large , multicenter trial to produce definitive conclusions . two recently completed phase iii trials are included in this analysis : intravenous magnesium sulphate for aneurysmal subarachnoid hemorrhage ( imash ) , and magnesium for aneurysmal subarachnoid haemorrhage ( mash - 2 ) . both were randomized , double - blind , placebo - controlled trials involving a large number of patients across multiple institutions . primary outcome in the imash study was defined as either severe deficit identified using the rankin scale or death three months after treatment . no secondary outcomes , quality of life measurements , or neurocognitive deficits were assessed . for the mash - 2 study , primary outcome was defined as good outcome using the glasgow outcome scale extended questionnaire and did secondary outcomes such as the presence of cvs and the sf - 36 questionnaire score . despite differences in outcome measures for these two clinical trials , similar outcomes were found for both magnesium and placebo groups in both studies . in the imash trial , wong et al . concluded that intravenous magnesium treatment was not efficacious in the treatment of sah . in mash - 2 , have not recommended the use of magnesium as an adjunct in sah . despite significant strengths , both studies suffered from methodological flaws . two important limitations were as follows : ( 1 ) recruitment of patients was completed over a wide range of times , and ( 2 ) initiation of treatment was consistently reported to begin after the acute cvs window had passed . in the imash and mash - 2 studies , participants were included if they were admitted within four days and 48 hours after sah , respectively . this time frame excludes the possibility of utilizing magnesium as a prophylactic tool to prevent acute cvs . furthermore , though the mash - 2 study did report serum levels of magnesium during treatment , this was not recorded in the imash study . this omission is important as the nonlinear movement of magnesium from the blood into the csf might not have allowed a therapeutic amount of magnesium to accumulate and be maintained in the csf . however , despite their deficits , these are the first studies to record a large number of patients and long - term outcomes without a loss of followup . while the value of intravenous magnesium therapy for the prevention and treatment of cvs remains questionable , magnesium may still play a role in the course and eventual treatment of this disease . risk - benefit analyses of various alternative administration routes need to be considered , such as intracisternal or intrathecal infusion . these studies also may indicate a different role for cvs in mortality and morbidity following sah . there may be other causes of dci or dind that are not directly related to vasospasm , and research into alternative etiologies , and how those alternative etiologies may confound investigations into magnesium , is warranted .\noutput:\n" }, { "from": "agent", "value": "subarachnoid hemorrhage ( sah ) is characterized by bleeding into the subarachnoid space , often caused by ruptured aneurysm . aneurysmal rupture occurs in 700,000 individuals per year worldwide , with 40,000 cases taking place in the united states . beyond the high mortality associated with sah alone , morbidity and mortality are further increased with the occurrence of cerebral vasospasm , a pathologic constriction of blood vessels that can lead to delayed ischemic neurologic deficits ( dind ) . treatment of cerebral vasospasm is a source of contention . one extensively studied therapy is magnesium ( mg ) as both a competitive antagonist of calcium at the n - methyl d - aspartate ( nmda ) receptor , and a noncompetitive antagonist of both ip3 and voltage - gated calcium channels , leading to smooth muscle relaxation . in our literature review , several animal and human studies are summarized in addition to two phase iii trials assessing the use of intravenous mg in the treatment of sah ( imash and mash - 2 ) . though many studies have shown promise for the use of mg in sah , there has been inconsistency in study design and outcomes . furthermore , the results of the recently completed clinical trials have shown no significant benefit from using intravenous mg as adjuvant therapy in the treatment of cerebral vasospasm ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sulfur mustard ( military code hd ) is a weapon of mass - destruction that is relatively simple to synthesize ; it is lethal in high doses and causes severe damage to skin , lungs , respiratory tract , and eyes . the most prominent toxic effects of hd are to dermal tissues where it produces severe damage including extremely slow healing lesions and blisters , which can ulcerate and promote secondary infections . despite the long military history of hd , the molecular mechanisms for its toxicity are not fully elucidated and an effective countermeasure has remained elusive . both hd and cees ( a monofunctional analog of sulfur mustard ) are alkylating agents that covalently react with nucleic acids , proteins , and intracellular glutathione ( gsh ) . gsh is a key intracellular antioxidant that is depleted by exposure to hd or cees . a considerable body of evidence supports the notion that oxidative stress is an important factor in promoting hd / cees toxicity and that antioxidants such as gsh or nac could be important countermeasures . recent studies have shown that gsh and nac , especially if used as a pretreatment , not only increase viability of cees - treated keratinocytes , but also attenuate cees toxicity in skh - 1 hairless mouse skin . the effectiveness of these antioxidants in cultured cells and animal models suggests that an oral application of gsh and / or nac should be considered as a potential countermeasure to the hd / cees toxicity in humans . first , the antioxidants are effective only during a short period after the exposure ( 1 hour ) . second , the effective dose of gsh in the animal experiments was 300 mg / kg , which suggests that the effective gsh dose in human should be in the range of few tens of grams . therefore , a systemic application in humans would be difficult due to the requirement of large amounts of solid or liquid antioxidants for a single treatment . a topical application seems to be more appropriate ; however , the absorption of water - soluble antioxidants is minimal after the topical application ( less than 1 % of the applied dose penetrates the stratum corneum ) . thus , we suggest that the treatment design should be based on the combination of the antioxidants with an effective delivery system for topical application . antioxidant liposomes , spherical nanoparticles consisting of phospholipid bilayer ( s ) with an aqueous compartment , possess the unique ability to effectively deliver both lipid soluble chemical antioxidants ( in the lipid bilayer ) and water - soluble chemical antioxidants ( in the aqueous phase ) . moreover , liposomes rapidly penetrate the dermal barrier making the delivery of water - soluble compounds as effective as lipid - soluble drugs . in contrast with other drug carriers such as dmso , liposomes are absolutely harmless to human skin since they are composed of naturally occurring biodegradable phospholipids . in previous studies , it has been demonstrated that antioxidant liposomes with encapsulated nac and antioxidant enzymes protect lung epithelial cells and reduce lymphocyte infiltration in rats intratracheally exposed to cees . we suggest that antioxidant liposomes could be useful as a multifunctional therapy since liposomal formulations similar to those used in the rat lung studies could also be protective in skin . in the present study , we tested the ability of several liposomal formulations containing water - soluble antioxidants ( nac or gsh ) and / or lipid - soluble antioxidants ( tocopherols or alpha - lipoic acid ) to attenuate cees toxicity after the dermal exposure . the protective effects of liposomes were initially studied in hacat human keratinocytes exposed to sulfur mustard analog , cees . the most protective gsh - containing liposomes were then tested in a human epidermal model , epiderm . stemline keratinocyte medium ii ( without l - glutamine , calcium - free ) , fluorimetric caspase - 3 assay kit , sigma luciferase atp determination kit , cees , nac , gsh , cholesterol , rrr - alpha - tocopherol , rrr - gamma - tocopherol , r - alpha - lipoic acid , dmso , edta , and all organic solvents were obtained from sigma chemical company ( sigma - aldrich inc . , st . celltiter 96 aqueous one solution cell proliferation assay kit based on mts ( 3 - ( 4,5 - dimethyl -2-yl ) - 5 - ( 3 - carboxymethoxyphenyl ) - 2 - ( 4 - sulfophenyl ) - 2h - tetrazolium , inner salt ) was purchased from promega corporation ( madison , wis ) . soybean phospholipid mixture phospholipon 90 g was obtained from american lecithin company ( oxford , conn ) . spontaneously immortalized human keratinocytes hacat were purchased from cell lines service ( eppelheim , germany ) . hacat cells were cultured at 37c in a humidified incubator with 5 % co2 in stemline keratinocyte medium ii ( without l - glutamine , calcium - free ) supplied with 10 % fetal bovine serum sigma chemical company ( st . adherent cells were subcultured over night in 96 well costar tissue culture plates in the keratinocyte medium ii and treated with cees in the presence or absence of various concentrations of antioxidants or antioxidant liposomes as indicated in the figures . cees was used only as fresh stock solutions in anhydrous dmso , which was quickly mixed with culture medium immediately prior to incubation ( final concentration of dmso was 1 % ( vol . / vol . ) ) . cees final concentration of 1 mm was chosen as it stably reduced hacat viability to 2030 % in our experimental settings ( preliminary experiments ) . this observation is in accordance with findings published by other investigators . epiderm human skin model system epi - 200 and conditioning medium were purchased from mattek corporation ( ashland , mass ) . epiderm is an in vitro human skin equivalent that consists of normal , human - derived epidermal keratinocytes ( nhek ) , which have been cultured to form a multilayered , highly differentiated model of the human epidermis ( http://www.mattek.com/pages/products/epiderm ) . the epiderm tissues in a clear plastic 24 - well plate were reconditioned overnight according to the manufacturer 's instructions . cees - containing media ( freshly mixed ) were applied topically ( 250 l per tissue ) into the plate insert . treatments ( free antioxidant solutions or antioxidant liposomes ) premixed in the culture media were applied by changing the bottom media . nac and gsh are capable of scavenging mustard electrophiles in solution . in order to prevent direct interaction of the antioxidantliposomes with cees , gsh - or nac - containing liposomes were added into the bottom media , whereas cees containing media were applied to epiderm tissues topically . water - soluble antioxidants ( gsh or nac ) were prepared as 0.5 m stock solutions in pbs ( ph adjusted to 7.4 ) , filter - sterilized , and stored at 4c for two weeks or less . lipophilic antioxidants ( alpha - tocopherol , gamma - tocopherol , or alpha - lipoic acid ) were prepared as 50 mm stock solutions in anhydrous ethanol and stored at 20c . antioxidant liposomes were prepared by extrusion of the phospholipid / cholesterol dry film emulsified in pbs . six types of antioxidant liposomes ( see table 1 ) were made by the extrusion technique using a small extruder apparatus purchased from avanti polar lipids inc . prior to extrusion , a lipid film was prepared in a 2 ml glass vial by mixing the lipid - soluble component stock solutions in chloromethane ( phospholipon 90 g , cholesterol with or without tocopherols or alpha - lipoic acid ) with subsequent evaporation of the solvent under a nitrogen stream . the thin lipid film was then hydrated and detached by vigorous mixing in pbs ( which did or did not contain water - soluble antioxidants gsh or nac ) at 30c . solubilized large multilamellar vesicles were then extruded through a polycarbonate membrane with 100 nm size pores ( avanti polar lipids inc . , the resulting liposomes , large unilamellar vesicles with a mean diameter 12030 nm , were used the next day or stored at 4c for one week or less . liposomes of this size provide relatively high antioxidants / phospholipids ratio and are not large enough to stimulate macrophages . liposomes of this size have been successfully used to attenuate cees toxicity in various models . size distribution of the liposomes was monitored in pbs by using dynamic light scattering with a nicomp 380 particle sizing systems ( port richey , fla ) . if liposomes were stored for more than one day their size distribution , the main parameter of liposome stability , was monitored again prior to the treatment . all of our liposome preparations appeared stable for at least one week . in the tissue culture experiments , antioxidant liposomes ( table 1 ) or antioxidant solutions / suspensions in pbs ( as controls ) were applied to hacat cells simultaneously with cees . in the epiderm experiments , antioxidant liposomes ( containing 200 mm nac or gsh encapsulated ) or antioxidant solutions in pbs ( as controls ) were applied to epiderm tissues via the bottom membrane ( diluted 1 : 20 ( v / v ) in the bottom media , thus providing a calculated final concentration of 10 mm ) and simultaneously with cees , which was applied topically . such application excluded direct contact between cees and liposomes , therefore preventing possible absorption of cees by liposomal phospholipids and subsequent hydrolysis of cees by the aqueous liposomal interior . overall design of these experiments was developed in accordance with the studies of cees toxicity in the epiderm models as well as with the studies of the protective effects of antioxidant liposomes in various models . the pi assay in the hacat cells was performed by a slight modification of the method described earlier . briefly , at the end of each experiment , cultured cells in 96 well dark plates with clear bottom ( 200 l of medium per well ) were incubated with pi ( final concentration 2 g / ml ) at 37c for 30 min . pi fluorescence in the dead cells was measured using a fluostar galaxy microplate reader ( bmg , germany ) at an excitation wavelength of 485 nm and an emission wavelength of 650 nm . the results were calculated using the formula : viability ( % ) = 100 ( 1 [ ( test sample low control ) / ( high control low control ) ] ) , where test sample is fluorescence of the cells exposed to cees or vehicle , low control is fluorescence of the cells in medium without cees or vehicle ( negative control , minimal fluorescence ) , high control is fluorescence of the cells incubated in medium containing 1 % triton x-100 ( positive control , maximal fluorescence ) . the mts assay in the hacat cells and in the epiderm tissues was performed using celltiter 96 aqueous one solution ( mts solution ) according to the manufacturer 's instruction . briefly , at the end of each experiment , cultured cells in clear plastic multiwell plates were incubated with celltiter 96 aqueous one solution ( diluted 1 : 20 ( v / v ) with medium ) at 37c for 1.5 hours . for hacat keratinocytes , the mts solution was applied by complete change of the culture medium . for epiderm tissues , celltiter 96 aqueous one solution was diluted into fresh bottom media and applied simultaneously with cees or vehicle ( applied topically ) . the formazan derived from mts is water soluble ( unlike mtt formazan product that needs to be dissolved in dmso ) and does not require additional washout or any separation of the cells prior to the od measurement . the formazan product produced by viable cells was detected by a visual inspection , and the od was measured at 590 nm with a spectra max plus 384 microplate reader ( molecular devices , sunnyvale , calif ) . in our preliminary experiments , blank liposomes containing phospholipids and cholesterol only ( see table 1 ) did not show any effect on cell growth inhibition after 24 or 48 hour incubation ; also , they did not attenuate the effect of cees significantly ( data not shown ) . therefore , we used blank liposomes as a control . caspase - 3 assay ( an apoptosis index ) and intracellular atp measurements ( drastic atp loss reflects necrosis ) were performed by assaying cell lysates using the caspase - 3 assay kit and the sigma luciferase atp determination kit , respectively , ( sigma - aldrich inc . , st . caspase - 3 and atp were measured in the cell lysates in order to estimate relative contribution of apoptosis and necrosis in the cell death mechanism in the epiderm . staurosporine ( 5 m ) was used to induce apoptosis ( positive control ) . to prepare cell lysates , epiderm tissues were carefully removed from insert membranes using a sterile forceps and placed in 1.5 ml microcentrifuge tubes . a volume of 100 l of somatic cell atp releasing reagent ( sigma - aldrich inc . the next day the samples were allowed to thaw for 15 min at room temperature . the supernatant fluids , designated the tissue lysates , were transferred to fresh plastic tubes and were placed on ice until assayed . all assays were performed immediately upon preparation of tissue lysates . at the end of incubation with celltiter 96aqueous one solution ( containing mts ) epiderm tissues were rinsed with cold sterile pbs , removed from insert membranes using forceps , placed on aluminium foil and frozen at 80c . for sectioning , each tissue was fixed between two thick layers of oct ( optimal cutting temperature ) compound . was cut in half and fixated on a microtable with oct compound in order to make vertical cuts . tissue slices ( 25 m thickness ) were made on leica rapid sectioning cryostat cm 1900 ( meyer instruments inc . , houston , tex ) , put on glass slides and fixed with formalin solution ( sigma - aldrich inc . , st . slides were examined and photographed using a bx51 olympus microscope equipped with a cc12 digital camera ( olympus america inc . , center valley , pa ) . hacat cell density was adjusted to 210 / ml , and a 100 l aliquot of the cell suspension in media was placed in each well of an 8 - well lab - tek chamber glass slide ( nunc , rochester , ny ) . vehicle ( 1 % dmso ) or cees ( 1 mm ) in the presence or absence of 10 mm gsh ( either encapsulated in the liposomes ( gsh - liposomes ) or nonencapsulated ( free gsh ) ) were simultaneously added to chamber slides and incubated for 6 hour ( to evaluate ros generation due to cees exposure ) or 18 hours ( to evaluate total thiol depletion due to cees exposure ) at 37c in 5 % co2 . the time period for the ros monitoring experiment was relatively short in order to account for relatively short lifespan of ros particles . at the end of the incubation ( 6 or 18 hours , resp . ) 100x stock solution of 6 - carboxy -2,7-dichlorodihydrofluorescein diacetate ( cardcfh - da ; h2o2 - sensitive probe for intracellular ros monitoring ) or 5 - chloromethylfluorescein diacetate ( cmf - da ; nonprotein thiol sensitive probe for intracellular thiols , including gsh ) in dmso was added ( final cardcfh - da or cmf - da concentration was 10 m ) and the slides were further incubated for 20 min at 37c in the dark . 100 m tert - butyl hydroperoxide ( tbhp ) was used to induce oxidative stress in the absence of cees or antioxidants ( positive control ) . the cells were washed with cold pbs twice , observed , and digitally photographed using a motic inverted phase contrast fluorescence microscope equipped with a nikon coolpix e43004 - megapixel camera ( martin microscope , easley , sc ) . vehicle - treated sample stained with cardcfh - da were photographed as merged images ( green fluorescence and phase contrast ) in order to visualize live cells in the absence of fluorescence . the number of living cells ( green fluorescence ) was determined after counting 200 cells in the squares ( 4 squares per sample ) of same size for each condition tested . data were analyzed by anova followed with the scheffe test for significance with p .05 using spss 17.0 for windows ( chicago , ill ) . mean values not sharing a common letter are significantly different ( p .05 ) . the mean values and standard deviations of at least three independent experiments are provided in all the figures . we first performed a series of preliminary experiments testing the effect of various antioxidant liposome formulations in hacat keratinocytes exposed to cees . six types of liposomes containing various antioxidants : blank ( no antioxidants ) , nac , gsh , alpha - tocopherol ( at ) , gamma - tocopherol ( gt ) , or alpha - lipoic acid ( ala ) were used for the initial experiments in hacat cells . figure 1 shows hacat cell viability ( mts assay ) after the exposure to 1 mm cees and simultaneous treatment withfree or liposome - encapsulated water - soluble antioxidants ( nac or gsh ) . the effects of antioxidant liposomes on the cell proliferation were measured by the mts assay after 18 hour incubation ( see section 2 ) . these results were confirmed with viability assays using the fluorescent probe propidium iodine ( pi ) that stains dead cells ( data not shown ) . both assays showed similar patterns for cell survival ( pi ) and for cell growth inhibition ( mts ) . only water - soluble antioxidants ( nac and gsh ) were effective in these experiments . both 5 mm and 10 mm gsh - liposomes prevented cees - induced decrease of cell viability in hacat keratinocytes ( figure 1 ( a ) ) . in a similar experiment , nac - liposomes also showed a dose - dependent increase in cell viability with the maximum at 10 mm , however , the effect was slightly lower compared to gsh - liposomes ( figure 1 ( b ) ) . gsh - liposomes were the most protective since they increased cell viability from 28 % ( blank liposomes ) to 67 % ( 10 mm gsh , liposome encapsulated ) . however , the effects of liposome - encapsulated nac and gsh were equal to the effects of nonencapsulated free nac and gsh . the lipid - soluble antioxidants ( alpha - tocopherol , gamma - tocopherol , or alpha - lipoic acid ) were not protective when liposome - encapsulated or as suspensions in pbs ( data not shown ) . in order to show that cees induces oxidative stress in the hacat cells we performed a series of fluorescent microscopy experiments monitoring ros and thiol status of the cees - treated cells in the presence and in the absence of gsh - liposomes ( figure 2 ) . as evidenced by cardcfh - da fluorescence , intracellular h2o2 , a major marker of ros generation , was enhanced upon the cees treatment ( 6 hours ) ; however , in the presence of gsh - liposomes or freecees exposure ( 18 hours ) also reduced average number of viable cells counted under microscope ( 14.78.2 % of control ) and promoted total thiol depletion ( figure 2 ( b ) ) ; the effect was attenuated in the presence of gsh - liposomes ( 33.19.5 % of control ) , as well as in the presence of free gsh ( 28.411.5 % of control ) . these observations provide additional evidence that the gsh - liposomes effectively protect human keratinocytes exposed to cees and attenuate cees - induced ros production and thiol depletion , although the effect of liposome - encapsulated gsh was similar to the effect of free gsh . these data also suggest that in hacat keratinocytes , gsh - liposomes provide effective intracellular gsh delivery . epiderm tissue consists of organized basal , spinous , granular , and cornified layers of differentiating epidermal human keratinocytes that closely mimic human epidermis . at present , epiderm is one of the best available in vitro models of human skin and has successfully been used to study cees toxicity in vitro . at firsta dose - dependent decrease of cell viability due to cees ( 0.55.0 mm ) exposure was observed ( data not shown ) . cees concentration of 2.5 mm reduced cell viability within the epiderm tissues to 488.6 % , and this concentration was chosen for the following experiments to study the effect of antioxidants . we tested the protective effect of gsh - and nac - containing liposomes in epiderm tissues exposed to cees . we found that only gsh - liposomes increased cell viability ( figure 3 ( a ) ) and reduced atp depletion ( figure 3 ( b ) ) in the epiderm tissues topically exposed to 2.5 mm cees . gsh - liposomes added immediately after cees provided an extremely effective countermeasure to cees toxicity since both cell viability ( figure 3 ( a ) ) and atp level ( figure 3 ( b ) ) did not significantly decrease from their original levels as observed in cells treated with vehicle alone . the attenuation of atp depletion in keratinocytes evidenced that gsh - liposomes reduce necrosis induced by cees . we also evaluated the ability of gsh - liposomes to influence apoptosis in cees - treated epiderm tissues using the caspase - 3 assay ( figure 4 ) . cees and hd induce both apoptosis and necrosis in human cell lines including hacat keratinocytes . however , relatively low doses of hd induce mostly apoptosis , whereas higher doses promote necrosis . thus , it is likely that cees 2.5 mm would promote mostly necrosis with only limited induction of apoptosis . indeed , at a level of 2.5 mm , cees induced a relatively low level of apoptosis in epiderm ( figure 4 ) . considering the marked loss of atp ( figure 3 ( b ) ) , necrosis , but not apoptosis is likely the major cause of cell death at this level of cees . figure 4 also shows that gsh - liposomes did not inhibit the apoptosis induced by 2.5 mm cees . these experiments suggest that gsh - liposomes are effective in blocking cees toxicity and necrosis , but do not prevent apoptosis in the epiderm model . in order to test the potential protective effect of gsh - liposomes under posttreatment conditions , we performed an experiment , in which nac - or gsh - liposomes were applied to epiderm one or two hours after the cees ( 2.5 mm ) exposure . only gsh - liposomes and free gsh showed significant protection in this experiment ( figure 5 ) . in the epiderm tissues , cees exposure reduced cell viability to 245 % ; gsh - liposomes applied simultaneously with cees altered cell viability to 879 % ; gsh - liposomes applied one hour after cees altered cell viability to 5211 % ; gsh - liposomes applied two hours after cees altered cell viability to 3212 % . although the latter ( two hours ) effect was not significant , the effect of one - hour posttreatment with gsh - liposomes was statistically significant , and the toxicity of cees was attenuated substantially ( two - fold difference ) . nac - liposomes did not show any statistically significant protective effect in the posttreatment experiments ( data not shown ) . it is known that hd and its analogs induce morphological changes in keratinocytes , in particular , hd affects size and shape of the cells and induces fragmentation of the extracellular matrix . in order to determine whether gsh - liposomes influence keratinocyte morphology , we performed microscopic examinations of epiderm tissues incubated with cees in the presence or absence of gsh - liposomes ; tissues were stained with mts at the end of the incubation to visualize viable cells . after cees ( 2.5 mm ) exposure the apical side of the keratinocyte multilayer showed the matrix disassembly ( the cells lost their compact structure within the tissue and prominent gaps appear in the matrix ) ; the integrity of the cell multilayer was markedly disturbed and the majority of proliferating cells were detached and lost . the remaining cells formed a dense structure with a very limited number of live cells . the remaining live cells appeared violet in color due to the reduction of mts dye by functioning mitochondria ; these cells showed size reduction and round shape ( figure 6 ) . this observation is in agreement with recent study of cees toxicity in the epiderm full - thickness skin equivalents . treatment with blank liposomes ( composed with phospholipids only ) did not affect the cees - exposed cells , however , marked changes were observed upon simultaneous treatment with cees and gsh liposomes ( figure 6 ) . the number of live keratinocytes increased as observed by the mts staining ; some live cells retained normal shape ; however , the overall integrity of the tissue was somewhat lower if compared to the control ( tissues exposed to vehicle only ) . our studies with the human epidermal model , epiderm , showed that gsh , bothfree and liposome encapsulated , attenuated toxicity induced by cees , a mustard gas analog . in our experimental settings , antioxidant liposomes and cees were applied separately ( topically and to the bottom media , resp . ) in order to prevent their direct interaction and scavenging of cees by the liposomes . systemic application of free gsh would require consumption of large amounts of solid or liquid antioxidants because hydrophilic compounds poorly penetrate the stratum corneum ; therefore , antioxidant liposomes would provide a reasonable alternative , especially after the dermal exposure . moreover , the liposome design presents an additional advantage as it allows encapsulating of multiple lipophilic and hydrophilic components . for instance , antioxidants can be combined with anti - inflammatory drugs as inflammation plays a role in the development of skin lesions . at a relatively high cees dose ( 2.5 mm ) , the major cause of cell death in our studies was necrosis with only a slight additional effect caused by apoptosis . our results indicated that the gsh liposomes not only enhanced cell viability in epiderm tissues exposed to cees , but also reduced necrosis as evidenced by inhibition of atp depletion induced by cees exposure . on the other hand , as shown by the caspase - 3 activity measurements , gsh liposomes had no significant effect on cees - induced apoptosis ( 2.5 mm cees ) . this is in accord with numerous studies of cees or hd toxicity to various cell lines including human keratinocytes . in endothelial cells and lymphocytes and also in hacat keratinocytes , relatively low doses of hd induced mostly apoptosis , whereas higher doses promoted necrosis . chiarugi , has shown that a potent alkylating agent , if applied to the cells at a sufficient level , induces a programmable form of necrosis due to a genotoxic stress . necrosis is a more inflammatory form of cell death . in epidermal keratinocytes , necrosis , but not apoptosis , the open wounds due to hd exposure were highly susceptible to infections and showed many typical characteristics of necrotic tissues . thus , in the search for therapeutic countermeasures to hd , it is important to show that the prospective treatment not only increases cell viability but also reduces necrosis . in our recent workapoptosis - to - necrosis switch in the hacat cells exposed to cees . the molecular mechanisms of cees / hd toxicity in human skin have not been fully investigated . recent findings strongly suggest , however , that these mechanisms are complex ; they involve dna and other macromolecular damage , oxidative stress and inflammation . it is widely accepted that ros generation and oxidative damage play a critical role in these mechanisms . in the epiderm model , this observation further confirmed previous in vitro studies of cees / hd toxicity , which have demonstrated that the antioxidants that reduce oxidative stress and prevent thiol depletion also attenuate cees toxicity , whereas oxidants ( hydrogen peroxide ) and agents that deplete intracellular glutathione ( buthionine sulphoximine ) sensitize human cell lines , in particular hacat , to cees / hd toxicity . thus , our study provides additional evidence of the critical role of oxidative stress in the pathogenesis of cees / hd - induced injury in the skin . although the protective effects of various antioxidants are well documented both in vitro and in vivo , it is possible that in the human skin , the antioxidants are effective only when applied prior to or short time after ( about 1 hour ) cees / hd exposure . for instance , in human endothelial cells , nac altered cell viability only when applied simultaneously or prior to hd . similarly , in a guinea pig model , superoxide dismutase , a powerful antioxidant enzyme , reduced skin lesions only when applied prior to hd exposure . it should be taken into account that the main direct chemical impact of the alkylating agents , such as hd or cees , within the cell is attributable to the dna damage derived from rapid alkylation of guanines by mustard sulfonium ions ; nac and gsh ( as nucleophilic scavengers ) are capable of scavenging mustard electrophiles in the cytosol . however , this direct detoxification is possible only during a short time after the exposure , and other nucleophilic scavengers , for example , thiopurines or exogenous peroxidases , are more effective in degrading of hd or cees . nevertheless , antioxidants and antioxidant liposomes have shown a great potential in preventive treatment of cees / hd toxicity . in addition , it is well known that mammalian skin cells exposed to cees / hd release proinflammatory cytokines and other immune stimulators . therefore , in a long run , it is critical not only to protect keratinocytes from immediate cell injuries , but also to reduce the inflammatory responses in the skin . this approach will require deeper understanding of the molecular mechanisms of cees / hd toxicity in multicell - type and animal models . in summary , we found that gsh liposomes have shown a protective effect ( viability increase , atp content protection , oxidative stress reduction ) in the epiderm model exposed to cees , a close analog of mustard gas . the molecular mechanisms of the protective effect of gsh - liposomes involved reduction of necrosis ( but not apoptosis ) . in addition , gsh liposomes attenuated ros generation and intracellular thiol depletion that were induced by cees . we suggest that in the epiderm model , gsh - liposomes protect the cells from necrosis not only by scavenging of cees electrophiles , but also by reduction of oxidative stress and inflammation . the hypothesis , however , needs more evidence , and that is being addressed in a separate study . although the protective effect of liposome - encapsulated gsh was limited in time and not statistically different to the effect of free gsh , we suggest that preventive orquick - response antioxidant therapy may be a useful strategy against mustard toxicity in human skin , especially considering the fact that water - soluble antioxidants can not penetrate epidermis if applied to the skin as a solution , whereas the liposomes possess superior delivery abilities in dermal applications . taking into account previously described antioxidant liposome - derived protection in lung tissues , we suggest that a multifunctional liposomal formulation containing encapsulated antioxidants will be effective against sulfur mustard toxicity both in the skin and in the lung .\noutput:\n" }, { "from": "agent", "value": "sulfur mustard or mustard gas ( hd ) and its monofunctional analog , 2 - chloroethyl ethyl sulfide ( cees ) , or half - mustard gas , are alkylating agents that induce dna damage , oxidative stress , and inflammation . hd / cees are rapidly absorbed in the skin causing extensive injury . we hypothesize that antioxidant liposomes that deliver both water - soluble and lipid - soluble antioxidants protect skin cells from immediate cees - induced damage via attenuating oxidative stress . liposomes containing water - soluble antioxidants and / or lipid - soluble antioxidants were evaluated using in vitro model systems . initially , we found that liposomes containing encapsulated glutathione ( gsh - liposomes ) increased cell viability and attenuated production of reactive oxygen species ( ros ) in hacat cells exposed to cees . next , gsh - liposomes were tested in a human epidermal model , epiderm . in the epiderm , gsh - liposomes administered simultaneously or 1 hour after cees exposure ( 2.5 mm ) increased cell viability , inhibited cees - induced loss of atp and attenuated changes in cellular morphology , but did not reduce caspase - 3 activity . these findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of gsh - liposomes in a human epidermal model . this study provides a rationale for use of antioxidant liposomes against hd toxicity in the skin considering further verification in animal models exposed to hd ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: renal transplantation is the preferred therapy for patients with end stage renal disease , with improved quality of life and survival compared to dialysis . the prevalence of hypertension remains high at 8090 % , despite improved glomerular filtration rate and fluid status after transplantation . it has been linked to both recipient and donor factors , including immunosuppressant use ( particularly cyclosporine ) , advancing donor age , transplant renal artery stenosis , and transplant dysfunction . treatment goals of hypertension among renal transplant recipients are more stringent than in the general hypertensive population . kdigo ( kidney disease improving global outcomes ) guidelines recommend target blood pressure levels of 130/80 mmhg . in the uk , up to 50 % of renal transplant recipients were found to have uncontrolled hypertension . in kenya , the figures are much higher , with unpublished data showing that 7984 % of renal transplant recipients have not met target blood pressure levels . cardiovascular disease is the leading cause of mortality among renal transplant recipients , more than mortality from infection and malignancy combined . in addition , poorly controlled hypertension is associated with reduced allograft survival , as shown in the collaborative transplant study . nonadherence to antihypertensive treatment is an important and often unrecognized risk factor that contributes to reduced control of blood pressure . the who estimates that up to 50 % of patients with chronic illnesses are nonadherent to long - term therapy . indeed , nonadherence to antihypertensive medications as determined by the 8 - item morisky medication adherence scale ( mmas - 8 ) was found to be predictive of elevated systolic and diastolic pressures among patients in portugal . renal transplant recipients may also have preferential adherence to their immunosuppressant therapy over nonimmunosuppressant therapy including antihypertensive medications . this was shown by terebelo et al . , who demonstrated adherence rates of 81.6 % to immunosuppressant therapy versus 55.1 % to nonimmunosuppressant therapy among renal transplant recipients in new york , usa ( p = 0.028 ) . other predictors of uncontrolled hypertension among renal transplant recipients include older recipient and donor age , male sex , higher levels of proteinuria , and low gfr , as well as cyclosporine and steroid use . we thus sought to determine demographic , social , and clinical factors associated with poor blood pressure control . we also sought to determine adherence rates to antihypertensive therapy , and its relation to blood pressure control . kenyatta national hospital ( knh ) renal unit , nairobi , kenya , is a national referral and teaching hospital with a rapidly growing renal transplant program . the entire cohort of renal transplant recipients were hypertensive , more than 2 months posttransplant , 18 years of age and above , and not on dialysis due to nonfunctional grafts and gave informed written consent . to determine factors associated with poor blood pressure control among renal transplant recipients . hypertension was defined as either the use of antihypertensive therapy or systolic blood pressure 140 mmhg and / or diastolic blood pressure 90 mmhg . controlled blood pressure was defined as bp 130/80 mmhg as per kdigo guidelines . level of adherence to antihypertensive medications was categorized as high ( score 8 ) , medium ( score 6 - 7 ) , or low ( score 6 ) . blood pressure measurement and anthropometric measures were taken using standard procedure with duly calibrated machines . in addition , blood pressure readings from the preceding two clinic visits were also recorded .2 mls of blood for serum and 5 mls of urine were taken for measurement of serum creatinine and urine albumin : creatinine ratio , respectively . this is an 8 - item questionnaire with high sensitivity ( 93 % ) in determining adherence to antihypertensive therapy . urine albumin : creatinine ratio measurement was done using the clinitek microalbumin analyzer . daily internal quality control was carried out before sample analysis to validate the results obtained . statistical analysis was carried out using statistical package for social sciences ( spss ) version 17.0 , ( spss inc . , association between uncontrolled hypertension and categorical variables ( sex , adherence to antihypertensives , and cyclosporine use ) was done using the chi - square test of association or fischer 's exact test for small numbers , as appropriate . student 's t - test was used to compare means of continuous variables ( level of proteinuria , age ) . ethical approval was given by the knh / uon ethics and research committee , and all procedures were in accordance with the institutional ethical standards . mean duration after transplantation was 30.2 months , with a range between 3 and 233 months . mean systolic blood pressure was 132.5 ( 17.3 ) mmhg and mean diastolic blood pressure was 82.8 ( 13.1 ) mmhg . the mean mmas - 8 score was 6.8 . of the nonadherent patients , about a quarter ( 23.5 % ) forgot to take their medications . in unadjusted univariate analysis , male sex ( or 3.7 , 95 % ci 1.49.5 , p = 0.006 ) , higher levels of proteinuria ( p = 0.042 ) , and nonadherence to antihypertensive medication ( or 18.0 , 95 % ci 5.265.7 , p 0.001 ) were associated with uncontrolled hypertension . association between uncontrolled hypertension and other variables including number of antihypertensive medications , recipient and donor age , gfr , and cyclosporine use did not reach statistical significance ( table 2 ) . on logistic regression analysis , independent predictors of uncontrolled hypertension were male sex ( adjusted or 4.6 , 95 % ci 1.119.0 , p = 0.034 ) and nonadherence to antihypertensives ( adjusted or 33.8 , 95 % ci 8.673.0 , p 0.001 ) ( table 2 ) . we found a high prevalence of uncontrolled hypertension among our renal transplant recipients . this is significant because cardiovascular disease remains the leading cause of mortality among renal transplant recipients . our purpose was to determine factors that may contribute to the poor blood pressure control in our recipients . some of these factors may be modifiable , leading to better control and ultimately , improved patient and allograft survival . the study population was relatively young , mean age of 42.4 ( 12.2 ) years . this is about a decade younger than that noted in studies carried out in developed countries . mason et al . found a mean age of 50.2 years among renal transplant recipients in uk . chronic kidney disease has been documented to occur at an earlier age in tropical countries . the male predominance is a reflection of the gender distribution of patients with chronic kidney disease attending nephrology clinics locally . males may be more economically advantaged compared to their female counterparts , enabling them to access the relatively expensive renal transplantation services . this figure is higher than that found among renal transplant recipients in jordan and in uk at 42 % and 50 % , respectively . our higher rates of uncontrolled hypertension could be explained by the differences in the duration after transplantation in these populations . mean duration after renal transplantation was much longer in uk ( 76 months ) and jordan ( 38 months ) compared to ours at 30.2 months . previous studies have demonstrated that blood pressure control improves as the duration after transplant increases . this is due to stabilization of graft function with improved gfr , as well as tapering - off of immunosuppressant medication doses , especially cyclosporine and steroids that have been implicated in causation of hypertension . only a third of our study population was found to be fully adherent to their antihypertensive medications . in a study done among patients with hypertension attending medical outpatient clinics at the kenyatta national hospital .31.8 % of her study population were adherent to therapy as assessed by the hill - bone questionnaire . this represents a possible area of intervention to improve adherence rates among our renal transplant recipient population . other possible reasons for low levels of adherence include high cost of drugs as well as the high pill burden faced by renal transplant recipients . male sex was independently associated with uncontrolled hypertension in our study . in an analysis of data from the third national health and nutrition survey , hyman andpavlik found male sex to be independently associated with uncontrolled blood pressure among 16,095 adults in the us . this sex difference could be due to increased plasma renin activity in males or androgen stimulation of sodium reabsorption and vasoconstrictor molecules such as endothelin . in uk , nonadherence to antihypertensive medications was independently associated with poor blood pressure control among our study participants . oliveira - filho et al . in portugal also demonstrated that nonadherence as measured by the same tool , the mmas - 8 , was predictive of elevated systolic and diastolic pressures among patients with hypertension . to our knowledge , there has been no other study looking at the association between adherence and blood pressure control specifically among renal transplant recipients , and we have no reason to believe that this population should be different from the general hypertensive population in this regard . it is , to our knowledge , the first study in sub - saharan africa to explore the factors linked with uncontrolled hypertension among renal transplant recipients . secondly , the tool used for assessment of adherence was the mmas - 8 questionnaire , validated for use in different cultural settings and with a higher reliability than its predecessor , the mmas - 4 ( a = 0.83 versus 0.63 ) . as the renal transplant population is still growing , we were limited in terms of participant numbers , as this is a limited sized cohort of patients . however , all eligible patients were included . in addition , this was a cross - sectional study , and hence causality can not be inferred . finally , consequences of the poor blood pressure control were not studied . nevertheless , our study was able to explore the possible factors that may be associated with uncontrolled hypertension in this unique population of patients . we were further able to determine the level of adherence to antihypertensive medications and possible reasons for nonadherence . strategies to improve levels of adherence to antihypertensive medications among renal transplant recipients should also be put in place . finally , we recommend follow - up analytical studies as the renal transplant recipient population grows , to look further into the associations alluded to in this cross - sectional study .\noutput:\n" }, { "from": "agent", "value": "objective . to determine the factors associated with poor blood pressure control among renal transplant recipients in a resource - limited setting . methods . a cross - sectional study was carried out on renal transplant recipients at the kenyatta national hospital . sociodemographic details , blood pressure , urine albumin : creatinine ratio , and adherence using the mmas - 8 questionnaire were noted . independent factors associated with uncontrolled hypertension were determined using logistic regression analysis . results . 85 subjects were evaluated . mean age was 42.4 ( sd 12.2 ) years , with a male : female ratio of 1.9 : 1 . fifty - five patients ( 64.7 % ) had uncontrolled hypertension ( bp 130/80 mmhg ) . on univariate analysis , male sex ( or 3.7 , 95 % ci 1.49.5 , p = 0.006 ) , higher levels of proteinuria ( p = 0.042 ) , and nonadherence to antihypertensives ( or 18 , 95 % ci 5.265.7 , p < 0.001 ) were associated with uncontrolled hypertension . on logistic regression analysis , male sex ( adjusted or 4.6 , 95 % ci 1.119.0 , p = 0.034 ) and nonadherence ( adjusted or 33.8 , 95 % ci 8.673.0 , p < 0.001 ) were independently associated with uncontrolled hypertension . conclusion . factors associated with poor blood pressure control in this cohort were male sex and nonadherence to antihypertensives . emphasis on adherence to antihypertensive therapy must be pursued within this population ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: fresh frozen tissue samples were obtained through postoperative needle biopsies targeting both tumor and normal areas of prostatectomy specimens at the netherlands cancer institute ( amsterdam , the netherlands ) . tissue samples from androgen deprivation resistant tumors ( from transurethral resection of the prostate ( turp ) ) and lymph node metastases were obtained from the erasmus university medical center ( rotterdam , the netherlands ) . slides stained with hematoxylin and eosin ( h & e ) of the cases were reviewed by our pathologists . leftover anonymized tissue , which can not be traced back to the patient and does not interfere with care and / or prognosis , and would have been discarded otherwise , has been used in accordance with the code of conduct of the federation of medical scientific societies in the netherlands . faire - seq was performed on four normal samples , four primary , three therapy resistant tumors and three lymph node metastases ( fig . androgen receptor chip - seq was carried out on four primary and three resistant tumors ( fig . briefly , fresh frozen tissues were cross - linked with 1 % formaldehyde for 20 min . subsequently , samples were treated with rnase a and proteinase k and purified by using a pcr purification kit ( roche ) .10 g of ar - n20 ( sc - 618 ; santa cruz ) antibody was used for immunoprecipitation , with 100 l of protein a magnetic beads ( invitrogen ) . reads were aligned to the human reference genome ( assembly hg19 , february 2009 ) using bwa 0.5.9 . reads that map uniquely to the genome , with mapq quality score above 20 , were used for the analysis . faire - seq and chip - seq peaks were called with two algorithms , macs 1.4 and dfilter 1.0 , against mixed input controls corresponding to each group . macs was run with default parameters , except for p = 10 for chip - seq data . dfilter was run with bs = 100 , ks = 50 for faire - seq data and bs = 50 , ks = 30 , refine , nonzero for chip - seq data . faire - seq , chip - seq data and clinical annotation of the samples that are deposited in ncbi geo under accession number gse65478 . for further analysis , the number of peaks detected by faire - seq was 25,797 , while 20,703 peaks were detected by chip - seq . the ar binding sites had a median width of 350 bp and peak size did not vary strongly with the largest peak size of 1202 bp ( fig . in contrast , faire - seq peaks had a larger spread in size with a median size of 255 bp . the largest peak size of faire - seq data was 2300 bp and a higher proportion of both small and large peaks was present ( fig . the distance to the nearest transcription start site ( tss ) was determined by the great tool ( http://great.stanford.edu/ ) . the number of peaks within 5 kb from the nearest tss was significantly higher in faire - seq data as compared to chip - seq data and the number of peaks further than 50 kb from a tss was higher in chip - seq data than in faire - seq ( p 10 fisher 's exact ; fig . this is in accordance with ar binding mainly distant enhancer elements , while accessible regions detected by faire - seq include not only enhancers , but also promoters . fresh frozen tissue samples were obtained through postoperative needle biopsies targeting both tumor and normal areas of prostatectomy specimens at the netherlands cancer institute ( amsterdam , the netherlands ) . tissue samples from androgen deprivation resistant tumors ( from transurethral resection of the prostate ( turp ) ) and lymph node metastases were obtained from the erasmus university medical center ( rotterdam , the netherlands ) . slides stained with hematoxylin and eosin ( h & e ) of the cases were reviewed by our pathologists . leftover anonymized tissue , which can not be traced back to the patient and does not interfere with care and / or prognosis , and would have been discarded otherwise , has been used in accordance with the code of conduct of the federation of medical scientific societies in the netherlands . faire - seq was performed on four normal samples , four primary , three therapy resistant tumors and three lymph node metastases ( fig . androgen receptor chip - seq was carried out on four primary and three resistant tumors ( fig . afterwards chromatin was sonicated , cleared by centrifugation and subjected to three consecutive phenol chloroformsubsequently , samples were treated with rnase a and proteinase k and purified by using a pcr purification kit ( roche ) . . 10 g of ar - n20 ( sc - 618 ; santa cruz ) antibody was used for immunoprecipitation , with 100 l of protein a magnetic beads ( invitrogen ) . reads were aligned to the human reference genome ( assembly hg19 , february 2009 ) using bwa 0.5.9 . reads that map uniquely to the genome , with mapq quality score above 20 , were used for the analysis . faire - seq and chip - seq peaks were called with two algorithms , macs 1.4 and dfilter 1.0 , against mixed input controls corresponding to each group . macs was run with default parameters , except for p = 10 for chip - seq data . dfilter was run with bs = 100 , ks = 50 for faire - seq data and bs = 50 , ks = 30 , refine , nonzero for chip - seq data . faire - seq , chip - seq data and clinical annotation of the samples that are deposited in ncbi geo under accession number gse65478 . for further analysis , the number of peaks detected by faire - seq was 25,797 , while 20,703 peaks were detected by chip - seq . the ar binding sites had a median width of 350 bp and peak size did not vary strongly with the largest peak size of 1202 bp ( fig . in contrast , faire - seq peaks had a larger spread in size with a median size of 255 bp . the largest peak size of faire - seq data was 2300 bp and a higher proportion of both small and large peaks was present ( fig . the distance to the nearest transcription start site ( tss ) was determined by the great tool ( http://great.stanford.edu/ ) . the number of peaks within 5 kb from the nearest tss was significantly higher in faire - seq data as compared to chip - seq data and the number of peaks further than 50 kb from a tss was higher in chip - seq data than in faire - seq ( p 10 fisher 's exact ; fig . this is in accordance with ar binding mainly distant enhancer elements , while accessible regions detected by faire - seq include not only enhancers , but also promoters . in conclusion , we provide a unique dataset of genome - wide epigenetic profiling of prostate cancer tissue from different stages of the disease . the dataset consists of two parts : accessible chromatin profiling by faire - seq and genome - wide androgen receptor binding to dna by chip - seq . we previously used this dataset to identify changes in transcriptional regulation in prostate cancer upon acquisition of resistance to hormonal therapy , as well as to derive a prognostic gene expression signature for prostate cancer .\noutput:\n" }, { "from": "agent", "value": "prostate cancer ( pca ) is the second most common cancer in men . the androgen receptor ( ar ) is the major driver of pca and the main target of therapy in the advanced setting . ar is a nuclear receptor that binds the chromatin and regulates transcription of genes involved in cancer cell proliferation and survival . in a study by stelloo et al . ( 1 ) we explored prostate cancer on the level of transcriptional regulation by means of formaldehyde - assisted isolation of regulatory elements and chromatin immunoprecipitation coupled with massive parallel sequencing ( faire - seq and chip - seq , respectively ) . we employed these data for the assessment of differences in transcriptional regulation at distinct stages of pca progression and to construct a prognostic gene expression classifier . genomics data includes faire - seq data from normal prostate tissue as well as primary , hormone therapy resistant and metastatic pca . furthermore , chip - seq data from primary and resistant pca were generated , along with multiple input controls . the data are publicly available through ncbi geo database with accession number gse65478 . here we describe the genomics and clinical data in detail and provide comparative analysis of faire - seq and chip - seq data ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: while type 1 diabetes ( t1d ) has not traditionally been associated with obesity and metabolic syndrome , recent studies indicate that the prevalence of patients with t1d that are overweight or obese is as high as 50 % , with 8 % to 40 % meeting the diagnostic criteria for metabolic syndrome . the rising incidence of obesity in patients with t1d has been shown to be related to the use of intensive insulin therapy to maintain tight glycemic control . obesity is a growing problem for patients with t1d given the vicious cycle of obesity - induced insulin resistance necessitating increasing insulin requirements to preserve glycemic targets , which leads to further weight gain . although bariatric surgery has been proven to be an effective treatment modality for the improvement and resolution of type 2 diabetes ( t2d ) in patients who are obese , the utility of bariatric surgery for t1d remains controversial . the initial belief that normalization of glucose levels in obese patients with t2d after bariatric surgery was primarily attributed to weight loss effects discouraged the application of bariatric procedures in patients with t1d , since autoimmune destruction of beta cells rather thanobesity - induced insulin resistance was considered the major pathophysiologic factor for the development of t1d . while some authors suggest that weight loss independent mechanisms such as gastrointestinal hormone modulation also play a part in the remission and improvement of t2d after bariatric surgery , the effectiveness of these changes in the absence of residual beta cell function , as is the case in t1d , remains unclear . few data is available regarding the impact of bariatric surgery in obese patients with t1d , although early small case reports suggest that bariatric surgery leads to reduction in insulin requirements in addition to improvements in body mass index and other comorbidities . therefore , given that the incidence of obesity in patients with t1d is increasing and that obesity can significantly complicate glycemic control , it is necessary to define the effects of bariatric surgery in this population . to date , bariatric surgery outcomes in obese patients with t1d have not been quantitatively summarized , although a number of single center experiences and small case series have been published in the last few years . the aim of this systematic review and meta - analysis is to evaluate the effects of bariatric surgery on body mass index ( bmi ) , total daily insulin requirement , and glycated hemoglobin ( hba1c ) in obese patients with t1d . a comprehensive search of electronic databases including medline , embase , scopus , the cochrane library , and web of science from 1946 to july 2015 was completed . title searching was restricted to include type 1 diabetes mellitus in conjunction with the following keywords / terms : bariatric , gastric bypass , gastric band , and sleeve gastrectomy . a manual search of the reference lists of pertinent articlesabstracts were screened by two independent reviewers and selected based on the following inclusion criteria : human studies , adult subjects 18 years , clinical obesity bmi 35 kg / m at baseline , primary bariatric surgery performed , diagnosis of t1d at baseline confirmed by the presence of pancreatic autoantibodies ( islet cell or glutamic acid decarboxylase ) , absence of c - peptide , documented history of dka , and / or insulin therapy required from the time of diagnosis . articles were excluded if they were letters , comments , or published in abstract form only . full articles for all selected abstracts were screened more thoroughly using the same selection criteria . pertinent data was collected from full - text articles for all selected abstracts by two independent reviewers and discrepancies were resolved by consensus . while there was more than one publication from the same study population , only the most recent findings were included for the analysis . secondary outcomes included basic patient demographics , sample size , duration of study follow - up , type ( s ) of bariatric surgery performed , weight loss outcomes , and other diabetes related outcomes . descriptive categorical data were expressed as percentages and continuous data were expressed as weighted mean standard deviation ( sd ) where appropriate . meta - analysis was used to compare the outcomes of weight loss and glycemic control indicators ( hba1c and total daily insulin requirement ) where data was available . the estimated effects were calculated using the latest version of revman software provided by the cochrane website . the random - effects method was applied in our analysis , assuming that the true effect estimates varied among studies . preliminary searching of the electronic databases identified 202 potentially relevant articles . after screening abstracts against the selection criteria , republication of studies by czupryniak et al . and middelbeek et al . was excluded ( n = 3 ) , as well as studies where the primary outcome of interest could not be extracted ( n = 2 ) . in total , 13 primary studies comprising 86 subjects were included in this systematic review and meta - analysis ( figure 1 ) . included studies were published between february 2010 and july 2015 ; 11 were case series and 2 were case reports ( table 1 ) . of note , was excluded as the patient was 18 years old and was clinically diagnosed with t2 dm at baseline . all studies had clear study designs , aims , consecutive study patients , and appropriate endpoints and follow - up times . subjects had a mean age of 41.166.76 years ( n = 64 ) with a preoperative weight and bmi of 123.503.84 kg ( n = 21 ) and 42.502.65 kg / m ( n = 86 ) , respectively . roux - en - y gastric bypass ( rygb ) was the favored procedure accounting for 69 % ( n = 59/86 ) of bariatric surgeries performed , followed by sleeve gastrectomy and biliopancreatic diversion at 15 % ( n = 13/86 ) and 14 % reported two cases of adjustable gastric banding comprising 2 % ( n = 2/86 ) of the bariatric operations in this analysis . weight loss outcomes were evaluated based on changes to bmi postoperatively at 12 months and at study endpoint . eight studies reported bmi at 12 months postoperatively ( n = 40 ) ; bmi at study endpoint was reported for all studies . there was a marked reduction in bmi postoperatively at 12 months and at study endpoint to 29.551.76 kg / m ( p 0.00001 ) and 30.632.09 kg / m ( p 0.00001 ) , respectively ( figure 2 ) . changes to both total daily insulin requirement and hba1c were analyzed to determine the effect of bariatric surgery on glycemic control . postoperative daily insulin requirement at 12 months and study endpoint was reported in seven ( n = 33 ) and ten studies ( n = 59 ) , respectively . preoperative weighted mean total daily insulin requirement was 9826 iu / d , which decreased significantly to 3615 iu / d ( p 0.00001 ) and 4211 iu / d ( p 0.00001 ) at 12 months and at study endpoint , respectively ( figure 3 ) . of note , weight - adjusted total daily insulin requirement at baseline and postoperatively at study endpoint was reported in all but one study ( n = 76 ) , which also decreased appreciably from 0.780.20 iu / d / kg to 0.480.11 iu / d / kg , respectively ( p = 0.0001 ) . in terms of hba1c , this was reported in eight studies at 12 months postoperatively ( n = 40 ) ; hba1c at study endpoint was reported for all studies . weighted mean preoperative hba1c was 8.460.78 % ( n = 86 ) , which decreased to 7.950.55 % ( p = 0.01 ) and 8.130.86 % ( p = 0.03 ) at 12 months and at study endpoint , respectively ( figure 4 ) . this systematic review and meta - analysis demonstrates that obese patients with t1d are able to achieve marked reductions in bmi after bariatric surgery . moreover , bariatric surgery not only leads to a substantial decrease in total daily insulin requirement but also improves long - term glycemic control as evidenced by a statistically significant reduction in hba1c postoperatively . while a qualitative summary of the current literature on the topic of bariatric surgery in patients with t1d has previously been published , this study is the first meta - analysis of its kind to evaluate weight loss and glycemic status related outcomes in this population . bariatric surgery has been proven to lead to cessation or reduction in insulin requirements for obese patients with t2d on insulin therapy . many authors suggest that this decrease in need for exogenous insulin is associated with the positive effect of weight loss on insulin sensitivity in the liver and peripheral tissues . similarly , this analysis reports a marked and sustained reduction in bmi for obese patients with t1d after bariatric surgery ( weighted mean difference of 13.42 at study endpoint , p 0.00001 ) that is accompanied by a reduction in total daily insulin requirement ( weighted mean difference of 49.98 iu / d at study endpoint , p 0.00001 ) . the observed correlation between weight loss and reduced insulin requirements suggests that although insulin resistance has traditionally only been associated with the pathophysiology of t2d , it may play a role in obese patients with t1d as well . furthermore , this finding adds validity to the accelerator hypothesis that proposes that t1d and t2d , rather than being separate disease processes , belong to the spectrum of a single disorder driven by insulin resistance , which inevitably leads to beta cell loss but at different tempos depending on genetic background . the existence of latent autoimmune diabetes in adults ( lada ) , which describes patients with the t2d phenotype who possess islet cell antibodies but experience slowly progressive beta cell failure , also supports this hypothesis . this analysis also reports that obese patients with t1d are able to achieve appreciable reductions in hba1c after bariatric surgery ( weighted mean difference of 0.64 % at study endpoint , p = 0.03 ) . however , while an improvement in postoperative hba1c was observed , it failed to meet the recommended target of 7.0 % considered for optimal glycemic control . some studies suggest that the elevated postprandial secretion of glp - 1 observed after bariatric surgery may not have as significant glucagonostatic effects as previously believed . more importantly , glp - 1 has been shown in animal models and isolated human islets to enhance beta cell function , including beta cell glucose sensitivity and stimulation of insulin secretion , as well as inducing beta cell neogenesis and proliferation while suppressing apoptosis . these contributions appear to have less of a positive effect on glycemic control in patients with little to no residual beta cell function , as is the case in t1d . this finding is consistent with three case series included in this analysis that demonstrated improved glycemic control reflected in normalization of hba1c in patients with c - peptide positive t2d requiring insulin therapy but not in those with c - peptide negative t1d . other studies have suggested that ongoing islet cell regeneration is present even in patients with longstanding t1d and that the timing of bariatric surgery is crucial , as glp - 1 mediated effects may help to preserve beta cell mass and prevent progression to total insulin deficiency if surgery is performed early in the course of the disease . another complicating factor to good glucose control in the obese patients with t1d given their persistent absolute insulin requirement is the high glucose variability that occurs after bariatric surgery , specifically in rygb , which accounted for 69 % of the procedures in this analysis . high and early postprandial hyperglycemic peaks followed by rapid interstitial glucose decreases are observed after rygb , which may account for the hypoglycemic - like symptoms that have been previously reported in patients with t2d after bariatric surgery and , in the t1d population , can contribute to a mismatch between blood glucose and subcutaneous insulin administration . use of sleeve gastrectomy may be more suitable for obese patients with t1d as it facilitates a more predictable absorption of carbohydrates and potentially less glycemic variability than what is seen in rygb . the present study highlights the fact that the metabolic benefits of bariatric surgery in obese patients with t1d are not well studied and remain poorly understood . this analysis is limited by the quality of the available studies , the majority of which were case series with a few case reports . furthermore , there was significant statistical heterogeneity among the studies in the meta - analysis performed , which limits the conclusions that can be drawn from the available data . in addition , all included studies were insufficiently powered for the primary outcome of hba1c , with only one study describing an experience of more than 10 subjects . ideally , randomized controlled trials comparing medical management of obesity to bariatric surgery in patients with t1d are needed , similar to the well - established studies published for t2d . in addition , the current study was unable to address rates of improvement and resolution of comorbid conditions due to insufficient reporting or inconsistent definitions used across the studies . previous studies have reported conflicting findings regarding improvement of diabetes associated complications and cardiovascular disease . in summary , this systematic review and meta - analysis demonstrates that obese patients with t1d can achieve marked reductions in weight as well as improvements in glycemic status reflected in both total daily insulin requirement and hba1c after bariatric surgery .\noutput:\n" }, { "from": "agent", "value": "background . the utility of bariatric surgery in type 1 diabetes remains controversial . the aim of the present study is to evaluate glycemic control outcomes in obese patients with type 1 diabetes after bariatric surgery . methods . a comprehensive search of electronic databases was completed . inclusion criteria included human adult subjects with bmi 35 kg / m2 and a confirmed diagnosis of type 1 diabetes who underwent a bariatric surgical procedure . results . thirteen primary studies ( 86 patients ) were included . subjects had a mean age of 41.16 6.76 years with a mean bmi of 42.50 2.65 kg / m2 . there was a marked reduction in bmi postoperatively at 12 months and at study endpoint to 29.55 1.76 kg / m2 ( p < 0.00001 ) and 30.63 2.09 kg / m2 ( p < 0.00001 ) , respectively . preoperative weighted mean total daily insulin requirement was 98 26 iu / d , which decreased significantly to 36 15 iu / d ( p < 0.00001 ) and 42 11 iu / d ( p < 0.00001 ) at 12 months and at study endpoint , respectively . an improvement in hba1c was also seen from 8.46 0.78 % preoperatively to 7.95 0.55 % ( p = 0.01 ) and 8.13 0.86 % ( p = 0.03 ) at 12 months and at study endpoint , respectively . conclusion . bariatric surgery in patients with type 1 diabetes leads to significant reductions in bmi and improvements in glycemic control ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it has been found that preflaring the coronal portion of the root canal provides advantages in irrigation efficacy , apical control , cone fit , and compaction procedures . however , excessive dentin removal , as a result of cervical preflaring , especially in curved and narrow canals , may cause perforation of the concavity located in the furcation region . the first rotary instruments used for the cervical preflaring were the gates - glidden ( gg ) burs . its low cost and high cutting power associated to its simplicity of use made it a commonly used instrument during endodontic procedures . the diameter of the gates - glidden bur # 2 ( 0.70 mm ) is generally considered safe for the cervical preflaring of the mesial canals of mandibular molars ; however , the use of higher diameters could promote significant dentin removal at the furcal aspect of the root canal , increasing the risk of a striping perforation in the root . the search for new instruments to promote an appropriate cervical preparation has led to the development of new rotary instruments such as triplegates ( helse , santa rosa de viterbo , sp , brazil ) . the manufacturer claims that this stainless steel instrument receives a nanotechnology treatment which increases its resistance and reduces friction in dry conditions . its tip is equivalent to an inactive file 30 and it has 50 , 70 and 90 mm diameters . this instrument has similar active portion with more conical conformation and enhanced intermediate than gates - glidden ( figure 1 ) . it should replace gates - glidden # 1 , # 2 and # 3 and can be used in cervical preflaring with the advantage of performing lateral movement . moreover , this bur would have the following major advantages : faster instrumentation and lower cost ; one bur only can replace all the different sizes of traditional burs , such as gates , largo , and peeso , with no need for instrument change during treatment ; increased safety , as a result of its shape , which limits bur action to the cervical third of the root canal and thus avoids any contact with critical areas of the furcation region ; adaptability to different root canal anatomic variations and preparation techniques ; and versatility because it can be mounted on the engine available at the practitioner s office . although its predecessor ( cpdrill ) has been recently evaluated regarding the effect in the risk zone of mandibular molars , to the best of the author s knowledge , there is no study evaluating the new preflaring bur triplegates . figure 1scanning electron microscope photomicrograph ( x10 ) showing the triplegates instrument thus , the aim of this study was to evaluate , by cone beam computed tomography analysis , the effects of cervical preflaring on mesial root canals of mandibular molars utilizing a crown - down sequence of gates - glidden burs and the triplegates instrument . the null hypothesis tested was that there was no difference in the effects of the cervical preflaring on the mesial root canals of mandibular molars when using different cervical preflaring instruments . this study was revised and approved by the ethics committee , nucleus of collective health studies ( no . a sample of 40 human first mandibular molars that had been stored in 5 % formol saline was selected from tooth bank . roots were initially inspected by stereomicroscopy under 12x magnification to exclude teeth with any pre - existing craze lines or cracks . a digital radiograph in a buccolingual direction was taken to determine the curvature angle of the mesial root using and open source image analysis program ( fiji v. 1.47 n ; fiji , madison , wi , usa ) . only teeth with a slight curvature of the mesial root ( ranging from 0 to 10 ) were selected . teeth not patent to the canal length with a size 10 k - file ( dentsply - maillefer , ballaigues , switzerland ) were also discarded . subsequently , the 40 teeth were pair - matched according to their shape and dimension , and one tooth from each pair was randomly distributed ( using the website http://www.random.org ) into 2 experimental groups ( n = 20 ) . afterwards , the teeth were embedded in acrylic resin blocks using a flask system measuring 20 mm in height and 20 mm in width . after acrylic resin curing , each tooth block was removed , and the initial image was obtained by a cone beam computed tomography ( cbct ) ( kodak 9000c 3d , kodak , atlanta , ga , usa ) using an acrylic resin apparatus . the exposure time was 32.4 seconds , operating at 60 kv and 10 ma . at this moment , the area of each mesial canal , as well as the shortest distance from the root canal to the mesial and distal root surface , was measured 3 mm below the root furcation , using the cs 3d imaging software ( kodak , atlanta , ga , usa ) ( figure 2a ) . figure 2a ) example of a preoperative image in the gates - glidden group ; b ) postoperative image in gates - glidden group ; c ) example of a preoperative image in triplegates group ; d ) postoperative image in triplegates group after capture and initial analysis of the mesial root canals , the gg drills ( dentsply - maillefer , ballaigues , switzerland ) were used in crown down order ( gg # 3 , gg # 2 and gg # 1 ) in the mesial canals . to operate the drills , a conventional low - speed hand piece operating at 2.500 rpmthe movement performed with the rotary instruments was slight apical pressure , upped and downed with only one penetration with each drill . the depth of the drill was determined by its clinging inside the radicular canal usually observed 3 mm below the entrance of the canals . previously to instrumentation , canals were irrigated and flooded with 1 ml of 5.25 % naocl using a 30 - gauge endo - eze tip ( ultradent products inc . after preparation , canals were irrigated with 1 ml 5.25 % naocl in the gg group and 4 ml 5.25 % naocl in the triplegates group . after the instrumentation , each tooth block was submitted to a new cbct exam and new images of the mesial root canal were captured . at this moment , the area of each mesial canal , as well as the shortest distance from the root canal to the mesial and distal root surface , was measured in the after - instrumentation image , 3 mm below the root furcation , using the cs 3d imaging software ( kodak , atlanta , ga , usa ) ( figure 2b ) . the total area of the root canal before and after the use of each instrument was measured . later , the thickness of the mesial and distal walls ( danger zone ) was established . comparisons of the increase of the instrumented area and dentin thickness among the groups were performed using student s t - test . table 1 presents the increase of the instrumented area in terms of percentage . no significant differences ( p 0.05 ) table 2 shows the mean and standard deviation of dentin wall thickness on the initial and postinstrumentation images for each group in millimeters . also , no statistically significant differences ( p 0.05 ) were found among the groups for the preoperative dentin wall thickness at the mesial and the distal aspects of the root . no statistically significant differences ( p 0.05 ) were found for the postoperative dentin thickness among the groups after the use of the preflaring instruments . table 1mean and standard deviation ( sd ) of the canal area increase in percentages after the use of the tested instrumentsgroupmean sdgates - glidden52 .831.7 triplegates44 .828.8 same letters represent no statistically significant difference ( p 0.05 ) same letters represent no statistically significant difference ( p 0.05 ) table 2means ( mm ) and standard deviation ( sd ) of dentin wall thickness on the initial and postinstrumentation images and percentage reduction in each group at the mesial and distal aspects of the root canalimagesgates - glidden triplegates mesialdistalmesialdistalinitial1 .350.17 mm1 .110.16 mm1 .320.17 mm1 .090.15 mmfinal1 .150.16 mm0 .650.19 mm1 .100.18 mm0 .600.18 mmreduction ( % ) 14.223.2 % 42.506.7 % 16.714.5 % 45.008.3 % different letters indicate statistical significant differences between the percentage of wear of the mesial and distal wall provided by the instruments tested ( p 0.05 ) . different letters indicate statistical significant differences between the percentage of wear of the mesial and distal wall provided by the instruments tested ( p 0.05 ) . preflaring of the cervical third decreases the tension of manual and rotary instruments during apical instrumentation by eliminating dentin projections , and also provides greater reliability when defining the working length and the apical gauging . moreover , when prepares with niti instruments without the pre - enlargement in the cervical region with stainless steel instruments , there is a greater action of the niti instruments on the wall of the furcation , reducing the dentin thickness to values below 0.5 mm . this fact occurs specially with instruments with conical core and large volume of metal mass in the central axis such as the protaper instruments . during the last few decades , a number of methodologies have been described to assess the effect of endodontic instruments on dentin wall thickness , including plastic models , histologic sections , scanning electron microscopic studies , serial sectioning and radiographic comparisons . in the present study , cbct was used to analyze the cervical dentin thickness and root canal area of mandibular molars . this methodology permits observations of the root canal in three - dimensional planes ( axial , transverse , and tangent planes ) and allows preinstrumentation and postintrumentation measuring of root canal volume and hence calculations of the amount of removed dentin during preflaring of the root canal without complicate procedures , destructive sectioning of the specimens , or loss of the root material during sectioning . in addition , cbct scans allow easy measurement of canal changes , because image has an accurate scale , decreasing the potential of a radiographic or photographic transfer error . the furcation area of the first mandibular molars , sectioned at a point located between 2 and 3 mm below the furcation of the roots , presented a concave aspect in 100 % of the mesial roots . several authors have described an area 3 to 4 mm below the entrance of the canals to be the most sensitive location for the perforation of mesial molar roots after the use of rotary instruments . based on these results , the present study opted to evaluate and measure the dentin thickness 3 mm below the furcation of the roots . in the present study , the option to use a crown - down sequence was based on a previous study that showed a greater remaining dentine / cementum thickness when using gates - glidden burs in the crown - down sequence than in a serial sequence . in that study , the tendency of greater wear after use a serial sequence could be seen in two samples , in which a total rupture of the dentine / cementum wall leading to the furcation area could be observed . throughout this experiment , it was observed that samples always suffer greater wear nearest to the distal surface ( risk zone ) rather than the mesial surface ( safety zone ) , which was also seen in previous studies . the tested null hypothesis was sustained in the present study as our comparison did not reveal any statistically significant differences between the tested groups because the mean percentage of canal area increase and the dentin wall thickness was similar in the canals as shown in table 1 and table 2 . however , the triplegates technique consumed less time than the gates - glidden sequence ( data not shown ) . no file separation was observed in the triplegates group ; however five gates - glidden ( three gg # 1 and two gg # 2 ) separations were observed in the present study . in this studyit was observed that the wear of the distal wall ( risk zone ) of the mesial canals of mandibular molars was significantly greater than the wear of the mesial wall ( safety zone ) ( p 0.05 ) , with no differences between the wear promoted between drills compared . similar results were observed previously . both gg and tp left an average remaining dentin thickness of approximately 0.6 mm in the distal wall ( table 2 ) . moreover , the present results are also similar to those obtained when niti files were used . remaining dentine thickness following several intra - radicular procedures may be the most important iatrogenic factor correlating to future root resistance against fracture . excessive flaring of the cervical and middle thirds in flat roots may lead to a pronounced decrease of the dentinal wall thickness or even result in a strip perforation towards the furcation . thin dentine walls increase root permeability and the possibility of fracture , not only during filling , but also during tooth functioning . the remaining dentin of 0.6 mm obtained in this study does not appear to compromise the tooth structure . it has been previously established that a limit of 0.2 and 0.3 mm of dentine thickness as a measurement in which the resultant forces of condensation during filling would not result in tooth fracture . having this in mind and through the results of the present study it was possible to conclude that both instruments offer the operator a great safety margin . our results showed that both tested instruments used for cervical preparation were safe to be employed in the mesial root canal of mandibular molars .\noutput:\n" }, { "from": "agent", "value": "the search for new instruments to promote an appropriate cervical preparation has led to the development of new rotary instruments such as triplegates . however , to the best of the authors ' knowledge , there is no study evaluating triplegates effect on the risk zone of mandibular molars . objectives : the aim of this study was to evaluate the effects of a crown - down sequence of gates - glidden and triplegates burs on the remaining cervical dentin thickness and the total amount of dentin removed from the root canals during the instrumentation by using cone beam computed tomography . the number of separated instruments was also evaluated.material and methods : mesial roots of 40 mandibular first molars were divided into 2 equal groups : crown - down sequence of gates - glidden ( # 3 , # 2 , # 1 ) and triplegates burs . cervical dentin thickness and canal area were measured before and after instrumentation by using cone beam computed tomography and image analysis software . student s t - test was used to determine significant differences at p < 0.05 . results : no significant differences ( p > 0.05 ) were observed between the instruments , regarding the root canal area and dentin wall thickness.conclusion : both tested instruments used for cervical preparation were safe to be used in the mesial root canal of mandibular molars ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in these analyses , we included participants of the national health and nutrition examination survey ( nhanes ) iii who were aged 20 years at the time of data collection . the national center for health statistics conducted this complex , stratified , multistage sample survey from 1988 to 1994 among a representative sample of the u.s . a total of 33,994 individuals participated in the interview ; of these , 31,311 underwent a comprehensive physical examination ( 14 ) . we considered participants who had plasma glucose measurements and received a periodontal examination ( n = 17,029 ) . participants were excluded if they were edentulous ( n = 1,957 ) , had missing data for plasma glucose level ( n = 1,056 ) or clinical attachment loss ( cal ) ( n = 1,495 ) , or if women were pregnant ( n = 267 ) , leaving 12,254 individuals as the final sample size . chronic periodontitis is an infectious disease that results in inflammation within the supporting tissues of the teeth , along with progressive loss of gingival attachment with or without resorption of supporting bone and is characterized by pocket formation and / or gingival recession ( 15 ) . pocket depth is the distance from the base of the periodontal pocket to the free gingival margin . cal is the distance from the cemetoenamel junction to the base of the periodontal pocket . a cal of 12 mm is considered to be slight , 34 mm moderate , and 5 mm severe ( 15 ) . periodontal health assessment was based on cal and pocket depth measurements made at two sites ( midbuccal and mesiobuccal ) on every tooth in each of two randomly chosen quadrants , one in maxilla and the other in mandible as described in the nhanes procedures manuals ( 14 ) . in total , 28 sites and 14 teeth per individualwe calculated mean cal and pocket depth for each individual and then grouped participants into quintiles of mean cal and pocket depth . this categorization was used because there is no consensus on a single accepted method to define chronic periodontitis in epidemiological studies . although various definitions to categorize cal and pocket depth have been used ( 16 ) , it does not impose an assumption of linearity during modeling , is easier to interpret , and it captures the range of variation of the variables . the american diabetes association criteria ( 17 ) for plasma fasting glucose levels and interview data from nhanes iii were used to categorize respondents into three groups ( normal defined as glucose 100 mg / dl [ 5.6 mmol / l ] , ifg as glucose 100 but 126 mg / dl [ 7.0 mmol / l ] , and diabetes as glucose 126 mg / dl ) . individuals self - reporting a diagnosis of diabetes by a doctor ( has the doctor ever told you that you have diabetes ? information on sociodemographic factors , general health , and oral health behaviors was obtained by interview at participants home . age , sex , race / ethnicity , income - to - poverty ratio , education years , smoking history , drinking habits , physical activity , and frequency of regular dental visits were derived from interview data . leisure time physical activity was assessed by questions of frequency and type of activity and was converted into metabolic equivalents ( mets ) . bmi , as an index of total body adiposity , was based on examination data and computed by dividing weight in kilograms by the square of height in meters ( kg / m ) . waist circumference to assess central obesity was measured using a steel measuring tape to the nearest 0.1 cm at the high point of the iliac crest at minimal respiration when the participant was in a standing position . age was classified into three groups ( 2044 , 4564 , and 65 years ) , race / ethnicity into four groups ( non - hispanic white , non - hispanic black , mexican american , and others ) , income into three groups by tertiles of the income - to - poverty ratio ( 14 ) ( 1.5 , 1.5 to 3.0 , and 3.0 ) , education years into three groups ( less than junior high school , 6 years ; junior high and high school , 12 years ; and more than high school , 13 years ) , the number of missing teeth into four groups ( 0 , 15 , 610 , and 11 ) , smoking into three groups ( never , past , and current ) , alcohol consumption into three groups ( never , former , and current ) , and physical activity into three groups based on mets ( active , 6 ; moderate , 4 and 6 ; and less active , 4 ) . bmi was classified into four groups ( kg / m ) ( obese , 30 ; overweight , 25 and 30 ; normal , 25 and 18.5 ; and underweight 18.5 ) . central adiposity was said to be present if waist circumference was 101.6 cm for male subjects and 88.9 cm for female subjects . people who had regular dental checkups were defined as those who had visited dental clinics at least once a year . continuous variables were categorized as above to avoid assuming a linear relation with the outcomes and for ease of interpretation . sas , version 9.1 ( sas institute , carey , nc ) was used for data management and statistical analyses . sas survey procedures were used to take into account the complex weighted sampling design and yield unbiased parameter estimates and standard errors . the distribution of sociodemographic factors and other potential risk factors across categories of cal and pocket depth was estimated to observe the descriptive relation between these factors . to explore the crude association between hyperglycemic status and periodontal measures ( cal and pocket depth ) , meanplasma glucose levels and percentage of individuals in normal , ifg , and diabetes categories were calculated for each quintile of cal and pocket depth . to examine the multivariable association between quintiles of cal and pocket depth and ifg and diabetes status , four different multiple logistic regression models for each outcome such as ifg and diabetes were built and adjusted odds ratios ( ors ) , 95 % cis , and p values calculated . the first model was adjusted for age and sex . race / ethnicity , education degree , and household income level were added in the second model . smoking , alcohol habits , the number of missing teeth , and dental checkups were added to the third model . finally , physical activity , bmi , and central adiposity were added to the fourth model . chronic periodontitis is an infectious disease that results in inflammation within the supporting tissues of the teeth , along with progressive loss of gingival attachment with or without resorption of supporting bone and is characterized by pocket formation and / or gingival recession ( 15 ) . pocket depth is the distance from the base of the periodontal pocket to the free gingival margin . cal is the distance from the cemetoenamel junction to the base of the periodontal pocket . a cal of 12 mm is considered to be slight , 34 mm moderate , and 5 mm severe ( 15 ) . periodontal health assessment was based on cal and pocket depth measurements made at two sites ( midbuccal and mesiobuccal ) on every tooth in each of two randomly chosen quadrants , one in maxilla and the other in mandible as described in the nhanes procedures manuals ( 14 ) . in total , 28 sites and 14 teeth per individual were measured if the subject had no history of tooth removal excluding third molars . we calculated mean cal and pocket depth for each individual and then grouped participants into quintiles of mean cal and pocket depth . this categorization was used because there is no consensus on a single accepted method to define chronic periodontitis in epidemiological studies . although various definitions to categorize cal and pocket depth have been used ( 16 ) , it does not impose an assumption of linearity during modeling , is easier to interpret , and it captures the range of variation of the variables . the american diabetes association criteria ( 17 ) for plasma fasting glucose levels and interview data from nhanes iii were used to categorize respondents into three groups ( normal defined as glucose 100 mg / dl [ 5.6 mmol / l ] , ifg as glucose 100 but 126 mg / dl [ 7.0 mmol / l ] , and diabetes as glucose 126 mg / dl ) . individuals self - reporting a diagnosis of diabetes by a doctor ( has the doctor ever told you that you have diabetes ? information on sociodemographic factors , general health , and oral health behaviors was obtained by interview at participants home . age , sex , race / ethnicity , income - to - poverty ratio , education years , smoking history , drinking habits , physical activity , and frequency of regular dental visits were derived from interview data . leisure time physical activity was assessed by questions of frequency and type of activity and was converted into metabolic equivalents ( mets ) . bmi , as an index of total body adiposity , was based on examination data and computed by dividing weight in kilograms by the square of height in meters ( kg / m ) . waist circumference to assess central obesity was measured using a steel measuring tape to the nearest 0.1 cm at the high point of the iliac crest at minimal respiration when the participant was in a standing position . age was classified into three groups ( 2044 , 4564 , and 65 years ) , race / ethnicity into four groups ( non - hispanic white , non - hispanic black , mexican american , and others ) , income into three groups by tertiles of the income - to - poverty ratio ( 14 ) ( 1.5 , 1.5 to 3.0 , and 3.0 ) , education years into three groups ( less than junior high school , 6 years ; junior high and high school , 12 years ; and more than high school , 13 years ) , the number of missing teeth into four groups ( 0 , 15 , 610 , and 11 ) , smoking into three groups ( never , past , and current ) , alcohol consumption into three groups ( never , former , and current ) , and physical activity into three groups based on mets ( active , 6 ; moderate , 4 and 6 ; and less active , 4 ) . bmi was classified into four groups ( kg / m ) ( obese , 30 ; overweight , 25 and 30 ; normal , 25 and 18.5 ; and underweight 18.5 ) . central adiposity was said to be present if waist circumference was 101.6 cm for male subjects and 88.9 cm for female subjects . people who had regular dental checkups were defined as those who had visited dental clinics at least once a year . continuous variables were categorized as above to avoid assuming a linear relation with the outcomes and for ease of interpretation . sas , version 9.1 ( sas institute , carey , nc ) was used for data management and statistical analyses . sas survey procedures were used to take into account the complex weighted sampling design and yield unbiased parameter estimates and standard errors . the distribution of sociodemographic factors and other potential risk factors across categories of cal and pocket depth was estimated to observe the descriptive relation between these factors . to explore the crude association between hyperglycemic status and periodontal measures ( cal and pocket depth ) , meanplasma glucose levels and percentage of individuals in normal , ifg , and diabetes categories were calculated for each quintile of cal and pocket depth . to examine the multivariable association between quintiles of cal and pocket depth and ifg and diabetes status , four different multiple logistic regression models for each outcome such as ifg and diabetes were built and adjusted odds ratios ( ors ) , 95 % cis , and p values calculated . the first model was adjusted for age and sex . race / ethnicity , education degree , and household income level were added in the second model . smoking , alcohol habits , the number of missing teeth , and dental checkups were added to the third model . finally , physical activity , bmi , and central adiposity were added to the fourth model . the mantel extension test was used to evaluate linear trend across quintile categories . the distribution of potential risk factors across categories of cal and pocket depth is shown in table 1 . participants in the highest quintile of cal were more likely to be older , male , and non - hispanic black and in lower education and income levels than those in the lowest quintile of cal . participants in the fifth quintile of cal had more missing teeth , were more likely to smoke , be overweight or obese , have more central adiposity , be less physically active , and visit the dentist less frequently than those in the first quintile . the trend forparticipant characteristics and risk - factor distribution by quintiles of cal and periodontal pocket depth in u.s . * income - to - poverty ratio : ( midpoint family income ) / ( poverty threshold values based on calendar years and inflation ) . missing due to caries / periodontal disease . central adiposity present if waist for male subjects 101.6 cm and for female subjects 88.9 cm . fasting plasma glucose levels were higher in the top versus bottom categories of cal ( 107.5 vs. 91.2 mg / dl ) and pocket depth ( 103.6 vs. 95.0 mg / dl ) . likewise , there were proportionately more participants with ifg and diabetes in the highest versus lowest categories of cal ( ifg , 37.9 vs. 15.8 % ; diabetes , 16.0 vs. 2.5 % ) and pocket depth ( ifg , 32.6 vs. 23.1 % ; diabetes , 11.2 vs. 5.2 % ) ( table 1 ) . the highest quintile of cal had higher prevalence odds of ifg ( or 1.55 [ 95 % ci 1.162.07 ] , p for trend 0.01 ) and diabetes ( 4.77 [ 2.698.46 ] , p for trend 0.01 ) after adjusting for age , sex , education , income , race , smoking , alcohol intake , missing teeth , dental visits , bmi , central adiposity , and physical activity ( table 2 ) compared with the lowest quintile . likewise , comparing extreme quintiles , pocket depth was positively associated with ifg ( 1.23 [ 0.861.76 ] , p for trend 0.01 ) and diabetes ( 1.63 [ 1.102.42 ] , p for trend 0.01 ) after accounting for the same confounders as the regression models for cal ( table 3 ) . dose - response relationship between periodontal attachment loss and ifg and diabetes * excluding subjects with diabetes . excluding subjects with ifg . dose - response relationship between periodontal pocket depth and ifg and diabetes * excluding subjects with diabetes . excluding subjects with ifgchronic periodontitis measured by cal and pocket depth was positively associated with ifg and diabetes in a dose - dependent manner among free - living u.s . adults than diabetes ( 18 ) and is associated with increased risk of diabetes ( 19 ) . prospective ( 11 ) and cross - sectional ( 12 ) studies conducted in japanese populations showed that periodontal disease was associated with increased risk of igt . nevertheless , some epidemiological studies ( 4,20 ) did not show any association between prediabetes and periodontitis risk . ( 4 ) with negative results included 100 adults aged 4070 years , of whom 27 had normal fasting glucose and 56 had igt ; the study was underpowered to detect any difference in igt by periodontal status . saito et al . ( 20 ) conducted their study among a larger sample ( n = 584 ) of adult women , of whom 108 had igt . however , in that study cal and pocket depth were divided into two groups ( high and low ) and did not evaluate the full range of the data . periodontitis was positively linked with ifg in a recent study ( 13 ) from israel . periodontitis presence was associated with increased a1c after 5 years of follow - up in a german population free of diabetes ( 21 ) . to our knowledge , this is the first study to find empirical evidence of the relation between chronic periodontitis and ifg in the u.s . population . it is plausible that hyperglycemia resulting from ifg may raise the risk of periodontal disease but also that chronic systemic inflammation from periodontal disease may stimulate inflammatory cytokines ( c - reactive protein , tumor necrosis factor , and interleukin - 6 ) , leading to insulin resistance and hyperglycemia ( 22 ) . our findings imply that people with ifg may need to be evaluated for periodontal health . it is also possible that periodontal treatment may reduce the risk of ifg , and this effect may extend to diabetes . however , this needs to be verified in future studies . notwithstanding the significance of the present studyfirst , nhanes iii data are cross - sectional so it is not possible to ascertain whether periodontitis led to hyperglycemia or vice versa . second , nhanes iii used a partial mouth examination , so that approximately half the teeth existing in mouth were examined and was thus subject to random sampling error . third , the categorization of cal and pocket depth into quintiles might not correspond to meaningful clinical categories of periodontitis . last , our study population only included individuals with one or more teeth so that the association between periodontitis and prediabetes and diabetes can not be generalized to edentulous persons even though they may have had a history of periodontal disease . first , we used quintiles of mean cal and pocket depth in these analyses because quintiles captured the range of periodontal damage in this population , did not depend on any a priori or arbitrary cut point , did not impose any distributional assumptions during modeling , and facilitated in the detection of a dose response relation . although cal and pocket depth measures are universally used to assess periodontal damage , and there are explicit clinical definitions of chronic periodontitis , there is no consensus on the optimal way to categorize cal and pocket depth in epidemiological studies although many approaches are suggested ( 16 ) . studies using these predetermined definitions of periodontal disease did not find a clear linear relation with type 2 diabetes and prediabetes ( 6,11 ) . adjustment for obesity , central adiposity , and physical inactivity would tend to attenuate the strengths of the association between chronic periodontitis and ifg because these variables may lie on the causal pathway ( 23 ) . ifg is more common than diabetes , but its progression to diabetes can be prevented through lifestyle interventions ( 24 ) . further research in this area may ultimately lead to new strategies to prevent ifg from its progressing to diabetes . finally , the nhanes data were collected with careful quality control , the sample was large enough to give us good power to evaluate the relations , and it was representative of the u.s . chronic periodontitis assessed by cal and pocket depth is positively associated in a dose - response way with increased prevalence odds of ifg and diabetes in a representative sample of u.s .\noutput:\n" }, { "from": "agent", "value": "objectivemany studies have reported that periodontal disease is associated with diabetes , but its relation with impaired fasting glucose ( ifg ) has been understudied . this study investigated the relationship between chronic periodontitis , ifg , and diabetes in the u.s . population.research design and methodsparticipants in the national health and nutrition examination survey iii , aged 20 years , who received periodontal examinations and provided blood samples ( n = 12,254 ) were grouped into quintiles of mean clinical attachment loss ( cal ) and pocket depth , with the lowest category being the reference . plasma fasting glucose was categorized into three groups ( normal , < 100 mg / dl ; ifg , 100 but < 126 mg / dl ; and diabetic , 126 mg / dl ) . sociodemographic factors and other potential risk factors were obtained by interview or examination . sas 9.1 was used for statistical analysis accounting for the complex weighted sampling.resultsparticipants in the top quintile category of cal had higher prevalence odds of ifg ( odds ratio [ or ] 1.55 [ 95 % ci 1.162.07 ] ) and diabetes ( 4.77 [ 2.698.46 ] ) after adjustment for related confounders , compared with those in the bottom quintile . the highest quintile of pocket depth was positively associated with ifg ( 1.39 [ 1.001.92 ] ) and diabetes ( 1.63 [ 1.102.42 ] ) compared with the lowest quintile . ors for cal increased from the lowest to the highest quintile ( p value test for trend < 0.01 ) for all outcomes . the ors for pocket depth also tended to rise across quintiles.conclusionschronic periodontitis measured by cal and pocket depth was positively associated in a linear relation with ifg and diabetes in u.s . adults ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: measurement of the bronchodilator response of forced expiratory volume in 1 second ( fev1 ) is an important method in clinical respiratory medicine . this measurement is used to predict the response to bronchodilator treatment and is part of the diagnosis of copd and asthma . the bronchodilator response of forced vital capacity ( fvc ) has less clinical use than the bronchodilator response of fev1 but may add important clinical physiological information .1 normality for a majority of lung function outcomes is based on their distribution in healthy subpopulations . however , the normal range of the bronchodilator response has often been based on data from selected populations of patients with asthma or copd .24 bronchodilator response can be expressed as the relative change from baseline value expressed as a percentage or as the difference in percent predicted ( after bronchodilation before bronchodilation ) expressed as a percentage .5 lorber et al6 first focused on the bronchodilator response in the general population . based on a healthy subpopulation , they proposed a relative change from baseline in fev1 of 7.7 % as a significant bronchodilator response . similar results have been published from canada and finland .7,8 the burden of obstructive lung disease ( bold ) study showed that the upper 95th percentile for the relative change from baseline was 12.5 % for fev1 for 3,922 healthy non - smokers .9 in the bold study , the upper 95th percentile for the difference expressed as a percentage of the predictive values was 10.1 % for fev1 , and the bold group recommends that the threshold should be expressed as 10 % change ( percentage ) of predicted .10 in clinical practice , patients sometimes show an isolated increase in fvc upon bronchodilation . a proposed mechanism for this finding is that deep inhalations reduce the caliber of the airways .2,11 among patients with copd , vital capacity ( vc ) responders have a greater degree of airway obstruction , but a similar degree of emphysema , compared with fev1 responders .1 for fvc , the evidence from general population - based studies is weaker , and the results are less consistent .6,12 the bold study showed that the upper 95th percentile was 11.2 % for a relative change from baseline of fvc in healthy non - smokers .9 the upper 95th percentile for the difference expressed in predictive values was 9.6 % for fvc . in the bold study , the positive predictors of bronchodilator response for fvc were age , male sex , diagnosed asthma , use of asthma drugs and ever smoking .10 when an fvc procedure is performed , higher dynamic compression may result in airway collapse and air trapping .13 this phenomenon is considered to be most pronounced in subjects with airflow obstruction but can be overcome by performing svc maneuvers . to the best of our knowledge , no studies have investigated the bronchodilator response for svc in the general population . a small study on 33 patients showed that the bronchodilator response was greater for fvc than for svc .13 a large general population - based study ( swedish cardiopulmonary bioimage study [ scapis ] ) has been initiated in sweden with the overall aim of extensively phenotyping a cohort of 30,000 individuals aged 5064 years and using the acquired information to improve risk stratification and to optimize conditions to characterize the mechanisms behind copd and different cardiovascular diseases .14 the field phase of the scapis is ongoing , and the plan is to complete the field study in 2019 . during the planning of the scapis , a small pilot study called the scapis pilot study was conducted , and the present study is based on the pilot study . the main study , scapis , and the scapis pilot have similar protocols , but one important difference is that the scapis pilot protocol comprises dynamic spirometry before and after bronchodilation . this study aimed to analyze and compare different measures of bronchodilator responses of fev1 , fvc and svc in the general population aged 5064 years . this analysis is performed using the scapis pilot .14,15 the study population comprises a general population sample comprising subjects aged 5064 years . of the 2,243 invited participants , 1,111 participated in the field study . all participants in the scapis pilot completed a respiratory questionnaire , including items of respiratory symptoms , physician - diagnosed asthma and smoking habits .15 dynamic spirometry was performed using a nose clamp and with the subject in the sitting position . the spirometry included fev1 , fvc and svc , using a jaeger master screen pft ( hoechberg , germany ) .16 svc was measured before fvc and fev1 . there were at least three and a maximum of eight attempts , stopping when two reproducible measurements were obtained . predicted values of fev1 and fvc were assessed using recently published swedish reference equations , and predicted values of svc were based on swedish reference material with reference equations for svc .17,18 airway obstruction before bronchodilation ( aopredil ) was defined as an fev1 / fvc ratio below the lower limit of normal ( lln ) before bronchodilation . copd was defined as an fev1 / fvc ratio below lln after bronchodilation .2,19 we used three measures of bronchodilator response , ie , the difference between the results after bronchodilation minus the baseline results before bronchodilation for each of fev1 , fvc and svc .2 thus , the bronchodilator response is expressed in the three following ways : in absolute terms , the baseline values were measured ( fev1 , fvc and svc ) and expressed in ml.as a percentage on the baseline values ( % fev1 , % fvc and % svc ) . in units of percent predicted normal , ie , percent predicted normal after bronchodilation minus percent predicted normal before bronchodilation ( % fev1p , % fvcp and % svcp ) . with this measure , an increase in fev1p from 70 % predicted to 77 % predicted will result in a % fev1p of 7 % . in absolute terms , the baseline values were measured ( fev1 , fvc and svc ) and expressed in ml . as a percentage on the baseline values ( % fev1 , % fvc and % svc ) . in units of percent predicted normal , ie , percent predicted normal after bronchodilation minus percent predicted normal before bronchodilation ( % fev1p , % fvcp and % svcp ) . with this measure , an increase in fev1p from 70 % predicted to 77 % predicted will result in a % fev1p of 7 % . body mass index ( bmi ) was defined as measured weight / height2 ( kg / m ) . the following questionnaire - based definitions were used : physician - diagnosed asthma was defined as an affirmative answer to have you ever had asthma diagnosed by a physician ? .20 physician - diagnosed copd or emphysema was defined as an affirmative answer to have you ever had copd or emphysema diagnosed by a physician ? .21 chronic bronchitis was defined as an affirmative answer to have you had longstanding cough with phlegm ? and if so , did any period last at least three months ? and if so have you had such periods at least two years in a row ? .22 current wheeze was defined as an affirmative answer to have you had wheezing or whistling in your chest during the last 12 months ? diabetes was defined as an affirmative answer to have you ever been told by a physician or another health professional that you have diabetes ? .23 current use of respiratory medications was based on reported use of drugs for asthma or copd ( inhalers and tablets ) . never - smoking was defined as an affirmative answer to i have never smoked . asymptomatic never - smokers were defined as those not reporting physician - diagnosed asthma , physician - diagnosed copd or emphysema , current wheeze or chronic bronchitis and being a lifelong never - smoker . the study was approved by the ume ethical board ( dnr 2010 - 228 - 31 m ) , and all participants provided written informed consent for this study . all calculations were performed using sas version 9.2 ( sas institute , cary , nc , usa ) . the distribution of the bronchodilator response was determined in all subjects , as well as among subjects with copd , physician - diagnosed asthma and asymptomatic never - smokers . the upper limit of normality was defined as the upper 95th percentile , and 95 % confidence limits were calculated using a distribution - free method based on order statistics .24 correlation coefficients , rs ( spearman ) , were analyzed for pre - bronchodilatory values of fev1 and different measures of the bronchodilator response for fev1 and fvc , and significance levels were tested .25 bronchodilator responses were finally assessed as mean values , median values or a cutoff limit over the 95th percentile . predictors for bronchodilator response of fev1 , fvc and svc were examined using multiple linear regression models . initially , an a priori model comprising age , sex , height , weight , smoking variables , physician - diagnosed asthma and aopredil was applied . airway obstruction before bronchodilation ( aopredil ) was defined as an fev1 / fvc ratio below the lower limit of normal ( lln ) before bronchodilation . copd was defined as an fev1 / fvc ratio below lln after bronchodilation .2,19 we used three measures of bronchodilator response , ie , the difference between the results after bronchodilation minus the baseline results before bronchodilation for each of fev1 , fvc and svc .2 thus , the bronchodilator response is expressed in the three following ways : in absolute terms , the baseline values were measured ( fev1 , fvc and svc ) and expressed in ml.as a percentage on the baseline values ( % fev1 , % fvc and % svc ) . in units of percent predicted normal , ie , percent predicted normal after bronchodilation minus percent predicted normal before bronchodilation ( % fev1p , % fvcp and % svcp ) . with this measure , an increase in fev1p from 70 % predicted to 77 % predicted will result in a % fev1p of 7 % . in absolute terms , the baseline values were measured ( fev1 , fvc and svc ) and expressed in ml . as a percentage on the baseline values ( % fev1 , % fvc and % svc ) . in units of percent predicted normal , ie , percent predicted normal after bronchodilation minus percent predicted normal before bronchodilation ( % fev1p , % fvcp and % svcp ) . with this measure , an increase in fev1p from 70 % predicted to 77 % predicted will result in a % fev1p of 7 % . body mass index ( bmi ) was defined as measured weight / height2 ( kg / m ) . the following questionnaire - based definitions were used : physician - diagnosed asthma was defined as an affirmative answer to have you ever had asthma diagnosed by a physician ? .20 physician - diagnosed copd or emphysema was defined as an affirmative answer to have you ever had copd or emphysema diagnosed by a physician ? .21 chronic bronchitis was defined as an affirmative answer to have you had longstanding cough with phlegm ? andif so , did any period last at least three months ? and if so have you had such periods at least two years in a row ? .22 current wheeze was defined as an affirmative answer to have you had wheezing or whistling in your chest during the last 12 months ? diabetes was defined as an affirmative answer to have you ever been told by a physician or another health professional that you have diabetes ? .23 current use of respiratory medications was based on reported use of drugs for asthma or copd ( inhalers and tablets ) . asymptomatic never - smokers were defined as those not reporting physician - diagnosed asthma , physician - diagnosed copd or emphysema , current wheeze or chronic bronchitis and being a lifelong never - smoker . the study was approved by the ume ethical board ( dnr 2010 - 228 - 31 m ) , and all participants provided written informed consent for this study . all calculations were performed using sas version 9.2 ( sas institute , cary , nc , usa ) . the distribution of the bronchodilator response was determined in all subjects , as well as among subjects with copd , physician - diagnosed asthma and asymptomatic never - smokers . the upper limit of normality was defined as the upper 95th percentile , and 95 % confidence limits were calculated using a distribution - free method based on order statistics .24 correlation coefficients , rs ( spearman ) , were analyzed for pre - bronchodilatory values of fev1 and different measures of the bronchodilator response for fev1 and fvc , and significance levels were tested .25 bronchodilator responses were finally assessed as mean values , median values or a cutoff limit over the 95th percentile . predictors for bronchodilator response of fev1 , fvc and svc were examined using multiple linear regression models . initially , an a priori model comprising age , sex , height , weight , smoking variables , physician - diagnosed asthma and aopredil was applied . in the clinical investigations , 61 subjects were excluded due to incomplete information about smoking habits or spirometry . the final study population hence comprised 1,050 participants , and baseline characteristics including sex , anthropometry , smoking and lung function are shown in table 1 . the mean values of bronchodilator responses for fev1 , fvc and svc are shown in table 2 . among all subjects , the mean fev1 was 118 ml ( median 100 ml ) , ranging from 470 ml to 1.7 l. the mean fvc was 23 ml ( median 0 ml ) ranging from 980 to 910 ml . the mean svc was 6 ml ( median 0 ml ) ranging from 3.1 to 2.9 l. the highest bronchodilator responses ( fev1 , fvc and svc ) were observed in subjects with physician - diagnosed asthma or copd . there was a significant correlation between pre - bronchodilatory fev1 and % fev1 ( rs = 0.22 ) and a weaker , but significant , correlation between pre - bronchodilatory fev1 and % fev1p ( rs = 0.11 ) ( table 3 ) . however , the correlation between pre - bronchodilatory fev1 and % fev1 was stronger compared with that between pre - bronchodilatory fev1 and % fev1p , and this difference was significant ( p 0.05 ) . the correlation between pre - bronchodilatory fev1 and the absolute change , fev1 , was lower and not significant ( table 3 ) . in table 4 , bronchodilator responses are expressed as the upper 95th percentiles for fev1 , fvc and svc , respectively . when the bronchodilator responses were examined in asymptomatic never - smokers , the upper 95th percentiles of % fev1 were 10.1 % ( 95 % confidence interval [ 95 % ci ] 8.511.8 ) , for % fvc 4.5 % ( 95 % ci 3.96.3 ) and for % svc 5.6 % ( 95 % ci 4.38.2 ) . when the upper 95th percentiles of the bronchodilator responses were outlined in units of percent of predicted normal , the bronchodilator responses were similar between men and women . in multiple linear regression models comprising all subjects ( n = 1,050 ) ( table 5 ) , % fev1 was negatively associated with height and positively associated with weight , physician - diagnosed asthma and airway obstruction . the predictors for the bronchodilator responses of fvc or svc were slightly different , but airway obstruction was related also to the bronchodilator response of both fvc and svc . in multiple linear regression models comprising all asymptomatic never - smokers ( n = 370 ) ( table 6 ) , bronchodilator responses of fev1 , expressed as % fev1 , were significantly associated only with airway obstruction . when reversibility of fev1 was expressed as % fev1p , the significant associations with airway obstruction remained . the main results of this study were that bronchodilator reversibility expressed as the difference between predicted values ( percentage predicted ) in a population - based cohort aged 5064 years was 8.7 % for fev1 , 4.2 % for fvc and 5.0 % for svc . the results regarding fev1 are consistent with the findings in bold , but our results regarding fvc indicate a lower bronchodilator response for fvc .9 for svc , our results are novel . in our regression models including the total population , the factors that were significantly associated with flow responding ( % fev1 ) in the total population were airway obstruction , height , weight and physician - diagnosed asthma . unsurprisingly , airway obstruction defined as the ratio of fev1 / fvc below lln before bronchodilation was associated with bronchodilator response of fev1 . we also tested regression models without including airway obstruction before bronchodilation with similar results , ie , resulting in significant associations with height , weight and physician - diagnosed asthma . in regression models , vc responding ( % fvc ) was associated with airway obstruction before bronchodilation , as well as physician - diagnosed asthma . current smokers had increased bronchodilator response of fvc but no association with bronchodilator response of fev1 or svc . when the bronchodilator response values for fev1 and fvc were outlined as the upper 95th percentiles in asymptomatic never - smokers , they were similar to those shown in the bold study .9 our study suggests a 95th percentile threshold of 10.1 % for relative change from baseline in fev1 and a threshold of 8.7 % for reversibility of fev1 assessed as change in predicted values . it should be noted that we used 400 g of salbutamol as recommended by gold , in contrast to the bold study , in which 200 g of salbutamol was employed .9,19 the bronchodilator response for fvc assessed as change in predicted values was lower in our study , 4.2 % , compared to the bold results , 9.6 % . there is still controversy whether the bronchodilator response should be expressed as a relative change from the baseline value or as a change in percentages of the predicted value . however , a low baseline fev1 increases the probability of a subsequent improvement , especially if it is expressed as a relative change .7,26 therefore , the bronchodilator response has been recommended to be reported as a change expressed as percent predicted .5 however , the joint american thoracic society - european respiratory society ( ats - ers ) guidelines suggested the use of a 12 percentage point change of the baseline values and 200 ml .2 the ats - ers - suggested recommendations were based on studies of short - term variation in patients and were not based on general population data . we believe that our results support the recommendations by quanjer et al ,5 ie , expressing the difference in units of percent predicted normal . there are two reasons : first , because we found that pre - bronchodilatory fev1 was significantly more correlated with % fev1 than with % fev1p . second , in our regression models of asymptomatic never - smokers , the importance of airway obstruction decreased when expressing bronchodilator reversibility as the difference of percent predicted and the influence of sex disappeared ( table 6 ) . the bold study also discussed this and reported that the percentage change in fev1 , assessed as the predicted value , was the most stable estimate .9 the authors concluded that a 10 % increase in predicted fev1 was required to determine a significant bronchodilator response .9 our data suggest a threshold of 8.7 % relative to predicted fev1 based on inhalation of 400 g of salbutamol . bronchodilator response is often used to separate between asthma and copd , but in most studies , the separation is not clear - cut .27 in this study , the asthma definition is based on self - report , and for the age span in our study , the items about physician - diagnosed asthma are misclassified in relation to copd .28,29 this makes it difficult to draw any firm conclusions about differentiation between asthma and copd , but still , our results indicate that the bronchodilator response seems to be similar among subjects with copd and asthma . we conclude that a 5 % increase relative to predicted fvc is the limit for determining a significant bronchodilator response of fvc . we also outlined 95th percentiles for women and men , but there was no obvious difference with regard to sex . the cutoff limits for the bronchodilator response of svc were slightly higher , with a 10.8 % increase relative to predicted baseline . limitations of this study are the small sample and the narrow age interval of 5064 years . another limitation is the low response rate , 50 % , which may introduce non - response bias in relation to smoking habits and male sex .30 however , this has mainly been observed in younger subjects . another limitation is the lack of assessment of reproducibility , which has not been investigated in our study . we conclude that bronchodilator responses preferably should be assessed in units of predicted normal values , ie , the difference between the predicted normal value after bronchodilation minus the corresponding value before bronchodilation . accordingly , bronchodilator responses of fev1 = 9 % , fvc = 4 % and svc = 6 % are suggested to be significant .\noutput:\n" }, { "from": "agent", "value": "backgrounddata are lacking from general population studies on how to define changes in lung function after bronchodilation . this study aimed to analyze different measures of bronchodilator response of forced expiratory volume in 1 second ( fev1 ) , forced vital capacity ( fvc ) and slow vital capacity ( svc ) . materials and methodsdata were derived from the swedish cardiopulmonary bioimage study ( scapis ) pilot study . this analysis comprised 1,050 participants aged 5064 years from the general population . participants were investigated using a questionnaire , and fev1 , fvc and svc were recorded before and 15 minutes after inhalation of 400 g of salbutamol . a bronchodilator response was defined as the relative change from baseline value expressed as the difference in units of percent predicted normal . predictors of bronchodilator responses were assessed using multiple linear regression models . airway obstruction was defined as fev1 / fvc ratio below lower limit of normal ( lln ) before bronchodilation , and copd was defined as an fev1 / fvc ratio below lln after bronchodilation . physician - diagnosed asthma was defined as an affirmative answer to have you ever had asthma diagnosed by a physician ? . asymptomatic never - smokers were defined as those not reporting physician - diagnosed asthma , physician - diagnosed copd or emphysema , current wheeze or chronic bronchitis and being a lifelong never - smoker.resultsamong all subjects , the greatest bronchodilator responses ( fev1 , fvc and svc ) were found in subjects with asthma or copd . the upper 95th percentile of bronchodilator responses in asymptomatic never - smokers was 8.7 % for fev1 , 4.2 % for fvc and 5.0 % for svc . the bronchodilator responses were similar between men and women . in a multiple linear regression model comprising all asymptomatic never - smokers , the bronchodilator response of fev1 was significantly associated with airway obstruction and height.conclusionwhen the bronchodilator response in asymptomatic never - smokers is reported as the difference in units of predicted normal , significant reversibility of fev1 , fvc and svc to bronchodilators is ~ 9 % , 4 % and 5 % , respectively ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: an estimated 630,000 people worldwide were diagnosed with head and neck squamous cell carcinoma ( hnscc ) in 2008 , representing 6 % of all malignancies and making it the 6th most common cancer . in the united states , approximately 48,000 cases occurred in 2009 , with 11,300 deaths . however , two - thirds of patients are diagnosed at a locoregional advanced stage ( iii - ivb ) , with 5 - year survival rates of 30 to 60 % for these patients . in the past decade , treatment of locoregional advanced hnscc has shifted from primary surgery to organ preservation with combination chemoradiotherapy ( crt ) . the current approach attempts to achieve both organ preservation and function with outcomes superior to radiotherapy alone or surgery with postoperative radiotherapy . a recent meta - analysis by pignon et al . showed an absolute survival benefit of 6.5 % at five years when chemotherapy was administered concomitantly with radiotherapy . the mechanism for the survival benefit of crt is thought to occur via increased tumor sensitization to the cytotoxic effects of radiotherapy , while providing adjuvant treatment for potential distant metastatic disease . however , crt has acute and long - term toxicities that can both limit treatment and increase morbidity . furthermore , although several crt regimens produce high rates of complete response at the primary site and regional neck nodes , there exists a high rate of failure to systemically eradicate micrometastases . this is demonstrated by the later occurrence of distant metastases , which account for many cancer - specific deaths . therefore , despite the successful use of numerous crt regimens and the development of multidisciplinary management , the prognosis of locoregional advanced hnscc remains poor . in this study , we review the outcomes of a heterogeneous cohort of patients with locoregional advanced hnscc . all patients were treated with curative intent with a uniform crt regimen that consisted of hyperfractionated radiotherapy and concurrent cisplatin / 5 - fluorouracil ( 5 - fu ) . outcomes evaluated were overall survival ( os ) , locoregional control ( lrc ) , and disease - free survival ( dfs ) . in an irb - approved study design ( greater baltimore medical center irb number 07 - 044 - 11 ) , the medical records of 105 patients with previously untreated , locoregional advanced , nonmetastatic stage iii - ivb squamous cell carcinoma of the oropharynx , hypopharynx , or larynx were reviewed . patients with cancers of the salivary glands , sinuses , or unknown primary sites were excluded , as were patients with recurrent tumors or previous chemotherapy or radiation to the head or neck . patients were evaluated by a head and neck surgeon , medical oncologist , radiation oncologist , dentist , speech pathologist , nurse , and social worker . all cases were discussed prior to therapy and on a regular basis thereafter at multidisciplinary conference . all patients underwent comprehensive head and neck exam , including laryngoscopy and triple endoscopy when necessary , and imaging assessment with chest x - ray , ct , pet / ct , or mri of the head and neck when appropriate . all patients had a histologic diagnosis of squamous cell carcinoma and were staged according to american joint committee on cancer ( ajcc ) guidelines . when possible , tumor samples were tested for hpv - 16 dna via in situ hybridization - catalyzed signal amplification as previously described . patient demographic and clinical characteristics collected at baseline included age , gender , race , patient - reported weight loss , and karnofsky performance status ( kps ) . in addition , history of tobacco and alcohol use was collected and categorized as follows : tobacco as nonsmoker , 20 pack - years ( py ) , 2040 py , 4060 py , or 60 py ; alcohol as nondrinker , 7 drinks / week ( social ) , 714 drinks / week ( moderate ) , or 14 drinks / week ( heavy ) . chemotherapy consisted of cisplatin ( 12 mg / m ) administered over one hour and 5 - fu ( 600 mg / m ) over twenty hours , dosed for five consecutive days in an inpatient setting during weeks one and six of radiation therapy . radiation therapy consisted of hyperfractionated doses of 125 cgy delivered twice daily for 2833 days for a total dose of 7075 gy to the primary tumor site , 60 gy to involved lymph nodes , and 50 gy to uninvolved cervical and supraclavicular lymph nodes . patients were treated with 6 mv photon beams , opposed lateral fields with focus blocks , and neck nodes were boosted with electron beam after a cumulative dose of 40 gy . treatment interruptions were minimized as much as possible , and a planned treatment break of one week was included after a cumulative dose of 40 gy . mucositis severity , scored according to the world health organization ( who ) oral toxicity scale , was collected from records of patient visits to speech language pathology and clinical notes of the radiation and medical oncologists . duration of gastrostomy tube dependence was calculated from the initiation of crt until the date of removal . all but seven patients with clinical n2 or n3 disease at the time of presentation underwent planned neck dissection . after treatment , patients returned for followup every 2 - 3 months in years 1 - 2 , every 36 months in years 35 , and every 612 months thereafter , or sooner in the event of a clinical concern requiring closer scrutiny . event time distributions were estimated with the method of kaplan and meier and compared using the log - rank statistic or the proportional hazards regression model . the simultaneous effect of two or more factors was studied using the multivariate proportional hazards model , which was reported with 95 % confidence intervals ( cis ) . os was calculated from the date of treatment initiation to the day of death or last followup . dfs was calculated from the date of treatment initiation to the day of recurrence or death , whichever came earlier . lrc was similarly calculated from the date of treatment initiation to the day of local or regional recurrence , whichever came first . factors evaluated for prognostic value included age , gender , race , tumor site , histologic grade , ajcc stage , tumor stage , nodal stage , self - reported weight loss , kps , pretreatment hemoglobin , tobacco and alcohol history , and hpv status . in proportional hazards regression models , variables were entered as categorical effects and the hazard ratios for these factors reflect either its presence or absence . the median followup of surviving patients was 57.6 months ( range 4.6 to 118.8 ) . median survival was 99 months , with 3 - and 5 - year overall survival rates of 77 and 63 % for stage iii and 72 and 58 % for stageiv . including both stages iii and iv , the 3 - and 5 - year os was 75 and 60 % . uni - and multivariate analyses of factors associated with survival are listed in figure 1 ( b ) . on uni - and multivariate analysis , age greater than 55 , primary hypopharyngeal cancers , and advanced t3 / t4 tumors were associated with decreased survival , while male gender was associated with increased survival . on univariate analysis only , any smoking history and greater than 40 pack - year smoking history were associated with decreased survival . hpv - positive cancers of the oropharynx were associated with slightly decreased mortality ; however , this was not statistically significant ( p = 0.3 ) . the distribution of deaths from primary head and neck cancer and other causes is shown in table 2 . the average time to locoregional recurrence was 13.8 months ( range 6.3 to 33.9 ) after initiation of crt . the 3 - and 5 - year rates of lrc were 76 and 68 % , respectively ( figure 2 ( a ) ) . of the five patients who developed regional recurrences , three had undergone planned neck dissection following completion of crt . two of these three patients had viable carcinoma identified in the ipsilateral cervical lymph nodes , while the other patient had no evidence of viable tumor identified in any lymph nodes . the most common site of distant metastatic disease was the lungs ( n = 12 ) . the average time to diagnosis of distant metastasis was 14.1 months ( range 3.2 to 31.9 ) after initiation of crt . the average time to development of any recurrence or metastasis was 14.1 months ( range 3.2 to 33.9 ) after initiation of crt . median disease - free survival was 96 months , with 3 - and 5 - year rates of 63 and 56 % , respectively ( figure 3 ( a ) ) . uni - and multivariate analyses of factors associated with dfs are listed in figure 3 ( b ) . hypopharyngeal cancer and t3 / t4 tumors were both significantly associated with decreased disease - free survival . eighteen second primary malignancies ( spms ) were diagnosed in 17 patients after the completion of treatment . the most common spm was lung ( n = 7 ) , followed by colorectal ( n = 3 ) , hnscc ( n = 2 ) , prostate ( n = 2 ) , medullary thyroid carcinoma ( n = 1 ) , chronic lymphocytic leukemia ( n = 1 ) , multiple myeloma ( n = 1 ) , and cutaneous squamous cell carcinoma ( n = 1 ) . the average time to diagnosis of spm was 33 months ( range 3.0 to 63.2 ) . twenty - four patients ( 36 % ) had grade 3 mucositis , and 39 patients ( 59 % ) had grade 4 mucositis . the median duration of peg use was 134 days ( range 311570 ) , which included patients who died with a peg tube in place . thirty - two of 94 patients ( 34 % ) required a peg for greater than 6 months , and 10/94 patients ( 11 % ) required a peg for greater than 12 months . thirteen out of these 67 patients ( 19 % ) developed a stricture , as reported previously . seventy - one of 105 patients were nodal stage n2 or n3 , and 64 patients underwent neck dissection ( 61 % ) . of the seven patients with n2 or n3 disease who did not undergo neck dissection , two died prior to surgery , one was too ill to undergo surgery , one refused surgery , and reasons were not available for the other three patients . this rate of viable carcinoma detected post - crt is comparable to that in the cohort of patients with oropharyngeal cancer previously reported by hillel et al . andthe use of combination chemotherapy and radiation therapy as primary treatment for locoregional advanced hnscc in medically fit patients has been well established as a treatment option in numerous trials and meta - analyses . furthermore , altered fractionation radiotherapy with concomitant chemotherapy is a well - established treatment for locoregional advanced , nonmetastatic disease . the landmark study by brizel et al . showed that hyperfractionated radiotherapy with cisplatin and 5 - fu resulted in improved survival compared to radiation therapy alone . therefore , we sought to review the efficacy of a uniform treatment regimen in a heterogeneous cohort with locoregional advanced hnscc . the results of the concurrent administration of crt for 105 consecutive patients revealed favorable outcomes . for example , two other studies reported 5 - year overall survival rates of 59 % and 40 % , respectively , in cohorts of patients with stage iii or iv disease who received similar radiation and the same chemotherapeutic agents . in another series of stage iv patients who received concurrent crt , the 5 - year os was 46 % . likewise , in the study by brizel et al . , which employed similar hyperfractionated radiotherapy and concurrent cisplatin and 5 - fluorouracil in the same doses as our regimen , the 3 - year os was 55 % and the lrc was 70 % . in our cohort , 12 patients ( 11 % ) developed locoregional recurrence , and 16 patients ( 15 % ) developed distant metastasis . this is comparable to other studies with similar crt regimens , which have reported locoregional recurrence in 2231 % of patients and distant metastasis in 1320 % of patients . the patterns of failure were approximately equal between locoregional ( n = 12 ) and distant sites ( n = 16 ) , which contrasts with several studies in which the majority of failures occur either at the primary tumor site or cervical lymph nodes . reported the results of their experience with two main treatment regimens : type 1 , intensive induction chemotherapy followed by split - course chemotherapy , or type 2 , intensive , split - course hyperfractionated chemotherapy . they reported a 5 - year lrc rate of 31 and 17 % for types 1 and 2 , respectively , and a 5 - year distant failure rate of 13 and 22 % for types 1 and 2 . interestingly , the patients who received induction crt were more likely to have locoregional control but were also more likely to have distant metastatic relapse . this has prompted some to suggest the role of induction chemotherapy in treating micrometastatic disease , as other trials have shown a reduction in rates of distant metastasis with the use of induction crt . in our cohort , there were 14 patients who presented with a primary cancer of the hypopharynx and one patient with cancers of the hypopharynx and oropharynx . eleven of the 14 patients ( 79 % ) with hypopharyngeal cancer underwent neck dissection , and 6/11 ( 55 % ) had viable carcinoma ( versus 28 % of the overall cohort who underwent neck dissection ) . eight of 14 patients ( 57 % ) had a recurrence , compared to 25/105 ( 24 % ) in the overall cohort . furthermore , of the eight recurrences in the hypopharynx group , seven of them presented with distant metastases . these data reflect the poor overall survival of those with hypopharynx cancers in this cohort , which is similar to other published studies . patients with hypopharyngeal squamous cell carcinoma may therefore need a different therapeutic approach . given the ongoing debate regarding the possibility of induction chemotherapy to better treat micrometastases , this method of crt should be considered in a direct trial against concomitant crt or perhaps a return to primary surgery with postoperative radiotherapy is warranted . the high rate of grade 3 or 4 mucositis observed in this cohort was consistent with other reports . with regard to the elective placement of peg tubes , this is supported by the need to maintain or minimize the weight loss associated with crt , which is between 10 to 14 % . in one study , elective versus nonelective use of peg was compared , and elective peg resulted in less weight loss and decreased length of hospitalization . the median duration of peg use and the rate of patients that required a peg tube for longer than 6 or 12 months is similar to other studies . furthermore , the exact duration reported may be overestimated due to the retrospective nature of this study and the inability to determine exactly when the patients no longer used the peg tube . patients with head and neck cancer have an increased rate of second primary malignancies , estimated at 39 % per year . these cancers affect the entire aerodigestive tract , are often related to smoking history , and are therefore of great significance in survivors of head and neck cancer . consistent with these studies , the high rate of second primary lung cancer detected in our patient cohort was not unexpected and was ultimately responsible for a significant fraction of patient deaths after they were without evidence of disease of head and neck cancer . in our cohort ,2 of 18 spm were cancers of the head and neck , similar to another cohort of patients treated with crt . the average time to occurrence of spm was 33 months ( 2.75 years ) in our cohort , similar to other publications of 2.8 years . in addition , treatment compliance was high , and few patients experienced unplanned treatment breaks or delays due to excessive toxicity . furthermore , long - term followup was available . only two patients were lost to followup immediately after treatment , and all but six remaining patients had records available from a provider at our institution within the previous year . other strengths included the utilization of a uniform crt regimen , and a thorough chart and database review and availability of the medical records of several departments . despite these strengths , although efforts were made to collect toxicity data , this was often unavailable and not systematically recorded in patient notes ; therefore , documentation of toxicity may have been underestimated and therefore may not be representative . the results of this study show that the use of hyperfractionated radiotherapy with concurrent cisplatin and 5 - fluorouracil remains an excellent regimen for the primary treatment of locoregional advanced head and neck cancer . however , the prognosis for patients who experience relapse remains poor , and research focused on predicting which patients will experience these events and what treatment modifications , if any , should be made in order to improve the outcomes for these patients is warranted . lastly , the poor outcomes of patients with cancer of the hypopharynx merit consideration of ongoing research and novel therapies to lessen the mortality of this disease .\noutput:\n" }, { "from": "agent", "value": "objective . we reviewed a cohort of patients with previously untreated locoregional advanced head and neck squamous cell carcinoma ( hnscc ) who received a uniform chemoradiotherapy regimen . methods . retrospective review was performed of 105 patients with stage iii or iv hnscc treated at greater baltimore medical center from 2000 to 2007 . radiation included 125 cgy twice daily for a total 70 gy to the primary site . chemotherapy consisted of cisplatin ( 12 mg / m2 / h ) daily for five days and 5 - fluorouracil ( 600 mg / m2 / 20 h ) daily for five days , given with weeks one and six of radiation . all but seven patients with n2 or greater disease received planned neck dissection after chemoradiotherapy . primary outcomes were overall survival ( os ) , locoregional control ( lrc ) , and disease - free survival ( dfs ) . results . median followup of surviving patients was 57.6 months . five - year os was 60 % , lrc was 68 % , and dfs was 56 % . predictors of increased mortality included age 55 , female gender , hypopharyngeal primary , and t3 / t4 stage . twelve patients developed locoregional recurrences , and 16 patients developed distant metastases . eighteen second primary malignancies were diagnosed in 17 patients . conclusions . the crt regimen resulted in favorable outcomes . however , locoregional and distant recurrences cause significant mortality and highlight the need for more effective therapies to prevent and manage these events ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: granulomatosis with polyangiitis ( wegener 's , gpa ) is a disease manifested by necrotizing granulomatous inflammation affecting predominantly small to medium vessels and associated with presence of antineutrophil cytoplasmic antibodies ( anca ) in blood . upper respiratory tract , eyes , lungs , and kidneys are typical target organs ; rarely skin , joints , and nervous system are also involved . this type of vasculitis is rare ( annual frequency in northern europe is lower than 1 : 100000 ) , but quite aggressive disease , which results in lethal outcome in 90 % of cases during first year if left untreated . an elevated frequency of alpha -1-antitrypsin ( a1at ) phenotypic variants was found in gpa patients in comparison with population incidence . a1at is an acute phase protein belonging to the serine proteases inhibitors family and is capable of inactivating many proteases including proteinase 3 that is recognized as the main autoantigenic target in gpa ( pr3 ) . alpha -1-antitrypsin deficiency ( a1atd ) is a frequent genetic disorder caused by low serum a1at concentration as a result of carriage of pathogenic alleles of pi - gene ( protease inhibitor ) . the deficiency of this important protective factor leads to different types of lung tissue injury , such as emphysema or destructive inflammation in gpa . the most common and normally functioning a1at allelic form is pim , so healthy human phenotype is designated as pimm . there are more than 100 genetic a1at variants , among which piz and pis are the most common and clinically significant . a1atd becomes clinically manifested in individuals carrying mutation in both gene pi alleles , especially in pizz variant , whereas in heterozygous state the defect is partly compensated by normal allele that is found in individuals with pimz and pims phenotypes . heterozygous a1at carriage does not provide high risk of a1atd , though it predisposes to some diseases , including gpa . according to the statistical data of american thoracic society / european respiratory society ( ats / ers ) , the frequency of z - alleles in gpa patients in europe varies from 9 to 17.6 % . quantitative methods , like turbidimetric measurement , are generally used for the laboratory detection of a1at . however , the diagnostic efficacy of these assays is limited , because the result might be incorrect due to cross - reactivity with lipids or haemoglobin , or acute phase reaction . reference method of screening for a1atd is isoelectrofocusing ( ief ) with selective a1at staining with polyclonal anti - a1at antibodies . the aim of our study was to evaluate the frequency of pathogenic a1at alleles among russian gpa patients and to find out whether a1at phenotype influences vasculitis activity . serum samples and clinical data were provided by saint - petersburg clinical rheumatology hospital number 25 .46 samples of healthy blood donors were collected as a control group . to estimate the clinical significance of different a1at phenotypic variants , we collected detailed clinical and laboratory data , including birmingham vasculitis activity score ( bvas ) , the incidence of lung involvement , and anti - pr3 antibodies concentrations , measured by enzyme - linked immunosorbent assay ( elisa ) with a commercial kit ( euroimmun , germany ) . we determined a1at phenotypes in all collected samples by ief with immunoblotting with the use of horizontal electrophoresis system ( pharmacia , sweden ) . ph gradient was created by adding narrow specter ampholytes ph 4.24.9 ( ge healthcare , sweden ) . the a1at molecules focused within agarose gel were blotted onto nitrocellulose paper and selectively stained by horseradish peroxidase conjugated goat anti - a1at antibodies ( bethyl laboratories , sweden ) . a1at phenotypes were assessed by comparing a1at migration patterns with control pimm , pimz , and pims samples . electrophoretic patterns of main a1at isoforms migration by ief are demonstrated in figure 1 . besides phenotyping , quantitative a1at measurements were performed with turbidimetric commercial kit ( sentinel diagnostics , italy ) . to estimate statistical significancewe compared clinical and laboratory parameters of the groups , using unpaired t - test or mann - whitney u test , depending on whether the distribution was gaussian . differences between the groups were considered to be significant at a p value of 0.05 . the group was heterogeneous by gender ( 16 men and 22 women ) and by age ( 1877 years old ) . pulmonary involvement in vasculitis was found in 64.5 % ( 20/31 ) of cases and was presented by cavitating infiltrates ( n = 13 ) and interstitial fibrosis ( n = 7 ) . all patients had a different degree of vasculitis activity , which was evaluated with bvas clinical scale . in gpa patientsfollowing a1at phenotypes were identified : 4 mz , 1 zz , and 2 mf . among 46 samples of healthysome clinical and laboratory parameters of 7 gpa patients , carrying pathological a1at phenotypes , are demonstrated in table 1 . to find out clinical significance of pathogenic a1at allelic forms , we analyzed gpa patients depending on a1at phenotype . mean a1at concentrations in groups with normal ( n = 31 ) and pathological ( n = 7 ) a1at phenotypes were 1840 mg / l 127.2 and 970.0 mg / l 167.6 , respectively ( p = 0.0038 , unpaired t - test ) . a1at concentrations in both groups are presented in figure 2 . only in 2 from 7 samples with abnormal a1at phenotype the a1at concentrations were below the reference range of 900 mg / l . comparing a1at phenotypes and clinical data , we found that the mean vasculitis activity , measured with bvas , in the group with normal phenotypes was 16.421.498 that was significantly lower than 24.002.828 , the mean bvas score in gpa patients with abnormal a1at ( see figure 3 ) . concentrations of anti - pr3 antibodies were also significantly higher ( p = 0.0480 , mann - whitney u test ) in gpa patients with abnormal a1at phenotypes ( 180.4 ru / ml 35.19 and 106.0 ru / ml 18.25 , resp . ) . mean values of erythrocyte sedimentation rate ( esr ) in patients with abnormal a1at phenotypes were also statistically higher than in patients with normal phenotypes : 35.70 mm / h 3.278 and 55.67 mm / h 2.031 , respectively , p = 0.0054 . the differences in other inflammation markers , such as fibrinogen , c - reactive protein , igg , we noted that pulmonary involvement was found in all gpa patients with abnormal a1at phenotype ( n = 7 ) and only in 65 % ( 20/31 ) patients with normal a1at , although this difference was not statistically significant . to analyze the incidence of abnormal phenotypic variants of a1at among russian gpa patients , we studied 38 serum samples from individuals suffering from this disease . we found abnormal a1at phenotypes in 18.4 % of cases , over the number shown in other publications : 917.6 % . we found higher bvas activity , greater concentrations of anti - pr3 antibodies , and higher esr in gpa patients carrying atypical alleles of a1at . these data suggest that gpa is more severe in these individuals and more effective treatment in such cases may be considered . our findings can be explained by the fact that a1at modulates pr3 activity and therefore it is presumably an important protective factor in systemic vasculitis . tissue inflammation induces pr3 expression by neutrophils ; this is attended by oxidative burst and partial neutrophil degranulation . pr3 also stimulates il - 8 production by endotheliocytes and monocytes and promotes increase of eicosanoids level and release of leucotriene b4 , launching aggressive necrotizing inflammatory cascade in gpa . it was experimentally proved that anca inhibit inactivation of pr3 by a1at molecule , when bound to pr3 in gpa patient 's serum . thus pr3 exhibits proinflammatory activity ; meanwhile a1at antagonizes pr3 , influencing both pr3 itself and pr3 induced neutrophil chemotaxis . the interaction of a1at and pr3 may have a considerable influence on severity of inflammatory process in gpa and can be impaired in case of abnormal a1at phenotype . the case of successful a1at replacement treatment of individual suffering from gpa and a1atd has been reported . when this patient with a1atd and gpa , resistant to standard therapy , was given replacement therapy with a1at , she developed stable remission of gpa with regression of skin lesions and improvement of pulmonary parameters . the laboratory testing for pathological a1at alleles is not usually ordered for patients with systemic vasculitides in routine clinical practice . considering relatively high frequency of pathological a1at phenotype carriage among gpa patients and its clinical significance we may conclude that the relevance of a1atd is underestimated . during medical examination of every gpa patient , the possibility of a1at deficiency should be considered .\noutput:\n" }, { "from": "agent", "value": "the deficiency of alpha - 1 protease inhibitor , or alpha -1-antitrypsin ( a1at ) , predisposes to chronic lung diseases and extrapulmonary pathology . besides classical manifestations , such as pulmonary emphysema and liver disease , alpha -1-antitrypsin deficiency ( a1atd ) is also known to be associated with granulomatosis with polyangiitis ( gpa or wegener 's granulomatosis ) . the aim of our study was to evaluate the frequency of allelic isoforms of a1at and their clinical significance among gpa patients . detailed clinical information , including birmingham vasculitis activity score ( bvas ) , incidence of lung involvement , anti - proteinase 3 ( pr3 ) antibodies concentrations , and other laboratory data were collected in 38 gpa patients . we also studied serum samples obtained from 46 healthy donors . in all collected samples a1at phenotyping by isoelectrofocusing ( ief ) and turbidimetric a1at measurement were performed . abnormal a1at variants were found in 18.4 % ( 7/38 ) of cases : 1 zz , 4 mz , 2 mf , and only 1 mz in control group ( 2 % ) . the mean a1at concentration in samples with atypical a1at phenotypes was significantly lower ( p = 0.0038 ) than in normal a1at phenotype . we found that patients with abnormal a1at phenotypes had significantly higher vasculitis activity ( bvas ) as well as anti - pr3 antibodies concentration . we conclude that a1at deficiency should be considered in all patients with gpa ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: studies have demonstrated that photorefractive keratectomy ( prk ) and laser in situ keratomileusis ( lasik ) for myopia are safe and predictable . the application of excimer laser for the treatment of hyperopia started in the late 90s .13 in this process , a paracentral meniscus of the corneal stroma is removed to steepen the central cornea . initially , prk with the excimer laser was used to corrected hyperopia . however , postoperative corneal haze restricted prk for hyperopia , and eventually lasik became the most common method for the correction of hyperopia . lasik , however , has certain limitations and drawbacks such as flap related complications ,4 dry eye ,5 and keratectasia .6 in addition , patients at risk of trauma and / or those with thin corneas are not eligible for lasik . the prevention of corneal haze with mitomycin - c ( mmc ) 7 has resulted in the resurgence of prk for keratorefractive surgery . the outcomes of hyperopic prk have been promising ; however , the predictability is lower , compared to myopic prk . published results indicate comparable efficacy for prk and lasik for the correction of up to 4.00 d of hyperopia .891011121314151617 however , few studies have assessed the outcomes of hyperopic prk with the application of mmc ( prk - mmc ) . here , we present 1 - year outcomes and complications with hyperopic prk - mmc for the treatment of mild to moderate hyperopia . from december 2009 to december 2010 , consecutive cases of hyperopia undergoing prk - mmc were approached . all excimer ablations were done using either the allegretto wave concerto ( alcon inc . , fort worth , tx , usa ) or the technolas 217 - z ( bausch and lomb inc . preoperatively , all patients were at least 20 years of age , and they had stable refraction in the past 18 months ( 0.50 diopters [ d ] change ) . none of the patients had any history of ocular surgery , connective tissue disorders , or diabetes , and they were not using any medication that might interfere with wound healing . soft contact lens users stopped wearing lenses three days before examinations , patients wearing hard contact lenses were advised to stop using the lenses for at least 3 weeks before their appointment . preoperative examinations included assessment of visual acuity with and without correction , manifest and cycloplegic refraction , measurement of the central corneal thickness with an ultrasound pachymeter ( nidek , us - 1800 echoscan ) , slit lamp examination , corneal topography ( eyesys vision , eyesys 3000 ) , fundus examination , and measurement of the intraocular pressure . in cases with a considerable discrepancy between manifest and cycloplegic refraction , manifest refraction was repeated after the effect of cycloplegic drops had receded to allow greater correspondence between refraction . the maximum acceptable difference between manifest and cycloplegicrefraction was 1.00 d. surgery was performed under topical anesthesia with tetracaine 0.05 % eye drops . a hockey knife spatula was used to mechanically remove the epithelium in the central 8.0 mm of the cornea , and the laser ablation was delivered to the surface . for those over 40 years of age , the correction was based on full cycloplegic refraction , and in younger patients , we used the average of cycloplegic and subjective refractions . treatments with the concerto excimer laser were programmed for an optical zone of 6.5 mm and a transition zone of 1.25 mm . treatments with the technolas laser were programmed for an optical zone of 6.0 mm with 1.0 mm for the transitional zone . once the ablation was completed , 0.02 % mmc solution was applied to the ablated area for 120 s ,15 and then the entire corneal surface and conjunctiva was rinsed with 20 ml cold normal saline . subsequently , chloramphenicol drops were instilled , and surgery was concluded by applying a bandage contact lens ( air optix ; novartis ag , basel , switzerland ) . postoperative medications included 0.5 % chloramphenicol eye drops , four times daily , until complete re - epithelialization , and 0.1 % betamethasone eye drops four times daily for the first two weeks which there replaced with 0.1 % fluorometholone drops four times daily for the next 6 weeks ( a total of 8 weeks ) . patients had follow - up visits every day until re - epithelialization was complete and were scheduled to be examined at 1 , 3 , 6 , and 12 months , postoperatively . ateach follow - up visit data were collected on the best corrected distance vision acuity ( bcva ) and uncorrected distance vision acuity ( ucva ) , manifest refraction , and slit lamp examination , and any complication such as infection , ectasia , or haze formation . the protocol of this study was approved by the institutional review board of noor ophthalmology research center , and all patients signed informed consents before enrollment . quantitative variables are summarized as a mean and standard deviation . to compare results at preoperatively and postoperatively we used the repeated measures analysis of variance . the mean age of the patients was 44.811.3 years ( range , 2055 years ) and eight cases ( 19 % ) were under 40 . preoperatively , mean manifest refractive spherical equivalent ( mrse ) was + 2.00 d 0.76 d ( range , 0.54.0 d ) and mean spherical error was + 2.57 d 0.87 d ( range , 1.255.5 d ) . figure 1 presents the changes in corrected and uncorrected visual acuity , and figure 2 demonstrates changes in mean mrse . meansd ( range ) of spherical and cylinder error ( diopters ) at different visits during a 1 - year follow - up logarithm of the minimum angle of resolution uncorrected distance visual acuity and best spectacle - corrected distance visual acuity preoperatively and at 1 , 3 , 6 , and 12 months after surgery stability of hyperopic photorefractive keratectomy with mitomycin - c out to 12 months postoperatively table 1 presents changes in sphere and cylinder errors due to each laser . changes in spherical ( 0.073 ) and cylindrical ( 0.197 ) errors were not significantly different between devices [ table 1 ] . one month after surgery , a mean spherical error was myopic but decreased toward emmetropia . there were significant changes in the spherical error preoperatively to 1 - month postoperatively ( p 0.001 ) , as well as from 1 to 3 months postoperatively ( p = 0.024 ) . postoperatively , both spherical error and mrse were significantly different from the preoperative values ( p 0.001 ) ; 69.0 % were within 0.50 d , and 98.0 % were within 1.00 d of emmetropia . at this time , 18 eyes ( 42.9 % ) had ucva of 20/20 , and in 39 eyes ( 92.8 % ) ucva was 20/40 or better . the best spectacle - corrected distance visual acuity ( bcva ) increased by two lines in three eyes ( 7.1 % ) and one line in two eyes ( 4.7 % ) , 31 eyes ( 73.8 % ) showed no change , three eyes ( 7.1 % ) lost one line , and three other eyes ( 7.1 % ) lost two lines of corrected vision [ figure 3 ] . thirty - one eyes showed no change , two lost two lines , and two gained two lines no stromal haze was observed in the central cornea . during the first 6 months , two eyes ( 5.0 % ) had peripheral haze ( hanna grade 1 ) which resolved by the 12 - month follow - up visit . slight haze was detected in 15 eyes ( 36.0 % ) and resolved in all cases within a few months . there was no case of ectasia or need for retreatment during the 1 - year follow - up . microbial keratitis occurred in one eye which was eliminated from the study and final analysis . in this study , we evaluated the safety , efficacy , stability , and predictability of hyperopic prk over 1 - year . unlike myopia , one of the challenges in making hyperopic corrections is the difference between manifest and cycloplegic refractions , especially in prepresbyopic patients . this issue is less significant in hyperopia over 5.0 d , where the latent component is lower . in a young patient , corrections based on manifest refraction will result in a late hyperopic shift while treating the full cycloplegic refraction will result in myopia . esquenazi and mendoza12 suggested using manifest refraction when there is more than 0.50 d discrepancy between manifest and cycloplegic refractions , but this could result in residual latent hyperopia in young patients . jackson et al. 18 recommended using only manifest refraction in a young patient and accept some regression and latent hyperopia . spadea et al. 19 based the laser correction according to the cycloplegic refraction in patients under 40 years of age , allowing for up to 0.5 d difference between the cycloplegic and manifest refractions . in cases over 40 years , they19 based corrections on manifest refraction . we used the cycloplegic refraction as the correction target in patients over 40 and the average of cycloplegic and manifest refractions in younger cases , and we allowed for up to 1.00 d of difference between cycloplegic and manifest refractions . it seems that less difference between the two refractions should be allowed before correction . at 12 monthspostoperatively , 43 % of our patients had 20/20 ucva , which is comparable to jackson et al . 's study18 ( 52 % at 12 months ) and spadea et al. s study19 ( 46 % at 24 months ) . in this study , the safety index ( postoperative bcva / preoperative bcva ) was 1.00 , and the efficacy index ( postoperative ucva / preoperative bcva ) was 0.88 , which were comparable to 0.95 and 0.87 values reported by leccisotti .14 however , despite a safety index of 1.00 , we had six eyes with one or two lines loss in bcva which could partly be due to loss of previous linear magnification of spectacles14 or irregular astigmatism caused by some apical nodular subepithelial haze .20 stability of refraction after hyperopic prk has been reported in most studies to occur sometime between 3 and 12 months after surgery . in our report , however , stevens and ficker ,22 reported that it took about 12 months for the refraction to stabilize . these discrepancies can be due to different magnitudes of preoperative hyperopia in these studies because higher hyperopic corrections require longer stabilize . review of our study in comparison to other studies on the correction of hyperopic photorefractive keratectomy mrse within 1.00 d of the intended refraction has been reported in different studies to be between 67 % and 100 % . we found it was 98 % , this can be attributed to better predictability with newer generations of excimer laser machines with larger ablation zones and improved ablation profiles .1223 in hyperopic prk , the central corneal stroma largely spared , and the main site of ablation is the periphery . thus , in the absence of serious complications , such as decentered ablation or infection , there should be no significant haze formation or loss bcva .16 however , haze has been reported and can cause decreased corrected vision and regression after prk . without mmc , grades 1 and 2 haze ( hanna 's scale ) has been reported .7 in our study , with the use of mmc , there were just two cases of grade 2 peripheral haze which resolved by 12 months postoperatively . high values of root mean square higher order aberrations in a 7 mm pupil size have been reported ,16 which were largely due to coma and negative 4 order spherical aberration , especially with higher corrections . we found hyperopic prk is an effective technique with good stability to correct low to moderate hyperopia , with some degrees of overcorrection during the first few months with regression toward emmetropia by 1 - year . safety , predictability , and stability are acceptable and comparable to that of hyperopic lasik after 1 - year follow - up .\noutput:\n" }, { "from": "agent", "value": "purpose : to evaluate refractive and visual outcomes of photorefractive keratectomy with mitomycin - c . ( prk - mmc ) for the treatment of mild to moderate hyperopia.materials and methods : this case series enrolled 21 patients with up to + 5.50 diopters ( d ) of hyperopia . all 42 eyes were treated with the concerto ( wavelight ) or the technolas 217 - z ( bausch and lomb ) excimer laser . outcome measures included best corrected distance vision acuity ( bcva ) and uncorrected distance vision correction and refraction at 1 , 3 , 6 , and 12 months postoperatively.results : mean patient age was 44.8 11.3 years . preoperatively , mean manifest refractive spherical equivalent ( mrse ) was + 2.00 d 0.76 d and mean spherical refractive error was + 2.57 d 0.87 d ( range , + 1.25 d to + 5.50 d ) . at 12 months postoperatively , mean mrse was + 0.1 d 0.61 d. mrse was within 0.50 d of emmetropia in 29 eyes ( 69 % ) , and 18 eyes ( 43 % ) had 20/20 uncorrected distant visual acuity . bcva increased by two lines or more in three eyes ( 7.1 % ) and one line in two eyes ( 4.7 % ) ; 31 eyes showed no change , three eyes ( 7.1 % ) lost one line , and three other eyes ( 7.1 % ) lost two lines of bcva . no eyes lost more than two lines of bcva . complications included grade 2 peripheral haze in two eyes which cleared by 12 months postoperatively.conclusion : prk - mmc was a safe and predictable method for the correction of mild to moderate hyperopia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: anti - n methyl d aspartate receptor encephalitis ( anti - nmdare ) , first defined in 2007 by dalmau et al . though the phenotype resembles that of the adults in many ways , yet there are important differences . we report a case of pediatric anti - nmda receptor encephalitis in a 13 - years - old girl , the second such case being reported from india . the incidental presence of left temporal arachnoid cyst added an interesting clinical dimension to the case . semiology consisted of sudden onset of repetitive eye blinks with loss of contact with surroundings and facial twitching towards right side and dystonic posturing of upper limbs , lasting for one to two minutes , followed by post - ictal confusion . child was born by normal full term vaginal delivery , and developmental milestones had been attained normally . after the first seizure , levetiracetam 500 mg per day had been started by a pediatrician . however , seizures continued to recur at a frequency of almost an episode every other day , despite subsequent escalation of levetiracetam dose to 750 mg per day and the addition of second anti - epileptic , i.e. carbamazepine at the dose of 600 mg per day . about 10 days after the onset of seizures , parents noticed language abnormalities in the form of progressively decreasing word output . mri brain was unremarkable , except for a well - defined cystic extra - axial lesion along anteromedial aspect of left temporal lobe measuring 4.2 by 2.7 cm , with no contrast enhancement , suggestive of left temporal arachnoid cyst [ figure 1 ] . interictal eeg done twice in 10 days revealed mild left temporal focal slowing and amplitude attenuation , possibly related to underlying arachnoid cyst . neurosurgical consultation was sought at this stage for further evaluation as to whether the arachnoid cyst could be epileptogenic and whether its surgical removal would be curative . axial flair mri brain showing left temporal arachnoid cyst examination at this stage revealed a conscious patient with severe non - fluent aphasia with preserved comprehension . in view of short history , unrelenting seizures and rapidly progressive language deficits , possibilities of infectious ( viral ) encephalitis , immune encephalitis , and acquired epileptiform aphasic disorder ( landau kleiffner syndrome ) repeat mri brain revealed interval development of few flair hyperintensities in left temporal region [ figure 2 ] . csf examination revealed mild lymphocytic pleocytosis ( 10 cells per high power field ) with normal glucose and protein levels . csf viral markers ( for herpes simplex virus , lyme , enterovirus , cytomegalovirus , and epstein barr virus ) , vdrl , gram stain , afb stain , india ink , cryptococcal antigen and bacterial , mycobacterial , and fungal cultures were negative while immune markers i.e. anti - vgkc antibody , anti - nmda antibody , and anti - gad antibody were yet awaited . levetiracetam was further hiked upto 1500 mg per day , carbamazepine was continued in the same dose , and empiric intravenous acyclovir 10 mg / kg body weight thrice a day were started . over the next few days , the language deficits progressed further to global aphasia . besides , patient developed orolingual dyskinesias as well as facial action myoclonus precipitated by attempted speech , smile or attempt to show her teeth . moreover , relentless seizures continued to occur , despite further increase in anti - epileptics to 3000 mg levetiracetam , 1200 mg carbamazepine , and 20 mg clobazam per day . twenty - four hour video eeg recording was done , which revealed 6 to 8 hertz background with intermittent left temporal slowing and frequent epileptiform activity arising from left mid - temporal leads with two instances of secondary generalization corresponding to clinical seizures , besides frequent facial jerks and oro - lingual movements with no eeg correlate . sleep eeg did not show continuous slow waves and spikes . at this stage , despite the results of csf immune markers not yet being available , it was thought prudent to treat the patient as immune encephalitis in view of the clinical evolution of the disease . intravenous immunoglobulins were started in the dose of 0.4 g / kg / day for 5 days . a gratifying clinical response was achieved , with remission of the seizures within 3 days after starting ivig . language deficits too began to show gradual but definite improvement within the next few days . meanwhile , two weeks after initiation of ivig , anti - nmda receptor antibody in csf was reported positive , thus confirming it as a case of anti - nmda receptor antibody - associated immune encephalitis . pelvic ultrasonography and magnetic resonance imaging did not reveal any ovarian teratoma or any other neoplasm . patient was discharged in a significantly improved state and currently remains on follow up with steadily resolving symptoms . comprehension deficits of language have completely resolved while residual mild non - fluent aphasia is resolving . likewise , extra pyramidal dyskinesias have fully resolved while facial myoclonus has become relatively very infrequent . axial flair mri brain showing left temporal gyral hyper intensities ( arrow ) in addition to arachnoid cystour case adds significantly to the increasing literature on pediatric anti - nmdare and is only the second case of pediatric age group anti - nmdare being reported from india . anti - nmdare has so far been well characterized in adults , predominantly young women , in whom the well - defined sequential clinical phases of the disease include prodromal phase , psychotic phase , dysautonomic and central hypoventilation phase , and phase of extra pyramidal dysfunction followed by recovery . the disease may occur either in an idiopathic form or as a paraneoplastic syndrome , the latter being associated commonly with ovarian teratomas ( in about 60 % women ) . pediatric cases are lesser defined and found to behave differently from adults in certain ways , despite considerable similarities . younger patients are reported to present more with speech problems , seizures , behavioral issues , and abnormal movements , while dysautonomia and hypoventilation are less frequent , and when present , less severe than in adults . the behavioral syndrome may be less recognizable than the frank psychosis - like features of adults . besides , the probability of finding a tumor is lesser . presentation in a child with focal seizures associated with ictal gyral swelling related transient focal hyper intensities in mri brain ( the most plausible explanation in our patient too ) has been reported before . our case conforms to the described pattern for children , with relentless seizures , speech abnormalities , and extra pyramidal features being the central clinical features while hypoventilation , dysautonomia or psychotic features were conspicuous by their absence . antibodies against the nr1 subunit of nmda receptors which act at widespread sites in the brain are thought to be pathogenic for anti - nmdare . the differences in nmda receptor expression in brain in children in comparison with adults may account for the relative differences in frequency and severity of certain clinical features described before . an mri brain in anti - nmdare may be normal or may demonstrate non - specific , non - contrast enhancing white matter hyper intensities in the t2 - weighted or flair sequences . csf may be abnormal , with moderate lymphocytic pleocytosis and normal or mildly increased protein concentration in up to 80 % of patients . our patient also had left temporal arachnoid cyst as a co - incidental finding on mri brain . had the possibility of immune encephalitis not been considered , the fact that her seizures clinically and electrographically localized to left temporal region could have led to the erroneous assumption of the arachnoid cyst being the substrate of epilepsy . the high index of suspicion for immune encephalitis by the treating neurologist in view of the constellation of clinical features , mild lymphocytic pleocytosis in csf , negative viral markers , and finally the positive csf anti - nmdar antibodies clinched the correct diagnosis in this case . although no standard of care exists , as in adult cases , immunotherapy with prednisolone , plasmapheresis or ivig constitutes the first - line approach in children too , usually with gratifying response . more vigorous immunotherapy , with rituximab or cyclophosphamide , may be considered in non - responsive cases . some patients may need continued immunosuppressants ( mycophenolate mofetil or azathioprine ) for up to a year after discontinuation of initial immunotherapies to prevent relapse . while tumor removal constitutes an important therapeutic approach in adult patients with tumor , tumors are not found in most of pediatric cases . however , this does not preclude the need to actively look out for a tumor ( usually ovarian teratoma in young girls ) and to follow the patient with periodic screening for teratomas , even if patients have recovered from encephalitis . considering the age - related limitations of some tests ( e.g. , trans - vaginal ultrasound ; exposure to radiation with repeat ct scans ) , six monthly ultrasound and mri of abdomen and pelvis for at least two years are recommended by most experts . in view of lesser number of patients , the recommendations for male adults or children are less clear . in conclusion , this case report illustrates the need to consider the diagnosis of anti - nmdar encephalitis in children with unexplained relentless seizures in the appropriate clinical context . pediatricians and pediatric neurologists should be aware of the occurrence of anti - nmdare in children and its subtle differences from the better characterized adult picture of nmdare to enable a high index of diagnostic suspicion of this treatable disorder .\noutput:\n" }, { "from": "agent", "value": "anti - n methyl d aspartate receptor encephalitis ( anti - nmdare ) is a recently defined disease , which is probably more under - recognized than rare . we report a case of anti - nmdare in a 13 - years - old girl , who presented with intractable seizures . to the best of our knowledge , this is the second case of pediatric anti - nmdare being reported from india . the need for a greater awareness of this disease and the subtle differences in clinical presentation between pediatric and adult patients are highlighted ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: by excluding dairy , the protein foods group name of myplate neglects the contribution of dairy foods to protein intake in the united states . for many americans , dairy is an important dietary staple and major source of protein .1,2 milk is the primary source of protein for children aged 2 to 18 years , comprising 13.2 % of the total protein this group consumes .1 among americans aged 19 to 50 years , cheese and milk are the third and fourth most common food sources of protein , respectively .2 milk also provides 7.4 % of protein for adults older than 51 years2 and is among the top 5 sources of dietary protein for americans along with poultry , meats , mixed dishes ( meat , poultry , fish ) , and bread .9 yet , whereas poultry , meats , and fish are included in the protein foodsbread and milk do contain less protein per gram than poultry , meats , and fish . grilled chicken breast meat has approximately 31 g of protein in every 100 g , and cooked ground beef ( 90 % lean ) has 26 g of protein in every 100 g of beef .6 yogurt and milk , on the other hand , both contain slightly more than 3 g of protein in every 100 g , and wheat bread has roughly 11 g of protein per 100 g. 6 however , protein amount does not reflect protein quality . while wheat bread contains protein , for instance , it does not contain lysine , 1 of 9 essential amino acids , and scores low onprotein digestibility .10 milk , on the other hand , is among the best protein sources . it contains all 9 essential amino acids in a bioavailable and digestible form .11,12 according to the most common protein quality evaluation measure , the protein digestibility corrected amino acid score ( pdcaas ) , milk protein has a value of 1.00 , the highest possible quality rating on this scale .10 historically , protein quality evaluation measures have even used milk protein as a reference to measure the quality of other proteins against .10,11 the pdcaas scoring evaluates protein quality based on limiting amino acids , fecal digestibility , and the protein needs of preschool - aged children .10 yet , because this scale truncates scores greater than 1.00 , it still can not fully reflect the quality of the protein that milk contains . milk s true pdcaas score is 1.21 , but because its concentration of some indispensable amino acids is higher than the amount of those amino acids required by preschool aged children , its value is truncated to 1.00 . however , the value of 1.00 versus 1.21 is relevant only in the context of a milk - only diet . as soon as other protein sources are added , which may be deficient in amino acids of which milk has an overabundance , milk can complement those deficient protein sources . most diets contain a variety of foods , so milk s nontruncated pdcaas score may more accurately reflect the quality of dairy protein . table 2 lists the pdcaas values for common protein group foods , as well as for wheat and milk . milk has a pdcaas value higher than either ground beef or soy , and its nontruncated value is even higher than that of eggs .12 according to the pdcaas scale , dairy is a source of excellent protein . protein quality of foods as indicated by protein digestibility corrected amino acid score values in addition , dairy protein is more affordable than some other protein foods . generally , protein tends to be more expensive than other sources of calories .3 animal protein , which is of higher quality than plant protein , is one of the most expensive foods besides produce .3 a 2010 study assessed foods from the usda food and nutrition database and the usda center for nutrition policy and promotion s food price database for the nutrient value of foods relative to their cost using the nutrient rich foods index .3 this index was used to rate the nutrient density of individual foods by assessing the presence of nutrients to encourage ( defined as protein , fiber , vitamin a , vitamin c , vitamin e , calcium , iron , magnesium , and potassium ) versus nutrients to limit ( added sugars , sodium , and saturated fat ) .3 in this study , eggs and milk were among the lowest - cost sources of vitamin a , dietary calcium , vitamin b12 , and riboflavin ( p 0.01 ) . eggs and milk were also among the least expensive protein sources .3 however , whereas eggs are consideredthe lower cost of dairy protein could have important ramifications for vulnerable populations , such as children and older adults , who have high protein needs . while the recommended dietary allowance ( rda ) of protein for adults is 0.8 g / kg body weight , the rda for children aged 1 to 14 years ranges from 1.00 to 1.14 g / kg .13 although not reflected in the rdas , elderly members of the population may also need more than 0.8 g / kg of protein to slow the loss of muscle tissue and function because of aging .14 while protein intake is sufficient for most of the population , the 2015 dietary guidelines advisory committee noted in their report that6 % of men older than 80 years and 11 % of women older than 80 years had protein intakes that were below the protein [ estimated average requirement ] .15 because older adults also have lower energy needs and tend to consume less protein ,14 it is especially important for this group to select foods with high - quality protein . by excluding dairy , the protein foods group name of myplate neglects the contribution of dairy foods to protein intake in the united states . for many americans , dairy is an important dietary staple and major source of protein .1,2 milk is the primary source of protein for children aged 2 to 18 years , comprising 13.2 % of the total protein this group consumes .1 among americans aged 19 to 50 years , cheese and milk are the third and fourth most common food sources of protein , respectively .2 milk also provides 7.4 % of protein for adults older than 51 years2 and is among the top 5 sources of dietary protein for americans along with poultry , meats , mixed dishes ( meat , poultry , fish ) , and bread .9 yet , whereas poultry , meats , and fish are included in the protein foodsbread and milk do contain less protein per gram than poultry , meats , and fish . grilled chicken breast meat has approximately 31 g of protein in every 100 g , and cooked ground beef ( 90 % lean ) has 26 g of protein in every 100 g of beef .6 yogurt and milk , on the other hand , both contain slightly more than 3 g of protein in every 100 g , and wheat bread has roughly 11 g of protein per 100 g. 6 however , protein amount does not reflect protein quality . while wheat bread contains protein , for instance , it does not contain lysine , 1 of 9 essential amino acids , and scores low onprotein digestibility .10 milk , on the other hand , is among the best protein sources . it contains all 9 essential amino acids in a bioavailable and digestible form .11,12 according to the most common protein quality evaluation measure , the protein digestibility corrected amino acid score ( pdcaas ) , milk protein has a value of 1.00 , the highest possible quality rating on this scale .10 historically , protein quality evaluation measures have even used milk protein as a reference to measure the quality of other proteins against .10,11 the pdcaas scoring evaluates protein quality based on limiting amino acids , fecal digestibility , and the protein needs of preschool - aged children .10 yet , because this scale truncates scores greater than 1.00 , it still can not fully reflect the quality of the protein that milk contains . milk s true pdcaas score is 1.21 , but because its concentration of some indispensable amino acids is higher than the amount of those amino acids required by preschool aged children , its value is truncated to 1.00 . however , the value of 1.00 versus 1.21 is relevant only in the context of a milk - only diet . as soon as other protein sources are added , which may be deficient in amino acids of which milk has an overabundance , milk can complement those deficient protein sources . most diets contain a variety of foods , so milk s nontruncated pdcaas score may more accurately reflect the quality of dairy protein . table 2 lists the pdcaas values for common protein group foods , as well as for wheat and milk . milk has a pdcaas value higher than either ground beef or soy , and its nontruncated value is even higher than that of eggs .12 according to the pdcaas scale , dairy is a source of excellent protein . in addition , dairy protein is more affordable than some other protein foods . generally , protein tends to be more expensive than other sources of calories .3 animal protein , which is of higher quality than plant protein , is one of the most expensive foods besides produce .3 a 2010 study assessed foods from the usda food and nutrition database and the usda center for nutrition policy and promotion s food price database for the nutrient value of foods relative to their cost using the nutrient rich foods index .3 this index was used to rate the nutrient density of individual foods by assessing the presence of nutrients to encourage ( defined as protein , fiber , vitamin a , vitamin c , vitamin e , calcium , iron , magnesium , and potassium ) versus nutrients to limit ( added sugars , sodium , and saturated fat ) .3 in this study , eggs and milk were among the lowest - cost sources of vitamin a , dietary calcium , vitamin b12 , and riboflavin ( p 0.01 ) . eggs and milk were also among the least expensive protein sources .3 however , whereas eggs are consideredthe lower cost of dairy protein could have important ramifications for vulnerable populations , such as children and older adults , who have high protein needs . while the recommended dietary allowance ( rda ) of protein for adults is 0.8 g / kg body weight , the rda for children aged 1 to 14 years ranges from 1.00 to 1.14 g / kg .13 although not reflected in the rdas , elderly members of the population may also need more than 0.8 g / kg of protein to slow the loss of muscle tissue and function because of aging .14 while protein intake is sufficient for most of the population , the 2015 dietary guidelines advisory committee noted in their report that6 % of men older than 80 years and 11 % of women older than 80 years had protein intakes that were below the protein [ estimated average requirement ] .15 because older adults also have lower energy needs and tend to consume less protein ,14 it is especially important for this group to select foods with high - quality protein . because of their high - quality protein content and contribution to the protein intake of americans , dairy foods areprotein foods .15,16 however , dairy does not belong with the other protein foods , because of its very different nutrient profile . in addition , dairy has its own section of myplate .17 in addition to protein , dairy contains calcium , vitamin d , and potassium , 3 of the nutrients of concern identified in the 2015 dietary guidelines for americans ( 2015 dga ) .16 however , dairy does not contain iron , niacin , vitamin e , or vitamin b6 like meat , poultry , beans , eggs , fish , and nuts and seeds do .18 therefore , although dairy foods are considered a food group to increase in the 2015 dga ,16 adding dairy to the protein foods group could result in nutrient displacement if dairy overtakes other sources of protein in the diet . furthermore , dairy already has its own unique section on myplate . in this section , daily consumption of 2 to 3 cups of dairy products is recommended primarily to encourage adequate calcium intake . retain their calcium after processing , such as milk , cheese , and yogurt .5 the dairy group also encompasses nondairy sources of calcium , including calcium - fortified foods ( juices , soymilk , cereals ) , canned fish , tofu , and leafy greens .19 dairy foods are protein foods but differ considerably from the foods currently in the protein foods group . myplate is the first us food guide to name a major food group with a nutrient .7 the historical precedent has been to label all food groups by their constituent foods . as shown in table 3 , the previous names of the protein foodsgroup used terminology similar to meat & beans . despite the major name change with myplate , the list of foods in this group has hardly changed since 1916 ( table 3 ) . a recent commentary addressing myplate myths suggests that this group was renamed to teach consumers that protein is available in a variety of foods .17 if the goal of renaming the former meat & beans group was to educate us consumers about the presence of protein in a variety of foods , then dairy , an important source of high - quality protein , would be included in the protein group . shift in protein group name in usdafood guides over time furthermore , if consumers do not understand what protein is , knowing that different foods contain it is unlikely to be helpful in selecting a healthful diet . qualitative research used in the development of the 2005 mypyramid found that consumers had difficulty understanding the differences between nutrients .8 in focus groups , consumers acknowledged that they did not understand the difference between saturated and unsaturated fats but did understand the difference between solid fats and oils , which refer more directly to foods .8 therefore , explaining nutrition using familiar food - based terminology may be a more effective way for consumers to understand dietary recommendations . the choosemyplate.gov web site states that its intention is to to help consumers build healthier diets with user - friendly nutrition information .20 yet , the use of protein to describe a group of foods instead of using food to describe a group of foods may actually make myplate less helpful . finally , referring to this group of foods by their primary macronutrient also downplays the 2015 dga s recommendation to focus on foods , not nutrients , when planning a healthful diet .16 focusing on nutrients makes good nutrition more difficult for consumers to understand and implement .8 just as the dairy foods group includes a list of nondairy sources of calcium , a meat & beans group could easily have 1 or more pages describing other sources of protein besides meat and beans , such as eggs , seafood , and soy products . separating dairy from the rest of the protein foods on myplate brings into question what exactly adairy foods include all 9 essential amino acids and contain highly bioavailable and digestible protein , making them protein foods , too . the protein foods group of myplate needs a food - based name . changing the name of the protein foods group to reflect the foods it contains may make it easier to communicate information about proper eating habits to a wider audience with a lack of knowledge about macronutrients . to improve the efficacy of myplate as a tool for consumer education , the information it communicates needs to be both evidence - based and easy for both professionals and lay audiences to understandgroup , the meat & beans group , would be an excellent place to start .\noutput:\n" }, { "from": "agent", "value": "changing the name of the protein foods group on the us department of agriculture s visual food guide , myplate , back to the meat & beans group would provide important clarification regarding us department of agriculture recommendations for a balanced diet . previous iterations of the food guide named the protein group after its constituent foods ( ie , the meat & beans group on the 2005 mypyramid ) , and the reasons for renaming the entire group with myplate are unclear . the exclusion of dairy foods from the protein foods group of the 2010 myplate illustrates the shortcomings of this group s name . dairy foods contain high - quality , affordable protein and constitute a significant portion of the protein intake among the us population but are not listed as protein foods on myplate . dairy products and other high - calcium foods do have their own section of myplate ; however , having this separate group does not mitigate the disingenuousness of having a protein group that excludes an important protein source . in addition , because consumers tend to understand food - based terms better than nutrient - based terms , a change to meat & beans group would also provide clarification for consumers and for educators regarding the content and role of this group ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: colorectal cancer ( crc ) is the third leading cause of cancer death in both male and female patients worldwide .1,2 stage iv cancer has a poor prognosis ,3 but patients with stage iii colon cancer who undergo radical surgery and standard adjuvant chemotherapy demonstrate a much better prognosis than those with stage iv cancer . colon cancer involves 6 months of folinic acid , fluorouracil , and oxaliplatin ( folfox ) or capecitabine and oxaliplatin ( capox ) in national comprehensive cancer network guidelines .4 on the other hand , the 2014 japanese society for cancer of the colon and rectum ( jsccr ) guidelines for the treatment of crc recommend the following adjuvant regimens : 6 months 5 - fluorouracil ( 5fu ) and leucovorin ( lv ) , tegafur / uracil + lv , capecitabine , folfox , and capox .5 the multicenter international study of oxaliplatin / 5 - fluorouracil / leucovorin in the adjuvant treatment of colon cancer study ( mosaic ) demonstrated that 6 months of adjuvant folfox treatment was associated with a significant increase in 6 - year overall survival in patients with stage iii colon cancer compared with lv5fu2 treatment .6,7 the national surgical adjuvant breast and bowel project c - 07 trials ( nsabp c - 07 ) also showed that adding oxaliplatin to 5fu significantly increased disease - free survival ( dfs ) in stage ii and iii colon cancer .8 the no16968 ( xelox in adjuvant colon cancer treatment ) study ( xeloxa ) demonstrated a statistically significant difference in 3 - year dfs using capox in the adjuvant treatment of stage iii colon cancer .9 the established administration period of adjuvant chemotherapy is 6 months based on the publication of two phase iii studies .10,11 in national comprehensive cancer network guidelines , 6 months of oxaliplatin - based chemotherapy is the standard adjuvant chemotherapy for completely resected stage iii crc .4 however , chau et al12 reported that the probability of 12 weeks of protracted venous infusion of 5fu being inferior to 6 months of bolus 5fu / lv was extremely low . dose - dependent oxaliplatin - induced peripheral neurotoxicity ( pn ) often develops and may become irreversible . therefore , optimal treatment duration of adjuvant therapy remains controversial . in mosaic , grade 3 peripheral sensory neuropathy ( psn ) during treatment was reported in 12.5 % in the folfox group and 0.2 % in the 5fu + lv ( lv5fu2 ) group .6,7 in nsabp c - 07 , grade 3/4 psn occurred in 8.4 % in the ( 5fu + lv + oxaliplatin ) flox group compared with 0.7 % in the 5fu + lv ( fulv ) group .8 in xeloxa , grade 3/4 psn occurred in 11 % of patients in the capox group versus 1 % in the 5fu / folic acid ( fa ) group .9 in mosaic , xeloxa , and nsabp c - 07 , 3 - year dfs ( % ) was 78.2 , 70.9 , and 76.1 , respectively , while the median dosage of oxaliplatin ( mg / m ) was 810 , 905 , and 677 , respectively .6,8,9 although the median dose of oxaliplatin in nsabp c - 07 was lower than that in mosaic or xeloxa , there was similarity in 3 - year dfs among mosaic , nsabp c - 07 , and xeloxa . the median dosage of oxaliplatin in nsabp c - 07 was equivalent to eight courses of folfox . five trials in the international duration evaluation of adjuvant chemotherapy have enrolled patients to test whether 3 months of oxaliplatin - based adjuvant therapy was noninferior for dfs to 6 months of the therapy in patients with stage iii colon cancer . according to the jsccr guidelines , 6 months of oxaliplatin - based adjuvant chemotherapy in stage iii colon cancer has not always been recommended .5 de gramont et al13 reported that the estimated incidence of grade 3 neuropathy calculated for patients exposed to folfox did not increase before five cycles . therefore , we set the duration of oxaliplatin treatment in this study to 3 months . in this study , we prospectively investigated the extent and degree of peripheral neuropathy in patients with stage iii and high - risk stage ii crc who underwent a sequential approach involving 3 months of an oxaliplatin - based regimen followed by 3 months of capecitabine , and verified the feasibility of the sequential regimen . the institutional review boards of all participating institutions in the japan southwest oncology group ( jswog ) approved the study protocol . we evaluated the frequency and grade of psn and peripheral motor neuropathy ( pmn ) in patients with r0 resected high - risk stage ii and stage iii crc . as for oxaliplatin - based chemotherapy , the rates of grade 3 psn at sixth and twelfth courses ( % ) were 4.16 and 12.4 in mosaic . nsabp c - 07 demonstrated that the rate of grade 3 psn was 8.4 % at the end of treatment . therefore , the expected incidence rate of grade 3 psn was assumed to be 4.16 % at the end of this sequential approach involving 3 months of an oxaliplatin - based regimen followed by 3 months of capecitabine . in order to detect at least one patient of grade 3 psn with a probability of 95 % , 73 patients would be required for the study to achieve the expected incidence rate of grade 3 psn . therefore , we decided that a total of at least 80 patients should be enrolled to account for exclusions from the analysis . this study was conducted in accordance with the declaration of helsinki and the ethical guidelines for clinical research revised in 2004 and was approved by the institutional review board of each participating hospital ( supplementary material ) . all patients who had no history of chemotherapy or radiotherapy , had histologically confirmed high - risk stage ii or stage iii according to the jsccr guidelines , and had an eastern cooperative oncology group performance status of 0 or 1 were eligible . high - risk features for stage ii were a high histological grade , lymphovascular or perineural invasion , a mucinous component , t4 stage , extramural vein invasion , symptomatic bowel obstruction or perforation at diagnosis , and removal of 12 lymph nodes . surgical resection was performed with the assurance of no residual disease , and postoperative adjuvant chemotherapy could start within 8 weeks after surgery . organ function was assessed as follows : white blood cell count , 3,00012,000 / mm ; neutrophil count , 1,500 / mm ; platelet count , 100,000 / mm ; total bilirubin , 2.0 mg / dl ; aspartate aminotransferase and alanine aminotransferase , 100 iu / l ; and serum creatinine , 1.5 mg / dl . patients with any of the following conditions were excluded : a history of severe drug allergy , clinically active multiple primary neoplasms , pregnancy , a history of crc , severe psn or pmn , uncontrolled hypertension , clinically significant cardiovascular disease , severe mental and neurological disorders , uncontrolled active infection , severe diarrhea , dementia , or uncontrolled diabetes mellitus . all patients enrolled in the study received an oxaliplatin - based regimen for 3 months : modified folfox ( mfolfox6 ) for six cycles or capox for four cycles , followed by capecitabine for four cycles ( figure 1 ) . the decision of whether to use mfolfox or capox was the choice of the physician . the study treatment was delayed if any of the following criteria were not met on the scheduled day of administration or the previous day : neutrophil count , 1,500 / mm ; platelet count , 75,000 / mm ; aspartate aminotransferase and alanine aminotransferase , 150 iu / l ; serum creatinine , 1.5 mg / dl ; total bilirubin , 2.0 mg / dl ; no diarrhea within 24 hours ; grade 01 stomatitis ; or grade 02 psn or pmn . if grade 3 or higher hematologic toxicity or nonhematologic toxicity occurred , the dose of oxaliplatin was reduced by two steps : 75 mg / m in the first step and 65 mg / m in the second step in the mfolfox regimen , and 100 mg / m in the first step and 85 mg / m in the second step in the capox regimen . for dose adjustment of 5fu in patients with grade 3 or higher hematologic toxicity or nonhematologic toxicity , the infusion dose was reduced by two steps : 2,000 mg / m in the first step and 1,600 mg / m in the second step . the bolus dose was also reduced in two steps in these patients : 300 mg / m in the first step and 200 mg / m in the second step . in the capox , capecitabine was reduced to 1,500 mg / m from the initial 2,000 mg / m and then to 1,000 mg / m . when the patient required a more than two - step dose reduction to recover from any adverse effect , adjuvant chemotherapy was terminated . hausheer et al14 have advocated the patient self - reported patient neurotoxicity questionnaire ( pnq ) as a new measurement to quantify symptoms and severity of chemotherapy - induced pn . pnq - oxaliplatin was used for measuring and evaluating neurotoxicity associated with patients receiving oxaliplatin . this questionnaire was filled out at baseline and at months 1.5 , 3 , and 6 after beginning adjuvant chemotherapy ( figure 2 ) . the grade of oxaliplatin - induced neurotoxicity was evaluated using the physician - based common terminology criteria for adverse events ( ctcae ) at every cycle of chemotherapy . regarding psn , grade 1 was asymptomatic : loss of deep tendon reflexes or paresthesia ; grade 2 was moderate symptoms : limiting instrumental activities of daily life ( adl ) ; grade 3 was severe symptoms : limiting self - care adl ; and grade 4 was life - threatening consequences : urgent intervention indicated in the ctcae . regarding pmn , grade 1 was asymptomatic : clinical or diagnostic observations only , intervention not indicated ; grade 3 was severe symptoms : limiting self - care adl , assistive device indicated in the ctcae ; and grade 2 and 4 were the same as psn . the pnq was distributed to the patient in the hospital while receiving chemotherapy and sent in an envelope to the jswog office within 1 week of completion . the primary objective of this study was to assess the frequency and degree of psn or pmn . the secondary end points were the proportion of patients who completed oxaliplatin - based therapy , the proportion who completed adjuvant chemotherapy , the proportion who underwent each treatment selection , dfs , adverse events , and comparison of efficacy and adverse events between folfox and capox . all statistical analyses were carried out using the statistical package for the social sciences software version 22.0 ( ibm corporation , armonk , ny , usa ) . the institutional review boards of all participating institutions in the japan southwest oncology group ( jswog ) approved the study protocol . we evaluated the frequency and grade of psn and peripheral motor neuropathy ( pmn ) in patients with r0 resected high - risk stage ii and stage iii crc . as for oxaliplatin - based chemotherapy , the rates of grade 3 psn at sixth and twelfth courses ( % ) were 4.16 and 12.4 in mosaic . nsabp c - 07 demonstrated that the rate of grade 3 psn was 8.4 % at the end of treatment . therefore , the expected incidence rate of grade 3 psn was assumed to be 4.16 % at the end of this sequential approach involving 3 months of an oxaliplatin - based regimen followed by 3 months of capecitabine . in order to detect at least one patient of grade 3 psn with a probability of 95 % , 73 patients would be required for the study to achieve the expected incidence rate of grade 3 psn . therefore , we decided that a total of at least 80 patients should be enrolled to account for exclusions from the analysis . this study was conducted in accordance with the declaration of helsinki and the ethical guidelines for clinical research revised in 2004 and was approved by the institutional review board of each participating hospital ( supplementary material ) . all patients who had no history of chemotherapy or radiotherapy , had histologically confirmed high - risk stage ii or stage iii according to the jsccr guidelines , and had an eastern cooperative oncology group performance status of 0 or 1 were eligible . high - risk features for stage ii were a high histological grade , lymphovascular or perineural invasion , a mucinous component , t4 stage , extramural vein invasion , symptomatic bowel obstruction or perforation at diagnosis , and removal of 12 lymph nodes . surgical resection was performed with the assurance of no residual disease , and postoperative adjuvant chemotherapy could start within 8 weeks after surgery . organ function was assessed as follows : white blood cell count , 3,00012,000 / mm ; neutrophil count , 1,500 / mm ; platelet count , 100,000 / mm ; total bilirubin , 2.0 mg / dl ; aspartate aminotransferase and alanine aminotransferase , 100 iu / l ; and serum creatinine , 1.5 mg / dl . patients with any of the following conditions were excluded : a history of severe drug allergy , clinically active multiple primary neoplasms , pregnancy , a history of crc , severe psn or pmn , uncontrolled hypertension , clinically significant cardiovascular disease , severe mental and neurological disorders , uncontrolled active infection , severe diarrhea , dementia , or uncontrolled diabetes mellitus . all patients enrolled in the study received an oxaliplatin - based regimen for 3 months : modified folfox ( mfolfox6 ) for six cycles or capox for four cycles , followed by capecitabine for four cycles ( figure 1 ) . the decision of whether to use mfolfox or capox was the choice of the physician . the study treatment was delayed if any of the following criteria were not met on the scheduled day of administration or the previous day : neutrophil count , 1,500 / mm ; platelet count , 75,000 / mm ; aspartate aminotransferase and alanine aminotransferase , 150 iu / l ; serum creatinine , 1.5 mg / dl ; total bilirubin , 2.0 mg / dl ; no diarrhea within 24 hours ; grade 01 stomatitis ; or grade 02 psn or pmn . if grade 3 or higher hematologic toxicity or nonhematologic toxicity occurred , the dose of oxaliplatin was reduced by two steps : 75 mg / m in the first step and 65 mg / m in the second step in the mfolfox regimen , and 100 mg / m in the first step and 85 mg / m in the second step in the capox regimen . for dose adjustment of 5fu in patients with grade 3 or higher hematologic toxicity or nonhematologic toxicity , the infusion dose was reduced by two steps : 2,000 mg / m in the first step and 1,600 mg / m in the second step . the bolus dose was also reduced in two steps in these patients : 300 mg / m in the first step and 200 mg / m in the second step . in the capox , capecitabine was reduced to 1,500 mg / m from the initial 2,000 mg / m and then to 1,000 mg / m . when the patient required a more than two - step dose reduction to recover from any adverse effect , adjuvant chemotherapy was terminated . hausheer et al14 have advocated the patient self - reported patient neurotoxicity questionnaire ( pnq ) as a new measurement to quantify symptoms and severity of chemotherapy - induced pn . pnq - oxaliplatin was used for measuring and evaluating neurotoxicity associated with patients receiving oxaliplatin . this questionnaire was filled out at baseline and at months 1.5 , 3 , and 6 after beginning adjuvant chemotherapy ( figure 2 ) . the grade of oxaliplatin - induced neurotoxicity was evaluated using the physician - based common terminology criteria for adverse events ( ctcae ) at every cycle of chemotherapy . regarding psn , grade 1 was asymptomatic : loss of deep tendon reflexes or paresthesia ; grade 2 was moderate symptoms : limiting instrumental activities of daily life ( adl ) ; grade 3 was severe symptoms : limiting self - care adl ; and grade 4 was life - threatening consequences : urgent intervention indicated in the ctcae . regarding pmn , grade 1 was asymptomatic : clinical or diagnostic observations only , intervention not indicated ; grade 3 was severe symptoms : limiting self - care adl , assistive device indicated in the ctcae ; and grade 2 and 4 were the same as psn . the pnq was distributed to the patient in the hospital while receiving chemotherapy and sent in an envelope to the jswog office within 1 week of completion . the primary objective of this study was to assess the frequency and degree of psn or pmn . the secondary end points were the proportion of patients who completed oxaliplatin - based therapy , the proportion who completed adjuvant chemotherapy , the proportion who underwent each treatment selection , dfs , adverse events , and comparison of efficacy and adverse events between folfox and capox . all statistical analyses were carried out using the statistical package for the social sciences software version 22.0 ( ibm corporation , armonk , ny , usa ) . in total , 91 patients from eleven hospitals were enrolled from march 2011 to december 2012 . two patients were excluded for not fulfilling the eligibility criteria , and three were excluded for refusing to continue treatment ( figure 3 ) . table 1 shows the characteristics of all eligible 86 patients . in the first half of the 6 - month adjuvant chemotherapy regimen ,30 patients received mfolfox ( median dose of oxaliplatin , 479 mg / m ) and 56 patients received capox ( median dose of oxaliplatin , 490 mg / m ) . overall , 83.7 % of patients completed the oxaliplatin - based therapy and 65.1 % of patients completed all treatments . there were no significant differences in the proportion of patients who completed mfolfox and those who completed capox ( table 2 ) . the most common grade 3 adverse events were neutropenia ( 9.3 % of all patients , 3.3 % of the mfolfox group , and 12.5 % of the capox group ) and diarrhea ( 8.1 % of all patients , 10.0 % of the mfolfox group , and 7.1 % of the capox group ) . other severe toxicities were increasing alanine aminotransferase concentration ( 5.8 % of all patients ) and anorexia ( 4.7 % of all patients ) . there was no significant difference in grade 3 hand - and - foot syndrome between the mfolfox group ( 3.3 % ) and the capox group ( 3.6 % ) . with respect to pn , grade 3 psn occurred in 3.5 % of all patients , 3.3 % of the mfolfox group , and 3.6 % of the capox group . grade 3 pmn occurred in 1.2 % of all patients , 0.0 % of the mfolfox group , and 1.8 % of the capox group showing a lower tendency than psn . in all - gradeadverse events , the mfolfox group suffered from anemia or oral mucositis more than the capox group with significant difference . the ctcae and pnq were used to compare the degree of neurotoxicity among the patients . figure 4 shows the frequency of neurotoxicity at four points : baseline and months 1.5 , 3 , and 6 after induction of adjuvant chemotherapy . the numbers of completed pnqs collected were 86 , 71 , 68 , and 53 at the four points from baseline to month 6 , while the numbers of completed ctcae evaluated by physicians were 86 , 75 , 68 , and 53 , respectively . the incidence of grade c or higher sensory neurotoxicity according to the pnq ( pnq - sensory ) gradually increased from 2.3 % to 11.3 % at month 1.5 , to 22.1 % at month 3 , and to 28.3 % at month 6 . conversely , the incidence of grade 2 sensory neurotoxicity according to the ctcae ( ctcae - sensory ) was 1.2 % , 5.3 % , 4.4 % , and 11.3 % from baseline to month 6 . the ctcae - sensory showed that the incidence remained low until month 3 and was markedly increased at month 6 . there was significant difference between the change of pnq - sensory and that of ctcae - sensory ( p = 0.042 ) . the incidence of motor neurotoxicity according to the pnq ( pnq - motor ) and ctcae ( ctcae - motor ) remained low from baseline to month 6 . we also studied the strength of the relationship between the pnq and ctcae using spearman s rank correlation coefficient . the correlation coefficient of the obtained data between the pnq - sensory and ctcae - sensory was 0.468 ( p 0.01 ) , while that between the pnq - motor and ctcae - motor was 0.127 ( p = 0.038 ) ( table 4 ) . in spearman s rank correlation coefficient , positive rs indicate positive linear association . moreover in graded interpretation , the rs ranged from 0.4 to 0.7 mean moderate correlation , while the rs ranged from 0.1 to 0.3 mean weak correlation . therefore , a positive correlation between the pnq - sensory and ctcae - sensory was suggested . the incidence of grade 1 or 2 psn during treatment was 77.9 % and decreased to 25.3 % at month 6 . conversely , the incidence of grade 3 psn during treatment was 3.5 % , but decreased to 0.0 % at month 6 ( figure 5 ) . moreover , we compared the transition of the pnq and ctcae at months 1.5 and 3 between patients in whom psn still remained at month 6 ( psn + ) and those in whom psn was not present at that time ( psn ) and analyzed the data ( figure 6 ) . there was no significant difference between these two groups of patients at month 1.5 , but there was a significant difference at month 3 in both pnq and ctcae . in the psn + group , the pnq had already reached nearly 50 % at month 3 despite a much lower incidence in the psn group at the same time point . the ctcae at month 3 also showed a significant difference between the psn + group and psn group . however , follow - up of this study is not complete yet . as shown in figure 7 , the results that we can make reference to at this stage are that 1 - year dfs was 91.6 % and that there was no difference between mfolfox and capox in 1 - year dfs . in total , 91 patients from eleven hospitals were enrolled from march 2011 to december 2012 . two patients were excluded for not fulfilling the eligibility criteria , and three were excluded for refusing to continue treatment ( figure 3 ) . in the first half of the 6 - month adjuvant chemotherapy regimen , 30 patients received mfolfox ( median dose of oxaliplatin , 479 mg / m ) and 56 patients received capox ( median dose of oxaliplatin , 490 mg / m ) . overall , 83.7 % of patients completed the oxaliplatin - based therapy and 65.1 % of patients completed all treatments . there were no significant differences in the proportion of patients who completed mfolfox and those who completed capox ( table 2 ) . the most common grade 3 adverse events were neutropenia ( 9.3 % of all patients , 3.3 % of the mfolfox group , and 12.5 % of the capox group ) and diarrhea ( 8.1 % of all patients , 10.0 % of the mfolfox group , and 7.1 % of the capox group ) . other severe toxicities were increasing alanine aminotransferase concentration ( 5.8 % of all patients ) and anorexia ( 4.7 % of all patients ) . there was no significant difference in grade 3 hand - and - foot syndrome between the mfolfox group ( 3.3 % ) and the capox group ( 3.6 % ) . with respect to pn , grade 3 psn occurred in 3.5 % of all patients , 3.3 % of the mfolfox group , and 3.6 % of the capox group . grade 3 pmn occurred in 1.2 % of all patients , 0.0 % of the mfolfox group , and 1.8 % of the capox group showing a lower tendency than psn . in all - gradeadverse events , the mfolfox group suffered from anemia or oral mucositis more than the capox group with significant difference . the ctcae and pnq were used to compare the degree of neurotoxicity among the patients . figure 4 shows the frequency of neurotoxicity at four points : baseline and months 1.5 , 3 , and 6 after induction of adjuvant chemotherapy . the numbers of completed pnqs collected were 86 , 71 , 68 , and 53 at the four points from baseline to month 6 , while the numbers of completed ctcae evaluated by physicians were 86 , 75 , 68 , and 53 , respectively . the incidence of grade c or higher sensory neurotoxicity according to the pnq ( pnq - sensory ) gradually increased from 2.3 % to 11.3 % at month 1.5 , to 22.1 % at month 3 , and to 28.3 % at month 6 . conversely , the incidence of grade 2 sensory neurotoxicity according to the ctcae ( ctcae - sensory ) was 1.2 % , 5.3 % , 4.4 % , and 11.3 % from baseline to month 6 . the ctcae - sensory showed that the incidence remained low until month 3 and was markedly increased at month 6 . there was significant difference between the change of pnq - sensory and that of ctcae - sensory ( p = 0.042 ) . the incidence of motor neurotoxicity according to the pnq ( pnq - motor ) and ctcae ( ctcae - motor ) remained low from baseline to month 6 . we also studied the strength of the relationship between the pnq and ctcae using spearman s rank correlation coefficient . the correlation coefficient of the obtained data between the pnq - sensory and ctcae - sensory was 0.468 ( p 0.01 ) , while that between the pnq - motor and ctcae - motor was 0.127 ( p = 0.038 ) ( table 4 ) . moreover in graded interpretation , the rs ranged from 0.4 to 0.7 mean moderate correlation , while the rs ranged from 0.1 to 0.3 mean weak correlation . therefore , a positive correlation between the pnq - sensory and ctcae - sensory was suggested . the incidence of grade 1 or 2 psn during treatment was 77.9 % and decreased to 25.3 % at month 6 . conversely , the incidence of grade 3 psn during treatment was 3.5 % , but decreased to 0.0 % at month 6 ( figure 5 ) . moreover , we compared the transition of the pnq and ctcae at months 1.5 and 3 between patients in whom psn still remained at month 6 ( psn + ) and those in whom psn was not present at that time ( psn ) and analyzed the data ( figure 6 ) . there was no significant difference between these two groups of patients at month 1.5 , but there was a significant difference at month 3 in both pnq and ctcae . in the psn + group , the pnq had already reached nearly 50 % at month 3 despite a much lower incidence in the psn group at the same time point . the ctcae at month 3 also showed a significant difference between the psn + group and psn group . dfs was one of secondary end points of this study . however , follow - up of this study is not complete yet . as shown in figure 7 , the results that we can make reference to at this stage are that 1 - year dfs was 91.6 % and that there was no difference between mfolfox and capox in 1 - year dfs . the incidence of neurotoxicity associated with oxaliplatin , including cold - related transient paresthesia or dysesthesia , is reportedly very high .15 in one study , the incidence of pn in oxaliplatin - based treatment was 18.2 % ( grade 3 ) .13 another randomized controlled trial reported pn rate of 9 % ( grade 3 ) .16 the incidence of grade 3 pn ( % ) was 12.4 in mosaic and 8.4 in nsabp c - 07.7,8 mosaic showed that the median dose of oxaliplatin was 810 mg / m. 6 in nsabp c - 07 , the median dose of oxaliplatin was 677 mg / m , with interquartile range from 320 to 763 mg / m. 8 namely , the median dosage of oxaliplatin in this study ( 479 mg / m ) was less than that of both studies .7,8 in the initial stage after induction , oxaliplatin - induced pn is reversible in some cases and subsides until the next administration of oxaliplatin . however , long - term oxaliplatin chemotherapy is associated with a possibility of marked worsening of pn . in mosaic , grade 1 , 2 , and 3 pn was observed in 11.9 % , 2.8 % , and 0.7 % of the patients examined , respectively , even at month 48.7 prevention of pn by calcium and magnesium infusions or goshajinkigan , a traditional japanese herbal medicine , was ineffective in two phase iii studies .17,18 the rates of grade 3 psn at the sixth and twelfth courses of chemotherapy were 4.16 % and 12.4 % , respectively , in mosaic . nsabp c - 07 showed that the rate of grade 3 psn was 8.4 % at the end of treatment .6,8 in this study , the proportion of grade 3 psn ( 3.3 % ) and pmn ( 1.2 % ) during treatment was lower than that previously reported at 6 months of adjuvant treatment . moreover , no patients had grade 3 psn at month 6 , while the incidence of psn was 1.3 % in mosaic at that time .5 therefore , a sequential approach involving 3 months of an oxaliplatin - based regimen followed by 3 months of capecitabine can be a safe treatment . correlation between pnq and ctcae by spearman s correlation coefficient demonstrated stronger correlation between pnq and ctcae in sensory neurotoxicity than that in motor neurotoxicity ( table 4 ) . the reason might be that oxaliplatin - induced pn appears as sensory neurotoxicity rather than motor neurotoxicity . the proportion of patients with more than grade c pn on the pnq - sensory began to increase at month 1.5 of treatment and continued to increase gradually until month 6 . however , the proportion of grade 2 on the ctcae - sensory hardly showed any difference until month 3 of treatment . a significant increase appeared for the first time at the 6 - month inquiry using the ctcae , which was the final assessment point . therefore , the pnq appears to detect oxaliplatin - induced neurotoxicity earlier than the ctcae . the pnq is an evaluation system to which the patient can voluntarily respond , while the ctcae is a different evaluation system to which the patient responds to the medical questions through the attending physician . this may mean that the pnq outcome is the result of an active response of the patient and the ctcae outcome is the result of a passive response . the proportion of patients with pn on the ctcae - sensory at month 6 was 11.3 % , while that on the pnq - sensory had already reached the same level at month 1.5 . on the other hand , figure 6 demonstrates that both the pnq and the ctcae showed significant differences between the psn + and psn groups at month 3 . therefore , both the pnq and ctcae at month 3 can assess whether continuation of oxaliplatin treatment is possible . in other words , consideration at the 3 - month point in oxaliplatin - based adjuvant chemotherapy should be crucial . moreover , the proportion in ctcae at 1.5 months in psn + group was found to be almost zero , whereas in psn group , the ctcae at 1.5 months was close to 10 % . that would be the reason why patients tend not to report their mild degree of psn to their physician . the results concerning dfs , one of the secondary study end points in this study , is still immature . as for 1 - year dfs , there is similarity among the results of mosaic , nsabp c - 07 , and this study .5,7 although the number of patients in this study was small , the present study results met the primary end point . a sequential approach involving 3 months of an oxaliplatin - based regimen followed by 3 months of capecitabine is a safe adjuvant treatment for crc . in addition , assessment of psn at month 3 with pnq and ctcae should provide useful information to prevent persistent psn after oxaliplatin - based adjuvant treatment .\noutput:\n" }, { "from": "agent", "value": "backgroundsix months of oxaliplatin - based chemotherapy is the standard adjuvant chemotherapy for completely resected stage iii colorectal cancer ( crc ) . also , patients with stage ii crc who are considered to be at high risk of disease recurrence often receive the same adjuvant chemotherapy treatment . we prospectively investigated the extent and degree of neuropathy suffered by stage iii and high - risk stage ii resectable crc patients who underwent sequential approach involving 3 months of an oxaliplatin - based regimen followed by 3 months of capecitabine.patients and methodspatients with completely resected stage iii and high - risk stage ii crc aged 20 years were eligible . patients were treated with folinic acid , fluorouracil , and oxaliplatin ( folfox ) or capecitabine and oxaliplatin ( capox ) for 3 months followed by capecitabine ( 2,500 mg / m2 on days 114 every 3 weeks ) for 3 months . primary end points were frequency and the grade of oxaliplatin - induced neurotoxicity as evaluated using the physician - based common terminology criteria for adverse events version 4.0 ( ctcae ) grading and the patient - based scale , self - reported patient neurotoxicity questionnaire.resultsninety - one patients were enrolled and 86 patients assessed . eighty - four percent of patients completed the planned oxaliplatin - based therapy for 3 months , and 63 % of patients completed all treatments for the full 6 months . overall incidences of grade 3 or 4 peripheral sensory or motor neuropathy according to the ctcae were 3.5 % and 1.2 % , respectively . regarding the peripheral sensory neuropathy , the proportion of patient neurotoxicity questionnaire ( grade c e ) and ctcae ( grade 24 ) at months 1.5 / 3/6 were 11.3 / 22.1 / 29.4 % and 5.3 / 4.4 / 11.3 % , respectively ( spearman correlation coefficient : 0.47 ) . conclusiona sequential approach to adjuvant chemotherapy with 3 months of an oxaliplatin - based regimen followed by 3 months of capecitabine was tolerated by patients and associated with a low incidence of neuropathy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: suicide is a leading cause of preventable deaths and it is among the top 20 leading causes of mortality globally for all ages . in the last 50 years , suicide rates have increased by 60 % worldwide while in india , in just last three decades there is 43 % increase . recent data suggest south india as one of the regions with highest suicide rates . current annual suicide rate in india is about 11/100 ,000 general population . in 2013 , 134,799 people committed suicide in india according to the statistics released by the national crime records bureau . every individual differs in suicide or suicide attempts due to diverse social and personal circumstances and biological predispositions . common psychosocial causes of attempted suicide in southeast asia includes problems in interpersonal relationships , family conflicts , domestic violence , academic failure , disappointment in love , recent bereavement , and other stressful life events . research reveals that 98 % of those who committed suicide may have suffered from some diagnosable mental disorder , especially adjustment disorder , depression , substance use disorders , and physical illness . to gain insight into the suicidal frame of mind , researchers have suggested analyzing national mortality statistics , psychological autopsies , nonfatal suicide attempts , and documents such as suicide notes . leenars stated that suicide notes are an invaluable starting point for assessing and predicting suicide and para suicidal behavior . subsequent methods , based on frederick 's analytical approach have used content , classification , and theoretical - conceptual analysis . content classification extracts explicit information from a suicide note , e.g. length of the message , words , and parts of speech . on the other hand , classification schemes use data such as age , sex , marital status , educational level , employment status , and mental disorder . it has been suggested that simple classification analysis has its limitations , but comparison of suicide note - writers with non - note - writers has consistently found no differences . study of suicide note may also have implication in developing strategies for future research in this area and strategies for prevention of suicide and suicide attempts . all suicide notes left behind by those who committed suicide between 2010 and 2013 , which were available with city crime record bureau , mysore , was included in the study . informed consent from family of deceased with permission from the commissioner of police was considered for study . the method of analysis was based on a disruptive study that included a collection of sociodemographic features . categorizing each note according to a scheme of four general categories : ( 1 ) addressee , ( 2 ) reasons stated , ( 3 ) specific content , and ( 4 ) general focus of note . addressee was further classified as ( 1 ) either parent ( 2 ) spouse ( 3 ) friend ( 4 ) media ( 5 ) others . a majority of suicide note was in age group of 1640 years ( 87 % ) and it ranged from 21 to 85 years [ table 1 ] . most were married ( 70 % ) and men ( 59 % ) [ table 2 ] . the majority ( 70 % ) in regional language kannada , three were written in mixture of kannada and english , two in english , and one in tamil . age group and number of individuals in each category gender and marital status of those who left suicide note the majority of suicide note was not addressed to any person in particular ( 55 % ) , others were addressed to relatives ( 36 % ) , spouse ( 18 % ) , and mother ( 13 % ) . four of them blamed self , two of them blamed husband , and seven have pointed some others . reasons for committing suicide has not been mentioned in one - fourth of suicide notes , marital issues has been mentioned in another one - fourth , one - third for other distressing situations , loss of dear ones and problems at workplace ( 14 % each ) , one has noted illness . contents of suicide notes shows an consistent theme that included apology / shame / guilt ( 90 % ) , love for those left behind ( 55 % ) , instruction regarding practical affairs ( 23 % ) , life too much to bear ( 14 % ) , hopelessness ( 14 % ) [ table 3 ] . in this study , 90 % of suicide notes contained the theme apology / shame / guilt which replicates finding from other studies from india and abroad . these themes suggests that the deceased individuals might have suffered from despair , depression and or an inability to consider possible alternative solutions , a constriction of the suicidal mind that can be treated by timely intervention involving supportive , cognitive therapies , and appropriate medications . apology / shame theme pervades the thinking of people contemplating suicide , it may present an opportunity for psychotherapeutic intervention . for example words pointing towards dilemma like , self - pity : story of a deceived girl from a hurt soul . frustration leading to anger at others was mentioned , for example all these who are the cause for me to take this extreme step should be imprisoned . they should suffer just as i did , for them to understand how badly they had hurt me . i hope this will bring an end to all the problems and also my sufferings if you win , you need not have to explainthere has been request to near and dear ones to consider the act as not that of shame . in one there is perceived sarcastic sense of relief from the account which states it 's a beautiful sunrise ! no more pain . studies have shown that suicide equally affects near and dear ones . in this study half of suicide notesthis can be important component to be incorporated into preventive strategies , so that the person can be made aware of the enduring suffering of those bereaved by suicide . understanding of all the content in suicide notes can be useful strategy as earlier research work shows no difference between those who left a suicide note and suicides without notes .23 % of the suicide notes give instructions regarding practical affairs , for example , one noted dear , pthere was two suicide note from elderly individuals , although it did not contain more details except one had just these words , association between theme burden to others and elderly suicides is of concern , it suggests the possibility of age related risk factors . elderly depressed people who perceive themselves to be a burden , such a perception may result from depressive thinking error which may be corrected if identified early . if these people had utilized competent problem solving skills and coping strategies they may not have reached such conclusions . indeed , it may be enough to assist suicidal people to recognize the underestimation of their own problem solving skills . the findings of this study lend support to leenars view that suicide notes are window to the mind of the deceased albeit sometimes the glass is translucent . scrutinies of suicide note themes in the light of previous research findings confirm the need for a biopsychosocial framework for suicide prevention . the major limitations to this study are that the available suicide notes were restricted to availability of suicide notes with mysore district police within specified time . the sample size was relatively small ; hence , it can not be generalized to larger population . the relatives of deceased were not interviewed in this study which would have added more comprehensive information about suicide and possible suicide prevention strategies . the major limitations to this study are that the available suicide notes were restricted to availability of suicide notes with mysore district police within specified time . the sample size was relatively small ; hence , it can not be generalized to larger population . the relatives of deceased were not interviewed in this study which would have added more comprehensive information about suicide and possible suicide prevention strategies . suicide notes provide valuable insight in study of suicide that can be incorporated in prevention strategies . if all suicide note are made available to scientific community , it may enhance current understanding about suicide . more focused research on suicide notes on wider population should be included to target prevention measures .\noutput:\n" }, { "from": "agent", "value": "background : suicide is one of the leading causes of preventable deaths . recent data suggest south india as one of the regions with highest suicide rates in the world . in 2013 , 134,799 people committed suicide in india according to the statistics released by the national crime records bureau . suicide note is one of the most important sources to understand suicide , which may be beneficial in suicide prevention . studies on suicidal notes from this part of the world are sparse.objective : the aim was to study the themes in suicide notes that might be useful in prevention strategies.materials and methods : a descriptive study of all suicide notes of those individuals who committed suicide between 2010 and 2013 available with police department , mysore district was obtained and analyzed.results : a total of 22 suicide note were available . a majority of suicide note was in age group of 1640 years ( 86 % ) and most were men ( 59 % ) . all suicide notes were handwritten , the majority ( 70 % ) in regional language kannada . length of notes varied from just few words to few pages . contents of suicide notes included apology / shame / guilt ( 80 % ) , love for those left behind ( 55 % ) and instruction regarding practical affairs ( 23 % ) . most have blamed none for the act ( 50 % ) . 23 % mentioned that they are committing suicide to prove their innocence . 32 % mentioned a last wish.conclusion : the majority of suicidal note contained guilt which is a strong indicator of possible depression in deceased . creating awareness about suicide among public and ensuring access to professionals trained in suicide prevention is need of the hour in this part of the world ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the world health organization ( who ) reported 9.27 million new cases of tb and 1.3 million tb - related deaths among human immunodeficiency syndrome ( hiv ) - negative populations in 2007 . in addition , the migration is expected to contribute to the spread of the disease in both industrialized and resource - poor countries . the disease especially appears in younger objects and generally involves the lungs in the immigrant populations from high - prevalence countries . central nervous system tb is the most destructive form of tb and is associated with high mortality rates up to 60 % and neurological sequel in 25 % of the survivors despite the new neuroimaging techniques and effective antituberculous therapy . with this report , we aimed to create awareness about tb especially its serious forms and complications among clinicians who deal with immigrants . a 14 - year - old child of an immigrant family , a native of azerbaijan who had been living in turkey for 10 years , presented to our clinic in september 2009 with complaints of fever , persistent headache and vomiting that lasted for 10 days . physical examination was normal except for neck rigidity , meningeal irritation sign and mild confusion . the emergent cranial computerized tomography ( ct ) without contrast on admission scan showed no pathological findings . the findings were : csf cell count , 57 / mm ; leukocyte ( 60 % lymphocyte ) , 18 / mm ; erythrocyte and glucose , 13 mg / dl ( simultaneous blood glucose 109 ) ; protein , 243 mg / dl . laboratory tests : wbc 12,300 / mm ; hemoglobin 11.7 g / dl ; crp 12 mg / dl ; anti - hiv antibody negative . on the same day , sudden loss of consciousness , bradycardia and hypotension developed and the patient was transferred to the intensive care unit ( icu ) . ceftriaxone and acyclovir therapy was started due to clinical deterioration , loss of consciousness and seizure on the same day . a negative herpes simplex virus ( hsv ) since the patient 's mother had a pulmonary tb history and her clinical condition did not improve , antituberculous therapy with four drugs and dexamethasone was started on the second day . then , the vital findings were found to have improved on the seventh day and she transferred to the infectious diseases ward . she was evaluated as stage iii and cranial magnetic resonance imaging ( mri ) , which was performed on the seventh day with gadolinium , showed multiple tuberculoma in the basal ganglions , cerebral and cerebellar hemispheres , basal meningitis and minimal hydrocephalus [ figure 1 ] . miliary pattern was detected in the thorax ct ( hrct ) [ figure 2 ] . csf polymerase chain reaction ( pcr ) for tb ( genexpert mtb - rif , cepheid , sunnyvale , ca , usa ) and quantiferon tb gold test ( cellestis , australia ) were positive on the third day . mycobacterium tuberculosis was isolated from the csf on the 21 day in loewenstein jensen ( l - j ) medium . during the hospitalization period , convulsion , hearing loss , aphasia and motor deficits developed and the patient was discharged from the hospital on the 34 day with neurological sequel ( aphasia , motor deficits , mild mental defect and hearing loss ) . she has been followed - up in our outpatient clinic ever since . a : multiple tuberculomas and basal meningitis b : hydocephalus in cranial imaging miliary pattern in high resolution computed tomographytuberculous meningoencephalitis ( tbm ) is the most severe , life - threatening form of tb and usually carries a subacute or chronic form . headache , vomiting , fever and neck rigidity are the most common complaints and findings . complaints of this case lasted for 10 days and , therefore , her disease was accepted as an acute / subacute form . on admission , there was no neurological deficit except confusion , but she was transferred to the icu with comatose mental status on the second day . there were some factors known as predictors of poor outcome , including extreme ages , stage of illness and hydrocephalus hosoglu and colleagues showed that drowsiness on admission is also an important predictor for neurological sequel . confusion of the case on admission was considered as a clue for poor outcome according to this report , and neurological sequel developing in the subsequent days supported this knowledge . the rate of tb history in the family or close contact with persons with active pulmonary tb is generally high in adult tbm patients in developing countries . in this case , living in poor socioeconomic conditions and crowded areas results in a high rate of positive family histories . positive family history , miliary tb , presence of hydrocephalus and multiple tuberculoma and younger age were predictive values for tbm . in addition to altered sensorium , these factors might be considered as poor prognostic factors in this case , which has clinical deterioration and neurological sequel . but , isolation of the agent may not be possible by this time - consuming process in every patient . antituberculous therapy ( att ) was started empirically on the second day in this case . however , quantiferon and tb pcr were positive on the third day while culture positivity in l - j medium was obtained on the 21 day . helpful diagnostic procedures like pcr or neuroradiological findings or presence of pulmonary tb may shorten this duration and provide early diagnostic advantages . basal meningitis and multiple tuberculoma were detected in cranial mri in this case , whereas urgent cranial ct scan was normal . indeed , a recent study mentioned the more diagnostic and more predictive facilities of mri for poor outcome in patients with tbm than ct . therefore , we suggest that clinicians should perform cranial mri and chest x - ray to detect radiological clues for tb or other helpful laboratory tests like pcr and quantiferon as soon as possible to shorten the diagnosis period . tuberculomas are the most common forms of central nervous system tb and comprise 534 % of all intracranial masses , which may be confused with other space - occupying lesions . they may be seen solitary , but multiple ones are more common . in this case , multiple tuberculomas that were noncaseating , located both in cerebral and cerebellar regions and sized less than 2 cm were detected in cranial mri . basal meningeal enhancement , hydrocephalus and basal ganglia infarctions consist of the common triad of neuroradiological findings . although early diagnostic procedures and follow - up ct were performed and steroid treatment was administered in the early stage , developing neurological sequel could not be prevented in this case . thus , we suggested that there may be other poor prognostic factors such as immune system of the patient . the detailed evaluation on admission and early diagnosis may contribute to the prevention of severe complications and death arising from delayed therapy in tbm , but this attitude is not valid every time and in all patients . tb is a global disease that travels in and between populations due to migration . in conclusion , physicians should be aware of central nervous system tb besides the pulmonary forms of tb in immigrant populations . detailed evaluation of these patients on admission may prevent poor outcomes of tbm related with delayed diagnosis and therapy .\noutput:\n" }, { "from": "agent", "value": "central nervous system tuberculosis ( tb ) is the most devastating manifestation of tb . it is a challenge for clinicians because of the difficulty in making an early diagnosis and the severe consequences of delayed treatment . the aim of this report is to point out the relation between migration and tb based on a 14 - year - old child with tuberculous meningoencephalitis ( tbm ) of an immigrant family . migration , crowded living conditions and positive family history contribute to the severe course of tb as tbm and miliary tb forms . tb control may prevent these severe manifestations of the disease among immigrants . prompt diagnosis with helpful early diagnostic tools like polymerase chain reaction in tbm is crucial due to the high mortality and morbidity ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: every year up to 3 million us pregnant women are affected by gestational diabetes mellitus ( gdm ) , diabetes mellitus during pregnancy , and it still has an increasing progress in pregnant women society . gdm has unfavorable effects on both mother and the baby which could be categorized into short term and long term morbidities . preeclampsia and delivery by cesarean section are the short term outcomes of gdm in mothers while hypoglycemia , excessive adiposity , shoulder dystocia , and macrosomia ( baby 's birth weight 8 pounds 13 ounces ( 4000 g ) ) are life threatening short term effects of gdm on newborns . in long term , both mother and the baby might face with difficulties including increased risk of obesity , cardiovascular diseases , and metabolic disorders such as type 2 diabetes mellitus . there are many papers which mention a 20 % higher risk of type 2 diabetes mellitus within nine years after delivery so the women with gdm needs more intervention for reducing future risk of type 2 diabetes mellitus . on the other hand , alteration in insulin resistance in gdm predisposes women to inflammation that causes increased level of inflammatory markers like high sensitive c - reactive protein ( hs - crp ) and fibrinogen . recently the role of the gut microbiota as a modulator of metabolic and inflammatory processes has been investigated . the gut microbiota is affected by many factors like antibiotic therapy , dietary patterns , weight loss , and pregnancy . intake of probiotics is a safe alternative for normalizing the gut microbiota . in 2002 , the joint fao ( food and agricultural organization of the united nations ) / who ( world health organization ) expert consultation was held and the latest definition for probiotics was reported as live microorganisms which , when administered in adequate amounts , confer health benefits on the host . the most important factors in efficacy of probiotics treatment in inflammatory and metabolic processes are genus and strains supplied in the probiotics . for example , some strains of lactic acid bacteria ( lab ) could modulate inflammatory and hypersensitivity process . vsl # 3 which was used as an intervention in this trial contained eight strains of lactic acid bacteria ( streptococcus thermophilus , bifidobacterium breve , bifidobacterium longum , bifidobacterium infantis , lactobacillus acidophilus , lactobacillus plantarum , lactobacillus paracasei , and lactobacillus delbrueckii subsp . this is the first time to investigate the effect of the specific probiotic on glycemic control and inflammatory status among the gdm subjects , although it has been previously used in other population groups . so far the exact mechanisms of probiotics in alteration of the gut microbiota are not known . in 2013 , a prospective , double - blind randomized controlled trial was conducted on pregnant women which were recruited during 2 years . as previously mentioned , the vsl # 3 probiotic has been used in other population groups to influence various blood parameters but has not yet been studied in a gdm population . therefore , a clinical trial was conducted in order to find the effects of this probiotics mixture on inflammatory markers and glycemic control in pregnant women with gdm . on the basis of the sample size formula suggested for the similar randomized clinical trials and considering types i and ii error of 5 % ( = 0.05 ) and 20 % ( = 0.2 ; power = 80 % ) , respectively , and serum insulin level as a key variable , we reached the sample size of 44 women for each group . of the 96 participants who were referred to tuba endocrine clinic ( sari , iran ) and assessed for study eligibility , 89 participants met inclusion criteria . all 89 consecutive patients diagnosed with gestational diabetes in our department from may 2014 until october 2015 were asked to participate in our study . among them , 82 agreed to participate and were randomly assigned by blocked randomization , at a ratio of 1 : 1 , to take vsl # 3 probiotic capsule ( n = 41 ) or placebo ( n = 41 ) . random assignment was done by using the random numbers generated by computer and a trained personnel at the endocrine clinic performed randomization . vsl # 3 is a freeze - dried pharmaceutical probiotic preparation containing 112.5109 cfu / capsule of eight strains of lactic acid bacteria ( streptococcus thermophilus , bifidobacterium breve , bifidobacterium longum , bifidobacterium infantis , lactobacillus acidophilus , lactobacillus plantarum , lactobacillus paracasei , and lactobacillus delbrueckii subsp . bulgaricus ) , microcrystalline cellulose , stearic acid , magnesium stearate , and vegetable capsule ( hydroxypropyl methylcellulose ) , silicon dioxide . identical - looking placebo capsules containing 40 mg microcrystalline cellulose were used for blinding . the capsules were stored at 2 to 8c prior to distribution and the subjects were instructed to refrigerate the capsules . gdm diagnosis will be based on the following criteria : 2 h , 75 g ogtt : fasting venous plasma glucose level , 5.5 mmoll or higher or 75 - g oral glucose tolerance test [ ogtt ] 2 - hour venous plasma glucose level , 8.0 mmoll or higher . exclusion criteria were an unwillingness to follow a prescribed diet , pre - gdm ( either type 1 or type 2 dm ) , the need for insulin treatment , and pregnancy comorbidities other than obesity , hypertension , and / or dyslipidemia . the study was approved by and performed under the guidelines of the research ethics committee of mazandaran university of medical sciences , iran , and a written consent was obtained from all subjects . the allocation of the intervention or control group was concealed from the researchers and the probiotic and placebo boxes had an identical appearance . neither the subjects nor the investigators were aware of the treatment assignments in this double - blinded study . ten days before the beginning of the trial , all patients refrained from eating yogurt or any other fermented foods or supplements . over 8wk , the intervention and placebo groups consumed probiotic and placebo capsules twice a day , respectively . all patients were asked , throughout the 8 - week trial , to maintain their usual dietary habits and lifestyle and to avoid consuming any bacteria supplement other than that provided to them by the researchers and any fermented foods . arrangements were made so that the patients would receive a 2 - week supply of their probiotic or placebo capsules every two weeks . information on food consumption , anthropometric measurements , and fasting blood samples were collected at the beginning and at the end of the trial . nutrient intakes during 3 d were estimated using a 24 - hour dietary recall at the beginning and at the end of the study . three - day averages of macronutrient and micronutrient intakes were analyzed by nutritionist 4 software ( first databank , hearst corp , san bruno , ca , usa ) . body weights were measured using a scale ( seca , hamburg , germany ) with 0.1 kg accuracy without shoes and with minimum clothing . heights were measured using a stadiometer ( seca ) with 0.1 cm accuracy without shoes . bmi was calculated by dividing body weight ( kilograms ) by height ( meters ) squared . blood samples were collected from the antecubital vein while fasting ( 12 - hour overnight fast ) to determine baseline glucose and insulin and then repeated after 8 weeks of treatment . the serum samples were separated from whole blood by centrifugation at 3500 rpm for 10 min ( avanti j - 25 , beckman , brea , ca , usa ) . fasting blood glucose was measured using the standard enzymatic method with a parsazmun kit ( karaj , iran ) . glycated hemoglobin ( hba1c ) was measured in the whole blood by cation exchange chromatography with a nycocard hba1c kit ( oslo , norway ) . insulin concentration was determined by a chemiluminescent immunoassay using a liaison analyzer ( diasorin , saluggia , italy ) . insulin resistance was assessed using the homeostatic model assessment of insulin resistance ( homa - ir ) formula . inflammatory parameters containing high - sensitivity c - reactive protein ( hs - crp ) and interleukin - 6 ( il - 6 ) were determined by the elisa technique using commercially available kits ( quantikine human , r & d systems , minneapolis , mn ) and interferon gamma ( ifn - ) , tumor necrosis factor - ( tnf - ) , and interleukin - 10 ( il - 10 ) levels were measured with an enzyme - linked immunosorbent assay kit ( ebioscience , san diego , california ) in accordance with the manufactures ' instructions . the present study was conducted according to the guidelines laid down in the declaration of helsinki and the protocol has been approved by the local ethics committee . the steering committee was established to monitor the trial . , chicago , il , usa ) computer software was used for the statistical analysis . student 's t - test and paired student 's t - test were used to compare values between baseline and the end of the study . there were two women in the study group and five in the control group who required insulin treatment because glycaemic goals were not reached with diet alone ; these individuals were excluded from the study . furthermore , two woman in the study group and one women in the control group were excluded because they delivered prematurely before 35 weeks of gestation . the final data analyses included 37 women treated with probiotic capsule and 35 treated with placebo ( figure 1 ) . the baseline characteristics ( age , height , bmi , prepregnancy weight , weight at baseline and end of trial , and oral glucose tolerance test values containing 1 h - 2 h and 3 h fasting glucose ) of the 72 evaluable patients in the two groups were similar and there were no significant differences in the intention to treat baseline characteristics between the two groups , as shown in table 1 . the dietary intake of macronutrients among participants which is shown in table 2 indicated that there were no significant differences in energy or macronutrient intake . in the other hands , participants dietary composition did not significantly change during the study period ( p 0.05 ) . with intention to treat analysis and after 8 wk of supplementation fpg , hba1c , homa - ir , and insulin levels remained unchanged in the probiotic and placebo group ( p 0.05 ) . the comparison between the two groups showed that there were no significant differences with some glycemic parameters containing fpg and hba1c ( p 0.05 ) , but there were significant differences in insulin levels and homa - ir which were calculated based on the power of 80 % and = 5 % ( 16.65.9 ; 3.71.5 , resp . ) there was a significant decrease in levels of il - 6 ( 3.810.7 ) , tnf - ( 3.101.1 ) , and hs - crp ( 4927.4924.6 ) . reductions in levels of ifn - g ( 19.2116.6 ) were not significant . no significant increase was observed in il - 10 ( 3.115.7 ) in the intervention group as compared with the control group after 8 wk ( p 0.05 ) ( table 3 ) . there are some data from studies , mostly animal studies , which suggest mechanisms whereby probiotics may improve glycemic control , insulin resistance , and inflammatory status . to the best of our knowledge , no study has evaluated the impact of vsl # 3 probiotics on inflammatory and glycemic status in patients with gdm . the present study suggests that supplementation with vsl # 3 with different subspecies of lactobacillus , bifidobacterium , and streptococcus may have a slight favorable effect on glycemic status . in the study , using the supplement product could not significantly affect fpg and hba1c but prevented the rise in serum insulin concentration and increase in insulin resistance . several studies on the effects of different strains of probiotics on glycemic status in patients with gdm have yielded inconsistent results . one study in finland was conducted to assess the efficacy of probiotic supplement in reducing the risk of gdm in pregnant women . in the study , 256 women were randomized in the first trimester of pregnancy to receive probiotic supplement ( lactobacillus rhamnosus atcc 53103 and bifidobacterium lactis bb - 12 ) , while the control group received placebo . it has been concluded that the probiotic intervention has a positive effect of glycemic status because blood glucose concentrations were the lowest in the women receiving the probiotic intervention . our results with regard to prevention of increased serum insulin concentration and development of insulin resistance are similar to those of asemi and colleagues , who showed that consumption of probiotic yogurt which was fermented with streptococcus thermophilus and lactobacillus bulgaricus and subsequently supplemented with bifidobacterium lactis bb - 12 and lactobacillus acidophilus la5 , for 9 weeks in the third trimester of pregnancy , prevented the increase in serum insulin levels and the development of insulin resistance . they showed that the probiotic yogurt could not significantly affect fpg , systolic and diastolic blood pressures compared with the conventional yogurt . in another study , the rate of gdm was significantly reduced to 13 % in women receiving specific probiotics . the results during the last trimester of pregnancy confirmed that blood glucose concentrations were statistically significantly the lowest in the probiotics group ; better glycemic status in intervention group was confirmed by the low insulin concentration and homeostasis model assessment , in addition to the reduced risk of elevated glucose concentration compared with the placebo group . the researchers implied that benefits achieved by probiotic intervention were maybe the result of direct effect of modulation of host metabolism by probiotics and indirect effect of modified gut microbiota composition . lindsay et al . in a double - blind , placebo - controlled trial assessed the impact of a probiotic intervention in pregnant women with an early pregnancy body mass index from 30.0 to 39.9 . the primary outcome was the change in fasting glucose between groups from preintervention to postintervention . no differences in primary and secondary outcome were detected between the study groups , which is in agreement with our results in regard to the primary outcome . in a recent study of 149 women with gdm , maternal fasting glucose decreased from preintervention to postintervention within both groups , but no difference in baseline - adjusted postintervention levels between intervention group with probiotic supplement subspecies lactobacillus salivarius ucc118 and placebo group was detected . the researchers described that the probiotic did not appear to have any beneficial glycemic effect or any improvement of pregnancy outcomes . one of the common points of these studies was to describe exact mechanism involved in the protective effects of probiotics which is unclear . inconsistent results of the effect of probiotics on glycemic status described above are maybe because of the strain - specificity of these microorganisms . every strain of probiotic has its own specific and unique local and systemic immunomodulatory effects which is because of the specific conditions associated with altered gut barrier function . another outcome of vsl # 3 supplementation in patients with gdm was an improvement in inflammatory status . as the inflammatory signalling pathways involved are causally linked to insulin resistance , it is speculated that improvement of inflammatory status could be contributed to diabetes control . the results of the study provide insight into the anti - inflammatory effects of probiotic supplements in patients with gestational diabetes . our results have shown that probiotic supplements significantly decreased il - 6 , tnf - , and hs - crp in the intervention group as compared with the control group . the reductions in ifn - g and the increase in il - 10 in the intervention group were not significant . the results were in close agreement with the results as assessed by matsuzaki et al . showing that lactobacillus casei significantly decreased plasma levels of glucose and proinflammatory cytokines ( such as il - 2 and ifn - ) in none - insulin - dependent diabetic mice after 16 weeks . showed that interleukin - 6 ( il - 6 ) was reduced while crp levels were elevated but the change was not statistically significant . showed that chewing gums ( with two strains : lactobacillus reuteri atcc 55730 and atcc pta 5289 ) significantly reduced tnf - level , although this did not have any significant effect on il - 6 level in healthy adults . mohamadshahi et al . also reported a significant decrease of serum levels of tnf - by using a probiotic yogurt enriched with bifidobacterium animalis subsp . in two separate studies with two different interventions ( probiotic and synbiotic ) in patients with type 2 diabetes reported that consumption of the probiotic yogurt appeared to attenuate low - grade inflammation by a significant decrease in sensitive crp levels in pregnant women . all of the above studies have suggested that using of different species of probiotics may lead to inhibition of production of various proinflammatory cytokines . however , there are some studies with inconsistent results in contrast with our study . considered a nonsignificant change of il - 6 and tnf - level in rheumatoid arthritis patients who take capsules of lactobacillus rhamnosus lc70536 . they showed that serum il - 1 beta increased slightly in the lgg group , but no differences were seen in il - 6 , tnf - alpha , mpo , il - 10 , or 1l - 12 . showed that the intake of probiotic yogurt for 9 weeks brought about a decrease in the serum hs - crp level but did not decrease tnf - concentration . the mechanism by which probiotic intake results in altered inflammatory and glycemic status is the gut microbiota . there are several studies which examined gut microbiota composition in diabetes or obesity on microbial flora . recent studies have shown that the association between gut bacteria can influence inflammatory state of patients through the component of the gram - negative bacterial cell walls , which is called popolysaccharide ( lps ) . this factor can trigger the inflammatory process by binding to the cd14 toll - like receptor - 4 ( tlr - 4 ) complex . it is confirmed that deletion of tlr - 4 can prevent the high - fat diet - induced insulin resistance . considered a decline in tnf - concentration by lactobacillus hy and they declared that it may be because of the inhibition of trinitrobenzene sulfonic acid and consequently inhibition of tnf - gene expression . another mechanism for anti - inflammatory effect of probiotics is through nf - k signalling pathway . in a study , bifidobacterium longum decreased tnf - concentration by suppressing nf - k activation of lamina propria mononuclear cells which will lead to downregulation of tnf - production . therefore , the mechanism of probiotics in gdm could be summarized as altering the properties and profile of gut microbiota to a balanced situation which will lead to an improvement of intestinal permeability function and to a regulated concentration of proinflammatory mediators . however , because of the diversity of human gut microbiota and because of the strain - specificity and multifunctionality of various species of probiotic , it is essential to clarify the complex mechanisms of action that contribute to the effects of probiotics intakes on secretion of proinflammatory mediators , which are only lately being unraveled . the duration of the intervention was 8 weeks and we were unable to administer the supplement for a longer period due to budget limitations . the small sample size for detecting the difference in the primary outcomes is another limitation . according to the results of this trial , clear differences in glycemic status and especially inflammatory mediators are revealed in this study . but we can not draw any firm conclusion about using probiotics in health improvement profile of gdm patients , clinically . future studies and further randomized trials of probiotics on pregnancy outcomes are suggested to fully elucidate the potential effects of probiotics in gdm patients .\noutput:\n" }, { "from": "agent", "value": "objective . this trial aims to examine the effects of a probiotic mixture ( vsl # 3 ) on glycemic status and inflammatory markers , in women with gdm . materials and methods . over a period of 8 weeks , 82 women with gestational diabetes were randomly assigned to either an intervention group ( n = 41 ) which were given vsl # 3 capsule or to a control group which were given placebo capsule ( n = 41 ) . fasting plasma glucose , homeostatic model assessment of insulin resistance , glycosylated hemoglobin , high - sensitivity c - reactive protein , tumor necrosis factor - , interleukin - 6 , interferon gamma , and interleukin - 10 were measured before and after the intervention . results . after 8 wk of supplementation fpg , hba1c , homa - ir , and insulin levels remained unchanged in the probiotic and placebo groups . the comparison between the two groups showed no significant differences with fpg and hba1c , but there were significant differences in insulin levels and homa - ir ( 16.6 5.9 ; 3.7 1.5 , resp . ) . unlike the levels of ifn - g ( 19.21 16.6 ) , there was a significant decrease in levels of il - 6 ( 3.81 0.7 ) , tnf - ( 3.10 1.1 ) , and hs - crp ( 4927.4 924.6 ) . no significant increase was observed in il - 10 ( 3.11 5.7 ) in the intervention group as compared with the control group . conclusions . in women with gdm , supplementation with probiotics ( vsl # 3 ) may help to modulate some inflammatory markers and may have benefits on glycemic control ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: for the protekt us study , isolates of s. pneumoniae were collected from across the united states from 2000 to 2003 . the numbers of collection centers that provided samples were 207 in year 1 ( 20002001 ) , 241 in year 2 ( 20012002 ) , and 247 in year 3 ( 20022003 ) . pathogenic respiratory tract isolates of s. pneumoniae were collected from adult and pediatric outpatients with community - acquired respiratory tract infections ( acute otitis media , pneumonia , acute exacerbations of chronic bronchitis , acute exacerbations of chronic obstructive pulmonary disease , and sinusitis ) . also included were isolates cultured from material collected from hospitalized patients within 48 hours of admission . the following sources were considered acceptable : cultures from blood , sputum , bronchoalveolar lavage , middle - ear fluid ( collected by tympanocentesis ) , nasopharyngeal swab or aspirate , and sinus aspirate . duplicate strains , or strains originating from existing collections , were also not included in the study . demographic data collected included the age and sex of the patient , infection , culture source , inpatient versus outpatient status , specimen accession number , and date of sample collection . details of the methods for isolate storage , transportation , and identification have been reported previously ( 23 ) . mics were determined at a central laboratory ( cmi , portland , or , usa ) by using the clinical and laboratory standards institute ( clsi ) broth microdilution method ( 24 ) . the following antibacterial agents were tested : amoxicillin - clavulanate ( amoxicillin alone was not tested ; however , susceptibility can be extrapolated from the amoxicillin - clavulanate results ) , azithromycin , cefuroxime , clarithromycin , clindamycin , co - trimoxazole , erythromycin , levofloxacin , linezolid , penicillin , telithromycin , and tetracycline . in all cases , susceptibility to telithromycin was determined by using the clsi breakpoints ( 25 ) : susceptible 1 g / ml ; intermediate 2 g / ml ; resistant 4 g / ml . all erythromycin - resistant ( mic 1 g / ml ) pneumococcal isolates collected from protekt us years13 were analyzed for the presence of erm ( b ) , erm ( a ) subclass erm ( tr ) , and mef ( a ) macrolide resistance genes . isolates in year 1 were analyzed by multiplex rapid - cycle polymerase chain reaction ( pcr ) with microwell - format probe hybridization , as described previously ( 26 ) . in years 2 and 3 , isolates were analyzed by using a multiplex taqman ( applied biosystems , foster city , ca , usa ) pcr assay that was validated against the previous pcr method ( 27 ) . a proportion of dual erm ( b ) + mef ( a ) macrolide - resistant isolates underwent serotyping and multilocus sequence type ( mlst ) determination at g.r . micro ltd ( london , uk ) . isolates were serotyped by using antisera from the statens serum institute ( ssi , copenhagen , denmark ) . serotyping and mlst determination were also conducted on 366/378 dual erm ( b ) + mef ( a ) macrolide - resistant s. pneumoniae isolates , respectively , collected from the global protekt study ( 19992003 ) . sequence type ( st ) and alleles were analyzed by upgma ( unweighted pair group method with arithmetic mean ) and burst ( based upon related sts ) analysis by using the start program ( version 1.0.5 ) to assign lineage and clonal complexes . from 2000 to 2003 , a total of 31,001 s. pneumoniae isolates were collected as part of the protekt us study : 10,103 in year 1 , 10,012 in year 2 , and 10,886 in year 3 . the proportion of s. pneumoniae isolates resistant to erythromycin was similar across years 1 , 2 , and 3 of the protekt us study ( 29.4 % overall ) . the prevalence of mef ( a ) in macrolide - resistant isolates decreased from 68.8 % in year 1 to 67.3 % in year 2 and to 63.9 % in year 3 , while the prevalence of erm ( b ) alone appeared stable ( 16.9 % in year 1 , 16.5 % in year 2 , 16.5 % in year 3 ) . by contrast , an increase was seen in the prevalence of macrolide - resistant strains carrying both erm ( b ) and mef ( a ) genes ; by year 3 , 16.4 % of isolates were of this genotype ( table 1 ) . when considered as a proportion of all s. pneumoniae isolates collected in year 3 , a total of 520 ( 4.8 % ) of 10,886 were positive for both erm ( b ) and mef ( a ) . * north - central = illinois , iowa , kansas , minnesota , missouri , nebraska , north dakota , south dakota , wisconsin ; northeast = connecticut , delaware , indiana , maryland , massachusetts , michigan , new jersey , new york , ohio , pennsylvania , rhode island , vermont , washington dc ; northwest = alaska , idaho , montana , oregon , washington , wyoming ; south - central = alabama , arkansas , louisiana , oklahoma , tennessee , texas ; southeast = florida , georgia , kentucky , north carolina , puerto rico , south carolina , virginia , west virginia ; southwest = arizona , california , colorado , nevada , new mexico , utah . geographic differences were observed in the prevalence of erm ( b ) + mef ( a ) encoded resistance across the united states , from 10.3 % in the southeast to 23.9 % in the north - central region ( year 3 ) . the prevalence of this genotype increased in all regions between years 1 and 3 ( table 1 ) . the largest increases in erm ( b ) + mef ( a ) - encoded resistance during the 3 - year study period occurred in isolates collected from pediatric patients ( table 2 ) . by year 3 , isolates exhibiting this genotype made up 254 ( 22.7 % ) of 1,119 isolates obtained from pediatric patients ( 14 years of age ) compared with 98 ( 12.3 % ) of 794 isolates collected from patients 64 years of age . patients in the 0 - to 2 - year age group had the highest prevalence ( 23.9 % ) of dual erm ( b ) + mef ( a ) resistance ( table 2 ) . across the 3 - year study period , the dual erm ( b ) + mef ( a ) genotypewas found most frequently in isolates collected from the ear or middle - ear fluid ( table 3 ) . in year 3 , the prevalence of this form of macrolide resistance was 30 % in isolates collected from either of these sources . by contrast , isolates cultured from blood samples had the lowest proportion of dual erm ( b ) + mef ( a ) - encoded resistance ( 92 [ 4.6 % ] of 2,014 isolates in the 3 years ) . * bal , bronchoalveolar lavage ; csf , cerebrospinal fluid ; mef , middle - ear fluid ; nap , nasopharyngeal swab or aspirate ; , no isolates collected . in addition to exhibiting almost universal resistance to the macrolides tested ( azithromycin , clarithromycin , erythromycin ) , isolates carrying both erm ( b ) and mef ( a ) were highly resistant ( 90 % ) to penicillin , cefuroxime , tetracycline , and co - trimoxazole ( table 4 ) . resistance to amoxicillin - clavulanate ( and hence amoxicillin ) was also common in these isolates ( table 4 ) , and the longitudinal data showed that the rate of resistance to this antibacterial drug increased from 29.9 % to 43.9 % from year 1 to year 3 . almost all ( 1,150 [ 99.2 % ] of 1,159 ) of the erm ( b ) + mef ( a ) isolates were multidrug - resistant ( i.e. , resistant to 2 classes of antibacterial drugs ) . * susceptibility was defined according to clinical and laboratory standards institute interpretive criteria ( 25 ) . amoxicillin alone was not tested ; however , susceptibility can be extrapolated from the amoxicillin - clavulanate results . a total of 16 ( 1.4 % ) of the 1,159 dual erm ( b ) + mef ( a ) isolates collected were resistant to levofloxacin ; mic values for these were as follows : 8 g / ml ( 2 isolates ) , 16 g / ml ( 9 isolates ) , 32 g / ml ( 4 isolates ) , and 128 g / ml ( 1 isolate ) . one dual erm ( b ) + mef ( a ) isolate ( 0.1 % of the total ) was resistant to telithromycin ( mic 4 g / ml ) . the results of mlst determination on 518 s. pneumoniae isolates ( 366 from protekt global [ including 35 from the united states ] and 152 from protekt us ) with dual erm ( b ) + mef ( a ) encoded resistance showed 82 st variants ( figure ) . of these ,21 were in the mlst database , and 61 were submitted to the database and assigned a new st ( sts 14071467 ) . all of the unique sts were serotyped and , together with the 20 s. pneumoniae clones listed by the pneumococcal molecular epidemiology network ( 29 ) , were analyzed for clonal relatedness by using upgma and burst ( figure ) . both the serotype distribution and range of mlsts in these isolates were limited ( table 5 ) , with 3 clonal complexes predominating . a phylogenetic analysis of these variations showed that 45 of the 82 sts were closely related , either serotype 19f or 19a ( table 5 ) . these strains were of ancestral st 271 and hence were designated clonal complex ( cc ) 271 , which is equivalent to cc i ( 15 ) and cc 236 ( 22 ) . overall , 305 ( 83.3 % ) of 366 global isolates had mlst profiles consistent with this clone ( table 6 ) . phylogenetic relationships of the 82 different sequence type variations found in 518 streptococcus pneumoniae isolates with combined erm ( b ) - and mef ( a ) - mediated macrolide resistance collected during the protekt global study ( 19992003 , n = 366 ) and the protekt us study ( 20002003 , n = 152 ) compared with the 20 pmen ( pneumococcal molecular epidemiology network ) clones . sequence type 236 was previously described as cc 236 by ko and song ( 22 ) but is described as cc 271 in this study based on burst analysis . * no clonal lineage found except for 2 isolates ( st 1467 ) and 1 isolate ( st 1452 ) , which were clonally related ( cc 1467 ) .8 isolates were clonally related ( st 1426 ) . of the 35 isolates collected in the united states from the protekt global study , all exhibited mlst profiles and serotypes characteristic of cc 271 ( table 6 ) . moreover , analysis of a geographically and chronologically varied sample of 152 s. pneumoniae isolates with dual erm ( b ) + mef ( a ) encoded resistance collected from the protekt us study suggested that 90 % of dual - resistant isolates in the united states belong to cc 271 . from 2000 to 2003 , a total of 31,001 s. pneumoniae isolates were collected as part of the protekt us study : 10,103 in year 1 , 10,012 in year 2 , and 10,886 in year 3 . the proportion of s. pneumoniae isolates resistant to erythromycin was similar across years 1 , 2 , and 3 of the protekt us study ( 29.4 % overall ) . the prevalence of mef ( a ) in macrolide - resistant isolates decreased from 68.8 % in year 1 to 67.3 % in year 2 and to 63.9 % in year 3 , while the prevalence of erm ( b ) alone appeared stable ( 16.9 % in year 1 , 16.5 % in year 2 , 16.5 % in year 3 ) . by contrast , an increase was seen in the prevalence of macrolide - resistant strains carrying both erm ( b ) and mef ( a ) genes ; by year 3 , 16.4 % of isolates were of this genotype ( table 1 ) . when considered as a proportion of all s. pneumoniae isolates collected in year 3 , a total of 520 ( 4.8 % ) of 10,886 were positive for both erm ( b ) and mef ( a ) . * north - central = illinois , iowa , kansas , minnesota , missouri , nebraska , north dakota , south dakota , wisconsin ; northeast = connecticut , delaware , indiana , maryland , massachusetts , michigan , new jersey , new york , ohio , pennsylvania , rhode island , vermont , washington dc ; northwest = alaska , idaho , montana , oregon , washington , wyoming ; south - central = alabama , arkansas , louisiana , oklahoma , tennessee , texas ; southeast = florida , georgia , kentucky , north carolina , puerto rico , south carolina , virginia , west virginia ; southwest = arizona , california , colorado , nevada , new mexico , utah . geographic differences were observed in the prevalence of erm ( b ) + mef ( a ) encoded resistance across the united states , from 10.3 % in the southeast to 23.9 % in the north - central region ( year 3 ) . the prevalence of this genotype increased in all regions between years 1 and 3 ( table 1 ) . the largest increases in erm ( b ) + mef ( a ) - encoded resistance during the 3 - year study period occurred in isolates collected from pediatric patients ( table 2 ) . by year 3 , isolates exhibiting this genotype made up 254 ( 22.7 % ) of 1,119 isolates obtained from pediatric patients ( 14 years of age ) compared with 98 ( 12.3 % ) of 794 isolates collected from patients 64 years of age . patients in the 0 - to 2 - year age group had the highest prevalence ( 23.9 % ) of dual erm ( b ) + mef ( a ) resistance ( table 2 ) . across the 3 - year study period , the dual erm ( b ) + mef ( a ) genotypewas found most frequently in isolates collected from the ear or middle - ear fluid ( table 3 ) . in year 3 , the prevalence of this form of macrolide resistance was 30 % in isolates collected from either of these sources . by contrast , isolates cultured from blood samples had the lowest proportion of dual erm ( b ) + mef ( a ) - encoded resistance ( 92 [ 4.6 % ] of 2,014 isolates in the 3 years ) . * bal , bronchoalveolar lavage ; csf , cerebrospinal fluid ; mef , middle - ear fluid ; nap , nasopharyngeal swab or aspirate ; , no isolates collected . in addition to exhibiting almost universal resistance to the macrolides tested ( azithromycin , clarithromycin , erythromycin ) , isolates carrying both erm ( b ) and mef ( a ) were highly resistant ( 90 % ) to penicillin , cefuroxime , tetracycline , and co - trimoxazole ( table 4 ) . resistance to amoxicillin - clavulanate ( and hence amoxicillin ) was also common in these isolates ( table 4 ) , and the longitudinal data showed that the rate of resistance to this antibacterial drug increased from 29.9 % to 43.9 % from year 1 to year 3 . almost all ( 1,150 [ 99.2 % ] of 1,159 ) of the erm ( b ) + mef ( a ) isolates were multidrug - resistant ( i.e. , resistant to 2 classes of antibacterial drugs ) . * susceptibility was defined according to clinical and laboratory standards institute interpretive criteria ( 25 ) . amoxicillin alone was not tested ; however , susceptibility can be extrapolated from the amoxicillin - clavulanate results . a total of 16 ( 1.4 % ) of the 1,159 dual erm ( b ) + mef ( a ) isolates collected were resistant to levofloxacin ; mic values for these were as follows : 8 g / ml ( 2 isolates ) , 16 g / ml ( 9 isolates ) , 32 g / ml ( 4 isolates ) , and 128 g / ml ( 1 isolate ) . one dual erm ( b ) + mef ( a ) isolate ( 0.1 % of the total ) was resistant to telithromycin ( mic 4 g / ml ) . the results of mlst determination on 518 s. pneumoniae isolates ( 366 from protekt global [ including 35 from the united states ] and 152 from protekt us ) with dual erm ( b ) + mef ( a ) encoded resistance showed 82 st variants ( figure ) . of these , 21 were in the mlst database , and 61 were submitted to the database and assigned a new st ( sts 14071467 ) . all of the unique sts were serotyped and , together with the 20 s. pneumoniae clones listed by the pneumococcal molecular epidemiology network ( 29 ) , were analyzed for clonal relatedness by using upgma and burst ( figure ) . both the serotype distribution and range of mlsts in these isolates were limited ( table 5 ) , with 3 clonal complexes predominating . a phylogenetic analysis of these variations showed that 45 of the 82 sts were closely related , either serotype 19f or 19a ( table 5 ) . these strains were of ancestral st 271 and hence were designated clonal complex ( cc ) 271 , which is equivalent to cc i ( 15 ) and cc 236 ( 22 ) . overall , 305 ( 83.3 % ) of 366 global isolates had mlst profiles consistent with this clone ( table 6 ) . phylogenetic relationships of the 82 different sequence type variations found in 518 streptococcus pneumoniae isolates with combined erm ( b ) - and mef ( a ) - mediated macrolide resistance collected during the protekt global study ( 19992003 , n = 366 ) and the protekt us study ( 20002003 , n = 152 ) compared with the 20 pmen ( pneumococcal molecular epidemiology network ) clones . * pmen , pneumococcal molecular epidemiology network ; nt , nontypeable . sequence type 236 was previously described as cc 236 by ko and song ( 22 ) but is described as cc 271 in this study based on burst analysis . * no clonal lineage found except for 2 isolates ( st 1467 ) and 1 isolate ( st 1452 ) , which were clonally related ( cc 1467 ) . of the 35 isolates collected in the united states from the protekt global study , all exhibited mlst profiles and serotypes characteristic of cc 271 ( table 6 ) . moreover , analysis of a geographically and chronologically varied sample of 152 s. pneumoniae isolates with dual erm ( b ) + mef ( a ) encoded resistance collected from the protekt us study suggested that 90 % of dual - resistant isolates in the united states belong to cc 271 . pneumococcal macrolide resistance in the united states is predominantly mediated by the mef ( a ) gene , which encodes for lower - level , efflux - mediated resistance ( 14 ) . however , the latest surveillance data from protekt us presented in this article show that the prevalence of this form of resistance is decreasing . this trend coincides with the emergence of multidrug - resistant clones of s. pneumoniae that express both erm ( b ) and mef ( a ) . these strains increased in prevalence from 9.7 % of macrolide - resistant isolates in 20002001 to 16.4 % in 20022003 . moreover , geographic data indicate that dual erm ( b ) + mef ( a ) isolates are currently even more prevalent in some regions of the united states ( accounting for 20 % of macrolide - resistant strains ) . by 20022003 , s. pneumoniae strains with this dual mechanism of resistance made up almost 5 % of all isolates collected . the major clinical implication of the present report is the increased potential for treatment failure with most antibacterial drugs currently recommended to empirically treat community - acquired respiratory tract infections ( 30,31 ) . ear isolates are more prone to represent treatment failure , and blood isolates represent primary infection ; thus , the dramatic increase in cc 271 in ear isolates compared to blood isolates ( table 2 ) is noteworthy . almost all dual erm ( b ) + mef ( a ) isolates were highly resistant to multiple antibacterial drugs , including penicillin , macrolides , tetracycline , and co - trimoxazole . . furthermore , resistance to amoxicillin - clavulanate ( and hence amoxicillin ) increased in these isolates from 29.9 % to 43.9 % during the 3 - year surveillance period , which raises concerns about the potential selection of resistant isolates through widespread use of this agent for community - acquired infections , particularly acute otitis media . the prevalence of resistance to fluoroquinolones , such as levofloxacin , was low ( 1.4 % overall ) in the dual erm ( b ) + mef ( a ) isolates ; however , when present , this resistance was often high ( mic 8128 g / ml ) . telithromycin resistance was rare ( 0.1 % ) in s. pneumoniae isolates with dual erm ( b ) + mef ( a ) encoded macrolide resistance . previous studies have indicated that a small number of clonal groups account for most penicillin - , macrolide - , and multidrug - resistant s. pneumoniae in the united states ( 18,32 ) . the mlst analysis conducted in the present study shows that the dual erm ( b ) + mef ( a ) macrolide - resistant s. pneumoniae isolates collected in the united states from 1999 to 2003 are associated with 3 major global clones , in addition to a wide variety of other mlst variations . most of these isolates belong to 1 major clonal group ; the genotypic profile and serotype distribution of this predominant group show that it is highly related to an international erm ( b ) + mef ( a ) clonal strain , taiwan - 14 , first found in the far east ( 22 ) . the designation of clonal groups is determined by burst analysis , which assigns ancestral lineage by the most common st . for this reason , the pneumococcal clone designated cc 271 in the present study was named cc 236 in the study by ko and song ( 22 ) . to avoid confusion , a common cc nomenclature ( such as the original designation of the clone , ccthe pneumococcal clone discussed in this paper was previously identified in the first year ( 19992000 ) of the protekt global study ( 15 ) . the most recent data from this survey , which covered the period 19992003 , confirm that this clone now has a worldwide distribution , with particularly high incidences in south africa and south korea , as reported in previous studies ( 15,19,21 ) . strains carrying both genes have also been recorded recently in new zealand ( 33 ) , canada ( 34 ) , italy ( 35 ) , and scotland ( 36 ) . together with the regional genotyping data , the epidemiologic analyses we describe show that this multidrug - resistant cc 271 is now widespread and increasing in prevalence across the united states . the widespread emergence of the erm ( b ) + mef ( a ) genotype into varying lineages at the apparent expense of strains expressing only 1 resistance determinant suggests that s. pneumoniae carrying this form of resistance has an evolutionary advantage . since dual resistant isolates have drug mics similar to those observed in strains harboring erm ( b ) alone , such an advantage can not be explained on the basis of increased macrolide resistance alone . this clone has previously been shown to contain 2 mobile genetic elements , tn1545 and \" mega \" ( 15 ) . while the erm ( b ) gene is most often present on tn1545 , \" mega \" is known to contain the mef ( e ) variant of mef ( a ) , and this variant has been shown to be present in cc 271 ( 15 ) . hence , acquisition of 2 mobile genetic elements and associated resistance genes is a possible explanation for the successful emergence of this clone over isolates with only erm ( b ) or mef ( a ) ; it is not solely the acquisition of the efflux or methylase gene but the associated resistance genes on the genetic elements that lead to a multidrug - resistant clone in which prevalence is driven by greater environmental pressures . of particular concern is the finding that dual erm ( b ) + mef ( a ) encoded resistance was most prevalent in isolates collected from pediatric patients . by year 3 of the study , 8.7 % of all s. pneumoniae isolates collected from children 14 years of age and 10.7 % of those collected from children 2 years of age exhibited this form of macrolide resistance . the introduction of the 7 - valent pneumococcal vaccine ( pcv7 ) in 2000 was aimed primarily at reducing the incidence of disease in this vulnerable group . while recent evidence suggests that this reduction has occurred ( 37,38 ) , the vaccine does not provide coverage against all s. pneumoniae serotypes . as discussed above , most dual erm ( b ) + mef ( a ) isolates characterized in this study are of serotype 19a ( the prevalence of which increased from years 1 to 3 ) or 19f . although serotype 19f is represented in the pcv7 vaccine , it affords low levels of protection against upper respiratory infections such as otitis media ( 39 ) and has been shown recently to be the least immunogenic of the vaccine serotypes ( 40 ) . the trends reported in this article indicate that the introduction of routine immunization has not prevented the spread of this nonvaccine serotype multidrug - resistant clone in the pediatric population and may have contributed to the selection of serotype 19a strains . in summary , although pneumococcal macrolide resistance rates appear to have stabilized in the united states , prevalence of clonal isolates with the combined erm ( b ) + mef ( a ) genotype is increasing . these strains show high - level macrolide and multidrug resistance , and their spread across the united states represents a serious public health concern . these findings also highlight the critical need for continued monitoring of pneumococcal resistance patterns over time , in particular , the spread of these multidrug - resistant clones , and for physicians to be aware of local or regional resistance patterns when selecting empiric antibacterial treatment for community - acquired respiratory tract infections .\noutput:\n" }, { "from": "agent", "value": "streptococcus pneumoniae isolates ( n = 31,001 ) were collected from patients with community - acquired respiratory tract infections during the protekt us surveillance study ( 20002003 ) . while the macrolide ( erythromycin ) resistance rate remained stable at 29 % , the prevalence of resistant isolates containing both erm ( b ) and mef ( a ) increased from 9.7 % in year 1 to 16.4 % in year 3 , with substantial regional variability . almost all ( 99.2 % ) dual erm ( b ) + mef ( a ) macrolide - resistant isolates exhibited multidrug resistance , whereas 98.6 % and 99.0 % were levofloxacin - and telithromycin - susceptible , respectively . these strains were most commonly isolated from the ear or middle - ear fluid of children . of 152 representative erm ( b ) + mef ( a ) isolates , > 90 % were clonally related to the multidrug - resistant international taiwan19f - 14 clonal complex 271 ( cc271 ) . of 366 erm ( b ) + mef ( a ) isolates from the protekt global study ( 19992003 ) , 83.3 % were cc271 , with the highest prevalence seen in south africa , south korea , and the united states . this study confirms the increasing global emergence and rapidly increasing us prevalence of this multidrug - resistant pneumococcal clone ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: evidence - based clinical practice requires that practitioners consider the best available evidence in support of potential clinical decisions . the highest category of evidence includes randomized controlled trials . with the increasing emphasis on evidence - based medicine , the urology literature has seen a rapid growth in the number of high - quality randomized controlled trials along with increased statistical rigor in the reporting of study results . statistical measures including p - values , confidence intervals ( ci ) , and number needed to treat ( nnt ) are becoming increasingly common in the urological literature . the meaning and appropriate interpretation of such measures are reviewed through the use of a clinical scenario . a 60 - year - old otherwise healthy man has just undergone a transrectal ultrasound - guided prostate biopsy for a persistently elevated prostate - specific antigen ( psa ) of 6.2 ng / ml . his biopsy pathology was negative for prostate cancer . he now inquires whether there is any medication that he can take to decrease his risk of developing prostate cancer in the future . you are aware that 5 - a - reductase inhibitors have been investigated for the chemoprevention of prostate cancer and decide to examine the literature for the current best evidence on this topic . you define the clinical question using the pico mnemonic . in men with negative prostate biopsies ( population ) , how effective are 5 - a - reductase inhibitors ( intervention ) when compared to no treatment ( comparison ) for the prevention of prostate cancer ( outcome ) ? you decide to examine the literature on this clinical question by using pubmed . a search for all articles on 5 - alpha - reductase inhibitors yields 1596 articles . a separate search for prostate cancer yields 85,759 articleswhen these two search terms are combined with the and function , 350 articles are found . by applyingone article in this list that addresses your clinical question is a randomized controlled trial entitled , effect of dutasteride on the risk of prostate cancer . in this study 's final analysis , 6729 men between the ages of 50 and 75 years of age with an elevated psa and negative baseline prostate biopsies were randomized to treatment with dutasteride 0.5 mg or placebo daily . these patients then underwent transrectal ultrasound - guided prostate biopsies at 2 and 4 years , and the number of patients who developed prostate cancer on biopsy was recorded . before looking at the results of the study , you first examine its methodology to determine if the study results would be valid . using the consolidated standards of reporting trials ( consort ) statement as a guidethe study 's primary endpoint was prostate cancer detection on biopsy at 2 and 4 years . over the entire 4 - year study period ,659 of the 3305 men in the dutasteride group and 858 of the 3424 men in the placebo group were found to have prostate cancer . this study reports this result as a relative risk reduction for the development of prostate cancer of 22.8 % ( 95 % ci : 15.2 - 29.8 ; p 0.001 ) for patients taking dutasteride compared to patients taking placebo . p - values were introduced in the first - half of the 20 century as the probability of rejecting the null hypothesis that a treatment has no effect when , in actuality , the null hypothesis is true . stated another way , a p - value is the probability that an observed difference is due to random chance when the null hypothesis is true . statisticians jerzy neyman and egon pearson later described this as a type i error in contrast to a type ii error where the null hypothesis is accepted when , in actuality , the null hypothesis is false . as statistician ronald a. fisher suggested , a p - value is an index for the strength of the evidence for the tested hypothesis against the null hypothesis . although a p - value is appropriately considered a statistic interpretable across a range of values , in contemporary experimental studies , statistical significancethis means that the null hypothesis is appropriately rejected if the probability of a type i error is 5 % . in our study example , the hypothesis being tested is whether dutasteride decreases the risk of prostate cancer as detected by biopsy among men at increased risk for prostate cancer . the null hypothesis is therefore that dutasteride does not decrease the risk of prostate cancer . in this particular study , a p - value of 0.01 or less was used as the predetermined criterion for statistical significance . this means that the null hypothesis in which dutasteride does not decrease the risk of prostate cancer is appropriately rejected if the probability that the null hypothesis is rejected when it is in fact true is 1 % . in this study , a relative risk reduction for the development of prostate cancer of 22.8 % therefore , the probability of rejecting the null hypothesis when it was in fact true was 0.1 % , and the result is statistically significant by the study 's predetermined criterion . we can therefore have confidence that dutasteride does reduce the risk of prostate cancer in this patient population by 22.8 % . although a p - value is helpful in determining the reliability with which the null hypothesis can be rejected and therefore the strength of the observed result , it does not provide information regarding the precision of the result . to address this issue , ci can be calculated around the point estimate of the result to provide a range of values within which the true value is certain to exist with a given level of confidence . a wide ci suggests an imprecise result and indicates that the results should be interpreted with caution regardless of statistical significance . in accordance with the conventional acceptance of statistical significance at a p - value of 0.05 or 5 % , if an observed result is statistically significant at a p - value of 0.05 , then the null hypothesis should not fall within the 95 % ci . in our study example , the result is expressed as a relative risk reduction percentage . the null hypothesis would therefore be a relative risk reduction of 0 % . in this study , the relative risk reduction over four years in men treated with dutasteride was 22.8 % and the 95 % ci was 15.2 - 29.8 % . the null hypothesis of no risk reduction with dutasteride does not fall within the 95 % ci , and the result is therefore statistically significant at a p - value of 0.05 . furthermore , the 95 % ci is relatively narrow and suggests that the true relative risk reduction with dutasteride is between 15.2 % and 29.8 % . the fact that there is a reasonably large relative risk reduction even at the low end of the confidence interval suggests that the result is not only statistically meaningful , but also clinically meaningful . although measures such as relative and absolute risk provide discrete statistical estimates of treatment effect , the magnitude of a treatment 's clinical effect is often difficult to determine through these statistics . the nnt , however , is a straightforward measure that conveys an estimate of a treatment 's clinical effect . for a study of treatment effect , the nnt is defined as the number of patients that must be treated in order to prevent one additional adverse outcome . it is easily calculated as the inverse of the absolute risk difference between treatment groups . in general , a large treatment effect is associated with a small nnt while a small treatment effect is associated with a large nnt . in our study example , after 4 years of treatment , 659 of the 3305 men in the dutasteride group and 858 of the 3424 men in the placebo group were found to have prostate cancer . in this study , the absolute risk of developing prostate cancer in the treatment group was 659/3305 = 19.9 % . the nnt is then the inverse of the absolute risk difference , which was 1/0 .052 = 19.2 . therefore , approximately 19 men need to be treated with dutasteride to prevent one additional case of prostate cancer at 4 years . it is important to note that nnt does not incorporate the time to the observed effect . in many cases , a longer duration of treatment will increase the reduction in risk . in our sample study , , the nnt would therefore have been 26.3 patients . because timing may change the result , it is important to report the timing of the observed effect along with the nnt . furthermore , just as ci can be calculated to provide a more complete picture of point estimates of effect such as relative risk reduction , so too can confidence intervals be calculated for nnt . if the observed effect is statistically significant , this can be accomplished by taking the inverse of the upper and lower limits of the ci of the absolute risk difference . the calculation of ci for a nonsignificant result has been described previously and is beyond the scope of this paper . according to our sample study , the use of dutasteride in men with an elevated psa between 2.5 and 10 ng / ml and a negative baseline prostate biopsy confers a significant relative risk reduction for the development of prostate cancer of 22.8 % ( 95 % ci : 15.2 - 29.8 ; p 0.001 ) at 4 years compared to patients who received placebo . the number of men that need to be treated with dutasteride to prevent one additional diagnosis of prostate cancer in 4 years is 19 . this result appears to be not only statistically significant , but also robust with a narrow confidence interval that is relatively far from the null hypothesis . a distinction should be made , however , between statistical significance and clinical significance . in general , a larger sample size will reduce the probability of a type i error and therefore decrease the p - value . this raises the possibility that a clinically insignificant difference may be found to be statistically significant . the actual magnitude of the treatment effect should always be considered separately from considerations of statistical significance . in particular , nnt places study results in a context that allows discussion of broader issues such as the cost of treatment to society and the exposure of patients to potential adverse reactions . in this study , the nnt is relatively low at 19 and provided additional benefits with regard to outcomes related to benign prostatic hyperplasia with a low side effect profile . based upon the results of this study , treatment of your patient with dutasteride may be appropriate as a means to decrease his risk of developing prostate cancer in the future . as the quality of the evidence in the urological literature improves , urologists are increasingly faced with statistical measures such as p - values , ci , and nnt . together , these statistical measures allow a more complete picture of the true effect observed in any given study . an understanding of these measures is therefore essential to the critical appraisal of the study literature in evidence - based medicine .\noutput:\n" }, { "from": "agent", "value": "objectives : with the increasing emphasis on evidence - based medicine , the urology literature has seen a rapid growth in the number of high - quality randomized controlled trials along with increased statistical rigor in the reporting of study results . p - values , ci , and number needed to treat ( nnt ) are becoming increasingly common in the literature . this paper seeks to familiarize the reader with statistical measures commonly used in the evidence - based literature.materials and methods : the meaning and appropriate interpretation of these statistical measures is reviewed through the use of a clinical scenario.results : the reader will be better able to understand such statistical measures and apply them to the critical appraisal of the literature.conclusions :p - values , ci , and nnt each provide a slightly different estimate of statistical truth . together , they provide a more complete picture of the true effect observed in a study . an understanding of these measures is essential to the critical appraisal of study results in evidence - based medicine ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: inguinal herniorrhaphy ( ih ) is a common day care procedure that can be performed under general anaesthesia ( ga ) , peripheral nerve blockade , regional anaesthetic techniques - subarachnoid block ( sab ) or paravertebral block ( pvb ) . pvb is advantageous in providing long - lasting unilateral anaesthesia , haemodynamic stability , early ambulation and prolonged pain relief . however , its use as a sole anaesthetic technique is underutilised in view of technical difficulty in inexperienced hands . pvb produces ipsilateral segmental analgesia through injection of local anaesthetic onto the spinal nerve roots alongside the vertebral column . it is advocated predominantly for unilateral procedures such as thoracotomy , breast surgery , chest wall trauma , hernia or renal surgery . however , there are very few studies comparing its potential as an effective anaesthetic technique with sab . hence , this study was undertaken to compare safety and efficacy between unilateral pvbs and sab in patients undergoing ih . after ethical clearance and obtaining written and informed consent , 66 male patients , aged 1865 years , american society of anesthesiologists ( asa ) physical status grade i or ii , posted for unilateral inguinal hernia - fully reducible direct or indirect hernia ( nyhus classification ) were randomly allocated into two groups using computer - generated randomisation sequence [ figure 1 ] . group p patients received pvb from t10 to l2 with 5 ml of bupivacaine ( 0.5 % ) with 1:400,000 epinephrine injected at each segment , and group s patients received sab with 12.5 mg of hyperbaric bupivacaine . exclusion criteria included patients with untreated and uncontrolled systemic illness , infections at block site , morbid obesity , history of substance abuse , chronic analgesic use , history of allergy to local anaesthetics , mental dysfunction , metabolic disease and active gastrointestinal reflux . eight hours fasting was ensured and patients were premedicated with oral ranitidine 150 mg on the night prior to surgery . patients were preloaded with 10 ml / kg lactated ringer 's solution and given supplemental oxygen ( 4 l / min ) with venturi mask in the operation room ( or ) . standard monitoring included heart rate ( hr ) , non - invasive blood pressure , respiratory rate and oxygen saturation ( spo2 ) . all the patients were pre - medicated with intravenous ( iv ) midazolam 2 mg and fentanyl 50 g in the or before block placement . in case of any discomfort during the surgery , pvb was performed using the technique described by moore and katz . in the sitting position , at five levels from t10 to l2 , 5 ml of bupivacaine ( 0.5 % ) with 1:400,000 epinephrine was injected at each segment ( total 62.5 g adrenaline ) . then , the patient was turned supine , and the onset of unilateral pinprick discrimination assessed every 5 min and up to 30 min . successful if the onset of pinprick discrimination started within 15 min ( endpoint ) or if the sensory block ( t10l2 ) was achieved within maximum period of 30 min . otherwise , it was consideredmotor block was evaluated at the end of surgery using a modified bromage scale of 03 ( 0 = full flexion of knees and feet ; 1 = just able to flex knees , full flexion of feet ; 2 = unable to flex knees , but some flexion of feet possible ; 3 = unable to move legs or feet ) . group s patients were administered sab in the sitting position using midline approach with a 25 gauge needle at l3l4 or l2l3 intervertebral space with 12.5 mg of hyperbaric bupivacaine . sensory block was assessed by pinprick from t4 downwards and surgery allowed to commence when the sensory block was higher than t10 . continuous monitoring of electrocardiogram , hr , systolic blood pressure ( sbp ) , diastolic blood pressure ( dbp ) , mean arterial pressure ( map ) and spo2 was done at baseline ( before premedication ) , immediately before the block , after the block ( positioned supine ) and then every 3 min for 115 min and thereafter , at 10 min till the end of surgery and post - operatively at 2 , 4 , 6 , 12 and 24 h. any episode of hypotension ( map lower than 20 % of baseline value ) was treated with iv fluids and if needed , 6 mg bolus of iv mephentermine . bradycardia ( hr 60 beats / min ) was closely observed and managed with iv atropine ( 0.6 mg ) if hr was 50 beats / min . various parameters noted included time required for performing the block ( trpb ) ( from premedication to the end of block procedure ) , time to surgical anaesthesia ( tsa ) ( from end of block to readiness of surgery ) , duration of surgery ( ds ) ( from the skin incision to the closure of the skin ) , post - anaesthesia care unit ( pacu ) transfer time [ ptt ] ( from the end of surgery to transfer to ward ) . in pacu , the patient was evaluated using modified aldrete scoring system wherein if score was 9 , patient bypassed the pacu directly to ward . in the ward , the patient was assessed by modified post - anaesthetic discharge scoring ( pads ) system for home readiness and discharge . time from the end of surgery to home readiness was noted and was taken as time to reach the discharge criteria . patients who achieved a modified pads score 9 were considered fit for discharge ( or home readiness ) . post - operatively , all the data were collected at 2 , 4 , 6 , 12 and 24 h after surgery . time to first post - operative analgesic requirement ( duration of post - operative analgesia ) , total analgesic consumption in the first 24 - h period , visual analogue score ( vas ) , and incidence of side effects ( nausea , vomiting , pruritus , headache , urinary retention , etc . ) were noted . vas score 4 was treated with tramadol in bolus of 50 mg iv and post - operative nausea and vomiting ( ponv ) was treated with 4 mg of ondansetron iv . considering 30 % increase in duration of post - operative analgesia in p group to be clinically relevant and taking confidence interval ( = 0.05 ) and the power of test ( 1 - ) as 80 % , we required a sample size of 50 ( 25 in each group ) . we enroled 35 patients in each group considering the possibility of dropouts in each group . all statistical tests were performed using commercially available statistical software ( spss for windows version 16.0 chicago , il , usa ) and graphs were produced using microsoft excel for mac 2011 ( version 14.1.2 , microsoft corporation . discrete categorical data were presented as n ( % ) and median ; continuous data were measured as mean standard deviation difference in demographic , surgical , anaesthetic and post - operative data was tested by independent student 's t - test ( continuous data ) and categorical data using pearson chi - square test . in group p , one patient had failed block and two patients had epidural spread of local anaesthetic ( bilateral sensory block ) and were excluded from the study . data from sixty patients were analysed , thirty in each group [ figure 1 ] . the baseline demographic variables and baseline haemodynamic parameters ( hr , sbp , dbp , map , spo2 ) were statistically comparable in between the two groups [ table 1 ] . the time trpb ( p 0.0001 ) and tsa ( p 0.0001 ) was longer in - group p and differences were statistically significant [ table 2 ] . intra - operative vitals [ figure 2 ] were comparable in both groups except for the map ( p 0.001 ) , which was significantly reduced in the group s ( p 0.0001 ) . no patients in the group p needed either mephentermine or atropine for any haemodynamic changes . however , three patients in the s group needed mephentermine 6 mg iv for the treatment of hypotension . bradycardia occurred in four patients in the group s as compared to the group p. a significantly high number of patients in - group p had low bromage scores [ table 2 ] . total fentanyl usage was found to be higher in the group p ( p 0.0001 ) [ table 2 ] . there was significant difference in the vas scores between the two groups at 4 h ( p 0.0001 ) and 6 h ( p 0.002 ) but not at 2 , 12 and 24 h. the vas scores were lowest at 2 h for both groups and highest at 6 h for group p and at 4 h for group s [ figure 3 ] respectively . duration of post - operative analgesia was significantly higher in group p ( p 0.001 ) ( 384.5738.26 min vs. 194.2620.30 min ) , and the total dose of analgesic required [ table 2 ] was significantly reduced in group p ( p 0.001 ) . distribution of subjects according to baseline demographic profile , baseline hemodynamic parameters distribution of subjects according to block characteristics and use of fluids and drugs comparison of vitals ( hr : heart rate , map : mean arterial pressure , spo2 : oxygen saturation between groups ) trends in post - operative visual analogue scale ( median value ) . ( group p : patients received paravertebral block from t10 to l2 with 5 ml of bupivacaine ( 0.5 % ) + 1:400,000 epinephrine injected at each segment . vas : visual analogue scale , pvb : paravertebral block , sab : subarachnoid block modified pads scores [ figure 4 ] was not significant at 2 h ( p 0.10 ) but it was significantly higher at 4 h ( p 0.0001 ) and 6 h ( p 0.0001 ) in group p. time to reach the discharge criteria ( home readiness ) was early in group p than group s , and this difference was highly significant ( p 0.0001 ) [ table 2 ] . all the 30 ( 100 % ) patients of group p bypassed the recovery room whereas 30 % ( n = 9 ) in group s bypassed the same [ table 3 ] . in the group s , more patients had been satisfied and had no discomfort associated with the block than in p group . five patients in group s experienced episodes of nausea and were treated with iv ondansetron ( 4 mg ) , but none of the patients of group p experienced it . mean modified post - anaesthetic discharge scoring score at 2 , 4 , 6 , 12 , and 24 h. group p : patients received paravertebral block from t10 to l2 with 5 ml of bupivacaine ( 0.5 % ) + 1:400,000 epinephrine injected at each segment . in our study , the use of pvb for inguinal herniorrhaphy was found to be a useful alternative to sab with the advantage of prolonged post - operative analgesia , shorter time to reach the discharge criteria , better haemodynamic stability and minimal adverse effects . inguinal hernia repair , being a day care procedure warrants adequate post - operative analgesia , rapid recovery , early home readiness and prevention of ponv or other adverse effects . the choice of anaesthetic technique for inguinal hernia repair depends on skill of the anaesthesiologist , the feasibility of the technique , the complexity and expected duration of the procedure , intra - and post - operative pain control , recovery time , post - operative morbidity and cost - effectiveness . according to the epidemiological data , ga is used in 6070 % , central neuraxial blocks in 1020 % and local infiltration anaesthesia in 510 % of cases . pvb have been used with success , both as an anaesthetic and analgesic technique , for inguinal herniorrhaphy . in our hospital , sab is a preferred technique of anaesthesia for ih that however is not an ideal anaesthetic technique for a fast track ambulatory surgery . sab has some adverse effects such as prolonged motor blockade , intra - operative hypotension , post - dural puncture headaches , urinary retention , delayed mobility and discharge from the hospital . hence , quest for an ideal technique for anaesthetising ih patients is still on . unlike sab , pvb preserves lower extremity motor function and provides unilateral , segmental anaesthesia of the operative site , prolonged post - operative analgesia and lowers incidence of ponv . for this reason , we decided to compare the effectiveness of pvb and sab in terms of post - operative pain relief and early ambulation . the population sample studied was homogenous with regards to the preanaesthetic characteristics such as age , weight , asa grade , ds and baseline haemodynamic parameters . we used 1 in 4 lakh adrenaline to limit the absorption of bupivacaine that had reached its highest safe limit of local anaesthetic . the mean hr and spo2 was statistically comparable in both groups throughout surgery [ figure 2 ] which is similar to the study results found by bhattacharya et al . in group p , there were no significant changes in the map compared to the baseline [ figure 2 ] due to less significant sympathetic blockade and unilateral nature of the block . however , in group s , there was a significant decrease in map compared to the baseline that remained throughout the surgery attributable to the sympathetic blockade . this resulted in higher fluid requirement and mephentermine boluses in group s compared to group p ( 1666.67232.42 ml vs. 1186.67121.01 ml and 10 % vs. 0 % ) [ table 2 ] . on intergroup comparison , map was statistically significantly decreased in group s compared to group p after the block and throughout the surgery . in group p , the time to perform the block was 18.831.98 min that was significantly higher than group s of 6.071.17 min because in pvb multiple injections were required and anatomical landmarks were difficult to identify as compared to sab . this time was longer in studies when a single level ( l1 ) pvb was used . the time to onset of surgical anaesthesia was significantly higher in group p as compared to group s which was similar to study results of bhattacharya et al . and akcaboy et al . in view of injections given at multiple levels . since post - operative pain is one of the common reasons that can delay early ambulation and discharge , addition of local anaesthetics or non - steroidal anti - inflammatory drugs ( nsaids ) can improve post - operative analgesia , thus facilitating an earlier discharge . in our study , very few patients had significant pain in either p or s group , as shown by the low vas scores at 2 h in the post - operative period . however , duration of analgesia was much more prolonged in group p compared to group s ( 300438 min vs. 138228 min ) allowing earlier ambulation . this finding of post - operative analgesia ( median , 6 h 24 min ) in our study corroborate with the some studies ( median , 5 h 45 min ) but are in contrast with others . prolonged sensory block enabling prolonged analgesia is the most significant characteristics of the pvb technique . this results from relative avascularity of the paravertebral space and hence , slow uptake of local anaesthetics . mean total post - operative analgesic requirement of tramadol was significantly lower ( p 0.001 ) in group p as compared to group s ( 121.6725.20 mg vs. 206.6725.37 mg ) , the longer duration of analgesia lessening analgesic requirement . in our study , all the 30 ( 100 % ) patients in group p and nine ( 30 % ) patients in s group were able to bypass the recovery room . the time to reach the discharge criteria was significantly earlier in the group p ( 166.5027.38 min ) as compared to group s ( 360.2018.77 min ) , so early home readiness could be caused by a reduced amount of pain experienced by this group . bilateral sab with high dose of bupivacaine may explain the delayed ambulation , increased need for recovery room and increased time required to reach the discharge criteria attributable to the residual motor and sympathetic blockade . in contrast ambulation is much earlier after pvb for inguinal hernia repair , probably due to minimum motor blockade of lower extremities , as shown by lower bromage scores in group p. comparing the side effects in both groups , group s was associated with higher incidence of nausea , urinary catheterisation , headache and backache ( 33 % , 3 % , 10 % and 13 % ) while none in group p had such complications . sab is associated with higher ponv because of the associated sympathetic blockade causing postural hypotension . this fact further precludes early ambulation and early transfer to the ward from the recovery room in patients receiving sab . headache and backache occurred in three ( 10 % ) and four ( 13.3 % ) patients of group s , respectively and in none of the patients of group p. both these symptoms were of a minor degree and manageable with rest or nsaids . some perceived disadvantages of pvb include the need for adequate training , the longer time required to perform the block , the possibility of block failure and the risk of pneumothorax . although the block performance time was longer than sab is consistent with some studies , but this did not affect the home readiness time . in our study , one patient ( 3 % ) had to be given ga due to block failure which is consistent with failure rates in any teaching institute , as shown by lnnqvist et al . multiple segments pvb were not comfortable for the patient and increased the risk of pneumothorax . deep needle penetration during pvb above t12 level can result in pneumothorax because the lung pleura extends up to t12 level . although the blocks were performed at the t10l2 levels , no pneumothorax was observed in our study . two patients in the group p had epidural spread and was excluded from the study that is comparable to the incidence reported in other studies . in two patients , femoral nerve block was a finding as the block was given at l5 , but that did not cause the overall prolonging of the discharge . one of the limitations of our study was small sample size but it had significantly important results , and we suggest future studies to be undertaken with a larger population size . another limitation of our study was that it was a single - blind study but double - blinding was not possible because of the varied difference between the two techniques so used . another limitation of the study was that we used landmark technique and not ultrasound - guided block . with the advent of ultrasonography into clinical practice , assessment of the distance to the thoracic paravertebral space and pleura or real - time monitoring of the position of the needle and the injection during the block is gaining popularity . there are at least nine different ultrasound - guided approaches to pvb described in literature and it must be realised that though it has increased safety of block performance , it has longer learning curve . unilateral pvb is more efficacious than conventional sab for inguinal hernia repair in terms of prolonged post - operative analgesia , better haemodynamic control , shorter time required for reaching the discharge criteria and lesser incidence of side effects . hence , pvb could be a better and safe alternative to sab for early home readiness .\noutput:\n" }, { "from": "agent", "value": "background and aims : unilateral paravertebral block ( pvb ) as a sole anaesthetic technique is underutilised even in experienced hands . hence , this study was undertaken regarding the efficacy and safety of pvb and compared with subarachnoid block ( sab ) for inguinal hernia repair procedures.methods : sixty - three consenting adult male patients scheduled for unilateral inguinal hernia repair were randomly assigned to receive either pvb or sab ( group p : pvbs at t10l2 levels , 5 ml of 0.5 % bupivacaine at each segment ; group s : sab at l3l4 level with 12.5 mg 0.5 % of hyperbaric bupivacaine ) . primary objective was to compare duration of post - operative analgesia and time to reach discharge criteria ( modified aldrete scores and modified post - anaesthetic discharge scoring [ pads ] scores ) . secondary objectives were to compare the block characteristics ( time required for performing the block , time to surgical anaesthesia , time to ambulation , time to the first analgesic , total rescue analgesic consumption ) and adverse effects . independent student 's t - test was used for continuous data and pearson chi - square test for categorical data . p < 0.05 was considered as statistically significant.results : the duration of post - operative analgesia ( min ) was 384.57 38.67 in group p and 194.27 20.30 in group s ( p < 0.05 ) . modified pads scores were significantly higher at 4 h and 6 h ( p < 0.0001 ) in group p. time to reach the discharge criteria was early in group p than group s.conclusion : pvb provides excellent post - operative analgesic conditions with lesser adverse effects and shorter time to reach the discharge criteria compared to sab ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: today , many aspects of the immune system like receptor - mediated signalling or induction of autoimmune diseases are only partly understood ( 13 ) . nevertheless , the substantial progress in the development of new vaccines ( 4,5 ) or therapeutic antibodies ( 6 ) demonstrates the great impact of immunological research on drug design and immune therapy . although not antigenic by themselves , haptens interact with t - cell receptors or specific antibodies when conjugated to a larger antigenic molecule , usually a carrier protein . t - cells recognize haptens which are bound to the major histocompatibility complex ( mhc ) presented on the surface of various cell types . in contrast , hapten recognition by b - cells is mediated by receptors located on their membranes . once they are activated , b - cells differentiate into ig - secreting plasma cells . such cells are able to produce highly specific antibodies that have the capability to bind haptens without carrier conjugation ( 7 ) . specific antibody recognition is utilized in the development of biosensors ( 8 ) , catalytic antibodies ( 9 ) , immunomodulators ( 10 ) or new vaccines ( 11 ) . however , an immune response is not always favourable . natural and synthetic compounds in food or cosmetic products can cause skin inflammation ( 12 ) , asthma and other allergic symptoms ( 13 ) . even though several mechanisms are discussed to be operative in the pathogenesis , immunogenic compounds are capable of eliciting autoimmune diseases like hepatocellular hepatitis ( 14 ) or systemic lupus erythematosus ( 15 ) . it is estimated that drug allergies account for 610 % of all adverse drug effects ( 16 ) . the international immunogenetics information system ( 17 ) consists of databases , online - tools and web resources regarding various immunological aspects . data relating to antigenic epitopes are collected in the databases jenpep ( 18 ) , antijen ( 19 ) and epitome ( 20 ) . furthermore the databases kabat ( 21 ) , mhcbn ( 22 ) , bcipep ( 23 ) and fimm ( 24 ) provides comprehensive information about mhc binding peptides , b - cell epitopes or antibody sequences . recently , a large manually curated immune epitope database ( iedb ) was published ( 25 ) . much more haptens are described within the haptendb ( 26 ) , a collection of approximately 1000 haptens with its main focus on the underlying immunochemical assays . it contains information about the assay method , conjugation ratio of haptens and carrier molecules , sensitivity and specificity of the system or cross reactivity of the antibodies used . although the database is very helpful to get an overview of the performed immunologic experiments , we noticed that many important immunologic compounds are missing . for example , drugs such as aspirin or beta adrenergic antagonists are capable of eliciting severe autoimmune diseases like bronchial asthma ( 27 ) or psoriasis ( 28 ) . chlorated benzenes present in pesticides , solvents and lubricants are frequently described as haptens but apparently not incorporated within the haptendb . while the authors processed in detail the data of approximately 250 hapten - related articles , a large proportion of described haptens and associated immunologic articles is ignored . furthermore , information about the availability of the described haptens and antibodies will be helpful in case a described immunoassay is to be reproduced . to overcome these problems , we have performed a more extensive semi - automatic literature screening , resulting in a comprehensive dataset . the basic application of the database is the identification of compounds that elicit immune response . the user interface provides diverse query types , like searching by hapten name , physicochemical properties , industrial use or associated carrier protein . a built - in molecule editor allows the user to draw a molecule and to screen the database for compounds with similar molecular structure . this feature is of particular interest even if the specific requested molecule is not part of the database . since compounds with high structural similarity frequently exhibit similar activities ( 29 ) , this method provides an informative basis for the identification of new immunogenic compounds . identified haptens are displayed by 3d structure and may act as starting points for further similarity searches . each compound is provided with a full info page containing synonyms , molecular properties and references to the underlying literature . another important aspect to assist immunologists is the availability of the haptens for further experiments . we have checked whether the haptens are commercially obtainable and provided 6279 compounds with ordering codes and external links to suppliers . similarly , the ordering information of 453 hapten related antibodies was determined and included within the database . carrier proteins are annotated with uniprot - id , pdb - structure and underlying references to literature . furthermore , we have checked whether the annotated haptens are structurally resolved in complex with antibodies , carriers or other proteins . the corresponding pdb cross references are included on the hapten related info pages . some haptens were identified , which are assured to be mhc - mediated . query types : ( a ) part of the cluster - tree , showing the structure of the scaffold classification . clicking on the nodes expands the branch : monocyclic aromatic compounds dinitrobenzene derivatives etc . ( b ) text query options including a classification regarding the origin of the haptens . ( c ) screenshot of the java applet marvin which allows upload or drawing of own structures for similarity searches in the superhapten database showing dinitrophenol . results ( d ) query results with search options for 2d similarity : dinitrophenol ( c6h4n2o5 ) and 2,4 - dinitro -6-methylphenol ( c7h6n2o5 ) . the compounds can be rotated ( left mouse button ) , different display styles are available , structures can be saved ( right mouse button ) and more detailed information , such as synonymous names and formula or supplier information can be obtained by use of the full info button . further information ( e ) antibody and suitable information like supplier , i d and source organism are displayed . ( f ) information on hapten specific carrier protein ( s ) , references , uniprot - , pdb - id etc . ( h ) recent scientific references confirming the haptenic effect including author information and abstract . key numbers of the database content another intention was to allow immunologists an overview of known immunogenic compounds . for that purpose , the haptens were compared all against all and clustered by structural similarity . the resulting 154 clusters containing at least eight similar compounds were manually ordered to obtain a hierarchical compound tree . for example , halogenated chemicals are frequently responsible for environmental skin diseases ( 30 ) . about 800 references to articles are retrievable , which describe an immunologic response to halogenated compounds . by the same procedure , chemical classes like sulfurones or triazines are easily accessible . the presented cluster tree could potentially allow researchers to analyse the relationship between molecular structure and immunogenic effect . examples of haptens classified as drugs , contact allergens or pesticides the cluster size specifies the number of highly similar haptens grouped together . the abstracts of the literature database pubmed were filtered for relevant immunologic articles , using specific keywords . the 15,000 abstracts thus obtained were screened against names and synonyms of 3 million chemical compounds as well as a distinct set of substrings of iupac names . the text passages containing matches were manually curated by a scientific team that confirmed the matching and analysed whether the identified compound was recognized by antibodies or t - cell receptors . two web resources were checked , the dimdi contact allergen database ( ) and the haptendb ( 26 ) . each compound of the basic dataset was translated into a structural fingerprint , using the chemistry development kit ( ) . up to six connected atoms all connectivity paths within the molecule are determined . for each path , a hash function calculates the location of a representing bit in a boolean array . the number of possible paths is huge and it is not possible to assign a particular bit to each path , thus a particular bit represents several paths . the combination of all representing bits of all paths yields in a specific pattern or structural fingerprint . the similarity index used is the tanimoto coefficient , which is the number of bit positions set to 1 in both fingerprints divided by the number of bit positions set to 1 in at least one of the fingerprints . if a set bit is considered as a feature present in the molecule , the tanimoto coefficient is a measure of the number of common features in both molecules ( 31 ) . a tanimoto coefficient of 0.85 indicates that two molecules have similar activities ( 32 ) . calculated fingerprints were used for a further structural screening against 4 million compounds . in this waythese putative haptens are highly probable candidates for eliciting the same kind of immune response , binding to the same carrier and being recognised by the same antibodies or t - cells as the haptens found in literature ( 29 ) . , ) and visualized with the free chime - plugin from mdl ( available for windows , sgi , mac ) . the same tool was also used for the built - in molecule editor that allows structural screening with self - edited molecules . for compatibility , our data model are directed to the schema implemented in the iedb ( 25 ) . the data are implemented as a relational database on a mysql server and publicly available at . by now , the presented database has become a useful tool to retrieve information about specific immunogenic compounds , or to get an overview of the known substances that elicit immune responses . the kegg - pathway analysis of single haptenic compounds revealed that their synthesis is exclusively performed by bacterial enzymes ( 33 ) . the included data on purchasability of haptens and related antibodies will enable systematic experimental approaches on the relation between structural similarity and cross - reactivity . furthermore , structure comparisons of self - edited molecules to the annotated haptens may allow a first rough estimation of the potential immunogenicity of new chemicals .\noutput:\n" }, { "from": "agent", "value": "the immune system protects organisms from foreign proteins , peptide epitopes and a multitude of chemical compounds . among these , haptens are small molecules , eliciting an immune response when conjugated with carrier molecules . known haptens are xenobiotics or natural compounds , which can induce a number of autoimmune diseases like contact dermatitis or asthma . furthermore , haptens are utilized in the development of biosensors , immunomodulators and new vaccines . although hapten - induced allergies account for 610 % of all adverse drug effects , the understanding of the correlation between structural and haptenic properties is rather fragmentary . we have developed a manually curated hapten database , superhapten , integrating information from literature and web resources . the current version of the database compiles 2d / 3d structures , physicochemical properties and references for about 7500 haptens and 25,000 synonyms . the commercial availability is documented for about 6300 haptens and 450 related antibodies , enabling experimental approaches on cross - reactivity . the haptens are classified regarding their origin : pesticides , herbicides , insecticides , drugs , natural compounds , etc . queries allow identification of haptens and associated antibodies according to functional class , carrier protein , chemical scaffold , composition or structural similarity . superhapten is available online at ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: salicylates are a class of nonsteroidal anti - inflammatory drugs ( nsaids ) with analgesic , antipyretic , and anti - inflammatory effects that are known to induce reversible hearing loss and tinnitus . a rationale for salicylate - induced hearing loss is the block of prestin , the molecular motor of outer hair cells ( ohc ) , through competition with intracellular cl . on the other hand , the mechanism underlying salicylate - induced tinnitus is still unclear , since in the cochlea these drugs , besides prestin , also target other systems , among which several players in the stress / inflammation pathways . the stress response affects a large number of targets , among which aqps , the proteins forming water channels in biological membranes . several aqps have been found in the inner ear , each with its distinct distribution , but so far only aqp4 is known to affect hearing . the distribution and role of aqp6 , however , are less clearly characterized , and may be interesting , given the low permeability to water and high permeability to anions ( both increased by low ph ) of this isoform . therefore , the function of aqp6 could be that of regulating the flow of anions rather than water , possibly affecting the behavior of outer hair cells ( ohcs ) , which are very sensitive to cl modulation . previous findings show that aqp6 is expressed in human and rat inner ear , but the protein localization is still controversial , possibly due to species differences , which have been observed for other aquaporins . whereas in vestibularepithelia aqp6 was found in the apical part of supporting cells both in human and rat in the cochlea aqp6 has been detected in the human organ of corti but not in the rat organ of corti . in agreement with aqp6 localization in other tissues , aqp6 immunoreactivity in the rat ear appeared limited to intracellular structures , with a negligible labeling in the plasma membranes . in the present paper , we studied aqp6 mrna expression in the mouse inner ear and its regulation by aspirin , by performing semiquantitative reverse transcription / polymerase chain reaction ( rt - pcr ) , real time rt - pcr ( qrt - pcr ) , immunoblotting and immunohistochemistry . c57bl6 mice ( 2025 days old ) were housed at the animal facility of the department of physiology , section of general physiology , university of pavia , cared for and sacrificed according to the current european legal animal practice requirements . after treatment with saline ( i.p . , for 3 days ) ( controls ) or aspirin ( 200 mg / kg / day for 3 days , i.p . ) at least 4 animals for each condition in each experiment , the mice were sacrificed 3 hours ( treatment ) or 24 hours ( recovery ) after the last injection and processed for rna isolation or immunolocalization . total rna was extracted from the inner ear of at least 4 mice for each condition ( saline or aspirin ) using the qiazol lysis reagent ( qiagen , italy ) . single cdna was synthesized from rna ( 1 g ) using random hexamers and m - mlv reverse transcriptase ( invitrogen s.r.l . , specific primers for mouse - actin and for aqps were synthesized based on their published sequences ( table 1 ) . cdna amplification was performed by gotaq flexi dna polymerase ( promega , italy ) , as previously described . the primers used for amplification are listed in the table 1 . the pcr protocol consisted of an initial denaturation of 5 min at 96c followed by 35 cycles of denaturation at 96c for 30 s annealing at 60c for 30 s , and extension at 72c for 30 s. reverse transcriptionwas always performed both in the presence ( positive ) or in the absence ( negative control ) of reverse transcriptase enzyme . first , sequences of the aqp bands were checked by using the big dye terminator cycle sequencing kit ( applied biosystem , pe , usa ) . pcr products were separated on a 3 % nusieve ( 2 : 1 ) gel agarose , stained with ethidium bromide , and acquired with the image master vds ( amersham biosciences europe ) . densitometric analysis of the bands was performed by the total lab v 1.11 computer program ( amersham ) and the results were expressed as a percentage of the aqp / - actin densitometric ratio . the molecular weight of the pcr products was compared with the dna molecular weight marker viii ( roche molecular biochemicals , italy ) . qpcr was performed in triplicate using 1 g cdna , obtained as above indicated , and specific primers ( table 1 ) . mesa green qpcr mastermix plus ( eurogentec ) was used according to the manufacturer instruction and qpcr performed using rotor gene 6000 ( corbett ) . the conditions were as follows : initial denaturation at 95c for 5 min , 40 cycles of denaturation at 95c for 30 s ; annealing at 60c for 30 s , and elongation at 72c for 40 s. the qrt - pcr reactions were normalized using - actin as housekeeping gene ( mm_actb_2_sg , quantitect primer assay qt01136772 , qiagen ) . melting curves were generated to detect the melting temperatures of specific products immediately after the pcr run . relative mrna levels were determined by comparative quantitation ( corbett ) and the results expressed as fold change . mouse kidneys were homogenized with an ultra - turrax homogenizer ( ika ) in a solution containing ; 100 mm nacl , 1 mm edta , 10 mm tris - hcl , ph 6.8 , and 0.1 mg / ml pmsf , and treated as previously described . lanes were loaded with 30 g proteins , subjected to 12.5 % sds - polyacrilamide gel electrophoresis and transferred to hybond ecl nitrocellulose membranes ( amersham ) by electroelution . after 3 hrs blocking with tris buffered saline ( tbs ) containing 5 % nonfat dry milk and 1 % triton x-100 ( blocking solution ) , membranes were incubated overnight with affinity purified antibody to aqp6 , diluted 1 : 800 in blocking solution . antibodies directed against the c - terminal peptide of rat aqp6 with an additional n - terminal cysteine were prepared according to yasui et al . . membranes were washed and incubated for 1 h with peroxidase - conjugated goat antirabbit immunoglobulin g ( 1 : 120000 in blocking solution ) ( amersham biosciences europe , italy ) . the bands were detected with an ecl advance western blotting detection system ( amersham biosciences europe , italy ) . control experiments ( not shown ) were performed , by preadsorbing the antibody with a 20-fold molar excess of the immunizing peptide and by incubating the blots with pre - immune rabbit serum . chemiblot molecular weight markers were used to accurately estimate the molecular weight and as a positive control for the immunoblot ( chemicon international , inc . , ca , usa ) . c57bl6 mice were anesthetized with 2 - bromo -2-chloro-1,1,1-trifluoroethane and intracardially perfused with acetate - buffered 4 % ( w / v ) formalin . temporal bones were rapidly removed , postfixed for 1 h , decalcified for at least 1 week in edta 4 m and successively processed into paraffin . serial paraffin sections ( 5 m ) were brought to water and then washed with pbs . sections were successively treated with 3 % ( w / v ) h2o2 for 20 min at room temperature ( 22c ) to block endogenous peroxidases . after washing for 5 min with pbs , sections were blocked with 3 % ( w / v ) bsa in pbs for 60 min at room temperature . sections were incubated overnight at 4c with rabbit anti - aqp6 diluted at 1 : 500 in pbs containing 1 % bsa . after three 5 - minute washes with pbs containing 1 % bsa , sections were treated according to the labeled streptavidin biotin ( lsab ) method ( universal lsab kit , dako italia s.p.a . , italy ) and washed three times with pbs containing 1 % bsa . the reaction was visualized by incubation with dakocytomation liquid dab ( dakocytomation , milan , italy ) . sections were counterstained with haematoxylin and mounted on dpx ( merck eurolab , milan , italy ) . control experiments were performed simultaneously using pre - immune serum or omitting the primary antibody . immunostained slides were examined by light microscopy using an olympus bx41 and the digital images captured with the nikon ds - fi1 digital camera using nis element f imaging software . the significance of the differences of the means was evaluated with one - way anova followed by newman - keuls 's q test , or student 's t test . expression of aqps in the mouse inner ear was first verified by semiquantitative rt - pcr after three days of treatment with aspirin or saline ( control condition ) . single bands of the expected size of cdna fragments were amplified ( 327 , 441 , 383 , 309 , 437 and 509 bp for aqp1 , 2 , 4 , 6 , 7 and - actin , resp . ) . the results of agarose gel electrophoresis of representative pcr reaction products are shown in figure 1 . only aqp6 mrna expression was clearly affected by aspirin treatment , while other aqps were unchanged ( figure 1 ) . densitometric analysis of the bands showed that aqp6 transcript was significantly reduced ( means s.e.m . of aqp6 / - actin densitometric ratio ) : saline , 16115 % ; aspirin , 11113 % ( * p .043 student 's t test ) . recently , yasui and coworkers found two aqp6 splice variants in the mouse kidney : aqp6a ( similar to the rat aqp6 ) , and aqp6b , found also in the mouse cerebellum . we performed rt - pcr using specific primers designed to differentiate between the two variants as in and found both variants expressed in the ear ( figure 2 ) . the effect of aspirin treatment on the expression of aqp mrnas in the mouse inner ear was then investigated by quantitative real time rt - pcr . results showed that aspirin treatment significantly decreases aqp6 mrna expression ( about 70 % , figure 3 ) , while no significant changes were observed for aqp1 , 2 , 4 and 7 transcripts under this condition . moreover , the results showed a significant recovery of mrna aqp6 expression 24 hours after the last treatment with aspirin ( figure 3 ) . to investigate the specificity of aspirin effect , we checked aqp6 mrna levels in the kidney and in the small intestine . in these organs , no significant changes of aqp6 transcript expressionwere observed : small intestine , 0.8830.001 ( saline ) and 0.7910.125 ( aspirin ) ; kidney , 1.010.03 ( saline ) and 0.960.09 ( aspirin ) ( fold change ; p .5 , student 's t test ) . immunoblots of mouse kidney homogenates have been performed to test the antibody used for immunohistochemistry . the results revealed the expected bands ( figure 4 ) , consistent with published data . cellular localization of aqp6 was investigated with immunohistochemistry using affinity - purified antibodies against mouse and rat aqp6 . aqp6 was expressed in both cochlear ( figures 5 ( a ) , 5 ( c ) and 6 ( a ) ) and vestibular ( figure 6 ( b ) ) epithelia , and in neuronal somata in the spiral ganglion ( figure 5 ( b ) ) ; faint or no labelling was noted in the stria vascularis ( not shown ) . in the organ of corti ( figure 5 ( a ) , 5 ( c ) ) , labelling was most intense and consistent in deiters ' cells , which were labelled throughout their length ( figure 5 ( a ) , 5 ( c ) ) , and also present at inner phalangeal cells and pillars of corti ( figure 5 ( a ) ) . controls in which the primary antibody was replaced by the pre - immune serum show an absence of labelling ( figure 5 ( d ) ) . no clear labelling was observed in hair cells ( figure 5 ( a ) and 5 ( c ) ) . in vestibular epithelia ( figure 6 ( b ) ) , labelling was evident , mainly in supporting cells . after treatment with aspirin ( see methods ) , labelling was strongly reduced or lost in both the organ of corti ( figure 6 ( c ) ) and vestibular epithelia ( figure 6 ( d ) ) . in the present paper , we characterize for the first time the expression pattern of aqp6 in the mouse ear sensory epithelia and its regulation by salicylates . our data agree with previous studies in human and rat showing strong aqp6 expression in the supporting cells of vestibular epithelia . in the cochlea , on the other hand , our results disagree with previous localization in the rat , where labelling was seen in the stria vascularis but not in the organ of corti . although some discrepancies could be ascribed to differences in species and antibodies used , it is also possible that the different labelling observed in the organ of corti results from variations in the modulation set point of expression , as our salicylate experiments show . our data show that aqp6 is expressed in the organ of corti , and particularly in deiters ' cells . this pattern of expression suggests a possible role for aqp6 in regulating ohc electromotility , which involves both water and chloride flow , or in modulating deiters ' cell stiffness , which would affect ohc action on basilar membrane movement . in facts , aqp6 displays interesting properties , and it is still debated whether its main function is that of an anion channel , a water channel , or both . moreover , although originally thought to be only intracellular , recent data show that aqp6 can bind calmodulin with its n - terminal domain , which is responsible for its subcellular localization . it is therefore possible that stimuli that increase cytoplasmic ca ( such as purinergic signalling in deiters ' cells ) , induce aqp6 traslocation to the plasma membrane , similar to what vasopressin does to aqp2 . to further explore this role , we treated mice with salicylates , which are known to impair ohc electromotility , and observed variations in the expression of aqp6 after treatment . aqp6 mrna expression and protein labeling of the organ of corti are dramatically reduced after treatment with aspirin . the reduction is quite rapid , being evident already at 3 hrs after the last day of treatment and reversed 24 hours after treatment has ended . these results appear interesting because salicylates are well known for their reversible ototoxic effect but the pathways through which they act are still largely unclear . since prestin and aqp6 appear to be expressed by different cell types , the link between their modulations may be complex . one possible link between ohc block and aqp6 downregulation in deiters ' cells is cox - 2 . in fact , this enzyme has been found to be involved in the downregulation of aqp2 in the kidney , and is expressed in deiters ' cells , where it is modulated by sound conditioning , possibly through mechanically sensitive pathways . this enzyme could be modulated by salicylates ( and by unknown physiological processes ) in vestibular epithelia as well ( where neither prestin nor motility are present ) , thus explaining aqp6 downregulation in these organs . moreover , it is interesting to note the absence of downregulation in small intestine and in the kidney epithelia , suggesting the presence of different modulation mechanisms in different organs . in the present paper , we characterize the expression pattern of aqp6 in the mouse inner ear sensory epithelia . our data show that aqp6 is expressed in the organ of corti , and in particular in deiters ' cells . this suggests a possible role for aqp6 in regulating ohc motility , through modulation of water and chloride flow or of deiters ' cell mechanical compliance . to further explore this role , we treated mice with salicylates , which impair ohc electromotility , and observed variations in the expression of aqp6 after treatment . aqp6 mrna expression and protein labeling of the organ of corti are dramatically reduced already at 3 hrs after the last day of treatment with aspirin . similar reduction is observed in vestibular epithelia , but not in control tissues ( small intestine and kidney ) . these results suggest that aqp6 downregulation is not due to motility / prestin - dependent pathways , but may affect ohcs ' ionic environment and / or their mechanical response through changes in coupling to the organ of corti .\noutput:\n" }, { "from": "agent", "value": "we characterize the expression pattern of aquaporin - 6 in the mouse inner ear by rt - pcr and immunohistochemistry . our data show that in the inner ear aquaporin - 6 is expressed , in both vestibular and acoustic sensory epithelia , by the supporting cells directly contacting hair cells . in particular , in the organ of corti , expression was strongest in deiters ' cells , which provide both a mechanical link between outer hair cells ( ohcs ) and the organ of corti , and an entry point for ion recycle pathways . since aquaporin - 6 is permeable to both water and anions , these results suggest its possible involvement in regulating ohc motility , directly through modulation of water and chloride flow or by changing mechanical compliance in deiters ' cells . in further support of this role , treating mice with salicylates , which impair ohc electromotility , dramatically reduced aquaporin - 6 expression in the inner ear epithelia but not in control tissues , suggesting a role for this protein in modulating ohcs ' responses ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 65 - year - old male reported to the clinic with a complaint of enlarged gums in relation to the right side upper and lower jaw for the past 2 years . nifedipine 30 mg bid for the past 3 years , as prescribed by his physician . history of the presenting illness revealed that the patient noticed the swelling which started before 2 years and progressed to the present stage . on intraoral examination , there was bulbous enlargement of the gingival mucosa in relation to 13 , 14 , 44 , and 45 ; surface was lobulated and reddish pink in color [ figure 1 ] . assessment of plaque accumulation was done using silness and loe plaque index ( 1964 ) which gave in a score of 3 ( marking abundance of soft matter within the gingival pocket and / or on the tooth and gingival margin ) . assessment of gingival inflammation was made using gingival index of silness and loe ( 1963 ) , which gave a score of 1 ( which includes mild inflammation , slight change in color , slight edema , and no bleeding on palpation ) . the gingival hyperplasia was graded by using angelopoulos and goaz ( 1972 ) criteria , which was graded as grade i ( which presents with hyperplastic gingiva extending to the cervical third or less of the anatomic crown ) . intra oral picture showing the bulbous enlargement of the gingival mucosa in relation to 13 , 14 , 44 , and 45there are various theories postulated in the pathogenesis of gingival enlargement due to nifedipine . among the antihypertensives , nifedipine showed higher prevalence of gingival enlargement . it starts as an enlargement of interdental papilla and later turns into a lobulated mass or nodules . it may also extend over the crown and reach occlusal heights , thereby interfering with mastication . these growths may aggravate the plaque accumulation and an increase in pocket depth formation , which adds to the problem . factors like age , genetic predisposition , pharmacological actions , dose , plaque , and oral hygiene have been attributed for gingival enlargement in nifedipine - induced gingival enlargement . younger age people show more enlargement because they have greater fibroblastic metabolism and hormonal change than the elderly . other factors like increased production of heparin sulfate glycosaminoglycan ( hspg ) , basic fibroblast growth factor ( bfgf ) , and transforming growth factor - beta ( tgf - ) were found to be increased in nifedipine - and phenytoin - induced gingival hyperplasia . calcium antagonists like nifedipine block the influx of calcium ions , thereby affecting homeostasis of collagen . the synthesis and degradation of the collagen being altered lead to the abnormal growth . with these factors , an ambiguity exists among different researchers in the pathogenesis and progression of gingival enlargement in nifedipine . our case showed gingival enlargement where teeth were present . obviously , the teeth with high plaque index were a key factor in the pathogenesis and progression of the disease in our case . in correlation with this , the edentulous areas did not show any enlargement , which proves that plaque is an essential factor in gingival enlargement due to nifedipine . the same observation was reported by eslami et al . that edentulous areas did not show signs of enlargement . the histopathology of our patient showed increased plasma cells and the other chronic inflammatory cells , proving plaque to have an inflammatory effect on gingiva resulting in gingival enlargement [ figure 2 ] . eslami et al . , in their study on 200 patients taking nifedipine , found gingival enlargement in patients with poor oral hygiene and high plaque index .10 histopathology showing hyperplastic epithelium with dense collagen fibres and chronic inflammatory cells in the connective tissue the dose of the drug also has an impact on gingival oral growth . they also found that the higher concentration of nifedipine in the gingival crevicular fluid could increase the severity of gingival enlargement . from earlier studies , it was obvious that good oral hygiene and drug dose were the main factors in gingival enlargement . gingival hyperplasia was substantially reduced by applying proper prophylactic method accompanied by plaque control measures . concluded that nifedipine - induced gingival enlargement can be prevented by periodontal treatment along with anti - inflammatory drugs like anti il - i ( interleukin - i beta ) . it was obvious from our case that poor oral hygiene along with drug dose can increase the gingival growth . . it should be mandatory that a physician should have a dental opinion before prescribing nifedipine to the patients . patients with nifedipine therapy need prophylaxis at least once in 3 months and also should have meticulous plaque control measures . it was also proved that increased drug dosage showed increased gingival enlargement , so the physician can consider altering the dose of nifedipine or combine it with other antihypertensives or substitute with other drugs .\noutput:\n" }, { "from": "agent", "value": "gingival enlargement is a common finding in a routine dental practice . though it has many etiological factors , enlargement due to drugs which are administered to treat the systemic problems is of major concern which needs attention . here , we present a case of nifedipine - induced gingival enlargement and discuss the reason for the enlargement ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: study on photosensitizers has received more and more attention . however , the effect of the photosensitization on dna , protein , cell , or even an organ should be given more attention , no matter whether the effect is harmful or helpful for the potential clinical application . it can be extracted from h. perforatum , a popular medicine for the treatment of depression . it has been used as a conventional medication for the treatment of depression and wound healing for a long time . recently , more and more interest has been given to some other important pharmaceutical potentials of this species , such as antivirus activity , anti - hiv , antibacterial activity and antitumor activity . most of the clinic functions are proposed to be related to the phototoxicity of hy . for instance , the cytotoxic activity can be greatly enhanced after light activation . the mechanism how it works is still to be explored , however , it is proposed that after being exposed in visible light at the wavelength of 540600 nm , hy will transfer light energy to oxygen to generate reactive oxygen species ( ros ) , which may further induce the apoptosis of cells . some other studies report that hy preferentially accumulates in the cell membranes , especially the mitochondria membrane , which might be the target in the photodynamic therapy . both the type i and type ii photodynamic reactions can take place in the photoactivation of hy , resulting in the formation of radicals , such as singlet oxygen and superoxide radical . in the paper , we report our studies of the photodynamic effect of hy on the structure and function of a protein by employing uv - vis spectroscopy and electrochemical methods . hemoglobin ( hb ) , a kind of heme protein , is used as the target protein for this work . on one hand , the structure and function of hb are relatively very clear , which is easier to get to know the information of the conformational and functional changes . on the other hand , it is relatively easier to design the experimental protocols , since its electrochemistry has been somewhat largely studied in our lab . besides , we have found that the reactive molecules , such as hydroxyl radical , superoxide anions , may influence the peroxidase activity of the protein , which may be ascribed to the conformational transformation of the protein . based on the data obtained in this study , we found that visible light irradiation of the protein in the presence of hy would cause the change of its conformation . and , the peroxidase activity of the protein towards hydrogen peroxide ( h2o2 ) can be obviously enhanced . since the structural and formational changes can take place after the treatment of the protein with visible light , the process of which is so common to occur , this study should be very interesting to lots of scientists in different research areas . uv - vis spectroscopy is a very helpful technique to study the conformational changes of heme proteins , since the soret band of the heme which is located at 407 nm can provide very useful information on the secondary structure of heme proteins . the position of the soret band will shift or the absorption will decrease if the structure of a heme protein is transformed . figure 1 shows that the absorption of the soret band remains almost unchanged even after 3h irradiation by visible light in the absence of hy , however , the peak will decrease evidently only after 1 hour treatment if this medicinal species is in the presence . therefore , the heme moiety of the protein can be hardly influenced only by visible light . nevertheless , irradiation treatment on hb together with hy , the structure of the protein , especially the microenvironment of the heme ring , will be changed or even be badly damaged . we propose that the ros , generated by the irradiation of hy , may react with the protein at the heme position , and change the microenvironment of the heme ring . it can be also observed from fig. 1 that the decrease of the absorption is much less significant for the case of lower hy concentration . so , the photodynamic effect of hy on hb is not only a time dependent but also a concentration dependent process . we have further employed electrochemical method to check whether the dynamic activity of hy may have any effect on the peroxidase activity of the protein . as is well known , , some other activities of this protein have also been revealed . especially in recent years , the peroxidase activity of hb has been largely studied , and these findings have been employed for the development of third - generation biosensors . based on our previous work of the preparation of protein - film modified electrodes and the fabrication of hb - based h2o2 biosensors with this protein , we have first prepared an hb - hy film modified electrode to study the catalytic activity of hb towards h2o2 . as is shown in figure 2 , the reduction peak of hb will increase gradually with the addition of h2o2 in the test solution . further studies reveal that a linear relationship between the increase of the reduction peak and the h2o2 concentration can be obtained from 110mol / l to 510mol / l , and the linear regression equation is : y = 2.15459 + 0.27599 x , r = 0.999 . in order to obtain an obvious contrast , andto more clearly show the change of the peroxidase activity of the protein , the value of the reduction peak with the addition of 110mol / l h2o2 is chosen as the baseline , and is set to be 0 . as is shown in figure 3 , the slope of the catalytic linearity is enhanced obviously after the irradiation of visible light on hb together with hy . , the slope increases with the irradiation time , which suggests that a longer time treatment on the samples will result in a higher catalytic ability of the protein . meanwhile , concentration of hy is found to be another key factor . as is shown in figure 4 , although the slopes will also increase for the case of low hy concentration , the changes are indistinct in the first two hours . and the increase is much smaller than that for the case with high hy concentration . these experimental results obtained with electrochemical method coincide very well with the results obtained by uv - vis spectroscopy , which further reveals that the photodynamic effect of hy is not only a time - dependent , but also a concentration - dependent process . from our further studies , this effect has also been known to be an oxygen - dependent process , although o2 is not required for the antivirus activity of hy . as is shown in fig .5 , if the samples are prepared and irradiated in an anaerobic situation , the catalytic slope will keep unchanged even if a 3h treatment has been made . this is reasonable , since o2 is required in a photodynamic process to generate ros , which is crucial in photoactivating hy . so , no influence of this medicinal species on the peroxidase activity of hb can be obtained without o2 being involved . these results have also confirmed that the phtosensitization of hy would be achieved only in the presence of oxygen . after absorbing the light energy , hy will be transformed to be an excited state , which may further transfer the energy to oxygen directly or indirectly , both of which induce the formation of the ros , especially the singlet oxygen . ros then react with hb , which may induce the change of the microenvironment of the heme position . as a result , the catalytic ability of the protein towards h2o2 is enhanced . in summary , with uv - vis spectroscopic and electrochemical techniques , we have found that irradiation on the mixture of hb and hy by the very common visible light can activate hy to generate ros , which will make the change of the structure of hb and enhance the catalytic activity of the protein towards the h2o2 reduction . this process depends not only on the irradiation time but also on the concentration of hy . meanwhile , o2 , which is required for the generation of ros , is also found to be a vital element in the photoactive effect . this work has not only confirmed the photosensitization of hy and revealed the enhanced peroxidase activity of hb , but also be helpful to the development of more sensitive h2o2 biosensor and the usage of this medicinal herb molecule . stock solutions were prepared by dissolving known amounts of hy in 1 ml of dimethyl sulphoxide ( dmso ) . stock solutions were prepared by dissolving known amounts of hb in 1 ml of double - distilled water . dmso and h2o2 ( 30 % ( w / v ) solution ) were provided from shanghai jinshan tingxin chemical reagent co. and nanjing chemical reagent co. , respectively . double - distilled water , which was purified with a milli - q purification system ( branstead , boston , ma , u.s.a . ) to a specific resistance of 18 m cm , was used in all the experiments , and all the solutions were stored in the refrigerator at 4 c . sample i preparation : 1l hy solution ( 0.1 mol / l ) , 5l hb ( 8 mg / ml , ph 7.0 ) and 4l tris - hcl buffer ( ph 7.0 ) were mixed in a microcentrifuge tube . sample ii preparation : 0.5 l hy solution ( 0.1 mol / l ) , 5l hb ( 8 mg / ml , ph 7.0 ) and 4l tris - hcl buffer ( ph 7.0 ) were mixed in a microcentrifuge tube . sample iii preparation : 1l hy solution ( 0.1 mol / l ) , 5l hb ( 8 mg / ml , ph 7.0 ) and 4l tris - hcl buffer ( ph 7.0 ) were mixed in a microcentrifuge tube . this sample was thoroughly deoxygenated by blowing high - purity nitrogen for at least 1 min , and then sealed by parafilm . the samples were exposed in the visible light emitted by a 200w filament lamp , which was filtered by an orange filer to get a wide band illumination above 580 nm , for 1h , 2h , 3h , respectively , at a distance of 20 cm . uv - vis spectroscopy was performed using a uv - 2550 spectrophotometer ( shimadzu , japan ) . after the treatment with visible light irradiation , the samples were then twentyfold diluted and analyzed immediately with the spectrophotometer . the substrate pyrolytic graphite ( pg ) electrode ( a = 6.28 mm ) was prepared by inserting a pg rod in a glass tube and fixing it with epoxy resin . electrical contact was made by attaching a copper wire to the rod with the help of wood 's alloy ( a fusible bismuth - based alloy ) . before the modification of the substrate electrode with hy and the protein , its surface was then polished to mirror smoothness with alumina ( particle size of approx . finally , the electrode was thoroughly washed by ultrasonicating in both double - distilled water and ethanol for approx .10 l of hy and hb mixture with their concentration being 110mol / l and 6.210 mol / l , respectively , was mixed with 10l dmso ( 20 % ) and then spread evenly on the surface of the substrate pg electrode . the hy and hb mixture had been previously treated with visible light irradiation before its immobilization onto pg electrode surface . after that , this electrode was thoroughly rinsed with double - distilled water and could be ready for use . cyclic voltammetry ( cv ) was performed with a parc 263a potentiostat / galvanostat ( eg & g ; princeton , nj , usa ) , using a three - electrode configuration at 250.5 c . the reference electrode was a saturated calomel electrode ( sce ) and the counter electrode was a platinum electrode . all the test solutions were thoroughly deoxygenated by bubbling high - purity nitrogen through the solution for at least 10 min . a stream of nitrogen was blown gently across the surface of the solution in order to maintain the solution anaerobic throughout the experiments . stock solutions were prepared by dissolving known amounts of hy in 1 ml of dimethyl sulphoxide ( dmso ) . stock solutions were prepared by dissolving known amounts of hb in 1 ml of double - distilled water . dmso and h2o2 ( 30 % ( w / v ) solution ) were provided from shanghai jinshan tingxin chemical reagent co. and nanjing chemical reagent co. , respectively . double - distilled water , which was purified with a milli - q purification system ( branstead , boston , ma , u.s.a . ) to a specific resistance of 18 m cm , was used in all the experiments , and all the solutions were stored in the refrigerator at 4 c . sample i preparation : 1l hy solution ( 0.1 mol / l ) , 5l hb ( 8 mg / ml , ph 7.0 ) and 4l tris - hcl buffer ( ph 7.0 ) were mixed in a microcentrifuge tube . sample ii preparation : 0.5 l hy solution ( 0.1 mol / l ) , 5l hb ( 8 mg / ml , ph 7.0 ) and 4l tris - hcl buffer ( ph 7.0 ) were mixed in a microcentrifuge tube . sample iii preparation : 1l hy solution ( 0.1 mol / l ) , 5l hb ( 8 mg / ml , ph 7.0 ) and 4l tris - hcl buffer ( ph 7.0 ) were mixed in a microcentrifuge tube . this sample was thoroughly deoxygenated by blowing high - purity nitrogen for at least 1 min , and then sealed by parafilm . the samples were exposed in the visible light emitted by a 200w filament lamp , which was filtered by an orange filer to get a wide band illumination above 580 nm , for 1h , 2h , 3h , respectively , at a distance of 20 cm . uv - vis spectroscopy was performed using a uv - 2550 spectrophotometer ( shimadzu , japan ) . after the treatment with visible light irradiation , the samples were then twentyfold diluted and analyzed immediately with the spectrophotometer . the substrate pyrolytic graphite ( pg ) electrode ( a = 6.28 mm ) was prepared by inserting a pg rod in a glass tube and fixing it with epoxy resin . electrical contact was made by attaching a copper wire to the rod with the help of wood 's alloy ( a fusible bismuth - based alloy ) . before the modification of the substrate electrode with hy and the protein , its surface was then polished to mirror smoothness with alumina ( particle size of approx . finally , the electrode was thoroughly washed by ultrasonicating in both double - distilled water and ethanol for approx .10 l of hy and hb mixture with their concentration being 110mol / l and 6.210 mol / l , respectively , was mixed with 10l dmso ( 20 % ) and then spread evenly on the surface of the substrate pg electrode . the hy and hb mixture had been previously treated with visible light irradiation before its immobilization onto pg electrode surface . the modified electrode was dried overnight at room temperature in the dark . after that , this electrode was thoroughly rinsed with double - distilled water and could be ready for use . cyclic voltammetry ( cv ) was performed with a parc 263a potentiostat / galvanostat ( eg & g ; princeton , nj , usa ) , using a three - electrode configuration at 250.5 c . the reference electrode was a saturated calomel electrode ( sce ) and the counter electrode was a platinum electrode . all the test solutions were thoroughly deoxygenated by bubbling high - purity nitrogen through the solution for at least 10 min . a stream of nitrogen was blown gently across the surface of the solution in order to maintain the solution anaerobic throughout the experiments .\noutput:\n" }, { "from": "agent", "value": "hypericin , extracted from h. perforatum , can induce the generation of reactive oxygen species by visible light irradiation , which may consequently induce the conformational change of hemoglobin . we have not only employed uv - vis spectroscopy to observe the changes of uv - vis spectra of the protein , which reveals the conformational changes of the protein , but also employed electrochemical method to obtain its enhanced peroxidase activity . the photodynamic effect of hypericin on the conformation and catalytic activity of the protein has also been proven to be strongly dependent on the irradiation time , the hypericin concentration and the presence of oxygen . this work is beneficial not only to the fabrication of more sensitive hydrogen peroxide biosensor , but also to the guidance of the usage of this medicinal herb molecule , since the conformational change of the protein and the enhanced peroxidase can be easily obtained only by visible light irradiation on hypericin , the process of which is so common to happen ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: substance abuse in adolescents and its often tragic consequences , including addiction , is one of the preventable major public health problems . because of not yet fully development in parts of the adolescent s brain that responsible for judgment , decision making , emotion and impulse control , they are more likely than adults to take risks , including experimenting with addictive substances and engaging in dangerous behaviors while under their influence , and highly susceptible to external social influences to engage in risky behaviors ( 13 ) . the younger an individual is at the onset of the substance abuse , the more risk developing substance use disorders and continuing into adulthood . over 90 percent of adults diagnosed with substance use disorders have experienced drug use before age 18 and half of them before age 15 ( 47 ) . teenager s substance abuse linked to some of the barriers to health and productivity such as poor grades in school , drop out of high school , unsafe sexual activity , accidents , homicides , suicides , violence and self - injury ( 815 ) . the center on addiction and substance abuse ( casa ) in united states ( 16 ) reported that at least three out of four high school students in america ( 75.6 percent ) have used one or more addictive substances . nearly three - quarters ( 72.5 percent ) have drunk alcohol , nearly half ( 46.3 percent ) have smoked cigarettes , more than a third ( 36.8 percent ) have used marijuana and 6.4 percent have used cocaine . because of social , religious , cultural and economical reasons , consumption of addictive substances in iran is different from other countries especially western countries and using opium is more prevalent . totally , there is a limited amount of information available on adolescent s substance abuse in iran . the results of one study which was conducted on 10th grade male students in shiraz in 2003 showed that 32 % of students had experienced alcohol consumption and 2.1 % of them had lifetime drug abuse ( 17 ) . another study conducted on 10th grade male students in tabriz in 2005 and 2006 longitudinally showed that 12.7 % of students had ever used alcohol and 2.0 % had used drugs . in addition , during one year follow - up , among students without experience of alcohol use , 10.1 % reported using alcohol , and among students without experience of drug abuse , 2.2 % reported using drugs ( 15 ) . tabriz is the center of east azerbaijan province , which based on 2006 census , the population of this city was about 1.4 million people and about 12 % of them were in age group of 1419 years old . the aims of this paper related to the first phase of a longitudinal study about smoking and substance abuse in a large random sample of adolescents are to estimate the prevalence of substance abuse in tabriz and to evaluate its some associated factors . this cross - sectional school - based study is the first phase of a longitudinal study about smoking and substance abuse in adolescents . a representative sample of 10th - grade students in tabriz ( northwest of iran ) was studied during november and december 2010 . the reason for limiting the subjects to 10th - grade students was the more potential to track individuals in the second phase of the study . totally 5106 high school students on a clustered and stratified , multi - stage proportionally sample were selected from 57 randomly selected schools . two hundred and three students were excluded from the study due to absent in the day of completion of questionnaire , refusal of responding and incomplete questionnaires . the questionnaire approved by ethics committee of tabriz university of medical sciences and research committee of the east azerbaijan province education organization . the aim of the questionnaire was obtaining information on demographical characteristics , substance abuse , socio - economical information , cigarette smoking behavior , general risk taking behavior , self - esteem , attitude towards smoking and self - injury . substance abuse measured by combining respondent s lifetime use of illicit drugs such as cannabis , opium , ecstasy and methamphetamines . any use of these substances was sufficient for that individual to be classified as having used drugs . socioeconomic status was built by using the father education , mother education , the family assets and the family income . by using principal component analysis , this measure graded students into very high , high , middle , lower and much lower socioeconomic status levels . according tothe kaplan et al . ( 18 ) study , cigarette smoking status was considered in three stages as : never smoker : adolescent who have never tried cigarettes , not even a few puffs.experimenter : adolescent who indicated having tried or experimented with cigarette smoking , even a few puffs , but have smoked less than 100 cigarettes.regular smoker : adolescent who indicated smoking 100 cigarettes or more in lifetime irrespective of current smoking status . never smoker : adolescent who have never tried cigarettes , not even a few puffs . experimenter : adolescent who indicated having tried or experimented with cigarette smoking , even a few puffs , but have smoked less than 100 cigarettes . regular smoker : adolescent who indicated smoking 100 cigarettes or more in lifetime irrespective of current smoking status . general risk taking behavior was assessed according kaplan et al. ( 18 ) by following question : do you enjoy doing things that are a little dangerous or risky ? respondents with answeringwe assessed self - esteem by using persian version of the rosenberg ( 19 ) self - esteem questionnaire that ranged from 10 to 40 , with lower scores indicating higher self - esteem . in pilot study with 23 grade - 10 students testretest correlation , with 2 - week interval , was 0.80 ( cronbach s alpha 0.81 ) . according to hill et al . ( 20 ) , attitude toward cigarette smoking was assessed by 6 - item questionnaire that produce a potential range of 12 to + 12 , which higher scores indicating positive attitude . retest pearson correlation of the persian version of this test in 23 grade - 10 students , with 2 - week interval , was 0.78 ( cronbach s alpha 0.89 ) . ninety - five percent of the confidence interval was calculated for prevalence of substance abuse . the chi - square tests , fisher exact test , independent t - test and logistic regression model were used for evaluating factors associated with substance abuse . this prevalence was statistically significant between boys and girls ( p 0.001 ) . among 2091 boys 50 ( 2.4 % , 95 % ci : 1.83.1 ) and among 2799 girls 17 ( 0.6 % ,95 % ci : 0.41.0 ) had ever substance abuse . among all substances which used 17 ( 25.4 % ) , 28 ( 41.8 % ) , 21 ( 31.3 % ) , 10 ( 14.9 ) and 12 ( 17.9 % ) cannabis , opium , ecstasy , methamphetamines ( called as shisheh in iran ) and other drugs , respectively . table 1 presents the demographic characteristics and risk variables of the total sample , as well as the conditional distribution of drug abuse at each level of the variables . a logistic model was used to evaluate the association of all significant variables at level of 0.2 in bivariate analysis . the results of this analysis indicate that after adjusting for other factors , gender ( male / female ) ( or = 2.13 ) , older age ( or = 1.43 ) , being in the mathematics and physics major ( protective effect ) , not living with parents ( or = 2.34 ) , having general risk taking behavior ( or = 2.26 ) , higher smoking stage ( or = 2.39 ) , higher self - esteem score that shows lower level of self - esteem ( or = 1.09 ) and positive attitude toward smoking ( or = 1.08 ) were factors associated with student s ever use of substance ( table 2 ) . the prevalence of substance abuse was 1.4 % ( 2.4 % for boys and .6 % for girls ) , which was consistent with a previous surveys of 10th grade male students conducted in shiraz ( 17 ) and tabriz ( 15 ) . in comparison to the other countries ( 16 , 2123 ) , the prevalence of substance abuse was considerably low in our study . lower substance abuse rates among adolescents in iran are mostly related to legal prohibition of illicit drugs , cultural values of iranian families against substance abuse especially among adolescents ; and strong parental disapproval of drug abuse by children . based on our resultsthe multi - variables logistic regression model showed that being a boy increased the odds of substance abuse experience by more than 2 times . in the united states , males and females high school students are equally likely to be current users of addictive substances ( 16 ) . generally in the world the rate of substance abuse and dependence is higher among men than it is among women ( 24 ) . women typically begin using substances later than do men , are strongly influenced by spouses or boyfriends to use ( 24 ) . moreover , due to social norms and cultural values in iran , the rates of substance abuse in women are much less than men . there is a strong association between the adolescent age and substance abuse ( 16 , 25 ) . in the present study the prevalence of substance abuse significantly increased by age of students and despite very low age variability and after controlling other variablessubstance abuse in adolescents is as a barrier to successful academic performance and academic achievement . smoking , alcohol and other drug users even those who have ever used these substances - tend to have worse scores and poorer school performances than other students ( 2628 ) . our findings showed that the mean of previous year average grades of substance abused students was lower than other students . however , after adjusting to other variables , this variable was not associated with student s substance abuse . on the other hand , our results showed that substance abuse was related to educational major which in iran selection of educational major strongly is associated with students grades . living with single parent or in divorced familiessubstance use in adolescents who live with a stepmother or stepfather are more than adolescents who live with both of their biological parents ( 29 ) . our results showed that the risk of substance abuse in students who do not live with both of their biological parents increased by 2.34 times . however , there are a number of studies that did not find association between substance abuse and living with both parents ( 15 , 30 ) . adolescents are more likely than adults to take risks , including experimenting with addictive substances and engaging in dangerous behaviors . similarly to other numerous studies ( 15 , 18 , 30 ) , the results of our study showed that having general risk taking behaviors is related to adolescent s substance abuse . kandel and yamaguchi ( 31 ) have argued that smoking increases the risk of onset of drug abuse . ( 15 ) found that the incidence rate of alcohol use and drug abuse were higher in smoker teens . results of the present study also indicated that student s substance abuse relates to their smoking status . adolescents with positive attitude toward smoking and substance use and adolescents with generally negative feelings about themselves which characterized as low self - esteem are more susceptible to substance abuse . in consistent to other studies ( 3235 ) , our results showed that positive attitude toward smoking and self - esteem score is related to substance abuse in students . the strength of present study was large sample size and representativeness of sample to 10 - grade students in tabriz . it is ; however , better to note the limitations of the present study too . first , limitation of the sample to 10th grade students limits the generalizability of the results to the whole adolescents . although we went to great lengths to ensure confidentiality and anonymity , we had no way of assessing underreporting of substance use . in addition , our study does not include students who drop out of school which numerous studies have been showed that the prevalence of substance abuse in these persons is more than other students ( 9 , 36 ) . therefore , the estimated prevalence of substance abuse reported above may thus represent lower estimates of the actual prevalence . finally , the cross - sectional nature of study limits the conclusions about associations between the correlates and substance abuse . our results has shown low prevalence of substance abuse in iranian adolescents and determined some of its associated factors . with considering the high prevalence of addiction in the iranian adult population , longitudinal studies in adolescent s samplesethical issues ( including plagiarism , informed consent , misconduct , data fabrication and / or falsification , double publication and / or submission , redundancy , etc ) have been completely observed by the authors .\noutput:\n" }, { "from": "agent", "value": "background : substance abuse in adolescents and its often tragic consequences , including addiction , is one of the preventable major public health problems . the aims of this paper were to estimate the prevalence of substance abuse and to evaluate its some associated factors in adolescents of tabriz city ( northwest of iran ) . methods : a self - administered questionnaire was completed in 4903 randomly selected students with mean age of 15.7 years old . the aim of the questionnaire was obtaining information on substance abuse , socio - economical information , cigarette smoking behavior , general risk taking behavior , self - esteem , attitude towards smoking and self - injury as well as demographical characteristics.results : prevalence of substance abuse was 1.4 % ( 95 % ci : 1.11.7 ) which was different statistically significant between boys ( 2.4 % ) and girls ( 0.6 % ) ( p < 0.001 ) . older age ( or = 1.43 ) , not living with parents ( or = 2.34 ) , having general risk taking behavior ( or = 2.26 ) , higher smoking stage ( or = 2.39 ) , lower self - esteem ( or = 1.09 ) and positive attitude toward smoking ( or = 1.08 ) were factors associated with student s ever use of substance.conclusion : the result has shown low prevalence of substance abuse in iranian adolescents . our findings showed some associated factors such as lower self - esteem with adolescent s substance abuse ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tuberous sclerosis complex ( tsc ) is a genetic disorder that can affect almost all organ systems . renal manifestations occur with high frequency , the most prevalent being angiomyolipoma ( aml ) . tsc - associated amls tend to be larger , more numerous , and more likely to cause spontaneous hemorrhage compared with sporadic amls . removal of renal calculi from kidneys with amls is particularly difficult because these tumors increase the potential for hemorrhage . we report the case of a 65 - year - old man with tsc - associated aml and a renal calculus greater than 4 cm in his left kidney . the calculus was successfully removed by retrograde flexible ureterorenoscopy ( f - urs ) with holmium laser lithotripsy . he was previously diagnosed with tsc after being identified with the typical features , such as dermatological lesions ( facial angiofibroma , ungual fibromas , and hypomelanotic macules on the toes ) , subependymal nodules , and multiple amls in both kidneys . while there was no family history of tsc , the patient had childhood epilepsy . he also experienced two episodes of hypovolemic shock concomitant with extensive retroperitoneal hemorrhage caused by spontaneous aml rupture , once in each kidney . following the second episode , which occurred in the left kidney , he developed sepsis caused by staphylococcus aureus , which was isolated from both venous blood and urine . blood counts were within normal limits except for a low red blood cell count ( 33110 / mm ; normal , 4301057010 / mm ) , low hemoglobin ( 9.5 g / dl ; normal , 13.517.0 g / dl ) , and a low hematocrit value ( 30.4 % ; normal , 40 % 50 % ) . serum creatinine level was 1.0 mg / dl ( normal , 0.61.1 mg / dl ) . ureter bladder ( kub ) radiography revealed a 4316 mm renal calculus in the left kidney [ figure 1a ] . intravenous pyelography revealed that the calculus filled the pelvis and lower calyx , causing dilatation of the upper calyx [ figure 1b ] . abdominal enhanced computed tomography ( ct ) demonstrated a significant bilateral renal aml burden in addition to the renal calculus in the left kidney [ figure 2 ] . we decided to remove the renal calculus for several reasons , including the present clinical symptoms and a previous history of urinary tract infection . minimally invasive retrograde f - urs with holmium laser lithotripsy was chosen because multiple renal amls have hemorrhagic potential . ( a ) kub radiography reveals a lower pole renal calculus in the left kidney . ( b ) intravenous pyelography shows the calculus causing dilatation of the upper calyx abdominal enhanced computed tomography demonstrates significant bilateral renal aml burden and a large renal calculus in the left kidney a 6.9 - fr f - urs , a 10 - fr ureteral access sheath , and a 200 - holmium : yag laser fibers were used for treatment . we attempted to vaporize the stone by painting the laser fiber over the stone surface . a 1.9 - fr nitinol basket , which minimizes the loss of deflection during f - urs , was used to extract large fragments and reposition them from the lower pole calyx into a position more readily accessible by the laser fiber , such as the renal pelvis or upper pole calyx . no evidence of greater than 2 - mm residual stones was observed before removal of the ureteral stent in postoperative kub radiography . three months after surgery , kub radiography confirmed the absence of any residual stones [ figure 3 ] , and urinalysis was also revealed normal findings . three months after flexible ureterorenoscopy , follow - up kub radiography confirms the absence of any residual stonesrakowski et al . reported renal lesions in 57.5 % tsc patients ; of these , aml was present in 85.4 % , cysts in 44.8 % , and renal cell carcinoma in 4.2 % . tsc - associated aml is more likely to cause spontaneous hemorrhage compared with its sporadic counterpart , with a hemorrhagic risk of 25 % to 50 % . tsc patients are also predisposed to nephrolithiasis because of both the disease and its treatments . for example , drugs like topiramate have proven to be effective for some forms of tsc - associated epilepsy ; however , they also increase the risk of nephrolithiasis . patients are also at higher risk for renal cystic disease because disruption of distal tubular function by a significant cyst burden leads to hypocitraturia . our patient was not undergoing any treatment for epilepsy , and ct demonstrated no evidence of renal cystic lesions . traditional surgical treatment of renal calculi , including minimally invasive procedures like percutaneous nephrolithotomy ( pnl ) or extracorporeal shockwave lithotripsy ( eswl ) , may lead to bleeding in patients with renal amls . pnl remains a milestone technique with a high success rate and with a low percentage of major complications ; however , the blood transfusion rate reported varies from 11.2 % to 17.5 % . pnl involves puncture and dilation of the renal collecting system via the renal parenchyma and poses an unacceptable risk of hemorrhage in kidneys with aml , although there are two reported cases of pnl performed directly through a renal aml . on the other hand , eswl requires large numbers of shock waves , which can lead to capillary damage with parenchymal or subcapsular hemorrhage ; eswl - induced retroperitoneal bleeding has been reported in a patient with renal aml . recent studies have evaluated f - urs as an alternative treatment for patients with contraindications to pnl or eswl , such as pregnant woman , obese patients , or those with coagulopathy . indeed , f - urs using pulsed laser energy can fragment stones with less risk of hemorrhage . furthermore , f - urs is a minimally invasive procedure that can treat 2 - cm renal calculi with a low morbidity and high success rate . our case and other reported cases indicate that f - urs can also safely treat larger stones . however , the management of lower pole renal calculi with f - urs remains debatable because of limited access and poor clearance of stone fragments . by the current literature , pnl should be considered the first line of treatment for greater than 2 - cm lower pole renal calculi . further advances in endoscopic technology and techniques are required to resolve the limitations of f - urs , including the technical difficulty in removing large stones , intrarenal influx with infected stones , and prolonged surgical duration . in conclusion , retrograde f - urs with holmium laser lithotripsy is an effective , minimally invasive therapy for patients at high risk of renal hemorrhage .\noutput:\n" }, { "from": "agent", "value": "renal calculi in patients with renal angiomyolipomas are difficult to treat because of the hemorrhagic potential of these tumors . we describe the case of a 65 - year - old man having tuberous sclerosis complex - associated multifocal renal angiomyolipomas with a large renal calculus . the patient presented with left flank dullness and a previous history of spontaneous angiomyolipoma rupture . intravenous pyelography revealed a 43 16 mm calculus in the pelvis and lower calyx of the left kidney . the calculus was successfully removed by retrograde flexible ureterorenoscopy and holmium - yag lithotripsy . flexible ureterorenoscopy is an effective , minimally invasive therapy for patients at high risk of renal hemorrhage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: thousands of dental restorations are placed everyday in children by dentists , dental students and ancillary personnel with reasonable clinical background knowledge in the management of dental caries . these restorations are performed at any time and place on the planet earth , yet it is well known that the earth does not have uniform climatic conditions . what might not be so clear to the operators involved in restoring the teeth is whether the different climatic conditions are able to influence the survival outcomes of these restorations . changes in environmental temperatures and humidity , among other changes , could have a potential influence on the restorative material used and subsequently on the survival results of the restorations made out of them . it is , therefore , possible that defective proportionation and mixing process could result in poor material mixture consistency and , consequently , changes in the integrity of the restoration . glass ionomer cement ( gic ) is a restorative material that is mixed prior to placing it in the prepared cavity . the material sets through a simple acid base chemical reaction . during the mixing stage of the material , the powder part is combined with the liquid part thus commencing the setting phase of the material . on exposure to aqueous solution , the cement powder part of the material reacts with the polycarboxylic acid part , setting up an acid base reaction that ensues in the formation of a bonding matrix . initially , the polycarboxylic acid dissociates into negatively charged carboxylate anions ( rcoo - ) and positively charged protons ( h + ) . the h + reacts with the surface of the glass filling of the gic material , the cement - forming metal ions , i.e. al3 + and ca2 + . in the presence of water , these ions activate the primary setting phase of the gic reaction that forms a salt gel and complexes with the carboxylate residues of the polycarboxylic acid component . the second stage follows with the release of aluminum ions that get incorporated into the pre - formed matrix to result in a three - dimensional , water - insoluble calcium aluminum carboxylate gel that is no longer susceptible to moisture or dehydration . changes in ambient temperature , the presence of water , the powder particle size and powder / liquid ratio of the material , the mode of mixing the material and the presence of other chemicals like fluoride material and tartaric acid are likely to influence the rate of this reaction process . the use of gic with the atraumatic restorative treatment ( art ) approach for the management of dental caries , especially in the primary dentition , is well documented . the art approach involves the removal of dental caries with exclusive use of hand instruments and restoring the cavity formed and sealing the adjacent fissures using gic , an adhesive restorative material . the ease of mixing the gic material , the self - setting properties , biocompatibility with the oral tissues and fluoride release mechanisms make gic an ideal material for use with the art approach in the prevention and management of dental caries . ideally , restorations placed in the primary dentition should last until the teeth exfoliate , meaning a maximum period of approximately 8 years . good survival results have been obtained in single - surface art restorations , but not in multi - surface art restorations . short - term studies ( evaluation after 1 year ) using the art approach have indicated success rates of approximately 80 - 95 % for class i and 30 - 75 % for class ii restorations . long - term studies ( evaluation after more than 2.5 years ) have reported success rates of approximately 43.4 - 86.1 % for class i and 12.2 - 82.1 % for class ii restorations . the causes of the art restoration failures have been found to be multi - factorial and include operator factors like improper caries removal , deficiency in proportionation of the material , poor mixing of gic , material handling time and poor application of the restorative material , the type of cavity to be restored , the experience of the operator / assistant , poor tooth isolation method and the consistency of the food taken soon after placing the restoration . the aim of the present study was to determine what influence the ambient temperature and the mixing time of gic material have on the survival rate of proximal art restorations placed in primary molars . a total of 804 children aged 6 - 8 years from 30 local schools in matungulu and kangundo , machakos county in kenya , participated in the study that lasted for 2 years ( 2006 - 2008 ) . random numbers were used to select the children who participated in the study , out of a group that had been previously selected on the basis of having appropriate proximal carious lesions restorable using the art approach . the selection of teeth was performed by trained , experienced and pre - tested examiners using the criteria described by kemoli et al . written consents were obtained from the parents / guardians and the children also assented to it , prior to their inclusion into the study . the study received ethical approval from the university of nairobi and kenyatta national hospital ethical committee prior to its commencement . one proximal cavity was restored in each of the participating children , and then followed . the restoration phase took place in a specially prepared classroom at each of the 30 schools that participated in the study . fuji ix ( gc europe ) , ketac molar easymix ( 3 m espe , ag ) and ketac molar applicap ( 3 m espe , ag ) were the three gic materials that were randomly used during the study to restore the carious primary molars . two tooth isolation methods were randomly applied ( rubberdam ; medium - dark , hygienic dental dam , hcm - hygienic corporation , malaysia ) with a rubber dam clamp ( fit - kofferdam klammer , u67 , hager and werken gmbh and co. , kg germany ) and cotton wool roll ( hartmann celluron , de - paul hartmann ag - 89522 , helderheim , germany ) . two sets of operators and assistants categorized as experienced and inexperienced as described by kemoli et al . experienced and four inexperienced operators assisted by four experienced and four inexperienced assistants participated in the operative phase . by rotation , one assistant always rested each day of the restorative phase . before taking part in the study , all the operators and assistants received adequate training and practice for their respective category . the operators were composed of dentists , final - year dental students and community oral health officers , whereas the assistants were community oral health officers and dental assistants . during the restoration phase , the child lay prone on a table / desk with the head supported with a pillow and the operator sitting on an ordinary chair placed at the head of the table / desk . using natural sunlight augmented with an artificial battery - powered headlamp , the operator isolated the cavity and widened the cavity access and removed enamel overhangs with a hatchet and the soft dentine within the cavity was removed using a spoon excavator aided by a caries - detector dye . wet and dry cotton pellets were utilized to clean and dry the prepared cavity before a matrix band ( union broach moyco ) was applied to the tooth and held interdental with wooden wedges ( sycomore interdental wedges no . the cavity size was measured through its center in the mesio - distal and bucco - lingual directions using michigan o with william 's markings periodontal probe in the same manner as described by kemoli and van amerongen . for deep cavities , a thin layer of calcium hydroxide ( dycal , caulk ) was applied at the deepest point before pre - treating the dentine surfaces of the tooth for 15 s using the diluted part of the liquid for fuji ix and the manufacturer 's conditioner for the other two materials . once the assistant had finished mixing the gic material , either manually ( fuji ix and ketac molar easymix ) or mechanically at 4300 oscillations per minute using a duomat 2 amalgamator , germany ( ketac molar applicap ) in accordance with the instructions of the manufacturer , the material was handed to the operator to restore the prepared cavity . once the operator had placed adequate gic material into the cavity and slightly overfilling the cavity , the operator applied petroleum jelly over the gloved finger and pressed the material firmly into the cavity and over the adjacent fissures in a technique referred to as finger press . the excess gic material was removed using the applier before the occlusion was corrected with the use of a spoon excavator and with the aid of articulating paper ( bausch articulating paper , nashua , nh03060 , usa ) . the assistant then recorded the time taken to mix the material and the time taken by the operator to complete restoring the cavity . for the mechanical mixing , although the time was constant , it was still recorded . the ambient temperature at the time of completing the restoration was also recorded by the assistant . afterwards , the child was released with specific instructions not to eat within the next hour . the restorations were clinically evaluated soon after placement ( within 2 h ) , after 1 week , 1 month , 5 months and then 6 - monthly for the remaining period of 2 years using the criteria described in table 1 . the criteria used to evaluate the survival of the proximal restorations the evaluators , who were final year dental students , were trained and calibrated in the manner described by kemoli et al . during the evaluation , the principal investigator ( pi ) the results of the calibrations showed a mean kappa value of kappa 0.92 ( n = 20 ) . the mean kappa values for the evaluations ranged from 8.4 to 0.86 ( n = 52 - 63 ) , with the mean inter - evaluator consistency of kappa 0.82 - 0.92 ( n = 48 - 52 ) . the daily intra - examiner agreements on 10 % of the restorations evaluated ranged from kappa 0.80 to 1.0 . spss ( spss inc , chicago , il , usa ) data entry computer program was used to process the data collected in the study . chi - square , kaplan meier survival analysis and cox proportional hazard tests with the significant value pegged at p 0.05 were used for comparison of the survival rate of the restorations in relation to the type of gic material , operator and dental assistant experience , the method of tooth isolation , the mixing time for the material and temperature at the time of finishing the restoration . a total of 804 children aged 6 - 8 years from 30 local schools in matungulu and kangundo , machakos county in kenya , participated in the study that lasted for 2 years ( 2006 - 2008 ) . random numbers were used to select the children who participated in the study , out of a group that had been previously selected on the basis of having appropriate proximal carious lesions restorable using the art approach . the selection of teeth was performed by trained , experienced and pre - tested examiners using the criteria described by kemoli et al . written consents were obtained from the parents / guardians and the children also assented to it , prior to their inclusion into the study . the study received ethical approval from the university of nairobi and kenyatta national hospital ethical committee prior to its commencement . one proximal cavity was restored in each of the participating children , and then followed . the restoration phase took place in a specially prepared classroom at each of the 30 schools that participated in the study . fuji ix ( gc europe ) , ketac molar easymix ( 3 m espe , ag ) and ketac molar applicap ( 3 m espe , ag ) were the three gic materials that were randomly used during the study to restore the carious primary molars . two tooth isolation methods were randomly applied ( rubberdam ; medium - dark , hygienic dental dam , hcm - hygienic corporation , malaysia ) with a rubber dam clamp ( fit - kofferdam klammer , u67 , hager and werken gmbh and co. , kg germany ) and cotton wool roll ( hartmann celluron , de - paul hartmann ag - 89522 , helderheim , germany ) . two sets of operators and assistants categorized as experienced and inexperienced as described by kemoli et al . experienced and four inexperienced operators assisted by four experienced and four inexperienced assistants participated in the operative phase . by rotation , one assistant always rested each day of the restorative phase . before taking part in the study , all the operators and assistants received adequate training and practice for their respective category . the operators were composed of dentists , final - year dental students and community oral health officers , whereas the assistants were community oral health officers and dental assistants . during the restoration phase , the child lay prone on a table / desk with the head supported with a pillow and the operator sitting on an ordinary chair placed at the head of the table / desk . using natural sunlight augmented with an artificial battery - powered headlamp , the operator isolated the cavity and widened the cavity access and removed enamel overhangs with a hatchet and the soft dentine within the cavity was removed using a spoon excavator aided by a caries - detector dye . wet and dry cotton pellets were utilized to clean and dry the prepared cavity before a matrix band ( union broach moyco ) was applied to the tooth and held interdental with wooden wedges ( sycomore interdental wedges no . the cavity size was measured through its center in the mesio - distal and bucco - lingual directions using michigan o with william 's markings periodontal probe in the same manner as described by kemoli and van amerongen . for deep cavities , a thin layer of calcium hydroxide ( dycal , caulk ) was applied at the deepest point before pre - treating the dentine surfaces of the tooth for 15 s using the diluted part of the liquid for fuji ix and the manufacturer 's conditioner for the other two materials . once the assistant had finished mixing the gic material , either manually ( fuji ix and ketac molar easymix ) or mechanically at 4300 oscillations per minute using a duomat 2 amalgamator , germany ( ketac molar applicap ) in accordance with the instructions of the manufacturer , the material was handed to the operator to restore the prepared cavity . once the operator had placed adequate gic material into the cavity and slightly overfilling the cavity , the operator applied petroleum jelly over the gloved finger and pressed the material firmly into the cavity and over the adjacent fissures in a technique referred to as finger press . the excess gic material was removed using the applier before the occlusion was corrected with the use of a spoon excavator and with the aid of articulating paper ( bausch articulating paper , nashua , nh03060 , usa ) . the assistant then recorded the time taken to mix the material and the time taken by the operator to complete restoring the cavity . for the mechanical mixing , although the time was constant , it was still recorded . the ambient temperature at the time of completing the restoration was also recorded by the assistant . afterwards , the child was released with specific instructions not to eat within the next hour . the restorations were clinically evaluated soon after placement ( within 2 h ) , after 1 week , 1 month , 5 months and then 6 - monthly for the remaining period of 2 years using the criteria described in table 1 . the criteria used to evaluate the survival of the proximal restorations the evaluators , who were final year dental students , were trained and calibrated in the manner described by kemoli et al . during the evaluation , the principal investigator ( pi ) the results of the calibrations showed a mean kappa value of kappa 0.92 ( n = 20 ) . the mean kappa values for the evaluations ranged from 8.4 to 0.86 ( n = 52 - 63 ) , with the mean inter - evaluator consistency of kappa 0.82 - 0.92 ( n = 48 - 52 ) . the daily intra - examiner agreements on 10 % of the restorations evaluated ranged from kappa 0.80 to 1.0 . spss ( spss inc , chicago , il , usa ) data entry computer program was used to process the data collected in the study . chi - square , kaplan meier survival analysis and cox proportional hazard tests with the significant value pegged at p 0.05 were used for comparison of the survival rate of the restorations in relation to the type of gic material , operator and dental assistant experience , the method of tooth isolation , the mixing time for the material and temperature at the time of finishing the restoration . the restoration phase of the study lasted 3 weeks , spread over a period of 1.5 months . from the initial number of participants of 804 aged 6 - 8 years , at the end of 2 years , a total of 648 participants aged 8 - 10 years could be evaluated , with the rest having fallen out due to various reasons ranging from absenteeism , truancy and one death . most of the restored teeth were in the mandibular arch ( 66.8 % ) , with the rest drawn from the maxillary arch . the initial evaluation of the proximal restorations in the study showed an initial cumulative survival rate of 94.4 % , which dropped to 30.8 % after 2 years . during the 2 years when the restorations were followed , no significant differences were noted in the survival rates of the restorations in relation to the type of gic material used . operators when related to the inexperienced operators , and the difference was statistically significant ( log - rank , chi - square 92.04 , 1 df , p = 0.15 ) . the cumulative survival of the restorations placed using rubber dam were much higher when related to those where cotton wool rolls were used , and the difference was statistically significant irrespective of the jaw in which the restoration was placed , the operator and the assistant experience used in placing the restorations ( cox ph model , p 0.05 ) . in the present study , the assistants did all the mixing of the gic materials that were used in restoring the cavities besides documenting the mixing and restoration times . analysis of the survival rate of the proximal restorations in relation to the experience of the assistant indicated that experiencedassistants were associated with significantly higher survival rate of the restorations they helped place when related to the inexperienced assistants ( log - rank , chi - square 12.41 , 1 df , p = 0.0004 ) . further , the results indicated that there was a significant interaction ( log - rank = chi - square of 15.8181 , 3 df , p = 0.0012 ) between the assistant and the operator experience , and that the inexperience of both the operator and the assistant increased the failure rate of the restorations . the mixing times for all the assistants during the restoration phase ranged from 11 s to 2 min , with a mean value of 30 s ( sd 0.25 ) . the mixing times , recorded by the assistants , were categorized as less than 30 s , 30 - 60 s and more than 60 s. the majority of the mixing times were found within either the less than 30 s or the 30 - 60 s categories . the grouped times were related to the survival rate of the restorations as shown in figure 1 . when the survival rate of the restorations was related to the mixing times as grouped , no statistical significant difference was detected ( cox proportional hazards model , est = -0.112 , se = 0.607 , chi - square = 0.034 , p = 0.853 ) . however , the highest survival rate of the restorations was associated with the mixing times between 30 and 60 s , followed by those where the mixing times were below 30 s. the experienced assistants were also associated with a higher survival rate of the restorations , and their mixing times fell between 30 and 60 s [ figure 1 ] . the majority of the inexperienced assistants inched toward achieving these times toward the end of the restorative phase of the study [ figure 1 ] , when the survival rate of the restorations they helped in placing became closer or equal to those of the experienced assistants . the time taken for the assistant to deliver the material to the operator and for the operator to restore the tooththere was no significant statistical difference ( chi - square , p 0.05 ) . assistants was higher and statistically significant ( chi - square , p 0.05 ) when related to those bymeier survival analysis for 2 years with regard to the assistant experience , the week of the restoration and the time taken in seconds to mix the glass ionomer cement material during the restoration phase of the study multiple logistic model with backward selection for the best model of dichotomized restoration survival in relation to factors as size of restoration , gic material , isolation method , mixing time , the week when restoration was done and the assistant used showed that there was a significant intercept ( df = 1 , est = -1.0516 , se = 0.2907 , chi - square = 13.086 , p = 0.0003 ) . the survival rate of the restorations in relation to the these factors was statistically significant with regard to restoration size df = 1 , est = 0.017 , se = 0.00611 , chi - square = 7.7033 , p = 0.0055 ) , rubber dam isolation method ( df = 1 , est = -0.1673 , se = 0.0850 , chi - square = 3.8694 , p = 0.0492 ) and assistant experience ( df = 1 , est = 0.2028 , se = 5.6875 , p = 0.0171 ) and the week when restored ( df = 1 , se = 0.2954 , chi - square = 0.1136 , wald = 0.2954 , p = 0.0093 ) . however , this model for predicting the best survival of the proximal art restorations found that the mixing time did not significantly affect the survival of these restorations ( df = 1 , se = -0.0875 , chi - square = 0.3337 , wald test = 0.0612 , p = 0.8046 ) . during the restoration phase , the temperature at the time of placing the restoration ranged from 19c to 31c , with a mean temperature of 24.5 c ( 5 ) . the temperatures were grouped as less than 20c , 20 - 30c and above 30c . when the survival rate of the proximal restorations was related to the ambient temperatures as grouped , there was no significant statistical difference noted . however , those restorations placed when the ambient temperatures were close to the manufacturer 's recommended temperature that was within the group 20 - 30c , had the highest survival rate . when the tooth isolation method , assistant experience , dental arch , temperature and mixing time as factors were again fitted in the cox proportional hazards model test , the results were as shown in table 2 . the parameter estimates from the cox proportional hazards model for survival of the restorations in relation to the isolation method , assistant experience , dental arch in which restoration was placed , ambient temperature and mixing time as risk factors from table 1 , the experienced assistants and the use of the rubber dam isolation method appeared to reduce the risk of failure of the restorations . the phenomenon was more pronounced during the third week of the restoration phase and less during the first and second weeks . the longevity of the retention of dental restorations is the most important parameter for determining the success of a dental restorative material . for a long time , amalgam has been the dental restorative material of choice for the treatment of cavitated posterior primary or permanent teeth . however , there has been a recent surge in the number of alternative dental restorative materials . these new materials have been developed to fulfill certain characteristics that amalgam was found to lack , for example , adhesion to the tooth surface , aesthetics , etc . gic is one of the newer restorative materials first developed in 1972 by wilson and kent . studies conducted to determine the survival rate of restorations placed using gic have reported varied results . the longevity of art occlusal restorations in the permanent teeth have been reported to be equal to or greater than the amalgam restorations placed in the same teeth , but in the primary dentition the studies have shown no difference in their survival rate . the failure of these restorations has been attributed to the poor material strength , experience of the operator , the type of cavity , etc . however , being a tooth - colored material with tooth adhesive properties , gic continues to be a preferred restorative material for cavitated primary teeth . further , gic has been used in situations where a more conservative cavity preparation is followed ( minimal destruction of the tooth ) and where its fluoride release characteristics provide further benefits to the affected tooth . in the present study , the gic materials used were tested for the longevity of the restorations made out of them in relation to the ambient temperature and the mixing time for the material during the restoration phase of the study . changes in the ambient temperature would be expected to affect the chemical reaction of gic . there are countries where temperature fluctuates from the very lowest during the winter season or cold season to the very highest in the summer season or hot season . the open air environment in which the art approach is carried out might have some effects on the material , considering the seasonal changes for some places . this might be particularly noticeable when the working area is poorly air - conditioned with the temperature not constantly maintained . the possibility that the setting reaction of gic material will be affected becomes likely in such conditions , by taking a longer or shorter period to set at lower or higher temperatures , respectively . the possibility of the operator leaving the material in the cavity before it is fully set or placing the material in the cavity in its advanced stages of setting is yet another very likely scenario . in the present study , the changes in temperature ranged between 19c and 31c during the restoration phase . the temperature range of 12 appears large , yet the results in the present study indicated that there was no significant statistical difference in the survival rate of the restorations in the study . this could have been be due to the varied number of restorations within the two extreme temperatures , compensating for ( canceling the effect of each other ) what could have probably shown a statistical difference in the survival of the restorations . the manufacturer 's recommended ambient working temperature was 23c for ketac molar aplicapat , 20 - 25c for kme and 23c for fuji ix . it was evident that restorations that had been placed at temperatures recommended by the manufacturer for the material used in the study had a higher survival rate when related to those placed with temperatures further away from that recommended by the manufacturer . however , the difference between the survival rates was not statistically significant , implying that for the best survival results the material should be mixed at a temperature close to or within that recommended by the manufacturer . outside the recommended levels , the survival rate of the restorations could be negatively affected . quality mixture of the restorative material ( an assistant - dependent factor ) should be expected to enhance the survival rate of the restorations made out of the material . it would be reasonable to imagine that the proportionation of the gic material ( powder and liquid ) might not be consistent for the hand - mixed type of gic compared with that already pre - portioned by the manufacturer . in turn , variations in the mixture of the gic material mixture produced could arise , leading to possible variations in the survival rate of the restorations placed using the material . mechanical mixing is likely to produce a mixture of gic with good consistency and results in better survival rate of the restorations . for the materials used in the study , the manufacturer 's recommended mixing times were 10 , 30 and 20 s , respectively , for kma , kme and fuji ix . in the study , the assistants hand - mixed fuji ix and ketac molar easymix , but the ketac molar applicap material had already been pre - portioned by the manufacturer and only mixed by the assistant using the duomat machine . yet , there were no significant differences noted between the survival rate of the restorations made out of the hand - mixed and the mechanically mixed gic . this could imply that the assistants proportioned the two hand - mixed materials rather well . the experienced assistants , in the present study , were associated with a higher survival rate of the restorations after 2 years . probably , they were able to accurately proportionate and quickly manipulate the hand - mixed material and quickly avail to the same to the operator , while in the case of the mechanically mixed material the handling process was probably performed expeditiously . assistant also simultaneously helped the operator to allay any anxiety in the child thus allowing the operator to concentrate on the critical areas of the restoration process . the reduction in the mixing times for the inexperienced assistants with time to mostly 30 - 60 s and less than 30 s categories during the third operative week could be a pointer to the gain in skills and competence by the assistant . changes in the ambient temperature would be expected to affect the chemical reaction of gic . there are countries where temperature fluctuates from the very lowest during the winter season or cold season to the very highest in the summer season or hot season . the open air environment in which the art approach is carried out might have some effects on the material , considering the seasonal changes for some places . this might be particularly noticeable when the working area is poorly air - conditioned with the temperature not constantly maintained . the possibility that the setting reaction of gic material will be affected becomes likely in such conditions , by taking a longer or shorter period to set at lower or higher temperatures , respectively . the possibility of the operator leaving the material in the cavity before it is fully set or placing the material in the cavity in its advanced stages of setting is yet another very likely scenario . in the present study , the changes in temperature ranged between 19c and 31c during the restoration phase . the temperature range of 12 appears large , yet the results in the present study indicated that there was no significant statistical difference in the survival rate of the restorations in the study . this could have been be due to the varied number of restorations within the two extreme temperatures , compensating for ( canceling the effect of each other ) what could have probably shown a statistical difference in the survival of the restorations . the manufacturer 's recommended ambient working temperature was 23c for ketac molar aplicapat , 20 - 25c for kme and 23c for fuji ix . it was evident that restorations that had been placed at temperatures recommended by the manufacturer for the material used in the study had a higher survival rate when related to those placed with temperatures further away from that recommended by the manufacturer . however , the difference between the survival rates was not statistically significant , implying that for the best survival results the material should be mixed at a temperature close to or within that recommended by the manufacturer . outside the recommended levels , the survival rate of the restorations could be negatively affected . quality mixture of the restorative material ( an assistant - dependent factor ) should be expected to enhance the survival rate of the restorations made out of the material . it would be reasonable to imagine that the proportionation of the gic material ( powder and liquid ) might not be consistent for the hand - mixed type of gic compared with that already pre - portioned by the manufacturer . in turn , variations in the mixture of the gic material mixture produced could arise , leading to possible variations in the survival rate of the restorations placed using the material . mechanical mixing is likely to produce a mixture of gic with good consistency and results in better survival rate of the restorations . for the materials used in the study , the manufacturer 's recommended mixing times were 10 , 30 and 20 s , respectively , for kma , kme and fuji ix . in the study , the assistants hand - mixed fuji ix and ketac molareasymix , but the ketac molar applicap material had already been pre - portioned by the manufacturer and only mixed by the assistant using the duomat machine . yet , there were no significant differences noted between the survival rate of the restorations made out of the hand - mixed and the mechanically mixed gic . this could imply that the assistants proportioned the two hand - mixed materials rather well . the experienced assistants , in the present study , were associated with a higher survival rate of the restorations after 2 years . probably , they were able to accurately proportionate and quickly manipulate the hand - mixed material and quickly avail to the same to the operator , while in the case of the mechanically mixed material the handling process was probably performed expeditiously . assistant also simultaneously helped the operator to allay any anxiety in the child thus allowing the operator to concentrate on the critical areas of the restoration process . the reduction in the mixing times for the inexperienced assistants with time to mostly 30 - 60 s and less than 30 s categories during the third operative week could be a pointer to the gain in skills and competence by the assistant . the changes in ambient temperature and the mixing time for gic material during the restorations of proximal cavities in primary molars using the art approach did not significantly influence the survival rate of the restorations .\noutput:\n" }, { "from": "agent", "value": "objective : temperature fluctuations and material mixing times are likely to affect the consistency and integrity of the material mixture , and hence the restoration made out of it . the purpose of the present study was to determine the influence of the ambient temperature and the mixing time of glass ionomer cement ( gic ) restorative material on the survival rate of proximal atraumatic restorative treatment ( art ) restorations placed in primary molars.materials and methods : a total of 804 restorations were placed in the primary molars of 6 - 8 - year - olds using the art approach . the restorations were then followed for a period of 2 years and evaluated at given intervals . the data collected were analyzed using spss computer statistical program , and the results tested and compared using the chi - square , kaplan meier survival analysis and cox proportional hazard statistical tests.results : the cumulative survival rate of the restorations dropped from the initial 94.4 % to 30.8 % at the end of 2 years . the higher survival rate of the restorations was associated with the experienced operators and assistants when using the rubber dam isolation method . however , there was no statistically significant difference in the survival rate of the restorations when related to the room temperature and the mixing time of the gic materials used in spite of the variations in the temperature recoded and the methods used in mixing the materials.conclusion : the ambient temperature and mixing time of gic did not have a significant effect on the survival of the proximal art restorations ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 26 - year - old female was referred to our department of oral and maxillofacial surgery with a chief complaint of deviated nose and smaller nostril on the right side . past surgical history revealed that she had undergone cleft lip repair at the age of 3 years . extra oral examination findings were nasal pyramid was tilted to the cleft side , the columella was short on the cleft side and deviated towards the noncleft side , the lateral crux of the lower lateral cartilage was displaced lower and to the cleft side resulting in excessive skin on the dome of lower lateral cartilage on the cleft side , nasal tip was asymmetrical , nostril on the cleft side was small and the entire nostril was retropositioned [ figure 1a c ] . columella short on the cleft side and deviated towards the noncleft side ; the lateral crux of the lower lateral cartilage was displaced lower and to the cleft side intraoral examination revealed a class i molar relation on the right and left the side with generalized spacing of upper and lower anteriors and a missing left upper lateral incisor with an alveolar cleft [ figure 2 ] . ( lateral incisor absent ) a definitive open rhinoplasty was planned for the cleft nasal deformity . the surgery was carried out under general anesthesia through orotracheal intubation . an inverted - v transcolumellar incision with bilateral marginal incisionswas made , the lower lateral cartilage and septal cartilage were exposed [ figure 3a ] , the cartilaginous septum was separated from the maxillary crest and secured to the midline using 50 pds suture , deviated portions of the septum were then removed and the excess cartilage is preserved for graft in future use [ figure 3b ] , while preserving an adequate dorsal and caudal strut . the tip projection and symmetry was increased with a strut graft in the columella in a pocket between medial crura , medial advancement of lower lateral cartilage was done [ figure 4 ] . alar hooding was improved and alar collapse was prevented by placing a spreader graft [ figure 5 ] . ( a ) inverted - v transcolumellar inscision with marginal extention . exposure of nasal septum and lower lateral cartilatge . ( b ) harvested excess septal cartilage columellar strut graft to support the columella spreader graft is placed to prevent alar collapse postoperatively the healing was satisfactory with no evidence of infection or wound dehiscence . the symmetry of the nasal tip was achieved , nostril on the cleft side was of the same size as the noncleft side , there was good projection of the nasal dorsum and nasal tip postoperatively [ figure 6 ] . the results were stable with no evidence of relapse with a period of follow - up of 1 - year . unilateral cleft lip nasal deformity is the result of undue forces to which the nasal tip is subjected as a consequence of uncoupling of the palatal shelves . the drawbacks of primary rhinoplasty are relapse and growth impairment , however the studies by mccomb and salyer stated that nasal cartilage growth is unaffected by nasal surgery but in our case a definitive rhinoplasty was done . the goals of definitive rhinoplasty include creation of symmetry , definition of nasal base and tip , relief of nasal obstruction and management of nasal scarring and webbing . one of the cleft lip nasal deformities is the alar columellar web deformity in which excess skin overhangs the superomedial side of the nostril . tajima and maruyama described a reverse u incision with a suture suspension of repositioned cleft lower lateral cartilage . nakajima et al . modified the technique by adding a z - plasty in the lateral nasal vestibule . cronin and denkler reported on v - yplasty of nasal mucosa left by the advancement of the lateral crus . they proposed that the vestibular lining of the lateral crus remain attached to add circulation and support especially when scoring of the cartilage is needed . maeda et al . reported using a bilateral reverse u incision in combination with cronins method . nakajima and yoshimura used a bilateral reverse u incision combined with a short banked forked flap in bilateral cleft lip nasal deformity . a traditional inverted - v transcolumellar incision advocated by potter and merville and popularized by goodmanwas used in this case and there was good visibility and access to the displaced structures with this incision . some stressthe need for lateral to medial advancement and lateral release of the lateral crus , others prefer a medial to lateral rotation , however , only a few use total detachment of the lateral crus from the vestibular skin . some surgeons mobilize the lateral crus together with vestibular skin to create a medially based chondrocutaneous flap . a lateral to medial advancement was preferred in our case . different techniques are described to repair the lateral vestibular wall following medial advancement of the crus . tajima and maruyama state that there is no redundant skin whereas gubisch uses a surplus of vestibular skin to close a gap between two flaps at the lateral nostril . millard excises not only part of the lateral crus but also the skin excess from the vestibular fold . most authors report a defect in the lateral wall and suggest direct approximation or standard flaps such as z - plasty or v - y advancement . published a series of cases where composite conchal cartilage was used in various forms to repair columellar deficit , to form nasal tubercle and nostril sill in cleft lip nasal deformity patients and concluded that conchal cartilage achieved symmetric and functional results . turkaslan et al . described a technique to place a cartilage graft at the posterior dome area after the release of cleft side ala from vestibular mucosa and skin to elevate the ala depression and tip projection . septal cartilage was used in presented case and was satisfactory and a second donor site morbidity was avoided . flores published a retrospective review where a combination of dibbell and tajima was used and concluded that there was a statistically significant decrease in alar base width , increase in columellar height and nostril height on the affected side . there are very few studies to assess the outcomes of cleft lip rhinoplasty in terms of patients satisfaction . evaluated esthetic and respiratory outcome with active change in nasal airflow and hydraulic diameter could be found and hence stated that while esthetic improvement of the cleft nose is a goal , which can be achieved in regularity nasal respiration still seems to be a challenge in cleft patients . analysis of respiratory outcome was not done in the case presented though the patient was satisfactory about the aesthetic result . there are very few studies to assess the outcomes of cleft lip rhinoplasty in terms of patients satisfaction . evaluated esthetic and respiratory outcome with active change in nasal airflow and hydraulic diameter could be found and hence stated that while esthetic improvement of the cleft nose is a goal , which can be achieved in regularity nasal respiration still seems to be a challenge in cleft patients . analysis of respiratory outcome was not done in the case presented though the patient was satisfactory about the aesthetic result . sandor and ylikontiola in their study on 35 patients with cleft nasal deformity treated by external rhinoplasty evaluated for satisfaction and perception of outcomes . the highest improvement was seen for the tip , followed by alar position , dorsum and symmetry of nostrils . leipzig in a similar study described high satisfaction rates by patients undergoing surgery for cleft nasal deformities . correction of the deformity requires a thorough and in detail understanding of the anatomy of cleft pathology and accurate assessment of both esthetic and functional impairments . open external approach rhinoplasty allows maximum exposure for structural graft placement to improve tip projection , definition , support , and function .\noutput:\n" }, { "from": "agent", "value": "it is universally accepted that correction of cleft lip nose deformity remains a formidable challenge for any cleft surgeon . the nose is a prominent part of the face , and hence a masterly executed cleft lip repair directs the beholders eyes from the deformed lip to the deformed nose . a deformed nose that results from unilateral cleft of the lip and palate is likened to a tent whose one side is depressed . many investigators believe that the deformity of the nose is produced by the malpositioning of essentially normal structures , on the other hand some cleft surgeons contend that it is the intrinsic defects in nasal structures that result in cleft nasal deformity . depressed and hypoplastic bony scaffolding is the most important aspect of cleft nose deformity and addressing this aspect of cleft nose deformity is the secret of success of a perfect secondary rhinoplasty . controversy still exists on timing of cleft nasal deformity . proponents of delayed nasal repair suggest that altering the cartilages in early nasal repair at the time of lip repair would complicate future corrective nasal surgeries if the primary repair would prove unsatisfactory . the correction of nasal deformity could be performed with closed or open technique . this paper highlights one such challenging unilateral cleft lip nasal deformity in a adult patient treated by secondary rhinoplasty by open technique ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: there is high chance of relapse after treatment for opioid addiction . as part of harm minimization , opioid substitution therapy ( ost ) buprenorphine has been established as a safe and cost - effective long - term alternative to methadone in substitution therapy for opioid dependence . it has shown benefits similar to those of methadone in retaining patients in treatment and improving quality of life and overall health status . however , concerns have been expressed about the compliance with treatment and diversion of the prescription buprenorphine . also , continued non - prescription opioid use has been documented among those on ost with buprenorphine . the reliability of self - report about non - prescription drug use and compliance with prescribed buprenorphine among opioid abusers remains debatable . it has been recommended that the ost be corroborated and monitored using objective measures such as urine drug screening . use of urinalysis findings when combined with self - report could provide important insights into the pattern of ost use and non - prescription opioid abuse among patients on buprenorphine therapy . international guidelines on buprenorphine prescription recommend routine use of some objective method to validate self - report of drug use pattern . urine drug screening is the most commonly used and the most cost - effective method for this purpose . the guidelines for use of buprenorphine in india are in accordance with the international recommendations . however , use of routine urine drug screening to ensure compliance is not recommended in these indian guidelines . the current study aims at understanding the pattern of use of ost and non - prescription opioid use among patients on buprenorphine maintenance . we reviewed the laboratory records of all urine samples sent for drug analysis over a period of 1 year at a tertiary - care de - addiction center . all cases with buprenorphine prescription for ost during this period were included in the study . all the subjects were being treated as outpatients and were being administered the medication from the treatment center on a biweekly basis . at this center , urine samples sent for drug evaluation are screened for common drugs of abuse in the region as well as medications prescribed as ost from the center , which include heroin ( detected as morphine ) , buprenorphine , dextropropoxyphene , and benzodiazepines . a supervised urine sample ( 50 ml ) is collected from patients coming for treatment at the de - addiction center . it is then sent to laboratory for analysis . a standardized modified hydrolysis method followed by thin - layer chromatography ( tlc ) the detection limit for urinalysis in the laboratory is 0.5 g / ml for morphine ( heroin ) and dextropropoxyphene , 0.2 g / ml for benzodiazepines , and 1.0 g / ml for buprenorphine . the pattern of prescription buprenorphine use and non - prescription opioid use was assessed using frequency distribution . we used the chi - square test to compare non - prescription opioid use among those testing positive and negative for buprenorphine on urinalysis . additionally , in order to assess the potential impact of the prescribed induction and maximum dose of buprenorphine on the findings , we carried out the independent - samples t test . conditions of anonymity and confidentiality , as recommended in the institute 's ethical guidelines , were strictly adhered to during the study . a total of 179 consecutive urine samples received over a 1 - year period were included in the study . the sociodemographic profile of the study sample and the dose of buprenorphine during the induction and maintenance phases is presented in table 1 . sociodemographic profile and buprenorphine prescription dose for the study sample ( n = 179 ) buprenorphine was detected in 99 ( 55.3 % ) of the samples . heroin and dextropropoxyphenewere detected in 10 ( 5.6 % ) and 14 ( 7.8 % ) of the samples , respectively . hence , the rate of non - prescription opioid use was 13.4 % [ table 2 ; figure 1 ] . the rate of detection of dextropropoxyphene was significantly higher among buprenorphine - negative samples ( chi - square 14.25 , df = 1 ; p 0.005 ) . the proportion of urine samples testing positive for heroin was similar in buprenorphine - positive samples and in buprenorphine - negative samples ( chi - square 0.08 , df = 1 ; p = 0.76 ) . urinalysis findings for opioid use for buprenorphine - prescribed opioid - dependent subjects findings of urinalysis for the total sample , buprenorphine - positive samples , and buprenorphine - negative samples the induction dose of buprenorphine was significantly lower among those testing positive for heroin than in those testing negative . this was found for both buprenorphine - positive ( n = 37 ; mean dose 2.110.78 mg / day vs 6.115.38 mg / day ; t = 6.94 , p 0.005 ) as well as buprenorphine - negative samples ( n = 26 ; mean dose 1.770.76 mg / day vs 6.175.49 mg / day ; t = 5.09 , p 0.005 ) [ table 3 ] . average induction daily dose of buprenorphine for buprenorphine - positive and buprenorphine - negative urine samples however , no such difference was observed for the maximum dose of prescription buprenorphine ( t = 3.435 , p = 0.74 and t = 0.214 , p = 0.847 for buprenorphine - positive and buprenorphine - negative urinalysis , respectively ) . similarly , no difference was observed for prescribed dose of buprenorphine among dextropropoxyphene - positive ( t = 0.19 , p = .85 ) and dextropropoxyphene - negative ( t = 1.34 , p = .18 ) urine samples among urine samples testing positive for buprenorphine . also , no differences were observed for prescribed dose of buprenorphine among dextropropoxyphene - positive ( t = 0.076 , p = .94 ) and dextropropoxyphene - negative ( t = 1.08 , p = .32 ) urine samples among urine samples testing negative for buprenorphine . the independent - samples t test failed to find any significant difference between the dose ( induction dose as well as maximum dose ) of the prescribed buprenorphine and buprenorphine urinalysis status ( n = 37 , t = 0.032 , p = 0.974 ; n = 26 , t = 0.641 , p = 0.524 ) . the current study aimed at understanding the pattern of use of ost and non - prescription opioid use among patients on buprenorphine maintenance . the rate of non - prescription opioid use among individuals on buprenorphine therapy has been found to vary across studies . it was found to be around 20 % in a comparative study of buprenorphine and methadone . all the samples in the current study were from opioid - dependent patients on ost with buprenorphine . however , urinalysis failed to detect buprenorphine in 44.7 % of the samples . such diversion of prescription buprenorphine has been reported from different countries , including australia , england , finland , france , ireland , new zealand , and scotland . it is likely that some of those testing positive for dextropropoxyphene ( with or without their sample being buprenorphine - positive ) might be using dextropropoxyphene in addition to the buprenorphine they were receiving through the ost program . , lack of difference in the prescribed dose of buprenorphine among those testing positive and negative for dextropropoxyphene makes the possibility of inadequate dose of prescribed buprenorphine unlikely . however , the stringent requirements of regular follow - up for buprenorphine ( daily to twice weekly ) might drive these individuals to ration their buprenorphine supply , substituting it in part with dextropropoxyphene . some of those registered with buprenorphine ost might be diverting it , while using dextropropoxyphene themselves . this is a likely explanation for those testing positive for dextropropoxyphene and negative for buprenorphine . the high street value and restricted availability of buprenorphine in the open market makes it a likely candidate for diversion . different patterns of treatment non - adherence to buprenorphine prescribed as ost have been observed . these include : ( a ) diversion to the black market , ( b ) non - adherence to prescriber 's recommendations about the dose to be used , ( c ) concurrent use of other drugs or alcohol , and ( d ) unsanctioned administration of buprenorphine ( by injection or sniffing ) . two of these possibilities , ( b ) and ( c ) , are supported by the urinalysis findings of the current study . the possibility of diversion to the black market and injecting use could be confirmed through focus - group discussions ( fgd ) and key informant interviews ( kii ) with the service users . use of an inadequate dose of buprenorphine , especially during the early phases of therapy , is a likely cause of continued use of heroin by opioid abusers . this was observed in the current study , where the induction dose of prescribed buprenorphine was significantly lower among the heroin - positive urine samples . this was observed for those concomitantly testing positive for buprenorphine as well those testing negative for buprenorphine . found high doses of buprenorphine to be more effective than low doses in reducing non - prescription opioid use ( f = 9.7 , p 0.05 ) . also buprenorphine - maintained patients who showed morphine - positive urines had significantly lower doses than those with negative urine screen findings ( 7.70.6 mg / day vs 11.30.5 mg / day ; t = 2.53 , p 0.05 ) . in the current study , the induction dose of buprenorphine was significantly lower among morphine - positive as well as buprenorphine - positive urine samples ( mean dose 2.110.78 mg / day vs 6.115.38 mg / day ; t = 6.94 , p 0.005 ) . similarly , the induction dose of buprenorphine was significantly lower among morphine - positive but buprenorphine - negative urine samples ( mean dose 1.770.76 mg / day vs 6.175.49 mg / day ; t = 5.09 , p 0.005 ) . while some of these under - prescribed individuals may have used heroin as atop - up , others may have discontinued using buprenorphine because of inadequate satisfaction of drug hunger and poor withdrawal management . inadequate dosing of buprenorphine is a common reason for noncompliance and continued non - prescription opioid use . while use of low doses of buprenorphine at induction has been associated with poor retention in treatment , rapid up - titration of buprenorphine has been found to improve compliance . prescription of an adequate dose of buprenorphine has been found to protect against doctor - shopping behavior among opioid abusers . the high ceiling effect for opioid agonist activity with buprenorphine makes it relatively safer in high doses . however , prescribers should also be alert to the possibility fatal accidents due to excessive dose of buprenorphine as a result of intravenous misuse or concomitant use of other sedative drugs such as benzodiazepines , which is always a possibility in this group . ost using buprenorphine - naloxone has been found to be safe and effective , with limited diversion rates . the use of urine drug screening in the current study has helped us understand the pattern of use of prescription buprenorphine as well as non - prescribed opioids ( including illicit heroin ) among those using ost . the reliability of self - report about non - prescription drug use and compliance with prescribed buprenorphine has been , and remains , debatable . international guidelines recommend routine use of some objective method to validate self - report of the service users regarding the drug use patterns . urine drug screening is the most commonly used and generally most cost - effective method for this purpose . the findings from the current study also support the routine use of some objective measure to corroborate self - reported drug use by those on ost . though indian guidelines on the use of buprenorphine as ost are in accordance with the international recommendations , use of routine urine drug screening to ensure compliance is not recommended in these guidelines . however , there is a need to include routine urine drug analysis as an integral component of the ost program . . it would be informative to explore these issues using fgd and kii among those on ost . the findings from the current study provide important insights into the pattern of use of ost as well as that of non - prescribed opioids ( including illicit heroin ) among individuals on buprenorphine therapy . these findings support routine use of urine drug screening among individuals on ost .\noutput:\n" }, { "from": "agent", "value": "objectives : to understand the pattern of use of opioid - substitution therapy ( ost ) and opioid abuse among patients on buprenorphine maintenance using urinalysis.materials and methods : the study was conducted at a tertiary care de - addiction center . we reviewed the laboratory record of all consecutive urine samples sent for drug analysis over a period of 1 year . in all , 179 consecutive urine samples were included in the analysis . the chi - square test was used to compare opioid abuse among those testing positive and negative for buprenorphine on urinalysis . additionally , in order to assess the potential impact of the prescribed induction and maximum dose of buprenorphine on the findings , we carried out the independent - samples t test . level of statistical significance was kept at p < 0.05 for all the tests.results : urinalysis failed to detect buprenorphine in 44.7 % of the samples . rate of detection of dextropropoxyphene was significantly higher among buprenorphine - negative samples ( p < 0.005 ) . the prescribed induction dose of buprenorphine was significantly lower among those testing positive for heroin . this was found for both buprenorphine - positive ( p < 0.005 ) as well as buprenorphine - negative samples ( p < 0.005 ) . conclusions : these findings support the routine use of urine drug screening among individuals on ost ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: influenza virus ( iv ) is the causative agent of several serious influenza pandemics ( 1 ) . recently , a highly pathogenic avian influenza virus ( aiv ; h5n1 ) has resulted in the death of more than 100 people and the slaughter of millions of poultry in asia , europe and africa ( world health organization , ) . scrupulous surveillance and multidisciplinary interrogation of the viral migration patterns and evolution are crucial for preventing further casualties of humans and domestic poultry . viral genome sequences provide essential information for understanding pathogenesis , diagnosis , and therapy of the virus . since the iv genome mutates very fast from host to host and from year to year , tracing iv lineages and discovering the pattern of sequence variation provide a solid foundation for evolutionary and functional studies ( 2 ) . genome - wide sequence analyses of iv have demonstrated various genotypes and proteotypes ( 3 ) and revealed multiple lineages and genetic re - assortment among viruses ( 4,5 ) . the beijing institute of genomics ( big ) has been sequencing ivs collected by scientists from different institutions from different parts of china . since a highly pathogenic avian influenza a subtype h5n1 virus [ a / goose / guangdong / 1/96 / ( h5n1 ) ] was initially isolated from china and subsequently identified as a precursor of the hong kong 1997 aiv ( a / hong kong / 156/97 ) ( 6 ) , china , especially the southern provinces , became one of the major foci for viral surveillance . phylogenetic analysis of all gene segments of h5n1 viruses isolated in china and other countries allowed us to trace the ecological and genetic origins of aiv ( 7 ) and the mechanism of its transmission to southeast asia , europe and africa ( 8 ) . we have sequenced isolates of aiv subtype h5n1 from 1997 to 2005 in different hosts found in china , such as wild birds , poultry , water fowl and mammals . some of these strains have been published , such as those from tree sparrows in henan province in 2004 ( 9 ) and migratory birds in qinghai province in 2005 ( 10 ) . significant international efforts in sequencing viral isolates have been made worldwide , so the number of iv sequences has been rising rapidly in public resources , such as the influenza virus resource ( ) at the national center for biotechnology information ( ncbi ) and the influenza sequence database ( isd ) at los alamos national laboratory ( 11 ) . the ncbi influenza virus resource presents data obtained from the niaid ( national institute of allergy and infectious diseases ) influenza genome sequencing project as well as from genbank . since most of the iv sequences are direct submissions , there is a growing need to curate and corroborate the data in order to analyze them effectively . isd provides curated data , but it requires a subscription fee to obtain full access to the data and tools . therefore , to provide a central iv - specialized database , which curates iv sequences , integrates information , and provides free online tools for data analysis , is of great importance . the influenza virus database ( ivdb ) contains both big 's data and published iv sequences after expert curation to ensure a high standard of accuracy and completeness . we have further developed tools and viewers to analyze and browse our data that include information concerning genomes , genes , polymorphisms , and phylogenetic relationships . ivdb aims to be a powerful information resource and an analysis workbench for scientists working on iv genetics , evolution , diagnostics , vaccine development and drug design . ivdb contains both big 's data ( big has an on - going effort to generate more aiv / iv sequences ) and data from public resources . since isd accepts direct submissions and contains some iv sequences that are absent from ncbi 's influenza virus resource , ivdb incorporates an additional 1654 segment sequences from isd . the data types hosted in ivdb include viral type / subtype , source information , nucleotide / protein sequence [ classified as complete genome , cds , untranslated region ( utr ) , three - dimensional ( 3 - d ) structural data ] , sequence alignment , polymorphism , and categorized literature and web resources covering iv genomics , pathogenicity and epidemiology . all data in ivdb have been curated manually since data quality is of crucial importance for analysis . to ensure adequate data quality , we first examine annotations and source information from each sequence entry in public databases . if we see inconsistencies or errors in the records , such as serotypes , we double check and proof - read the sequences . sequences that do not have a genotype and subtype assigned are manually typed using phylogenetic analysis and blast tools . second , we redefine host species ( e.g. goose , coot instead of avian in general ) and sampling locations ( not only continents and countries / regions , but also provinces / states ) , and store the information in searchable fields . the detailed host information is crucial since phylogenetic studies of influenza a virus isolates have revealed that the viral genes form species - specific lineages ( 13 ) . this is especially useful for aiv research since users have to distinguish wild birds from poultry , particularly the aquatic birds that are thought to be the primary carriers of influenza a viruses ( 13 ) . third , we match protein sequences with nucleotide sequences , and further annotate some predicted cds and utrs . users may browse the nucleotide and protein information simultaneously in one single record and trace back to the original records , if available , through hyperlinks . furthermore , we developed the iv sequence quality filter system ( q - filter ) that classifies the nucleotide sequences into 7 categories of c1c4 and p1p3 , respectively , according to their sequence content ( cds , 5 - utr , 3 - utr ) and integrity ( c : complete or p : partial ) . the c1c4 sequences have complete cds and differ in utrs ( such as without utr , with 5 / 3 - utr or both ) . all nucleotide sequences in ivdb have been classified and users may choose a specific category of data for analysis . it is often useful to filter out short sequences since the length of nucleotide sequences ranges from dozens to thousands of base pairs . this allows researchers to have a clear understanding of the sequence data and to choose high - quality data for their research . the website also provides pre - computed alignments , phylogenetic trees , and variations in iv genes and proteins , which are grouped by host , subtype and segment . results are presented through a graphical view of snp distribution or minor allele distribution , as well as tabular statistics on each nucleotide position compared with the consensus sequence . users are not only able to search for sequence polymorphisms by host , subtype , and segment but also have instant access to pre - made alignments , phylogenetic trees , and geographical distributions on a world map . the current version of ivdb contains 35549 iv nucleotide sequences , most of which are from influenza a virus with 5670 h5n1 sequences . . there are 2687 iv genome sets that contain all eight segments of type a and b iv , or all seven segments of type c iv . more than 40000 protein sequences , 118 protein 3 - d structure records , and 200 groups of multiple sequence alignments with polymorphic sites highlighted are also included . the statistics of nucleotide sequences available on september 16 , 2006 are shown in table 1 . all data are freely available for downloading from our ftp site ( ) . statistics of nucleotide sequences in ivdb ( september 16 , 2006 ) the total number of nucleotide sequences from influenza a , b and c viruses . ivdb provides a powerful search engine for users to retrieve different data types hosted in ivdb . except for keyword search , users may combine various search options such as type ( influenza type a / b / c virus ) , serotype , host species , sampling place , sampling year , sequence length range , and sequence category classified by q - filter . if users select the genomeset option , ivdb will display complete sets of sequence segments from selected iv strains . a key enhancement is to allow users to browse results from the first search and to acquire more targeted data sets through a second search . for example , users can acquire full - length ha sequences of h5n1 serotype isolated from chickens in guangdong province of china between 2003 and 2005 . all search results can be saved to a personalized workset for users ' convenience in data management . users can also maintain the workset themselves , delete , append or download data as well as apply successive analyses to the data using the tools provided . as an iv data analysis platform , ivdb provides a toolkit and a series of viewers for analyzing iv genomes , genes , polymorphisms , and phylogenetic relationship individually or in a comparative context . ivdb integrates blast tools for comparing user - supplied data ( e.g. workset ) with ivdb 's built - in databases , clustalw for multiple sequence alignment ( 14 ) , muscle ( 15 ) and phylip ( 16 ) for building phylogenetic trees . to facilitate analysis of global viral transmission and evolution , we developed the iv sequence distribution tool ( ivdt ) for plotting worldwide geographic distributions of iv sequences . it displays a zoomed - in geographic distribution of iv sequences from an upper level world map to a bottom - level of nation map . when the cursor is placed on a specific area of interest , it will show sequence statistics in the area with information on hosts and years of sampling . when the user clicks on the bottom - level map , it will display a list of hyperlinked sequence records that link to more details . users may alternate easily from their search results to sequence distribution maps , and vice versa . the ivdt 's sequence distribution map is a useful visual aid to display in which countries and at what density the samples have been collected in different regions of the world . however , its results need to be interpreted with care since sampling biases are likely to be present . all data and tools housed in ivdb are cross - linked , and the whole ivdb website forms an interrelated network as illustrated in figure 1 , which helps users to utilize , analyze , and understand the data more effectively and efficiently . search results can be selectively saved in a personalized workset and subjected to successive data analyses , such as plotting geographical distribution , aligning multiple sequences , and building phylogenetic trees . it consists of three hardware components , a world wide web server , a database server , and a server for sequence analysis . the system is based on a mysql relational database , and the front end consists of a set of jsp scripts running on a tomcat web server . the q - filter and search engineivdt is similar to gis ( geographic information system ) with country coordinates stored in the database . the blast and multiple sequence alignment tools run on clusters of super computers , and computational tasks are submitted by pbs ( portable batch system ) . we are aiming to build a central iv - specialized database functioning not only as an integrated information resource , but also as an analysis platform for genetic , genomic , and phylogenetic research of ivs . continuing efforts will be made to update iv sequences and incorporate new data and resources as soon as they become available . ivdb will further classify iv sequences into host - specific clusters since ivs are isolated from a broad range of species . for analyzing transmission patterns in wild birds , ivdb will offer additional information on the geohydrologic environment , seasonal migrations , and migratory flyways of recorded wild bird populations throughout the world ( 20 ) , providing useful references for sequence variations from ivdb . in - depthiv mutation analysis can be performed based on the pre - computed polymorphic results to identify synonymous / non - synonymous mutations and calculate silent ( ds ) and non - silent ( dn ) mutation rates . as an analysis platform for iv research , ivdt continues to make enhancements to user interfaces , to improve infrastructures and functionality , and to add new applications . in order to identify the correlation between protein structure change and iv virulence , a key enhancement is to develop tools for displaying sequence variations in protein 3 - d structures and to develop viewers for zooming in to a region of interest . more analytical tools , such as epitope prediction software and a primer design pipeline , will also be integrated .\noutput:\n" }, { "from": "agent", "value": "frequent outbreaks of highly pathogenic avian influenza and the increasing data available for comparative analysis require a central database specialized in influenza viruses ( ivs ) . we have established the influenza virus database ( ivdb ) to integrate information and create an analysis platform for genetic , genomic , and phylogenetic studies of the virus . ivdb hosts complete genome sequences of influenza a virus generated by beijing institute of genomics ( big ) and curates all other published iv sequences after expert annotation . our q - filter system classifies and ranks all nucleotide sequences into seven categories according to sequence content and integrity . ivdb provides a series of tools and viewers for comparative analysis of the viral genomes , genes , genetic polymorphisms and phylogenetic relationships . a search system has been developed for users to retrieve a combination of different data types by setting search options . to facilitate analysis of global viral transmission and evolution , the iv sequence distribution tool ( ivdt ) has been developed to display the worldwide geographic distribution of chosen viral genotypes and to couple genomic data with epidemiological data . the blast , multiple sequence alignment and phylogenetic analysis tools were integrated for online data analysis . furthermore , ivdb offers instant access to pre - computed alignments and polymorphisms of iv genes and proteins , and presents the results as snp distribution plots and minor allele distributions . ivdb is publicly available at" } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in almost all cases , malignant rhabdoid tumor ( mrt ) is a rare and highly aggressive tumor characterized by its rhabdoid feature and biallelic loss of smarcb1 / ini1 / hsnf5 . for various reasons , mrt poses a challenge to clinicians . despite the advancements in diagnostics tools , diagnostic challengesremain due to the myriad of anatomical locations of this tumor , the overlapping pathologic finding with other diseases , and the diverse immunophenotypic profile [ 2 - 8 ] . it has a predilection for infants and young children , peaking between birth and 3 years of age , an age group with risk of long - term sequelae following radiotherapy . no standard treatment has been established for mrt , because systematic analysis of the outcome of the small numbers of heterogeneously treated patients has thus far been impossible based on the few retrospective reviews . most importantly , mrt is a highly aggressive tumor with published 5 - year overall survival ( os ) ranging between 15 % and 36 % . we reviewed the clinical characteristics and treatment outcome of extra - cranial mrt patients treated in our institute . we thus aim to add to the current knowledge of this highly aggressive disease , and to aid in the development of better treatment strategies . a retrospective medical record review was conducted on 11 children treated for extra - cranial mrt at seoul national university children s hospital between january 2003 and may 2013 . all of the patients were pathologically confirmed as mrt by the institutional pathologist on the basis of morphological and immunohistochemical evaluations . they were all confirmed not to have concurrent involvements in the central nervous system with radiological imaging . patients were staged according to the surveillance , epidemiology , and end results ( seer ) staging system . patients received multimodal therapies , including chemotherapy , surgical resection , radiotherapy , and high dose chemotherapy and autologous stem cell rescue ( hdct / ascr ) . from november 2010 , all extra - cranial mrt patients who achieved complete remission after conventional therapy underwent hdct / ascr with uniform conditioning with melphalan , etoposide , and carboplantin . this consisted of melphalan 140 mg / m on day 7 , 70 mg / m on day 6 , etoposide 200 mg / m and carboplatin 400 mg / m from days 8 to 5 . mobilized autologous peripheral blood stem cells were infused on day 0 . adverse events were graded according to the national cancer institute common terminology criteria for adverse events ver . kaplan - meier method was used for analysis of os and event - free survival ( efs ) , and log - rank test was used for subgroup comparisons . the institutional review board ( irb ) at seoul national university hospital approved this retrospective medical record review ( irb no . eleven patients ( 7 boys , 4 girls ) were diagnosed with extracranial mrt during the 10 years and 5 - month period in a single pediatric institute . patients were diagnosed at very young ages ; they presented at median age of 7 months old ( range , 1 month to 13 years 1 month old ) and were diagnosed at median age of 9 months old ( range , 2 months old to 13 years 2 months old ) . six patients ( 55 % ) were diagnosed during infancy and only one patient ( 9 % ) was diagnosed during adolescence ( table 1 ) . primary sites of tumor were variable ; six patients ( 55 % ) had renal mrt , all of which were unilateral , and five patients ( 45 % ) had soft tissue mrt , predominantly at deep axial locations such as submental , paraspinal , retrosternal , and coccygeal area . the most common presenting sign for renal mrt was gross hematuria ( n = 4 ) , whereas that for soft tissue mrt was a mass lesion at primary sites ( n = 4 ) ( table 1 ) . five patients ( 45 % ) had distant stage according to the seer staging system ; their most common site of metastasis was the lung ( n = 3 ) and all patients with lung metastases had multiple lung nodules . the rest of the patients had regional stage ( n = 3 , 27 % ) or localized stage ( n = 3 , 27 % ) ( table 1 ) . two of our patients were not pathologically confirmed as extra - cranial mrt on initial diagnosis . the primary tumor of patient no .2 was too large for surgical excision and it had extensive perirenal hematoma with risk of severe bleeding which impeded incisional biopsy . it was suspected as a wilms tumor based on the location of the primary tumor on radiologic imaging . after a cycle of chemotherapy with actinomycin and vincristine , he thus underwent chemotherapy with actinomycin and vincristine ; however , despite chemotherapy , his condition deteriorated and he developed disseminated intravascular coagulation , metabolic acidosis , and oliguria . thus , the initially biopsied specimen was further evaluated including ini1 staining and the diagnosis was revised to renal mrt due to the loss of ini1 staining ( table 1 ) . specimens of 10 patients were studied for ini1 staining ; those of nine patients ( 90 % ) had loss , and that of one patient ( 10 % ) had retained ini1 staining .3 was the only patient whose specimen had retained ini1 staining ; he was also the only patient who showed unusual clinical characteristics , with late presentation during adolescence and an outstanding treatment outcome ( table 1 ) . all patients ( 100 % ) underwent chemotherapy with various combinations of vincristine ( n = 10 ) , cyclophosphamide ( n = 10 ) , etoposide ( n = 10 ) , doxorubicin ( n = 8 ) , carboplatin ( n = 8 ) , and ifosfamide ( n = 7 ) ( table 1 ) . eight patients ( 73 % ) underwent surgical resection of the primary tumor ; three patients ( 27 % ) underwent upfront surgery and five patients ( 45 % ) underwent delayed surgical resection after chemotherapy . primary tumors were not resected in three patients ( 27 % ) ; tumor progressed in two patients and regressed in one patient ( table 1 ) . six patients ( 55 % ) received local therapeutic radiotherapy . in four other patients ( 36 % ) , therapeutic radiotherapywas not indicated ; two patients had unresectable tumors which progressed and two patients had distant metastases .3 , did not undergo radiotherapy due to his extraordinary outcome ; he is the only patient among survivors to not have received radiotherapy . recipients of local therapeutic radiotherapy received median 27.0 gy ( range , 10.5 to 41.4 gy ) in median 16 fractions ( range , 7 to 36 fractions ) , at median 40.2 months ( range , 0.1 to 14.3 months ) from diagnosis . the earlier three patients underwent radiotherapy postoperatively , but beyond november 2010 , radiotherapy has been delayed until after hdct / ascr , and three patients underwent radiotherapy as such ( table 1 ) . from november 2010 , patients who achieved complete remission with conventional therapy underwent hdct / ascr . four patients ( 36 % ) have thus far undergone hdct / ascr with melphalan , etoposide , and carboplatin . they had median 8.610 mononuclear cells ( mnc ) / kg ( range , 7.210 to 12.210 mnc / kg ) and 8.410 cd34 cells / kg ( range , 3.310 to 24.110 cd34 cells / kg ) infused . neutrophils engrafted on median day 10 ( range , day 9 to day 10 ) . during hdct / ascr , one patient had additional grade 3 lung infection , grade 2 otitis media , and grade 2 sinusitis . another patient had grade 3 acute kidney injury , and another patient had grade 1 acute kidney injury . overall , three patients ( 27 % ) progressed during treatment and two patients ( 18 % ) relapsed after off - therapy . the three patients who progressed during treatment had initial lung metastases , which were multiple and which did not respond to initial chemotherapy . these patients progressed at median 1.0 month ( range , 0.9 to 1.7 months ) from diagnosis , and died of disease at median 3.8 months ( range , 2.3 to 4.5 months ) from diagnosis ( table 1 ) . one patient relapsed in the brain , and another relapsed in the brain and the lung . both of these patients were proven not to have concurrent disease of the central nervous system at initial radiological evaluation . they relapsed at median 3.7 months ( range , 3.4 to 3.9 months ) from off - therapy , and died of disease at median 4.3 months ( range , 1.0 to 7.6 months ) from diagnosis ( table 1 ) . the os of the total study population was 53.0 % and their efs was 54.5 % with a median follow - up duration of 17.8 months ( range , 2.3 to 112.3 months ) ( fig .1 ) . the six survivors are currently disease - free for a median duration of 43.0 months from off - therapy ( range , 17.5 to 104.7 months ) . in particular , patient nos . 2 , 3 , and 6 are long - term survivors ( table 1 ) . the os of patients who underwent hdct / ascr was 66.7 % and their efs was 75.0 % with a median follow - up duration of 23.8 months ( range , 8.1 to 42.6 months ) from hdct / ascr ( fig .2 ) . the three survivors are currently disease - free for a median duration of 36.3 months from off - therapy ( range , 8.1 to 42.6 months ) . in subgroup analysis ,75 % of patients ( 6 of 8 patients ) who were under 2 years old at diagnosis , died of disease whereas none of the three patients who were older at diagnosis , died of disease . in addition , 80 % of patients ( 4 of 5 patients ) with metastatic disease , died of disease whereas only 7 % of those ( 1 of 6 patients ) without metastasis , died of disease . however , worse survival of neither patients who were under 2 years of age at diagnosis nor patients with initial metastasis was supported with statistical significance on log - rank test . eleven patients ( 7 boys , 4 girls ) were diagnosed with extracranial mrt during the 10 years and 5 - month period in a single pediatric institute . patients were diagnosed at very young ages ; they presented at median age of 7 months old ( range , 1 month to 13 years 1 month old ) and were diagnosed at median age of 9 months old ( range , 2 months old to 13 years 2 months old ) . six patients ( 55 % ) were diagnosed during infancy and only one patient ( 9 % ) was diagnosed during adolescence ( table 1 ) . primary sites of tumor were variable ; six patients ( 55 % ) had renal mrt , all of which were unilateral , and five patients ( 45 % ) had soft tissue mrt , predominantly at deep axial locations such as submental , paraspinal , retrosternal , and coccygeal area . the most common presenting sign for renal mrt was gross hematuria ( n = 4 ) , whereas that for soft tissue mrt was a mass lesion at primary sites ( n = 4 ) ( table 1 ) . five patients ( 45 % ) had distant stage according to the seer staging system ; their most common site of metastasis was the lung ( n = 3 ) and all patients with lung metastases had multiple lung nodules . the rest of the patients had regional stage ( n = 3 , 27 % ) or localized stage ( n = 3 , 27 % ) ( table 1 ) . two of our patients were not pathologically confirmed as extra - cranial mrt on initial diagnosis . the primary tumor of patient no . 2 was too large for surgical excision and it had extensive perirenal hematoma with risk of severe bleeding which impeded incisional biopsy . it was suspected as a wilms tumor based on the location of the primary tumor on radiologic imaging . after a cycle of chemotherapy with actinomycin and vincristine , he thus underwent chemotherapy with actinomycin and vincristine ; however , despite chemotherapy , his condition deteriorated and he developed disseminated intravascular coagulation , metabolic acidosis , and oliguria . thus , the initially biopsied specimen was further evaluated including ini1 staining and the diagnosis was revised to renal mrt due to the loss of ini1 staining ( table 1 ) . specimens of 10 patients were studied for ini1 staining ; those of nine patients ( 90 % ) had loss , and that of one patient ( 10 % ) had retained ini1 staining .3 was the only patient whose specimen had retained ini1 staining ; he was also the only patient who showed unusual clinical characteristics , with late presentation during adolescence and an outstanding treatment outcome ( table 1 ) . all patients ( 100 % ) underwent chemotherapy with various combinations of vincristine ( n = 10 ) , cyclophosphamide ( n = 10 ) , etoposide ( n = 10 ) , doxorubicin ( n = 8 ) , carboplatin ( n = 8 ) , and ifosfamide ( n = 7 ) ( table 1 ) . eight patients ( 73 % ) underwent surgical resection of the primary tumor ; three patients ( 27 % ) underwent upfront surgery and five patients ( 45 % ) underwent delayed surgical resection after chemotherapy . primary tumors were not resected in three patients ( 27 % ) ; tumor progressed in two patients and regressed in one patient ( table 1 ) . six patients ( 55 % ) received local therapeutic radiotherapy . in four other patients ( 36 % ) , therapeutic radiotherapywas not indicated ; two patients had unresectable tumors which progressed and two patients had distant metastases .3 , did not undergo radiotherapy due to his extraordinary outcome ; he is the only patient among survivors to not have received radiotherapy . recipients of local therapeutic radiotherapy received median 27.0 gy ( range , 10.5 to 41.4 gy ) in median 16 fractions ( range , 7 to 36 fractions ) , at median 40.2 months ( range , 0.1 to 14.3 months ) from diagnosis . the earlier three patients underwent radiotherapy postoperatively , but beyond november 2010 , radiotherapy has been delayed until after hdct / ascr , and three patients underwent radiotherapy as such ( table 1 ) . from november 2010 , patients who achieved complete remission with conventional therapy underwent hdct / ascr . four patients ( 36 % ) have thus far undergone hdct / ascr with melphalan , etoposide , and carboplatin . they had median 8.610 mononuclear cells ( mnc ) / kg ( range , 7.210 to 12.210 mnc / kg ) and 8.410 cd34 cells / kg ( range , 3.310 to 24.110 cd34 cells / kg ) infused . neutrophils engrafted on median day 10 ( range , day 9 to day 10 ) . during hdct / ascr , one patient had additional grade 3 lung infection , grade 2 otitis media , and grade 2 sinusitis . another patient had grade 3 acute kidney injury , and another patient had grade 1 acute kidney injury . overall , three patients ( 27 % ) progressed during treatment and two patients ( 18 % ) relapsed after off - therapy . these five patients ( 45 % ) who progressed or relapsed , died of disease . the three patients who progressed during treatment had initial lung metastases , which were multiple and which did not respond to initial chemotherapy . these patients progressed at median 1.0 month ( range , 0.9 to 1.7 months ) from diagnosis , and died of disease at median 3.8 months ( range , 2.3 to 4.5 months ) from diagnosis ( table 1 ) . one patient relapsed in the brain , and another relapsed in the brain and the lung . both of these patients were proven not to have concurrent disease of the central nervous system at initial radiological evaluation . they relapsed at median 3.7 months ( range , 3.4 to 3.9 months ) from off - therapy , and died of disease at median 4.3 months ( range , 1.0 to 7.6 months ) from diagnosis ( table 1 ) . the os of the total study population was 53.0 % and their efs was 54.5 % with a median follow - up duration of 17.8 months ( range , 2.3 to 112.3 months ) ( fig .1 ) . the six survivors are currently disease - free for a median duration of 43.0 months from off - therapy ( range , 17.5 to 104.7 months ) . in particular , patient nos . 2 , 3 , and 6 are long - term survivors ( table 1 ) . the os of patients who underwent hdct / ascr was 66.7 % and their efs was 75.0 % with a median follow - up duration of 23.8 months ( range , 8.1 to 42.6 months ) from hdct / ascr ( fig .2 ) . the three survivors are currently disease - free for a median duration of 36.3 months from off - therapy ( range , 8.1 to 42.6 months ) . in subgroup analysis ,75 % of patients ( 6 of 8 patients ) who were under 2 years old at diagnosis , died of disease whereas none of the three patients who were older at diagnosis , died of disease . in addition , 80 % of patients ( 4 of 5 patients ) with metastatic disease , died of disease whereas only 7 % of those ( 1 of 6 patients ) without metastasis , died of disease . however , worse survival of neither patients who were under 2 years of age at diagnosis nor patients with initial metastasis was supported with statistical significance on log - rank test . this is the first single institutional report on the clinical characteristics and outcome of extra - cranial mrt in korea . in accordance with the significantly improved prognosis of mrt over the past decade , the current study showed promising results and some of the patients were long - term survivors [ 1,9 - 13 ] . diagnosis of extra - cranial mrt as a distinct entity is a challenge ; it is found in a myriad of anatomic sites , has overlapping pathological findings with other diseases , and shows histological heterogeneity with a diverse immunophenotypic profile . the presence of rhabdoid feature is a histological hallmark of mrt but it is also observed in various other malignant tumors . thus with the discovery that the loss of ini1 gene contributes to the oncogenesis of mrt , ini1 antibody immunohistochemistry became an important tool in its diagnosis . in the current study , the diagnosis of patient no . 5 was revised to extra - cranial mrt after additional ini1 staining . in fact , tumor specimens of most of our patients showed loss of ini1 staining . nonetheless , there was a case of tumor specimen retaining ini1 staining despite pathologic confirmation as extra - cranial mrt based on morphological and other immunohistochemical studies . previous literature has reported that genetic variations do exist in mrt , and that up to 20 % have no alteration in the ini1 gene at the dna or rna level . our patients who had retained ini1 staining also showed unusual clinical characteristics and extraordinary outcome . thus , the possible impact of loss of ini1 gene on the clinical characteristics and prognosis of mrt needs further evaluation . extra - cranial mrt is treated with multimodal therapies , including chemotherapy , surgery , radiotherapy , and hdct / ascr , however , no standard treatment has been established to date . also , alternating courses of the combination of vincristine , doxorubicin , and cyclophosphamide ( vdcy ) and the combination of ifosfamide , carboplatin , and etoposide ( icbe ) have been suggested to be effective in metastatic mrt . currently , the treatment recommendation of eu - rhab registry employs the use of doxorubicin , ifosfamide , carboplatinum , etoposide , vincristine , actinomycine d , and cyclophosphamide . our study population received combinations of chemotherapeutic agents including vincristine , cyclophosphamide , etoposide , doxorubicin , carboplatin , ifosfamide , and actinomycine d. however , patients included in the current study received heterogeneous combinations of chemotherapy regimens and thus an analysis on the benefits of a particular regimen could not be performed . complete surgical resection and radiotherapy have been reported to have survival benefits [ 9 - 11,13 ] . in the current study ,63 % of the patients ( 5 of 8 patients ) who managed to undergo complete surgical resections of the primary tumor as opposed to 33 % of the patients ( 1 of 3 patients ) whose initial masses were unresectable are currently alive with no evidence of disease . however , due to the current small study population , the survival benefits of either surgery or therapeutic radiotherapy could not be analyzed with statistical significance . hdct / ascr with etoposide , carboplatin , and melphalan ( etoposide 200 mg / m on days 7 to 4 , carboplatin 400 mg / m on days 7 to 4 , melphalan 40 mg / m on days 3 to 2 ) have been shown to result in clinical responses and long - term survival in patients with poor prognostic factors . the current study includes four patients who underwent hdct / ascr with melphalan , etoposide , and carboplatin . despite the small number of patients , the os of 66.7 % and efs of 75.0 % with a median follow - up duration of 23.8 months ( range , 8.1 to 42.6 months ) this suggests a possible role of hdct / ascr with melphalan , etoposide , and carboplatin in extra - cranial mrt . younger age has previously been found to be an independent risk factor , with patients either under 2 years of age or 3 years of age showing poorer survival . in addition , association of metastatic disease at diagnosis with worse survival has been reported [ 10 - 12 ] . although worse survival of neither the patients who were under 2 years of age at diagnosis nor the patients with initial metastasis was supported with statistical significance , there were tendencies of worse survival in these groups and further analysis is needed with a larger number of patients . in accordance with some of the previous reports , lung was the most common site of metastasis in the current study . in literature , complete resection of solitary lung nodules , whole - lung irradiation , and alternative courses of icbe and vdcy chemotherapy has been suggested as possible strategies for lung metastases . the current study is limited by its retrospective nature , the small cohort size , and the heterogeneous treatment strategies . a prospective , multicenter collaboration study on a larger number of patients treated with uniform treatment regimens will enable verification of the benefits of various treatment modalities , and identification of prognostic factors . this will thus aid in the development of better treatment strategies for this aggressive disease . extra - cranial mrt is a distinct disease entity and ini1 antibody immunohistochemistry may assist in its diagnosis . it is still a highly aggressive tumor in young children but the improved survival of our study population is promising . multimodal treatment approach should be employed for this disease including chemotherapy , surgery , radiotherapy , and hdct / ascr . hdct / ascr with melphalan , etoposide , and carboplatin conditioning may be a promising treatment option for children with extra - cranial mrt .\noutput:\n" }, { "from": "agent", "value": "purposemalignant rhabdoid tumor ( mrt ) is a rare and highly aggressive tumor that affects young children . due to its extreme rarity , most of the available data are based on retrospective case series . to add to the current knowledge of this disease , we reviewed the patients treated for extra - cranial mrt in our institute.materials and methodsa retrospective medical record review was conducted on children treated for pathologically confirmed extra - cranial mrt at seoul national university children s hospital between january 2003 and may 2013 . resultseleven patients ( 7 boys , 4 girls ) were diagnosed with extra - cranial mrt at a median age of 9 months old . ini1 staining was important in the pathological confirmation . six patients ( 55 % ) had renal mrt and five ( 45 % ) had soft tissue mrt . five patients ( 45 % ) had metastases at diagnosis . all patients underwent chemotherapy , eight patients ( 73 % ) underwent surgery , six patients ( 55 % ) received therapeutic radiotherapy , and four patients ( 36 % ) underwent high dose chemotherapy with autologous stem cell rescue ( hdct / ascr ) with melphalan , etoposide , and carboplatin . five patients ( 45 % ) died of disease following progression ( n = 3 ) or relapse ( n = 2 ) , however , there was no treatment related mortality . the overall survival of the cohort was 53.0 % and the event - free survival was 54.5 % with a median follow - up duration of 17.8 months ( range , 2.3 to 112.3 months ) . conclusionextra - cranial mrt is still a highly aggressive tumor in young children . however , the improved survival of our cohort is promising and hdct / ascr with melphalan , etoposide , and carboplatin may be a promising treatment option ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the basic objective of biomechanical preparation consists of pulp tissue removal keeping the apical foramen as tight as possible , developing a gradual tapered shape of the root in a crown - apex direction , with the use of endodontic instruments associated with chemical irrigating substances6 . the internal anatomic variations of the root canal system have a role on the success of endodontic therapy . in flattened canals , et al. 16 ( 2000 ) the buccal and lingual extensions of flattened root canals are areas of difficult instrumentation and filling . the success of root canal therapy depends directly on how effectively all phases of the endodontic treatment ( i.e. , shaping , cleaning , disinfection and obturation ) are performed . several techniques have been used for biomechanical preparation . however , due to the limitations of conventional techniques in working in curved and flattened canals , some crown - down techniques have been recently investigated in order to provide a more efficient canal preparation . complete biomechanical preparation with stainless steel instruments involves a high risk of perforating or significantly weakening the root . on the other hand , it seems questionable whether highly flexible ni - ti instruments allow a controlled preparation of canal extensions12 . ni - ti rotary instrumentation has been shown to have a limited area of action . due to their super - elasticity , it is known that niti instruments can not be pressed against the root canal walls , leaving the polar areas of flattened root canals uninstrumented . flattened root canals do not allow a great widening of canal diameter without the risk of creating lateral perforations . this movement can be manually executed or can be done using special handpieces that currently have a prominent place in endodontic practice causing a lower incidence of canal transportation and better centralization of the prepared root canal3 ,7,11,13 . the endo - eze aet oscillatory system ( anatomic endodontic technology ultradent , south jordan , ut , usa ) has been recently released to the market with the objective of yielding cleaning and shaping of root canals using the root canal anatomy as a guide and hence preserving the dental structure . this system is comprised of a handpiece that has right - left oscillatory movements at 30 amplitude , acting in conjunction with stainless steel files14 . the purpose of this study was to evaluate the biomechanical preparation of flattened root canals using two different systems : endo - eze aet oscillatory system ( ultradent ) and race rotary system ( fkg dentaire , la - chaux - de - fonds , switzerland ) . the research protocol was reviewed by the ethics in research committee of the state university of feira de santana ( ba , brazil ) and the study design was approved ( caae 0035.0.059.000 - 05 ) . the teeth had a buccolingual distance twice as long as the mesiodistal distance , confirmed by clinical evaluation of the shape of the flattened mesiodistal root , and had been extracted for periodontal reasons and / or extensive caries . the teeth were randomly assigned to two groups : group 1 - instrumentation with oscillatory endo - eze aet files ( oscillatory technique ) ; group 2 - instrumentation with rotary niti race files ( rotary technique ) . the teeth were decoronated with a 40 - mm diamond disc ( kg sorensen , so paulo , sp , brazil ) at the cementoenamel junction . a # 10 stainless steel k - file ( maillefer , ballaigues , switzerland ) was then passively introduced into the canal until its tip was seen at the apical foramen . the instrument was retracted 1 mm to determine the working length ( wl ) by the visual method . mesiodistal and buccolingual radiographs were taken to confirm the existence of only one root canal . the teeth had the apices and coronal openings sealed with sticky wax and were placed inside a pvc ring ( 25 mm in diameter ; 25 mm in height ) that was filled with crystal - clear orthophtalic polyester resin ( polyfibras - bahia - brazil ) at a ratio of 10 % monomer per kilogram of resin . the pvc ring had its base perforated to allow the placement of a thread and a screw ( fischer mqr 19 , rio de janeiro , rj , brazil ) with the purpose of facilitating the removal of the sections for undertaking photographs during the experiment2 ( figures 1a and 1b ) . the roots were sectioned transversally with diamond discs ( discoflex 40 mm ) at 10 mm ( middle third ) and 5 mm ( apical third ) from the apex and the segments were reassembled for instrumentation . in group 1 , the teeth were instrumented using endo - eze aet oscillatory system ( ultradent ) with endo - eze files . the following sequence of instruments belonging to the shaping filesfirst , the oscillatory s1 file ( yellow shank , d0 = 10 mm , taper 2.5 % ) was used at wl until it became loose into the canal . this file was followed by the sc instrument ( red shank , d0 = 13 mm , taper 3.5 % ) , the s2 instrument ( blue shank , d0 = 13 mm , taper 4.5 % ) and the s3 instrument ( green shank , d0 = 13 mm , taper 6 % ) . after using the oscillatory files , the apical third was instrumented using manual files belonging to apical files set of the system ( # 15 to # 30 ) . in group 2 , the teeth were instrumented using race rotary system ( fkg dentaire ) according to the crown - down technique in the following sequence : pre - race 40.08 , race 35.02 , 30.04 , 30.02 , 25.04 and 25.02 . apical preparation was completed with race 25.04 or 30.02 files , depending on root canal anatomy . in this group , all root canals were prepared using a low - speed handpiece ( 300 rpm ) with high - torque motor with torque control ( easy endo ; easy , belo horizonte , mg , brazill ) . the root canal sections were photographed before and after biomechanical preparation . during the instrumentation , the root canals of both groups were irrigated with 5.25 % sodium hypochlorite . using superimposition of images obtained from magnified and standardized photographs taken before and after biomechanical preparation , the middle and apical thirds were evaluated to determine whether there were changes on root canal original anatomical shape . in order to evaluate the differences between the root canal contours before and after biomechanical preparation , scores were given according to instrument touch on the intracanal walls ( table 1 ) . the score means were submitted to statistical analysis using the kruskal - wallis test ( p 0.05 ) and dunn s multiple comparison test . the research protocol was reviewed by the ethics in research committee of the state university of feira de santana ( ba , brazil ) and the study design was approved ( caae 0035.0.059.000 - 05 ) . the teeth had a buccolingual distance twice as long as the mesiodistal distance , confirmed by clinical evaluation of the shape of the flattened mesiodistal root , and had been extracted for periodontal reasons and / or extensive caries . the teeth were randomly assigned to two groups : group 1 - instrumentation with oscillatory endo - eze aet files ( oscillatory technique ) ; group 2 - instrumentation with rotary niti race files ( rotary technique ) . the teeth were decoronated with a 40 - mm diamond disc ( kg sorensen , so paulo , sp , brazil ) at the cementoenamel junction . a # 10 stainless steel k - file ( maillefer , ballaigues , switzerland ) was then passively introduced into the canal until its tip was seen at the apical foramen . the instrument was retracted 1 mm to determine the working length ( wl ) by the visual method . mesiodistal and buccolingual radiographs were taken to confirm the existence of only one root canal . the teeth had the apices and coronal openings sealed with sticky wax and were placed inside a pvc ring ( 25 mm in diameter ; 25 mm in height ) that was filled with crystal - clear orthophtalic polyester resin ( polyfibras - bahia - brazil ) at a ratio of 10 % monomer per kilogram of resin . the pvc ring had its base perforated to allow the placement of a thread and a screw ( fischer mqr 19 , rio de janeiro , rj , brazil ) with the purpose of facilitating the removal of the sections for undertaking photographs during the experiment2 ( figures 1a and 1b ) . the roots were sectioned transversally with diamond discs ( discoflex 40 mm ) at 10 mm ( middle third ) and 5 mm ( apical third ) from the apex and the segments were reassembled for instrumentation . in group 1 , the teeth were instrumented using endo - eze aet oscillatory system ( ultradent ) with endo - eze files . the following sequence of instruments belonging to the shaping filesfirst , the oscillatory s1 file ( yellow shank , d0 = 10 mm , taper 2.5 % ) was used at wl until it became loose into the canal . this file was followed by the sc instrument ( red shank , d0 = 13 mm , taper 3.5 % ) , the s2 instrument ( blue shank , d0 = 13 mm , taper 4.5 % ) and the s3 instrument ( green shank , d0 = 13 mm , taper 6 % ) . after using the oscillatory files , the apical third was instrumented using manual files belonging to apical files set of the system ( # 15 to # 30 ) . in group 2 , the teeth were instrumented using race rotary system ( fkg dentaire ) according to the crown - down technique in the following sequence : pre - race 40.08 , race 35.02 , 30.04 , 30.02 , 25.04 and 25.02 . apical preparation was completed with race 25.04 or 30.02 files , depending on root canal anatomy . in this group , all root canals were prepared using a low - speed handpiece ( 300 rpm ) with high - torque motor with torque control ( easy endo ; easy , belo horizonte , mg , brazill ) . the root canal sections were photographed before and after biomechanical preparation . during the instrumentation , using superimposition of images obtained from magnified and standardized photographs taken before and after biomechanical preparation , the middle and apical thirds were evaluated to determine whether there were changes on root canal original anatomical shape . in order to evaluate the differences between the root canal contours before and after biomechanical preparation , scores were given according to instrument touch on the intracanal walls ( table 1 ) . the score means were submitted to statistical analysis using the kruskal - wallis test ( p 0.05 ) and dunn s multiple comparison test . table 2 gives a general overview of the scores attributed after analysis of the photographs taken before and after biomechanical preparation with both tested techniques . in group 1 ( oscillatory technique ) , one section changed from the original root canal shape in the middle third , that is the instrumentation touched only on one wall ( score 1 ) , while in the apical third two sections did not maintain the original root canal shape ( one section with score 2 and the other with score 1 ) . in group 2 ( rotary technique ) , six sections had score 2 ( the biomechanical preparation produced a circular protuberance in the root canals leaving uninstrumented the isthmus walls ) and three sections had score 1 in the middle third ( figure 2 ) . in the apical third , five sections presented change in the original anatomy of the root canal ( two sections with score 2 and three sections with score 1 ) ( figure 3 ) . in 7 out of 10 mandibular incisors instrumented with the oscillatory system , the biomechanical preparation maintained the original root canal shape up to the working length ( figure 4 and 5 ) . on the other hand , only 1 out of 10 mandibular incisors instrumented with the rotary system maintained the original root canal shape up to the working length . the statistical analysis showed that the middle third of the root canals instrumented with the rotary system presented a statistically significant change from the original anatomy ( p 0.05 ) , a fact that was not observed in the apical third . with the oscillatory instrumentation , the changes that occurred in the original shape of the canals were not statistically significant . root canal instrumentation is one of the most important steps to the success of endodontic treatment and several biomechanical instrumentation techniques have been proposed . however , despite the limitations of the conventional techniques in working in curved and flattened canals , crown - down techniques have been recently proposed with the aim of achieving a more efficient preparation . the quality of the biomechanical preparation is related to the internal anatomical characteristics of the root canal system1 . manual crown - down instrumentation techniques have been more effective in cleaning mesiodistally flattened root canals than rotary techniques . in this study , the root canals that had mesiodistal flattening and were instrumented with the race rotary system presented changes in their original anatomy with the formation of a protuberance in the mesiodistal direction , leaving the walls of the isthmus uninstrumented . this showed that the rotary instrumentation had a limited working area , in according with previous studies5 ,10 . the flexibility of the niti instruments does not allow a controlled instrumentation of the buccal and lingual extensions of flattened canals . these instruments frequently produce a circular protuberance in the root canals , maintaining the extensions uninstrumented5 ,12 . wu and wesselink15 ( 2001 ) also demonstrated that , after biomechanical preparation of mandibular incisors with oval root canals using balanced force , 65 % of the canals presented non - instrumented isthmuses . in the present study , the group instrumented with the rotary system had better results in the apical third , with only two sections having non - instrumented buccal and lingual extensions ( isthmuses ) versus six middle third sections this may be attributed to the fact that most flattened root canals become more round towards the apex , as previously shown in a study with extracted teeth16 . several automated systems that connect different types of files to different handpieces are being introduced to endodontics . amongst theseare the alternating systems that use oscillatory movements , which have been described as the best type of movement for biomechanical preparation of flattened root canals8 . endo - eze instruments have recently been introduced to the market and , according to its manufacturer , the use of stainless steel instruments attached to an oscillatory handpiece allows the preparation of oval anatomical irregularities of root canals , thus cleaning the intracanal space without weakening the root . in this study , the oscillatory system ( endo - eze ) was used in flattened root canals to allow comparisons with the data of previous studies1 ,10,12 , which carried out similar studies under the same conditions using similar techniques , but used rotary niti instead . the present study evaluated the amount of uninstrumented root canal area after biomechanical preparation using the oscillatory technique . our results were better than those of previous studies that used rotary instrumentation in flattened root canals and found that the rotary instrumentation was not capable of reaching all the root canal walls1 ,10,12 . in this study , the number of sections that maintained the original root canal shape when using the oscillatory technique in middle third was statistically significant ( 9 sections ) , if compared to the rotary technique ( section 1 ) ( table 2 ) . in the apical thirdthis result disagree with those of camargo4 ( 2004 ) , according to whom endo - eze instrumentation caused greater displacement of root canal center than the race instrumentation in the apical third of artificial premolars . under the tested conditions , endo - eze oscillatory system yielded the instrumentation of all flattened root canal walls , maintaining the canal original shape throughout the biomechanical preparation , and was more effective than race rotary system .\noutput:\n" }, { "from": "agent", "value": "objective : the aim of this study was to evaluate the biomechanical preparation of flattened root canals using the following systems : endo - eze aet stainless steel oscillatory instruments ( ultradent ) and race rotary niti instruments ( fkg dentaire ) . materials and methods : twenty extracted human mandibular incisors were randomly assigned to two groups : group 1 - instrumentation with oscillatory endo - eze aet files ( oscillatory technique ) ; group 2 - instrumentation with rotary niti race files ( rotary technique ) . the teeth were decoronated , had their apices and coronal openingssealed with sticky wax and were embedded in crystal - clear orthophtalic polyester resin . the roots were sectioned transversally with diamond discs at 10 mm ( middle third ) and 5 mm ( apical third ) from the apex and the segments were reassembled for instrumentation . the sections were photographed before and after root canal instrumentation and evaluated with respect to whether the original root canal shape was modified by instrumentation . to evaluate the differences in the root canal shape before and after biomechanical preparation , scores were given regarding the instruments touch on the intracanal walls.results : in middle third of the root canals instrumented with the rotary system , there was a change in the original canal anatomy ( p < 0.05 ) , with formation of a protuberance in the mesiodistal direction . this protuberance did not occur when the oscillatory instrumentation was used . the oscillatory system had better results in the middle and apical thirds as evaluated by dunn s multiple - comparison test ( p > 0.05 ) . conclusion : under the tested conditions , endo - eze oscillatory system yielded the instrumentation of all flattened root canal walls , maintaining the canal original shape throughout the biomechanical preparation , and was more effective than race rotary system ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: elucidation of the dynamic changes in secretomes , i.e. , the secreted subset of the proteome , underlies a systems approach to understanding the mechanisms controlling cell cell and cellit is now clear that changes in the cellular microenvironment determine disease progression , and that these include two - way interactions between cancer cells and surrounding stromal cells . several recent studies have employed proteomic techniques to define the secretomes of cancer cells . recent studies have also defined the secretome in breast and colon cancer fibroblasts , but in general the interrogation of stromal cell secretomes by proteomic methods has been limited . changes in secretomes may reflect alterations in secretory protein abundance due to variations in gene expression , rates of exocytosis or presecretory post - translational processing . but in addition , there may also be extensive postsecretory proteolysis that defines the extracellular tumor degradome . in cancer , alterations in extracellular proteolysis through differential secretion of proteases or their inhibitors is important , not least because it underlies disease progression and sensitivity to protease targeted therapies . cancer - associated fibroblasts , of which myofibroblasts are a subset , are important stromal cells that exhibit an altered phenotype in many cancers . myofibroblasts play important roles in defining the tissue microenvironment through secretion of extracellular matrix components , growth factors , proteases and their inhibitors . differences between normal and cancer - associated myofibroblasts ( cams ) have been linked to tumor progression by mechanisms including recruitment from circulating mesenchymal stromal cells , global dna hypomethylation and changes in gene expression profiles . since myofibroblasts stimulate cancer cell invasion , in the present study we sought to define the differences between gastric cams compared with adjacent tissue - derived myofibroblasts ( atms ) with respect to proteolytic processing of their secretomes . the data indicate both upregulation and activation of matrix metalloproteinases ( mmps ) - 1 , -2 , and -3 are characteristic of the cam secretome . myofibroblasts from gastric cancers ( cams ) and adjacent tissue ( atms ) from two patients have been described previously ( supporting information ) . the work was approved by the ethics committee of the university of szeged , hungary , and subjects provided informed consent . myofibroblasts were cultured in dmem silac media ( pierce , thermo scientific , rockford , il , usa ) for 6 population doublings in the presence of either natural ( light ) or heavy c6 - labeled l - arginine ( 0.94 mm ) and c6l - lysine ( 0.46 mm ) ( invitrogen , paisley , renfrew , u.k . ) . media were further supplemented with 10 % dialyzed fetal bovine serum ( pierce ) , 2 % antibiotic / antimycotic ( sigma - aldrich , poole , u.k . ) and 1 % penicillin / streptomycin ( sigma ) . media ( 10 ml , serum - free ) obtained from 110 myofibroblasts plated in 10 cm diameter dishes ( 8090 % confluency ) were collected after 24 h. samples were concentrated to approximately 0.5 ml using amicon ultra-153 kda centrifugal filter devices ( millipore , watford , u.k . ) , precipitated with 20 % tca and resuspended in 50 mm hepes , ph 7.4 , 100 mm nacl , 0.8 % w / v chaps , 1 % v / v protease inhibitor cocktail set iii , edta - free ( calbiochem , merck biosciences , beeston , u.k . ) . equal amounts ( 35 g each ) of light and heavy silac - labeled secretome samples from cams and atms were mixed following determination of protein concentration by the bradford assay ( bio - rad lab , inc . , hemel hempstead , u.k . ) . methionyl - cofradic was performed as described previously ( see supporting information methods ) . samples were reduced and s - alkylated , and following trypsinization ( trypsin : protein 1:100 ) , peptides were fractionated by reversed - phase hplc ( rp - hplc ) using an agilent 1100 hplc system with a zorbax 300sb - c18 column ( 2.1 mm ( internal diameter ) 150 mm , agilent technologies , wokingham , u.k . ) . the resulting hplc fractions were further processed by incubating for 30 min with 0.1 % w / v hydrogen peroxide at 30 c . following oxidation of methionines , reaction mixtureswere immediately reinjected onto the rp - hplc column for secondary rp - hplc separations under identical conditions . fractions with methionine containing peptides displayed a hydrophilic shift and were collected ( n = 90 ) and analyzed by lcn - terminal cofradic was performed as described previously ( see supporting information methods ) . proteins were reduced and alkylated , and primary - and - amines were blocked by trideutero - acetylation . samples were then trypsinized , and n - terminal peptides were pre - enriched by strong cation exchange chromatography at low ph . following a pyro - glutamate removal step , peptides were separated by rp - hplc as described above . primary fractions were incubated with 2,4,6 - trinitrobenzenesulphonic acid ( tnbs ) to modify internal tryptic peptides with free - n - termini . a series of secondary rp - hplc runs was then performed on each individual primary fraction , and n - terminal peptides ( which did not display a hydrophobic shift ) were collected ( n = 36 ) for lcsamples prepared for shotgun analysis of the secretomes were processed following the same method as for met - cofradic up to the stage immediately before the first rp - hplc run . at this pointms / ms analysis ( see supporting information methods ) . for neo - n - terminal enrichment , the non - cofradic method employed a scx - only enrichment of n - terminal peptides . samples were prepared as for n - terminal cofradic up to the first rp - hplc run . at this stage60 fractions of 1 min interval were collected , pooled to give a total of 20 fractions , dried and prepared for lc ms / ms analysis . peptides were analyzed using a ltq orbitrap xl mass spectrometer ( thermo electron , bremen , germany ) as described previously . mascot generic files ( mgf ) were created using the mascot distiller software ( version 2.2.1.0 , matrix science , ltd . , london , u.k . ) . when generating peak lists , grouping of spectra was performed with a maximum intermediate retention time of 30 s and maximum intermediate scan count of 5 . a peak list was only generated when the spectrum contained more than 10 peaks . there was no deisotoping , and the relative signal - to - noise limit for both precursor and fragment ions was set to 2 . the peak lists were then searched with mascot using the mascot daemon interface ( version 2.2.0 , matrix science , ltd . ) against human proteins in the swiss - prot database ( uniprot release 15.0 , containing 20333 human protein sequences ) . spectra were searched with semiargc / p enzyme settings , allowing no missed cleavages for the n - terminal peptide experiments , and with trypsin / p settings allowing no missed cleavages for the met - cofradic / shotgun experiments . mass tolerance of the precursor ions was set to 10 ppm ( with mascot s c13 option set to 1 ) and of fragment ions to 0.5 da . variable modifications were acetylation of alpha - n - termini and pyroglutamate formation of n - terminal glutamine residues ; fixed modification was oxidation of methionine ( sulfoxide ) . additionally , for n - terminal peptide experiments , trideutero - acetylation of the n - terminus was set as variable peptide modification , and trideutero - acetylation of lysine side chains was included as fixed modification . only peptides that were ranked one and scored above the identity threshold scorethe fdr was calculated for every search as described previously ( see supporting information methods , table sm3 ) . identified peptides were quantified using the mascot distiller quantitation toolbox ( www.matrixscience.com ) in the precursor mode as described previously . ratios for all peptides of interest were validated by manual inspection of spectra . for processing of all ms data , protein ratios were inferred using the mean of the peptide group ratios for each protein . a peptide group represents all quantifications of a single peptide sequence in an experiment . the distribution of protein ratios as determined by the met - cofradic and shotgun experiments was plotted using rover . this was used to define thresholds to give the 5 % of proteins with the largest fold changes in cams relative to atms . all spectra have been stored in the pride database ( http://www.ebi.ac.uk/pride/ , accession numbers 2715727161 ) using pride converter . protein subcellular localizations and functional classifications were manually curated , using the uniprot and hprd online databases . immunocompromised mice ( 6 weeks old , balb / c nu / nu , charles river , wilmington , ma ) with xenogafts of mkn45 cells with or without cams ( supporting information methods ) were used for imaging mmp - activity using mmpsense 750 fast . these experiments were approved by the university of liverpool animal welfare committee and were conducted in compliance with the u.k . myofibroblast cell extracts were prepared in ripa buffer containing protease and phosphatase inhibitors . cell extracts or media were resolved by sds - page and processed for western blotting as previously described . blots were probed with antibodies against mmp - 1 ( baf901 , r & d systems , minneapolis , mn , usa ) , mmp - 2 ( baf902 , r & d systems ) and mmp - 3 ( baf513 , r & d systems ) . membranes were reprobed with anti - gapdh antibody ( biodesign , saco , maine , usa ) for assessing equal loading where appropriate . fluorogenic assays for mmp enzyme activity were performed using selective substrates : dnp - pro - leu - ala - leu - trp - ala - arg - oh ( mmp - 1 ; calbiochem , bedfont cross , u.k . ) , dnp - pro - leu - gly - met - trp - ser - arg - oh ( mmp - 2/9 ; calbiochem ) , mca - pro - leu - ala - nva - dpa - ala - arg - nh2 ( mmp - 2 ; calbiochem ) , dnp - pro - tyr - ala - ty - trp - met - arg - oh ( mmp - 3 ; anaspec , fremont , ca , usa ) and 5 - fam - arg - pro - lys - pro - val - glu - nva - trp - arg - lys ( tq2w ) - nh2 ( mmp - 3 ; enzo life sciences , exeter , u.k . ) as previously described . briefly , equal volumes of assay buffer and media from 10 myofibroblasts were incubated with 12 m substrate as appropriate . gastric cancer cell ( ags ) migration ( 10 cells per 8 m pore filter insert ) ( bd biosciences , oxford , u.k . ) was studied as previously described . conditioned media were collected as described above and treated with mmp - 1 neutralizing antibody ( mab901 , r & d systems ) , or selective mmp - 2 ( inhibitor i , calbiochem ) and mmp - 3 ( inhibitor iv , calbiochem ) inhibitors as appropriate . results are expressed as mean standard error of the mean ( sem ) , unless otherwise stated . student s t - test or anova ( systat software , inc . , hounslow , london , u.k . ) as appropriate were used to determine statistical significance of results and considered significant at p 0.05 , unless otherwise stated . when myofibroblasts derived from two gastric cancers and corresponding atms were silac labeled and the secretomes analyzed by lcms / ms , approximately 350 unique proteins ( 310 and 392 ) were identified in each pair on the basis of one or more peptide unique assignments with validated quantification ( supporting information tables s1 , s2 ) . of these ,42 and 48 % were characterized as extracellular proteins on the basis of annotations in the uniprot and hprd databases . one of the paired samples was further analyzed using the cofradic technology that enriches for methionine - containing peptides in an attempt to increase overall proteome coverage by reducing sample complexity . this approach more than doubled the number of unique peptides and proteins identified in the secretome , although a comparable proportion ( 31 % ) of the identifications were attributable to extracellular proteins ( figure 1a ; supporting information table s3 ) . the met - cofradic analysis identified the majority ( 72 % ) of proteins identified in the initial experiments ( figure 1a ) . in total across the three experiments , 1460 unique proteins were identified , of which 364 were annotated to be extracellular proteins . ( a ) venn diagram showing , left , identification of unique proteins , on the basis of one or more unique peptides with a validated quantification , in media from pairs of cams / atms from two patients , and overlap with met - cofradic identifications in patient 1 based on the same criteria ; right , extracellular proteins in this data set . ( b ) functional classification of extracellular proteins identified by met - cofradic and classical shotgun proteomics , alongside cleaved proteins and total cleavage products in myofibroblast secretomes by n - terminal peptide enrichment ( restricted to identifications with successful quantification ) . extracellular proteins making up the secretome were grouped into 11 functional classifications ( figure 1b ) . there was a broadly similar distribution across these groups in both pairs of cams and atms , with binding proteins and extracellular matrix proteins the two largest groups ( figure 1b ) . when 95 % confidence limits were determined and applied to individual experiments , 947 proteins were identified that were above or below these limits ( supporting information figure s1 ; supporting information table s4 ) . interestingly , mmp - 1 , mmp - 3 , mmp - 10 and upa were identified as upregulated in cams in both patients ( supporting information table s4 ) . the largest groups showing differential abundance were binding proteins , e.g. , the insulin - like growth factor binding proteins ( igfbps ) , receptor proteins , e.g. , epidermal growth factor receptor , and proteases , e.g. , mmp - 1 ( supporting information table s4 ) . we then extended the analysis to the identification of neo - n - termini generated as a consequence of proteolytic cleavage . thus , silac - labeled media samples were enriched for n - terminal peptides using a strong cation exchange ( scx ) step to remove nonterminal peptides . as part of this procedure , neo - n - terminal peptides had been trideutero - acetylated prior to trypsinisation to facilitate discrimination from other peptides by mass spectrometry , and the results were filtered so that only peptides that were trideutero - acetylated and had a valid mascot identification were used in subsequent analyses . of unique quantified peptides , this process identified peptides starting at residues 1 or 2 of the protein or immediately after removal of the signal sequence , which were excluded from further analysis as they were considered uninformative for present purposes . for each of the remaining peptides , the ratio of relative abundance between the cam and atm samples was manually validated by inspecting the spectra and calculating the area under the peaks of the heavy and light isotopes . one of the paired samples was further analyzed using n - terminal cofradic in addition to the scx enrichment step in an attempt to increase coverage of n - terminal peptides by reducing sample complexity . similar numbers of peptides were identified by n - terminal cofradic and scx - only enrichment , but over 2-fold more of these identifications corresponded to neo - n - termini in the cofradic data set ( supporting information table s5 ) . approximately 50 % of all unique proteins identified corresponded to putative secreted proteins ( supporting information table s6 ) . in the functional classification , furthermore , 41 proteins were identified that were not seen in the first set of silac experiments , of which 24 were known extracellular proteins . in the data set as a whole , neo - n - termini corresponding to putative proteolytic cleavage sites were identified in a total of 94 unique proteins , of which collagens alpha1 ( i ) and alpha - 2 ( i ) and igfbp - 5 had the most cleavage sites ( supporting information table s7 ) . in order to refine cancer - related changes , we then sought those proteins for which unique neo - n - termini were identified in cam secretomes relative to their atm counterparts . applying this criterion , we identified 13 proteins that exhibited cam - restricted proteolytic cleavage ( table 1 ) : strikingly , these included cleavages in the propeptide domains of mmp - 1 ( interstitial collagenase ) and mmp - 3 ( stromelysin - 1 ) ( table 1 and supporting information figure s2 ) ; moreover , n - terminal cofradic also identified increased prodomain cleavage in mmp - 2 ( 72 kda type iv collagenase ) ( supporting information table s7 ) . functional classification and cleavage sitesstart and end position number of the n - terminally labeled peptide are relative to unprocessed forms of the protein . to determine the in vivo relevance of myofibroblasts for mmp activity in tumors , we made use of fmt imaging of a mmp fluorescent substrate in a xenograft model consisting of mkn45 gastric cancer cells alone or with human cams . in matched tumors of similar size generated with and without coadministration of cams , the mmpsense substrate revealed significantly increased activity when human cams were present ( figure 2 ) . increased mmp activity in vivo in xenografts containing cams . ( a ) in balb / c nu / nu mice , mmp activity revealed by fmt imaging of mmpsense 750 fast is increased in xenografts of gastric cancer mkn45 cells containing two different cams compared with mkn45 cells alone . ( b ) representative fmt images of mice with xenografts of mkn45 cells alone ( top row ) , mkn45 cells + cam2 ( middle row ) , and mkn45 cells + cam1 ( bottom row ) . the substrate used for in vivo imaging does not distinguish individual mmps , and subsequent studies therefore made use of in vitro techniques to assess the relative contribution of mmps13 in cam media . western blots of mmp - 1 revealed increased abundance of a 42 kda form corresponding to the active enzyme in cam compared with atm media ; in contrast , in cell extracts of the two cell types there was similar abundance of the precursor proteins of 57 and 52 kda ( figure 3a ) . for mmp - 2 , we identified a precursor form of 72 kd in cells and media of both cams and atms , again in similar abundance in the two cell types . when blots of media were overexposed it was possible to identify a minor band of 63 kda corresponding to the active enzyme in cam but not atm media ( figure 3b ) . finally , for mmp - 3 we identified precursor proteins of 59 and 54 kda in cells and media of both cams and atms ; a band of 45 kda corresponding to the active enzyme was found in media , and the abundance was greater in cams compared with atms ( figure 3c ) . western blots show the active forms of mmp - 1 , mmp - 2 , and mmp - 3 in cam media . ( a ) representative western blots of mmp - 1 in cam and atm media ( left ) and cell extracts ( right ) . ( b ) representative western blots of mmp - 2 in cam and atm media ( left ) and cell extracts ( right ) . ( c ) representative western blots of mmp - 3 in cam and atm media at two different exposures ( left , center ) and cell extracts ( right ) . to establish the functional significance of these results , we then studied mmp enzyme activity in cam and atm media . using a fluorogenic substrate for mmp - 1 , we found significantly greater activity in cam compared with the corresponding atm media ( figure 4a ) . similarly , substrates selective for mmp - 2 , or for mmp - 2 / mmp - 9 ( figure 4a ) , revealed greater activity in cam than atm media , and the same pattern was observed with two different mmp - 3 substrates ( figure 4a ) . increased mmp - 1 , mmp - 2 , and mmp - 3 activity in cam media . ( a ) mmp - 1 , mmp - 2 , and mmp - 3 enzyme activities ( using the selective substrates indicated in brackets ) are increased in cam compared with atm media ; left , assays based on trp fluorescence and right on fret . ( b ) cam - cm media stimulates ags cell migration and is inhibited by neutralizing antibody to mmp - 1 ( 2.5 g ml ) or inhibitors ( see text ) of mmp - 2 ( 6 m ) and mmp - 3 ( 3 m ) . there is mmp - stimulation of migration of ags gastric cancer cells in boyden chambers , and this was then used to test the functional significance of the changes in mmp abundance and activity in cam media . conditioned media ( cm ) from both cams and atms stimulated ags cell migration , but the response to the former was significantly greater than to the latter ( cam - cm : 20711 cells per field ; atm - cm : 14511 , p 0.05 ; control media : 152 ) . neutralizing antibody to mmp - 1 ( 2.5 g ml ) significantly suppressed ags cell migration in response to cam - cm ( figure 4b ) ; similarly , previously characterized selective inhibitors of mmp - 2 or mmp - 3 at concentrations approximately 3-fold above their reported ki in each case ( 6 and 3 m , respectively ) also inhibited ags cell migration in response to cam - cm , indicating that active mmp - 2 and mmp - 3 released from myobfibroblasts play a role in cancer cell migration ( figure 4b ) . the tumor microenvironment reflects the secretomes of both cancer and stromal cells including myofibroblasts , fibroblasts , pericytes , endothelial cells , inflammatory and immune cells . crucially , interactions between different secretomes influence cancer cell migration , invasion and metastasis by multiple mechanisms including the activation or inhibition of proteases with consequences for the proteolytic cleavage of ecm proteins , growth factors , cytokines and chemokines . the secretomes of cancer cells have attracted increasing attention in recent years , but little is yet known of stromal cell secretomes . differences in the secretomes of myofibroblasts recovered from gastric cancers and those recovered from adjacent tissue have been reported recently using itraq . we have now used silac and cofradic to determine the extent to which proteolysis influenced myofibroblast secretomes in gastric cancer . our study identified neo - n - termini derived from 94 proteins in cam secretomes including evidence of cleavage of the prodomains of mmp - 1 , -2 , and -3 leading to increased extracellular proteolytic activity . the data indicate that a distinguishing feature of cancer myofibroblasts is increased expression and increased activation of these mmps in an autonomous manner in gastric cancer with the potential for promoting cancer progression . the identification of secreted biomarkers by cancer cells has been a focus of interest for several generations and has been stimulated more recently by the development and refinement of proteomic methods and the prospect of rigorously defining the cancer secretome . extracellular proteolysis presents additional challenges in defining the relevant secretomes ; it is important not least because it underlies multiple mechanisms implicated in cancer progression including angiogenesis , tumor cell migration and invasion . a number of proteomic methods have recently been used to identify neo - n - termini generated in complex samples including cofradic and terminal amine isotopic labeling of substrates ( tails ) , which has been applied to the identification of substrates of mmp - 2 and mmp - 9 in fibroblast secretomes . since silac has previously been used successfully for secretome studies in a range of cell types including stromal cells from other tissues , and since cofradic coupled with silac labeling is considered to offer a rigorous approach to n - terminomics , these methods were selected for the present studies . golgi secretory pathway ; however , as commonly found in secretome studies , there were also proteins likely to be released by other mechanisms including cytoplasmic proteins liberated through cell death , shedding of membrane proteins and release of exosomes . previous studies have identified similar rates of apoptosis in cams and atms suggesting that differential cell death is unlikely to account for differences in the cam and atm secretomes . for proteins released through classical secretory mechanisms , we were able to identify many previously reported in the secretomes of fibroblasts and of the stem cells that may give rise to them , including extracellular matrix proteins , igfbps , mmps and timps . the differences between cam and atm secretomes may reflect alterations in gene expression , post - translational processing , relative rates of secretion and in proteolysis following release . we have now defined the latter though identification of neo - n - termini in cams compared with their corresponding atms . for example , we found multiple neo - n - termini in collagens alpha - 2 ( i ) and alpha - 1 ( i ) , and igfbp5 , as well as at limited sites in 91 other proteins . in a small subset of proteins we identified neo - n - termini that were unique to cams , andthese included six neo - n - termini in the prodomains of mmp - 1 and mmp - 3 , suggesting that activation of these mmps might be functionally important in cams . it is well established that mmp activity is increased in tumors and promotes cancer cell migration and invasion ; the present in vivo imaging data indicate that cams contribute to this increased activity in an animal model . it is likely that mmps have multiple roles in different tumor functions accounting for the fact that mmp inhibitors have not yet led to successful anticancer therapies . the present demonstration of increased expression and activation of mmp - 1 , mmp - 2 and mmp - 3 in cam secretomes nevertheless suggests a novel dimension to the role of these enzymes . in vivothere may be activation of myofibroblast mmps by epithelial or cancer - derived proteases , e.g. , mmp - 7 . importantly , however , the present data indicate that increased mmp activity in cam media occurs independently of a cancer or epithelial cell stimulus . this is nevertheless relevant to cancer cell function not least because mmp - 1 , mmp - 2 , and mmp - 3 stimulate cancer cell migration and make a substantial contribution to the chemotactic properties of cam conditioned media . the prodomain cleavages of mmp - 1 , -2 , and -3 identified here are all on the n - terminal side of the conserved cysteine switch sequence , and we think it is possible that these facilitate activation by exposing the site for autolysis much in the same way that trypsin activates mmps . however , the precise protease ( s ) responsible for cam - autonomous prodomain cleavages is presently unclear and should now be investigated . in this contextit is worth noting that there was decreased abundance of protease inhibitors , including timps - 1 , -2 , and -3 in one patient ( supporting information table s4 ) , which may contribute to increased protease activity . cofradic has provided the most detailed analysis of gastric cancer myofibroblast secretomes to date . it extends previous studies , but in addition , it defines differences in the extracellular degradomes of cams and atms . at least some of the differences between cafs or cams and their normal tissue counterparts are thought to reflect interactions that occur in the presence of cancer cells . the present data indicate that selective mmp - activation occurs in the cam secretome even when these cells are cultured in the absence of cancer cells . this property reflects a cell - autonomous mechanism by which cams might contribute to a cancer - promoting microenvironment . the possibility of targeting anticancer therapies to stromal cells has emerged recently , and the present data indicate how these could be refined to include the stromal degradome .\noutput:\n" }, { "from": "agent", "value": "cancer progression involves changes in extracellular proteolysis , but the contribution of stromal cell secretomes to the cancer degradome remains uncertain . we have now defined the secretome of a specific stromal cell type , the myofibroblast , in gastric cancer and its modification by proteolysis . silac labeling and cofradic isolation of methionine containing peptides allowed us to quantify differences in gastric cancer - derived myofibroblasts compared with myofibroblasts from adjacent tissue , revealing increased abundance of several proteases in cancer myofibroblasts including matrix metalloproteinases ( mmp ) - 1 and -3 . moreover , n - terminal cofradic analysis identified cancer - restricted proteolytic cleavages , including liberation of the active forms of mmp - 1 , -2 , and -3 from their inactive precursors . in vivo imaging confirmed increased mmp activity when gastric cancer cells were xenografted in mice together with gastric cancer myofibroblasts . western blot and enzyme activity assays confirmed increased mmp - 1 , -2 , and -3 activity in cancer myofibroblasts , and cancer cell migration assays indicated stimulation by mmp - 1 , -2 , and -3 in cancer - associated myofibroblast media . thus , cancer - derived myofibroblasts differ from their normal counterparts by increased production and activation of mmp - 1 , -2 , and -3 , and this may contribute to the remodelling of the cancer cell microenvironment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: people over age 60 numbered around 600 million worldwide in 2000 , and these figures are expected to reach 1.2 billion by 2025 and 2 billion by 2050 . of these , about two thirds currently live in the developing world , and it is estimated that this figure will rise to 75 % by 20251 . globally , this increase in both overall numbers of older people and their percentage relative to the total population has considerable implications for older people and service availability2 . specifically , this will lead to changing demands on health care systems in both developing and developed countries and saudi arabia is no exception . the world health organization ( who ) defines quality of life ( qol ) as an individual s perception of their position in life in the context of their culture and value systems and in relation to their goals , expectations , standards and , concerns . it is a broad concept complexly affected by the person s physical health , psychological state , personal beliefs , social relationships , and relationship with environmental features1 . the kingdom of saudi arabia is one of the largest countries in the middle east , and during recent decades has experienced a rapid expansion in health services . the health care system in saudi arabia can be divided into government and private sectors , with free - of - charge government services for saudi and non - saudi individuals , with very few restrictions . there are large , technologically advanced hospitals in major cities that provide open - heart surgery , kidney transplantation , and oncology therapy . however , despite expansion , health expenditures are expected to dramatically increase and exceed the population growth rate as hospital bed demand grows . while the proportion of the elderly population to total population was 5.8 % in 2000 , it is expected to reach 8.7 % by 2026 and 15.0 % by 2050 . this demographic transition of population aging is a global phenomenon that demands international , national , regional , and local action . consequently , there has been increasing international awareness of health issues relating to aging populations . consequently , saudi adults are becoming older and the percentage of the population over 60 is rising , and is expected to more than double by 2020 . by this date , the number of older people is expected to grow from approximately 1 million ( 4 % of the population ) to roughly 2.5 million ( 7 % of the population ) 1 , 2 . this increased number of older people in saudi arabia presents numerous challenges to health care system , and especially to health care workers providing services to older clients with both acute and chronic conditions . the current changes to the health care system and shortage of health care personnel have made it difficult for older adults to access adequate health care of suitable quality . in light of the above , health care provision for older people in saudi arabiais not yet as well developed as general services , and studies concerning older peoples needs are scarce . the saudi cultural tradition for supporting older people puts a premium on personal family care , especially for those that are partially disabled , sick , and older , remains strong in the kingdom , and is largely underpinned by religious faith . in general , old age is admired as a holy state of great religious significance and the aged are given considerable respect within the family in eastern cultures . in the home environment , an older person s views usually prevail . thus , older patients would not expect any dramatic changes to the way they are accustomed to being treated in health care facilities . however , the family emphasis potentially raises tensions with formal support . whilst there is no doubt that the older population is growing and increasing older people s adequate health care needssuch cultural and religious considerations pose unique challenges to service providers when entering homes , particularly of older persons unaccustomed to the professions of social workers or in - home nurses . furthermore , it is regarded as religiously condemnable and socially irresponsible for children to send their parents to nursing homes rather than providing home care3 . however , the severity of older peoples needs has increased , and nursing home health care is expected to significantly grow in the coming years in saudi arabia4 , which is a primary concern for health care providers . moreover , older patients are currently dissatisfied with health services in saudi arabia as the result of a lack of specialty clinics and skilled nursing5 . there is also a limited response to older people s care in acute care hospitals in saudi arabia . similarly , one study claims that hospitals are not ideal for older persons with long - term conditions who have high accident rates ( 62.5 % ) that primarily occur in patients aged 60 years or older6 . it is suggested that may be the result , in part , to nursing staff lacking the time and skills necessary to provide longer - term hospital care for older patients7 . clearly , there is a need not only for more adult care training in saudi arabia , but for such training to equip health care providers with the skills needed to support older people . any attempt to provide high quality care for older people must consider both attitudes towards these patients and knowledge of the ageing process . a cross - sectional study was conducted among elderly individuals ( aged 60 years and older ) in a major hospital in jeddah , saudi arabia . participants included 55 male and female adults with an age range of 6090 years ( mean 67.97.71 ) . this study was approved by the institutional review board at king abdulaziz university . prior to beginning the study , informed consent was acquired . potential participants were recruited based on the following criteria : ( 1 ) aged 60 and older , and ( 2 ) ability to participate in activities of daily living ( adl ) independently with or without using an ambulatory aid . data were collected using an interview questionnaire , records review , and by taking some measurements . as recommended by previous studies , qol is best assessed using direct patient interviews . during assessment , researchers were careful not to reveal their own biases . determining a patient s preferences is usually possible with this method and even patients with mild dementia or cognitive impairment can report preferences when researchers use simple explanations and questions . in this study , it was recommended that family members were present when discussing patient preferences for those with a cognitive impairment . subjects were instructed that they had the right to withdraw from the study at any time . the questionnaire provided important background information regarding general health , which consists of each participant s adls , fall risk , health status ( diabetic mellitus ( dm ) , hypertension ( htn ) , heart disease , kidney , rheumatoid arthritis , osteoporosis ) , memory problems , sleep patterns , economic status , psychological status , educational level , and caregiver presence . this information allowed us to establish subjects health status and determine if they had any problems that could significantly affect their qol . additionally , a pre - designed questionnaire was used to collect information about personal and socio - demographic characteristics , caregiver presence , personal habits , and perceived health . subjects functional capacity was established by asking about their ability to complete basic activities , such as walking , bathing , using the toilet , dressing , eating , and getting in and out of the home without needing help . the presence of chronic diseases was identified by asking about physician - diagnosed chronic disease . subjects weight and height were measured , and body mass index ( bmi ) was calculated ( bmi = weight in kg / height in meters squared ) . data were analyzed using the statistical package spss for windows version 16.0 ( spss , inc . , chicago , il , usa ) . the level of statistical significance was set at p 0.5 . the results showed a significant positive correlation between age and adl ; age and memory problems , anxiety , and loneliness ; and sleep disturbance and falls . this study also found that the main factors contributing to qol among older adults were chronic disease , falls , sedentary lifestyle , sleep disturbance , and financial situation . furthermore , there was an alarmingly high rate of falls among older adults with dm ( 58.18 % ) and htn ( 29.0 % ) . in addition , this study confirmed that older saudi adults engaged in little physical activity ( 63 % ) due to bone and joint pain ( 90.0 % ) and led a sedentary life ( 69 % ) . these factors can predispose them to risk of developing a disability and experiencing falls . furthermore , this study indicated that single sensory impairments ( either visual or auditory ) are significantly and independently linked with a high risk of depression and decreased self - sufficiency in daily living activities , which can adversely affect mobility and the ability to perform adl ( tables 1table 1 . functional characteristics , mean and percentages among older saudi adultsmean age ( years ) 67.97.71 education ( years ) 10.73.7 marital status ( married ) ( 92.9 % ) vision problem ( 82.0 % ) hearing problem ( 54.54 % ) mild - moderate handicap ( 16.3 % ) severe handicap ( 11 % ) mental ( 32.1 % ) diabetes ( 58.18 % ) cancer ( 27.2 % ) stroke ( 21.8 % ) hypertension ( 29.0 % ) coronary ( 69.9 % ) bones / joints ( 90.9 % ) back / neck ( 70.9 % ) brain / neuro ( 69.0 % ) tobacco use ( 32.1 % ) , 2table 2 . activities of daily living among older saudi adultsactivity of daily living ( adl ) frequency ( n = 55 ) % self - reliant1425 .4 % require little help2036 .4 % require a lot of help1222 % fully dependent916 .3 % , 3table 3 . activity level among older saudi adultsactivity levelfrequency ( n = 55 ) % sedentary level3869 .0 % one hour weekly activity916 .4 % more than two hours weekly activity814 .65 % , 4table 4 . sleep difficulty among older saudi adultssleep difficultyfrequency ( n = 55 ) % yes3970 % no1629 % , 5table 5 . causes of falls among older saudi adultscause of falls among the elderlyfrequency ( n = 55 ) % environment2974 .3 % dizziness1221 .8 % gait disorders1120 % drop attack23 .6 % syncope11 .8 % ) . health status is an important factor that significantly impacts the qol of the elderly population . the major elements of health status are perceived health , especially psychological well - being , chronic illnesses , and functional status ( e.g. , fall risk ) . some factors that influence health - related qol are institutionalization , reduced life expectancy , cognitive impairment , disability , chronic pain , social isolation , and functional status . in the current study , researchers found sleep disorders and chronic diseases were associated with an increased risk of falls , leading to a poorer qol among older adults . fall injuries are the greatest threat to the quality of health and well - being of older adults8 . however , this study found that 51 % ( n = 29 ) of participants had fallen once and 49 % ( n = 27 ) had fallen more than once in the past 12 months . furthermore , this study indicated a high positive correlation between age and fall history ( r = 0.06 ) . similarly , another study has reported that people aged 85 years and older have a greater risk of falls or fall - related injuries compared to those in the 6585 age range9 . more detailed questions about sleeping disorders revealed that participants experienced difficulty sleeping ( 65.22 % ) , difficulty falling back to sleep after waking ( 63.04 % ) , feeling drowsy when awake ( 41.30 % ) , and feeling exhausted during the day as the result of sometimes ( 50 % ) or often ( 17.39 % ) having problems sleeping at night . in addition , difficulty falling asleep varied between sometimes ( 36.96 % ) and often ( 32.61 % ) . thus , sleep disturbances are often experienced by older adults9 ,10,11 and were prevalent in older adults ( 65.2 % ) . similar results from a study of 150 participants reported that falls and sleep disturbances were common during the previous year , as evident in the presence of participants reporting falls ( 44 % vs. 41 % ) and multiple falls ( 20 % vs. 16 % ) . in contrast , one study shows that more than a third of community - dwelling women ( 37.7 % ) reported at least one night - time sleep problem , and 8.1 % reported abnormal daytime sleepiness12 . abnormal daytime sleepiness was also significantly prevalent among those who experienced falls but no association has been found between night - time sleep problems and increased fall risk9 . additionally , the present study shows that the older adults with chronic diseases who had a higher risk of falls ( 43.5 % ) had more than two chronic conditions , such as dm ( 58.18 % ) and htn ( 29.0 % ) . previous studies have confirmed that older adults with chronic diseases have a greater risk of falling . the percentage of older adults with two or more chronic conditions increased for men and women ; 45 % of older adults aged 65 and over had been diagnosed with two or more chronic diseases . another study revealed that older women with any chronic diseases had a higher risk of falling ( 32 % ) than those who used psychotropic drugs ( 25 % ) . accordingly , it suggested preventing falls using strategies focusing on prevention and control of chronic disease should be used rather than polypharmacy13 . consequently , there is widespread agreement that older adults poor sleep habits affect qol . likewise , another study confirmed that elderly people without any physical disease enjoyed better sleep quality and qol than those with more than two physical diseases , particularly those suffering from heart disease14 . thus , health professionals should consider sleep disorders and chronic diseases risk factors for a poor qol among older people . further research is strongly needed to investigate the impact of specific chronic diseases , such as dm , on the risk of falling in the saudi community . additionally , the present study reports that poor vision and hearing affected 40.09 % of older adults , which may subsequently influence qol . similarly , previous research has confirmed that poor qol was more frequent in older people with a combination of poor vision and other sensory and balance impairments . specifically , older people with vision and hearing loss were more likely to have fallen in the past year ( 37.6 % ) than those without vision or hearing impairment ( 16.5 % ) . in addition , using mobility aids and assistive devices increase older adults confidence and sense of security , which promotes increased activity level and independence15 , 16 . the relation between using an assistive device and the risk of falling remains unclear17 . for instance , a prospective prediction of increased fall risk among older adults using mobility aids has been found as the result of disrupted balance control when using an aid without sufficient training or lack of necessary skills . in this study ,39.13 % of participants reported walking with mobility aids , indicating a correlation between mobility aid use and increased fall risk that can affect qol . nonetheless , this study confirms that older saudi adults engage in little physical activity ( 69 % ) , which can predispose them to a risk of developing a disability or a chronic disease such as dm . thus , the greater number of risk factors an individual has , the more likely they are to fall and the more serious the results of falls will be18 . furthermore , this study reports that single sensory impairments ( either visual or auditory ) are significantly and independently linked with a high risk of depression and reduced adl self - sufficiency . mood levels and social relationships are particularly influenced by visual impairment , whereas self - sufficiency in daily living is more strongly related to hearing impairment19 , 20 . however , the kingdom remains in the early stages of development , despite that chronic diseases are now the primary conditions for which older people seek health care . however , since there are no special hospital wards for older patients in saudi arabia , they are treated by general internists , highlighting the need for a cost - effective national program for older saudi people21 ,22,23 . to shed additional light on these issues , a saudi arabian study was conducted by the department of family and community medicine to elicit decision makers ( both medical and non - medical ) opinions on the types of facilities , their locations , and culturally acceptable levels of service for the health care of the older population24 . the conclusions from this study were that the majority of respondents favored the establishment of special health care facilities that are able to directly respond to older peoples health needs . we recommend promoting healthy lifestyles and behavioral changes through a community - based health education program . screening programs for chronic diseases among the elderly population ( especially for dm and htn ) are also highly recommended . additionally , there is a need for satisfactory living conditions for the elderly ; this would satisfy their psychosocial needs , increase adl , and increase participation in useful activities . moreover , welfare services and heath planners should be encouraged to provide good quality training for elderly home care services , similar to those in western countries . these should be culturally and religiously acceptable , and include residential accommodation , sheltered housing , and rest homes for older people .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] this study investigated physical health status and quality of life among older saudi adults . [ subjects and methods ] participants included older adults ( n = 55 ) aged 6090 years ( mean = 67.9 7.71 ) from a major hospital in jeddah . subjects completed surveys and evaluations including assessments of personal and socio - demographic characteristics , caregiver presence , personal habits , perceived health , primary physical and psychological complaints , physician - diagnosed chronic diseases , and functional capacity ( i.e. , activities of daily living ) . [ results ] results showed a significant positive correlation between age and adl ; age and memory problems , anxiety , and loneliness ; and sleep disturbance and falls . main factors contributing to quality of life decline were chronic disease , falls , sedentary lifestyle , sleep disturbances , and financial concerns . participants with diabetes mellitus ( 58.18 % ) and hypertension ( 29.0 % ) had a very high fall rate . participants engaged in minimal physical activity ( 63 % ) , often due to bone and joint pain ( 90.0 % ) , and led sedentary lives ( 69 % ) . single sensory impairments were significantly and independently linked to high depression risk and decreased self - sufficiency . [ conclusion ] healthy lifestyle and behavioral changes should be promoted through community - based health education programs for older saudi adults . chronic disease screening programs for the elderly population ( especially diabetes and hypertension ) are recommended ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: epidemiological studies suggest childbearing is an important contributor to development of obesity in many women . weight retention associated with pregnancyis estimated to be between 0.5 and 3.8 kg at 2.5 years postpartum . according to several long - term us studies , including the national maternal and infant health survey and the first national health and nutrition examination survey ( nhanes ) , average weight gain associated with one live birth is approximately 1.6 to 1.7 kg above age - associated weight gain . higher than average permanent weight retention , however , is experienced by many women who become overweight or obese following the birth of a single child . for example , according to nhanes , having one live birth increases the risk of becoming moderately overweight ( body mass index , bmi 27.3 kg / m ) by 60 % and becoming obese ( bmi 30.0 weight loss at 6 months postpartum has emerged as a key predictor of long - term weight retention , highlighting the importance of early postpartum weight reduction . in one long - term study of 795 women , those who lost all pregnancy - associated weight gain by 6 monthspostpartum were 2.4 kg heavier eight to ten years later , whereas those who retained weight were 8.3 kg heavier . even though breastfeeding often emerges as a protective factor against weight retention , in fact , butte and hopkinson observed that the effect of lactation on postpartum weight reduction is highly variable and may even contribute to net weight gain in some mothers . although socioeconomic , environmental , and lifestyle factors , including number of children , maternal age , and exercise habits , are important determinants of weight retention following pregnancy , it is possible that hormonal changes that occur as a result of pregnancy or lactation may also be at play . recent evidence has brought attention to the gut hormones as key contributors to the regulation of food intake and energy balance . these hormones include the stomach - derived orexigenic peptide ghrelin and the intestinal - derived anorexigenic peptides glucagon - like peptide - 1 ( glp - 1 ) and peptide yy ( pyy ) , which serve as signals to the appetite - regulating centers of the brain . it is not known , however , whether ghrelin , pyy , or glp - 1 ( or other modulators of the brain - gut axis ) is altered in the postpartum state , particularly during lactation . a few human studies have measured circulating ghrelin in postpartum women ; however , it remains unclear if and how these hormones fluctuate across the first postpartum year , both during fasting and in response to a meal , and whether circulating concentrations influence postpartum weight retention . the primary purpose of this study is to determine whether the appetite - regulating hormones ghrelin , pyy , and glp - 1 are altered during lactation ( both fasting and in response to a meal ) and to determine whether circulating concentrations of these hormones , along with insulin and / or leptin , are associated with body weight retention in the year following childbirth . a secondary purpose is to explore whether these hormones are acutely associated with appetite and food intake in an ad libitum meal . based on the foregoing , it is plausible to hypothesize that fasting or meal - induced concentrations of these hormones are altered during lactation and are associated with body weight retention . in particular , variations of one or all of these hormones could help explain the highly variable differences in body weight and body composition noted in lactating women . in agreement with this premise , cummings et al . proposed that ghrelin is a thrifty gene product that evolved to help animals consume and store fat well , thereby increasing survival during times of reduced food availability or famine . it could be argued that lactation is a time when thrifty metabolism , acting to preserve maternal adiposity , might offer a survival advantage for both mother and offspring . alternately , elevated ghrelin and / or lowered pyy or glp - 1 during fasting may serve as maternal signals to increase food intake to support the energy demands of lactation . twenty - four healthy , primiparous , postpartum , exclusively breastfeeding women and 20 never - pregnant controls were recruited from november 2009 through april 2013 and followed for one year . women were recruited during late pregnancy and early postpartum using recruitment flyers distributed to clinics , physician offices , lactation consultants , and area hospitals . to qualify , participants had to be at least 18 yr of age , nonsmokers in good general health , and with a hemoglobin and thyroid stimulating hormone ( tsh ) concentration within the normal range ( hemoglobin = 12.018.0 g / dl ; tsh = 0.355.50 u / ml ) . participants were excluded if they had renal , hepatic , endocrine , gastrointestinal , pulmonary , cardiac , or hematologic disease , including elevated blood pressure ( 140/90 mm hg ) ; showed signs of depression , anxiety , disordered eating , alcoholism , or other psychological or substance abuse issues ; or used prescription or over - the - counter medications / herbal preparations that could influence metabolism . lactating participants were excluded if they had complications of pregnancy ( e.g. , gestational diabetes or pregnancy - induced hypertension ) , had a multiple birth , or either were not currently exclusively breastfeeding or did not intend to breastfeed for at least a year . women were included regardless of delivery method as long as they had no activity restrictions at 4 - 5 wk postpartum . the never - pregnant controls were of an age and bmi range that allowed matching to the postpartum lactating group at baseline ( 4 - 5 weeks postpartum ) for age , bmi , and race / ethnicity ; this was accomplished by recruiting groups of control women following the baseline visits of groups of postpartum participants . never - pregnant control women were excluded if they planned on becoming pregnant or relocating from the area within the year following their baseline visit . volunteers were fully informed of possible risks during all procedures before providing written informed consent . lactating women were studied 46 weeks after delivery and at 6 and 12 months postpartum ( figure 1 ) . control women were initially evaluated and followed up at 5 and 11 months from their baseline date . at the initial visit , body weight , body composition , and resting metabolic rate ( rmr ) were measured and a meal test was performed to measure the hormonal ( ghrelin , pyy , glp - 1 , and insulin ) responses to a standardized breakfast meal and ad libitum lunch . these same measures excluding the rmr and the meal testing were performed at follow - up ( figure 1 ) . blood was drawn after a 12 - hour overnight fast for analysis of ghrelin , pyy , glp - 1 , insulin , and leptin . test days were scheduled during the follicular phase of the menstrual cycle for controls and lactating women who had resumed menstruation ; serum progesterone concentrations were measured in all women to confirm status ( i.e. , serum progesterone 2.0 ng / ml ) . body composition was assessed by dual energy x - ray absorptiometry ( lunar prodigy , ge healthcare , fairfield , ct ) and waist circumference was measured at the level of the umbilicus . food intake was controlled for 24 hours prior to baseline testing by providing a controlled diet which consisted of commercially available foods / beverages . energy content of the diet was estimated using the equation of redman et al . based on body weight , age , and sex with an estimate of 1900 kj ( 454 kcal ) added for lactating women . participants were asked to consume all food / beverages provided and to return empty wrappers and any unconsumed food / beverages . two snack bars ( 28.4 g , ~ 418 kj ; clif bar & company , berkeley , ca ) were given as optional snacks above calculated energy requirements if the participant felt in need of additional energy . participants were allowed plain water ad libitum but were asked not to consume other beverage or food not provided by the researchers . participants were also asked to refrain from moderate - to - strenuous exercise for 24 hours before each test day . on the test day morningrmr and fasting respiratory quotient ( rq ) were measured over a 30 min period by indirect calorimetry using a commercially available metabolic cart ( parvomedics trueone 2400 , sandy , utah ) , calibrated before each test with standardized gases . immediately following the rmr , an intravenous catheter was inserted into a forearm or hand vein and connected to a sterile saline solution ( 0.9 % sodium chloride ) that was slowly infused ( ~ 30 cc / hour ) to keep the catheter patent . after the baseline blood draw , participants were provided with a breakfast smoothie ( 15 % protein , 60 % carbohydrate , and 25 % fat ) that they were to consume in 15 minutes . the energy content of the test meal was individualized to provide 20 % of each subject 's estimated total energy expenditure ( ~ 16752500 kj depending on weight , age , and lactation status ) . blood samples were drawn 30 , 60 , 90 , 120 , and 150 minutes after test meal ingestion and 60 minutes following the ad libitum lunch meal ( see below ) . ad libitum food intake was used as a marker of appetite ( commonly defined as the desire to eat ) and was assessed following the 150 - minute blood draw . ad libitum intake was determined individually in a room with the following food / beverages , in gram - weight portions , arranged on the table : ice water , cooked pasta ( 160 g dry ) , marinara sauce ( 140 g ) , alfredo sauce ( 140 g ) , parmesan cheese , meat balls ( 3 ) , hard - boiled eggs ( 2 ) , whole wheat bread ( 2 slices ) , white bread ( 2 slices ) , fresh apples and oranges , milk , fruited - yogurt ( 3 , individual containers ) , and individual portions of margarine , assorted - jellies , honey , and peanut butter . subjects were told the meal was provided to allow baseline ratings for hunger and satiety on a full stomach and were instructed to eat as much as desired within 20 minutes . subjects were not allowed to read or study during the meal or carry bags / backpacks or coats into the room . the amount of food and fluid consumed was determined by weighing food remaining in the buffet as well as unconsumed food on the subjects ' plates . protein , fat , carbohydrate , and total energy were calculated using a food analysis program ( nutribase 8 professional edition v. 8.3.6 ) based on the usda national nutrient database . hunger and satiety were assessed at baseline and at 30 , 60 , 90 , 120 , and 150 minutes after test meal ingestion ( in accordance with blood draws ) and at 20 and 60 minutes following the ad libitum meal using standard visual analogue scales ( vas ) . ( 2 ) how satisfied do you feel ? ( 3 ) how full do you feel ? the vas was 100 mm in length and was anchored at each end by words describing the extremes of the appetite being measured . blood samples were collected , placed on ice , and cold centrifuged ( 28c ) to prevent protein degradation . for the gut peptides , 150 l of aprotinin and 40 l of dpp - ivwere added to 4 ml edta - containing tubes immediately after collection for analysis of pyy and glp - 1 concentrations . blood for analysis of ghrelin and its specific active or acylated form ( ghrelinacyl ) was collected into prechilled tubes containing 100 l of 200 mm aebsf in addition to edta . following separation of plasma , 200 l of 1 nhydrochloric acid was added for each 1 ml of plasma for ghrelin analysis only . leptin , total ghrelin , ghrelinacyl , pyy , and glp - 1 were analyzed by ria using commercially available kits ( millipore corp . , insulin analysis was also completed using a commercially available kit ( siemens diagnostics , tarrytown , ny ) . fasting blood drawn at baseline was analyzed for leptin , progesterone , and prolactin as specified by the kit manufacturer ( progesterone , siemens diagnostics ; prolactin , cayman chemical company , ann arbor , mi ) . intra - assay cvs are as follows : leptin 8.1 % , insulin 12.1 % , ghrelin 4.4 % , ghrelinacyl 11.8 % , pyy 10.1 % , glp - 16.5 % , and prolactin 2.3 % . interassay cv for assays analyzed in multiple batches was as follows : leptin 16.4 % , ghrelin 9.7 % , ghrelinacyl 23.5 % , pyy 10.5 % , and glp - 117.9 % . during the 6 - and 12 - month follow - up visits , participants reported to the laboratory between 7:00 and 9:00 am following a 12 h fast . height , weight , and body composition were measured and blood was obtained for analysis of fasting concentrations of leptin , insulin , ghrelinacyl , total ghrelin , pyy , glp - 1 , and progesterone . information on prepregnancy body weight , weight gain during pregnancy , infant 's birth weight , and lactation status was collected from lactating women , and information on menstrual status was collected from all women via questionnaire and logs . participants were provided logs to document lactation status and menstrual function which were initially provided at baseline and returned at the 6 - and 12 - month visits .15 to 20 subjects per group were initially selected based on power / sample size calculations . specifically , sample size calculations were performed using fasting and 60 min postprandial ghrelin from our previous study which were the only data available at study initiation . these calculations determined that a sample size of 10 to 26 subjects would be required to detect ( with 8099 % power ) a difference between the postpartum lactating and nonpregnant control groups at either time point based on average concentrations in the lactating and control groups and a common standard deviation . sample size calculations performed for the association between fasting ghrelin and fasting pyy and the change in body fat over the one - year follow - up period suggested 14 to 29 postpartum subjects would be required to detect ( with 8099 % power ) an association between fasting postpartum ghrelin and change in body fat if the true change in body fat mass is 0.007 kg per pg / ml change in fasting ghrelin ; the standard deviation of fasting ghrelin is 39 pg / ml and the standard deviation of body fat change is 2.0 kg . at baseline , independent sample t - tests were used to test for differences in body weight / composition , food intake , and fasting hormone concentrations between lactating and control women . changes in hormone concentrations and appetite ratings in response to the standardized meal were analyzed using anova to test for a group ( lactating , control ) by time interaction or main effects for time or group . data collected in response to the ad libitum lunch meal were not included in these analyses . area under the curve ( auc ) was calculated using the trapezoidal method corrected for baseline values ( prism version 6.05 for windows , graphpad software , inc . , la jolla , ca ) for appetite ratings and hormones that changed with meal ingestion including insulin , total ghrelin , ghrelinacyl , pyy , glp - 1 , and the appetite ratings . for hormones and appetite ratings that were initially decreased after meal , including total ghrelin , ghrelinacyl hunger , and desire to eat , both aucs below ( negative ) and above ( positive ) the effect of group for the aucs was determined using independent sample t - tests . separate anova models were used to test for appetite and hormone responses to the ad libitum lunch . for the longitudinal analysis , changes in body weight , body composition , and the fasting hormones over the 12 - month period were analyzed by repeated measures anova to test for a group by time ( baseline , 6 months , and 12 months ) interaction or main effects of time or group and by comparing the deltas of key variables ( i.e. , delta body weight from baseline to 6 and 12 months ) using independent sample t - tests . weight retention was analyzed similarly using delta body weight from reported prepregnancy weight to weight at 6 and 12 months . standard correlation and anova procedures were used to compare differences between women who lost within 2 kg of prepregnancy weight versus those who retained weight . physical and anthropometric characteristics of the postpartum lactating and never - pregnant control women are summarized in table 1 . of the 24 enrolled ,8 were overweight prior to pregnancy ( bmi 24.9 kg / m ) and 16 were normal weight ( bmi = 18.524.5 kg / m ) . lactating women gained 16.14.1 kg during pregnancy , based on reported prepregnancy weight , and were studied at 5.00.7 weeks postpartum . the never - pregnant controls were studied on day 5.33.4 of their menstrual cycle and reported being weight stable for at least the past year . lactating and control women were matched at baseline for age , height , weight , bmi , and body composition ( table 1 ) . lactating women , however , had larger waist and hip circumferences than control women ( p 0.001 ) . all women had progesterone concentrations 2.0 ng / ml during baseline study , indicative anovulation or follicular phase of the menstrual cycle . baseline hip and waist circumferences are missing for one lactating subject and resting metabolism data are missing for two lactating and three control participants due to equipment failure or scheduling conflicts . complete blood and hormonal concentration data were also not available for one lactating woman at baseline due to problems with catheter insertion during the meal test . in addition , occasional samples are missing for two lactating and two control women for ghrelin and ghrelinacyl , one lactating and one control participant for pyy , and two controls and five lactating for glp - 1 due to problems with indwelling catheter clotting at specific time points . missing blood data that occurred at 60 , 90 , or 120 min were filled in by using the average of previous and subsequent points . missing blood data at baseline , 30 min ( after meal ) , or 150 min ( immediately before ad libitum meal ) however was considered missing ; participants with missing data at these time points were not included in the repeated measures analyses and auc analysis . energy and macronutrient intakes of the controlled diet averaged 95142192 kj ( 2274524 kcal ; 16.11.3 % protein , 23.83.4 % fat , and 62.65.2 % carbohydrate ) in the lactating and 97991494 kj ( 2342357 kcal ; 15.31.1 % protein , 23.42.5 % fat , and 64.34.0 % carbohydrate ) in the control groups ( p 0.05 ) . the rmr and resting rq of lactating and control women are summarized in table 1 . no differences were detected between groups ( p 0.05 ) even after adjusting for differences in fat - free mass , fat mass , and age . tsh was within normal limits for all women but was significantly lower in lactating compared to control women ( p = 0.05 ) . prolactin concentration was also higher in lactating compared to control women ( p = 0.001 ) . fasting insulin , leptin , ghrelin , ghrelinacyl , pyy , and glp - 1 concentrations , however , did not differ ( p 0.05 ) between groups . as summarized in table 3 , fasting leptin and insulin concentrations were associated with total body weight and body adiposity but not lean mass , whereas fasting ghrelin tended to correlate negatively with body fat . there were no associations between fasting concentrations of ghrelinacyl , pyy , and glp - 1 and body mass , fat mass , or fat - free mass . the standardized breakfast meal provided 2087452 kj ( 499108 kcal ; 14.31.1 % protein , 22.90.8 % fat , 58.90.5 % carbohydrate , and 2.80.7 grams of fiber ) for lactating women and 1720134 kj for control women ( 41132 kcal ; 14.20.4 % protein , 22.90.9 % fat , 58.90.8 % carbohydrate , and 2.30.4 grams of fiber ) . the insulin , ghrelinacyl , pyy , and glp - 1 responses to the standardized breakfast meal are shown in figure 2 and auc responses for all hormones presented in table 2 . ghrelin ( not shown ) and ghrelinacyl did not change significantly in response to meal ingestion ( p 0.05 ) . the concentration of ghrelinacyl was visibly higher in lactating versus control women after meal but there was only a trend for a group effect ( p = 0.13 at 150 minutes ) . in contrast , insulin , pyy , and glp - 1 increased significantly ( p 0.001 ) following the standardized meal and fell over the next 150 minutes . these meal - induced responses , however , were not different between lactating and control women ( p 0.05 , group time ) . peak insulin responses ( highest insulin concentration minus fasting insulin ) were also not different between groups and averaged 19.618.7 in the controls and 14.013.3 u / ml ( p = 0.27 ) . ratings of hunger and desire to eat decreased after the standardized breakfast meal and then increased over the 150 minutes postprandially in both groups ( p 0.05 , time effect ; figure 3 ) . ratings of satiety and fullness demonstrated the opposite pattern . despite small visual differences in appetite ratings between the lactating and control women between 60 and 120 min , no significant group differences were found ( p 0.10 , group time and group effect ) . the auc for the four appetite ratings was also not different between groups ( p 0.10 ) . the lactating women consumed more energy ( p 0.05 ) ( 36781146 kj ; 879274 kcal ) , protein ( 36.910.8 grams ) , and carbohydrate ( 134.747.6 grams ) than the controls ( 2971816 kj ; 710195 kcal , 29.810.0 g protein , and 108.636.4 g carbohydrate ) but the macronutrient composition and fiber content were similar ( p 0.05 ) between lactating ( 16.92.2 % protein , 24.66.9 % fat , 61.58.4 % carbohydrate , and 9.43.5 g fiber ) and control groups ( 16.63.0 % protein , 25.67.2 % fat , 61.09.6 % carbohydrate , and 7.62.4 g fiber ) . the ad libitum meal resulted in increased ( p 0.05 ) serum concentrations of pyy , glp - 1 , and insulin at 60 min postprandial compared to before initiation of the ad libitum meal ( i.e. , 150 minutes ) ( figure 2 ) . hunger and desire to eat were decreased greater than those of the standardized breakfast and satiety and fullness were increased ( figure 3 ) . ghrelin and ghrelinacyl , however , did not change significantly over time ( p 0.05 for time ) following consumption of the ad libitum lunch but plasma concentrations of ghrelinacyl were greater ( p = 0.04 ) at 60 minutes postprandially in lactating compared to control women ( figure 2 ) . energy intake was not predicted by concentrations of appetite - regulating hormones or hunger or satiety ratings prior to the ad libitum meal or by hormone response to the previous standardized meal . however , higher serum concentrations of ghrelinacyl prior to the meal ( at 150 min ) and a higher ghrelinacyl response ( auc ) were associated with selection of more carbohydrate ( p 0.05 , r = 0.33 , and r = 0.39 , resp . ) and less protein ( p 0.05 , r = 0.035 , and r = 0.46 ) as a percent of total energy in the ad libitum lunch meal . a higher pyy auc was correlated with higher absolute carbohydrate intake ( r = 0.33 ; p 0.05 ) . of the initial 24 lactating and 20 control women ,6 lactating and 5 controls were unable to complete the longitudinal measurements because of relocation , time constraints , or undisclosed reasons . of the 18 lactating women , 9 continued to breastfeed for the duration of the study and 9 stopped lactating between baseline and the 6 - month ( n = 4 ) and 12 - month follow - up ( n = 5 ) . the anthropometric characteristics of these 18 lactating and 15 controls are shown in table 4 . anthropometric characteristics of the women lost to attrition did not differ ( p 0.05 , data not shown ) from those completing the study . during the follow - up period , lactating women lost 5.32.2 kg of body mass whereas the body weight of control women remained stable ( p = 0.02 ; group time interaction , figure 4 ) . lactating women also experienced a reduction of fat mass , body fat percentage , and waist circumference ( p = 0.011 , p = 0.007 , and p = 0.027 , resp . lean mass remained unchanged ( p = 0.947 ) in both groups . the majority of loss in waist circumference , weight , and body fat occurred during the first six months postpartum ( figure 4 ; table 2 ) . at 12 months postpartum , 15 of the lactating women were within 2 kg of their prepregnancy weight while the remaining three were 6.0 to 17.5 kg heavier than prepregnancy weight . change in total body mass and fat mass did not differ at either time point in the lactating women who continued to lactate at 12 months ( n = 9 ) compared to those who discontinued lactation ( n = 9 ) ( p 0.05 ) . despite decreases in total body weight and adiposity in lactating women , fasting concentrations of leptin , ghrelin , ghrelinacyl , and glp - 1 remained relatively stable across the first postpartum year ( table 4 ) . fasting concentrations of insulin and pyy increased slightly in both lactating and control women ( p 0.05 for time ) . absolute change in body mass and body fat for lactating women at either 6 or 12 months was not explained by concentrations of the appetite - regulating hormones at baseline either during fasting or in response to the standardized breakfast meal ( auc ) . comparisons between women who returned to within 2 kg of their prepregnancy weight ( n = 15 ) and those that had retained their pregnancy - associated weight gain ( n = 3 ) suggested that those retaining weight had gained more during pregnancy ( 22.05.7 versus 15.03.4 kg , p 0.05 ) despite similar self - reported weight and bmi ( 63.28.9 kg , 25.23.0 kg / m versus 64.68.5 kg , 22.69.5 the weight retainers also had higher fasting insulin during baseline testing ( 1.40.8 versus 0.00.0 ) and greater insulin ( total auc , 1299542 versus 446362 , p 0.05 ) and ghrelin rebound responses ( i.e. , higher response after the initial postmeal fall ; positive auc , 1715527648 versus 28933033 , p 0.05 ) after the standardized breakfast meal . failure to lose weight following pregnancy is an important and identifiable risk factor for long - term obesity and alterations in circulating fasting and meal - induced appetite regulators during lactation were considered as a possible mechanism of postpartum weight retention . we determined that fasting concentrations of these hormones and their postprandial pattern following standardized intake were not different between lactating and never - pregnant control women matched for age , body mass , and body composition . the only notable difference was the tendency for higher postprandial ghrelinacyl in the lactating women ( figure 2 ) that was higher after the ad libitum lunch despite consumption of 24 % more energy than control women . circulating concentrations of appetite - regulating hormones were also not predictive of postpartum weight loss ; however , higher postprandial ghrelin and insulin responses were observed in women who did not lose pregnancy - associated body mass by the end of the first postpartum year . this suggests that a greater response of the orexigenic hormone ghrelin may work against postpartum weight loss by either promoting increased appetite / food intake and / or preventing body fat loss . to our knowledge , this is the first study to comprehensively evaluate differences in fasting and meal - induced responses of the gut peptides ghrelin , pyy , and glp - 1 along with insulin and the adipose - derived hormone leptin . these hormones act in concert serving as signals between the gut , adipose tissue , and brain and are involved in appetite , glucose homeostasis , and body weight regulation . although the actions of these hormones are not completely elucidated , ghrelin is thought to enhance food intake through interactions with neuropeptide y ( npy ) and agouti - related protein - ( agrp - ) expressing neurons of the hypothalamic arcuate nucleus whereas pyy , glp - 1 , and leptin work via dampening these neurons . the role of these hormones in obesity pathogenesis is not yet delineated but peripheral infusion of ghrelin is shown to promote food intake in humans and decrease fat oxidation and promote adiposity in animal models , whereas infusion of pyy and glp dampens appetite and food intake in humans . our results suggest that differences in these hormones do not , however , predict intake in an ad libitum meal . curiously , higher serum concentrations of ghrelinacyl prior to the ad libitum meal and a higher ghrelinacyl auc were associated with selection of more carbohydrate and less protein . somewhat in contrast to the current results , our previous study found lactating and nonlactating postpartum women had lower fasting ghrelin concentrations compared to never - pregnant controls . our earlier study , however , measured only total ghrelin ( not ghrelinacyl ) and pyy at 60 min postprandially and was complicated by the higher body mass and adiposity in the postpartum women compared to leaner controls . the current study , which carefully matched lactating and control groups at baseline for body mass and body composition , also did not find differences in postprandial hormone concentrations apart from the consistently higher postprandial ghrelinacyl in lactating women that was statistically different after lunch . given the potential role of ghrelin , pyy , and glp - 1 in appetite regulation and energy balance , we had expected identifying a different fasting postprandial pattern in lactating women reflecting their increased energy demands . the higher ghrelinacyl concentration in lactating women 60 min after consumption of the ad libitum lunch , despite consumption of 24 % more energy , is the only notable finding and may suggest reduced suppression of hunger even after a full meal . this could promote shorter frequency of food intake initiation between meals . on the other hand , similar to our generally null findings , serum concentrations of ghrelin and pyy are also unaffected by lactation in rats and pigs . however , higher circulating ghrelin concentration in lactating dairy cows is predictive of greater pasture intake during pasture grazing . another purpose of the current study was to evaluate whether varying concentrations or patterns of appetite - regulating hormones predict weight retention over the first year postpartum . this could help to explain the highly variable differences in body mass and body composition changes observed after childbirth and during lactation . butte and hopkinson speculated over fifteen years ago that body composition changes during lactation are in response to a sequence of complex neuroendocrine and biochemical stimuli , many of which were unknown . although we did not find that fasting or meal - induced changes in gut peptides predict absolute body mass change , a greater ghrelin rebound after meal was observed in the three women who retained postpartum weight at the end of the first postpartum year . a higher fasting insulin and greater insulinemic response was further noted and is likely due to the higher adiposity of these women . altered ghrelin may work to promote food intake and / or dampen fat oxidation preventing spontaneous body weight loss . women who increase body mass excessively during the first pregnancy or retained weight after delivery also have a higher risk in subsequent pregnancies of overweight and obesity . although well controlled , the current study was limited by sample size , use of a liquid versus a solid standardized meal , and the known general variability of both circulating concentrations of gut peptides among participants and the intra / intervariability of the assays . even though our sample size of 24 lactating and 20 never - pregnant controls is relatively large given recruitment feasibility and well within the a priori target sample , it may have limited our ability to detect differences for various peptides particularly ghrelinacyl and glp - 1and subjective appetite ratings . a larger and more diverse sample may have provided more statistical power to detect differences in the groups . longitudinal data was likely limited by sampling from a healthy university community as well as the approximate 25 percent attrition and may have contributed to the small number of weight retainers at one year ( 3 versus 15 ) . our observation that weight retainers had higher ghrelin rebound responses ( i.e. , higher response after the initial postmeal fall ) , higher fasting insulin , and greater insulin meal after the standardized breakfast meal should be followed up in future studies . a final possible limitation was our decision to match controls based on body mass in early versus late postpartum . this may have masked true differences in the early postpartum period when lactating women are expected to be heavier than never - pregnant women . results of the current study are not in support of the hypothesis that appetite - regulating gut peptides and leptin are altered during lactation and associated with postpartum body weight retention . the potential for differences in the ghrelinacyl and glp - 1 responses to a meal during lactation should be further evaluated in future larger - scale studies . similarly , our observation that postpartum weight loss may be countered by alterations in postprandial ghrelinacyl at early postpartum deserves further exploration in a larger , more diverse sample of women . understanding how these and other appetite - and body weight - regulating hormones function during this particularly obesogenic stage of the women 's lifecycle may be helpful in furthering the overall understanding of obesity pathogenesis .\noutput:\n" }, { "from": "agent", "value": "to determine whether fasting and meal - induced appetite - regulating hormones are altered during lactation and associated with body weight retention after childbearing , we studied 24 exclusively breastfeeding women ( bmi = 25.2 3.6 kg / m2 ) at 4 - 5 weeks postpartum and 20 never - pregnant controls ( bmi = 24.0 3.1 kg / m2 ) . ghrelin , pyy , glp - 1 , and appetite ratings were measured before / and 150 minutes after a standardized breakfast and 60 minutes after an ad libitum lunch . body weight / composition were measured at 6 and 12 months . fasting and area under - the - curve responses for appetite - regulating hormones did not differ between lactating and control groups ; ghrelinacyl , however , tended to track higher after the standardized breakfast in lactating women and was higher ( p < 0.05 ) after the ad libitum lunch despite a 24 % higher energy intake ( p < 0.05 ) . by 12 months , lactating women lost 5.3 2.2 kg ( n = 18 ) , whereas control women ( n = 15 ) remained weight stable ( p = 0.019 ) ; fifteen of the lactating women returned to within 2.0 kg of prepregnancy weight but three retained > 6.0 kg . the retainers had greater ( p < 0.05 ) postmeal ghrelin rebound responses following breakfast . overall these studies do not support the hypothesis that appetite - regulating hormones are altered during lactation and associated with postpartum weight retention . altered ghrelin responses , however , deserve further exploration ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: hashimoto 's thyroiditis ( chronic autoimmune thyroiditis ) is the most common cause of hypothyroidism in the united states . with a 510 times preference over men , ht is an autoimmune disorder and is characterized by the presence of antithyroperoxidase ( anti - tpo ) antibodies . a mixed population of lymphocytes , sometimes represented in the form of crushed lymphocytes and lymphoglandular bodies ( cytoplasmic debris ) together with the presence of hurthle cells , is characteristic cytological feature of hashimoto 's thyroiditis ( ht ) . till date , nowhere in the literature , a case of ht with four lobed thyroid gland has been reported , making our case an interesting and rare one . a 40 - year - old married woman came to the out - patient clinic of our institute with chief complaints of a progressively increasing swelling on the anterior aspect of the neck since last 9 months . there was no history of any dysphagia , dyspnea , stridor , hoarseness of voice , fever or loss of weight . on examination of the neck , there was a diffuse swelling on the anterior aspect of neck , nontender , firm , freely mobile horizontally but restricted mobility longitudinally . ultrasonography of neck demonstrated thyromegaly with hypoechoic thyroid parenchyma and increased vascularity on color doppler imaging . fine - needle aspiration cytology ( fnac ) of the swelling was advised which revealed features suspicious of follicular neoplasm . contrast - enhanced computed tomography ( cect ) neck revealed diffuse enlargement of thyroid with lobulated appearance of both lobes and isthmus . there was evidence of minimal tracheal compromise at isthmus level . however , there was no cect evidence of cervical lymphadenopathy . serum levels of t3 , t4 , and tsh were 1.16 ng / ml ( n = 0.82.0 ng / ml ) ; 6.5 milligram ( mg ) / deciliter ( n = 4.511.5 mg / dl ) , and 4.7 miu / l ( n = 0.54.70 miu / l ) , respectively . the patient was taken for surgery and intraoperatively , we found an unusual anatomy of thyroid gland consisting of four lobes . the additional two lobes were on the antero - medial aspect of enlarged right and left main thyroid lobes and were completely separated from each other . the gland was firm and was adherent posteriorly to trachea . due to the nonavailability of frozen section biopsy facility , histopathology of each of the four lobes showed hurthle cell changes with lymphocytic background , features suggestive of ht [ figure 2 ] . thyroidectomy specimen showing four lobed thyroid gland with extra lobes ( 3 and 4 ) antero - medial to main ( 1 and 2 ) thyroid lobes histopathology of the thyroid specimen showing hurthle cell changes ( pink cells ) with lymphocytic backgroundht is the most prevalent cause of subclinical or overt hypothyroidism in areas with sufficient iodine intake . it has a peak incidence between the ages of 30 and 50 , and other autoimmune disorders may coexist with ht . ht can present clinically as painless , firm diffuse goiter often accompanied by hypothyroidism and autoantibodies . the clinical diagnosis is confirmed by low serum t4 levels , high thyroid - stimulating hormone levels , and the presence of autoantibodies to thyroglobulin and thyroid peroxidase . it is not rare for patients with ht to have neither symptoms nor physical signs . in our casealso , the patient was asymptomatic and t3 / t4 levels were within normal range with a slight increase in tsh levels ( subclinical hypothyroidism ) . if only clinical and serum findings were used to diagnose ht , the diagnosis would be missed in at least half of patients . since fnac was suspicious of follicular neoplasm , tests for autoantibodies to thyroglobulin and thyroid peroxidase were not performed in our case . the sensitivity and specificity improve dramatically by combining ultrasound evaluation with clinical and serological assessments . the most accurate method of diagnosing ht , however , remains biopsy and histologic study . on sonography the gland is often diffusely enlarged , and the parenchyma is coarsened , hypoechoic , and often hypervascular . a micronodular pattern on ultrasound is highly diagnostic of ht with a positive predictive value of 95 % . they are hypoechoic as a result of lymphocyte infiltration and have an echogenic rim . on color doppler , the thyroid parenchyma can vary from slightly hypervascular to markedly hypervascular . in addition to the diffuse form , ht may form discrete nodules within a diffusely altered parenchyma or within a sonographically normal thyroid parenchyma ( nodular ht ) . ours was a diffuse form of ht with two extra thyroid lobes completely separated from main lobes with increased vascularity . such distorted anatomy of thyroid gland in a patient of ht has never been reported in the literature till date . if we consider it as an anomaly of thyroid gland , again no literature has mentioned such an anomaly till date . histopathology in ht shows infiltration of the thyroid by t and b cells that are reactive to thyroid antigens . the cytotoxic t cells are largely responsible for the destruction of the thyroid parenchyma , leading to initial thyrotoxicosis followed by hypothyroidism . typical histopathologic appearance of ht includes lymphocyte aggregates with germinal centers , small thyroid follicles with sparse colloid , oxyphilic changes of epithelial cells , presence of hurthle cells and variable fibrosis . in our case , histopathology from all the four lobes showed hurthle cell changes with lymphocytic background , features suggestive of ht .\noutput:\n" }, { "from": "agent", "value": "hashimoto 's thyroiditis ( ht ) , an autoimmune disorder , is the most prevalent cause of subclinical or overt hypothyroidism in areas with sufficient iodine intake . the gland is often diffusely enlarged , and the parenchyma is coarsened , hypoechoic , and often hypervascular on ultrasonograpy . histopathologic appearance of ht includes lymphocyte aggregates with germinal centers , small thyroid follicles , presence of hurthle cells , and variable fibrosis . we present a case of a 40 - year - old female with suspected follicular neoplasm on fine - needle aspiration cytology of neck swelling . intraoperatively , thyroid gland was found having four lobes separated from each other . total thyroidectomy was done and histopathology from all four lobes revealed ht . at present , there is no literature to support the fact that such distorted thyroid anatomy may be due to the underlying disease . if we consider it as thyroid gland anomaly , no such anomaly has been mentioned in the literature till date ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: one of the major factors that can negatively affect breastfeeding is the lack of breast milk . there are many instructions on the subject of breast milk in iranian traditional medicine resources . this article attempts to investigate causes and reasons for the lack of breast milk from the perspective of the great scholars in this field . this study reviews the literature based on the iranian traditional medicine . the literature review included traditional medicine resources and a survey of reputable databases using keywords such as morzae , sady , pestan , sheer , sheerkhar , and hifzossehhe . according to the viewpoint stated in traditional medicine literature , the primary substance for milk production is blood that transforms to milk after crossing the breast glandular tissue . the main causes of milk shortage can be classified into four categories , namely food - related factors , factors related to blood impaired , factors related to breast tissue and psychological and physical factors . one of the main reasons for milk shortage is the impaired quality and quantity of food . appropriate mizaj of breast tissue is required for adequate milk production as it develops sufficient ability to absorb and transform the substance into milk . on the other hand , the ability of breast tissue is greatly influenced by the main organs of the body , particularly the heart ; being the core of understanding psychological factors . thus , psychological factors can have a significant effect on the process of milk production . due to the importance of breastfeeding , reflection on other viewpoints , such as those mentioned in iranian traditional medicine , could pave the way towards new research areas .\noutput:\n" }, { "from": "agent", "value": "background : support for breastfeeding is a public health priority . one of the major factors that can negatively affect breastfeeding is the lack of breast milk . there are many instructions on the subject of breast milk in iranian traditional medicine resources . this article attempts to investigate causes and reasons for the lack of breast milk from the perspective of the great scholars in this field.methods : this study reviews the literature based on the iranian traditional medicine . the literature review included traditional medicine resources and a survey of reputable databases using keywords such as morzae , sady , pestan , sheer , sheerkhar , and hifzossehhe . the content analysis was used after collecting data.results : according to the viewpoint stated in traditional medicine literature , the primary substance for milk production is blood that transforms to milk after crossing the breast glandular tissue . the main causes of milk shortage can be classified into four categories , namely food - related factors , factors related to blood impaired , factors related to breast tissue and psychological and physical factors . one of the main reasons for milk shortage is the impaired quality and quantity of food . appropriate mizaj of breast tissue is required for adequate milk production as it develops sufficient ability to absorb and transform the substance into milk . on the other hand , the ability of breast tissue is greatly influenced by the main organs of the body , particularly the heart ; being the core of understanding psychological factors . thus , psychological factors can have a significant effect on the process of milk production.conclusion : due to the importance of breastfeeding , reflection on other viewpoints , such as those mentioned in iranian traditional medicine , could pave the way towards new research areas . it could also steer policies towards an extra focus on breastfeeding by mothers ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in the united states , incidence rates of oral cavity and pharynx cancer ( ocpc ) have been decreasing at about 1 % per year over the past decade , with some differences according to race , sex , and subsite . tobacco use is the major risk factor for these cancers ; heavy alcohol drinking is an independent risk factor and appears to enhance the effect of smoking . the attributable risk for tobacco and alcohol use has been estimated at 80 % to 90 % among us white and black men . dietary factors , particularly consumption of fruits and vegetables , have been consistently associated with reduced risks of ocpc . oral human papillomavirus ( hpv ) , particularly hpv 16 , is a newly recognized cause of a subset of ocpc , responsible for 4080 % of oropharyngeal squamous cell cancers . rising incidence rates for certain subsites within the oral cavity and pharynx , notably the base of tongue , tonsil , and oropharynx related to hpv infection , have been reported in the us particularly among young white men using data from the surveillance , epidemiology , and end results ( seer ) program and national program of cancer registries . rising incidence rates of oral tongue cancer , a subsite not related to hpv infection , also have been reported , especially among young white women . to better understand the us incidence patterns , especially differences by gender , our analysis updates and extends earlier descriptive studies that classified ocpc by anatomic subsite into presumed hpv - related or hpv - unrelated oral cavity and pharynx cancers by incorporating cases diagnosed through 2008 , considering oral tongue cancer not related to hpv as a separate category , including data for hispanic whites , asian / pacific islanders ( asian / pis ) , and american indian / alaskan natives ( ai / ans ) as well as blacks and non - hispanic whites , and presenting age - specific male / female ratios by year of birth . data from population - based registries in the national cancer institute 's surveillance , epidemiology , and end results ( seer ) program were used to calculate incidence rates of invasive squamous cell carcinoma ( scc ) ( international classification of diseases for oncology , 3rd edition ( icd - o - 3 ) morphology codes 8050 - 8084 ) of the oral cavity ( icd - o - 3 topography codes c01.9 - c06 .9 ) and pharynx ( codes c09.0 - c10 .9 , c12.9 - c14 .8 ) ( excluding lip , salivary glands , and nasopharynx ) . like the classification based on anatomic subsite and etiologic relationship with hpv used in two recent publications , we categorized ocpc subsites as presumed hpv - related or not and then considered hpv - unrelated oral tongue separately . specifically , the hpv - related sites were c01.9 - base of tongue , nos ( not otherwise specified ) ; c02.4 - lingual tonsil ; c09.0 - tonsillar fossa ; c09.1 - tonsillar pillar ; c09.8 - overlapping lesion of tonsil ; c09.9 - tonsil , nos ; c10.0 - vallecula ; c10.1 - anterior surface of epiglottis ; c10.2 - lateral wall of oropharynx ; c10.3 - posterior wall of oropharynx ; c10.4 - branchial cleft ; c10.8 - overlapping lesion of oropharynx ; c10.9 - oropharynx , nos ; c14.2 - waldeyer ring . the hpv - unrelated ( except oral tongue ) sites were : c03.0 - upper gum ; c03.1 - lower gum ; c03.9 - gum , nos ; c04.0 - anterior floor of mouth ; c04.1 - lateral floor of mouth ; c04.8 - overlapping lesion of floor of mouth ; c04.9 - floor of mouth , nos ; c05.0 - hard palate ; c05.1 - soft palate , nos ; c05.2 - uvula ; c05.8 - overlapping lesion of palate ; c05.9 - palate , nos ; c06.0 - cheek mucosa ; c06.1 - vestibule of mouth ; c06.2 - retromolar area ; c06.8 - overlapping lesion of other and unspecified mouth ; c06.9 - mouth , nos ; c12.9 - pyriform sinus ; c13.0 - postcricoid region ; c13.1 - aryepiglottic fold , hypopharyngeal ; c13.2 - posterior wall of hypopharynx ; c13.8 - overlapping lesion of hypopharynx ; c13.9 - hypopharynx , nos ; c14.0 - pharynx , nos ; c14.8 - overlapping lesion of lip , oral cavity and pharynx . lastly , the hpv - unrelated oral tongue sites were c02.0 - dorsal surface of tongue , nos ; c02.1 - border of tongue ; c02.2 - ventral surface of tongue , nos ; c02.3 - anterior 2/3 of tongue , nos ; c02.8 - overlapping lesion of tongue ; c02.9 - tongue , nos . data from the original nine seer registries ( seer 9 ) for cases diagnosed during the 34 - year period from january 1 , 1975 , through december 31 , 2008 , were available for whites and blacks . these nine registries are located in the metropolitan areas of atlanta , detroit , san - francisco - oakland , and seattle - puget sound and the states of connecticut , hawaii , iowa , new mexico , and utah . for cases diagnosed during 19922008 , data were available for the racial groups of whites , blacks , asian / pis , and ai / ans and whether of hispanic origin in the seer 13 , which includes the seer 9 plus four additional areas , the california metropolitan areas of san jose - monterey and los angeles , rural georgia , and alaska natives in alaska . in the recent years 20042008 , the seer 9 and 13 registries accounted for about 10 % and 14 % of the us population , respectively . all seer registries annually meet the gold standard registry certification from the north american association of central cancer registries , inc . for completeness ( at least 95 % ) , accuracy ( 3 % of cases identified through death certificates only ) , and timeliness of data . age - adjusted incidence rates per 100,000 person - years of ocpc ( using the 2000 us standard ) were calculated for each subsite category ( total , hpv - related , hpv - unrelated , and oral tongue ) by sex and race / ethnicity using seer * stat . temporal trends in age - adjusted incidence rates using five - or six - year time periods 197579 , 198085 , 198691 , 199297 , 19982003 , and 20042008 were plotted according to year of diagnosis by race / ethnicity , subsite category , and sex . temporal trends in age - specific rates were plotted according to year of birth to facilitate visual comparison of rates . the year of birth was derived by subtracting age at diagnosis ( midpoint of age group , i.e. , 35 for age group 2544 , 50 for age group 4554 , 60 for age group 5564 , and 77.5 for age group 65 + ) from calendar year of diagnosis ( midpoint of the calendar period ) ; the cohorts are referred to by their approximate midyear of birth . temporal trends were plotted so that a slope of 10 degrees represented a change of 1 % per year ( i.e. , 40 years on the horizontal axis is the same length as one logarithmic cycle on the vertical axis ) . estimates of annual percent changes ( eapcs ) were calculated for the period 19852008 using weighted least squares . there were 27,767 cases ( 18,573 men and 9,194 women ) of ocpc diagnosed among whites and blacks during 19751991 in the seer 9 and 43,679 cases ( 30,068 men and 13,611 women ) among whites ( non - hispanic ) , blacks , hispanics ( white ) , asian / pis , and ai / ans during 19922008 in the seer 13 ( table 1 ) . total ocpc rates among men were 24 times those among women across each race / ethnicity and time period . male / female ( mf ) irrs for 19922008 seer 13 were highest among blacks for each subsite ( irr = 2.604.32 ) and lowest among asian / pis ( irr = 2.39 ) for total , whites for hpv - related ( irr = 3.98 ) and hpv - unrelated ( irr = 2.16 ) , and ai / ans for oral tongue ( irr = 0.88 , the only irr not significantly higher than 1.0 ) . the mf irr for hpv - related cases ( recent range 3.984.47 ) was higher than that for hpv - unrelated cases ( recent range 2.163.37 ) in all instances except 19751991 seer 9 blacks . the mf irr for oral tongue ( recent range 0.882.77 ) was smaller than that for other hpv - unrelated cases among each racial / ethnic group . among whites and blacks in the seer 9 , the mf irrs increased from 19751991 to 19922008 for hpv - related sites , but declined for hpv - unrelated sites and oral tongue . trends in the age - adjusted ocpc incidence rates by race / ethnicity ( whites ( non - hispanic ) , blacks , hispanics ( white ) , and asian / pis ) , subsite category , and gender in the seer 13 during 19922008 are presented in figure 1 . for historical purposes , trend data for whites and blacks in the seer 9as seen in figure 1 , the two sets of rates in recent years were similar except for oral tongue among blacks where the rates were somewhat higher in the seer 13 than the 9 . because the rates are based on larger numbers of cases and thus are more stable in the seer 13 than the seer 9 , we will focus on them . furthermore , it is increasingly important to distinguish non - hispanics and hispanics among whites because their rates are quite different , and the population proportions have been changing over time . thus , we will use the term whites to refer to whites in the seer 919751991 and white non - hispanics in the seer 1319922008 , blacks in the seer 9 early years and seer 13 recent years , and hispanics for hispanic whites and asians for asian / pis in the seer 13 recently . among whites , total rates for men peaked at 12.7 per 100,000 person - years in 19801985 before declining gradually ( 11 % ) to 11.3 in 19982003 and then rose 5 % to 12.0 in 20042008 . rates among women also peaked in 19801985 at 5.4 and declined more rapidly ( 20 % ) to 4.3 in 20042008 . among blacks , total rates for both men and women peaked during 19801985 and then declined dramatically until 20042008 , by 48 % from 23.7 to 12.3 among males and by 43 % from 6.5 to 3.7 among females . during the recent 17 - year period , total rates decreased significantly among all racial / ethnic / gender groups except white men . hpv - related rates among white men rose 88 % from 3.4 in 19751979 to 6.4 in 20042008 , more rapidly in recent years than earlier , while hpv - unrelated rates declined 50 % from 7.2 in 19801985 to 3.6 in 20042008 ( figure 1 ) . among the other race / sex groups , rates for hpv - related sites generally decreased or changed little . hpv - unrelated rates declined sharply among all race / sex groups , similar to white males . rates decreased from 19801985 to 20042008 among white females by 43 % from 3.0 to 1.7 and among blacks even more rapidly , by 64 % among men from 13.3 to 4.8 , and by 48 % among females from 3.3 to 1.7 . rates also declined rapidly among hispanics ( men 34 % , women 49 % ) and asians ( men 34 % , women 28 % ) during 19922008 . oral tongue cancer rates among white men varied little over time , whereas rates in white women increased 44 % from 0.9 in 19751979 to 1.3 in 20042008 . rates rose more rapidly among females than males among hispanics ( men 10 % , women 45 % ) and asians ( men 19 % , women 26 % ) . the eapcs from 1985 to 2008 among white males were + 2.9 % for hpv - related cancers and 3.1 % for hpv - unrelated cancers , among white females 2.7 % for hpv - unrelated cancers and + 1.1 % for oral tongue cancers , and among blacks for hpv - unrelated cancers 4.9 % and 2.9 % for males and females , respectively . the mf irrs among whites doubled from 2.4 to 4.8 for hpv - related cancers declined modestly from 2.4 to 2.1 for hpv - unrelated cancers , and moderately from 2.0 to 1.5 for oral tongue cancers . among blacks , the decrease in mf irr for hpv - unrelated cancers was quite rapid , from 4.0 to 2.8 . among whites , total rates rose in the youngest age group among men and women due to substantial increases in successive birth cohorts for hpv - related cancers , more rapid among men than women , and oral tongue cancers , more rapid among women than men ( figure 2 ) . the hpv - related rates among men aged 2544 years more than tripled from 0.4 per 100,000 man - years in the 1942 birth cohort to 1.5 in the 1972 cohort , and rates among men aged 4554 years more than doubled from 5.3 for the 1939 birth cohort to 12.8 for the 1956 birth cohort ; rates also rose among men 5564 from 12.5 for the 1923 cohort to 23.0 for the 1946 cohort . the eapcs among men aged 2564 each were 3 % . among women , hpv - related rates forthe older age groups did not vary greatly in successive birth cohorts . for hpv - unrelated cancers , rates among white men declined 67 % ( from 0.9 to 0.3 ) , 54 % ( from 9.2 to 4.2 ) , 59 % ( from 23.9 to 9.7 ) , and 42 % ( from 28.6 to 16.5 ) among those aged 2544 , 4554 , 5564 , and 65 + years , respectively ; the eapcs ranged between 3.1 % and 4.0 % among all but the oldest . rates among women also declined 37 % ( from 0.27 to 0.17 ) , 66 % ( from 4.1 to 1.4 ) , 66 % ( from 9.8 to 3.3 ) , and 24 % ( from 12.2 to 9.3 ) , respectively . oral tongue cancer rates among women aged 2544 years more than tripled at + 3.4 % per year from 0.2 per 100,000 woman - years in the 1942 birth cohort to 0.7 in the 1972 cohort where rates approached those for young men , among whom rates increased 71 % over the 30 - year time period . oral tongue rates also rose among women aged 4554 years born since 1940 but not among men ; rates for men or women in the older age groups did not change greatly . among blacks , total rates declined among cohorts born since at least 1930 reflecting the strong downward trends among men and women especially for hpv - unrelated sites ( figure 2 ) . black men aged 2544 experienced the most rapid decrease in rates for hpv - unrelated sites across successive birth cohorts , 82 % ( from 4.5 to 0.8 ) ; and rates among males aged 4554 , 5564 , and 65 + years also declined impressively , 76 % ( from 28.3 to 6.8 ) , 74 % ( from 51.1 to 13.4 ) , and 43 % ( 33.5 to 19.2 ) , respectively . the corresponding eapcs were 7.4 % among those aged 2544 , and 6.8 % , 5.5 % , and 2.7 % among the oldest . rates decreased notably among women aged 2544 ( 78 % ) , 4554 ( 76 % ) , and 5564 ( 64 % ) , but not among women aged 65 + . oral tongue cancer rates among men generally declined across successive birth cohorts except for the older age groups where rates were relatively stable ; in recent years among the youngest age group , the male predominance was no longer apparent . of note , there was no suggestion of rapid increases in rates of hpv - related or oral tongue cancers among young blacks as seen among whites . among hispanics and asians , however , rates of hpv - unrelated cancer generally declined across successive birth cohorts for both genders . oral tongue cancer rates appeared to be converging among young men and women of both groups . the mf irrs for total among whites remained about 2 among those born prior to 1940 , after which they rose to 2.93.8 among those born during the 1950s and then declined to 2.3 among those born around 1970 ( figure 3 ) . mf irrs for hpv - related cases were higher , hovering between 2 and 3 among those born prior to 1930 , after which they rose to almost 6 among those aged 4564 years born during the late 1940s1950s ; among those aged 2544 , the irr rose from 1.9 among those born in the early 1940s to about 4 among those born since the mid-1950s . the mf irrs for hpv - unrelated cases varied less by age group and year of birth , ranging between 2 and 3 among those born prior to the mid-1940s , rising to between 3 and 4 among those born during the 1950s and falling back to 3 or lower subsequently . oral tongue cancer irrs were all 3 ; among both the oldest and the youngest age groups , the irrs decreased from about 2 to 1.3 - 1.4 over the study period . in this study , we analyzed temporal trends of total ocp , presumed hpv - related , presumed hpv - unrelated , and oral tongue cancer among us men and women of white , black , hispanic , asian , and ai / an ethnicity . our study , which highlights changing patterns by gender , is based on the same categorization of anatomic subsites as presumed hpv - related or not used in two recent publications , and we extend these findings by classifying cancer of the oral tongue separately from other hpv - unrelated sites , incorporating cases diagnosed through 2008 , increasing the study population by including data from seer 13 , classifying whites as hispanic or non - hispanic , and presenting mf irrs overall and by year of birth . similar to other studies , we found overall ocpc incidence rates among men to be 24 times those among women of all race / ethnicities , and in recent decades , they varied from 4 or greater for hpv - related sites to 2 - 3 for hpv - unrelated sites , and 13 for oral tongue cancer . the mf irr for hpv - related sites doubled among whites from 2.4 to 4.8 over the study period , due especially to rapidly rising rates of hpv - related ocpc among white men , particularly those born since 1940 . consistent decreases in the mf irrs for hpv - unrelated sites were observed for whites ( from 2.4 to 2.1 ) and blacks ( from 4.0 to 2.8 ) , due to rapidly declining rates especially among black men born since 1940 . the irrs for oral tongue cancer generally declined among all ethnic groups due especially to rising rates among younger white , hispanic , and asian women . the age - adjusted rates for hpv - related cancers rose 3 % per year among white males , for hpv - unrelated cancers declined 3 % per year among whites of both genders and black females and 5 % per year among black males , and for oral tongue cancer rose 1 % per year among white females . the declines seen in hpv - unrelated cancer for all race / ethnic - sex groups are consistent with a pathway mainly driven by alcohol and tobacco ( potentially related to p53 or other molecular alterations ) that parallel the reductions in us cigarette smoking prevalence and may also reflect decreases in national per capita alcohol consumption , especially the use of hard liquor . the steep declines in scc of the ocp and racial / gender patterns seen here resemble the patterns for scc of the esophagus , which also reflect the trends in cigarette smoking prevalence and alcohol consumption . among white males , the much smaller declines in the incidence of total ocpc appear to be driven by the rising incidence of hpv - related cancers , in contrast to the declines in hpv - unrelated cancers . a number of studies have documented the increasing prevalence of hpv in oropharyngeal cancers during the past 30 years . in the us , the prevalence of hpv in oropharyngeal cancers rose from 33 % during the 1980s to 70 % in the 1990s and 82 % during 20002004 , based on 72 cases assayed in colorado and from 16 % during the 1980s to 73 % during the 2000s based on 271 cases from seer tissue repositories in hawaii , iowa , and los angeles . during the 2000s , several groups have reported hpv prevalence rates among oropharynx , tongue , and tonsil cases ranging from 63 % to 92 % , whereas the prevalence among other oral cancers has been 20 % or less . thus , our assignment of presumed hpv status based on anatomic subsite certainly included non - hpv - related cases , more so during the earlier years compared to more recently . the incidence data suggest that the proportions also varied by gender , racial / ethnic group , and age . data from the 2003 - 2004 national health and nutrition examination survey ( nhanes ) revealed that the seroprevalence of any hpv types 6 , 11 , 16 , or 18 ( types in the quadrivalent vaccine ) among persons aged 1459 years was 22.4 % overall , higher among females ( 32.5 % ) than males ( 12.1 % ) , peaked at 42.0 % among females aged 3039 years and 18.0 % among males aged 5059 years , and was associated with lifetime number of sexual partners , especially among females . about 90 % of both females and males aged2544 ever had oral sex with an opposite - sex partner , based on data from the 20062008 national survey of family growth ( nsfg ) . the prevalence of oral infection with any of 37 hpv dna types during 2009 - 2010 was 6.9 % among those aged 1469 , significantly higher among men ( 10.1 % ) than women ( 3.6 % ) , and increased with the number of sexual partners and cigarettes smoked per day , based on nhanes data . similar to other recent studies of oral tongue cancer , we found increasing rates among young white adults aged 2544 that were more rapid for women than for men , and some suggestion of similar patterns among blacks , hispanics , and asians . the causal pathway for oral tongue cancer in these patients is not known , but it does not appear to be related to use of alcohol or tobacco or to the presence of hpv . its unique age - and sex - specific incidence patterns suggest that it may have a different etiology from other ocpcs including other oncogenic viruses , bacteria , and lifestyle and environmental factors . a limitation of our descriptive study is that hpv status is based on a categorization by anatomic subsite and thus likely resulted in some misclassification of actual hpv status . it has been suggested that hpv - related base of the tongue cancer may have been misclassified as oral tongue ; however , the mf irrs appear to be very different . cases without a particular site of the tongue specified ( coded c02 .9 = tongue , not otherwise specified ) accounted for about 15 % of oral tongue cases among whites during 19752008 , and the proportion rose from 13 % during 19751979 to 17 % during 20042008 . to the extent that some of these may have been hpv - related , then the observed increases in hpv - related cancers among white males have been underestimated . the observed increases in hpv - unrelated oral tongue cancer among white females may have been overstated ; however , rates for each specific tongue subsite as well as tongue , nos , all rose . in summary , our large numbers based on seer 13 allowed us to plot race - , sex - , and age - specific incidence rates of ocpc by hpv category and year of birth and to carry out a detailed analysis of oral tongue cancers . the significant decreases in total ocpc incidence seen for most race / sex groups reflect reductions in smoking prevalence due to public health efforts aimed at cessation and lowering initiation rates as well as decreases in alcohol consumption . the increasing rates of cancer of the oral tongue especially among young men and women is of growing concern and suggest the need for dedicated research into the epidemiology of these understudied tumors ; the narrowing of the gender differences apparent across all the racial / ethnic groups provides a clue worthy of pursuit . the much smaller decline in total ocpc incidence and recent increases among white men born since the mid-1940s appear related to the rapidly rising rates of hpv - related cancers and may reflect changes in sexual practices since the mid-1960s . the potential impact of hpv vaccination recently approved for both girls and boys on these trends is unknown , but changes are likely many years in the future . dentists and physicians need to be aware of the notable and significant rise in rates of cancers of the oral tongue and hpv - related cancers of the oropharynx , especially among young men and women , and ensure that these new at - risk groups receive routine oral cancer screening .\noutput:\n" }, { "from": "agent", "value": "objective . to evaluate oral cavity and pharynx cancer ( ocpc ) patterns by gender . methods . we used surveillance , epidemiology , and end results program data for 71,446 cases diagnosed during 19752008 to classify ocpc by anatomic subsite as potentially hpv - related or not , with oral tongue cancer considered a separate category . results . total ocpc rates among men were 24 times those among women . among whites , total ocpc rates rose in the younger age groups due to substantial increases in successive birth cohorts for hpv - related cancers , more rapid among men than women , and oral tongue cancers , more rapid among women than men . among blacks , total ocpc rates declined among cohorts born since 1930 reflecting the strong downward trends for hpv - unrelated sites . among hispanics and asians , hpv - unrelated cancer rates generally declined , and oral tongue cancer rates appeared to be converging among young men and women . conclusions . decreases in total ocpc incidence reflect reductions in smoking and alcohol drinking . rising hpv - related cancers among white men may reflect changing sexual practices . reasons for the increasing young oral tongue cancer rates are unknown , but the narrowing of the gender differences provides a clue ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the incidence of primary malignant brain tumors globally is 2.6 and 3.7 per 100,000 in females and males , respectively . in developed countries alone , malignant primary brain tumors are the 13th most common malignancy , and the 10th most common cause of cancer death . the overall 5 - year survival is 22 % compared with 66 % for all cancers , and they account for the third longest average length of stay for hospital admissions due to malignancy ( 12 days ) . intracranial metastatic disease is also a significant cause of morbidity and mortality , with a median survival ranging from 3 to 18 months post - treatment . an increase in the number of neuro - oncology centers in australia , coupled with population growth both in regional and metropolitan areas , has coincided with significant advancements and innovations in neuro - oncology . whereas the overall incidence and survival of primary brain tumors in australia has been reported , to date , there are little data addressing the differences in presentation and management of primary cerebral neoplasia at major urban compared with regional centers . we therefore sought to audit the experiences of a major australian regional neurosurgical center and compare the incidences of different types of cerebral neoplasia undergoing biopsy or resection in this rural / regional center with a major metropolitan public and private hospital . we searched the computerized databases of 2 separate public hospital anatomical pathology laboratories in new south wales ( nsw ) , australia , to identify all cases of cerebral neoplasia undergoing surgical resection , form calendar year 2001 to 2014 . one of these laboratories provided all surgical pathology services for a regional neurosurgical unit , whereas the other serviced the neurosurgical unit of both a major capitol city public and private hospital . primary intracranial neoplasms were then classified according to the 2007 world health organization ( who ) classification of central nervous system tumors into neuroepithelial tumors ( which included all astrocytic , oligodendroglial , ependymal , mixed glial , choroid plexus , neuronal and mixed - neuronal - glial , pineal , neuroblastic , or glioblastic tumors ) , meningeal , or other subtypes of primary or metastatic neoplasms . tumors that typically demonstrate an extracranial component such as chordoma and neuroblastoma were excluded , as were vascular lesions such as cavernous hemangioma and arteriovenous malformations . repeated presentations of the same patient were identified and compiled before deidentification of data to enable calculation of tumor presentations and reoperation rates . the clinical and pathological characteristics between the different treating hospitals were compared using a chi - square test for differences in the frequency distributions of categorical study variables , and 1 - way analysis of variance ( anova ) to compare the means of the continuous variable of age . ethical approval for this study ( ref : lnr / 13 / wgong / 131 ) was provided by the university of wollongong / illawarra and shoalhaven local health district health and medical hrec on october 28 , 2014 . a total of 3717 pathology specimens were identified over the study period , from 3268 brain tumors . briefly , 379 patients underwent a second operation either subsequent to a diagnostic biopsy , subtotal resection , or re - excision at a later date , equating to a reoperation rate of 11.2 % . of all tumors , 51.4 % were from a city private hospital , totaling 1960 specimens from 1674 tumors ; 33.0 % of tumors were from a city public hospital totaling 1196 specimens from 1075 tumors ; and 15.6 % of tumors were from a regional public hospital totaling 561 specimens from 519 tumors . clinical and pathological characteristics of 3268 patients with brain tumors , grouped by treatment hospital among the patients undergoing surgery at the major capital city private hospital , 49.6 % were males , with an average age at initial surgery of 59.315.1 years ( range 1593 years ) . most neoplasms were neuroepithelial in origin ( 599 ; 35.8 % ) , closely followed by meningeal ( 394 ; 23.5 % ) , metastatic ( 362 ; 21.6 % ) , and pituitary adenomas ( 181 ; 10.8 % ) , as shown in table 1 . briefly , the majority were astrocytic ( 445 ; 74.3 % ) , with a much smaller proportion of oligodendroglial tumors ( 74 ; 12.4 % ) and few other subtypes . most neuroepithelial tumors were who grade iv ( 383 ; 64.4 % ) , with a serially decreasing proportion of grade iii ( 114 ; 19.0 % ) , grade ii ( 62 ; 10.4 % ) , and grade i ( 37 ; 6.2 % ) tumors . most primary cerebral but non - neuroepithelial tumors were meningiomas , with the remainder comprised of hemangioblastomas ( 24 ) , hemangiopericytomas ( 2 ) , and solitary fibrous tumors ( 1 ) . two hundred and eighty - six ( 77.3 % ) meningiomas were who grade i , 75 ( 20.3 % ) were atypical ( who grade ii ) , and 9 ( 2.4 % ) were anaplastic ( who grade iii ) . the most common metastatic tumors were from the lung ( 100 ; 27.6 % ) , melanoma ( 87 ; 24.0 % ) , breast ( 59 ; 16.3 % ) , and colorectal ( 41 ; 11.3 % ) origin . among the metastatic tumors , 16.3 % were of unknown primary site at the time of initial pathological diagnosis . among the patients operated on at the capital city public hospital , 49.7 % were males averaging 59.315.6 years old ( range 1693 years ) . most tumors were neuroepithelial in origin ( 421 ; 39.2 % ) followed by metastatic disease ( 261 ; 24.3 % ) , meningeal tumors ( 229 ; 21.3 % ) , and pituitary adenomas ( 80 ; 7.4 % ) , as shown in table 1 . neuroepithelial tumors were largely astrocytic in origin ( 324 ; 77.0 % ) , followed by oligodendroglial tumors ( 50 ; 11.9 % ) and others , as shown in table 2 . most neuroepithelial tumors were who grade iv at diagnosis ( 283 ; 67.2 % ) , followed by grade iii ( 80 ; 19.0 % ) , grade ii ( 41 ; 9.7 % ) , and grade i ( 17 ; 4.0 % ) . meningiomas were the most common non - neuroepithelial tumors and were comprised largely of who grade i ( 156 ; 77.3 % ) , with a smaller collection of atypical who grade ii ( 50 ; 20.3 % ) and anaplastic who grade iii ( 7 ; 3.3 % ) tumors . the remainder of non - neuroepithelial tumors were hemangioblastomas ( 12 ) , hemangiopericytomas ( 2 ) , and solitary fibrous tumors ( 2 ) . intracranial metastasis in patients presenting to this city center public hospital originated largely from the lung ( 105 ; 40.2 % ) , followed by melanoma ( 57 ; 21.8 % ) , breast ( 38 ; 14.6 % ) , and colorectal ( 18 ; 6.9 % ) . thirty - five ( 13.4 % ) metastatic tumors were of unknown origin at time of diagnosis ( table 1 ) . clinical and pathological characteristics comparison of regional public hospital to city hospitals ( both private and public ) the regional hospital cohort was comprised of 50.8 % males , and the average age at initial diagnosis was 59.614.5 years ( range 1689 years ) . the tumor origin was neuroepithelial ( 205 ; 39.5 % ) , metastatic disease ( 153 ; 29.5 % ) , or meningeal ( 108 ; 20.8 % ) , with a smaller number of pituitary adenomas ( 30 ; 5.8 % ) , lymphomas ( 14 ; 2.7 % ) , and others , as shown in table 1 . the majority of neuroepithlial tumors were astrocytic ( 180 ; 87.8 % ) , with a prevalence of who grade iv ( 144 ; 66.4 % ) , as shown in table 2 . meningeal tumors were comprised of 104 meningiomas ( 96.2 % ) , of which 91 ( 87.5 % ) were who grade i , 12 ( 11.5 % ) were who grade ii , and 1 grade iii . metastatic disease was most commonly from the lung ( 48 ; 37.5 % ) , followed by melanoma ( 28 ; 21.9 % ) , breast ( 14 ; 10.9 % ) , and colorectal ( 12 ; 9.4 % ) . the clinical and pathological features of the 3 patient groups ( regional public hospital , city public hospital , city private hospital ) are compared in each of tables 25 . clinical and pathological characteristics comparison of city public hospital with city private hospital clinical and pathological characteristics comparison of regional public hospital with city public hospital clinical and pathological characteristics of regional public hospital with city private hospitalamong the patients undergoing surgery at the major capital city private hospital , 49.6 % were males , with an average age at initial surgery of 59.315.1 years ( range 1593 years ) . most neoplasms were neuroepithelial in origin ( 599 ; 35.8 % ) , closely followed by meningeal ( 394 ; 23.5 % ) , metastatic ( 362 ; 21.6 % ) , and pituitary adenomas ( 181 ; 10.8 % ) , as shown in table 1 . briefly , the majority were astrocytic ( 445 ; 74.3 % ) , with a much smaller proportion of oligodendroglial tumors ( 74 ; 12.4 % ) and few other subtypes . most neuroepithelial tumors were who grade iv ( 383 ; 64.4 % ) , with a serially decreasing proportion of grade iii ( 114 ; 19.0 % ) , grade ii ( 62 ; 10.4 % ) , and grade i ( 37 ; 6.2 % ) tumors . most primary cerebral but non - neuroepithelial tumors were meningiomas , with the remainder comprised of hemangioblastomas ( 24 ) , hemangiopericytomas ( 2 ) , and solitary fibrous tumors ( 1 ) . two hundred and eighty - six ( 77.3 % ) meningiomas were who grade i , 75 ( 20.3 % ) were atypical ( who grade ii ) , and 9 ( 2.4 % ) were anaplastic ( who grade iii ) . the most common metastatic tumors were from the lung ( 100 ; 27.6 % ) , melanoma ( 87 ; 24.0 % ) , breast ( 59 ; 16.3 % ) , and colorectal ( 41 ; 11.3 % ) origin . among the metastatic tumors , 16.3 % were of unknown primary site at the time of initial pathological diagnosis . among the patients operated on at the capital city public hospital , 49.7 % were males averaging 59.315.6 years old ( range 1693 years ) . most tumors were neuroepithelial in origin ( 421 ; 39.2 % ) followed by metastatic disease ( 261 ; 24.3 % ) , meningeal tumors ( 229 ; 21.3 % ) , and pituitary adenomas ( 80 ; 7.4 % ) , as shown in table 1 . neuroepithelial tumors were largely astrocytic in origin ( 324 ; 77.0 % ) , followed by oligodendroglial tumors ( 50 ; 11.9 % ) and others , as shown in table 2 . most neuroepithelial tumors were who grade iv at diagnosis ( 283 ; 67.2 % ) , followed by grade iii ( 80 ; 19.0 % ) , grade ii ( 41 ; 9.7 % ) , and grade i ( 17 ; 4.0 % ) . meningiomas were the most common non - neuroepithelial tumors and were comprised largely of who grade i ( 156 ; 77.3 % ) , with a smaller collection of atypical who grade ii ( 50 ; 20.3 % ) and anaplastic who grade iii ( 7 ; 3.3 % ) tumors . the remainder of non - neuroepithelial tumors were hemangioblastomas ( 12 ) , hemangiopericytomas ( 2 ) , and solitary fibrous tumors ( 2 ) . intracranial metastasis in patients presenting to this city center public hospital originated largely from the lung ( 105 ; 40.2 % ) , followed by melanoma ( 57 ; 21.8 % ) , breast ( 38 ; 14.6 % ) , and colorectal ( 18 ; 6.9 % ) . thirty - five ( 13.4 % ) metastatic tumors were of unknown origin at time of diagnosis ( table 1 ) . clinical and pathological characteristics comparison of regional public hospital to city hospitals ( both private and public ) the regional hospital cohort was comprised of 50.8 % males , and the average age at initial diagnosis was 59.614.5 years ( range 1689 years ) . the tumor origin was neuroepithelial ( 205 ; 39.5 % ) , metastatic disease ( 153 ; 29.5 % ) , or meningeal ( 108 ; 20.8 % ) , with a smaller number of pituitary adenomas ( 30 ; 5.8 % ) , lymphomas ( 14 ; 2.7 % ) , and others , as shown in table 1 . the majority of neuroepithlial tumors were astrocytic ( 180 ; 87.8 % ) , with a prevalence of who grade iv ( 144 ; 66.4 % ) , as shown in table 2 . meningeal tumors were comprised of 104 meningiomas ( 96.2 % ) , of which 91 ( 87.5 % ) were who grade i , 12 ( 11.5 % ) were who grade ii , and 1 grade iii . metastatic disease was most commonly from the lung ( 48 ; 37.5 % ) , followed by melanoma ( 28 ; 21.9 % ) , breast ( 14 ; 10.9 % ) , and colorectal ( 12 ; 9.4 % ) . the clinical and pathological features of the 3 patient groups ( regional public hospital , city public hospital , city private hospital ) are compared in each of tables 25 . clinical and pathological characteristics comparison of city public hospital with city private hospital clinical and pathological characteristics comparison of regional public hospital with city public hospital clinical and pathological characteristics of regional public hospital with city private hospitalthis study describes an audit of 3268 histologically defined intracranial neoplasms from 3 institutions over a 14 - year period . over a third of all intracranial neoplasms were neuroepithelial in origin , a quarter were of metastatic disease , a fifth meningeal , and 10 % pituitary adenomas . because this study was based on auditing the surgical pathology databases of 2 institutions , the population is limited to presentations that were both appropriate for surgical intervention and yielded tissue for histopathological diagnosis . most neuroepithelial tumors were astrocytic in origin , with a significant component of tumors displaying oligodendroglial differentiation ( 11.2 % ) . the 3 most common origins of metastatic disease demonstrated in this population were lung , melanoma , and breast . a higher proportion of intracranial neoplasms treated in the regional center were metastatic tumors ( 29.5 % vs 23 % in urban centers ) , and lung and melanoma were the 2 most common origin of metastatic disease . we accept that the survey of 3 hospitals may not be representative of trends across all regional and metropolitan hospitals ; however , it is interesting to note significant differences in the spectrum of disease presenting to each institution . overall , a larger proportion of primary brain tumors presented to city centers as compared with the regional center ( p = 0.001 ) . neuroepitihelial tumors differed between groups in both histological subclassification ( p = 0.01 ) and grade ( p 0.01 ) . it is interesting to note that the difference in tumor grade was most notable between the city public and private hospitals . this may represent a referral bias towards the private system for patients with slow - growing disease , most of which is treated semielectively , or surgeon preference for treating less complex tumors in the private setting . in contrast , patients with high - grade lesions are more likely to present acutely and therefore undergo surgery in the public setting . tumors with oligodendroglial differentiation were less common in the regional center ( 6.3 % of all neuroepithelial were oligodendrogliomas and there were no oligoastrocytomas ) compared with the urban center ( 12.2 % oligodendrogliomas and 3.8 % oligoastrocytomas ) . the regional center currently does not support a specialist neuropathologist , and difficult cases historically have been referred externally for specialist review . fluorescent in - situ hybridization ( fish ) analysis for 1p / 19q codeletion has been obtained with increasing frequency during the study period where oligodendroglial differentiation has been suspected . routine referral for fish analysis of all glial tumors may aid in improving diagnostic accuracy . recognition of oligodendroglial differentiation has historically been a challenge in neuropathology , resulting in significant interobserver variability . it is well recognized that subspecialist neuropathologists are more likely to identify oligodendroglial differentiation than general surgical pathologists . in 1997 , coons et al found a program of joint review by multiple pathologists both improved intradepartmental concordance rates and increased the rate of diagnosis of oligodendroglial tumors . in addition , objective molecular criteria for classification of glial tumors would greatly benefit pathologists . a study by reus et al in 2014 demonstrated a diagnostic algorithm using sequential alpha - thalassemia / mental retardation syndrome x - linked ( atrx ) immunohistochemistry , isocitrate dehydrogenase 1 gene ( idh1 ) mutation , 1p / 19q and subsequent copy number analysis to better classify glial tumors . using the consensus ish - haarlem guidelines , they were able to classify adult glioma tumors as astrocytomas , oligodendrogliomas , and glioblastomas in a way they conclude is better associated with patient outcomes . improving the diagnostic reliability of neuroepithelial tumors is imperative because of the significant impact on treatment and prognosis in the diagnosis of oligodendroglial differentiation . this study adds weight to the need for more objective histological criteria for the grade and linage of gliomas . the number of patients undergoing multiple operations for the same tumor was different between the populations studied . overall , 7.5 % of cases underwent a second operation in the regional center , compared with 10.0 % at the city public hospital and 13.9 % at the city private hospital ( p 0.001 ) . this trend was present for all tumor subtypes , except for pituitary adenomas and meningeal tumors . rates of reoperation for intracranial metastases in particular were remarkably different , with 3.3 % regional compared with 8.0 % city public and 20.4 % at city private hospitals . published caseloads from other institutions describe reoperation rates somewhere in between these values . indeed , in appropriately selected patients , repeat craniotomy for resection of intracranial metastatic disease is correlated with better outcomes . reoperation rate for glioblastoma have previously been reported as 19 % in retrospective studies . in these cases , there was no difference demonstrated according to public versus private hospital , or regional verses city location of residence . we can only speculate as to the reason for these differences in our cohorts ; however , influencing factors may be surgical waiting times , resource allocation , differences in imaging capabilities , and surgeon practice . over the study period , although the caseload remained constant in city - based centers , there has been a steady growth of the neuro - oncology activity in the regional center ( fig .1 ) . over the 14 - year period of this study , new intracranial tumor diagnoses doubled at the regional center . this was likely a reflection in part of the addition of a second neurosurgeon to the department in 2004 , and a third in 2005 . regional population growth and differences in referral patterns may be a further factor in the increased surgical activity of the regional center , as the number of cases continued to climb even at the study 's conclusion . the recent rise in the activity of the regional center may be related in the increased public and general practice awareness of the department 's knowledge , expertise , and skills through public education presentations , and news media releases . in addition , there is an increased trend for patients to prefer receiving treatment in centers close to their residence . we report the characteristics of a database comprised of over three and a half thousand histologically defined brain tumors gathered from public and private , city , and regional settings , over an 11 - year period in australia . this regional center had a higher proportion of intracranial metastatic disease , and less meningeal disease compared with the city center . there was also a lower rate of reoperation for metastatic disease in the regional center . in addition , in the regional center , there were fewer pathological diagnoses of tumors with oligodendroglial differentiation . whereas the neuro - oncology case load is smaller for this regional center , the number of cases have steadily increased throughout the study period , and it is likely that more neuro - oncology surgery will be undertaken in regional centers in the future .\noutput:\n" }, { "from": "agent", "value": "abstractprimary intracranial tumors occur with an incidence of between 2.5 and 6 per 100,000 individuals . they require specialist expertise for investigation and management including input from radiology , pathology , neurosurgery , and oncology . therefore , most patients with intracranial neoplasia are investigated and managed in larger hospitals . the geographically dispersed population of australia has facilitated the development of neurosurgical units in regional areas . however , major metropolitan hospitals are over - represented compared with regional centers in most research cohorts . we therefore sought to investigate the spectrum of intracranial neoplasms undergoing biopsy and surgery at a major regional center in australia and to compare the demographic and pathological features to similar cohorts treated in major metropolitan hospitals.we searched the pathological databases of both a major regional pathology provider and a major metropolitan pathology practice , which provides surgical pathology services for both a large private and a large public neurosurgical hospital , to identify all cerebral tumors undergoing biopsy or resection over a 14 - year period ( calendar years 2001 and 2014 ) . in all , 3717 cerebral tumors were identified . among them , 51 % were from an urban private hospital , 33 % from an urban public hospital , and 16 % from a regional public hospital . overall , one - third of them were neuroepithelial in origin , a quarter metastatic disease , a fifth meningeal , and one - tenth were pituitary adenomas . the regional center treated a higher proportion of metastatic tumors and less meningeal tumors compared with the urban center . additionally , patients were less likely to undergo a second operation in the regional center ( p < 0.001 ) . the differences give an important insight into the burden of neurosurgical disease in regional australia , and how it differs from that encountered in large metropolitan centers ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ramadan is a holy month observed by muslims all over the world , during which fasting is rigorously observed from dawn until sunset . the duration of fasting varies by geographical location and season . during summer and northern latitudes , fasting begins after a meal before dawn ( sahur ) and is completed after sunset by usually consuming sweetened water or dates followed by a meal ( iftar ) . individuals are exempted from ramadan fasting in circumstances such as illness or menstruation that could adversely affect health outcomes leading to interruption of fasting during such periods . in such casesis generally assumed that the calorie consumption is low and there is a greater tendency for hypoglycemia and irregular glycemic control in subjects with type 2 diabetes mellitus . ( t2 dm ) . the effect of experimental short - term fasting on carbohydrate metabolism has been published in the literature . it has been uniformly found that a slight decrease in serum glucose from 3.3 mmol to 3.9 mmol ( 60 mg / dl to 70 mg / dl ) occurs in normal adults a few hours after fasting has begun . however , this reduction in serum glucose tends to cease due to increased gluconeogenesis in the liver during fasting , and related decrease in insulin concentration and a rise in glucagon and sympathetic activity . glycogen stores , along with some degree of gluconeogenesis , may maintain normal serum glucose when a fast follows a large pre - dawn meal . the epidar study that recruited 12,914 muslim diabetic subjects from thirteen countriesreported prevalence estimates of fasting during ramadan as 43 % for type 1 diabetes mellitus and 86 % for t2 dm . although this study was the largest epidemiological report that described diabetes - related practices during ramadan , the study failed to include a detailed dietary assessment during the fasting period although the authors report unaltered life style practices in about 50 % of the individuals during ramadan . it is generally perceived that calorie consumption is restricted during the fasting period , but there exists some degree of dietary indiscretion during the non - fasting period with excessive compensatory eating , which may contribute to hyperglycemia and weight gain . there is paucity of information available on dietary practices and diet components during ramadan fasting . since calorie restriction , adherence to dietary counseling and maintenance of balanced diet forms an integral component of general diabetes management and especially during critical periods such as fasting , the current study aimed to evaluate dietary patterns and diet - adherence at different time points during 30 - day fasting period of ramadan amongst muslims living in south india . diabetes management during fasting is challenging since physical activity is restricted and pharmacological therapy is usually lowered in fear of hypoglycemia . therefore appropriate glycemic control largely relies on appropriate diet modulation of diet that efficiently maintains the blood glucose and counter - balances the fasting effects , especially hypoglycemia , without compromising religious fasting . the importance of dietary management have been strongly underscored by the diabetes control and complications trial ( dcct ) and uk prospective diabetes study ( ukpds ) . although , during ramadan , the benefits of fasting appear only in patients who maintain their appropriate diets . most patients with diabetes find it increasingly difficult to understand and adhere to the nutritional component of their treatment . in the current study , we therefore describe the general dietary pattern followed by muslims during religious fasting and the degree of compliance to the prescribed diet during ramadanall subjects in this dietary survey were muslims with t2 dm who intended to undertake fasting for the entire holy month of ramadan ( 30 days ) . the participants were recruited from an original multicenter , randomized double blind , placebo controlled trial where pioglitazone was used along with conventional ohas to assess the status of glycemic control and incidence of hypoglycemia during ramadan described elsewhere . table 1 shows the baseline characteristics of subjects who participated in the study prior to any type of dietary assessment . baseline characteristics of subjects who took part in the dietary survey all subjects were subjected to 24 - hour dietary recall and diabetic diet counseling at screening . follow - up dietary assessment was carried out at three stages , i.e. , before initiation of ramadan fasting , mid - ramadan ( 15 days after initiating fasting ) and post - ramadan ( 1 week after completing the fasting period ) by a trained dietician . diet was assessed using 24 - hour dietary recall method and through standard questionnaires based on food frequencies as detailed below . study design ; flow of patients regular dietary pattern was obtained by a 24 - hour recall method , and quantitative food assessment was done using a food frequency questionnaire . food frequency questionnaires ( ffq ) based on self - reported intake of daily food have been shown to validly measure long - term dietary patterns in epidemiological studies . the food frequency questionnaire used for the assessment of nutrient intake in the north indian population was easy to administer , showed moderate to good correlation with the 5 - day diet record , and was reproducible . a set of standardized cups , spoons , and glasses were used to aid the subject to recall the quantity of food prepared and consumed . the amount of food intake and raw ingredients used for each food preparation was obtained individually from each subject using reference standardized cups . participants were asked to recall their usual intake of foods and beverages over the past 6 months . both the frequency of intake and the serving size were ascertained . the subject 's intake in terms of raw equivalent was calculated as the product of the total raw amount of each ingredient and the amount of cooked food intake divided by the total food cooked per day . this method is useful in obtaining qualitative details of diet and the pattern of food consumption at household level and also includes assessment of the frequency of consumption of different foods on daily , weekly , fortnight or occasional basis . participants were also queried with regard to the special dietary practices they followed during the fasting period , the use of dietary supplements , and food preparation methods . energy , carbohydrates , proteins , fat , and fiber were calculated using the food composition table reference from national institute of nutrition and indian council for medical research . based on the dietary intake pattern , along with anthropometric measurements ( height , weight ) , cultural preferences , beliefs , lifestyle and customary intake , a standard diabetic diet sheet was given to each individual . the dietary recommendations were adapted to the specific needs of the individual based on nutrition assessment , desired treatment outcomes , and modification of usual food intake . all subjects were advised to strictly adhere to a two meal , two snack ( one meal and one snack before onset of fasting and one meal and one snack after breaking of fast ) pattern during the fasting period of ramadan . a typical day 's meal and snacks aimed at providing 1500 to 2000 calories with 65 - 70 % calories from carbohydrate , 15 - 20 % from protein and 10 - -15 % from fat . prototype dietary recommendation based on body mass index the food exchange system for planning diabetic diets for the current study was based on the concept of food equivalents . seven food groups listed in the food exchange system ( cereals , pulses , meat , milk , vegetables , fruits , and fat ) were included in the diet prescribed to the participants . . the description of food exchanges according to their general composition and characteristics are included in table 3 . food exchanges recommended during fasting dietary counseling was given individually and food portions were instructed using standardized cups and spoons . a - days dietary pattern with traditional foods was displayed in portions to ease understanding of dietary recommendations . in this visual method , a plate served as a pie chart to show the proportions of the plate that have to be covered by various food groups . overall glycemic control during 30 days of fasting was assessed using serum fructosamaine , measured by boehringer mannheim automated analysis ( bm / hitachi system 912 ) . values for optimal glycemic control was based on comparison of serum fructosamaine to hba1c values performed on non - diabetic controls recruited in the original study . glycemic control was classified as good , suboptimal and poor if the corresponding serum fructosamine were 185.285 um / l , 286 - 485 um / l and carbohydrate , protein , and fat intake were expressed as percent contribution to daily energy intake . repeated measure anova was used to compare the difference in proportions in calorie consumption during different time points of fasting . all subjects in this dietary survey were muslims with t2 dm who intended to undertake fasting for the entire holy month of ramadan ( 30 days ) . the participants were recruited from an original multicenter , randomized double blind , placebo controlled trial where pioglitazone was used along with conventional ohas to assess the status of glycemic control and incidence of hypoglycemia during ramadan described elsewhere . table 1 shows the baseline characteristics of subjects who participated in the study prior to any type of dietary assessment . follow - up dietary assessment was carried out at three stages , i.e. , before initiation of ramadan fasting , mid - ramadan ( 15 days after initiating fasting ) and post - ramadan ( 1 week after completing the fasting period ) by a trained dietician . diet was assessed using 24 - hour dietary recall method and through standard questionnaires based on food frequencies as detailed below . regular dietary pattern was obtained by a 24 - hour recall method , and quantitative food assessment was done using a food frequency questionnaire . food frequency questionnaires ( ffq ) based on self - reported intake of daily food have been shown to validly measure long - term dietary patterns in epidemiological studies . the food frequency questionnaire used for the assessment of nutrient intake in the north indian population was easy to administer , showed moderate to good correlation with the 5 - day diet record , and was reproducible . a set of standardized cups , spoons , and glasses were used to aid the subject to recall the quantity of food prepared and consumed . the amount of food intake and raw ingredients used for each food preparation was obtained individually from each subject using reference standardized cups . participants were asked to recall their usual intake of foods and beverages over the past 6 months . both the frequency of intake and the serving size were ascertained . the subject 's intake in terms of raw equivalent was calculated as the product of the total raw amount of each ingredient and the amount of cooked food intake divided by the total food cooked per day . this method is useful in obtaining qualitative details of diet and the pattern of food consumption at household level and also includes assessment of the frequency of consumption of different foods on daily , weekly , fortnight or occasional basis . participants were also queried with regard to the special dietary practices they followed during the fasting period , the use of dietary supplements , and food preparation methods . energy , carbohydrates , proteins , fat , and fiber were calculated using the food composition table reference from national institute of nutrition and indian council for medical research . based on the dietary intake pattern , along with anthropometric measurements ( height , weight ) , cultural preferences , beliefs , lifestyle and customary intake , the dietary recommendations were adapted to the specific needs of the individual based on nutrition assessment , desired treatment outcomes , and modification of usual food intake . all subjects were advised to strictly adhere to a two meal , two snack ( one meal and one snack before onset of fasting and one meal and one snack after breaking of fast ) pattern during the fasting period of ramadan . a typical day 's meal and snacks aimed at providing 1500 to 2000 calories with 65 - 70 % calories from carbohydrate , 15 - 20 % from protein and 10 - -15 % from fat . the food exchange system for planning diabetic diets for the current study was based on the concept of food equivalents . seven food groups listed in the food exchange system ( cereals , pulses , meat , milk , vegetables , fruits , and fat ) were included in the diet prescribed to the participants . . the description of food exchanges according to their general composition and characteristics are included in table 3 . dietary counseling was given individually and food portions were instructed using standardized cups and spoons . a - days dietary pattern with traditional foods was displayed in portions to ease understanding of dietary recommendations . in this visual method , a plate served as a pie chart to show the proportions of the plate that have to be covered by various food groups . overall glycemic control during 30 days of fasting was assessed using serum fructosamaine , measured by boehringer mannheim automated analysis ( bm / hitachi system 912 ) . values for optimal glycemic control was based on comparison of serum fructosamaine to hba1c values performed on non - diabetic controls recruited in the original study . glycemic control was classified as good , suboptimal and poor if the corresponding serum fructosamine were 185.285 um / l , 286 - 485 um / l and carbohydrate , protein , and fat intake were expressed as percent contribution to daily energy intake . repeated measure anova was used to compare the difference in proportions in calorie consumption during different time points of fasting . athe current study examined dietary patterns and adherence to diet prescribed during fasting days of ramadan in 72 muslim subjects with t2 dm . the participants were middle aged ( 459 years ) with a shorter duration of diabetes ( 8.02 years ) and mean bmi was 29.85 kg / m . all subjects included in the study were on anti - diabetic medications either in the form of monotherapy ( n = 12 ) , or combination therapy ( n = 38 ) . the overall calorie consumption during ramadan varied significantly prior to initiation of fasting , 15 days after initiation of fasting and end of the fasting period ( p = 0.001 ) . the percentage of energy consumption from dietary carbohydrate prior to fasting ( 64.116.73 ) , during fasting ( 68.414.41 ) , and at the end of fasting ( 70.465.45 ) remained almost unchanged with marginal statistical significance ( p = 0.041 ) . analysis of individual components of diet consumption showed a substantial increase in dietary components during mid - ramadan fasting [ table 4 ] . dietary intake and glycemic control in patients compared from before and after during the fasting period of ramadan a significant reduction in fasting and post prandial glucose was observed during mid - ramadan , but the glycemic patterns resumed to baseline values when subjects resumed their normal dietary pattern after ramadan fasting . overall glycemic control as assessed by serum fructosamine at the end of the fasting period was optimal ( p = 0.005 ) . nearly one - fourth of the world 's population constitutes muslims . over 50 countries across the globethe 2011 population census of india ( http://censusindia.gov.in ) report an approximate 13.4 % ( 138 million ) muslims living in india clustered in minority communities , which is more than islamic community in the arab countries . however , it is evident from clinical observations an health surveys that most of the muslims in india practice religious fasting during the holy month of ramadan . the major changes in life style pattern during ramadan fasting are chrono - biological and behavioral . although there is considerable evidence on physiological alterations and diabetes management with oral hypoglycemic drugs or insulin , little emphasis is laid upon dietary management during fasting . in the current study we aimed to investigatethe dietary patterns during the ramadan fasting and also assess adherence to prescribed diets to optimize blood sugar control among south indian muslims who undertook 30 day fasting during ramadan . results from our study demonstrates that there is an overall increase in calorie consumption during ramadan fasting despite sufficient dietary counseling in our participants . although religious fasting permits intake of food only twice a day ( before and after sunrise and sunset ) , there appears to be compensatory overeating in adults as observed by the increase in total calorie intake during fasting . there was a significant increase in the percentage carbohydrates , protein and fats consumed during fasting , most of the later are a part of the traditional foods that are specifically consumed during ramadan in this population . contrary to our findings , a study among 22 diabetic muslims from malaysia have shown low calorie consumption during ramadan fasting , however detailed dietary description was not reported among these individuals . the calorie consumption during the entire period of fasting was also not reported among these individuals . we identified a distinct dietary behavioral pattern during the fasting period among our particpants , with regard to type of food groups consumed with a mean increase in consumption of all components of diet during 30 - day fasting . this specific pattern of high calorie food intake was independent of the socio - economic strata and educational status . it was evident from the patient - dietician interview that most patients perceived that intake of large quantities of food that yield sufficient energy could help them sustain fasting and prevent hypoglycemia . observed an increase consumption of dietary fat ( 35.8 % ) , especially saturated fats ( 43.3 % ) among muslims during fasting periods similar to our observations ( 44.2 % ) during mid - ramadan . although this dietary practice of high calorie compensation was contrary to actual religious preaching ( of non - compensatory eating ) , the main concern among participants was interruption of continuous 30 - day fasting due to hypoglycemia . most dietary guidelines for diabetes management are targeted towards intake of specific macronutrients . in an indian setting , many individuals find it difficult to make dietary changes based on such numerical criteria . therefore , our recommendations were based on overall pattern of dietary intake focusing on appropriate food choices . we focused mainly on high - carbohydrate and high - fiber ( hchf ) diet during the nonfasting hours , as it is noted that diets which were high in rich complex carbohydrates and dietary fiber , and relatively low in fat , benefited individuals with diabetes mellitus . despite repeititive counseling on dietary patterns and reinforcing prescribed diet according to patients choices and traditional practices , the compliance to prescribed diet was poor . these conclusions were not supported by questionnaire based assessments but , from overall assessment of the diet diary where the patient recorded foods consumed during fasting . we learn that although targeted counseling is implemented , it is difficult to break the traditional pattern of high - fat and high - protein diet during the period of ramadan fasting . glycemic assessment by serum fructosamine at the end of the study was optimal ( p = 0.005 ) among our participants . several studies have reported no change in hba1c or fructosamine in subjects who undertook fasting during ramadan . it is important to note that the variation in diet pattern during fasting is crucial leading to hypo - and hyperglycemia . hypoglycemia is one of the major concerns both among patients and treating physicians who undertake short - term fasting due to religious practices . hypoglycemia assessment ( based on self - reports ) was not seen among our participants similar to previous observations in fasting diabetic patients treated with anti - diabetic drugs or insulin . however , a large epidemiological study demonstrated that the risk of severe hypoglycemia increased by 4.7 and 7.5 folds in subjects with type 1 and type 2 diabetes who undertook fasting during ramadan . in another muticentric observational study , symptomatic hypoglycemiawe did not observe significant difference in weight or bmi change before , during or after fasting similar to observations by mguil et al . a power calculation to determine the sample size was not used due to the lack of prior similar studies evaluating the dietary habits during ramadan . the 24 - hour dietary recalls can mostly give an estimate of the average nutrient intake , and this possibly explains the difference in food intake when comparing the two dietary assessment methods . there is some element of bias in the recall of food intake as most subjects volunteered participation . however the present study gives us an insight into the dietary habits , food adherence patterns , and traditional beliefs in a unique group of muslim subjects who undertook fasting during ramadan . the large proportion of muslim subjects who undertake fasting during ramadan represents a challenge to the treating physicians . the present study is one of the first studies that have attempted to present the overall picture of the food pattern in fasting muslim subjects during ramadan , and our prototype diet based on regional food practices and a culturally acceptable diet pattern is a recommendation for patients with diabetes who fast during ramadan in india . there is a overwhelming need for additional studies that could provide assessment and dietary recommendations that are ethnic / culture specific and form mainstay of diabetes management in all religious groups that practice short - term fasting .\noutput:\n" }, { "from": "agent", "value": "aims : the aim was to assess the dietary pattern during ramadan season among type 2 diabetic muslim subjects who underwent fasting and intensive dietary counseling.materials and methods : the study was conducted among 70 muslim subjects with type 2 diabetes mellitus who undertook fasting during ramadan and was part of a randomized control trial using pioglitazone published previously . all subjects were subjected to a dietary assessment and counseling at three stages , i.e. , initiation of the study , mid - ramadan and post - ramadan , by a trained dietician . dietary assessment was done by the 24 - hour dietary recall method and the food frequency questionnaire . diabetic diet sheets were dispensed to subjects based on their body mass index ( bmi ) , daily activity , and needs.results : the mean caloric intake between pre - ramadan ( before fasting ) and mid - ramadan ( 15 days after fasting ) were 1506.80 kcal and 1614.29 ( p = 0.001 ) respectively . the distribution of active components pre and during ramadan were : carbohydrates ( g ) 260.76 and 265.35 g ( p = 0.001 ) , proteins ( g ) 43.64 and 46.19 ( p = 0.001 ) and fat ( g ) was 32.88 and 44.16 ( p = 0.0001 ) respectively . the percentage of energy from dietary carbohydrate prior to fasting ( 64.11 6.73 ) and during fasting ( 68.41 4.41 ) remained almost unchanged but statistically significant when compared at different intervals before and during fasting . fat intake increased significantly during fasting ( p = < 0.001 ) . conclusions : the dietary composition in a type 2 diabetic muslim population who undertook fasting during ramadan showed a mean increase in consumption of all components of diet during the period of fasting . nutritional compliance during such a time seems to be difficult and warrants repeated counseling and regular follow - up to achieve targets ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bouveret syndrome is a rare form of gallstone ileus which occurs due to impaction of the stone in the duodenum . the usual cause is an underlying bilio - enteric fistula between the gallbladder and duodenum ( cholecystoduodenal fistula ) through which the stone migrates into the bowel . computed tomography ( ct ) scan has been useful as a diagnostic modality for demonstration of the obstructing calculus and the bilio - enteric fistula . we present a case of bouveret syndrome where primary diagnosis of the cholecystoduodenal fistula along with demonstration of the incriminating calculus was done by magnetic resonance ( mr ) and mr cholangiopancreaticography ( mrcp ) study of the abdomen . a 72 - year - old male presented to the casualty department with complaints of recurrent bilious vomiting and right upper quadrant pain since 15 days . there was no fever , hematemesis , melaena , or jaundice . on physical examination , the patient was frail [ body mass index ( bmi ) 17 kg / m ] and had mild pallor and dehydration . the individual was otherwise anicteric and his vital parameters were stable . abdominal examination revealed a 64 cm sized lump in the right upper quadrant which was well defined , smooth , and mobile . an urgent usg ( ge logiq p5 , color doppler machine , korea ) of the abdomen was performed which revealed a large calculus possibly impacted in the gut . it appeared as a large hyperechoic lesion casting distal acoustic shadow and was causing proximal bowel dilatation involving the duodenum and stomach . ct study of the abdomen was not possible since the patient was vomiting and could not tolerate oral contrast . therefore , further evaluation of the case was done by mrcp ( ge hdx signa 1.5 t mri system , china ) . it revealed a 554038 mm sized hypointense calculus impacted in the third part of duodenum with proximal dilatation of the gut [ figures 1 and 2 ] . a fistulous communication was noted between it and second part of the duodenum on coronal and axial t2 - weighted ( t2w ) images [ figures 3 and 4 ] . coronal t2w image showing a large calculus ( marked with a star ) lodged in the third part of duodenum with proximally dilated gas - filled bowel axial t2w image showing a large hypointense calculus obstructing the third part of duodenum ( marked with a star ) axial t2w image revealing cholecystoduodenal fistula ( marked with arrow ) . the gallbladder is collapsed , thickened , and adherent to the second part of duodenum coronal t2w image revealing cholecystoduodenal fistula ( marked with arrow ) . the gallbladder is collapsed , thickened , and adherent to the second part of duodenum on mrcp , type c biliary variant anatomy with a short right hepatic duct was seen . there was dilatation of the common bile duct ( cbd ) and common hepatic duct ( chd ) seen with evidence of pneumobilia . thick slab mrcp demonstrating the cholecystoduodenal fistula between the collapsed gallbladder and second part of duodenum . dilated cbd is also seen upper gastrointestinal ( gi ) endoscopy of the patient revealed a cholecystoduodenal fistula in the second part of duodenum . a 5 - cm sized calculus was noted in the third part of duodenum beyond which the scope was not negotiable . repeated attempts at endoscopic retrieval along with extracorporeal shock wave and mechanical lithotripsy proved fruitless andper - operatively , the gallbladder was collapsed with dense supracolic adhesions and a frozen c - loop . enterolithotomy and extrication of the stone was done and a 6 cm sized dirty brown pigment stone was delivered [ figure 6 ] . the patient showed smooth recovery up to the 5 post - operative day when he developed sepsis and he succumbed to multi - organ system failure on the 10 day . bouveret syndrome was first described by leon bouveret in 1896 . it is an unusual cause of gastric outlet obstruction due to an impacted gallstone in the duodenum secondary to a cholecystoduodenal fistula . it is a particular form of gallstone ileus which occurs in only 3 % of the total cases . gallstone ileus itself is a rare presentation of the gallstone disease occurring in 0.3 - 0.5 % and constituting 1 - 3 % of all cases of intestinal obstruction . the rarity of this entity in clinical practice is also evidenced by only up to 300 reported cases in literature . factors favoring the biliary - enteric fistula formation include : size of the gallstone ( 2 - 8 cm ) , long history of biliary disease , repeated episodes of cholecystitis , female sex , and old age ( 60 years ) . the relative frequency of fistula is cholecystoduodenal ( 60 % ) , cholecystocolic ( 15 % ) , cholecystogastric ( 5 % ) , and choledochoduodenal ( 5 % ) . once a gallstone erodes into the intestinal lumen , it may manifest as either being asymptomatic , eliminated by either fecal or oral route , or being impacted in the intestinal tract causing obstruction ( 15 % cases ) . the obstruction can be as a result of impaction of the stone in the terminal ileum ( 50 - 75 % ) , proximal ileum and the jejunum ( 20 - 40 % ) , colon and , more rarely , stomach or the duodenum . this is rather influenced greatly by the delay in establishing a correct diagnosis and unjustified delay in intervention . prompt and correct diagnosis of this entity , therefore , is of paramount importance in managing these patients with a relatively high mortality . historically , abdominal radiograph demonstrating classical rigler 's triad of bowel obstruction , pneumobilia , and an ectopic gallstone has been described in gallstone ileus . subsequent radiographs may demonstrate a shift in position of the radio - opaque stone . on usg , however , the ectopic location of the gallstone within the intestinal lumen may be confused with an orthotopic location in a contracted gallbladder . the fistulous tract filled with air or fluidthe rigler 's triad is easily identifiable as is the bilio - enteric fistula which is usually delineated by air or oral contrast . in addition , a secondary sign of presence of contrast in the gallbladder may be a pointer towards the diagnosis . so far where a primary diagnosis of the cholecystoduodenal fistula was made on mr and mrcp study of the abdomen . this may be especially valuable in demonstrating isoattenuating stones and in patients who are unable to tolerate oral contrast medium . in our case too , owing to the unstable condition of the patient , a decision to delineate the pathology on magnetic resonance imaging ( mri ) study of the abdomen was undertaken with successful demonstration of the impacted gallstone as well as the cholecystoduodenal fistula . the treatment options include one - stage approach with enterotomy , cholecystectomy , and resection of fistula or a two - stage approach with emergency enterotomy to remove the obstructing gallstone followed by a second stage cholecystectomy after a period of recuperation . endoscopic extraction of the gallstone along with extracorporeal shock wave lithotripsy and argon plasma coagulation have also been described as treatment options of this entity . in our patient , endoscopic extraction of the impacted stone was initially performed failing which the patient was taken up for surgery . to conclude , bouveret syndrome is an unusual and a rare complication of gallstone disease . it is associated with a high mortality and the outcome is significantly influenced by timely diagnosis and treatment . mri and mrcp studies can also act as successful adjuncts in imaging of this disease for primary demonstration of the bilio - enteric fistula in cases where oral contrast is not well tolerated .\noutput:\n" }, { "from": "agent", "value": "bouveret syndrome is an unusual complication of cholelithiasis which results in upper gastrointestinal obstruction due to a gallstone impacted in the duodenum through a bilio - enteric fistula . we present this rare entity which was primarily diagnosed on magnetic resonance ( mr ) and mr cholangiopancreaticography ( mrcp ) study ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the prevalence of congenital cataract is reported to be between 3.0 and 4.5 per 10,000 children .12 timely cataract extraction , refractive correction and amblyopia management have a significant role in visual prognosis . the best optical management in cataract surgeries during the 1 year of life ( infancy ) remains controversial . a complicated aspect in cataract surgery among this group is the optimal optical correction after cataract surgery . a recent increase in intraocular lens ( iol ) implantation in the pediatric population is due to technical developments and promotion of iol technology3 however , there are some challenging factors in iol implantation during infancy ( the 1 year of life ) . iol implantation in infants and children is not approved by the united states food and drug administration due to greater tissue reactivity to iol material . another problem is the changing axial length and keratometry as children age , complicating permanent correction with iols .456 it has been documented that the axial length of the eye and the corneal curvature change logarithmically according to age , particularly during the first 2 years of life . the other challenging factors are related to the small size of the infantile globe , the growing pattern of the eye and the subsequent myopic shift of the eye , complicating iol implantation in infants .378 piggyback iol implantation has been used for full optical correction during infancy .489 in this technique , a posterior permanent iol is implanted in the capsular bag , and an anterior temporary iol is implanted in the ciliary sulcus . with this technique , the myopic shift of the eye over time can be compensated with explantation of the anterior iol .7 this concept was first proposed by gayton and sanders in 1993.8 in 2001 wilson et al . proposed temporary pseudophakia for this technique of iol implantation and demonstrated good visual outcomes .9 in 2009 , boisvert et al . reported a new theoretical strategy for choosing proper iol power for achieving emmetropia after removal of the temporary iol .4 in this study , we evaluate the long - term visual outcomes and complications of piggyback iol implantation compared with aphakia and secondary iol implantation in patients with infantile cataract . all infants who participated in our study were admitted to rassoul akram hospital ( a referral hospital in tehran , iran ) . written informed consent for the studyall parents or legal guardians underwent a full presentation detailing iol implantation and aphakia with contact lens or spectacle correction . the research adhered to the tenets of the declaration of helsinki and was approved by the institutional review board and ethics committee of the tehran university of medical sciences . in this historical cohort study , piggyback iol implantation was performed for 14 infants ( 23 eyes ) ( piggyback iol group ) with infantile cataract from 1998 to 2007 . furthermore , in the same time period , we evaluated 20 infants ( 32 eyes ) who were candidates for infantile cataract surgery and subsequent aphakia ( aphakia group ) during the 1 year of life . in the aphakia group ,14 eyes received contact lens correction , 10 received spectacle correction and 8 eyes underwent secondary iol implantation . keratometry , axial length , and white - to - white measurements were performed , and iol implant power was calculated based on the hoffer q formula or srk / t formula .10 in all patients , a limbal incision was carried out , and capsulotomy was performed using a vitrector . after aspiration of the lens material using a bimanual aspiration / irrigation device or the aspiration mode of the vitrectomy device , posterior capsulotomy was performed using a vitrector . subsequent anterior vitrectomy was performed via the anterior approach . in patients who were selected for piggyback iol implantation , a permanent polymethyl - methacrylate ( pmma ) iolthe power of the anterior iol was calculated based on the estimated change in refraction during an infant 's developmental period . in the majority of casesit was estimated to be about one - third of the total iol power .4 acetylcholine 1 % ( miochol ) was used for intraocular instillation and the limbal incision was closed with an interrupted 10 - 0 nylon suture . one patient who was scheduled for piggyback iol implantation formed a severe fibrin reaction during iol implantation , and the surgery was converted to an aphakic procedure , and the patient was excluded from the study . for all patientssubconjunctival long acting betamethasone was injected , and a diluted solution of betadine ( 5 % ) was applied at the end of the surgery . follow - up visits were scheduled for 1 - day , 2 days , 1 - week and 1 - month postoperatively and further visits were scheduled according to the medical status of the patient . visual acuities were measured using a tumbling e. the anterior segment , posterior segment , refraction , intraocular pressure ( iop ) and ocular motility were checked at each visit ( examination was performed under anesthesia if necessary ) . when the hoffer q formula or srk / t formula predicted emmetropia after removal of sulcus fixated iol , the anterior iol was removed . we did not perform a sample size calculation in advance ( we recruited infants in the piggyback iol group during the course of the study ) . however , based on the observed standard deviation of visual acuities in two groups ( 0.73 and 0.56 logmar ) , our study has 20 % and 40 % power to detect 0.2 and 0.3 logmar difference in visual acuity in two groups , respectively . to evaluate 0.2 logmar difference in our study with a power of 95 % and 0.05 of type i error , 248 eyes ( 124 eyes in each group ) were required . however , this sample size of infants was far too large to enroll from our center . visual acuities were changed to logmar values for statistical analysis and for presenting the data in this study . to describe data , frequency was used for qualitative variables , mean , standard deviation , median , and range for quantitative variables . based on this test , the mann whitney or student 's t - test was used to compare the continuous variables between groups . the percent of complications in each group was compared using the two - sided fisher 's exact test . a total of 55 eyes from 34 infants ( 17 males and 17 females ) with infantile cataract were enrolled . there were 23 eyes of 14 infants ( 8 males and 6 females ) in the piggyback iol group . there were 32 eyes from 20 consecutive infants ( 9 males and 11 females ) with infantile cataract who underwent cataract surgery without implantation iol ( aphakia group ) in the same period . in the piggyback iol group , the patients in piggyback iol group were followed up for 6.21.7 years . in aphakic group ( 32 eyes ) , eight patients underwent unilateral cataract . the mean length of follow - up in the aphakic group was 5.81.7 years , and follow - up lasted at least 4 years for both groups . there were no statistically significant differences in age or any other demographic data between groups [ table 1 ] . associated ocular abnormalities were persistent fetal vasculature ( pfv ) ( 5 cases ) , microphthalmos ( axial length less than two standard deviations below the age - adjusted mean ) ( 5 cases ) , nystagmus ( 14 cases ) and strabismus ( 16 cases ) [ table 2 ] . the first postoperative refraction at 1 - month for the piggyback iol group was + 0.521.58 d. the mean visual acuity in the piggyback iol group was 0.850.73 logmar ( median = 0.7 logmar , interquartile range = 0.3 logmar to 1.32 logmar ) at the end of follow - up . age at the time of surgery was not significantly correlated to visual acuity ( r = 0.155 , p = 0.481 ) . thirteen eyes ( 41 % ) of this group underwent anterior iol removal during the course of this study . of these eyes , two eyes of one patient underwent ahmed valve implantation which was associated with anterior iol removal sooner than the expected , and the remaining 11 eyes underwent iol explantation at the expected time . in these 11 eyes , the mean refraction was 0.403.10 d , 1 - month after iol removal , and the visual acuity was 0.640.46 logmar ( median = 0.59 logmar , interquartile range = 0.32 logmar to 0.93 logmar ) at the end of follow - up . the mean visual acuity in the aphakia group with secondary implantation of iol ( 8 eyes ) was 1.130.89 logmar ( median = 0.96 logmar , interquartile range = 0.47 logmar to 1.67 logmar ) at the end of follow - up and the mean refraction for this group was 0.401.571 - month after iol implantation . the mean visual acuity in the aphakia group without iol implantation ( 24 eyes ) was 0.810.39 logmar ( median = 0.79 logmar , interquartile range = 0.52 logmar to 1.06 logmar ) . demographic data of patients associated ocular abnormalities in piggyback and aphakic groups there was no significant difference between the mean visual acuity in the aphakia group ( 0.890.56 logmar ) ( median = 0.86 logmar , interquartile range = 0.50 logmar to 1.24 logmar ) and the piggyback iol group ( 0.850.73 logmar ) ( median = 0.79 logmar , interquartile range = 0.32 logmar to 1.22 logmar ) ( mann whitney test ; p 0.05 ) . considering two age groups ( under and above 6 months old ) , there was no significant difference in visual acuity between groups for each age group [ table 3 ] ( p 0.05 ) . in the aphakia group , there was a statistically significant relationship between age at surgery and visual acuity ( r = 0.4 , p = 0.04 ) . in the piggyback iol group , there were 3 ( 13 % ) cases of iol capture that were easily repositioned under mask anesthesia . there were 2 ( 9 % ) cases of mild iol decentration that did not require repositioning . there was 1 ( 4 % ) case of vitreous tag likely due to prolapse of tenacious vitreous despite meticulous attention during vitrectomy , adhering to the posterior site of the wound , causing mild decentration of iol . there were 8 ( 35 % ) cases of visual axis opacification ( vao ) also known as posterior capsular opacification and 2 ( 9 % ) cases of membrane formation that underwent reoperation for membrane removal and removal of the opacification . glaucoma was defined as iop 21 mmhg associated with increased cupping of the optic disk compared to the baseline examination . there were 2 ( 9 % ) cases of glaucoma ; both underwent a shunt procedure , and there were no cases of vitreous hemorrhage . there was 1 ( 4 % ) case of retinal detachment requiring vitreoretinal surgery ( for one patient who underwent shunt insertion 1 - month earlier ) . the incidence of reoperation due to complications in the piggyback iol group was statistically significantly greater than the aphakia group ( 48 % vs. 16 % respectively , p = 0.03 ) . there were 15 and 17 cases more than 6 months in the aphakic and piggyback groups respectively , and there was no significant difference between reoperation rates between groups after 6 months ( 6 % vs. 9 % ) respectively . vao was statistically significantly higher in the piggyback iol group compared to the aphakia group ( 8 out of 23 [ 35 % ] vs. 2 out of 32 [ 6 % ] in piggyback iol and aphakic groups , respectively , p = 0.01 ) . the mean spherical equivalent refraction change ( using retinoscopy ) at the spectacle plane 1 - year postoperatively was defined as a myopic shift at the 1 year . this parameter was 5.281.06 d in the piggyback iol group and was 5.101.02 d in the aphakic group ( p 0.05 ) . spectacles and contact lenses are solutions for optical correction in infantile aphakia after cataract surgery . however , there are some disadvantages related to contact lenses and incorrect methods of spectacle use . advances in contact lens technology , have allowed successful use in aphakic infants ,11 however , 50 % of infants may experience poor compliance with contact lens wear .12 visual performance after infantile cataract extraction has been related to the good compliance with contact lens wear .13 hence , considering the degree of parental compliance with contact lens wear is critical . iol implantation in the pediatric population is gaining popularity .814 in a study using a mail out questionnaire surveying ophthalmologists in the uk and ireland , only 25 % of respondents preferred not to perform primary iol implantation in a child under 1 - year old with infantile cataract .15 there are reports of successful visual outcomes after primary implantation of iols in pediatric cataract surgery , especially for unilateral cataract surgeries ; however , these studies have reported an increased risk of complications and reoperations .1617181920 despite a primary posterior capsulectomy and anterior vitrectomy , vao can occur after infantile cataract surgery . in our study , the rate of vao was 35 % ( 8/23 ) of patients in the piggyback iol group and 6 % ( 2/32 ) of patients in the aphakic group . astle et al . reported a 70.8 % risk of vao in children younger than 1 - year who underwent lensectomy and iol implantation .19 because of the high incidence of vao , they proposed that cataract surgery and iol implantation in children younger than 2 years should a two - stage procedure .21 gupta et al . 's study of children 2 years old reported that primary implantation of iol was a safe method of visual rehabilitation in this age group . they reported a low risk of vao ( 6.7 % ) and none of their patients developed glaucoma postoperatively .22 a study from india proposed that primary iol implantation was a successful method for correcting aphakia in children under 2 years old . they noted a 13.3 % rate of vao after cataract surgery .23 lu et al . in a study on primary iol implantation in infants aged 612 months documented a 26.9 % risk of vao .24 trivedi et al. 25 reported that 23.6 % of infantile cataract and primary iol implantation , required reoperation for vao . this rate was higher in female infants but did not differ between various acrylic hydrophobic iol models used in trivedi et al . 's study .25 wilson et al . reported that piggyback iol group had a higher rate of reoperations compared to the patients with single iol in the bag .8 according to the literature , the mean incidence of vao in eyes after lensectomy , posterior capsulectomy , anterior vitrectomy and a hydrophobic acrylic iol implantation is 44 % ( 8.180 % ) .26 the risk of vao after cataract surgery increases with time .27 the risk for vao is 2.7 greater when in infants under 6 months of age at the time of the surgery compared to infants older than 6 months .28 in our study , there were two cases of pupillary membrane formation ( 9 % ) in the piggyback iol group leading to reoperation which is in line with other studies . the risk of membrane formation and vao was higher in the pseudophakic group compared to the aphakic group .20 the source of the differences in the incidence of vao may be related to patient age , the time since the surgery , the type of iol and perhaps different threshold levels for detecting opacification . . the risk may increase with microcornea , microophthalmos , pfv and younger age .24 there is some controversy about the protective role of iol implantation against glaucoma after infantile cataract surgery . for example , a study29 on infants who underwent cataract surgery in the 1 year of life , found a 13 % chance of glaucoma in pseudophakic eyes compared to a 33 % chance of glaucoma in aphakic eyes . however , they concluded that despite a significantly lower incidence of glaucoma , primary iol implantation following cataract surgery in infants was not protective against glaucoma .29 they also concluded that the mean time of diagnosing glaucoma in pseudophakic eyes was lower than aphakic eyes , and younger infants at the time of the surgery ( 2.5 months ) had higher risk of glaucoma .29 however , in this study , the mean age of aphakic patients was significantly lower than pseudophakic patients . asrani et al. 30 proposed two theories for this decrease in the risk of glaucoma ; the first is that chemical components from the vitreous in aphakic eyes can damage the trabecular meshwork . the iol and posterior capsule seal and block the chemical material to access the anterior chamber . the second theory is that the aphakic state damages the trabecular meshwork through a lack of support , the iol prevents this structural damage thus reducing the risk of glaucoma over the long - term .30 wilson et al . documented that no one of 15 eyes with implanted piggyback iol had glaucoma compared to 6 % of eyes with a single iol implantation [ table 4 ] .8 present the different studies reporting pseudophakic glaucoma associated with primary implantation of iol in infants . in our study , two eyes ( 9 % ) in the piggyback iol group developed glaucoma compared to three eyes in the aphakic group ( 9 % ) , and the difference was not statistically significant ( p 0.050 ) . these results are comparable with two other large studies , which reported no difference between pseudophakic and aphakic groups .2031 however , glaucoma developed at a younger age in pseudophakic eyes . previous studies of pseudophakic glaucoma associated with primary iol implantation in infants choosing the correct iol power in infantile cataract is complicated due to the constant growth of the eye during childhood . the axial length of an infant 's eye increases with age , causing a myopic effect . this is compensated by a decrease in keratometric value , resulting in a logarithmic change in refractive error .42 while most of the corneal flattening is complete in the first 3 months , most of axial elongation occurs in the first 18 months .2942 thus , refractive outcomes after iol implantation may be different between studies depending on the iol power used in cataract surgery . according to the changing pattern of axial length and keratometry , the highest change in refraction takes place during the 1 year after surgery . iol implantation may slow axial length growth after childhood cataract surgery . due to the shift in iol position as the patient ages , the myopic shift in pseudophakic eyes is significantly greater than aphakic eyes , although in unilateral cataracts implanted with iol , pseudophakic eyes showed the same axial length growth as the other normal eye .14 in our study , a myopic shift after 1 - year postoperatively , in the piggyback iol group and aphakic group , was 5.28 d and 5.10 d respectively . this may be related to pushing the posterior lens by the anterior lens , which may compensate the difference between myopic shift in pseudophakic and aphakic eyes .24313342434445 lloyd et al . studied 25 infants who underwent primary iol implantation before 1 - year of life and documented an average 4.83 d myopic shift at 12 months . the mean myopic shift was 5.3 d in infants who underwent surgery before 10 weeks of age . their results were comparable with other studies .13142743 in our study , the mean refraction 1 - month after piggyback iol implantation was + 0.521.58 d , thus refractive outcome after piggyback iol implantation seems to be favorable 1 - month postoperatively compared to the aphakic group . at the end of follow - up , the visual acuity in the piggyback iol group was 0.850.73 logmar . in the piggyback iol group , the anterior iol removal , and mean refraction was 0.403.10 d that was acceptable and the visual acuity was 0.640.04 logmar . although visual acuity in the piggyback iol group was better than the aphakic group , the difference was not statistically significant ( p 0.05 ) . there was no significant difference in visual acuity between unilateral aphakic and piggyback groups ( 5 vs. 8 cases ) . in general , the rate of complications and reoperations was higher in the piggyback iol group than the aphakic group . the mean age of these complications excluding strabismus surgery and one case of retinal detachment in aphakic patients was approximately 6 months or lower [ table 3 ] . in this age group , although visual acuity in the aphakic group was higher than the piggyback iol group , it was not statistically significant ( p 0.05 ) . as mentioned , there was a relationship between patient age at the time of operation and visual acuity in the aphakic group . the lower correlation coefficient in the piggyback iol group may be related to the higher reoperation rate and adverse events in this group . although piggyback iol implantation for infantile cataract is optically acceptable as a treatment option , and there is no significant difference in visual outcomes compared to aphakia . the incidence of reoperation in patients aged 6 months or younger is higher than those treated with aphakia . for the age groupolder than 6 months , this incidence showed no difference compared to the aphakic group , although there was no significant difference in visual acuity in this group compared to the aphakic group . however , the limitation of aphakic correction , especially in relation to noncompliance in children during their development should be considered .\noutput:\n" }, { "from": "agent", "value": "purpose : to evaluate the long - term visual outcomes and complications of the piggyback intraocular lens ( iol ) implantation compared to aphakia for infantile cataract.patients and methods : in a comparative study from 1998 to 2007 , piggyback iol implantation ( piggyback iol group ) was performed for 14 infants ( 23 eyes ) with infantile cataract and 20 infants ( 32 eyes ) who were aphakic ( aphakia group ) after infantile cataract surgery . data were collected on logmar visual acuity , and postoperative complications over a mean follow - up time of 6.2 1.7 years and 5.8 1.7 years.results : the mean age at surgery was 7.5 0.6 months and 6.0 3.3 months for the piggyback and the aphakic group respectively ( p > 0.05 ) . at the last follow - up visit , visual acuity was 0.85 0.73 ( median = 0.70 , interquartile range = 0.31.32 ) in the piggyback iol group and 0.89 0.56 ( median = 0.86 , interquartile range = 0.501.24 ) in the aphakic group ( p > 0.05 ) . there was a positive relationship between age and visual outcomes in the aphakic group ( r = 0.4 , p = 0.04 ) but not in the piggyback iol group ( p = 0.48 ) . there was no significant difference between the mean myopic shift in the piggyback iol group ( 5.28 1.06 d ) and the aphakic group ( 5.10 1.02 d ) ( p > 0.05 ) . the incidence of reoperation due to complications in piggyback iol group was higher than aphakic group ( % 48 vs. % 16 , respectively , p 0.01 ) . however , in patients older than 6 months , this risk was not significantly different compared to the aphakic group.conclusions : although piggyback iol implantation for infantile cataract is optically acceptable as a treatment option , there is no significant difference in visual outcomes compared to aphakia . the incidence in reoperation due to complications in patients aged 6 months or younger is higher than those treated with aphakia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: adrenocortical carcinoma ( acc ) is a rare malignancy ( 0.52 cases / million / year ) with poor prognosis ( 5 - year overall survival : 3245 % ) due to delay in diagnosis and the lack of effective adjuvant treatment . the prognostic value of inferior vena cava ( ivc ) thrombus extension is debated but does not represent a contraindication to surgery . right - sided acc may grow into the ivc more frequently than left sided tumors . left side acc extends into the ivc through the renal vein . in such a situation , a left nephrectomy is usually performed along with resection of the tumor and the thrombus . to the best of our knowledge , this is the first case report of a kidney - preserving adrenalectomy and ivc thrombectomy in a patient with bilateral normally functioning kidneys . a 55 - year - old healthy male was incidentally detected to have a retroperitoneal mass in the left suprarenal location . laboratory tests including serum creatinine , cortisol , aldosterone , 17 - hydroxy progesterone , androstenedione , urinary vanillylmandelic acid , epinephrine , and norepinephrine were normal . computed tomography and magnetic resonance imaging showed an enhancing left adrenal mass ( 8 cm ) with a tumor thrombus extending into the infrahepatic ivc ( thrombus extending up to 5 cm of ivc from renal vein ) , displacing the left kidney laterally [ figure 1a and b ] . ( a ) illustration showing adrenal cortical carcinoma with tumor thrombus extending into inferior vena cava . ( b ) contrast enhanced computed tomography abdomen showing adrenal mass with tumor thrombus extending into inferior vena cava ( star depicting adrenal mass and arrow showing tumor thrombus extending from adrenal vein into renal vein and inferior vena cava ) laparotomy was performed with a chevron incision and lower sternotomy . we proceeded with an en bloc resection of the mass and the para - aortic lymph nodes after mobilization of the spleen and the tail of the pancreas . the infrahepatic ivc was exposed and venous control was achieved by placing four tourniquets ; two on the ivc cranial and caudal to the thrombus , one around the left renal vein proximal to the thrombus and one around the right renal vein . the thrombus was also infiltrating the ivc wall , which was resected with the specimen . the specimen included the tumor thrombus , infiltrated ivc wall , distal left renal vein , adrenal vein , and the adrenal mass [ figure 2a ] . the renal vein proximal to the thrombus was sutured with 6 - 0 prolene , preserving the gonadal and lumbar veins [ figure 2b ] . ( a ) pathology specimen showing resected adrenal mass along with inferior vena cava thrombus . ( b ) illustration showing venous drainage of left kidney after wide excision of adrenal mass with inferior vena cava thrombectomy . ( c ) contrast enhanced computed tomography abdomen at 1 - year follow - up showing normal contrast uptake and enhancement in both kidneys postoperatively on day 1 , the serum creatinine started rising due to acute tubular necrosis secondary to intraoperative hypotension . in view of rising creatinine , color doppler was done which showed normal patency and flow in the ivc and renal vein . the patient needed renal replacement therapy and supportive intensive care unit management for a week followed by gradual return of renal function to normal . at 1 year follow - up , the patient is doing well without any evidence of metastasis on positron emission tomography contrast enhanced computed tomography ( pet - cect ) with a serum creatinine of 1.1 mg / dl . cect abdomen images acquired during the pet - cect study at 1 - year follow - up showed normal contrast uptake and enhancement in both kidneys [ figure 2c ] . the management of a patient with left acc extending into the ivc is complex . considering that prognosisdepends strictly on a radical resection , the main aim is to obtain a complete excision of the tumor . therefore , an aggressive approach is required , however preserving the ipsilateral left kidney whenever possible , is a surgical challenge . the adrenal venous drainage varies by side and both adrenal glands are drained by a single large vein . on the left side , the adrenal vein enters the cranial aspect of the left renal vein and on the right side , the adrenal vein enters the ivc directly on its posterio - lateral aspect . in our patient , the tumor thrombus was extending from the left adrenal vein into the distal left renal vein and then into the ivc as shown in figure 1a and 1b . after resection of the distal left renal vein , venous drainage of the kidney was possible through lumbar and gonadal veins . thus the left kidney was preserved even though the distal part of the left renal vein was excised [ figure 2b ] . a few studies have shown significant survival after radical surgery in patients of acc with ivc thrombus . local stage , curative surgery , age below 35 years , and no other organ resection are significantly associated with better survival . an aggressive approach is not recommended in case of metastasis because even with radical surgery , the 2 year survival rate is 20 % . acc with tumor thrombus extending into the ivc does not represent a contraindication to surgery and curative resection is feasible . kidney - sparing surgery , if possible , should be attempted without compromising surgical margins .\noutput:\n" }, { "from": "agent", "value": "adrenocortical carcinoma with tumor thrombus extending via an adrenal vein into the inferior vena cava is uncommon . we describe a left side kidney - preserving surgery in such a patient where , after transection of the main renal vein at the point of insertion of the adrenal vein , the left kidney was being drained by lumbar and gonadal veins ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the coordinated development of the cardiovascular and pulmonary organ systems is illustrated in embryonic development , when the lung endoderm protrudes into the cardiac mesoderm as the two organs develop in parallel to form the cardiopulmonary circulation . however , little is known about the origins and pathways involved in co - development of the cardiopulmonary system . we assessed pulmonary vascular development in a model of lung agenesis through conditional deletion of - catenin ( ctnnb1 ) within the anterior foregut ( afg ) endoderm . the lung fails to develop from the foregut in shh : ctnnb1 mutants , while the development of the heart and other foregut - derived organs remains intact ( supplemental fig .1 ) . using cd31 whole mount immunostaining and confocal microscopy to visualize early cardiopulmonary vascular development we show that in wild - type embryos , the paired pulmonary arteries ( pa ) descending from the outflow tract ( oft ) of the heart and the pulmonary veins ( pv ) extending from the atria connect with the lung bud to form a vascular plexus at e10 .5 ( fig. 1a e and supplemental video 1 ) . in shh : ctnnb1 lung agenesis mutants , the pa and pv continues to develop and intersect at a region approximately where the lung bud would normally form ( fig . although this vascular plexus persists throughout embryonic development in the absence of lung , it fails to branch or develop further ( supplemental fig . d ) . interestingly , shh is expressed in the afg even in the absence of lung development ( supplemental fig . the presence of both the pas and the pvs in the absence of lung development suggests that cardiac progenitors contribute to the generation of these structures . the cardiac progenitors closest to the anterior foregut where the lung arises are defined by expression of isl1 and are referred to as the second heart field ( shf ) ( supplemental fig . nkx2 .5 expression further subdivides the isl1 + domain into a ventral / medial domain that expresses both isl1 and nkx2 .5 , and a lateral / dorsal domain that expresses only isl1 ( supplemental figs . 3 and 7 ) . we performed cell lineage tracing using the isl1 , isl1 , and nkx2 .5 mouse strains to define the contribution of these lineages to pulmonary mesoderm derivatives ( fig . 1 and supplemental fig . lineage tracing using the isl1 : r26r mice demonstrates that isl1 + cells tagged at e8 .5 prior to lung development give rise to all layers of the pulmonary vasculature as well as the myocardium of the cardiac inflow tract ( fig . this is supported by lineage tracing with the constitutive isl1 demonstrating that isl1 + cells generate ventral lung mesenchyme adjoining the inflow tract of the heart , whereas lineage tracing with nkx2 .5 shows that nkx2 .5 + progenitors only generate the myocardium of the proximal pv ( fig . 1o and supplemental fig .3 ) . we generated a wnt2 mouse to delineate the temporal and spatial relationship between the ventral mesoderm flanking the anterior foregut and overlapping the posterior pole of the heart with the development of pulmonary mesoderm lineages ( supplemental fig . wnt2 is expressed in a unique pattern that is confined to the posterior pole of the developing heart adjacent to the afg prior to lung development at e8 .5 e9 .5 ( fig . lineage labeling of wnt2 + cells at e8 .5 reveals that wnt2 + progenitors generate cells within the cardiac inflow tract but not the outflow tract ( supplemental fig .5 ) , and these cells progressively move into the developing lung bud ( fig . 2c and d , supplemental fig . 6 ) . by e17 .5 , wnt2 + cells labeled at e8 .5 generate multiple mesoderm lineages within the developing heart including cardiomyocytes and endocardium ( supplemental fig . importantly , wnt2 + cardiac progenitors can generate all layers of the pulmonary vasculature , airway smooth muscle , and pdgfr + / ng2 + lung pericyte - like cells similar to the isl1 + cardiac progenitor population ( fig . thus , prior to lung specification , wnt2 marks a multipotent progenitor population that generates the majority of the repertoire of mesodermal lineages in the developing lung and cardiac inflow tract . gli1 is expressed in a temporal and spatial pattern similar to that of wnt2 and isl1 in the ventral mesoderm surrounding the anterior foregut that is activated by shh . we performed lineage tracing with the gli1 mouse and our data show that gli1 + cells marked at e8 .5 can contribute to the inflow tract mesoderm of the heart as well as cells surrounding the early lung bud similar to the wnt2 + progenitors ( fig . examination of the fate of e8 .5 gli1 + progenitors at e17 .5 shows that they can generate all of the mesoderm derivatives within the cardiac inflow tract and developing lung including vascular and airway smooth muscle , proximal vessel endothelium , and pv myocardium in a manner indistinguishable from wnt2 + and isl1 + progenitors ( fig . furthermore , wnt2 + progenitors co - express isl1 and gli1 ( supplemental fig . 7 ) . these data identify a population of multipotent cardiopulmonary mesoderm progenitors ( cpps ) defined by wnt2 + / gli1 + / isl1 + expression that generates the majority of mesoderm lineages in the lung and cardiac inflow tract ( fig . wnt2 + , gli1 + , nor isl1 + progenitors contributed in a significant manner to the distal alveolar capillary endothelium of the lung , but did contribute to the vwf + proximal endothelium of the pulmonary vessels ( supplemental fig . 8 ) . using the ve - cadherin : r26r mouse line , we show that ve - cadherin + endothelial cells at e8 .5 give rise to both the proximal and distal alveolar capillary endothelium of the lung ( supplemental fig . this suggests that the distal alveolar capillary endothelium arises prior to lung development from a ve - cadherin + population distinct from cpps . interestingly , wnt2 + cells labeled after e12 .5 exhibit a significant reduction in their ability to contribute to vascular or airway smooth muscle , the cardiac inflow tract , and proximal vascular endothelium but retain their ability to contribute to the pdgfr + lung pericyte - like cells in the alveoli ( supplemental figs .9 and 10 ) . to define the clonal relationship of cell lineages generated by cpps , we performed clonal analysis using limiting amounts of tamoxifen at e8 .5 in wnt2 : r26r mice that would reproducibly induce single clones of 13 cells at e9 .5 within the posterior pole of the heart ( fig . c , supplemental fig . 11 , supplemental table 1 , supplemental table 2 ) . all of the clones with cell clusters in the lung had associated clusters in the sinus venosus and the posterior wall of the atria at e10 .5 e11 .5 , suggesting that cpps clonally generate cell lineages within the cardiac and pulmonary mesoderm ( fig . tamoxifen induction at e8 .5 led to well - isolated and same - colored clones located in both the primitive lung bud and sinus venosus / posterior atria ( fig . these analyses also show that vascular smooth muscle , airway smooth muscle , proximal endothelium , and pdgfr + pericytes - like cells share a common clonal origin in the lung ( fig . the expression of shh in the anterior foregut endoderm adjacent to the cardiac inflow tract during pulmonary vascular initiation ( fig . 4a , ) , and the co - expression of the hedgehog activated effector gli1 with wnt2 and isl1 in cpps ( supplemental fig .7 ) , suggest that hedgehog signaling plays an important role in regulating cpp development . shh mutants have a disorganized vascular endothelial plexus along the anterior foregut that fails to connect to the inflow and outflow tract of the heart ( fig . conditional inactivation of smoothened ( smo ) within different vascular lineages and in cpps shows that loss of hedgehog signaling in endothelium and smooth muscle does not affect cardiopulmonary vascular patterning and differentiation ( supplemental fig . 12 , ) . in contrast , smo inactivation in isl1 + cpps reproduced the shh / phenotype ( fig . 4d and supplemental fig . 13 ) . isl1 : smo embryos exhibit a persistence of an aortopulmonary collateral circulation in addition to the persistent truncus arteriosus previously reported ( supplemental fig . isl1 : smo mutants also demonstrate severe inflow tract defects with pulmonary vein atresia ( supplemental figs . 13 and 14 ) . lineage tracing analyses revealed a significant reduction of vascular and airway smooth muscle derived from isl1 + and gli1 + cpps lacking smo expression compared to controls ( fig . we have used cell lineage tracing coupled with clonal analysis , to identify and characterize a novel population of mesoderm progenitors called cpps that generate both cardiac inflow tract and pulmonary mesoderm cell lineages ( fig . furthermore , we show that hedgehog signaling is required for the development of cpps into the smooth muscle compartment in the lung and promotes the cardiopulmonary connection essential for terrestrial existence . the wnt2 mouse line was generated by insertion of the creert2 cdna downstream of the atg of the mouse wnt2 gene using homologous recombination in mouse embryonic stem cells as previously described . pcr genotyping primers for wnt2 are : common forward primer : 5 - tgagtctcaccactagccgca - 3 ; wnt2 wt reverse : 5 - actgggaatcagccagggagggt - 3 ; wnt2 mutant reverse : 5 - tccaggtatgctcagaaaacg - 3 . generation and genotyping of the gli1 , nkx2 .5 , isl1 , r26r , smo , r26r , tie2 , sm22 , ve - cadherin , shh , ctnnb1 , gli1 , and isl1 lines have been previously described . at least 3 mouse embryos per genotype were collected at each indicated time points and fixed in 2 % paraformaldehyde , dehydrated in a series of increasing ethanol concentration washes , embedded in paraffin and sectioned ( except the experiments performed with the isl1 : r26r embryos , which were performed with frozen sectioning as previously described ) . antibodies used are anti - smooth muscle actin ( mouse anti - sma 1:200 abcam ) , cd31 ( rat anti - cd311 : 500 bd pharmingen ) , von willibrand factor ( rabbit anti - vwf 1:200 sigma ) , mf20 ( mouse anti - mf201 : 20 abcam ) , isl1 ( mouse anti - isl11 : 10 hybridomabank ) , nkx2 .5 ( goat anti - nkx2 .51 : 10 santa cruz ) , sarcomeric - actinin ( mouse anti - saa 1:100 sigma ) , ng2 ( rabbit anti - ng21 : 100 millipore ) , and gfp ( goat anti - gfp 1:100 abcam ) . embryos were fixed in 2 % paraformaldehyde for 20 min , and washed with cold pbs 3 times for 10 min each . the washed embryos were then washed with blocking solution ( 0.4 % triton x-100 , 5 % serum in pbs ) for 1 hour on ice , and incubated with primary antibody ( rat anti - cd311 : 500 bd pharmingen , rabbit anti - gfp 1:1000 mbl , goat anti - gfp 1:500 abcam , rabbit anti - sm22 , 1:250 abcam ) in blocking solution overnight . the next day , embryos were washed in 0.4 % triton x-100 in pbs on ice 3 times for one hour each and incubated with secondary antibody overnight . the next day , the embryos were washed on ice 3 times for one hour each . the stained embryos were then dehydrated in 100 % methanol , and then babb ( 1 part benzyl alcohol : 2 part benzyl benzoate ) and mounted on a slide with fastwell and sealed with cover slip . the slide was imaged on a zeiss lsm 710 confocal microscope and analyzed and reconfigured in imagej software . a previously published protocol for immunostaining of thick tissue sections embedded in agarose was employed . embryos were fixed in 4 % paraformaldehyde overnight and washed with cold pbs 4 times for 30 minutes each . the embryos was then embedded in 4 % agarose and sectioned on a vibratome to obtain 300 m thick slices . the individual slices embedded in agarose were then incubated in blocking solution ( 0.4 % triton x-100 , 5 % serum in pbs ) for 1 hour on ice , and incubated with primary antibody ( rat anti - cd311 : 500 bd pharmingen , rabbit anti - sm22 , 1:250 abcam ) in blocking solution overnight . the next day , slices were washed in 0.4 % triton x-100 in pbs on ice three times for one hour each and incubated with secondary antibody overnight . the next day , the slices were washed on ice three times for one hour each , and then mounted on a glass slide with prolong gold anti - fade reagent ( molecular probes ) and sealed with cover slip . the slides were imaged on a zeiss lsm 710 confocal microscope and analyzed in imagej software . to assess for clonal relationships in cpps , the wnt2 : r26r were treated with tamoxifen at e8 .5 at a concentration ( 0.025 mg / g body weight ) that was emprically determined to generate small clones or cluster of cells 13 in number at 24 hours after treatment . a total of 59 embryos between e10 .511.5 were determined to contain gfp clusters , and each was imaged per whole mount immunohistochemistry protocol with cd31 / gfp double staining described above . z - stacks were acquired for the entire volume capturing the heart and the lung to include all of the gfp + cells . from 59 embryos ,22 clusters of gfp + cells were identified that were spatially segregated with cellular distribution in the lung mesenchyme . cells per cluster were counted through all z - stacks and doubling time was calculated ( dt = ( tt0 ) log2 / ( lognlogn0 ) . for clonal analysis of gli1 : r26r mice , 0.05 mg / g body weight of tamoxifen was injected at e8 .5 and tissue was collected at the indicated time points and sectioned at a thickness of 300 m and imaged per protocol described above with cd31 or sm22 counterstaining . z - stacks were acquired for the entire volume capturing the entire thickness of the section to include all fluorescently labeled cells . from 23 embryos , 15 clusters of single - colored and spatially segregated cell clusters with distribution in the lung mesenchyme were identified for cellular localization , and 19 clusters for concurrent lineage analysis . at least 3 embryos per genotype per time point were used and at least 5 sections were used per embryo at comparable levels . plug - in and performed by two people blinded to the specimen genotype and condition . results were averaged between the two cell counters and standard deviations were calculated per genotype / time point . 1 - tailed paired t - tests were used to determine the p value . the wnt2 mouse line was generated by insertion of the creert2 cdna downstream of the atg of the mouse wnt2 gene using homologous recombination in mouse embryonic stem cells as previously described . pcr genotyping primers for wnt2 are : common forward primer : 5 - tgagtctcaccactagccgca - 3 ; wnt2 wt reverse : 5 - actgggaatcagccagggagggt - 3 ; wnt2 mutant reverse : 5 - tccaggtatgctcagaaaacg - 3 . generation and genotyping of the gli1 , nkx2 .5 , isl1 , r26r , smo , r26r , tie2 , sm22 , ve - cadherin , shh , ctnnb1 , gli1 , and isl1 lines have been previously described . at least 3 mouse embryos per genotype were collected at each indicated time points and fixed in 2 % paraformaldehyde , dehydrated in a series of increasing ethanol concentration washes , embedded in paraffin and sectioned ( except the experiments performed with the isl1 : r26r embryos , which were performed with frozen sectioning as previously described ) . antibodies used are anti - smooth muscle actin ( mouse anti - sma 1:200 abcam ) , cd31 ( rat anti - cd311 : 500 bd pharmingen ) , von willibrand factor ( rabbit anti - vwf 1:200 sigma ) , mf20 ( mouse anti - mf201 : 20 abcam ) , isl1 ( mouse anti - isl11 : 10 hybridomabank ) , nkx2 .5 ( goat anti - nkx2 .51 : 10 santa cruz ) , sarcomeric - actinin ( mouse anti - saa 1:100 sigma ) , ng2 ( rabbit anti - ng21 : 100 millipore ) , and gfp ( goat anti - gfp 1:100 abcam ) . embryos were fixed in 2 % paraformaldehyde for 20 min , and washed with cold pbs 3 times for 10 min each . the washed embryos were then washed with blocking solution ( 0.4 % triton x-100 , 5 % serum in pbs ) for 1 hour on ice , and incubated with primary antibody ( rat anti - cd311 : 500 bd pharmingen , rabbit anti - gfp 1:1000 mbl , goat anti - gfp 1:500 abcam , rabbit anti - sm22 , 1:250 abcam ) in blocking solution overnight . the next day , embryos were washed in 0.4 % triton x-100 in pbs on ice 3 times for one hour each and incubated with secondary antibody overnight . the next day , the embryos were washed on ice 3 times for one hour each . the stained embryos were then dehydrated in 100 % methanol , and then babb ( 1 part benzyl alcohol : 2 part benzyl benzoate ) and mounted on a slide with fastwell and sealed with cover slip . the slide was imaged on a zeiss lsm 710 confocal microscope and analyzed and reconfigured in imagej software . a previously published protocol for immunostaining of thick tissue sections embedded in agarose was employed . embryos were fixed in 4 % paraformaldehyde overnight and washed with cold pbs 4 times for 30 minutes each . the embryos was then embedded in 4 % agarose and sectioned on a vibratome to obtain 300 m thick slices . the individual slices embedded in agarose were then incubated in blocking solution ( 0.4 % triton x-100 , 5 % serum in pbs ) for 1 hour on ice , and incubated with primary antibody ( rat anti - cd311 : 500 bd pharmingen , rabbit anti - sm22 , 1:250 abcam ) in blocking solution overnight . the next day , slices were washed in 0.4 % triton x-100 in pbs on ice three times for one hour each and incubated with secondary antibody overnight . the next day , the slices were washed on ice three times for one hour each , and then mounted on a glass slide with prolong gold anti - fade reagent ( molecular probes ) and sealed with cover slip . the slides were imaged on a zeiss lsm 710 confocal microscope and analyzed in imagej software . to assess for clonal relationships in cpps , the wnt2 : r26r were treated with tamoxifen at e8 .5 at a concentration ( 0.025 mg / g body weight ) that was emprically determined to generate small clones or cluster of cells 13 in number at 24 hours after treatment . a total of 59 embryos between e10 .511.5 were determined to contain gfp clusters , and each was imaged per whole mount immunohistochemistry protocol with cd31 / gfp double staining described above . z - stacks were acquired for the entire volume capturing the heart and the lung to include all of the gfp + cells . from 59 embryos ,22 clusters of gfp + cells were identified that were spatially segregated with cellular distribution in the lung mesenchyme . cells per cluster were counted through all z - stacks and doubling time was calculated ( dt = ( tt0 ) log2 / ( lognlogn0 ) . for clonal analysis of gli1 : r26r mice ,0.05 mg / g body weight of tamoxifen was injected at e8 .5 and tissue was collected at the indicated time points and sectioned at a thickness of 300 m and imaged per protocol described above with cd31 or sm22 counterstaining . z - stacks were acquired for the entire volume capturing the entire thickness of the section to include all fluorescently labeled cells . from 23 embryos , 15 clusters of single - colored and spatially segregated cell clusters with distribution in the lung mesenchyme were identified for cellular localization , and 19 clusters for concurrent lineage analysis . at least 3 embryos per genotype per time point were used and at least 5 sections were used per embryo at comparable levels . plug - in and performed by two people blinded to the specimen genotype and condition . results were averaged between the two cell counters and standard deviations were calculated per genotype / time point . 1 - tailed\noutput:\n" }, { "from": "agent", "value": "summaryco - development of the cardiovascular and pulmonary systems is a recent evolutionary adaption to terrestrial life that couples cardiac output with the gas exchange function of the lung 1 . in this report , we show that the pulmonary vasculature develops even in the absence of lung development . we have identified a population of multi - potent cardiopulmonary mesoderm progenitors ( cpps ) within the posterior pole of the heart that are marked by the expression of wnt2 / gli1 / isl1 . we show that cpps arise from cardiac progenitors prior to lung development . lineage tracing and clonal analysis demonstrates that cpps generate the mesoderm lineages within the cardiac inflow tract and lung including cardiomyocytes , pulmonary vascular and airway smooth muscle , proximal vascular endothelium , and pericyte - like cells . cpps are regulated by hedgehog expression from the foregut endoderm , which is required for connection of the pulmonary vasculature to the heart . together , these studies identify a novel population of multipotent cardiopulmonary progenitors that coordinates heart and lung co - development that is required for adaptation to terrestrial existence ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: positron emission tomography ( pet ) imaging studies have revealed multiple abnormalities of regional cerebral blood flow ( cbf ) and glucose metabolism in limbic and prefrontal cortex ( p.fc ) structures in mood disorders . these abnormalities implicate limbic - thalamic - cortical and limbic - cortical - striatal - pallidal - thalamic circuits , involving the amygdala , orbital , and medial pfc , and anatomically related parts of the striatum and thalamus in the pathophysiology of mood disorders . interestingly , recent morphometric magnetic resonance imaging ( mri ) and postmortem investigations have also demonstrated abnormalities of brain structure that , persist independently of mood state and may contribute to the corresponding abnormalities of metabolic activity ( discussed in references 2 and 10 ) . thus , structural imaging studies have demonstrated reduced gray matter volumes in areas of the orbital and medial pfc , ventral striatum , and hippocampus , and enlargement of the third ventricle in mood - disordered samples relative to healthy control samples ( table i ) . complementary postmortem neuropathological studies have shown abnormal reductions in cortex volume , glial cell counts , and / or neuron size in the subgenual pfc , orbital cortex , dorsal anterolateral pfc , and amygdala ( table ii ) . it is not currently known whether these deficits constitute developmental abnormalities that may confer vulnerability to abnormal mood episodes , compensatory changes to other pathogenic processes , or the sequelae of recurrent , affective episodes perse . understanding these issues will partly depend upon experiments that delineate the onset of such abnormalities within the illness course and determine whether they antedate depressive episodes in individuals at high familial risk for mood disorders . nevertheless , the marked reduction in glial cells in these regions has been particularly intriguing in view of the growing appreciation that glia play critical roles in regulating synaptic glutamate concentrations and cns energy homeostasis , and in releasing trophic factors that participate in the development and maintenance of synaptic networks formed by neuronal and glial processes . abnormalities in glial function could thus prove integral to the impairments of structural plasticity and overall pathophysiology of mood disorders . ad , alzheimer 's disease ; bp , bipolar ; bpi , bipolar type i disorder ; bpii , bipolar type ii disorder ; car , cerebral atrophy ratio ; csf , cerebrospinal fluid ; ct , computed tomography ; dat , dementia of the alzheimer type ; ect , electroconvulsive therapy ; fc , frontal cortex ; hc , hippocampus ; mdd , major depressive disorder ; mri , magnetic resonance imaging ; mz , monozygote ; pfc , prefrontal cortex ; stg , superior temporal gyrus ; sz , schizophrenia ; up , unipolar ; v3 , third ventricle ; vbr , ventricle / brain ratio . impairments of neuroplasticity and cellular resilience in severe mood disorder : implications for the development of novel therapeutics . psychopharmacol bull . 2001 ; 35:5 - 49 . cortical thickness rostral oribital fc , mdd volume of subgenual pfc in familial mdd and bd laminar cortical thickness in layers iii , v , and vi in subgenual anterior cingulate cortex in bd volumes of nacc ( left ) , basal ganglia ( bilateral ) in mdd and bd parahippocampal cortex size in suicide pyramidal neuronal density , layers iii and v in dorsolateral pfc in bd nonpyramidal neuronal density in layer ii ( -27 % ) in anterior cingulate cortex in bd neuronal density and size in layer ii / iii in rostral oribital fc in mdd neuronal size in layer vi ( -23 % ) in anterior cingulate cortex in mdd neuronal density in layer iii , v , and vi in subgenual anterior cingulate cortex in bd layer - specific interneurons in anterior cingulate cortex in bd and mdd nonpyramidal neuron density in the ca2 region in bd density / size of glia in dorsolateral pfc and caudal oribital fc , in mdd and bd ; layer - specific glial ( but not neuron ) number in subgenual pfc in familial mdd ( -24 % ) and bd ( -41 % ) glial cell density in layer vi ( -22 % ) in anterior cingulate cortex in mdd glial cell counts , glial density , and glia - to - neuron ratios in amygdalain developing hypotheses regarding the pathogenesis of these histopathological changes in mdd , the alterations in cellular morphology resulting from various stressors have been the focus of considerable recent research . thus , although mdd undoubtedly has a strong genetic basis , considerable evidence has shown that severe stressors are associated with a substantial increase in risk for the onset of mood disorders in susceptible individuals . in rodents , certain stressors are capable of producing dendritic atrophy , death , or endangerment ( priming the substrate so that it is more vulnerable to other pathophysiological insults ) of hippocampal ca3 pyramidal neurons . the extent to which such stress - induced neuronal changes also occur in other brain regions remains unclear . activation of the hypothalamic - pituitary - adrenal ( hpa ) axis appears to play a critical role in mediating these effects , since stress - induced neuronal atrophy is prevented by adrenalectomy , and duplicated by exposure to high concentrations of glucocorticoids ( reviewed in references 89 to 91 ) . these observations are noteworthy with respect to the pathophysiology of mood disorders , since a significant percentage of patients with mdd display some form of hpa axis activation , and the subtypes of depression most frequently associated with hpa axis activation arc those most , likely to be associated with hippocampal volume reductions . a significant , percentage of patients with cushing 's disease , in which pituitary gland adenomas result in cortisol hypersecretion , are also known to manifest prominent , depressive symptoms , as well as hippocampal atrophy . furthermore , some patients with cushing 's disease show a reduction in hippocampal volume that correlates inversely with plasma cortisol concentrations ; following corrective surgical treatment , enlargement of hippocampal volume is observed in proportion to the treatment - associated decrement in urinary free cortisol concentrations . in addition to directly causing neuronal atrophy , stress and glucocorticoids also appear to reduce cellular resilience , thereby making certain neurons more vulnerable to other insults , such as ischemia , hypoglycemia , and excitatory amino acid toxicity . thus , recurrent , stress ( and presumably recurrent mdd episodes , which are often associated with hypercortisolemia ) may lower the threshold for cellular death / atrophy in response to a. variety of physiological ( eg , aging ) and pathological events . such processes may conceivably also play a role in the relationship between mood disorders and cerebrovascular events , considering that , individuals who develop their first depressive episode in late life have an increased likelihood of showing mri evidence of cerebrovascular disease . the precise mechanisms by which glucocorticoids exert , these deleterious effects on the hippocampus remain to be fully elucidated , but , likely involve the inhibition of glucose transport , ( thereby diminishing capability of energy production , leading to a cellular failure to handle increasing loads ) , and the facilitation of glutamatergic signaling . the latter observation is noteworthy since , as we discuss below , there is increasing evidence for an association between alterations of brain glutamatergic neurotransmission and the pathophysiology of mood disorders . although somewhat , overlooked due to a monoaminergic preoccupation , there has been evidence for a possible role of the glutamatergic system in mood disorders since the 1950s , when d - cycloserine , a partial agonist , at the n - methyl - d - aspartate ( nmda ) receptor glycine site ( used as a part of multidrug antituberculosis treatment ) was reported to have mood - elevating effects . the beneficial effects of d - cycloserine at , doses of 500 mg / day occurred in a high proportion of the patient studies with respect to depressed mood , insomnia , and reduced appetite ( as discussed in reference 100 ) . although d - cycloscrine clearly exerts multiple pharmacologic effects at the doses employed to treat tuberculosis , it has mild acute , dose - related euphoric and amnesic effects in humans that resemble the effects of subperceptual doses of noncompetitive nmda antagonists . thus , it has been suggested that the antidepressant effects of d - cycloserine may reflect consequences of its capacity to reduce nmda receptor function . since these early serendipitous clinical observations , a growing body of preclinical and clinical research suggests that the nmda class of glutamate receptors may be involved in the pathophysiology of mdd and the mechanism of action of antidepressants ( table iii ) . nmda receptor antagonists such as dizocilpine and ap - 7 ( 2 - amino -7-phosphonoheptanoic acid ) , and an a amino -3-hydroxy-5-methyl-4-isoxazole propionic acid ( ampa ) receptor potentiator , the biarylpropylsulfonamide ly392098 , have demonstrated antidepressant effects in animal models of depression ( including the application of inescapable stressors , forced - swim , and tail suspension - induced immobility tests ) , in learned - helplessness models of depression , and in animals exposed to a chronic mild stress procedure ( reviewed in references 100 and 121 ) . in some of these studies , nmda receptor antagonists had dose - related effects that were comparable in magnitude , but more rapid , than imipramine . moreover , chronic administration of conventional antidepressants has been shown to affect nmda receptor function and nmda receptor - binding profiles , and to regionally alter expression of mrna that encode multiple nmda receptor subunits . recently , berman et al reported the first , placebo - controlled , double - blind trial assessing the treatment effects of a single dose of an nmda receptor antagonist , keta mine , in 7 patients with depression . effects of ketamine infusion emerged over the first , 180 min and persisted over 72 h. within this intriguing study , some patients reported antidepressant , effects lasting as long as a week . similarly , several case reports and open studies have reported the efficacy of lamotrigine ( which among other effects , robustly reduces glutamate release ) in bipolar depression . a randomized , placebocontrolled , 7 - week study comparing two doses of lamotrigine with placebo in 195 patients with moderate - tosevere bipolar depression has now been completed . lamotrigine was superior to placebo after 3 weeks as assessed by changes on the montgomcry - sberg depression rating scale ( madrs ) . overall , the data suggest , that regionally selective abnormally enhanced glutamatergic functioning - either primary or secondary to enhanced glucocorticoid release - may contribute to the impairment of neuroplasticity and cellular resilience observed in mood disorders . more importantly for the present , discussion , although quite preliminary , the existing data suggest , that medications that attenuate glutamatergic functioning ( and perhaps more specifically , nmda throughput ) may possess antidepressant effects . ongoing studies investigating the putative antidepressant effects of riluzole ( which reduces glutamate release ) and memantine ( an nmda antagonist ) may ultimately lead to the development , of novel antidepressant strategies targeting the glutamatergic system . the reduction in neuroplasticity and cellular resilience may also reflect the propensity for various stressors ( and potentially mood disorders ) to decrease the expression of neurotrophic factors . neurotrophins are a family of regulatory factors that mediate the differentiation and survival of neurons , as well as the modulation of synaptic transmission and synaptic plasticity . neurotrophins can be secreted constitutivcly or transiently , and often in an activity - dependent manner . recent , observations support , a model wherein neurotrophins are secreted from the dendrite and act in a retrograde manner at . presynaptic terminals , where they act to induce long - lasting modifications . within the neurotrophin family , brainderived neurotrophic factor ( bdnf ) is a. potent physiological survival factor , which has also been implicated in a variety of pathophysiological conditions , such as parkinson 's disease , alzheimer 's disease , and diabetic peripheral neuropathy . bdnf and other neurotrophic factors are necessary for the survival and function of neurons , implying that a sustained reduction of these factors could affect neuronal viability . although endogenous neurotrophic factors have traditionally been viewed as increasing cell survival by providing necessary trophicsupport , it is now clear that , their survival - promoting effects are mediated in large part by an inhibition of cell death cascades . increasing evidence suggests that neurotrophic factors inhibit cell death cascades by activating the mitogen - activated protein ( map ) kinase signaling pathway and the phosphotidylinositol - 3 kinase ( pi3k ) / akt pathway ( figure 1 ) . one important mechanism by which the map kinase signaling cascades inhibits cell death is by increasing the expression of the antiapoptotic protein bcl - 2 . the neurotrophic fac tor / map kinase / bcl - 2 signaling cascade may thus play a critical role in cell survival in the cns , since there is a very fine balance maintained between the levels and activities of pro- and antiapoptotic factors ; modest changes in this signaling cascade or in the levels of the bcl - 2 family of proteins ( potentially due to genetic , or illness - or insult - related factors ) may therefore profoundly affect cellular viability . modified and reproduced from reference 130 : moore gj , bebchuk jm , wilds ib , chen g , manji hk . in addition to regulating synaptic efficacy , bdnf appears to function as a modulator that , is required for the induction , expression , and / or maintenance of ltp . thus , genetic deletion of bdnf in mice disrupts normal induction of ltp , which can be rescued by reintroducing bdnf either by transfecting hippocampal slices with bdnf - expressing adenovirus or the exogenous administration of bdnf . the information reviewed here clearly shows that neurotrophin signaling cascades play a major role in regulating various forms of neuronal and synaptic plasticity , as well as neuronal survival - all of which may be impaired in severe recurrent mood disorders . we now turn to a. discussion of the evidence that neurotrophic signaling cascades are long - term targets for antidepressants and mood stabilizers . in an extensive series of studies , duman and associates have demonstrated that the cyclic adenosine monophosphate ( camp ) - camp response element , binding protein ( crhb ) cascade - an important pathway involved in cell survival and plasticity - is upregulated by chronic antidepressant treatment , in a timeframe that parallels clinical response . the results include increased coupling of the stimulatory g - protein , gs , to adenylyl cyclase , increased protein kinase a ( pka ) activity in the particulate fraction of limbic structures , increased pka levels in the nuclear fractions of cerebral cortex , and increased mrna expression of the type 1 adenylyl cyclase in the rat hippocampus . the same workers have found that chronic administration of different , classes of antidepressants - ssris ( fluoxetine and sertraline ) , a selective norepinephrine reuptake inhibitor ( desipramine ) , a dual aminergic reuptake inhibitor ( imipramine ) - and chronic electroconvulsive seizures upregulate the expression of creb . by contrast , the nonantidepressant psychotropic drugs cocaine and haloperidol , did not , influence creb mrna expression indicating the specificity of creb induction to antidepressants . chronic administration of these antidepressants has also been demonstrated to increase mrna and protein levels of the camp - specific phosphodiesterase pde4 isozymes , pde4a and pde4b , in rat frontal cortex ( fc ) and hippocampus . the upregulation of pde4 gene expression in response to sustained activation of the camp - creb cascade likely represents a compensatory adaptation that would reduce camp levels back to baseline . as we discuss below , inhibition of specific phosphodiesterases may thus represent a new strategy for developing novel agents for the treatment of depression . one way in which creb can mediate antidepressant induccd neural plasticity is by regulating target genes that , are essential for maintaining synaptic function and cell survival , most notably bdnf . several studies have shown that chronic administration of different types of antidepressant , increases the expression of bdnf in limbic brain areas , particularly the hippocampus , and blocks the stress - induced downregulation of bdnf in the hippocampus . the possibility that increased expression of bdnf may contribute to the therapeutic effects of antidepressants is supported by the rodent , behavioral studies in which direct , infusion of bdnf into the rat . midbrain showed efficacy in the learned - helplessness and forced - swim depression behavioral models . although the human postmortem studies are quite limited and subject , to numerous methodological confounds , they have revealed increased bdnf levels in hippocampal regions in subjects treated with antidepressant medications at the time of death , compared with unmedicated subjects . as discussed above , bdnf is known to play a major role in regulating structural plasticity . do antidepressants , via effects on this major growth factor , actually bring about structural changes in the brain ? because the dendrite is the dynamic compartment of neuronal cell body processes that , forms synapses with other neurons , these changes in its spine density could dramatically alter neurotransmission , synaptic function , and ultimately , neural plasticity . in this context , an important , studv demonstrated that chronic administration of tianeptine ( an antidepressant that , facilitates serotonin reuptake ) blocked stress - induced dendritic remodeling of hippocampal ca3 pyramidal neurons . however , precluding the generalizability to all antidepressants is the observation that chronic fluoxetine and fluvoxamine treatment ( more traditional antidepressants that inhibit serotonin reuptake ) had no influence on dendritic remodeling . more recently , the influence of chronic antidepressant treatment , on neurogenesis of hippocampal neurons has been examined . chronic , but not . acute , antidepressant treatment was found to increase the number of new cells in the dentate gyrus granule cell layer . furthermore , these effects were observed with different classes of antidepressants , but , not with several other psychotropic medications investigated . a very recent , detailed study investigated the effects of tianeptine in the chronic psychosocial stress model of depression in adult , male tree shrews . animals were subjected to a 7 - day period of psychosocial stress to elicit stressinduced endocrine and cns alterations before the onset of daily oral administration of tianeptine ( 50 mg / kg ) . the proliferation rate of the granule precursor cells in the dentate gyrus was reduced ( -33 % ) by stress , effects that were prevented by the simultaneous administration of tianeptine yielding normal values . in stressed animals treated with tianeptine , while these effects of tianeptine are intriguing indeed , a detailed study using several different , classes of antidepressants is clearly needed to determine the precise influence of antidepressants on dendritic remodeling and synaptic function . in toto , although some of the evidence is correlational rather than clearly causal , the evidence indicates that bdnf is associated with an antidepressant response and its induction may represent a key strategy for developing novel antidepressant , medication . in this context , a subtle mechanism to facilitate antidepressant - induced increase in creb / bdnf expression / function may be by the use of camp - specific pde4 inhibitors . indeed , the possibility that inhibitors of this enzyme have antidepressant efficacy is supported by older studies with rolipram , a relatively selective inhibitor of pde4 . rolipram is reported to have efficacy in clinical trials and in preclinical models of depression , but . molecular cloning studies demonstrate that there are four separate pde4 genes , three of which are expressed in brain ( pde4a , pde4b , and pde4d ) . studies are currently underway in pde4a , pde4b , and pde4d null mutant mice , as well as with more selective inhibitors , to further validate these pde4 isozymes as targets of antidepressant treatments . as discussed above , several endogenous growth factors - including nerve growth factor ( ngf ) and bdnf - exert many of their neurotrophic effects via the map kinase signaling cascade . in view of the important role of map kinases in mediating long - term neuroplastic events , it , is noteworthy that , lithium and valproic acid ( vpa ) , at therapeutically relevant concentrations , have recently been demonstrated to robustly activate the extracellular signal - regulated kinase ( erk ) map kinase cascade in rat , fc and hippocampus , as well as in human neuroblastoma sh - sy5y cells ( figure i ) . since the erk map kinases are known to mediate many of the effects of various neurotrophic factors and to promote neurite outgrowth , vpa 's effects on the morphology of human neuroblastoma cells have been examined in detail . human neuroblastoma sh - sy5y cells exposed to vpa ( 1.0 mm ) in serum - free media for 5 days exhibited prominent , growth cones and dramatic neurite outgrowth . elevated levels during neurite growth during development or regeneration , and a 3-fold increase in gap - 43 levels was observed after 5 days ' vpa exposure . follow - up studies have recently shown that , similar to the effects observed in neuroblastoma cells in vitro , chronic lithium or vpa also robustly increases the levels of activated erk in areas of brain that , have been implicated in the pathophysiology and treatment , of bd : the fc and hippocampus . interestingly , neurotrophic factors are now known to promote cell survival by activating map kinases to suppress intrinsic , cellular apoptotic machinery , not by inducing cell survival pathways ( see above ) . thus , a downstream target of the map kinase cascade , ribosomal s -6 kinase ( rsk ) phosphorylat.es creb and this leads to induction of bcl - 2 gene expression ( figure 1 ) . recent studies have therefore undertaken to determine if lithium or vpa regulates the expression of bcl - 2 . doses of lithium and vpa produced a doubling of bcl - 2 levels in fc , effects that were primarily due to a marked increase in the number of bcl - 2 immunoreactive cells in layers ii and iii of fc . interestingly , the importance of neurons in layers ii to iv of the fc in mood disorders has recently been emphasized , since primate studies indicate that these areas are important for providing connections with other cortical regions , and that , they are targets for subcortical input . chronic lithium also markedly increased the number of bcl - 2 immunoreactive cells in the dentate gyrus and striatum ; and detailed immunohistochcmical studies following chronic vpa treatment are currently underway . subsequent to these findings , it has been demonstrated that lithium also increases bcl - 2 levels in c57bl / 6 mice , in neuroblastoma sh - sy5y cells ( human neuronal origin ) in vitro , and in rat cerebellar granule cells in vitro . the latter study was undertaken as part of investigations into the molecular and cellular mechanisms underlying the neuroprotective actions of lithium against glutamate excitotoxicity ( see below ) . these investigators found that lithium produced a remarkable increase in bcl - 2 protein and mrna levels . moreover , lithium has recently been demonstrated to reduce the levels of the proapoptotic protein p53 both in cerebellar granule cells and in neuroblastoma sh - sy5y cells . thus , overall , the data clearly show that chronic lithium robustly increases the levels of the neuroprotective protein bcl - 2 in areas of rodent fc , hippocampus , and striatum in vivo , and in cultured cells of both rodent and human neuronal origin in vitro . furthermore , at least in cultured cell systems , lithium has also been demonstrated to reduce the levels of the proapoptotic protein p53 . consistent , with bcl - 2 's known cytoprotective effects , lithium , at , therapeutically relevant concentrations , has been shown to exert , neuroprotective effects in a variety of preclinical paradigms . thus , lithium has been demonstrated to protect , against the deleterious effects of glutamate , nm.da receptor activation , aging , serum / ngf deprivation , ouabain , thapsigargin ( which mobilizes intracellular methlphenylpyridinium ( mpp + ) , ca2 + ) , and p - amyloid in vitro . more importantly , lithium 's neurotrophic and cytoprotective effects have also been demonstrated in rodent , brain in vivo . thus , lithium treatment has been shown to attenuate the biochemical deficits produced by kainic acid infusion , ibotcnic acid infusion , and forebrain cholinergic system lesions , to exert dramatic protective effects against middle cerebral artery occlusion , and to enhance hippocampal neurogenesis in the adult rodent hippocampus . while the body of preclinical data demonstrating neurotrophic and neuroprotective effects of lithium is striking , considerable caution must , clearly be exercised in extrapolating to the clinical situation with humans . in view of lithium and vpa 's robust effects on the levels of the cytoprotective protein bcl - 2 in the fc , drevets and associates reanalyzed older data demonstrating approximately 40 % reductions in subgenual pfc volumes in familial mood disorder subjects . consistent , with neurotrophic / neuroprotective effects of lithium and vpa , they found that the patients treated with chronic lithium or vpa exhibited subgenual pfc volumes , which were significantly higher than the volumes in non - lithiumtreated or vpa - treated patients , and not . significantly different from controls . although the results of the study by drevets suggest that mood stabilizers may have provided neuroprotective effects during naturalistic use , considerable caution is warranted in view of the small sample size and crosssectional nature of the study . to investigate the potential neurotrophic effects of lithium in humans more definitively , a. longitudinal clinical study was recently undertaken using proton magnetic resonance spectroscopy ( mrs ) to quantify n - acctylaspartate ( naa , a putative marker of neuronal viability ) levels . it was found that chronic lithium administration at therapeutic doses increases naa concentration in the human brain in vivo . ' ittiesc findings provide intriguing indirect , support , for the contention that , similar to the findings observed in the rodent brain and in human neuronal cells in culture , chronic lithium increases neuronal viability / function in the human brain . furthermore , a striking approximately 0.97 correlation between lithiuminduced naa increases and regional voxel gray matter content , was observed , thereby providing evidence for colocalization with the region - specific bcl - 2 increases observed in the rodent , brain cortices ( eg , gray versus white matter ) . these results suggest , that chronic lithium may exert , not only robust , neuroprotective effects ( as has been demonstrated in a variety of preclinical paradigms ) , but also neurotrophic effects in humans . in follow - up studies to the naa findings , it . was hypothesized that , in addition to increasing functional neurochemical markers of neuronal viability , lithium - induced increases in bcl - 2 would also lead to neuropil increases , and thus to increased brain gray matter volume in patients with bipolar disorder . in this clinical research investigation , brain tissue volumes were examined using high - resolution three - dimensional mri and validated quantitative brain tissue segmentation methodology to identify and quantify the various components by volume , including total brain white and gray matter content . measurements were made at baseline ( medicationfree , after a. minimum 14 - day washout ) and then repeated after 4 weeks of lithium at therapeutic doses . this study revealed that , chronic lithium significantly increases total gray matter content in the human brain of patients with bipolar disorder ( figure 2 ) . no significant changes were observed in brain white matter volume or in quantitative measures of regional cerebral water content , thereby providing strong evidence that the observed increases in gray matter content , are likely due to neurotrophic effects as opposed to any possible cell swelling and / or osmotic effects associated with lithium treatment . a finer - grained subregional analysis of this brain imaging data is ongoing , and suggests that , lithium produces a regionally selective increase in gray matter , with prominent , effects being observed in hippocampus and caudate ( unpublished observations ) . modified and reproduced from reference 2 : manji hk , drevets wc , charney ds . the cellular neurobiology of depression . as discussed , there is a. considerable body of evidence both conceptually and experimentally in support of the regulation of signaling cascades regulating synaptic plasticity and cellular resilience in the treatment ( and potentially pathophysiology ) of mood disorders . regulation of signal transduction within critical regions of the brain affects the intracellular signal generated by multiple neurotransmitter systems ; these effects thus represent , attractive putative mediators of the pathophysiology of mood disorders and the therapeutic actions of antidepressants and mood stabilizers . it is also becoming increasingly clear that , for many refractory mood disorder patients , new drugs that simply mimic manytraditional drugs , which directly or indirectly alter neurotransmitter levels , and those which bind to cell surface receptors may be of limited benefit . this is because such strategies implicitly assume that the target receptor ( s ) - and downstream signal mediators - arc functionally intact , and that , altered synaptic activity will thus be transduced to modify the postsynaptichowever , the possible existence of abnormalities in signal transduction pathways suggests that , for patients refractory to conventional medications , improved therapeutics may only be obtained by the direct , targeting of postreceptor sites . recent discoveries concerning a variety of mechanisms involved in the formation and inactivation of second messengers offers the promise for the development of novel pharmacological agents designed to target signal transduction pathways . although clearly more complex than the development of receptor - specific drugs , it may be possible to design novel agents to selectively affect , second messenger systems , because they are quite heterogeneous at . the molecular and cellular level , are linked to receptors in a variety of ways , and are expressed in different stoichiometrics in different , cell types . additionally , since signal transduction pathways display certain unique characteristics depending on their activity state , they offer built - in targets for relative specificity of action , depending on the setpoint of the substrate . it . is also noteworthy that a variety of strategies to enhance neurotrophic factor signaling are currently under investigation . an increasing number of strategies are being investigated to develop small molecular switches for protein - protein interactions , which have the potential to regulate the activity of growth factors , map kinase cascades , and interactions between homo - and heterodimers of the bcl - 2 family of proteins ; this progress holds much promise for the development , of novel therapeutics agents for the long - term treatment of severe mood disorders , and for improving the lives of millions .\noutput:\n" }, { "from": "agent", "value": "there is mounting evidence that recurrent mood disorders - once considered good prognosis diseases - are , in fact , often very severe and life - threatening illnesses . furthermore , although mood disorders have traditionally been conceptualized as neurochemical disorders , there is now evidence from a variety of sources demonstrating regional reductions in central nervous system ( cns ) volume , as well as reductions in the numbers and / or sizes ofglia and neurons in discrete brain areas . although the precise cellular mechanisms underlying these morphometric changes remain to be fully elucidated , the data suggest that mood disorders are associated with impairments of synaptic plasticity and cellular resilience . in this context , it is noteworthy that there is increasing preclinical evidence that antidepressants regulate the function of the glutamatergic system . moreover , although clearly preliminary , the available clinical data suggest that attenuation of n - methyl - d - aspartate ( nmda ) function has antidepressant effects . recent preclinical and clinical studies have shown that signaling pathways involved in regulating cell survival and cell death are long - term targets for the actions of antidepressant agents . antidepressants and mood stabilizers indirectly regulate a number of factors involved in cell survival pathways , including cyclic adenosine monophosphate ( camp ) response element binding protein ( creb ) , brain - derived neurotrophic factor ( bdnf ) , the antiapoptotic protein bcl - 2 , and mitogen - activated protein ( map ) kinases , and may thus bring about some of their delayed long - term beneficial effects via underappreciated neurotrophic effects . there is much promise for the future development of treatments that more directly target molecules in critical cns signaling pathways regulating synaptic plasticity and cellular resilience . these will represent improved long - term treatments for mood disorders ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although the prevalence of tobacco use is decreasing , one of five adults in the u.s . still smokes , and cigarette smoking continues to be the leading cause of preventable illness and death . the highest rates of tobacco use occur among people with the lowest levels of income and education . low socioeconomic status ( ses ) contributes to higher rates of tobacco use and of tobacco - related morbidity and mortality , and , for those in this category , there is limited access to tobacco cessation treatment and prevention . low ses and tobacco is an issue for children as well as adults , for 26.2 % of children live in households where someone smokes . moreover , in households below the poverty line , the percentage is 36.9 % . children in smoking families have substantial exposure to secondhand smoke ( shs ) , to which there is no risk - free level of exposure . nearly nine million preschool children are exposed to shs , a cause of low birth weight , sids , asthma , bronchitis , pneumonia , middle ear infection , and other diseases . although smokers with lower levels of education generally have less knowledge about the negative health effects associated with smoking , many are interested in quitting . a challenge to tobacco control programs is to make evidence - based cessation strategies available to those in greatest need . in thisregard , head start ( hs ) programs have access to low - ses smokers and to the children most vulnerable to shs exposure . this paper describes the development of the hs tobacco cessation initiative , a program promoted by the american legacy foundation ( legacy ) , to incorporate into existing services , protocols to engage families in discussions about tobacco use , to identify tobacco users in households , to build partnerships with groups providing cessation services , and to educate families about risks associated with exposure to shs . this study was approved by the institutional review board of louisiana state university health sciences center ( lsuhsc ) . the concept for engaging hs sites in tobacco cessation developed from a partnership between legacy and the mailman school of public health ( msph ) at columbia university . free to grow ( ftg ) , a community - based initiative of the msph , provided entry to 15 hs sites . of these , 4 agreed to participate in the formative phase of the initiative . once the four pilot sites were selected , legacy and msph entered into collaboration with the behavioral and community health sciences program of the lsuhsc school of public health . the experience of this group in initiating systems change in organizations serving high - risk populations was integral to the development of initiative guidelines , which were designed to enable participating sites to incorporate cessation identification and referral protocols into their existing infrastructures . this group developed protocols for implementing the initiative and strategies for incorporating the initiative into hs programs . figure 1 illustrates the range of relationships developed among stakeholders involved in the initiative . at the national level , stakeholders included the office of head start , the federal agency responsible for programmatic and fiscal oversight for all hs programs ; the national head start association , a membership - based organization representing hs programs and providing advocacy , training , and technical assistance ; and the environmental protection agency , a federal agency emphasizing prevention of exposure to shs . on the state level , stakeholders included state tobacco control programs and agencies responsible for overseeing tobacco cessation and prevention activities , including the provision of services and administration of grant funding to provider organizations ; the state head start collaboration office , where hs staff members facilitated collaboration among hs agencies and state and local entities as charged by the office of head start ; head start associations , the voluntary organizations in each state representing the interests of the hs programs at the state and local levels ; and state offices of public health , which often house the tobacco control and other maternal and child and chronic disease prevention programs . on the local level , organizations that provide tobacco cessation and prevention services and which were appropriate partners for hs programs were also stakeholders.fig . the role of legacy in the development of relationships among national , state , and local stakeholders in support of the head start tobacco cessation initiative head start tobacco cessation initiativethe role of legacy in the development of relationships among national , state , and local stakeholders in support of the head start tobacco cessation initiativethere were three phases to this project : formative pilot , program implementation , and site expansion . program development continued in 2006 with an implementation program in pierce county , washington , and , in 2007 , with a more extensive effort in king county , washington . the goal of this process was to integrate tobacco control strategies into existing hs infrastructure and protocols and to identify strategies for statewide implementation . since all hs children and their families receive a screening for needs assessment , adding tobacco use and shs exposure to hs forms provided a framework for including tobacco control in existing protocols . the formative pilot ( phase i ) was designed to determine the feasibility of applying , in an hs setting , strategies to integrate , into existing practices , identification and treatment of tobacco use as recommended by the u.s . public health service ( usphs ) and engagement of tobacco users for referral to local cessation resources . the 15 - month pilot program was launched at four hs sites that reflected a range of demographic and geographic characteristics . these were umatillamorrow head start ( umhs ) , in hermiston , oregon ; maui economic opportunity ( meo ) , in wailuku , hawaii ; the marathon county child development agency ( mccda ) in wausau , wisconsin ; and the community action project ( cap ) in tulsa , oklahoma . umhs has a large latino population ; meo serves a large native hawaiian community ; mccda supports a growing hmong population ; and the cap relates to large african american and hispanic groups . each of the four sites , which received small seed grants from legacy for creation and implementation of their model programs , developed procedures that reflected their community context within an overall framework of standardized steps designed for implementation in hs centers nationwide . during phase i , a series of surveys was administered to determine the extent to which the four sites focus on addressing tobacco issues with their hs families . hs directors completed a modified baseline facility survey ( bfs ) used in the public hospital system in louisiana . the directors of each hs site were asked to report on center practices and policies regarding tobacco use and cessation services , cessation interventions , efforts to monitor tobacco use among parents , budgets for tobacco control activities , tobacco control practices , policies of affiliated health care providers , and strategies and barriers to increase tobacco cessation activities . the results indicated that directors of the pilot sites recognized the need to change the priority given to addressing tobacco use among hs families ; could identify system and resource barriers to tobacco cessation education , training , and outreach ; could recommend mechanisms to identify tobacco users ; and could educate staff about tobacco cessation and outreach ( table 1 ) . table 1options for implementation of cessation - related activities developed in head start formative pilot sites in oregon , hawaii , wisconsin , and oklahoma , 20042006cessation activitiesoption 1option 2option 3option 4option 5referral to partner for servicesxxxhs provides services ( staff trained in cessation curriculum ) xxxfollow - up by family service workersxxxxquit - linexxxxxpharmacotherapyxxxxxsupport by hs staff ( i.e. , hs - sponsored support group ) xxxx options for implementation of cessation - related activities developed in head start formative pilot sites in oregon , hawaii , wisconsin , and oklahoma , 20042006 in october 2004 , 15 people , representing the four sites , attended a 2 - day training session . legacy provided information about nicotine addiction , evidence - based cessation resources , and the principles and practice of brief tobacco intervention ( bti ) , which is effective in helping low - income individuals quit smoking . legacy also presented training in motivational interviewing ( mi ) , a counseling approach that engages intrinsic motivation . the participants were then able to ( a ) identify common opportunities and challenges to incorporating tobacco cessation activities into hs environments ; ( b ) draft an implementation plan for cessation activities for presentation to their site directors ; ( c ) identify target populations for inclusion in the cessation models ; and ( d ) perform a preliminary survey of community cessation resources . personnel at each of the four pilot sites developed cessation models that reflected their community context and partnerships with local agencies addressing tobacco issues . there were 5 different options for implementation of cessation - related activities ( table 1 ) . option 1 was limited to identification and referral of household tobacco users to external cessation services and option 5 , the most comprehensive , required hs staff members to include tobacco users on their case loads . most often , pilot sites adopted option 2 , a model requiring systemic changes for identification and documentation of household smoking , referral to community partners for counseling and pharmacotherapy , and support from hs staff . table 2 outlines the 13 - month sequence of events for approval , preparation , and implementation of the tobacco intervention at hs sites . following training and organizational assessments , participating sites used their enhanced capacity to address tobacco use among their families.table 2start - up timeline for the tobacco cessation initiative identified in the head start formative pilot , 20042006activitiesmonths12345678910111213assess interest of stakeholders in the initiativexxxxxinitiate trainingxxidentify cessation resources and partnersxxxxprovide additional training , revise protocols , create referral processxxdevelop memoranda of understanding with referral organizationsx start - up timeline for the tobacco cessation initiative identified in the head start formative pilot , 20042006 the meo site consisted of 15 centers with 70 staff members serving 298 families . two hs and eight staff members of partner organizations were trained to provide cessation services . of the 66 hs households identified as having at least one smoker , 14 individuals accepted a referral , and five of these made a connection with the cessation resource . the cap served 1262 families , all of whom were queried about household smokers and interest in cessation . all households with smokers ( n = 325 ) received smoking cessation educational information and referral information . of these , 45 indicated an interest in attending smoking cessation groups ; 7 participated in one or more sessions ; and 15 reported a contact with the state quit - line . umhs developed a cessation resource guide and informed their staff members about cessation resources in the community . parents in selected centers were shown a 5 - min video on shs . in conjunction with completing a questionnaire ,2350 persons who were enrolled in the women , infants and children program received tobacco education . of the 478 families enrolled in hs centers , 45 had at least one smoker in the household ; seven accepted referral to cessation services ; and 4 connected with the referral resource . marathon county child development agency used a similar approach , informing 50 staff members about community resources and about referring hs families to community - based cessation providers . in hs households ,22 were interested in quitting soon ; 28 wanted to quit in the next 3060 days ; 16 wanted to quit within the next year ; and 80 were not interested in quitting . the phase i formative pilot provided data on the feasibility of using systems change strategies to integrate the identification and treatment of tobacco use recommended in the usphs 2000 clinical practice guideline in an hs setting . it identified common points of access , existing practices , and personnel most likely to engage families about tobacco use . these activities identified useful strategies that provided a framework for the next phase of the project , program implementation . phase ii , program implementation , was conducted in pierce county , washington , at seven hs sites . all hs families were educated about the health risks associated with exposure to shs , and households with tobacco users were assisted with obtaining cessation services . strategies , identified in phase i , included staff training , systems change , and the establishment of new partnerships . staff training , conducted by regional and national personnel , included tobacco education classes , introductions to bti and mi , discussion of local and state cessation resources , and alteration of hs forms to identify tobacco users . forms were modified to include questions on tobacco use among family members , household rules restricting tobacco use , and children s exposure to shs . in phase ii , for tobacco programming to occur in tandem with the hs calendar , staff training and system changes were accomplished in the year prior to program initiation . one finding in this phase was that , in hs , the months of october through february , during which time new and returning students are enrolled and registered , offered the best opportunity to complete training , change forms , and develop new partners . in 2007 , the initiative was expanded to additional sites as phase iii to include public healthseattle & king county ( phskc ) in seattle , washington , and 12 hs sites , which included 219 staff members and the capacity for 1,294 child enrollees . this phase focused on expanding the reach of the initiative and understanding the level of technical assistance and stakeholder involvement needed for implementation . the majority of these sites were served by an agency that also served the phase ii sites in king county and had been exposed to form changes through this agency before phase iii began . baseline assessment of new sites was accomplished by interviews with the site directors or their designee between january and march , 2008 . for follow - up , the assessment was re - administered one year later . as in pierce county , the hs staff in king county received training regarding problems associated with use of tobacco , bti , mi , and local cessation resources . phskc also made small reimbursement - based grants of $ 2,500 available to sites each of 2 years . representatives from nine of the sites attended a two - day group training prior to initiation of the effort in december . at all facilities , on - sitetraining ranged from 2 to 6 h. one site received an introductory training on tobacco issues , while all others had training on bti . participating in the training sessions were 101 staff members ( 52 % ) ; representatives from six of the twelve sites completed both pre - and post - training assessments . assessment of attitudes about shs exposure and tobacco interventions before and after training indicated that staff entered training believing that counseling families about shs exposure and tobacco cessation was important . prior to training , however , few were confident in their skills for treating tobacco use ; after training , there was a fourfold increase in staff confidence . during phase iii , home visits , site - based support , educational groups , and meetings with parents provided opportunities to engage parents about tobacco use . at baseline , both resource and system barriers to addressing tobacco use were identified . these included lack of knowledge and education , competing priorities for resources and time , and the lack of a system for screening and utilizing information on smoking status . ten sites participated in a 12 - month follow up and reported increases in staff training to conduct brief interventions for tobacco use ( from 1 to 10 sites ) , delivery of tobacco interventions ( from 4 to 9 for advising , 6 to 10 for referring ) , systems to document tobacco use and smoke exposure ( from 7 to 9 ) , and use of data regarding family tobacco use and shs exposure to provide resources ( from 6 to 10 ) . nine sites reported working with 109 families to address tobacco use and exposure to shs , and one site introduced a written plan for addressing tobacco use and shs exposure . competing priorities and lack of systems persisted as barriers at follow - up , but lack of knowledge did not . the hs tobacco cessation initiative was grounded in a systems - change approach designed to increase the capacity of hs centers in addressing high rates of tobacco use among low ses families and the exposure of children to shs . strategies included adding questions about tobacco use to hs standard forms ; enhancing protocols to assess tobacco use ; helping administration and staff understand why tobacco control should be a priority ; and training staff in how to engage family members in discussions about tobacco use , shs exposure risks , and cessation , and to make appropriate referrals to cessation support groups . protocols and activities associated with the initiative were incorporated into the routine operations of hs centers and their partners . in phasei , three steps were identified as essential for implementation of cessation support within the hs structure : ( 1 ) training to increase staff knowledge of the effects of tobacco use and skill building in the use of mi and bti ; ( 2 ) establishing relationships with local and state tobacco cessation providers ; and ( 3 ) revising hs protocols to identify , engage , and refer family members who use tobacco to appropriate cessation services . phase ii confirmed the following : ( 1 ) county health departments will support hs and provide resources to engage families about tobacco use and shs exposure and provide technical assistance to ensure implementation of newly acquired skills , such as mi and bti . ( 2 ) existing assessment protocols and family support practices within hs programs provide a point of access for identifying tobacco users . embedding tobacco questions in the hs forms allows discussions about tobacco use and permits staff to explore readiness to make a quit attempt and willingness to ban or restrict household tobacco use . ( 3 ) modifying forms and program practices should begin 69 months prior to the start of a school year and should include input from governing entities and site personnel . in phase iii , resource and system barriers to addressing tobacco usewere a key focus , and staff training was identified as an essential component of the initiative . follow - up assessment found changes in practices to deliver tobacco interventions , including systematic changes in documentation . previous studies indicate that after participation in an mi counseling session , parents smoked fewer cigarettes and household nicotine levels decreased . in this initiative , mi was identified as an important skill useful to hs staff for engaging families about tobacco use . the systems changes observed in this project required the support of administrators and others responsible for shaping programmatic focus and for building staff support and capacity . program directors participated in discussions about the importance of addressing tobacco use among hs families , training staff to engage families about tobacco use , and including tobacco assessment and engagement as a component of staff supervision . each was considered a catalyst for adoption of the initiative , and for improving the acceptability of engaging families about tobacco use as a part of the commitment to the well - being of the enrolled children . implementation of the initiative required formation of relationships between hs staff and local health departments , cessation providers , state health departments , and state quit - line providers . as such , system changes will be more likely achieved when the national office of head start adopts performance standards that specifically address tobacco use and shs exposure . limitations : while aspects of systems change could be directly observed ( e.g. , changes to forms ) , changes in practice ( e.g. , increased advising ) were measured by report of site directors or designees . direct measurement of these changes and the extent to which they are sustained is warranted . to achieve widespread changes in hs staff and family behaviors , implementation must focus building a sustainable delivery model that includes training personnel to interact with the priority population and expanding strategically across hs sites . applying system strategies in non - clinical settings such as hs offers a way to improve health and quality of life of preschool children at risk for exposure to shs . nationwide application will require broadening the cadre of stakeholders so that national policy can shape practice , and local practices can be supported by state and local entities promoting tobacco control .\noutput:\n" }, { "from": "agent", "value": "tobacco use continues to be the leading cause of preventable illness and death in the united states . remarkably , more than nine million preschool - aged children are exposed to secondhand smoke , resulting in increased rates of morbidity and mortality . even more disturbing is that tobacco use is highest among people with the lowest levels of income and education . thus , reaching these populations is a challenge facing tobacco control programs . this report describes an innovative pilot project implementing a systems change model that involves multiple stakeholders in integrating evidence - based cessation strategies into federal head start programs , which serve low - income adults and their children . the tobacco cessation initiative was developed through a partnership between the american legacy foundation , the mailman school of public health at columbia university , and the louisiana state university health sciences center school of public health . the partnership developed guidelines to fit into the overall mission of head start by enabling participating sites to incorporate tobacco cessation identification and referral protocols into their existing infrastructures . this program allowed head start sites to incorporate , into their existing family services , protocols for user identification and referral ; build partnerships with groups supporting tobacco cessation ; link families to cessation services ; and educate families about risks associated with exposure to secondhand smoke . applying system strategies in non - clinical settings such as head start offers a way to improve the health and quality of life of preschool children at the highest risk for exposure to secondhand smoke ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: she was diagnosed for full - mouth rehabilitation . according to the kennedy 's classification system and applegate 's rules , the maxillary partially edentulous arch was classified as class ii modification 4 and the mandibular arch as class i modification 1 [ figures 1 and 2 ] . maxillary occlusal view mandibular occlusal view after complete clinical and radiographic examination , a treatment plan was formulated . she was referred for a complete oral prophylaxis following , which she was advised an intentional root canal procedure for all the mandibular teeth . her maxillary teeth revealed grade iii mobility and was referred to the department of surgery for extraction of all the maxillary teeth . she was advised to report back to for full - mouth rehabilitation after complete healing of the extraction site . primary impressions were made for the maxillary and mandibular archesspecial tray was fabricated for the maxilla following , which a secondary impression was mademaster casts were fabricated , and bite rims were made . using the maxillary bite rims and camper 's plane as guide an occlusal plane was established and bite was taken using the lower teeththe bite was mounted on a three - point articulator and teeth setting were donefollowing this wax up for the lower cast was done , and index was made for temporizationtooth preparation was done for 33 , 34 , 35 , 43 , 44 , 45 and temporization was donemetal copings were fabricated with extracoronal precision attachment [ figure 3 ] figure 3metal try in with attachmentswaxing - up of abutments was performed , and milling of lingual area of the metal ceramic setup was done . articulation spaces and bulkiness were evaluated in order to proceed with optimal positioning of attachments using proper parallelometer mandrelmetal ceramic crowns waxed up with attachment structure were casted , and porcelain firing was done . joint crowns were fabricated with the attachments in the laboratory , and the trial of the same was done to check the exact fit of the crownscast partial denture with attachment was fabricated in the laboratory , and the metal framework trial was done in the patient 's mouth for the accuracy of fit . cast structure framework was checked up for stability and precision , and jaw relation was recordedwaxing - up of teeth was performed and teeth setting trial was done [ figures 46 ] . the trial dentures were sent for acrylization figure 4maxillary wax trial figure 5mandibular wax trial with anterior fpd figure 6wax trial in occlusiontrial seating of the finished prosthesis was performed , and cementation of crowns was done using glass ionomer cement . attachments are protected with a thin layer of petroleum jelly ( vaseline ) , uniliver , mumbai , india in order to easily remove cast partial denture after joint porcelain fused to metal crowns with attachment have been seated . complete seating of finished mandibular combined prosthesis with extracoronal castable distal extension precision attachment was evaluated clinically and maxillary complete denture was seated in the patient 's mouth and the patient was recalled after 24 h for review [ figure 7 ] . figure 7final finished prosthesis primary impressions were made for the maxillary and mandibular arches special tray was fabricated for the maxilla following , which a secondary impression was made master casts were fabricated , and bite rims were made . using the maxillary bite rims and camper 's plane as guide an occlusal plane was established and bite was taken using the lower teeth the bite was mounted on a three - point articulator and teeth setting were done following this wax up for the lower cast was done , and index was made for temporization tooth preparation was done for 33 , 34 , 35 , 43 , 44 , 45 and temporization was done metal copings were fabricated with extracoronal precision attachment [ figure 3 ] figure 3metal try in with attachments metal try in with attachments waxing - up of abutments was performed , and milling of lingual area of the metal ceramic setup was done . articulation spaces and bulkiness were evaluated in order to proceed with optimal positioning of attachments using proper parallelometer mandrel metal ceramic crowns waxed up with attachment structure were casted , and porcelain firing was done . joint crowns were fabricated with the attachments in the laboratory , and the trial of the same was done to check the exact fit of the crowns cast partial denture with attachment was fabricated in the laboratory , and the metal framework trial was done in the patient 's mouth for the accuracy of fit . cast structure framework was checked up for stability and precision , and jaw relation was recorded waxing - up of teeth was performed and teeth setting trial was done [ figures 46 ] . the trial dentures were sent for acrylization figure 4maxillary wax trial figure 5mandibular wax trial with anterior fpd figure 6wax trial in occlusion mandibular wax trial with anterior fpd wax trial in occlusion trial seating of the finished prosthesis was performed , and cementation of crowns was done using glass ionomer cement . attachments are protected with a thin layer of petroleum jelly ( vaseline ) , uniliver , mumbai , india in order to easily remove cast partial denture after joint porcelain fused to metal crowns with attachment have been seated . complete seating of finished mandibular combined prosthesis with extracoronal castable distal extension precision attachment was evaluated clinically and maxillary complete denture was seated in the patient 's mouth and the patient was recalled after 24 h for review [ figure 7 ] . primary impressions were made for the maxillary and mandibular archesspecial tray was fabricated for the maxilla following , which a secondary impression was mademaster casts were fabricated , and bite rims were made . using the maxillary bite rims and camper 's plane as guide an occlusal plane was established and bite was taken using the lower teeththe bite was mounted on a three - point articulator and teeth setting were donefollowing this wax up for the lower cast was done , and index was made for temporizationtooth preparation was done for 33 , 34 , 35 , 43 , 44 , 45 and temporization was donemetal copings were fabricated with extracoronal precision attachment [ figure 3 ] figure 3metal try in with attachmentswaxing - up of abutments was performed , and milling of lingual area of the metal ceramic setup was done . articulation spaces and bulkiness were evaluated in order to proceed with optimal positioning of attachments using proper parallelometer mandrelmetal ceramic crowns waxed up with attachment structure were casted , and porcelain firing was done . joint crowns were fabricated with the attachments in the laboratory , and the trial of the same was done to check the exact fit of the crownscast partial denture with attachment was fabricated in the laboratory , and the metal framework trial was done in the patient 's mouth for the accuracy of fit . cast structure framework was checked up for stability and precision , and jaw relation was recordedwaxing - up of teeth was performed and teeth setting trial was done [ figures 46 ] . the trial dentures were sent for acrylization figure 4maxillary wax trial figure 5mandibular wax trial with anterior fpd figure 6wax trial in occlusiontrial seating of the finished prosthesis was performed , and cementation of crowns was done using glass ionomer cement . attachments are protected with a thin layer of petroleum jelly ( vaseline ) , uniliver , mumbai , india in order to easily remove cast partial denture after joint porcelain fused to metal crowns with attachment have been seated . complete seating of finished mandibular combined prosthesis with extracoronal castable distal extension precision attachment was evaluated clinically and maxillary complete denture was seated in the patient 's mouth and the patient was recalled after 24 h for review [ figure 7 ] . figure 7final finished prosthesis primary impressions were made for the maxillary and mandibular arches special tray was fabricated for the maxilla following , which a secondary impression was made master casts were fabricated , and bite rims were made . using the maxillary bite rims and camper 's plane as guide an occlusal plane was established and bite was taken using the lower teeth the bite was mounted on a three - point articulator and teeth setting were done following this wax up for the lower cast was done , and index was made for temporization tooth preparation was done for 33 , 34 , 35 , 43 , 44 , 45 and temporization was done metal copings were fabricated with extracoronal precision attachment [ figure 3 ] figure 3metal try in with attachments metal try in with attachments waxing - up of abutments was performed , and milling of lingual area of the metal ceramic setup was done . articulation spaces and bulkiness were evaluated in order to proceed with optimal positioning of attachments using proper parallelometer mandrel metal ceramic crowns waxed up with attachment structure were casted , and porcelain firing was done . joint crowns were fabricated with the attachments in the laboratory , and the trial of the same was done to check the exact fit of the crowns cast partial denture with attachment was fabricated in the laboratory , and the metal framework trial was done in the patient 's mouth for the accuracy of fit . cast structure framework was checked up for stability and precision , and jaw relation was recorded waxing - up of teeth was performed and teeth setting trial was done [ figures 46 ] . the trial dentures were sent for acrylization figure 4maxillary wax trial figure 5mandibular wax trial with anterior fpd figure 6wax trial in occlusion mandibular wax trial with anterior fpd wax trial in occlusion trial seating of the finished prosthesis was performed , and cementation of crowns was done using glass ionomer cement . attachments are protected with a thin layer of petroleum jelly ( vaseline ) , uniliver , mumbai , india in order to easily remove cast partial denture after joint porcelain fused to metal crowns with attachment have been seated . complete seating of finished mandibular combined prosthesis with extracoronal castable distal extension precision attachment was evaluated clinically and maxillary complete denture was seated in the patient 's mouth and the patient was recalled after 24 h for review [ figure 7 ] . to meet the patient expectations of masticatory efficiency the procedure described in the rehabilitation of this patient is an innovative way of restoration of partially edentulous arches . in the conventional removable partial denture fabrication forces or loadsbut in the current technique force management , maximal retention and stability for the removal prosthesis is achieved . the impact strength , compressive strength of the alloys stands superior in comparison with the denture base materials and mainly this will enable the patient to fulfill his needs . an extra coronal attachment requires only a routine full coverage abutment preparation and provides easy patient insertion and removal . one part is connected to a root , tooth , or implant and the other part to the prosthesis providing a mechanical connection between the two . precision attachment gives a removable prosthesis the exceptional feature of improved esthetics , less postoperative adjustments , and improved comfort . it is mostly indicated for long - span edentulous arches , distal extension bases , and nonparallel abutments . there is a wide range of attachments available for use in all manners of restorative procedures , from partial dentures to implant - supported prosthesis . by analyzing study models and x - rays , the clinician can make several important points of determination , each of which will influence final attachment selection . apart from improving esthetics and retention of removable partial dentures , the availability of the precision attachment has made designing of removable partial dentures more flexible . various cases with esthetic and retention challenges can be solved with correct selection of attachment . thus , unnecessary surgery and cutting of sound tooth for abutment preparation can be avoided in restoring missing teeth . construction of such attachment requires skill from dental technicians that can not be acquired easily and needs training . the parts of the attachment are usually exposed to wear and tear and needed to be replaced over time . attachments system used in the case discussed in this paper is extracoronal castable attachment positioned on the distal of the crowns as an extension allowing a lot of vertical space for optimal esthetics . the castable ot cap male can be easily shaped together with the crowns during waxing - up stage avoiding complicated adaptation procedures like welding a metal attachment after crown casting . the male component design is sphere with a flat head , and female component is retentive nylon caps which are color - coded according to different retentive properties . removable partial dentures still have a good place as a treatment option for partially edentulous kennedy 's class i and class ii conditions . with proper case selection and treatment plan , precision attachment such as rhein 83 ot cap attachments systemcan be used to improve retention , esthetics , and function of removable partial denture . the above - mentioned procedure using allows fabrication of very functional and comfortable prosthetic solution for the edentulous bilateral distal extension patient cases . attachments retention can be monitored and upgraded during time just replacing retentive caps into the framework of dentures for patients comfort and satisfaction .\noutput:\n" }, { "from": "agent", "value": "successful restoration of the dentition requires plenty of contemporary and conventional treatment techniques and planning and attachment retained partial dentures are one such kind of treatment modality in prosthodontics . satisfactory restoration in a patient with a partially edentulous situation can be challenging especially when unilateral or bilateral posterior segment of teeth is missing . one such treatment modality is attachment - retained cast partial dentures . the purpose of this article is to provide an overview of a case with maxillary complete denture and opposing cast partial denture with precision attachment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: aeromonas hydrophila is a motile gram - negative bacilli typically causing infection after exposure of wounds to fresh water , soil , or marine creatures , and oral consumption of contaminated food ( 1,2 ) . we present an account of necrotizing fasciitis caused by a hydrophila in a 60 - year - old immunocompromised male , without a history of wound contamination on the involved extremity . surgeons should raise high suspicion of a hydrophila as an offending pathogen when signs of rapidly progressive soft tissue infection developed in an immunocompromised host ( 2 ) . the 60 - year - old man was brought to the emergency room with pain , swelling , and erythema involving his left leg of one - day duration , which was accompanied by fever and chills . the patient denied a history of prior wounds on the left lower extremity . on examination , there was marked circumferential , diffuse swelling of the leg , and subsequent development of multiple hemorrhagic bullae over a large area . during the course of the day , friable and malodorous changes developed rapidly ( figure 1 ) . large hemorrhagic bullae on an extended erythematous area over the left lower extremity the operative findings revealed diffuse necrosis of skin , fascia , and muscle ( figure 2 ) . the patient was prescribed parenteral piperacillin 4 grams and tazobactam 500 mg every six hours . a series of aggressive fasciectomies and debridements were undergone to prevent the infection from further spreading . during the surgery , the patient remained hypotensive and febrile , with a greater demand for vasoactive medications . the patient was resuscitated , and was subsequently transferred to the surgical intensive care unit . wound cultures grew gram - negative bacilli , which were identified as aeromonas hydrophila . although our team staff had commenced aggressive medical and surgical therapies , the patient died due to multi - organ failure on the third day of admission . aeromonas hydrophila is a motile gram - negative bacillus found in water sources that can cause a wide range of human illness , including acute gastroenteritis , soft tissue infections , meningitis , hepatobiliary tract infections , peritonitis , pneumonia , empyema , and primary septicemia ( 15 ) . possible routes of transmission include intake of contaminated food , exposure of wounds to environments that contain the pathogen ( 1 - 8 ) . severe soft tissue infections caused by aeromonas hydrophila usually involve people with chronic illness , such as cirrhosis , malignant diseases , chronic renal failure , diabetes mellitus , or steroid use ( 3,4 ) . necrotizing fasciitis from aeromonas hydrophila infection in patients with immunocompromised conditions has been reported and is an emerging concern ( 3,4 ) . the prognosis and outcome of patients with necrotizing fasciitis due to a hydrophila infection often rely on early diagnosis and aggressive treatment modalities ( 3,4 ) . in immunocompromised hosts , severe soft - tissue infections often resist antibiotic and surgical therapies ( 3 - 5 ) . our literature research indicates that the fatality rate of necrotizing fascitis attributable to a hydrophila in a host with compromised immunity has been reported to be as high as 50 % to 100 % ( 1 - 5 ) . there are two main mechanisms of pathogenecity in the severe soft tissue infections caused by aeromonas species ( 9,10 ) . first , aeromonas species can produce highly toxic exotoxins , which may lead to extensive myonecrosis as well as necrotizing fasciitis . several tissue factors can be released from pathological process of necrosis , and further contribute to disturbance of circulation , significant edema , or disseminated intravascular coagulation . in this case , the cirrhotic and diabetic patient developed severe soft tissue infections and septic shock , even without trauma lesions on the body or wound exposure to contaminated water which introduced pathogen invasion . broad - spectrum antibiotic agents were administered as soon as sepsis was identified and multiple prompt , thorough surgical measures were attempted to prevent infection from spreading . in spite of an early diagnosis and appropriate treatments , the case demonstrated rapid deterioration and mortality within 72 hours of admission . our experience suggest that surgeons be highly alert to the rare fulminant presentations attributable to a hydrophila infection and prompt surgical measures be performed to aid in early recognition of the disease in the absence of an implicative history .\noutput:\n" }, { "from": "agent", "value": "we present a case of serious necrotizing fasciitis due to aeromonas hydrophila without a suggestive history of routes of pathogen invasion in a 60 - year - old male . despite prompt broad - spectrum antibiotic and extensive surgical therapies , the patient died within 72 hours following initial presentation . our experience suggests clinicians be highly alert to the disease when an immunocompromised patient featured fulminant soft - tissue infection in the endemic area ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: intestinal malrotation is a failure of gut to rotate completely ( 270 degree anticlockwise ) in utero . it can cause small intestinal obstruction and strangulation in infants due to midgut volvulus . a 20 - year female presented with a history of mild mid abdominal pain for 2 days . ct abdomen showed alteration of sma / smv ( superior mesenteric artery and vein ) axis with large bowel on the left and small bowel on the right . on laparoscopy , clumping of small bowel on right and caecum to left iliac fossa noted . operative techniques - one 10 mm umbilical port for camera and two 5 mm working ports in the flanks were used . peritoneal bands were divided with a combination of harmonic scalpel ( ethicon endosurgery ) and fine scissor . small bowel released from membranous adhesions , malpositioned dj flexure released and ladd bands excised . no suture fixation was used . a 14 - year female presented with right sided abdominal pain , mainly early postprandial ( within 1 h ) , on and off for 6 months . small bowel loops were to the right and caecum and appendix was up towards epigastrium and to the left . a 25 - year - old female with epigastric pain on and off for 3 months was admitted with sub acute intestinal obstruction . all the patients , when asked , confirmed that symptoms were present since childhood and either ignored or treated with common household remedies . oral liquids started after 6 h and all three patients were discharge on second postoperative day . these patient , now in more than 6 months follow up , are doing well . a 20 - year female presented with a history of mild mid abdominal pain for 2 days . ct abdomen showed alteration of sma / smv ( superior mesenteric artery and vein ) axis with large bowel on the left and small bowel on the right . on laparoscopy , clumping of small bowel on right and caecum to left iliac fossa noted . operative techniques - one 10 mm umbilical port for camera and two 5 mm working ports in the flanks were used . peritoneal bands were divided with a combination of harmonic scalpel ( ethicon endosurgery ) and fine scissor . small bowel released from membranous adhesions , malpositioned dj flexure released and ladd bands excised . a 14 - year female presented with right sided abdominal pain , mainly early postprandial ( within 1 h ) , on and off for 6 months . small bowel loops were to the right and caecum and appendix was up towards epigastrium and to the left . a 25 - year - old female with epigastric pain on and off for 3 months was admitted with sub acute intestinal obstruction . all the patients , when asked , confirmed that symptoms were present since childhood and either ignored or treated with common household remedies . oral liquids started after 6 h and all three patients were discharge on second postoperative day . these patient , now in more than 6 months follow up , are doing well . when symptomatic , patients present with acute obstruction or chronic abdominal pain or nonspecific complaints . imaging shows small bowel in the right and colon up and to the left ( figure 1a ) . angiography shows sma / smv axis alteration ( whirl sign - sma going around smv ) with possibility of intestinal ischemia . as in pediatric patients , physical examination and abdominal imaging , followed by diagnostic laparoscopy / laparotomy andif identified , ladd 's procedure is recommended to avoid the risk of midgut volvulus . small intestine to right and cecum up and to left the surgical steps consist of division of ladd 's band ( figure 1b and 1c ) and other congenital fibers and adhesions constricting the base of mesentery , appendectomy and functional positioning of the intestine ( figure 1d ) with or without fixation . at the end , widening of the mesentery base ( figure 2a and 2b ) and straighteningduodenum descends along the right gutter , small intestine lie on the right and the caecum and ascending colon in the midline or left side of the abdomen . appendicectomy ( figure 2c ) helps avoiding future diagnostic confusion and also help fixation of caecum . ladd 's bands being dissected twisted mesentery getting released brodedned mesentry untwisted the sma / smv axis it is reported in some series that pathophysiology of pain and other chronic symptoms may not correlate with the extent of radiological anomaly seen , especially the obstructive component . all our cases had twist of the narrowed mesenteric pedicle that was easily reversed after peritoneal band lyses . peritoneal bands may have a restrictive effect on normal duodenal motility and duodenal malrotation ( figure 2d ) often coexists with other parts of intestinal malrotation . complex neurohumoral or neuromuscular changes that occur as the result of release of entrapped bowel also contribute to symptom resolution . abnormal positioned ligament of traitz in malrotated duodenum there is evidence that laparoscopic ladd 's procedure in pediatric age group is safe and gives similar results as in open procedure . our result agrees with other studies showing laparoscopic ladd procedure as safe and effective with the advantage of minimally invasive approach in adult patients with intestinal malrotation without midgut volvulus . if the embryological origin of the malrotation is kept in mind and the systematic steps are followed to divide the bands and release the bowel rather than try to bring caecum to right and small bowel to left , the procedure becomes straightforward and can be accomplished laparoscopically much easily .\noutput:\n" }, { "from": "agent", "value": "intestinal malrotation is rare in adults . patients may present with acute obstruction or chronic abdominal pain . these symptoms are caused by ladd 's bands and narrow mesentery resulting from incomplete gut rotation . barium , computed tomography ( ct ) and magnetic resonance imaging ( mri ) , angiography and sometimes explorative laparotomy are used for diagnosis . ladd 's procedure is the treatment of choice but data about laparoscopic approach in adult is scarce . we report three cases of laparoscopic correction of adult malrotation presenting with chronic abdominal pain . the diagnosis is made by ct / mri . laparoscopic ladd 's procedure ( release of bands , broadening of mesentery and appendicectomy ) was performed via three ports . procedure time 25 - 45 min . all patients were discharged on postoperative day 2 . at 6 month follow - up , all are symptom free . laparoscopic ladd 's procedure is an acceptable alternative to the open technique in treating chronic symptoms of intestinal malrotation in adults ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the physiological effects of whole body vibration ( wbv ) training have been the subject of several studies during the last decade ( rittweger 2010 ) . wbv has always been applied in combination with resistive static or dynamic exercise , which was at minimum weight - bearing during upright standing . the effects of the mechanical stress and the complex afferent input by mere wbv without additional voluntary contraction are not known so far ( rittweger 2010 ) . when vibration is added to an isometric or dynamic muscle load , the leg muscles react with an increase in emg activity ( cardinale and lim 2003 ; ritzmann et al .2013 ) and an increase in energy turnover ( rittweger et al . 2001 ; zange et al . moreover , during vibration muscle converts part of the absorbed kinetic energy into heat ( cochrane et al . ( 2001 ) were the first to find a significant increase in blood flow in the popliteal arteria after 3 - min standing in a shallow squatting posture on a side alternating vibration platform vibrating at a frequency of 26 hz . ( 2013 ) summarised eight similar studies on the post - exercise - reactive hyperaemia by wbv and showed a positive correlation between the increase in blood flow and the vibration load defined as the maximum velocity during vibration movement . near infrared spectroscopy ( nirs ) was used to measure the content and oxygenation of haemoglobin in m. vastus lateralis during squatting exercise with and without wbv ( yamada et al . this study could show a steeper decrease in oxygenation of muscle haemoglobin during exercise with wbv , where post exercise was followed by a transient greater oxygenation than baseline . muscle hypoxia is the major stimulus for the gradual arterial vasodilation by which muscle increases its oxygen supply during exercise ( casey and joyner 2011 ; sarelius and pohl 2010 ) . however , it is still under discussion whether during exercise mechanical impacts on erythrocytes or the endothelia may also activate the release of metabolites like atp or no , respectively , which are involved in the decrease of vascular tone ( casey and joyner 2011 ; sarelius and pohl 2010 ) . acceleration of muscle by wbv may cause large local mechanical stresses which could activate such mechanical mechanisms that involved vasocontrol ( rittweger et al . the mechanisms which cause the extra , vibration - specific muscle activity during wbv are also not finally solved . most authors refer to the tonic vibration reflex which was originally described as a mono - synaptic reflex response to vibration locally applied to a tendon or to the belly of a muscle ( burke et al . ( 2013 ) recently showed that the vibration - specific component of the emg response to wbv was increased when subjects standing on the vibration plate were bearing additional loads . in this study , we examined the effects of the mere vibration stimulus in the calf muscle in a setup typical for wbv without applying any further resistive muscle loading . we tested the unloaded and not voluntarily contracting gastrocnemius medialis muscle of seated subjects who had one foot affixed on a side alternating wbv platform . this setup was used to measure the haemodynamic responses by nirs and the emg response of mere vibration of the whole lower leg like in wbv , however , without any additional load bearing or voluntary contraction of the lower leg muscles . furthermore , we compared the effects from unloaded wbv with effects of weak ( 5 % mvc ) to moderate ( 40 % mvc ) voluntary isometric contraction and discussed the probability of a reflex contraction in response to wbv . the hypothesis was that the vibration caused a visible and emg detectable contraction with increases in muscle pressure and energy turnover . in consequence , we expected an initial decrease in venous blood volume and therefore a decrease in total haemoglobin ( thb ) content and an increase in muscle haemoglobin oxygen saturation ( smo2 ) to a maximum followed by a rapid decrease of smo2 by the increased oxygen demand . we predict that this is followed by smo2 reaching a new steady state lower than baseline . a hyperaemia after vibration would be visible by a rapid and overshooting increase in thb and smo2 . alternatively , if the calf muscle was not contracting in response to vibration , we hypothesised a simultaneous increase in smo2 and thb indicating a vasodilation during vibration . the responses in smo2 and thb to an unloaded wbv like stimulus were furthermore compared with time - matched isometric contractions ranging between 5 and 40 % mvc . originally the study only consisted of the vibration experiment . twelve male subjects ( age 242 years , body mass 779 kg , height 1837 cm ) took part in this vibration experiment . unfortunately , only three subjects from the first experiment could be recruited for the second experiment . therefore , a slightly older group of eight male subjects including five new subjects ( age 296 , p = 0.10 , weight 8210 kg , height 1844 cm ) performed the contraction experiment . for technical reasons subjects were selected by their foot lengths to range between 25 and 30 cm . for both experiments , we asked the subjects not to perform intensive training during the examination day and the day before . experiments were performed between 9 a.m. and 6 p.m. the study was performed and designed in compliance with the declaration of helsinki and subjects gave their written informed consent in accordance with the ethics committee of the rztekammer nordrhein , dsseldorf , germany . results of this study are reported as recommended in a recent consensus publication ( rauch et al . the subjects sat in front of a side alternating vibration platform ( galileo 900 , novotec medical gmbh , pforzheim , germany ) with their right foot affixed to the platform ( fig . 1 ) . seat height and position were individually adjusted to reach an upright position of the lower leg at a knee angle of 90 . the bare foot was affixed using a small snow board binding which assures vibration transmission to the calf muscles . the foot was either placed parallel to rotation axis of the platform , which during vibration caused an up and down movement of the heel and a small ankle tilt in directions of pronation and supination , or orthogonal to rotation axis to induce an up and down combine with a tilt in directions of plantar flexion and dorsi flexion . in both foot positions , the vibration peak - to - peak displacement was 5 mm at the ankle.fig .1 left the right foot of a subject was fixated in a snowboard binding that was attached to a side alternating platform in orthogonal orientation to the rotation axis . right a pair of emg electrodes and a plate with nirs optodes was affixed to the belly of the m. gastrocnemius medialis . the upper thick optode is light emitting and the six thin optodes receive light left the right foot of a subject was fixated in a snowboard binding that was attached to a side alternating platform in orthogonal orientation to the rotation axis . right a pair of emg electrodes and a plate with nirs optodes was affixed to the belly of the m. gastrocnemius medialis . the upper thick optode is light emitting and the six thin optodes receive light the vibration test included two intervals of 3 - min vibration at either 15 or 25 hz applied in randomised order at randomised foot positions ( table 1 ) . three min baseline was followed by 3 - min vibration , 3 - min recovery , 3 - min vibration , and 3 - min final recovery , respectively.table 1randomised order of test conditions in two groups of subjectstest 1recovery 1 daytest 2vibration 1vibration 2vibration 1vibration 2group 1 ( n = 6 ) 15 hz orthogonal25 hz orthogonal15 hz parallel25 hz parallelgroup 2 ( n = 6 ) 25 hz parallel15 hz parallel25 hz orthogonal15 hz orthogonalthe time line of both tests comprised 3 - min baseline , 3 - min vibration 1 , 3 - min recovery , 3 - min vibration 2 , and 3 - min final recovery , respectively . the foot was placed on the vibration plate orthogonal or parallel to the rotation axis of the plate . the vibration peak - to - peak displacement was 5 mm at the ankle randomised order of test conditions in two groups of subjects the time line of both tests comprised 3 - min baseline , 3 - min vibration 1 , 3 - min recovery , 3 - min vibration 2 , and 3 - min final recovery , respectively . the foot was placed on the vibration plate orthogonal or parallel to the rotation axis of the plate . the vibration peak - to - peak displacement was 5 mm at the ankle foot plantar flexion torque was measured at a 90 foot angle using dynamometer ( biodex system3 , biodex medical systems , new york , ny , usa ) . since the examined medial gastrocnemius muscle produces the greatest force with extended knee , this posture was chosen for the contraction experiment . at first maximum voluntary contraction ( mvc ) was determined as the highest torque reached in sequences of three trials of 5 s duration each separated by 60 s recovery . during the contraction experiment each subject performed four tests at different levels corresponding 5 , 10 , 20 , and 40 % mvc , respectively . the 5 % mvc was chosen as the lowest contraction level that could be reasonably controlled by the subjects . the four contractions were arranged in two sets containing a baseline period of 3 min and two contractions of 3 min each followed by 3 min recovery . one group of four subjects performed the two exercise sets with increasing order of torque , while the other four subjects performed the two sets with decreasing torque . the concentrations of oxygenated and desoxygenated haemoglobin ( hbo2 , hbh given in mol / l tissue ) in the medial gastrocnemius muscle were measured using nirs . the nirs device ( rhein ahr campus remagen , university of applied sciences koblenz , remagen , germany ) emitted light from a 50 w halogen light source through a fibre bundle ( diameter 5 mm ) transcutaneous into belly of the muscle . the scattered light emitted from the skin was detected by a linear array of six equidistant optical fibres of 1 mm diameter that were placed at distances between 22.5 and 35.0 mm from the emitting fibre . the whole set of optical fibre bundles ( optodes ) , i.e. the plane ends of the glass fibres , was affixed in a soft plastic plate in almost orthogonal position to the muscle surface . the optode plate was taped over the belly of the medial gastrocnemius muscle with the line of optodes approximately parallel to the muscle fibres . the concentrations of hbh and hbo2 were calculated from attenuation spectrum between 650 and 900 nm that was sampled every 2.5 s. haemoglobin parameters were calculated according to spatial - resolved spectroscopy ( suzuki et al .1999 ) and details of the setup can be found in the literature ( geraskin et al . changes in muscle blood content were monitored as changes in total haemoglobin ( thb , mol / l ) calculated as the sum of hbh and hbo2 . furthermore , muscle oxygen saturation ( smo2 given in % ) was calculated as 100 hbo2 / thb . in our study , we examined lean male subjects who typically show an adipose tissue thickness of 5 mm at the position of the gastrocnemius muscle . with our experimental setup , the potential effects of such thin adipose tissue layers on the measured absolute thb and smo2 values are much smaller than the inter - subject variability and can therefore be neglected ( geraskin et al . 2009 ) . during the vibration experiment bipolar emgwas recorded from the medial gastrocnemius muscle with a pair of active electrodes attached beside the array of nirs optodes . emg was recorded within 10500 hz at a sampling rate of 2,000 hz using a noraxon myosystem 1400 ( velamed , cologne , germany ) . repeated measure anova was used to test for significant effects of vibration or voluntary contraction and for significant effects due to frequency , the order of applied frequency , and the foot position in the vibration experiment as well as the four different torque levels in the contraction experiment . significance was accepted at p 0.05 and high significance at p 0.01 . originally the study only consisted of the vibration experiment . twelve male subjects ( age 242 years , body mass 779 kg , height 1837 cm ) took part in this vibration experiment . unfortunately , only three subjects from the first experiment could be recruited for the second experiment . therefore , a slightly older group of eight male subjects including five new subjects ( age 296 , p = 0.10 , weight 8210 kg , height 1844 cm ) performed the contraction experiment . for technical reasons subjects were selected by their foot lengths to range between 25 and 30 cm . for both experiments , we asked the subjects not to perform intensive training during the examination day and the day before . experiments were performed between 9 a.m. and 6 p.m. the study was performed and designed in compliance with the declaration of helsinki and subjects gave their written informed consent in accordance with the ethics committee of the rztekammer nordrhein , dsseldorf , germany . results of this study are reported as recommended in a recent consensus publication ( rauch et al . the subjects sat in front of a side alternating vibration platform ( galileo 900 , novotec medical gmbh , pforzheim , germany ) with their right foot affixed to the platform ( fig . 1 ) . seat height and position were individually adjusted to reach an upright position of the lower leg at a knee angle of 90 . the bare foot was affixed using a small snow board binding which assures vibration transmission to the calf muscles . the foot was either placed parallel to rotation axis of the platform , which during vibration caused an up and down movement of the heel and a small ankle tilt in directions of pronation and supination , or orthogonal to rotation axis to induce an up and down combine with a tilt in directions of plantar flexion and dorsi flexion . in both foot positions , the vibration peak - to - peak displacement was 5 mm at the ankle.fig .1 left the right foot of a subject was fixated in a snowboard binding that was attached to a side alternating platform in orthogonal orientation to the rotation axis . right a pair of emg electrodes and a plate with nirs optodes was affixed to the belly of the m. gastrocnemius medialis . the upper thick optode is light emitting and the six thin optodes receive light left the right foot of a subject was fixated in a snowboard binding that was attached to a side alternating platform in orthogonal orientation to the rotation axis . right a pair of emg electrodes and a plate with nirs optodes was affixed to the belly of the m. gastrocnemius medialis . the upper thick optode is light emitting and the six thin optodes receive light the vibration test included two intervals of 3 - min vibration at either 15 or 25 hz applied in randomised order at randomised foot positions ( table 1 ) . three min baseline was followed by 3 - min vibration , 3 - min recovery , 3 - min vibration , and 3 - min final recovery , respectively.table 1randomised order of test conditions in two groups of subjectstest 1recovery 1 daytest 2vibration 1vibration 2vibration 1vibration 2group 1 ( n = 6 ) 15 hz orthogonal25 hz orthogonal15 hz parallel25 hz parallelgroup 2 ( n = 6 ) 25 hz parallel15 hz parallel25 hz orthogonal15 hz orthogonalthe time line of both tests comprised 3 - min baseline , 3 - min vibration 1 , 3 - min recovery , 3 - min vibration 2 , and 3 - min final recovery , respectively . the foot was placed on the vibration plate orthogonal or parallel to the rotation axis of the plate . the vibration peak - to - peak displacement was 5 mm at the ankle randomised order of test conditions in two groups of subjects the time line of both tests comprised 3 - min baseline , 3 - min vibration 1 , 3 - min recovery , 3 - min vibration 2 , and 3 - min final recovery , respectively . the foot was placed on the vibration plate orthogonal or parallel to the rotation axis of the plate . foot plantar flexion torque was measured at a 90 foot angle using dynamometer ( biodex system3 , biodex medical systems , new york , ny , usa ) . since the examined medial gastrocnemius muscle produces the greatest force with extended knee , this posture was chosen for the contraction experiment . at first maximum voluntary contraction ( mvc ) was determined as the highest torque reached in sequences of three trials of 5 s duration each separated by 60 s recovery . during the contraction experiment each subject performed four tests at different levels corresponding 5 , 10 , 20 , and 40 % mvc , respectively . the 5 % mvc was chosen as the lowest contraction level that could be reasonably controlled by the subjects . the four contractions were arranged in two sets containing a baseline period of 3 min and two contractions of 3 min each followed by 3 min recovery . one group of four subjects performed the two exercise sets with increasing order of torque , while the other four subjects performed the two sets with decreasing torque . the concentrations of oxygenated and desoxygenated haemoglobin ( hbo2 , hbh given in mol / l tissue ) in the medial gastrocnemius muscle were measured using nirs . the nirs device ( rhein ahr campus remagen , university of applied sciences koblenz , remagen , germany ) emitted light from a 50 w halogen light source through a fibre bundle ( diameter 5 mm ) transcutaneous into belly of the muscle . the scattered light emitted from the skin was detected by a linear array of six equidistant optical fibres of 1 mm diameter that were placed at distances between 22.5 and 35.0 mm from the emitting fibre . the whole set of optical fibre bundles ( optodes ) , i.e. the plane ends of the glass fibres , was affixed in a soft plastic plate in almost orthogonal position to the muscle surface . the optode plate was taped over the belly of the medial gastrocnemius muscle with the line of optodes approximately parallel to the muscle fibres . the concentrations of hbh and hbo2 were calculated from attenuation spectrum between 650 and 900 nm that was sampled every 2.5 s. haemoglobin parameters were calculated according to spatial - resolved spectroscopy ( suzuki et al .1999 ) and details of the setup can be found in the literature ( geraskin et al . changes in muscle blood content were monitored as changes in total haemoglobin ( thb , mol / l ) calculated as the sum of hbh and hbo2 . furthermore , muscle oxygen saturation ( smo2 given in % ) was calculated as 100 hbo2 / thb . in our study , we examined lean male subjects who typically show an adipose tissue thickness of 5 mm at the position of the gastrocnemius muscle . with our experimental setup , the potential effects of such thin adipose tissue layers on the measured absolute thb and smo2 values are much smaller than the inter - subject variability and can therefore be neglected ( geraskin et al . 2009 ) . during the vibration experiment bipolar emg was recorded from the medial gastrocnemius muscle with a pair of active electrodes attached beside the array of nirs optodes . emg was recorded within 10500 hz at a sampling rate of 2,000 hz using a noraxon myosystem 1400 ( velamed , cologne , germany ) . repeated measure anova was used to test for significant effects of vibration or voluntary contraction and for significant effects due to frequency , the order of applied frequency , and the foot position in the vibration experiment as well as the four different torque levels in the contraction experiment . significance was accepted at p 0.05 and high significance at p 0.01 . at both foot positions and at both vibration frequencies lower leg muscles did not visibly contract in response to vibration . the emg records showed a dominant , rhythmic signal in the frequency of the corresponding vibration frequency . after transferring intervals of 1,024 ms ( 1,024 data points ) into the frequency domain using spectral analysis , the vibration frequency and three harmonic frequencies were cut out with a band width of 5 hz . the remaining very low emg signal could either be due to off - resonance movement artefacts or a low activity of motor unit action potentials . as there is no means to clarify this , emg signals were not further analysed . typical records of smo2 and thb during and after 3 min of vibration ( 25 hz ) are shown in fig . this time course was observed stereotypically in all experiments , with the onset of vibration always resulting in an increase in smo2 and a rapid drop of thb . ( mean sd ) followed by a decline and a steady period which lasted till the end of vibration . after vibration , both smo2 and thb slowly recovered back to baseline within 3 min . this general pattern of the smo2 and thb responses to vibration was observed in all subjects .1 ) were selected and the corresponding values for both smo2 and thb were statistically evaluated . the magnitude of the effects neither depends on the vibration frequency ( 15 , 25 hz ) , nor on the addition or absence of an ankle rotation by the two foot positions on the vibration plate , nor on the order of the applied stimuli ( all p values 0.1 , also see table 2 ) . since for smo2 and thb no group effect was significant , data from both vibration frequencies and both foot positions were pooled for further analysis.fig .2 example of typical records of smo2 and thb in the medial gastrocnemius muscle during and after vibration . the foot was placed parallel to the axis of the platform and was therefore lifted without rotation in the ankle . the numbers and arrows indicate the time points selected for the statistical evaluation of smo2 and thb , respectively ( compare fig .3 ) ; 1 last data point at rest , 22.5 s vibration , 3 maximum smo2 , 4 steady state of smo2 , 5180 s vibration , 62.5 s recovery , 730 s recovery , 8180 s recoverytable 2 p values of group effects from repeated measure anova on the time courses of smo2 and thb in the medial gastrocnemius muscle during and after the application of vibrationgroup p values for smo2 p values for thbfrequency order0 .7130.933 frequency0 .3570.882 foot placement0 .1050.551 twelve subjects were examined . group effects were the order of the applied vibration frequency ( 15 hz first or 25 hz first ) , the frequency ( 15 or 25 hz ) , and the placement of the foot on the vibration platform resulting in lifting of the whole foot or a small rotation in the ankle . the selection of time points used in the repeated measure anova is shown in fig . 1 . therefore , all groups were pooled for further analysis example of typical records of smo2 and thb in the medial gastrocnemius muscle during and after vibration . in this example , the vibration frequency was 25 hz . the foot was placed parallel to the axis of the platform and was therefore lifted without rotation in the ankle . the numbers and arrows indicate the time points selected for the statistical evaluation of smo2 and thb , respectively ( compare fig .3 ) ; 1 last data point at rest , 22.5 s vibration , 3 maximum smo2 , 4 steady state of smo2 , 5180 s vibration , 62.5 s recovery , 730 s recovery , 8180 s recovery p values of group effects from repeated measure anova on the time courses of smo2 and thb in the medial gastrocnemius muscle during and after the application of vibration twelve subjects were examined . group effects were the order of the applied vibration frequency ( 15 hz first or 25 hz first ) , the frequency ( 15 or 25 hz ) , and the placement of the foot on the vibration platform resulting in lifting of the whole foot or a small rotation in the ankle . the selection of time points used in the repeated measure anova is shown in fig . 1 . therefore , all groups were pooled for further analysis on average smo2 increased from 551 % to a maximum of 661 % . smo2 slowly decreased until it reached a steady state at 621 % after approximately 1.5 min of vibration . during recoveryin parallel thb decreased from 534 mol / l at baseline to 372 mol / l when smo2 had reached its maximum . this value almost remained on the same level until the termination of the vibration stimulus . duringrecovery thb returned to baseline in a slow exponential - like time course ( see fig .3 mean values ( se , n = 12 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after the application of vibration ( compare fig . 2 ) . data were pooled from experiments using 15 and 25 hz and two foot positions . vibration significantly affected both smo2 and thb ( p 0.01 , repeated measure anova ; * * p 0.01 , tukey s post hoc test ) . both smo2 and thb returned to baseline after 180 s recovery mean values ( se , n = 12 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after the application of vibration ( compare fig . 2 ) . data were pooled from experiments using 15 and 25 hz and two foot positions . vibration significantly affected both smo2 and thb ( p 0.01 , repeated measure anova ; * * p 0.01 , tukey s post hoc test ) . both smo2 and thb returned to baseline after 180 s recovery initial values of thb were lower in the contraction experiment than in the vibration experiment . this difference was obviously caused by the different posture of the lower leg due to knee extension . smo2 started at comparable levels in both experiments ( compare figs . 3 , 4 ) . fig .4 mean values ( se , n = 8 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after an isometric contraction at levels between 5 and 40 % of mvc . for both smo2 and thb only at 20 and 40 % mvc repeated measure anova indicated significant effects of contraction with respect to initial rest ( * p 0.05 , * * p 0.01 , tukey s post hoc test ) mean values ( se , n = 8 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after an isometric contraction at levels between 5 and 40 % of mvc . for both smo2 and thb only at 20 and 40 % mvc repeated measure anova indicated significant effects of contraction with respect to initial rest ( * p 0.05 , * * p 0.01 , tukey s post hoc test ) as expected , the effects of isometric contraction on smo2 and thb depended on the torque of muscle contraction ( see fig . 4 ) . contractions at 5 % mvc did neither affect smo2 nor thb . contractions at 10 % mvc resulted in moderate decreases of smo2 and thb which , however , did not reach significance . smo2 significantly decreased during 20 % mvc ( 581395 % ) and 40 % mvc ( 571185 % ) . after contraction , smo2 rapidly recovered with 30 s and showed an overshoot in response to the 40 % mvc contraction . thb also decreased during 20 % mvc ( 404373mol / l ) and 40 % mvc ( 414333thb recovered until the first point of measurement ( 2.5 s ) and showed an overshoot in response to the both contraction levels . at both foot positions and at both vibration frequencies lower leg muscles did not visibly contract in response to vibration . the emg records showed a dominant , rhythmic signal in the frequency of the corresponding vibration frequency . after transferring intervals of 1,024 ms ( 1,024 data points ) into the frequency domain using spectral analysis , the vibration frequency and three harmonic frequencies were cut out with a band width of 5 hz . the remaining very low emg signal could either be due to off - resonance movement artefacts or a low activity of motor unit action potentials . as there is no means to clarify this , emg signals were not further analysed . typical records of smo2 and thb during and after 3 min of vibration ( 25 hz ) are shown in fig . this time course was observed stereotypically in all experiments , with the onset of vibration always resulting in an increase in smo2 and a rapid drop of thb . ( mean sd ) followed by a decline and a steady period which lasted till the end of vibration . after vibration , both smo2 and thb slowly recovered back to baseline within 3 min . this general pattern of the smo2 and thb responses to vibration was observed in all subjects .1 ) were selected and the corresponding values for both smo2 and thb were statistically evaluated . the magnitude of the effects neither depends on the vibration frequency ( 15 , 25 hz ) , nor on the addition or absence of an ankle rotation by the two foot positions on the vibration plate , nor on the order of the applied stimuli ( all p values 0.1 , also see table 2 ) . since for smo2 and thb no group effect was significant , data from both vibration frequencies and both foot positions were pooled for further analysis.fig .2 example of typical records of smo2 and thb in the medial gastrocnemius muscle during and after vibration . the foot was placed parallel to the axis of the platform and was therefore lifted without rotation in the ankle . the numbers and arrows indicate the time points selected for the statistical evaluation of smo2 and thb , respectively ( compare fig .3 ) ; 1 last data point at rest , 22.5 s vibration , 3 maximum smo2 , 4 steady state of smo2 , 5180 s vibration , 62.5 s recovery , 730 s recovery , 8180 s recoverytable 2 p values of group effects from repeated measure anova on the time courses of smo2 and thb in the medial gastrocnemius muscle during and after the application of vibrationgroup p values for smo2 p values for thbfrequency order0 .7130.933 frequency0 .3570.882 foot placement0 .1050.551 twelve subjects were examined . group effects were the order of the applied vibration frequency ( 15 hz first or 25 hz first ) , the frequency ( 15 or 25 hz ) , and the placement of the foot on the vibration platform resulting in lifting of the whole foot or a small rotation in the ankle . the selection of time points used in the repeated measure anova is shown in fig . 1 . therefore , all groups were pooled for further analysis example of typical records of smo2 and thb in the medial gastrocnemius muscle during and after vibration . in this example , the vibration frequency was 25 hz . the foot was placed parallel to the axis of the platform and was therefore lifted without rotation in the ankle . the numbers and arrows indicate the time points selected for the statistical evaluation of smo2 and thb , respectively ( compare fig .3 ) ; 1 last data point at rest , 22.5 s vibration , 3 maximum smo2 , 4 steady state of smo2 , 5180 s vibration , 62.5 s recovery , 730 s recovery , 8180 s recovery p values of group effects from repeated measure anova on the time courses of smo2 and thb in the medial gastrocnemius muscle during and after the application of vibration twelve subjects were examined . group effects were the order of the applied vibration frequency ( 15 hz first or 25 hz first ) , the frequency ( 15 or 25 hz ) , and the placement of the foot on the vibration platform resulting in lifting of the whole foot or a small rotation in the ankle . the selection of time points used in the repeated measure anova is shown in fig . 1 . therefore , all groups were pooled for further analysis on average smo2 increased from 551 % to a maximum of 661 % . smo2 slowly decreased until it reached a steady state at 621 % after approximately 1.5 min of vibration . during recoveryin parallel thb decreased from 534 mol / l at baseline to 372 mol / l when smo2 had reached its maximum . this value almost remained on the same level until the termination of the vibration stimulus . duringrecovery thb returned to baseline in a slow exponential - like time course ( see fig . n = 12 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after the application of vibration ( compare fig . 2 ) . data were pooled from experiments using 15 and 25 hz and two foot positions . vibration significantly affected both smo2 and thb ( p 0.01 , repeated measure anova ; * * p 0.01 , tukey s post hoc test ) . both smo2 and thb returned to baseline after 180 s recovery mean values ( se , n = 12 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after the application of vibration ( compare fig . 2 ) . data were pooled from experiments using 15 and 25 hz and two foot positions . vibration significantly affected both smo2 and thb ( p 0.01 , repeated measure anova ; * * p 0.01 , tukey s post hoc test ) . both smo2 and thb returned to baseline after 180 s recoveryinitial values of thb were lower in the contraction experiment than in the vibration experiment . this difference was obviously caused by the different posture of the lower leg due to knee extension . smo2 started at comparable levels in both experiments ( compare figs . 3 , 4 ) . fig .4 mean values ( se , n = 8 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after an isometric contraction at levels between 5 and 40 % of mvc . for both smo2 and thb only at 20 and 40 % mvc repeated measure anova indicated significant effects of contraction with respect to initial rest ( * p 0.05 , * * p 0.01 , tukey s post hoc test ) mean values ( se , n = 8 ) of smo2 and thb in the medial gastrocnemius muscle at baseline and selected time points during and after an isometric contraction at levels between 5 and 40 % of mvc . for both smo2 and thb only at 20 and 40 % mvc repeated measure anova indicated significant effects of contraction with respect to initial rest ( * p 0.05 , * * p 0.01 , tukey s post hoc test ) as expected , the effects of isometric contraction on smo2 and thb depended on the torque of muscle contraction ( see fig . 4 ) . contractions at 5 % mvc did neither affect smo2 nor thb . contractions at 10 % mvc resulted in moderate decreases of smo2 and thb which , however , did not reach significance . smo2 significantly decreased during 20 % mvc ( 581395 % ) and 40 % mvc ( 571185 % ) . after contraction , smo2 rapidly recovered with 30 s and showed an overshoot in response to the 40 % mvc contraction . thb also decreased during 20 % mvc ( 404373mol / l ) and 40 % mvc ( 414333thb recovered until the first point of measurement ( 2.5 s ) and showed an overshoot in response to the both contraction levels . in the belly region of the voluntarily relaxed gastrocnemius medialis muscle the vibration of the whole lower leg resulted in a rapid decrease in thb and an increase of smo2 reaching a maximum after 30 s. the rapid decrease in thb strongly suggests a reduction of the total blood content , and the increase in smo2 indicates that more non - oxygenated than oxygenated blood is extruded . taken together , this could well be explained by a blood extrusion from the venules . the maximum in smo2 was followed by a transient decrease to a new steady state significantly higher than baseline . after vibration , thb and smo2 slowly returned back to baseline within 3 min . time course and magnitude of the vibration effect were neither affected by the two vibration frequencies ( 15 , 25 hz ) nor by mode of vibration induction with small foot tilting in the pronation supination or plantar flexionthe decrease in thb and the increase in smo2 caused by a wbv - like stimulus on the unloaded gastrocnemius muscle match with the previous findings when wbv was applied on subjects in shallow squat standing position ( rittweger et al .2010 ) . however , in standing position these initial effects of wbv were smaller than in the unloaded muscle . the later changes in thb and smo2 during vibration observed in standing subjects were very variable and probably caused by irregular calf muscle contractions to stabilise stance during wbv . in so far the effects of wbv in standing posture differ to a large extent from the stereotypic time courses of wbv effects in completely unloaded muscles in our study . even bigger are the differences between the effects of wbv on the unloaded calf muscle observed here and the effects of wbv on thigh muscles during resistive squatting exercise which was causing a steeper decrease in smo2 indicating a greater oxygen extraction than during mere squatting exercise ( yamada et al . 2005 ) . principally , driving forces for the initial extrusion of venous blood by the wbv - like stimulus on the unloaded calf muscle could result from extravascular pressure by a reflex muscle contraction or by forces induced by passive motions between muscle and vessels . it is well established that wbv added to resistive exercise causes an excess emg activation ( cardinale and lim 2003 ; ritzmann et al .2013 ) and energy turnover ( rittweger et al . 2001 ; zange et al . 2009 ) . however , the wbv - like vibration of the unloaded lower leg failed to induce a remarkable reflex reaction in the calf muscle .2007 ) , the emg record showed rhythmic artefacts in the corresponding vibration frequency and its harmonics . in our experiments on voluntary relaxed musclesthis artefact signal was so dominant that any further analysis of the emg signal after filtering was not feasible for technical reasons . in our experiment the foot was placed in two directions on the platform where the whole lower leg was vibrated either by lifting the leg or by causing a small tilt in the ankle . we expected that a potential reflex contraction of the gastrocnemius would be more likely caused when the ankle was tilted . furthermore a vibration reflex contraction should be stronger at 25 hz than at 15 hz . however , the extrusion of venous blood from the muscle was independent from both the foot position and the frequency which gave further evidence that the initial blood extrusion by vibration was not caused by a reflex contraction . nevertheless , in our experiment the observation of a very weak muscle contraction by the vibration stimulus could be hampered by the motion of the leg , the very strong sensation of vibration by the subjects , or the emg artefact . therefore , we compared the effects of vibration on thb and smo2 with the corresponding effects of voluntary isometric contraction . the lowest contraction level that could be controlled by the subjects was 5 % mvc . this very low contraction level did not cause any mean reactions of thb and smo2 . the higher force levels of 10 , 20 , and 40 % mvc resulted in the expected pattern of a decrease in thb and decrease in smo2 caused by a functional muscle ischaemia and increasing oxygen consumption both increasing in significance with increasing force levels . the reaction pattern to vibration , i.e. an increase in smo2 followed by a decrease to a steady state higher than baseline , respectively , was not observed at any tested level of voluntary contraction . taking the evidence together , namely ( 1 ) the lack of any visible , sensible or emg - based muscle activity , ( 2 ) the lack of any different effects of 15 and 25 hz and any effect of ankle - tilt involvement , and ( 3 ) the different effects of voluntary isometric contraction on thb and smo2 during and after contraction we propose that the clear - cut responses of thb and smo2 to vibration on the unloaded lower leg were independent from muscle contraction . we therefore propose a direct mechanical action of vibration accelerating partially deoxygenated blood out of the small and nirs visible venules into larger veins totally absorbing near infrared light . the unknown mechanisms which transfer the oscillating acceleration into a directed force probably utilise the direction of blood flow and an involvement of venous valves . recoveries of thb and smo2 after vibration were very slow and did not follow the pattern of a reactive hyperaemia that was observed , e.g. after an isometric contraction at 40 % mvc ( see fig . when applied to a relaxed muscle , vibration did not result in dilatation of resistive arteries . during muscle exercise the control of blood flow by the vascular tone is generally determined by metabolic factors which predominantly depend on the balance of oxygen supply and the oxygen demand of the working muscle ( casey and joyner 2011 ) . besides this , also minor involvement of mechanical stimuli on the mechanisms controlling arterial vasodilatation in muscle is discussed like the atp release from red blood cells by deformation or the no release from endothelia cells by shear stress ( sarelius and pohl 2010 ) . wbv is a strong mechanical stimulus for the whole muscle tissue that force the muscle to deal with kinetic energy which is determined by both frequency and amplitude ( rittweger 2010 ) . our results show that mechanical forces , at least when applied by vibration , did not induce vasodilation of resistive arteries in the m. gastrocnemius medialis . moreover , during vibration the transient decrease of smo2 after the maximum and the parallel small increase in thb could be interpreted as a moderate vasoconstriction as an autonomic response of the subjects to the uncomfortable sensation of the vibration of the lower leg . such a vasoconstriction would have forced a higher oxygen extraction from the blood that would match with the observation of the decrease of smo2 to a new steady state in our experiments . the absence of a vasodilation in the unloaded calf muscle stimulated by a wbv like stimulus seems to be in contrast with the frequency - depending reactive hyperaemia that was found in response to the combination of wbv with resistive exercise ( fuller et al . 2013 ; kerschan - schindl et al . 2001 ) . as previously mentioned , in the combination of wbv and resistive exercise , wbv additionally activates the muscle ( cardinale and lim 2003 ; ritzmann et al .2013 ) , increases muscle energy turnover ( rittweger et al . 2002 ; zange et al .2009 ) , causes a rise in muscle temperature by the conversion of vibration energy into heat ( cochrane et al . since wbv applied to the unloaded muscle did not cause a vasodilation when wbv seems to cause an exclusive mechanical stimulus , we conclude that wbv added to resistive working muscle also does not act via mechanically triggered pathways . instead , wbv added to resistive exercise likely induces vasodilation exclusively by factors related to the enhanced muscle hypoxia or heating caused by this combination of exercise modes ( cochrane et al . in conclusion , our study on the medial gastrocnemius muscles showed that vibration applied to the unloaded , relaxed lower leg induces alterations in the content of oxygenated and deoxygenated blood in the belly region of the muscle that could clearly be interpreted as an extrusion of partially desoxygenated blood from the small veins . we could not find any evidence for a reflex contraction in response to the wbv in the unloaded muscle . we therefore propose a direct vibration - depending mechanism for the initial extrusion of blood from the muscle . furthermore , vibration when separated from any further voluntary active or resistive muscle contraction did not result in post - vibration hyperaemia by vasodilation . since such a strong and permanent mechanical stimulus applied in the absence of hypoxia did not reduce vascular tone in the gastrocnemius muscle , one could conclude that generally in this muscle mechanical stimuli seemingly do not activate signal pathways controlling vasodilation in response to exercise .\noutput:\n" }, { "from": "agent", "value": "purposeduring vibration of the whole unloaded lower leg , effects on capillary blood content and blood oxygenation were measured in the calf muscle . the hypotheses predicted extrusion of venous blood by a tonic reflex contraction and that reactive hyperaemia could be observed after vibration.methodstwelve male subjects sat in front of a vibration platform with their right foot affixed to the platform . in four intervals of 3 - min duration vibration was applied with a peak - to - peak displacement of 5 mm at frequencies 15 or 25 hz , and two foot positions , respectively . near infrared spectroscopy was used for measuring haemoglobin oxygen saturation ( smo2 ) and the concentration of total haemoglobin ( thb ) in the medial gastrocnemius muscle.resultswithin 30 s of vibration smo2 increased from 55 1 to 66 1 % ( mean se ) . within 1.5 min afterwards smo2 decreased to a steady state ( 62 1 % ) . during the following 3 min of recovery smo2 slowly decreased back to base line . thb decreased within the first 30 s of vibration , remained almost constant until the end of vibration , and slowly recovered to baseline afterwards . no significant differences were found for the two vibration frequencies and the two foot positions.conclusionsthe relaxed and unloaded calf muscles did not respond to vibration with a remarkable reflex contraction . the acceleration by vibration apparently ejected capillary venous blood from the muscle . subsequent recovery did not match with a reactive hyperaemia indicating that the mere mechanical stress did not cause vasodilation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: expressing a protein by delivering the encoding mrna has many benefits over methods that use plasmid dna or viral vectors . during mrna transfection , the coding sequence of the desired protein is the only substance delivered to cells , thus avoiding all the side effects associated with plasmid backbones , viral genes , and viral proteins . also , the cell - delivered mrna can be instantly translated even in axon terminals located remotely from the nucleus , because mrna only requires protein synthesis machinery , which is ubiquitous throughout the cell cytoplasm . more importantly , unlike dna - and viral - based vectors , the mrna does not carry the risk of being incorporated into the genome . considering these benefits , it is surprising that mrna - based transfection has not become a more common procedure to overexpress therapeutic proteins in vivo . in 1992 , bloom and colleagues successfully rescued vasopressin - deficient rats by injecting in vitro - transcribed vasopressin mrna into the hypothalamus . this represents the first and , until 2011 , the only study where in vitro - transcribed mrna is used for gene replacement in vivo . for many years , immunization with mrna coding for cancer antigens has been the only field of application where direct injection of in vitro transcripts was successfully used , even reaching clinical trials . for this application , the low levels of translation and the immunogenicity of the mrna were not limiting factors , but those two characteristics greatly restricted the exploitation of mrna for many other in vivo and ex vivo applications . as we and others have shown , in vitro transcribed rna is immunogenic , activating cell surface , endosomal , and cytoplasmic rna sensors , including toll - like receptor ( tlr ) 3 , tlr7 , tlr8 , retinoic acid - inducible gene i ( rig - i ) , rna - dependent protein kinase ( pkr ) , and the 2 -5-oligoadenylate synthetase / rnase l axishowever , when modified nucleosides , such as pseudouridine , were incorporated into the rna , it no longer activated tlr7 , tlr8 , rig - i , pkr , and 2 -5-oligoadenylate synthetase . more importantly , pseudouridine - containing mrna ( - mrna ) was not only translatable , but higher amounts of protein were produced compared to uridine - containing mrna ( u - mrna ) . this was partly due to increased resistance of - mrna to rnase l - mediated cleavage and a lack of pkr activation . recently , kormann et al . reported a successful in vivo use of modified nucleoside - containing mrnas to express therapeutic proteins in mice . incorporation of both 5 - methylcytidine and 2 - thiouridine into the mrnas was critical for this accomplishment , since those reduced , although did not completely eliminate , immune activation . we achieved robust improvement in the translational capacity of - mrna through high - performance liquid chromatography ( hplc ) purification , which also completely eliminated immunogenicity when tested in vitro . therefore , we were interested in testing the performance of these newly perfected mrnas in vivo . we selected erythropoietin ( epo ) - encoding mrnas for our evaluation , since detecting the effect of epo on red blood cell production , by measuring reticulocyte levels and the hematocrit from whole blood , is straightforward and well - established . using hplc - purified epo - encoding - mrna complexed with transit - mrna ( transit ) , a nonliposomal cationic polymer / lipid formulation , we demonstrate that injection of submicrogram amounts into mice is sufficient to significantly increase the levels of reticulocytes and the hematocrit without an induction of circulating proinflammatory cytokines [ interferon - ( ifn - ) , tumor necrosis factor - ( tnf - ) , and interleukin - 6 ( il - 6 ) ] . the presence of pseudouridine in the mrna was critical , since hplc - purified epo u - mrna induced ifn - and had no significant effect on erythropoiesis . extension of these preliminary studies into rhesus macaques similarly demonstrated the ability of systemically administered epo - encoding - mrna complexed with transit to produce significant amounts of circulating epo without inducing proinflammatory cytokines . these results demonstrate that hplc - purified , pseudouridine - containing mrnas encoding therapeutic proteins have great potential for clinical applications . to identify the optimal murine epo mrna for use in vivo , we generated sets of mrnas and tested their translational capacity in human dendritic cells ( dcs ) . dcs efficiently translate exogenously delivered mrna and express all known rna sensors , such as tlr3 , tlr7 , tlr8 , rig - i , mda - 5 , and pkr . the mrnas were hplc purified and contained the 5 - utr derived from the tobacco etch virus 5 leader rna , 3 - utr of xenopus - globin mrna , an enzymatically - generated cap1 structure , and a plasmid - encoded 51 nt - long poly ( a ) tail , which was extended to ~ 200 nt - long using poly ( a ) polymerase . the codon - optimized epo mrnas contained hybrids of au - and gc - rich codons that have been reported to increase translation of human epo mrna . indeed , the highest level of translation and a complete lack of proinflammatory cytokine secretion were achieved from pseudouridine - containing mrna that was codon - optimized ( figure 1 and data not shown ) ; therefore , we used this mrna for subsequent in vivo analysis . for simplicity , we labeled this rna as epo - mrna and the corresponding control mrna that contained uridine as epo u - mrna . to determine if epo mrna administered in vivo can elevate blood epo levels , adult mice were intraperitoneally ( i.p . ) injected with epo mrna ( 0.1 g ) complexed with transit . a sharp increase in serum epo levelswere measured , reaching a maximum at 6 hours postinjection ( figure 2a ) . remarkably , epo levels remained elevated up to 4 days after epo - mrna administration , while epo u - mrna resulted in much lower epo levels that returned to pre - injection baseline levels by day 2 . the injection of 3 - g recombinant murine epo could not be detected beyond 6 hours postinjection , suggesting a rapid half - life , in agreement with studies that found a half - life for exogenously delivered epo in mice of about 2 hours . therefore , the high epo levels we detected up to 4 days following a single injection are best explained by sustained translation of epo - mrna . when tenfold more ( 1.0 g ) epo - mrna complexed with transit was injected , a proportional tenfold higher epo level was detected in the blood ( data not shown ) . to determine if the injected epo mrna produces functional epo protein , we counted reticulocytes in the treated animals . reticulocytes are circulating immature red blood cells and their blood level is proportional to the rate of new red blood cell formation . in a dose escalation experiment , we gave epo - mrna ( 0.00110 g ) complexed with transit to groups of mice and monitored blood reticulocyte levels . significant increases in the levels of reticulocytes were measured as early as day 3 postinjection , reached a maximum at day 5 , remained elevated at day 7 , and declined to baseline ( ~ 5 % ) by day 10 ( figure 2b ) . using human epo protein , which is functional in mice , as a comparison , the reticulocyte level returned to baseline by day 7 ( figure 2b ) . there was a dose - dependent relationship between the amount of - mrna injected , up to 1 g , and the increase in circulating reticulocytes . it is remarkable that 0.001 g epo - mrna was as potent as 1 g of epo u - mrna in increasing reticulocyte counts ( figure 2b ) . it is worth mentioning that both subcutaneously and intramuscularly injected epo - mrna also raised reticulocyte counts significantly ( data not shown ) , although not as potently as the i.p . - delivered mrna . we found no elevation of reticulocyte counts at any time point when luciferase - encoding - mrna complexed with transit was injected ( figure 2b ) , demonstrating that the effects were not due to - mrna injection but to functional epo translation from the exogenous epo - mrna ( figure 2b ) . since ~ 1 g epo - mrna produced a maximal effect , elevating the reticulocyte counts from a pre - injection level of 5 % to 20 % 5 days after injection , we used 1 g mrna to determine the physiological impact of epo - mrna on the hematocrit . injection of transit - complexed epo - mrna led to a significant increase in the hematocrit as early as 3 days after injection and reached maximum at day 6 . injection of 1 g of epo u - mrna or luc - mrna did not result in a significant elevation of the hematocrit at any time point ( figure 2c ) , thus demonstrating pseudouridine incorporation is critical for efficient translation . we also found that an elevated hematocrit could be maintained with weekly injections of 0.1 g epo - mrna complexed to transit . the preinjection hematocrit was raised , from 43.21.5 % up to 57.71.1 % , and maintained during the 5 - week course of treatment ( figure 2d ) . certain formulations of epo protein given to humans and epo gene therapy given to macaques have resulted in serious autoimmune reactions directed at epo . serum from mice that received 5 weekly injections of transit - complexed epo - mrna were analyzed for the presence of antibodies that bound to murine epo protein in a sandwich enzyme - linked immunosorbent assay ( elisa ) and none were detected . the assay could detect as little as 0.1 ng / ml of anti - epo antibody in plasma . we recently demonstrated that mrna complexed with transit does not induce ifn - secretion from transfected human dcs , as long as the rna contains pseudouridine and is purified by hplc . it was therefore important for us to determine whether or not epo - mrna remains nonimmunogenic in vivo . we injected mice with transit - complexed epo - mrna or epo u - mrna ( 1 g ) i.p . and measured serum ifn - , tnf - and il - 6 levels at 6 hours postinjection . while the uridine - containing epo mrna was highly immunogenic , resulting in robust induction of ifn - measured from plasma , ifn - was not induced in mice injected with epo - mrna ( figure 2e ) . the levels of tnf - and il - 6 in the plasma of epo - mrna and epo u - mrna injected mice were at background levels ( data not shown ) . in a pilot study , we delivered a single injection of transit - complexed rhesus epo - encoding - mrna ( rhepo - mrna ) to macaques and measured circulating epo levels . the i.p . injected rhepo - mrna elevated the levels of plasma epo with kinetics similar to those observed in mice ( figure 3 ) . no increase in the levels of serum type i ifns , tnf - , and il - 6 were detected after any dose of rhepo - mrna measured at 648 hours postinjection ( data not shown ) . our study demonstrates the feasibility of using in vitro transcribed mrna to express therapeutic proteins in vivo . as a model system , we used epo - mediated induction of erythropoiesis to show the efficacy of mrna - based therapy . we demonstrate in mice that a single dose of 0.1 g epo - encoding mrna complexed with transit is sufficient to increase blood epo levels as early as 6 hours postinjection and high levels are maintained for 4 days . we also demonstrate that the injected transit - complexed mrna does not induce adverse side - effects or detectable increases in circulating proinflammatory cytokines . these remarkable features were achieved by a combination of incorporating pseudouridine into the mrna and purifying by hplc . in our previous studies , we demonstrated that - mrna possesses superior translational properties . the mechanisms underlying its enhanced translational quality include : ( i ) diminished pkr activation , thereby reducing translational inhibition , ( ii ) a stabilizing effect on the rna by increasing resistance to rnase l - mediated cleavage , and ( iii ) a lack of 2 -5-oligoadenylate synthetase activation and ribosomal rna cleavage , thus avoiding a global reduction in translation . we also demonstrated that pseudouridine , similar to other modified nucleosides , reduced rna - elicited innate immune responses . recently , we further improved the quality of pseudouridine - containing rna with hplc purification . we found that hplc removed double - stranded rna and other contaminants from the in vitro - transcribed rna , thereby maximizing its translational efficiency , as well as eliminating any residual immunogenicity . in this report , we demonstrate that hplc - purified , pseudouridine - containing rna complexed with transit , possessing very high translational capacity with no detectable immunogenicity , is not only effective in vivo but requires doses that will allow pharmacological development . despite much progress in the field , the immune activation caused by viral and plasmid vectors remains one of the primary reasons for failure in human gene therapy trials . examples of both include , respectively ; induction of anti - epo antibodies and severe autoimmune anemia when epo - expressing viral vectors were used in monkeys , and patients treated with an altered formulation of recombinant epo protein developed anti - epo neutralizing antibodies and transfusion - dependent anemia . thus , avoiding an immune reaction is essential for effective protein replacement , regardless if it is performed by directly supplying the protein or via an encoding vector . using nucleoside - modified mrna coding for the therapeutic protein seems the optimal choice . recently used nucleoside - modified mrna in vivo , and the innate immune reaction to the injected mrna was limited but not completely abolished . their mrna construct still induced cytokine production , although at a lower level than unmodified mrna . the residual immune activation was likely caused by transcription - related aberrant rna contaminants ; however , those contaminants , as we have found , are removable by hplc - purification , thus making the nucleoside - modified mrna nonimmunogenic ( figure 2e ) . mammalian codons usually have g or c in their third degenerative position , and such sequences are expressed more efficiently than those in which the codons end with a or t. high expression levels of human epo were reported using a chimeric construct in which the n - terminal part of epo was coded by sequences enriched in at - ending codons , whereas the remaining part of epo was coded by gc - ending codons . in the present study , we adopted this codon - optimization strategy for our murine epo . typically , codon optimizations are performed by comparing protein production from dna plasmids carrying the wild - type sequence to the optimized sequence . in this setting , it is difficult to sort out if the increased protein expression from the codon - optimized construct is caused by enhanced transcription , increased rna stability , or augmented translation . however , one study compared translation of cell - delivered wild - type and codon - optimized rnas directly and , similar to our results with the - mrnas ( figure 1 ) , found an increase in protein production from the codon - optimized mrna . as an extension to our analysis in mice , we were able to perform a short pilot study in rhesus macaques . hplc - purified transit - complexed - mrna encoding rhesus epo was delivered i.p . at doses similar to those we used in mice , and we observed a substantial increase in circulating epo . due to limitations , including cost , time constraints , and the small cohort of macaques , we were unable to perform experiments where the hematological responses to epo induction could have been measured . regardless , and more importantly , no adverse effects were observed and no increase in levels of ifn - , tnf - , and il - 6 were found . future studies are needed to optimize both the route of delivery and the formulation of complexing agent for primate studies . an initial evaluation in the macaques using subcutaneous injection , which is the preferred therapeutic route , found levels of circulating epo at 48 hours that were similar to those measured at 24 hours , suggesting prolonged production and release . mrna therapy could be a promising approach for expressing proteins and the treatment of inherited genetic disorders . at present , extracellular proteins that are administered to patients , including type i ifns , monoclonal antibodies , and adenosine deaminase , can successfully treat their conditions . however , delivering or replacing an intracellular protein requires alternative approaches , such as gene therapy . hplc - purified , pseudouridine - modified mrna offers a new approach to the therapeutic expression of both extra - and intracellular proteins . it avoids the two major adverse events found clinically with other gene therapy approaches , vector immunogenicity , and chromosomal integration . a limitation of mrna delivery compared with integrative gene transfer is the transient duration of protein expression . however , there are many pathological disorders that can be treated with transient expression of therapeutic proteins . in addition , unless an integrative gene therapy approach targets the stem cells of interest , it will need to be repeated at a duration associated with the half - life of the cells being targeted . mrna therapy has the added benefits that the dosing is scalable and the treatment stops when the rna and the encoded protein degrade . adapting mrna delivery to therapeutics will require continued improvement in mrna translational capacity , safe and efficient techniques to deliver mrna to specific cells or tissues , a better understanding of the molecular mechanisms mediating mrna uptake , and optimization of the large - scale production of mrna for clinical use . all experiments were carried out with the approval of the institutional animal care and use committee ( iacuc ) of the university of pennsylvania . balb / c female mice from jackson laboratory ( bar harbor , me ) , aged 612 weeks , were used . they are accredited by the association for assessment and accreditation of laboratory animal care international ( aaalac ) and meet national institutes of health standards as described in the guide for the care and use of laboratory animals . mrnas were transcribed as previously described , using linearized plasmids encoding wild - type and codon - optimized murine epo ( ptevwtepo and ptevoptepo ) , firefly luciferase ( ptevluc ) , and rhesus macaque epo ( ptevrhepo ) . the rhesus epo and codon - optimized mouse epo genes were synthesized by entelechon ( bad abbach , germany ) . codons for the mouse epo gene were selected based on entelechon 's proprietary algorithm and codon - optimized human epo . the megascript t7 rna polymerase kit ( ambion , austin , tx ) was used for transcription , and utp was replaced with pseudouridine triphosphate ( trilink , san diego , ca ) to generate pseudouridine - containing mrna . additional poly ( a ) tail was added in a 3 - hour incubation with yeast poly ( a ) polymerase ( usb , cleveland oh ) . to obtain cap1 , rna was processed using the m7 g capping and 2 - o - methyltransferase kits ( cellscript , madison , wi ) . rna was complexed to transit - mrna ( mirus bio , madison , wi ) according to the manufacturer . a ratio of mrna ( 0.1 g ) , transit - mrna reagent ( 0.11 l ) , and boost reagent ( 0.07 l ) in a final volume of 10 l dulbecco 's modified eagle 's medium was used . for complexing different amounts of mrna the volumes of the reagents and the final volumeblood , 25 l , was drawn from the tail vein before treatments to establish baseline parameters . the mrna and epo proteins were injected into the peritoneal cavity with a 27 - gauge needle using standard technique . translational levels of wild - type and codon - optimized epo mrnas were measured in human dcs . cells were seeded into 96 - well plates ( 1.510 cells / well ) in 190 l of complete medium and transfected by adding 0.1 g mrna complexed with transit in a 10 - l final volume . mouse epo levels were measured in the culture medium 24 hours post - transfection using a mouse epo elisa kit ( r & d systems , minneapolis , mn ) . the same kit was used to measure epo levels in the plasma of animals ( 5 mice / group ) that were injected with either rna complexed with transit or with 3 g of recombinant mouse epo protein ( sigma - aldrich , st louis , mo ) . since blood was being drawn repeatedly , it was essential to minimize the volume so the sampling would not affect the hematological parameters of the animals . eighteen microliter of blood was mixed with 2 l edta ( 0.2 mol / l ) and placed into a 20 l drummond microcaps glass microcapillary tube ( sigma - aldrich ) . after sealing one end of the tubes with cha - seal ( chase scientific glass , rockwood , tn ) , the capillary tubes were centrifuged in iec mb microhematocrit centrifuge ( damon / iec division , needham , ma ) for 3 minutes at 14,000 rpm . capillary tubes were scanned ( scanmaker ; microtek , santa fe , ca ) and digital images of the tubes were imported into canvas x ( adb system , seattle , wa ) and the packed cell volume ratio was determined . after determining the hematocrit , capillary tubes were snapped and the plasma was collected for the measurement of plasma epo levels . reticulocyte counts . five microliter of blood drawn from the tail vein of balb / c mice ( 311 animals / group ) injected with transit - complexed mrna ( 0.00110 g ) or with 100 u of recombinant human epo ( epogen ; amgen , thousands oaks , ca ) was mixed with 0.5 l edta ( 0.2 mol / l ) and analyzed using retic - count , a thiazole orange reagent ( bd biosciences , san jose , ca ) , as recommended by the manufacturer . stained cells were analyzed on a facscalibur flow cytometer using cellquest software ( bd biosciences ) . values are expressed as the percentage of reticulocytes relative to total erythrocytes . measuring ifn - , balb / c mice injected with transit - complexed mrna ( 1 g ) were processed 6 hours later by injecting 100 l of heparin ( abraxis , schaumburg , il ) i.p . and sacrificed . elisa was used to measure the levels of ifn - ( r & d systems ) , tnf - and il - 6 ( cell sciences , sharon , ma ) in undiluted plasma . a sandwich elisa was used to measure the development of murine antibody responses to epo protein . plasma from mice injected weekly for 5 weeks with 0.1 g of epo or luc - mrna was diluted 1:10 in phosphate - buffered saline and added to murine epo protein coated plates . a positive control containing a rat anti - murine epo mab ( r & d systems ) spiked into normal mouse plasma was used . bound antibodies were detected with goat anti - mouse and rat ig antisera labeled with peroxidase . a concentration of 0.1 ng / ml of anti - epo antibody spiked into plasma - phosphate - buffered saline could be detected . two - to three - year - old rhesus macaques ( n = 4 ) were bled and injected with transit - complexed mrna i.p . using standard procedures . plasma for rhesus epo was analyzed undiluted in a human epo - specific elisa kit that crossreacts with rhesus epo ( r & d systems ) . rhesus - specific elisas were used to measure the levels of ifn - ( pbl interferon source , piscataway , nj ) , tnf - , and il - 6 ( cell sciences ) in undiluted plasma .\noutput:\n" }, { "from": "agent", "value": "advances in the optimization of in vitro - transcribed mrna are bringing mrna - mediated therapy closer to reality . in cultured cells , we recently achieved high levels of translation with high - performance liquid chromatography ( hplc ) - purified , in vitro - transcribed mrnas containing the modified nucleoside pseudouridine . importantly , pseudouridine rendered the mrna non - immunogenic . here , using erythropoietin ( epo ) - encoding mrna complexed with transit - mrna , we evaluated this new generation of mrna in vivo . a single injection of 100 ng ( 0.005 mg / kg ) mrna elevated serum epo levels in mice significantly by 6 hours and levels were maintained for 4 days . in comparison , mrna containing uridine produced 10100-fold lower levels of epo lasting only 1 day . epo translated from pseudouridine - mrna was functional and caused a significant increase of both reticulocyte counts and hematocrits . as little as 10 ng mrna doubled reticulocyte numbers . weekly injection of 100 ng of epo mrna was sufficient to increase the hematocrit from 43 to 57 % , which was maintained with continued treatment . even when a large amount of pseudouridine - mrna was injected , no inflammatory cytokines were detectable in plasma . using macaques , we could also detect significantly - increased serum epo levels following intraperitoneal injection of rhesus epo mrna . these results demonstrate that hplc - purified , pseudouridine - containing mrnas encoding therapeutic proteins have great potential for clinical applications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: many researchers have recently presented results of experiments on animals related to the mechanisms of learning and memory . some of these investigations concern the essence of the processes of data remembering and retrieval . for instance , akar et al . presented results that confirm the thesis that inhibition of nitric oxide synthetase disturbs emotional , visual , and olfactory memory in mice . there are increasing publications presenting the results of trails in animals of effectiveness of various substances and drugs on improvement of memory . in parallelthere are also reports on attempts to improve the effectiveness of memory capacity in humans , both through the use of medication and by use of special training method . animal experiments on memory have been performed specifically to increase the possibility of evaluating and improving human memory . both in animal experiments and in observations and studies on humans , the researchers use tests that assess memory capacity and eventual improvements of storage and data retrieval . to be able to transfer research findings from animal experiments to address problems of memory disorders in humans , it would be convenient to utilize , at least in part , memory tests , that are equivalent in both animal and human experiments since they deal with similar aspects of memory mechanisms . contemporary investigations on methods of assessment and improvement of memory are particularly important due to frequent memory impairments in old age , which is important for healthcare in an aging society . the quality of life in the elderly is especially affected by impairments in functioning of the working memory system ( wms ) . we performed a review of memory tests used by investigators engaged in experiments on animals as well as tests used by scientists engaged in research on humans , looking for methods that evaluate the basic equivalent mechanisms of data storing and processing . we also present a review focused on tests suitable for the assessment of working memory , which is essential for overall mental capacity . ciecko - michalska et al . evaluated impairments of memory among patients with liver cirrhosis and used the following tests : auditory verbal learning test ( avlt ) , letter and semantic fluency tests ( lf and sf ) , trail making test ( tmt ) , digit symbol test ( dst ) , block design test ( bdt ) , and mental rotation test ( mrt ) . utilized the automated neuro - psychological test battery ( fepsy ) to assess the memory and perceptual - motor skills of patients with chronic renal impairments . investigated whether dietary supplementation with soy - derived phosphatidylserine , a naturally occurring phospholipid , improves memory and adhd symptoms in children . they investigated 36 children with symptoms of adh aged 414 years , who had not previously received any drug treatment related to adhd , and a group of 17 children who received placebo . they examined short - term auditory memory and working memory using the digit span test of the wechsler intelligence scale for children . alvares - sabin et al . evaluated the effects on cognitive impairment of treatment using citicoline and tested 6 neurocognitive domains : attention and executive function , memory , language , spatial perception , motor speed , and temporal orientation . on the basis of the review of many articles , we noted that the action of the wms in humans is very often assessed by designation of neuropsychological tasks such as the wisconsin card sort task ( wcst ) , in which the subject sorts a stack of 128 cards into piles . the cards differ in the kind of presented shapes ( forms ) , number of these forms , and colors . the psychologist decides at a particular moment of testing which criterion should be used for sorting and the patient must figure it out . the psychologist saysonce the patient is sorting along the correct criterion , the tester adopts a new criterion . researchers use also often the sternberg item recognition paradigm ( sirp ) in humans in which a small group of items , called the positive set , , a single item is presented that may or may not have been shown before . no , indicating their recognition of the item . this procedure is repeated over several trials in which the number of items in the positive set is varied . subjects are asked to respond as fast as they can without making errors ( figure 1 ) . the essence of the recently proposed methods of memory training is using the basic mental activity enforced by sirp , which consists of a visual - to - code ( symbol ) switching . an overview of methods used in humans can also be found in well - known textbooks . the search for equivalent animal / human memory tests should be facilitated by a schema of contemporary distinguished domains of mental abilities . strauss et al . , in a well - known textbook , enumerated the following types of tests : general cognitive functioning , neuropsychological batteries and assessment of premorbid intelligence , achievement tests , executive function , attention , memory , language tests , test of visual perception , tests of somatosensory function , olfactory function and body orientation , test of motor function , assessment of mood , personality and adaptive function , and test of response bias and suboptimal performance in their textbook , strauss et al . list memory tests using the following methods : autobiographical memory interview ( ami ) , benton visual retention test ( bvrt ) , brief visuospatial memory test ( bvmt ) , brown - peterson task , buschke selective reminding test ( srt ) , california verbal learning test ( cvlt ) , children s memory scale ( cms ) , doors and people test ( dpt ) , hopkins verbal learning test ( rmt ) , recognition memory test ( rmt ) , rey - osterrieth auditory verbal learning test ( ravlt ) , rey complex figure test ( pocf ) , rivermead behavioral memory test ( rbmt ) , ruff - light trail learning test ( rulit ) , sentence repetition test ( srt ) , wechsler memory scale ( wms - iii ) , and wide range assessment of memory and learning ( wraml .2 ) . only the recognition memory test ( rmt ) and rivermead behavioral memory test ( rbmt ) use simple mental processes that are used by both humans and animals . among the described methods , there are probably only 4 tests related to the assessment of the working memory system : brief visuospatial memory test ( bvmt ) , raven s progressive matrices , category test , and wisconsin card sorting test . the examples of methods used by investigators of memory in humans reveal that tests used in such studies are inappropriate for use in experiments in animals because usually they involve more complex mental functions . it would probably be easier to find guidance related to this kind of test from researchers implementing animal experiments . akar et al . used 5 tests of memory in their experiments : novel object recognition test ( nort ) , passive avoidance test ( pa ) , social transmission of food preference test ( stfp ) , open field test , and free exploratory paradigm . the administration of nort and pa test are illustrated in figures 2 and 3 . hasanein and shahidi used the passive avoidance test ( pa ) in studying the influence of a selected substance on memory deficit in diabetic rats . zeef et al . investigated the impairments of spatial and object recognition memory in experiments on transgenic rats , an established model of huntington s disease . they tested the memory function using the object location test ( olt ) and the object recognition task ( ort ) . assessed cognitive performances by behavioral tests measuring episodic ( novel object recognition test , nort ) , associative ( one - trial contextual fear conditioning , cfc ) , and visuospatial ( morris water maze and barnes maze ) learning and memory . the method of administration is similar , but simpler the y maze test is illustrated in figure 5 . describe their methodology , writing that male swiss mice were tested for anxiety in the elevated plus maze test ( epm ) , and for cognition using passive avoidance ( pa ) procedures . the same team , in their former work , evaluated the impact of substances that affect the cholinergic system in mice , using the modified elevated plus maze ( mepm ) test , emphasizing that this test allows examination of various processes of memory ( acquisition , consolidation , and retrieval ) . as an index of memory , the authors used the time necessary for mice to move from the opened arm to the enclosed arm . tried to verify the hypothesis that flavonoids , compounds present in fruits and vegetables , prevent neurodegenerative diseases . these investigators assessed the effect of quercetin ( 3,3,4,5,7 - pentahydroxyflavone ) on oxidative stress and memory retrieval using a step - through passive avoidance task in kindled rats . tested whether ciproxifan ( histamine h3 receptor type antagonists ) improves working memory in sleep - restricted mice . they tested the function of working memory by appropriate tasks using spatial spontaneous alternation behavior . examined the impact of antagonists of h ( 3 ) - type histamine receptors on the various properties of memory . they tested whether ciproxifan could reverse the behavioral effects of mk - 801 , a drug used in animals to mimic the hypoglutamatergic state suspected to exist in schizophrenia . four behaviors were chosen for study : locomotor activity , ataxia , prepulse inhibition ( ppi ) , and delayed spatial alternation . examined the temporal profile of pharmacologically enhanced episodic memory , using the object recognition task . investigated the effects of 2 cyclic gmp - specific phosphodiesterase enzyme type 5 inhibitors , sildenafil and vardenafil , using the object recognition task to assess memory performance of rats . this study showed the memory enhancing effects of phosphodiesterase type 5 ( pde5 ) inhibitors . the same team of researchers , in their subsequent work performed on mice , demonstrated some differences in nitric oxide ( no ) - mediated cyclic gmp ( cgmp ) signaling in the hippocampus between rats and mice . taken together , these studies show that inhibition of pde5 improves object recognition memory in rats and mice . levin et al . wrote that in a variety of studies the nicotinic agonists have been shown to improve cognitive function and they experimentally determined the attentional function . rats discriminate whether or not a light signal occurred on a trial and respond with a lever press on 1 side after a signal and on the opposite side after the absence of a signal in order to receive a food pellet reinforcer . the authors of a recently published paper reported the impact of zaprinast and rolipram on a model of spacial and emotional memory in mice used for verification of influences of the elevated plus maze test ( epm ) and passive avoidance test . investigated the effects of a potent nitric oxide - guanylate cyclase activator on learning and memory functions in aged rats , using the morris water maze ( mwm ) and passive avoidance ( pa ) test . the same team of researchers used a mouse model to investigate the anxiolytic and antidepressive impacts of exenatide , a potent agonist for the glucagon - like peptide - 1 ( glp - 1 ) , which is used in the treatment of type ii of diabetes mellitus . they used a modified elevated plus - maze test for evaluation of anxiolytic behavior and a forced swimming test for evaluation of depressive behavior . the elevated plus maze test ( epm ) mentioned in several of the above - cited papers has been described in detail by komad et al . . their open access paper includes visualization available online , showing how this test is administered [ http://www.ncbi.nlm.nih.gov/pmc/articles/pmc2762911/ ] . careful analysis of the above - mentioned investigations performed on humans and animals leads us to propose that the most appropriate candidate for testing memory in both humans and animals is the novel object recognition test ( nort ) , which was used by akar et al . . the inventors of this method write that the test is based on the differential exploration of familiar and new objects by animals . in a first application of the test , the rats are exposed to 2 identical objects , and in a second trial to 2 dissimilar objects a familiar and a new one . the authors found that the test is similar to visual recognition tests widely used in primates , and that it is entirely based on the spontaneous behavior of rats and can be considered as apure working - memory test completely free of reference memory component and it does not involve primary reinforcement such as food or electric shocks ; this makes it comparable to memory tests currently used in man . ennaceur and delacour took advantages of features of their elaborated method for testing in experiments on rats the efficacy of the medicament piracetam used in human therapy . there are currently some exhaustive discussions of all aspects of the utilization of this method and some of its modifications . in search of a test that would be equivalent for experiments on animals and humans in verification of the efficiency of working memory system , we should consider the sternberg item recognition paradigm , which is a generalized procedure for reproducing the above - discussed nor test . this generalization enables it to also assess wms capacity . . we emphasized in our previous paper that capacity and proper functioning of wms in experiments on animals usually is done by means of the delayed response task ( drt ) . performing this kind of testthe tests based on the delayed response task also evaluate the visual and spatial function of working memory . this aspect of working memory is also evaluated by the object - location test . among the whole range of tests designed to evaluate the capacity of human memory , we should look for the simplest tests used to assess the ability to memorize spatial data . the best - known and utilized tests evaluating visual - spatial working memory are the corsi block - tapping test ( cbt ) and visual pattern span . the tool used during the performance of the classic cbt are 9 wooden blocks ( 33 cm ) that are randomly distributed on a 2530 cm board , requiring the subject to press on a series of blocks . subsequently , the subject must recall the sequence and immediately repeat it in the same order . there are several computerized versions of the corsi test , including the called walking version of the test . perrchon et al . clearly illustrated the protocol of the cbt performance in their paper , which is accessible online . it is possible to become familiar with the essence of this test through the readily available websites presenting the popular versions of this test . the subject is asked to copy the matrix pattern from memory into an empty matrix . the matrix patterns are increased in size and complexity until the participant s ability to replicate them collapses . on averagecareful consideration of the data presented above , related to the most well - known tests , is the basis for forming proposals to solve the problem set as the goal of this paper . we propose that 2 pairs of tests nort sirp and olt cbt ( bvsmt ) be used as the basic tools for interdisciplinary memory assessment in humans and animals , particularly in studies on efficacy of drugs . moreover , it seems to us that in the many recent software tools available to assess and improve memory capacity , we should always try to find out the implemented rules of nort sirp and olt cbt ( bvsmt ) . some of the memory tests already in use are characterized by simplicity and do not require reinforcement techniques , so they are suitable for the assessment of the memory capacity in both animals and humans , which is important for trials of new drugs . further efforts are needed to establish equivalent memory tests for both animal and human experiments . two pairs of tests nort sirp and olt cbt ( bvsmt ) constitute the basic tools for interdisciplinary memory assessment , and its essential rules can be found in recently commercialized software for memory training .\noutput:\n" }, { "from": "agent", "value": "older people often exhibit memory impairments . contemporary demographic trends cause aging of the society . in this situation , it is important to conduct clinical trials of drugs and use training methods to improve memory capacity . development of new memory tests requires experiments on animals and then clinical trials in humans . therefore , we decided to review the assessment methods and search for tests that evaluate analogous cognitive processes in animals and humans.this review has enabled us to propose 2 pairs of tests of the efficiency of working memory capacity in animals and humans.we propose a basic set of methods for complex clinical trials of drugs and training methods to improve memory , consisting of 2 pairs of tests : 1 ) the novel object recognition test sternberg item recognition test and 2 ) the object - location test visuospatial memory test . we postulate that further investigations of methods that are equivalent in animals experiments and observations performed on humans are necessary ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: an 89 - year - old caucasian man presented to our clinic with a 3 - year history of an asymptomatic , slow - growing , hyper - pigmented skin lesion located on the distal third of the dorsal aspect of the right arm . the physical examination revealed an asymmetrical , ill - defined brown patch with 21 mm of maximum diameter ( figure 1 ) . dermoscopy examination of the lesion disclosed an atypical network , irregularly distributed brown and black globules , pigmented internal streaks and a milky - red area ( figure 2 ) . based on clinical and dermoscopic findings a diagnosis of slow - growing malignant melanoma was made . simultaneously , a well - defined blue papule with 4 mm of maximum diameter was seen on the proximal third of the dorsal aspect of the same arm ( figure 1 ) . the patient added that the papule followed local skin injuries from a grenade explosion during the ii world war . therefore , foreign body reaction and traumatic pigmentation were also included in the differential diagnosis . the blue papule was further examined by reflectance confocal microscopy ( rcm ) and high - definition optical coherence tomography ( hd - oct ) . , usa ) evaluation was unremarkable , with normal honeycomb pattern , edged - papillae in the dermal - epidermal junction , and absence of atypical cells and dendritic melanocytes in the superficial dermis . some changes attributed to chronic sun exposure were seen , including elongated cords , flattened junction and moderately refractive lace - like material adjacent to collagen bundles , correlating to solar elastosis at the upper dermis ( figure 4 ) . hd - oct ( skintell , agfahealthcare , belgium ) en face mode enabled the observation of scattered bright inflammatory cells in the dermis and clusters of bright coarse particles in the deeper dermis ( figure 5 ) . image splitter in which the number of pixels with specific values is isolated in an image ( figure 6 ) . both lesions were excised . subsequent histopathological examination of the hyperpigmented patch confirmed the diagnosis of melanoma in situ , while the examination of the blue papule revealed a foreign body with fibrosis and sparse inflammatory infiltrate ( figure 7 ) . several non - invasive imaging techniques have emerged in recent years aiming for higher accuracy of in vivo diagnosis . these include dermoscopy , reflectance confocal microscopy ( rcm ) and high - definition optical coherence tomography ( hd - oct ) . the colors that are seen in dermoscopy depend on the anatomic level of the skin at which the chromophores ( melanin , hemoglobin , collagen ) are seen . its diagnosis can be challenging especially if a diffuse bluish pigmentation is found under dermoscopy . the differential diagnosis of melanocytic lesions with blue color should include blue nevus , spitz nevus , malignant melanoma and cutaneous melanoma metastasis . blue hue can also be seen in nonmelanocytic lesions like seborrheic keratosis , including lichen planus - like keratosis , hemangioma , pigmented basal cell carcinoma , hemosiderotic dermatofibroma , kaposi sarcoma and angiosarcoma . finally , exogenous dermal blue pigmentation , such as ink tattoo , radiation tattoo , and traumatic penetration of foreign pigmented materials . our differential diagnosis for this blue lesion included cmm , common blue nevus and foreign body reaction / exogenous pigmentation . cutaneous melanoma metastasis was our first and immediate diagnosis because of the simultaneous observation of a suspected melanoma and a blue lesion with homogeneous blue color under dermoscopy , and located in proximity to the primary melanoma . however , the suspected melanoma lesion had a slow - growing progression , and dermoscopy revealed asymmetrical network , irregular globules and internal streaks , which were a clue for a thin melanoma . the diagnosis of cmm is usually suspected based on a history of primary invasive , thick melanomas . the lesion history with a 75 - year duration of onset also allowed for the clinical exclusion of cmm . the clinical and dermoscopic diagnosis of common blue nevus was then considered relying on the dermoscopic observation of diffuse , homogeneous bluish pigmentation , in absence of specific melanoma criteria , on a long - standing , stable lesion . the possible post - traumatic relation to the onset of the lesion made us includethe diagnosis of exogenous traumatic pigmentation , usually also associated with a blue structureless pattern in dermoscopy . since dermoscopy was not conclusive rcm examination of the blue papule was performed . rcm allows for the visualization of microscopic features in vivo with a nearly histological resolution . increasing knowledge on the rcm appearance of a wide range of skin lesions may help us to improve our bedside diagnostic accuracy . the findings of normal honeycomb pattern and lack of atypical cells and dendritic melanocytes in the superficial dermis allowed the exclusion of cmm and blue nevus in the examined skin levels . however , limited laser depth penetration ( 250 m ) hampers visualization of the deep dermis representing a limitation of rcm in the assessment of both cmm and common blue nevus . hd - oct is a recently introduced technique based on the same principles of conventional oct but differing on its ability to give optical imaging up to 570 m deep within the skin with high resolution of 3 m both in axial and lateral directions . this technique is capable of capturing not only slice but also en face images in real time and fast three - dimensional acquisition . therefore , hd - oct allows in vivo examination of the skin enabling visualization of individual cells with a greater depth than rcm . enface mode imaging and histogram representation showed scattered highly refractile inflammatory cells and aggregates of brightly refractile particles in the deeper dermis . it was also possible to exclude cmm and blue nevus , in a greater depth penetration using hd - oct . en face and histogram changes possibly corresponded to foreign body material and inflammation associated to the skin trauma reported by the patient that took place 75 years ago . the definite diagnosis in our case was made with the histopathological examination that revealed a foreign body in the deeper dermis , a possible consequence of the grenade explosion , showing good correlation with the hd - oct findings of large bright refractile particles in the same location . the deeper location of foreign material in our case caused a bluish appearance , both in clinical and dermoscopic presentation . it can be explained by a similar phenomenon as seen with dermal melanin : the tyndall effect of the physical light scattering effect of blue pigmentation in the dermis . in conclusion , the diagnostic evaluation of a blue lesion should always rely on the integration of all data , including patient s age , duration of onset and rate of growth of the lesion , palpability and dermoscopic features . other noninvasive techniques , like rcm and hd - oct can also be important aids in the differential diagnosis of a blue lesion . hd - oct showed good correlation to the histopathological features of foreign body reaction . as a rule all blue lesions that not fulfil clinical and dermoscopic criteria for a specific benign lesion should be excised . that was particularly true in our case due to the puzzling simultaneous clinical appearance of a melanoma and blue lesion . even with a very long history of blue .\noutput:\n" }, { "from": "agent", "value": "the colors that are seen in dermoscopy depend on the anatomic level of the skin at which the chromophores are seen . blue color can be found in a variety of melanocytic and nonmelanocytic lesions.an 89 - year - old man presented with a 3 - year history of a slow - growing , hyperpigmented patch located on the distal third of the right arm . dermoscopy showed an atypical network , irregularly distributed globules , pigmented internal streaks and a milky - red area . based on these findings a diagnosis of slow - growing malignant melanoma was made . simultaneously , a well - defined blue papule was seen on the proximal third of the same arm . dermoscopy disclosed a homogeneous blue pattern . after clinical and dermoscopic correlation our differential diagnosis for this blue lesion included cutaneous melanoma metastasis , blue nevus and foreign body reaction . the patient recalled its onset 75 years ago after a grenade explosion . we also discuss the blue lesion appearance under reflectance confocal microscopy and high - definition optical coherence tomography . histopathological examination after excision of the hyperpigmented patch and blue papule revealed a melanoma in situ and a foreign body reaction , respectively.the diagnostic evaluation of a blue lesion should always rely on the integration of all data , especially clinical and dermoscopic features . other non - invasive techniques , like reflectance confocal microscopy and high - definition optical coherence tomography can also be important aids for its differential diagnosis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although the role of the two functional bundles ( anteromedial ( am ) and posterolateral ( pl ) ) has been defined , few studies exist that attempt to establish the exact pattern or patterns of injury that may occur . similarly , specific factors that can influence the relative pattern of injury are yet to be defined . biomechanical studies have shown that variations in acl tunnel placement result in variable postoperative knee kinematics and loads . employed a straight knee hyperextension model to rupture the native acl and demonstrated a variable pattern of acl tears at high vs. low energy moments . recently , zantop et al . studied the rupture pattern of the native acl at the time of arthroscopy . their results demonstrated that 24 % of patients had a partial acl rupture and in 44 % of the total cases , the am and pl bundle did not rupture at the same level ( proximal , mid - substance , distal ) . with the increasing number of acl reconstructionsbeing performed annually , a subsequent increase in the number of revision cases has occurred . recently , greater attention is being paid to re - rupture cases and what can be learned in this setting . biomechanical studies have shown that variations in acl reconstruction technique , i.e. difference in tunnel placement and graft type , result in variable postoperative knee kinematics and loads . theoretically , this exposes the reconstructed acl graft to variable forces and potentially results in different rupture patterns when the graft is stressed to failure . to date , no studies have specifically attempted to determine the most common rupture pattern and causative or related factors in failure of double - bundle acl reconstruction . double - bundle acl reconstruction may have additional causes of failure than single - bundle reconstruction , associated with 4 tunnels instead of 2 . if causes of failure can be determined , as well as factors that can identify these causes , they can be prevented in the future . the primary purpose of this study was to determine the most common rupture pattern in acl revision cases after previous double - bundle reconstruction . our secondary purpose was to identify variables that can be correlated with rupture pattern of the graft . the hypothesis of this study was that it is possible to identify factors that influence the rupture pattern of the acl graft , such as the time between the primary surgery and the failure and the mechanism of injury . between 2005 and 2009 , all patients who underwent revision acl surgery after a previous double - bundle reconstruction were evaluated . after receiving approval from our institutional review board , we excluded all patients who had undergone multiple ( 1 ) revision surgeries on the knee of interest . three orthopedic surgeons with sports medicine fellowship training independently reviewed the arthroscopic footage of the included subjects to determine the rupture pattern . the rupture pattern was recorded using the classification system previously described by zantop et al . specifically , each bundle was classified independently as ruptured proximally , mid - substance or distally , functionally insufficient due to elongation , or intact / uninjured . if the observers felt they were unable to determine the rupture pattern due to insufficient footage , they could score a bundle as indeterminate . patient demographic data including age , gender , date of the initial acl reconstruction , date of the re - injury and etiology of failure were collected . posterior radiographs of the knee , using a commercially available radiographic imaging system ( stentor , philips healthcare , andover , ma ) . the tunnel angle was defined as the angle between the tunnel and the axis of the femur ( fig .1 anterior posterior flexion weight - baring radiograph of the right knee after double - bundle acl reconstruction . the tunnel angle is measured as the angle between the axis of the femur and the outline of the tunnel anterior posterior flexion weight - baring radiograph of the right knee after double - bundle acl reconstruction . the tunnel angle is measured as the angle between the axis of the femur and the outline of the tunnel data were analyzed with pasw statistics ( version 17.0 , spss inc . inter - observer agreement for the three observers was calculated using the fleiss kappa coefficient for multiple ratings per subject . statistical analysis of associated variables was performed using the rupture pattern ratings from observer number one . descriptive statistics were calculated for all the variables , including frequency counts for nominal variables and means , medians , standard deviation and a range for all continuous variables . the kruskalwallis one - way analysis of variance was used to determine the influence of patient age , acl reconstruction to re - injury time interval and tunnel angle on the rupture pattern . when statistical significance was achieved ( p 0.05 ) , a post - hoc mann whitney u test was performed to further specify the difference . for the post - hoc analysis , the bonferroni correction was applied to adjust the a priori alpha level to the number of comparisons performed . this resulted in p 0.05 / 3 for the am bundle and 0.05 / 6 for the pl bundle as the level of significance . the chi - square test and cramer v correlation coefficient were used to measure the relationship between the rupture pattern and nominal variables such as gender and etiology of failure . the a priori alpha level was p 0.05 . when statistical significance was achieved , a post - hoc analysis of the standard residuals was performed . inter - observer agreement for the three observers was calculated using the fleiss kappa coefficient for multiple ratings per subject . this method generates a single kappa value for all three observers combined . statistical analysis of associated variables was performed using the rupture pattern ratings from observer number one . descriptive statistics were calculated for all the variables , including frequency counts for nominal variables and means , medians , standard deviation and a range for all continuous variables . the kruskalwallis one - way analysis of variance was used to determine the influence of patient age , acl reconstruction to re - injury time interval and tunnel angle on the rupture pattern . when statistical significance was achieved ( p 0.05 ) , a post - hoc mann whitney u test was performed to further specify the difference . for the post - hoc analysis , the bonferroni correction was applied to adjust the a priori alpha level to the number of comparisons performed . this resulted in p 0.05 / 3 for the am bundle and 0.05 / 6 for the pl bundle as the level of significance . the chi - square test and cramer v correlation coefficient were used to measure the relationship between the rupture pattern and nominal variables such as gender and etiology of failure . the a priori alpha level was p 0.05 . when statistical significance was achieved , a post - hoc analysis of the standard residuals was performed . the kappa for multiple observers was .80 for the am bundle and .76 for the pl bundle . the most frequent rupture pattern was mid - substance rupture of both the am and pl bundle graft ( 35.1 % ) . after combined mid - substance injuries , the three most common patterns seen were mid - substance rupture of the am graft with either elongation ( 13.5 % ) or proximal rupture ( 8.1 % ) of the pl graft and proximal rupture of the am bundle with an intact pl bundle ( 8.1 % ) ( fig . 2 ) . since there was an extremely low number of distal ( tibial - sided ) graft ruptures , distal and mid - substance ruptures were collapsed as a single category for further statistical analysis.table 1demographic data ( n = 40 ) ratiomeansdrangegender male : female22 : 17age19 ( median ) 1638 months between initial surgery and re - injury18 .69.5639 etiology of failure traumatic : a - traumatic35 : 5 tunnel angle am2313141 tunnel angle pl4382762sd standard deviation , am anteromedial bundle graft , pl posterolateral bundle grafttable 2frequencies ( % of total ) of the different rupture patterns for the am and pl bundle graftplproximalmid - substancedistalelongatedintacttotal amam proximal5005819 mid - substance835014359 distal033038 elongated5300514 intact000000 total pl194131919100pl bundle graft , am anteromedial bundle , pl posterolateral bundlefig .2 arthroscopic figures of the right knee in 90 of flexion displaying the four most frequent double - bundle graft rupture patterns after anterior cruciate ligament reconstruction . . a anteromedial portal view , the am and pl bundle have ruptured mid - substance . b anterolateral portal view , the am bundle ruptured mid - substance and the pl bundle is elongated . c anteromedial portal view , the am bundle ruptured mid - substance and the pl bundle proximal . d anteromedial portal view , the am bundle ruptured proximal and the pl bundle is still intact . am anteromedial , pl posterolateral , lfc lateral femoral condyle demographic data ( n = 40 ) sd standard deviation , am anteromedial bundle graft , pl posterolateral bundle graft frequencies ( % of total ) of the different rupture patterns for the am and pl bundle graft pl bundle graft , am anteromedial bundle , pl posterolateral bundle arthroscopic figures of the right knee in 90 of flexion displaying the four most frequent double - bundle graft rupture patterns after anterior cruciate ligament reconstruction . b anterolateral portal view , the am bundle ruptured mid - substance and the pl bundle is elongated . c anteromedial portal view , the am bundle ruptured mid - substance and the pl bundle proximal . d anteromedial portal view , the am bundle ruptured proximal and the pl bundle is still intact . am anteromedial , pl posterolateral , lfc lateral femoral condyle isolated analysis of the am bundle graft showed that the time between the initial acl surgery and re - injury significantly influenced the rupture pattern . the reconstruction to re - rupture interval was significantly greater in proximal ruptures when compared to distal or mid - substance ruptures ( 32 vs. 14 months , p = 0.001 ) . rupture pattern of the am graft was also significantly correlated with the etiology of failure ( traumatic vs. atraumatic ) ( cramer v = 0.436 ; p = 0.025 ) . ninety - four percent of proximal , mid - substance or distal tears were traumatic , while only fifty - seven percent of elongated grafts were the result of a traumatic event . wallis test also showed a main effect of tunnel angle on the am graft rupture pattern , however , post - hoc analysis was unable to further specify this effect . the am rupture pattern was not significantly different based on the patients age or gender ( table 3 ) . table 3factors that influence the rupture pattern of the anteromedial bundlefactorsproximal ( n = 7 ) mid - substance and distal ( n = 25 ) elongated ( n = 7 ) p valueage ( median , [ 95 % ci ] ) 2018.523.5 nsgender ( % male ) 57 % 56 % 50 % nsmonths out ( median , [ 95 % ci ] ) 3214170.002 etiology of failure ( % traumatic ) 86 % 96 % 57 % 0.025 tunnel angle ( median , [ 95 % ci ] ) 1429200.04895 % ci 95 % confidence interval , ns not significantproximal ruptures had a significantly greater time between the primary surgery and re - injury than the mid - substance and distal ruptures , p = 0.001 cramer v = 0.436 . atraumatic injuries were more likely to be elongatedpost - hoc analysis was unable to further specify this difference factors that influence the rupture pattern of the anteromedial bundle 95 % ci 95 % confidence interval , ns not significant proximal ruptures had a significantly greater time between the primary surgery and re - injury than the mid - substance and distal ruptures , p = 0.001 cramer v = 0.436 . atraumatic injuries were more likely to be elongated post - hoc analysis was unable to further specify this difference with respect to the pl bundle , the time interval between the initial acl surgery and re - injury also influenced the rupture pattern . distal or mid - substance ruptures occurred at a significantly shorter reconstruction to re - rupture interval than the proximal ruptures ( 13 vs. 24 months , p = 0.006 ) . the pl rupture pattern was not significantly different based on the patients age , gender , etiology of failure or tunnel angle ( p = 0.054 ) ( table 4 ) . table 4factors that influence the rupture pattern of the posterolateral bundlefactorsproximal ( n = 7 ) mid - substance and distal ( n = 16 ) elongated ( n = 10 ) intact ( n = 5 ) p valueage ( median , [ 95 % ci ] ) 211819.519 nsgender ( % male ) 83 % 56 % 40 % 40 % nsmonths out ( median , [ 95 % ci ] ) 241317220.039 etiology of failure ( % traumatic ) 86 % 100 % 70 % 100 % nstunnel angle ( median , [ 95 % ci ] ) 4345 [ 4351 ] 4037 ns95 % ci 95 % confidence intervall , ns not significantthe proximal ruptures had a significantly longer time between the primary surgery and re - injury than the mid - substance and distal ruptures , p = 0.006 factors that influence the rupture pattern of the posterolateral bundle 95 % ci 95 % confidence intervall , ns not significant the proximal ruptures had a significantly longer time between the primary surgery and re - injury than the mid - substance and distal ruptures , p = 0.006 the most important finding of the present study was that the most common rupture pattern in acl revision cases after previous double - bundle reconstruction is mid - substance rupture of the am bundle with either mid - substance rupture , proximal rupture , or elongation of the pl bundle , as well as an isolated proximal am bundle rupture with an intact pl graft . this differs from the most frequent rupture pattern seen in the native acl , as reported by zantop et al . . their study demonstrated proximal rupture of the am bundle with either proximal or mid - substance rupture of the pl bundle as the most common patterns of injury ( fig .3 ) . however , despite this difference , we did see similar results for the occurrence of both bundles ruptures at the same level and for the relative incidence of an intact pl bundle ( table 5 ) . in another caseseries of acl revision surgeries , kaz et al . also reported an isolated am bundle rupture with intact pl bundle among their report of three double - bundle re - ruptures .3 arthroscopic figure of the right knee in 90 of flexion showing the most frequent rupture pattern of the native anterior cruciate ligament . both the am and pl bundle are rupture proximally . when compared to the most common rupture pattern in revision surgery ( fig . am anteromedial , pl posterolateral , lfc lateral femoral condyle , mfc medial femoral condyletable 5comparison of the rupture pattern in acl revision surgery to the rupture pattern of the native aclmeasured datazantop et al . rupture pattern native aclcurrent study rupture pattern reconstructed acltwo most frequent rupture patternsam proximal pl proximalam mid - substance pl mid - substanceam proximal pl mid - substanceam mid - substance pl elongatedcases where both bundles ruptured at the same location56 % 43 % pl bundle intact12 % 18.9 % acl anterior cruciate ligament , am anteromedial bundle , pl posterolateral bundle arthroscopic figure of the right knee in 90 of flexion showing the most frequent rupture pattern of the native anterior cruciate ligament . both the am and pl bundle are rupture proximally . when compared to the most common rupture pattern in revision surgery ( fig . am anteromedial , pl posterolateral , lfc lateral femoral condyle , mfc medial femoral condyle comparison of the rupture pattern in acl revision surgery to the rupture pattern of the native acl acl anterior cruciate ligament , am anteromedial bundle , pl posterolateral bundle patient - related factors such as the age and gender showed no correlation with the pattern of rupture . the time interval between the initial acl reconstruction and the re - injury did significantly influence the rupture pattern . a longer time period was associated with more proximal ruptures of the graft , whereas a shorter time resulted in more distal and mid - substance ruptures . we believe that this finding may be the result of varied degrees of healing orstated another way , when the graft was given more time to heal and remodel , the resultant re - injury pattern was most similar to the native acl , i.e. proximal rupture of the graft . ligamentization may also be influenced by graft type ( allograft vs. autograft ) and procedure ( single - vs. double - bundle ) . we believe that tunnel positioning is a key determinant of the biomechanical function of the knee . theoretically , variable graft tunnel positioning should result in differences in forces seen by the graft . lastly , this study showed a relationship between the rupture pattern and the etiology of failure . when the patient self - reported an actual traumatic event , the graft was more often ruptured . in comparison , if the tunnel was placed outside of the native acl insertion site , this could result in a mal - functioning graft that is exposed to unusual forces and as a result elongates over time . in addition , the rupture pattern was established by review of arthroscopic videos captured at the time of the revision surgery . therefore , observers were not able to control the arthroscope or to probe the ruptured ligament . still , despite the lack of tactile data , we did find a good to excellent inter - observer reliability . since a satisfactory correlation was seen between all observers , we deemed it appropriate to utilize a single observer s ratings for further statistical analysis . in only one case , the am bundle was scored as indeterminate , while the pl rupture pattern could be established . this subject was excluded for the analysis of the am bundle and included for the analysis of the pl bundle . this dilemma was solved by combining the distal and mid - substance ruptures , so no comparisons could be made between these two classes individually . finally , the rupture pattern may be determined by multiple of the factors assessed in this study , some of which may be confounding . the reconstruction techniques for revision surgery after previous double - bundle acl reconstruction are still being developed . although the outcome of double - bundle reconstruction is generally good , with the high incidence of acl injuries , revisions are to be expected . during revision acl surgery , the pattern of injury may yield valuable information about the function of the primary acl graft . isolated rupture of the am bundle has been shown to have a greater effect on the anterior drawer sign than on the lachman test . the opposite is true for pl bundle ruptures , which can also be tested using the pivot shift . an isolated pl bundle rupture is more difficult to diagnose because of the oblique course of this bundle taking the ligament out of plane when standard mri sequences are employed . three - dimensional reconstruction and 3d magnetic resonance imaging ( mri ) can better visualize the rupture pattern preoperatively , but this requires specialized views or use of ultra high - field 3 tesla mri , which are not typically available in routine clinical practice . at present , the rupture pattern can best be observed and classified during arthroscopic examination . visualizing the rupture pattern during arthroscopy may present a challenge because the am bundle overlies the pl bundle when viewed from the standard anterolateral portal . using the figure of four position or viewing through the anteromedial portal will help in the visualization of the whole acl and both the tibial and femoral insertion sites . if there is an isolated rupture of the am or pl graft , augmentation surgery should be considered , similar to primary acl reconstruction . this study shows that after double - bundle reconstruction , the most common rupture pattern is the failure of both grafts mid - substance . factors that influence the rupture pattern are the time interval between acl reconstruction and re - injury , etiology of failure and graft tunnel angle .\noutput:\n" }, { "from": "agent", "value": "purposeto determine the most common rupture patterns of previously reconstructed db - acl cases , seen at the time of revision surgery , and to determine the influence of age , gender , time between the initial acl reconstruction and re - injury , tunnel angle and etiology of failure.methodsforty patients who presented for revision surgery after previous double - bundle acl reconstruction were enrolled . three orthopedic surgeons independently reviewed the arthroscopic videos and determined the rupture pattern of both the anteromedial and posterolateral grafts . the graft rupture pattern was then correlated with the previously mentioned factors.resultsthe most common injury pattern seen at the time of revision acl surgery was mid - substance am and pl bundle rupture . factors that influenced the rupture pattern ( proximal vs. mid - substance and distal rupture vs. elongated , but in continuity ) were months between acl reconstruction and re - injury ( p = 0.002 ) , the etiology of failure ( traumatic vs. atraumatic ) ( p = 0.025 ) and the measured graft tunnel angle ( p = 0.048 ) . conclusionsthe most common pattern of graft re - rupture was mid - substance am and mid - substance pl . as the length of time from the initial db - acl reconstruction to revision surgery increased , the pattern of injury more closely resembled that of the native acl . evaluation of patients who have undergone double - bundle acl reconstruction , with a particular focus on graft maturity , mechanism of injury and femoral tunnel angles , and graft rupture pattern assists in preoperative planning for revision surgery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a benign or malignant tumor can present as a soft tissue swelling . often these tumors are visible with the eye , but still an important delay in the final diagnosis is common . here , we present an asymptomatic young female with a subcutaneous mass , who was referred to our hospital almost 1 year after initial presentation to the doctor . a 4 year oldfemale was referred to our hospital because of a swelling between the left scapula and the spine . she consulted her general practitioner , who suspected a lipoma and proposed a wait and see policy . after 2 months , she was reexamined and an ultrasound of the mass was requested . no action was undertaken by the family because the swelling was not painful and did not change in size . it took more than 10 months before the ultrasound was performed , after which she was referred to our hospital for further diagnostics and treatment . physical examination showed a solid swelling of about 5 cm in size just medial to the left scapula . the mass is not mobile or painful and is covered with normal intact skin ( fig . an ultrasound of the shoulder region showed a highly vascular inhomogeneous mass of 502126 mm fused with the scapula . mri of thorax / thoracic spine revealed an extended multilobulated mass , originating from the left neuroforamen on t6 or t7 ( fig .2 ) . there was no destruction of the bones , but it had grown into the lung apex and the mediastinum as well as into the left paravertebral muscles . comprehensive blood tests , including lactate dehydrogenase , uric acid , creatinine kinase , kidney function , liver function , electrolytes , complete blood count , and inflammatory parameters were normal . the genetic examination showed a normal array cgh ( comparative genomic hybridization ) analysis , and fish ( fluorescence in situ hybridization ) was negative for 1p depletion and mycn amplification . bone marrow aspiration and biopsy were normal . in view of the complexity of the localization of the tumor , a multidisciplinary team consisting of a neurosurgeon , a thoracic , and a pediatric surgeon was assembled to perform the operation . first , a multilevel laminectomy was performed in prone position to remove the spinal and subcutaneous part of the tumor . the pathology of the tumor confirmed the diagnosis of the biopsy ; the margins were free of tumor . , she had only a minor thoracic scoliosis deformity which will be evaluated annually by a pediatric orthopedic surgeon . our case stood out because of major doctor and patient delay in diagnosis of the tumor .1 reviewed 100 patients referred with soft tissue sarcoma to determine doctor and patientrelated delay . the most frequent reason of doctorrelated delay ( median of 4 months ) was a wrong diagnosis at presentation ( on clinical basis or on ultrasound ) , while the main reason for patientrelated delay was a painless mass that was ignored . if the first symptoms were presented at the emergency department , there was less doctors delay , compared with children who presented at the general practitioners office 2 . this can be explained by the fact that a general practitioner rarely sees a soft tissue malignancy , probably only once every 20 years 3 . several studies examined the causes of the patients delay before presenting to a doctor with a significant swelling . painless swelling , not causing any discomfort , was reported most often . patients and / or their parents often assume that the swelling is harmless .2 reviewed retrospectively the patient delay of 1360 children and adolescents in canada diagnosed with leukemia or lymphoma and concluded that a lower age was associated with a higher patients delay .4 investigated 172 children with cancer in egypt to determine the factors associated with delay in diagnosis . they concluded that delay is related to the child 's age , family 's socioeconomic status and parental education , cancer type , and localization of the malignancy . in our casealthough soft tissue masses in children are fairly common 5 , they cover a heterogeneous group of lesions originating from extra skeletal nonepithelial tissues of the body , excluding the viscera , meninges , and lymphoreticular system . also other tumors , not originating from the soft tissue , can present as a subcutaneous swelling . for that reason , when a child presents with a mass , the differential diagnosis is broad , consisting of malignant and benign tumors 6 . it may be clinically difficult to distinguish between the different diagnoses among other things , as a result of the ( lack of ) symptoms , the localization , and the agerelated pathology . soft tissue tumors are general benign ( approximately 100 times more common ) , especially when the swelling is superficial and less than 5 cm in diameter 7 . in adults , approximately onethird of all benign soft tissue swellings are lipomas , onethird are fibrous tumors , 10 % are from vascular origin , and 5 % are nerve sheath tumors 6 . in children , on the other hand , a benign subcutaneous swelling is more likely posttraumatic , a result of inflammation or a vascular or fibrous tumor 5 . a lipoma in childhood is quite rare and is only seen in about 4 % of all soft tissue swellings 8 . malignant soft tissue tumors account for less than 1 % of the overall malignant tumors in adults 9 . in grownups , organspecific tumors or metastasis , we have to consider lymphoma , rhabdomyosarcoma , and tumors of the sympathetic nervous system 11 . see table 1 for an overview of the differential diagnosis of soft tissue tumors in children and adults . differential diagnosis of soft tissue masses / subcutaneous swelling 5 , 7 , 11 , 12 early referral of children suspected of soft tissue sarcomas , is believed to improve prognosis , although there are no studies to prove this . due to the rarity of soft tissue sarcomas ( about 7 % of all childhood malignant tumors 12 , most general practitioners will never come across a soft tissue sarcoma during their professional career . any child with a soft tissue mass increasing in size , with size larger than 5 cm or localized underneath the deep fascia , whether or not painful , should be referred to a tertiary center under suspicion of a soft tissue malignant tumor 14 . we report a female with a large ganglioneuroblastoma , an uncommon neuroblastic tumor arising from the sympathetic nervous system . most of these tumors occur in the abdomen , mediastinum , neck , and pelvis 15 . the international neuroblastoma pathology classification distinguishes four categories based on the balance between the undifferentiated neuraltype cells and mature schwanntype cells , reflecting the spectrum of maturity of the tumor 16 . ganglioneuroblastoma ( intermixed or nodular ) , as present in our patient , is composed of both mature gangliocytes and immature neuroblasts . neuroblastoma is the most malignant tumors and exist of immature , undifferentiated cells , or poorly differentiated and is schwannian stromapoor 17 . most of the patients with a ganglioneuroblastoma present with a painful swelling due to local infiltration of the primary tumor . they can also present with metastatic disease ( most often the bone or the liver ) or other signs and symptoms due to the location of the tumor 18 . as in our patient with ganglioneuroblastoma of the intermixed type , surgery is the only necessary treatment . these tumors can sometimes even regress spontaneously or / and mature into benign ganglioneuromas 20 . we present a young female with a subcutaneous mass , who was diagnosed and treated after a long patientrelated and doctorrelated delay , due to the asymptomatic character of the lesion and the unfamiliarity of the healthcare workers with the agerelated differential diagnosis .\noutput:\n" }, { "from": "agent", "value": "key clinical messagea general practitioner faces regularly soft tissue swelling in otherwise healthy children . delay in diagnosis of soft tissue malignancies is often due to asymptomatic nature and the unfamiliarity with the agedependent differential diagnosis . hence , an accurate knowledge is important to prevent important delay in diagnosis of potential malignancies ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: heterotopic pregnancy is a rare condition that is characterized by presence of simultaneous intra and extrauterine pregnancy 1 . it mostly happens with known risk factors notably assisted reproductive techniques ( art ) , infertility treatment , and previous history of pelvic inflammatory diseases ( pid ) 2 . patients with known risk factors are usually kept under strict followup schedules that include booking an antenatal scan with subsequent early detection of any possible hp . the diagnostic challenge still remains in those who present with hp without identifiable risk factors and with spontaneous pregnancy , and those who usually attend first with complicated hp , are usually overlooked . we want to report our experience of hp after spontaneous pregnancy , and unluckily misdiagnosed with ultimately , loss of the intrauterine pregnancy . our hope is to raise awareness for such a rare event to ensure better patient outcomes . a 38yearold pregnant woman g7 p3 ( ab3 ) came to our antenatal emergency unit with abdominal pain that was in the right lower quadrant , aching , continuous in nature , and associated with two vomiting episodes of clear fluid . her last menstrual period ( lmp ) was 9 weeks previously , and she had no prior history of ectopic pregnancy , artificial reproductive techniques ( arts ) , pelvic inflammatory disease ( pid ) , or infertility treatment . upon examination , the patient appeared stressed from pain , vital signs were within normal limit , and an abdominal examination revealed tenderness at right iliac fossa and positive rebound tenderness . routine work up was initially done that revealed , hemoglobin level : 11.8 / dl , white cell count : 13.19 / mm , and bhcg : 45,200 miu / ml . transabdominal ultrasound showed gravid uterus with living fetus corresponding 6 + 5 weeks ( fig . 1 ) and right adnexal mass ( 1087 cm ) with mild to moderate free fluid ( fig . our radiologist and obstetrician got a false assurance as they saw a viable intrauterine fetus by ultrasound and kept the possibility of the hp in the bottom of the differential diagnosis list . signs of acute abdomen and clinical picture of suggestive complicated appendicitis warranted urgent intervention . the patient and her husband were informed of all the benefits and risks of such a procedure that include the possibility of miscarriage from general anesthesia and surgery . after an initial grid iron ( mcburney 's ) incision and as the peritoneum was opened , there was hemoperitoneum , and the right fallopian tube was found to be ruptured ( fig . the incision was extended by obe / gynae team and a total right salpingectomy was performed . the patient was discharged with uneventful postoperative period but unfortunately she return after 12 days suffering incomplete miscarriage that was managed by medical termination . the case was initially misdiagnosed as complicated appendicitis and ended with miscarriage of the intrauterine one . heterotopic pregnancy is a rare event with a reported incidence in the general population of 1 in every 7000 pregnancies . the incidence has increased due to widespread use of art and history of pid to approximately 1 in 100 pregnancies . it 's extremely rare among patients who conceive naturally , 1 in 30,0003 , 4 . in a series of 13 cases of hp , one case only was after spontaneous pregnancy , six after art and six after infertility treatment 5 . the fallopian tube is the most frequent reported site ( 72 % ) for extrauterine pregnancy , as was our case . also , ovarian and cervical sites 6 , 7 , and spontaneous triple hp with two yolk sacs in one tube were reported 8 . accurate and early diagnosis of hp is challenging and still remains a diagnostic and therapeutic challenge to practitioners despite the increased medical knowledge and use of improved reproductive technologies 2 , 3 . few modalities may help in the hp diagnosis of hp , notably bhcg and transvaginal ultrasound . serial samples of bhcg measurements are often difficult to interpret because of intrauterine pregnancy , and cause the bhcg concentration to increase appropriately . the serum level of bhcg in our case was 45.200 miu / ml , which is around the normal level for intrauterine pregnancy at this period of gestation . our case was really a challenging one as she did not have any of the known risk factors of hp , was conceived naturally and had no antenatal visit prior to her emergency presentation . moreover , serum bhcg was around the normal range and transvaginal ultrasound could not help for diagnosis . missed hp also has reported by kratschlaapochal et al . and gibson kyle et al .9 , 10 . nevertheless , it was earlier detected in other series 11 , 12 . medical management can be offered for elective and nonemergent heterotopic pregnancy under some circumstances after accurate diagnosis of the extrauterine gestational sac . ultrasoundguided vaginal aspiration and in situ injection of methotrexate , potassium chloride , or hyperosmolar glucose have been reported 13 . immediate intervention remains the only viable option for acute presentation of hp ; laparoscopy offers both diagnosis and management and allows for minimal handling of the uterus . laparoscopy can be considered as a safe option among most of the gynecologists , the outcome of the intrauterine pregnancy is comparable to that obtained with laparotomy 5 . preoperatively early detection of extrauterine pregnancy occurs especially during dating scan and postoperative factors may include short operative time , quality of anesthesia , and minimal uterine manipulation . however , it was suggested that in those undergoing laparotomy , the loss rate is around 40 % of fetuses 14 . although a rare event , presence of intrauterine pregnancy does n't eliminate the possibility of hp in pregnant women who present with adnexal mass , even after natural conception . in suspicious cases and with unavailability of laparoscopy , abdominal exploratory incision is recommended . heterotopic pregnancy has mentioned infrequently in the literature , and it seems that physicians have not had full awareness by such a rare condition . the patient had heterotopic pregnancy that was misdiagnosed as complicated appendicitis with a delay in diagnosis and intervention that ended by loss of the intrauterine pregnancy days after the exploration . we hope to convey our message to the physicians to alert them to such a rare event that will improve future patient outcomes . heterotopic pregnancy has mentioned infrequently in the literature , and it seems that physicians have not had full awareness by such a rare condition . our case report is a typical example . the patient had heterotopic pregnancy that was misdiagnosed as complicated appendicitis with a delay in diagnosis and intervention that ended by loss of the intrauterine pregnancy days after the exploration . we hope to convey our message to the physicians to alert them to such a rare event that will improve future patient outcomes .\noutput:\n" }, { "from": "agent", "value": "key clinical messagesimultaneous presence of intra and extrauterine pregnancies have been known as heterotopic pregnancy ( hp ) ; the condition which is extremely rare with natural conception . our aim is to increase the obstetrician 's awareness to increase the level of positive outcome in such rare events ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the data source for this study was the 19992004 nhanes conducted by the national center for health statistics of the centers for disease control and prevention . nhanes is a cross - sectional survey of the civilian , noninstitutionalized population of the u.s . participants self - reported their age , race / ethnicity , and sex . race / ethnicity was coded as non - hispanic white , non - hispanic black , mexican american , and other . nhanes oversampled african americans , mexican americans , and subjects aged 60 years and older . participants with aged 21 years and a platelet count 100 and 45010 / l were excluded . of a sample of 13,021 people who underwent detailed in - person interviews , physical examinations , and laboratory testing ,11,730 had data to classify them as with or without diabetes , and 10,775 had data on the five components of the metabolic syndrome ( abdominal obesity , hypertension , hypertriglyceridemia , low hdl cholesterol , and abnormal glucose metabolism ) . the dataset with subjects having all nonmissing values for diabetes , the metabolic syndrome , and each component of the metabolic syndrome , is defined as the complete case dataset and is used for domain analysis . history of diabetes was defined as a random glucose 200 mg / dl , fasting blood glucose 126 mg / dl , or treatment with insulin or oral hypoglycemic agents . we used the metabolic syndrome definition published as part of the national cholesterol education program adult treatment panel iii recommendations ( 17 ) . the fasting blood glucose threshold of 100 mg / dl set by the american diabetes association was used as part of the definition for abnormal glucose metabolism ( 18 ) . abdominal obesity was defined as a waist circumference 102 cm ( 40 inches ) in men and 88 cm ( 35 inches ) in women . history of hypertension was defined as systolic blood pressure 130 mmhg or diastolic blood pressure 85 mmhg . the hypertension definition could also be met by a self - report of current use of antihypertensive medication or whether the patient responded yes to the question : have you ever been told by a doctor or other health professional that you had hypertension , also called high blood pressure ? hypertriglyceridemia was identified by triglycerides 150 mg / dl , and low hdl cholesterol was identified by hdl cholesterol 40 mg / dl in men or 50 mg / dl in women . the mean platelet volume ( mpv ) , platelet count , and other blood cell indices were measured using a beckman coulter method of counting and sizing , automatic diluting , and mixing . an automated chemical analyzer ( beckman syncrom lx20 , beckman coulter , fullerton , ca ) was used to determine nonfasting total cholesterol , triglycerides , and hdl cholesterol levels . nhanes uses a complex , multistage , probability - sampling design to select participants representative of the civilian , noninstitutionalized u.s . all analyses accounted for the complex sampling method following the nhanes analytic guidelines ( 19 ) . because the goodness - of - fit tests for normal distribution of the mpv show that the mpv is not normally distributed ( p 0.01 ) , the median ( interquartile [ iqr ] ) for mpv was used in the descriptive analyses . in regression analyses on the mpv , however , the continuous mpv was used according to the central limit theorem because the sample size is quite large ( 20 ) . to test the mpv level differences between presence and absence of diabetes , the metabolic syndrome , and each component of the metabolic syndrome , we obtained p values by using linear regression of continuous mpv on those dichotomous variables mentioned above ( table 1 ) . we also obtained wald p values by using logistic regression of presence and absence of diabetes , the metabolic syndrome , and each component of the metabolic syndrome on continuous mpv ( table 2 ) . mpv levels ( fl ) according to the presence or absence of diabetes , the metabolic syndrome , and each component of the metabolic syndrome prevalence of diabetes ( stratified by glycemic control ) and metabolic syndrome components by mpv quartile associations between mpv and glucose or hba1c were examined using pearson correlation coefficients . to explore the relationship between mpv and the prevalence of diabetes , logistic regression was used with diabetes as the dichotomous outcome and mpv as the main predictor . first , we added in demographics such as age , sex , and race into the logistic regression model . lastly , we sequentially added hdl cholesterol , waist circumference , high blood pressure , and triglycerides to the logistic regression model ( when waist circumference was included , bmi was excluded ) . all p values presented are two - tailed ; p 0.05 was considered statistically significant . all statistical analyses were performed using sas 9.2 software to account for the complex sampling design . the mean platelet volume ( mpv ) , platelet count , and other blood cell indices were measured using a beckman coulter method of counting and sizing , automatic diluting , and mixing . an automated chemical analyzer ( beckman syncrom lx20 , beckman coulter , fullerton , ca ) was used to determine nonfasting total cholesterol , triglycerides , and hdl cholesterol levels . fasting glucose was measured using a hexokinase method . nhanes uses a complex , multistage , probability - sampling design to select participants representative of the civilian , noninstitutionalized u.s . all analyses accounted for the complex sampling method following the nhanes analytic guidelines ( 19 ) . because the goodness - of - fit tests for normal distribution of the mpv show that the mpv is not normally distributed ( p 0.01 ) , the median ( interquartile [ iqr ] ) for mpv was used in the descriptive analyses . in regression analyses on the mpv , however , the continuous mpv was used according to the central limit theorem because the sample size is quite large ( 20 ) . to test the mpv level differences between presence and absence of diabetes , the metabolic syndrome , and each component of the metabolic syndrome , we obtained p values by using linear regression of continuous mpv on those dichotomous variables mentioned above ( table 1 ) . we also obtained wald p values by using logistic regression of presence and absence of diabetes , the metabolic syndrome , and each component of the metabolic syndrome on continuous mpv ( table 2 ) . mpv levels ( fl ) according to the presence or absence of diabetes , the metabolic syndrome , and each component of the metabolic syndrome prevalence of diabetes ( stratified by glycemic control ) and metabolic syndrome components by mpv quartile associations between mpv and glucose or hba1c were examined using pearson correlation coefficients . to explore the relationship between mpv and the prevalence of diabetes , logistic regression was used with diabetes as the dichotomous outcome and mpv as the main predictor . first , we added in demographics such as age , sex , and race into the logistic regression model . lastly , we sequentially added hdl cholesterol , waist circumference , high blood pressure , and triglycerides to the logistic regression model ( when waist circumference was included , bmi was excluded ) . all p values presented are two - tailed ; p 0.05 was considered statistically significant . all statistical analyses were performed using sas 9.2 software to account for the complex sampling design . baseline characteristics of the sample population are detailed in the supplementary table . among the 13,021 subjects , 48 % were men , 73 % were non - hispanic white , and the mean age was 47 years ( range 2185 years ) . the prevalence of cardiovascular disease , as defined by a history of myocardial infarction or stroke , in the overall population was 5.6 % . of the 11,730 subjects ( 90 % ) for whom diabetes status was available , 1,558 had diabetes , for an unadjusted weighted prevalence of 9.7 % . there were 4,034 subjects with metabolic syndrome , for an unadjusted weighted prevalence of 31 % . table 1 reports the median mpv levels in participants with and without diabetes , the metabolic syndrome , and its individual components . mpv was significantly higher in the subjects with diabetes ( 8.20 vs. 8.06 femtoliter [ fl ] , p = 0.007 ) . there was no significant difference in mpv between subjects with and without the metabolic syndrome ( 8.09 vs. 8.07 fl , p = 0.24 ) . for the individual components of the metabolic syndrome , mpv was significantly higher in subjects with abdominal obesity ( p = 0.03 ) and low hdl cholesterol ( p = 0.04 ) , and was not significantly different in those with high blood pressure ( p = 0.07 ) , abnormal glucose metabolism ( p = 0.71 ) , or hypertriglyceridemia ( p = 0.46 ) . median ( iqr ) mpv levels ( in fl ) increased with the number of components of the metabolic syndrome : 8.05 ( 7.548.67 ) if no components were present , 8.07 ( 7.558.66 ) if one component was present , 8.06 ( 7.568.65 ) if two components were present , 8.07 ( 7.588.73 ) if three components were present , 8.12 ( 7.578.73 ) if four components were present , and 8.23 ( 7.608.81 ) if five components were present . however , this finding failed to reach statistical significance ( p = 0.09 ) . significant correlations were found between mpv and fasting blood glucose ( p 0.0001 ) and between mpv and hba1c ( p 0.0001 ) in the population with diabetes . these correlations were no longer significant in the nondiabetic population ( p = 0.13 and p = 0.08 , respectively ) . subjects in higher mpv quartiles were more likely diabetic ( 8.5 % [ se 0.7 ] in quartile 1 , 8.9 % [ 0.7 ] in quartile 2 , 9.6 % [ 0.5 ] in quartile 3 , and 11.5 % [ 0.7 ] in quartile 4 ; p = 0.004 ; fig . this difference was most apparent in diabetic subjects with poor glycemic control ( table 2 ) . the se for the prevalence of diabetes is 0.7 in the 1st mpv quartile , 0.7 for the 2nd mpv quartile , 0.5 for the 3rd mpv quartile , and 0.7 for the 4th mpv quartile . to better understand the relationship between glycemic control and diabetes , we evaluated mpv in diabetic subjects stratified by hba1c . median ( iqr ) mpv ( in fl ) increased with hba1c : 8.09 ( 7.558.74 ) if hba1c 6.5 % , 8.24 ( 7.78.82 ) if hba1c was 6.67.9 % , and 8.35 ( 7.778.91 ) if hba1c 8 % ( p = 0.02 ) . the prevalence of metabolic syndrome was not different when evaluated by mpv quartiles ( table 2 ) ; however , the prevalence of abdominal obesity and low hdl was higher with increasing mpv quartiles . the estimated prevalence of diabetes increased with increasing mpv . the odds of having diabetes rose with increasing mpv levels and became statistically significant with mpv levels in excess of the 90th percentile ( table 3 ) . compared with subjects with mpv levels less than the 50th percentile ( 8.07 fl ) , subjects with higher mpvs had a graded increase in the odds of diabetes : odds ratio ( or ) 1.21 ( 95 % ci 0.981.49 ) for mpv 75th percentile ( 8.69 fl ) , 1.48 ( 1.191.84 ) for mpv 90th percentile ( 9.31 fl ) , and 2.17 ( 1.223.85 ) for mpv 99th percentile ( 10.57 fl ) . in a multivariable model adjusted for age , sex , and race / ethnicity , mpv was associated with prevalence of diabetes : or 1.15 ( 0.941.42 ) for mpv 75th percentile , 1.40 ( 1.121.75 ) for mpv 90th percentile , and 2.03 ( 1.133.67 ) for mpv 99th percentile . in further analyses also adjusting for bmi and platelet count , the association between higher mpv and diabetes was present with some attenuation of the magnitude : or 1.36 ( 0.991.89 ) for mpv 90th percentile and 1.68 ( 0.833.39 ) for mpv 99th percentile . when the components of metabolic syndrome ( hdl cholesterol , waist circumference , high blood pressure , and triglycerides ) were sequentially added to the modelthis is the largest study to date to examine mpv with diabetes and correlate mpv to the degree of glycemic control in a large unselected population . several small studies have noted a higher mpv in patients with diabetes ( 2126 ) . however , the data correlating mpv to glycemic control are conflicting and from relatively small or single - center populations ( 2126 ) . although one study correlated mpv to the presence of metabolic syndrome ( 27 ) , no study has evaluated mpv and the individual components of the metabolic syndrome . the current analysis is the largest study of platelet activity in diabetes and the only study to evaluate the complex relationship between mpv and diabetes , glycemic control , and the metabolic syndrome with its individual components . in the current study , platelet activity , as measured by mpv , is significantly higher in the diabetic population and , in particular , in those subjects with diabetes and poor glycemic control . ( 24 ) that demonstrated a graded association between mpv and the glucometabolic state ( diabetes impaired fasting glucose healthy control subjects ) . this is also consistent with a study of 105 subjects that demonstrated mpv was higher in the 35 subjects with diabetes and a hba1c level 7 % compared with subjects with diabetes and a hba1c 7 % ( 25 ) . furthermore , mpv was decreased at the 3 - month follow - up in the 30 diabetic patients in whom glycemic control was improved with intensive diet and pharmacotherapy ( 25 ) . although the underlying mechanism of higher mpv in diabetic subjects is incompletely understood , it has been suggested that increased mpv in diabetes may be due to osmotic swelling as a result of hyperglycemia ( 28 ) . another postulated mechanism from a study in mice demonstrated that insulin causes megakaryocytes to produce larger platelets ( 29 ) . alternatively , increased platelet size may reflect the presence of high platelet turnover and younger platelets ( 30 ) . larger platelets and younger platelets are both believed to be more physiologically active , have greater prothrombotic potential , and may be less responsive to antiplatelet therapy ( 11,31 ) . these data may help explain the increased cardiovascular risk and worse responsiveness to antiplatelet therapy observed in diabetes ( 32,33 ) . the current study demonstrates a significant correlation of mpv with degree of glycemic control only in the diabetic population and not in the nondiabetic population . among subjects with metabolic syndrome , the group with abnormal glucose metabolism ( versus normal glucose metabolism ) did not have a significantly higher mpv . these data suggest that hyperglycemia alone ( without diabetes ) is insufficient to see a difference in platelet activity . an underlying abnormal glucometabolic state and poor glycemic control is necessary to observe a higher mpv . of note , there was no significant difference in mpv in subjects with and without metabolic syndrome , suggesting that the association of metabolic syndrome to cardiovascular events may not be through the mechanism of increased platelet activity . only one small study of 345 subjects previously examined the relationship between metabolic syndrome and mpv ( 27 ) . although higher mpv was demonstrated in subjects referred for coronary angiography with metabolic syndrome compared with those without metabolic syndrome , many of the patients with metabolic syndrome also had coronary artery disease , whereas those without metabolic syndrome had only angiographically normal coronary arteries . subjects with coronary artery disease are known to have higher mpv than those without coronary artery disease ( 14,15 ) , and that elevated mpv is associated with atherosclerosis rather than metabolic syndrome itself is highly plausible . the current study found that mpv was significantly higher in subjects with low hdl cholesterol and abdominal obesity . hdl cholesterol and obesity have consistently been associated with markers of platelet activity ( 3436 ) . in fact , infusion of reconstituted hdl in subjects with diabetes resulted in a reduction of ex vivo platelet aggregation ( 37 ) . furthermore , weight loss in subjects with obesity was also associated with a decrease in platelet activity ( 38 ) . in addition to being a marker of risk , platelet activity may serve as a potential therapeutic target . this is an observational study , and because of the cross - sectional design , we can not establish a causal relationship between mpv and diabetes and degree of glycemic control . however , our findings do support the link between an underlying abnormal glucometabolic state , poor glycemic control , and platelet activity as measured by mpv . second , the mpv value evaluated in this study represents only one point in time . third , although specific instructions were given to run the blood count within 2 h of collection , sites were allowed to run the sample up to a maximum of 24 h , and , therefore , we are unable to determine time - sensitive edta - induced platelet swelling ( 39 ) . nonetheless , any bias introduced would have biased the results toward the null hypothesis . fourth , our study did not account for use of medications affecting platelet activity ; however , there are data suggesting that mpv is not influenced by platelet - directed therapies and therefore , this would unlikely affect the study results ( 40 ) . finally , the findings are limited to the cohort studied here , which included noninstitutionalized adults from the u.s . , and , thus , exclude hospitalized patients and may not be applicable to other nationalities . in conclusion , mpv is strongly and independently associated with the presence of diabetes . large prospective studies correlating vascular complications of diabetes with mpv should be considered and may support the role of monitoring mpv in the diabetic population . this is an observational study , and because of the cross - sectional design , we can not establish a causal relationship between mpv and diabetes and degree of glycemic control . however , our findings do support the link between an underlying abnormal glucometabolic state , poor glycemic control , and platelet activity as measured by mpv . second , the mpv value evaluated in this study represents only one point in time . third , although specific instructions were given to run the blood count within 2 h of collection , sites were allowed to run the sample up to a maximum of 24 h , and , therefore , we are unable to determine time - sensitive edta - induced platelet swelling ( 39 ) . fourth , our study did not account for use of medications affecting platelet activity ; however , there are data suggesting that mpv is not influenced by platelet - directed therapies and therefore , this would unlikely affect the study results ( 40 ) . finally , the findings are limited to the cohort studied here , which included noninstitutionalized adults from the u.s . , and , thus , exclude hospitalized patients and may not be applicable to other nationalities . in conclusion , mpv is strongly and independently associated with the presence of diabetes . large prospective studies correlating vascular complications of diabetes with mpv should be considered and may support the role of monitoring mpv in the diabetic population .\noutput:\n" }, { "from": "agent", "value": "objectivethe association between platelet activity , diabetes , and glucometabolic control is uncertain . we aim to investigate mean platelet volume ( mpv ) , a marker of platelet size and platelet activity , with the prevalence of diabetes , metabolic syndrome , and degree of glycemic control.research design and methodsthis is a retrospective analysis of 13,021 participants in the national health and nutrition examination survey from 1999 to 2004 . prevalence of diabetes was defined as nonfasting glucose > 200 mg / dl , fasting glucose 126 mg / dl , or treatment with hypoglycemic agents . presence of metabolic syndrome was determined by the national cholesterol education program adult treatment panel iii definition . odds ratios and 95 % cis were estimated by logistic regression.resultsmpv was significantly higher in subjects with diabetes ( 8.20 vs. 8.06 femtoliter [ fl ] , p < 0.01 ) but not in subjects with metabolic syndrome ( 8.09 vs. 8.07 fl , p = 0.24 ) . for the metabolic syndrome components , mpv was significantly higher in abdominal obesity ( p = 0.03 ) and low hdl ( p = 0.04 ) , and not different in high blood pressure ( p = 0.07 ) , abnormal glucose metabolism ( p = 0.71 ) , or hypertriglyceridemia ( p = 0.46 ) . there was a significant correlation between mpv and glucose ( p < 0.0001 ) and between mpv and hemoglobin a1c ( p < 0.0001 ) in subjects with diabetes . these correlations were no longer significant in those without diabetes . the adjusted odds of diabetes rose with increasing mpv levels and were most pronounced in subjects with mpv levels exceeding the 90th percentile ( 9.31 fl ) . the association between mpv and diabetes was most apparent in those with the poorest glucose control.conclusionsmean platelet volume is strongly and independently associated with the presence and severity of diabetes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the cerebral neocortex is notable for the richness of inputs to each area and also to each neuron . how a cortical neuron operates on these multiple inputs to produce an output is a major ongoing area of research . unlike other areas of the brain , such as the hippocampus , the anatomy of the cerebral neocortex is such that an experimenter can not easily control the direct inputs to a single neuron . many experiments have used the presentation of two separate visual stimuli in the receptive field ( rf ) of a visual cortical neuron as a surrogate for stimulating two inputs . this is a powerful technique , and much has been learned using it , especially as regards the effect of changes in selective attention . in general , studies using two stimuli in the rf of visual cortical neurons in a wide array of different areas have each found a diversity of results between different neurons . some studies have found that the general tendency is for the response to two stimuli to be near the weighted average of the responses to each stimulus presented separately ( moran and desimone , 1985 ; luck et al . , 1997 ; reynolds et al . , 1999 ; other studies have found that it was more common for the response to two stimuli to be similar in magnitude to the larger of the responses to the two stimuli presented separately , a winner - take - all or maxresult , at least for high - contrast stimuli ( sato , 1989 ; heuer and britten , 2002 ; rolls et al . , 2003 ; , 2004 ; finn and ferster , 2007 ; oleksiak et al . , 2011 ) . in an attempt to limit the possible interactions at earlier processing stages , studies in this laboratory used two stimuli that were presented as far apart from each other as possible while still remaining within the rf ( gawne and martin , 2002a ; gawne , 2008 ) , and found a strong tendency for a max operation . it has also been proposed that both weighted averaging and max are too simplistic and that models of summation within a rf with more free parameters are required ( ghose and maunsell , 2008 ) . it must also be pointed out that previous studies show a wide diversity of selection criteria for choosing the stimuli , which could account for the diversity of results between different studies . howevermost of these previous studies used only two fixed stimulus locations within the rf of each neuron . given that these studies typically find a wide range of behaviors between neurons , this raises the question as to whether this response diversity is due to different neurons implementing different operations which they each apply uniformly to all stimuli , or if different positioning of stimuli within the rf could lead to apparently different combinatorial rules for a single neuron . to address this issue the responses of 24 single primate v2 neurons to stimuli presented at six fixed locations within the rf and tothe results indicate that , for closely apposed stimuli within the rf , different configurations of stimuli often result in different operations as reflected in the response magnitude ( spike count ) . therefore you can not generalize the operation performed by a visual cortical neuron by sampling at a limited number of locations with the rfin particular , the response latency to two simultaneously presented stimuli was often locked to the shortest latency to a single stimulus , even though the magnitude of the response was changed . recordings were made from v2 in two awake macaques ( one macaca mulatta and one macaca fascicularis ) using methods described previously ( gawne , 2010 ) . using standard sterile technique , each monkey was anesthetized with isoflurane , and an 18 - mm - diameter peek ( polyetheretherketone ) plastic recording chamber was implanted over the dorsal posterior skull . high - strength plastic strips were also bolted to the skull with ceramic screws and connected to a head - fixation system . after recovery , each animal was trained to fixate on a small white square displayed on a computer monitor . eye position was monitored with a video tracking system ( iscan ) , and juice rewards given for maintaining fixation to within 0.5 of the target square . the video display was run at a frame rate of 85 hz , positioned 57 cm away from the eye , and was 39 cm wide and 27 cm tall . single - unit recording was made through a 23 - gage guide tube that penetrated the dura and allowed parylene - insulated microelectrodes ( microprobe ) with tip impedances of approximately 1.2 megohms to be introduced into cortex . peripheral v2 was used because the larger rfs reduced the effects of small errors of eye fixation . the electrode signal was amplified with an a - m systems 1801 amplifier , and digitized at 32 khz . final spike isolation was performed offline using a principal - components based technique ( abeles and goldstein , 1977 ) . the individual stimuli consisted of two white and two black squares positioned inside a larger square . these individual stimuli were luminance - balanced with the uniform gray background ( 6.96 cd / m ) . as illustrated in figure 1a , one stimulus was placed in the center of the receptive field of each neuron and the remaining five arranged around it . the distance between adjacent squares was always one - half the width of the squares . the size of the squares , and hence the overall spatial extent of the rectangular grid of six stimuli , were sized for each neuron individually so that all the stimuli lay within the extent of the rf as determined by hand mapping . as illustrated in figure 1b , the stimuli were then presented both separately and in every possible pair - wise combination . the normalized distance of separation between the stimuli was indicated as a d ( distance ) metric that varied from 1.0 for immediately adjacent stimuli to 2.2 for stimuli two over and one up or down . a null stimulus was also presented to determine the spontaneous firing rate over the recording interval . ( a ) one single stimulus was placed centered in the receptive field ( indicated by dashed circle , not shown in the actual display ) of each neuron , and five other stimuli were arranged around it separated by a spacing of one - half the stimulus width . ( b ) combinations of stimuli included : all six single stimuli , all 15 combinations of two stimuli , and a null stimulus . the paired stimuli were classified according to a normalized distance metric : d = 1 means adjacent stimuli , d = 1.4 means diagonally adjacent stimuli , d = 2 means stimuli two places removed , and d = 2.2 means two spaces horizontal and one vertical . the receptive field centers ranged from 9.2 to 26.8 from the center of gaze ( median 19.1 ) , and the size of the individual stimuli varied from 0.64 to 1.68 in width . the stimulus combinations were presented in shuffled random order , minimally 20 repetitions , and with a median of 32 repetitions . trials where the animals did not maintain fixation were not included in these totals and were not analyzed . rewards were given after every three or four stimulus presentations , and a 3 - s interval was inserted after the reward to minimize lick artifact in the spike channel . while the stimuli were not explicitly optimized for each neuron , only neurons that responded robustly to the single stimuli were used in this study . all neurons had statistically significant responses to single stimuli that were at least twice baseline for at least four of the six locations within the rf , and only five neurons did not meet this criteria for all six locations . the mean spike count for all single stimuli and all neurons was 23.96 spikes / s , and 90 % of the mean spike counts were between 4.1 and 50.0 spikes / s . the stimuli were flashed on for 24 video frames at 85 hz ( approximately 282 ms duration ) , in a data acquisition window that lasted 440 ms . these 440 ms epochs were separated by intervals that varied randomly from 400 to 800 ms , except when a reward was given . presenting the stimuli in short temporal epochs is consistent both with the brief duration of inter - saccadic intervals , and with the observed high speed of the visual system ( thorpe et al . , 1996 ) . additionally , for most visual cortical neurons the effects of flashing a stimulus on in the receptive field with the eyes fixed is comparable to having a saccade bring a constant stimulus into the receptive field ( richmond et al . hence , this paradigm closely approximates the normal operating conditions of primate visual cortical neurons . the animals were in a controlled behavioral state , performing a fixation task , where all the different stimulus configurations had the same lack of behavioral relevance . it is possible that there could have been uncontrolled covert shifts in attention , but because the stimuli were presented in random order , and because of the short - time analysis intervals , this could not have caused any systematic bias in the results . the single - unit responses were quantified by convolving the raw spike times with a gaussian kernel with a = 3 ms , which has the effect of low - pass filtering with a cutoff frequency of 44 hz . this creates a continuous spike density function ( silverman , 1986 ) , which is essentially a smoothed post - stimulus histogram , but with the advantage that it does not suffer from bin - edge artifact ( the problem with histograms when changing spike times near the edge of two bins radically alters the appearance of the response ) . these filter parameters can result in spike density functions with very high peak rates with very few spikes : a burst of just three spikes separated by inter - spike intervals of 3 ms results in peak rates of 300 spikes / s . while lower - frequency cutoff filters increase the precision of estimation of the firing rate over a defined epoch , exploring rapid response dynamics requires high - frequency cutoff filters . this could result in a selection bias for units that produce high - temporal precision firing : using a broader sigma ( such as 75 ms as was used in ghose and maunsell , 2008 ) , would allow significant responses to be obtained from units that fire at low rates or with low temporal precision relative to stimulus onset times , but would also make it difficult or impossible to study the short - time scale dynamics studied here . response latency was defined as the time that it took the response to go halfway from baseline to the maximum of the spike density function in the range of 30150 ms after stimulus onset . starting at baseline is a general procedure used for this technique to avoid false triggering for cells with high baselines and low peak responses ( lee et al . , 2007 ) . response magnitude , in mean spikes per second , was also defined during this interval . using the time to half - maximum response has the advantage that the number of trials per stimulus condition does not influence the measure of latency as compared to using the time where the response surpassed a particular sd ( lee et al . , 2007 ) , and has been shown to be a relatively robust and reliable indicator of latency ( levick , 1973 ) . for some cells , latency values could not be assigned for some stimulus cases because few or no spikes were produced , and these data were excluded from any analysis involving latency . the data were resampled with replacement 1000 times , and the latency recalculated each time , which allowed a bootstrapped 95 % confidence interval to be calculated . in order to quantify the interaction between stimuli within the rf of a neuron , we used a response index defined as the spike count for two stimuli presented simultaneously ( r12 ) , divided by the maximum of the response to each stimulus of the pair ( r1 , r2 ) presented individually . thus , a response index value of 1.0 indicates a winner - take - all or maxoperation , a value less than 1.0 indicates suppression , and a value greater than 1.0 indicates summation . it has been pointed out that accurately modeling the spatial summation of multiple stimuli within a rf can require models with more free parameters ( see ghose and maunsell , 2008 ) . however , the purpose of this response index was to provide a simple and robust indicator of the interaction between stimuli . using more complex models of summation with multiple free parameters per stimulus pair would also have been hard to interpret with more than two locations of stimulus positions within a rf . all experimental procedures and care of the animals were carried out in compliance with guidelines established by the national institute of health and were approved by the university of alabama at birmingham animal care and use committee . recordings were made from v2 in two awake macaques ( one macaca mulatta and one macaca fascicularis ) using methods described previously ( gawne , 2010 ) . using standard sterile technique , each monkey was anesthetized with isoflurane , and an 18 - mm - diameter peek ( polyetheretherketone ) plastic recording chamber was implanted over the dorsal posterior skull . high - strength plastic strips were also bolted to the skull with ceramic screws and connected to a head - fixation system . after recovery , each animal was trained to fixate on a small white square displayed on a computer monitor . eye position was monitored with a video tracking system ( iscan ) , and juice rewards given for maintaining fixation to within 0.5 of the target square . the video display was run at a frame rate of 85 hz , positioned 57 cm away from the eye , and was 39 cm wide and 27 cm tall . single - unit recording was made through a 23 - gage guide tube that penetrated the dura and allowed parylene - insulated microelectrodes ( microprobe ) with tip impedances of approximately 1.2 megohms to be introduced into cortex . peripheral v2 was used because the larger rfs reduced the effects of small errors of eye fixation . the electrode signal was amplified with an a - m systems 1801 amplifier , and digitized at 32 khz . final spike isolation was performed offline using a principal - components based technique ( abeles and goldstein , 1977 ) . the individual stimuli consisted of two white and two black squares positioned inside a larger square . these individual stimuli were luminance - balanced with the uniform gray background ( 6.96 cd / m ) . as illustrated in figure 1a , one stimulus was placed in the center of the receptive field of each neuron and the remaining five arranged around it . the distance between adjacent squares was always one - half the width of the squares . the size of the squares , and hence the overall spatial extent of the rectangular grid of six stimuli , were sized for each neuron individually so that all the stimuli lay within the extent of the rf as determined by hand mapping . as illustrated in figure 1b , the stimuli were then presented both separately and in every possible pair - wise combination . the normalized distance of separation between the stimuli was indicated as a d ( distance ) metric that varied from 1.0 for immediately adjacent stimuli to 2.2 for stimuli two over and one up or down . a null stimulus was also presented to determine the spontaneous firing rate over the recording interval . ( a ) one single stimulus was placed centered in the receptive field ( indicated by dashed circle , not shown in the actual display ) of each neuron , and five other stimuli were arranged around it separated by a spacing of one - half the stimulus width . ( b ) combinations of stimuli included : all six single stimuli , all 15 combinations of two stimuli , and a null stimulus . the paired stimuli were classified according to a normalized distance metric : d = 1 means adjacent stimuli , d = 1.4 means diagonally adjacent stimuli , d = 2 means stimuli two places removed , and d = 2.2 means two spaces horizontal and one vertical . the receptive field centers ranged from 9.2 to 26.8 from the center of gaze ( median 19.1 ) , and the size of the individual stimuli varied from 0.64 to 1.68 in width . the stimulus combinations were presented in shuffled random order , minimally 20 repetitions , and with a median of 32 repetitions . trials where the animals did not maintain fixation were not included in these totals and were not analyzed . rewards were given after every three or four stimulus presentations , and a 3 - s interval was inserted after the reward to minimize lick artifact in the spike channel . while the stimuli were not explicitly optimized for each neuron , all neurons had statistically significant responses to single stimuli that were at least twice baseline for at least four of the six locations within the rf , and only five neurons did not meet this criteria for all six locations . the mean spike count for all single stimuli and all neurons was 23.96 spikes / s , and 90 % of the mean spike counts were between 4.1 and 50.0 spikes / s . the stimuli were flashed on for 24 video frames at 85 hz ( approximately 282 ms duration ) , in a data acquisition window that lasted 440 ms . these 440 ms epochs were separated by intervals that varied randomly from 400 to 800 ms , except when a reward was given . presenting the stimuli in short temporal epochs is consistent both with the brief duration of inter - saccadic intervals , and with the observed high speed of the visual system ( thorpe et al . , 1996 ) . additionally , for most visual cortical neurons the effects of flashing a stimulus on in the receptive field with the eyes fixed is comparable to having a saccade bring a constant stimulus into the receptive field ( richmond et al . , 1999 ; gawne and martin , 2002b ) . hence , this paradigm closely approximates the normal operating conditions of primate visual cortical neurons . the animals were in a controlled behavioral state , performing a fixation task , where all the different stimulus configurations had the same lack of behavioral relevance . it is possible that there could have been uncontrolled covert shifts in attention , but because the stimuli were presented in random order , and because of the short - time analysis intervals , this could not have caused any systematic bias in the results . the single - unit responses were quantified by convolving the raw spike times with a gaussian kernel with a = 3 ms , which has the effect of low - pass filtering with a cutoff frequency of 44 hz . this creates a continuous spike density function ( silverman , 1986 ) , which is essentially a smoothed post - stimulus histogram , but with the advantage that it does not suffer from bin - edge artifact ( the problem with histograms when changing spike times near the edge of two bins radically alters the appearance of the response ) . these filter parameters can result in spike density functions with very high peak rates with very few spikes : a burst of just three spikes separated by inter - spike intervals of 3 ms results in peak rates of 300 spikes / s . while lower - frequency cutoff filters increase the precision of estimation of the firing rate over a defined epoch , exploring rapid response dynamics requires high - frequency cutoff filters . this could result in a selection bias for units that produce high - temporal precision firing : using a broader sigma ( such as 75 ms as was used in ghose and maunsell , 2008 ) , would allow significant responses to be obtained from units that fire at low rates or with low temporal precision relative to stimulus onset times , but would also make it difficult or impossible to study the short - time scale dynamics studied here . response latency was defined as the time that it took the response to go halfway from baseline to the maximum of the spike density function in the range of 30150 ms after stimulus onset . starting at baseline is a general procedure used for this technique to avoid false triggering for cells with high baselines and low peak responses ( lee et al . , 2007 ) . response magnitude , in mean spikes per second , was also defined during this interval . using the time to half - maximum response has the advantage that the number of trials per stimulus condition does not influence the measure of latency as compared to using the time where the response surpassed a particular sd ( lee et al . , 2007 ) , and has been shown to be a relatively robust and reliable indicator of latency ( levick , 1973 ) . for some cells , latency values could not be assigned for some stimulus cases because few or no spikes were produced , and these data were excluded from any analysis involving latency . the data were resampled with replacement 1000 times , and the latency recalculated each time , which allowed a bootstrapped 95 % confidence interval to be calculated . in order to quantify the interaction between stimuli within the rf of a neuron , we used a response index defined as the spike count for two stimuli presented simultaneously ( r12 ) , divided by the maximum of the response to each stimulus of the pair ( r1 , r2 ) presented individually . thus , a response index value of 1.0 indicates a winner - take - all or maxoperation , a value less than 1.0 indicates suppression , and a value greater than 1.0 indicates summation . it has been pointed out that accurately modeling the spatial summation of multiple stimuli within a rf can require models with more free parameters ( see ghose and maunsell , 2008 ) . however , the purpose of this response index was to provide a simple and robust indicator of the interaction between stimuli . using more complex models of summation with multiple free parameters per stimulus pair would also have been hard to interpret with more than two locations of stimulus positions within a rf . all experimental procedures and care of the animals were carried out in compliance with guidelines established by the national institute of health and were approved by the university of alabama at birmingham animal care and use committee . figure 2 shows example results from three neurons . each row represents a subset of the results from a single neuron . each panel illustrates the average spike density function of the responses , overlaying the responses to both stimuli presented separately , and both presented together . the neuron in the topmost row ( figures 2a d ) showed either weighted averaging ( figures 2a , d ) or max behavior ( figures 2b , c ) in the response magnitude . however , for all pairs of stimuli , the response latency was precisely locked to the shortest latency of the responses to both stimuli presented separately . for the neuron in the middle row the response magnitude showed weighted averaging ( figures 2e , h ) , max ( figure 2 g ) , or enhancement ( figure 2f ) depending on which pair of stimuli were used . as with the first neuron , the response latency for two stimuli was generally very tightly locked to the shortest latency response of the individual stimuli , but there was one exception ( figure 2e ) . when the response to a pair of stimuli has a different latency than the shortest latency to one stimulus by itself , this will be termed a latency shift . the third neuron in this example figures 2i l also had response magnitude effects that ranged from max ( figure 2i ) , weighted averaging ( figures 2j , l ) , and enhancement ( figure 2k ) . however , the latency shifts were more common here : in figures 2i , j the latency shifts were on the order of 1 ms , and in figures 2k , l on the order of 8 ms . ( a d ) are from one neuron , and ( e h ) from another , and ( i l ) from a third . the configurations of the stimuli are indicated schematically in each panel similar to that shown in figure 1 . black lines are the responses to both stimuli presented at the same time , and red and blue lines are for each stimulus presented separately . dashed lines are the mean plus or minus one se . ( a , d ) the response to the pair has a magnitude in between the responses to the stimuli presented separately ( weighted averaging ) . ( b , c , g ) the magnitude of the response to a pair is equal to the magnitude of the larges response to a single stimulus ( max ) . ( e ) in this case the magnitude of the response to both stimuli is closer to the weakest of the two responses , but there is also a strong latency shift . ( f ) the magnitude of the response to the pair is greater than the response to either stimulus presented separately ( summation ) . ( i , j ) latency shifts are on the order of 1 ms . ( k , l ) large latency shifts are observed for both summation ( k ) and suppression ( l ) . figure 3 shows summary data from all pair - wise stimulus combinations for all neurons in the study . the tendency across all neurons and all inter - stimulus separation distances was for there to be suppression / averaging , but the range of the results was considerable . some neurons did tend to have the same sort of interaction for all pairs of stimuli , but most neurons displayed a wide range of different sorts of interactions within their rfs depending on the specific configuration of the stimulus pairs . a one - way anova on the mean response index for each neuron was significant p 0.001 , demonstrating that there was a significant difference between cells in how pairs of stimuli interact in their rfs , but it only explained 27.6 % of the variance . in other words , some neurons tend to respond to pairs of stimuli with a degree of consistency , but overall , the results are dominated by the variability within a single neuron . ( a ) the degree to which two stimuli interact ( response index ) in their effect on the responses of a visual cortical neuron , as a function of the normalized distance between stimuli . each point is from a single pair of stimuli for a single neuron . the median and 25 % quartile ranges for the data are also shown . some neurons did tend toward one level of response , but overall the trend was weak , and neurons typically showed a wide variety of behavior depending upon the position of the stimuli within their receptive fields . figures 4a c shows plots of response strength vs. response latency for three example neurons . there is an occasional tendency for the weakest responses to have the longest latencies ( see figure 4c ) , but in general there was no correlation between response strength and latency . plot of response latency vs. strength for three example neurons ( a c ) . responses to single stimuli are indicated via blue circles ; responses to pairs of stimuli via black squares . horizontal bars are se of the mean ; vertical bars are bootstrapped 95 % confidence intervals . in generalthere is no relationship between response strength and latency . in ( c ) for the weakest responses latency is prolonged , but this was rarely seen , because for many cells all the responses were relatively robust , and also because for the weakest responses it was often the case that latency could not be defined . figure 5a plots the normalized response strength vs. the relative latency shift for all pair - wise stimulus combinations for all neurons in this study . strength was normalized to the strongest response of any condition for each neuron , and latency is relative to the median latency for each neuron . there is effectively no correlation between the response strength and latency for the stimuli used in this study . figure 5b illustrates the response latency shift for a pair of stimuli relative to the response shortest latency to either of the two stimuli presented alone . there is a significant dispersion of latency shifts , with a roughly equal tendency for the latencies to be shifted to shorter or longer times . however , there were many cases where the response latency to two stimuli was precisely locked to the shortest of the latencies of to each stimulus presented separately . note that the distribution is not a gaussian , but rather has a strong peak at zero phase delay that falls away in an approximately exponential manner , suggesting that there is something special about small latency shifts . the sd of this distribution is large because of outliers ( 9.3 ms ) , but 51.9 % of the distribution lies within 2 ms of zero . ( a ) plots of normalized response strength vs. relative latency for all neurons and all stimulus combinations in this study . strength was normalized to the strongest response , and latency was calculated as a difference relative to the median latency . ( b ) plot of the shift in latency for the response of a cell to two stimuli , relative to the shortest latency of the response to each stimulus in the pair presented separately . a negative number means that the response to two stimuli has a shorter - latency than the shortest of the response to a single stimulus ( this could be considered a phase - advance ) . at least for the population of neurons and stimulus conditions used in this experiment , there is very little consistency in how the responses to two stimuli are related to the responses to single stimuli . we can consider that the function applied to two visual stimuli is more strongly related to the positions of the stimuli within the rf than it is a fixed property of a specific neuron itself . with hindsight this should not be surprising : two widely separated stimuli may have separate perceptual identities , but when stimuli are in close proximity their relative position should have strong effects on their perceptual meaning and hence on their neural processing . for example , as two separate spots are brought closer together they could start to be treated as a single bar , and different positional shifts could engage end - stopping mechanisms , etc . however , as with most previous studies of this nature , here it was not possible to probe how the monkey perceived the pairs of stimuli , so this remains speculative . studies where different configurations of stimuli have different behavioral relevance , or are specifically designed to be part of larger forms , may help to answer such questions . the lack of an effect of the distance of separation between stimuli was unexpected ( see figure 3a ) , but even those stimuli with the greatest degree of separation were still not as far apart as was the case in previous studies in this lab . it has been proposed that many cortical neurons perform a single canonical operation on their inputs . for example , the output of a neuron could be driven by the single strongest input , a winner - take - all rule ( riesenhuber and poggio , 1999 ) . however , the results of this study demonstrate that you can not in general determine the rule by only using two stimulus locations , because the rule could be different for stimuli that are located in different areas of the rf . it must be emphasized that stimulating a visual cortical neuron with discrete visual stimuli is not the same thing as directly controlling the inputs to that neuron . this is because there are many processing stages between the visual image that is focused on the retina , and a visual cortical neuron , including the processing in the neural retina , thalamus , and any earlier cortical areas . therefore it is possible that many of the neurons in this study did have a single computational rule that they applied to all of their direct inputs equally , but that the observed sensitivity of the responses to changes in position within the rf was due to interactions between the stimuli at earlier stages in processing . as you change the configurations of stimuli inside the rf of a visual cortical neuron , the response strength varies in complicated patterns that presumably reflect aspects of form processing . however , the response latency has a very different pattern of results , and tended to remain fixed as stimuli were combined in different ways . if these neurons were summing up excitatory and inhibitory inputs over some period of time , there should have been a link between strength and latency : for example , if the response to two stimuli was larger than the response to either alone , the response latency should have been shorter . previous studies have demonstrated a separation of the response magnitude and latency of visual cortical neurons ( carandini and heeger , 1994 ; albrecht , 1995 ; gawne et al . , 1996 ; reich et al . , 2001 ) , and the results here are in accord with and extend these previous results . one interpretation is that response strength represents visual form , and that it therefore changes with changes in the relative configuration of the two stimuli in the rf of the neurons . latency , however , could represent stimulus saliency , and at least under some conditions the saliency of an entire form could be inherited from the most salient single component . in previous studies from this laboratory , relative response times were varied by either changing the spatial frequency of the stimuli ( gawne and martin , 2002a ; for references to the effects of spatial frequency on response latency see marr and poggio , 1979 ; nishihara , 1984 ; anderson and van essen , 1987 ; parker et al . , 1997 ; bredfeldt and ringach , 2002 ; menz and freeman , 2003 ; frazor et al . , 2004 ) , or by changing the contrast and also the relative onset timing of the stimuli ( gawne , 2008 ) . evidence for rapid temporal gating was observed in these studies , where the temporal response to pairs of stimuli was completely dominated by the temporal response to the stimulus that by itself elicited the shortest latency . a similar effect is seen here , in that the response to two stimuli often has the same latency as the shortest single latency response , and there is no second peak in the response to two stimuli that would correspond to the peak of the longer latency response . however , the results of this study showed an important difference from previous studies : the stimulus that by itself elicited the longest response latency could often affect the magnitude of the shorter - latency response , but without always shifting its latency . it has been proposed that much of cortical computation is performed at the millisecond level using feed - forward circuitry ( delorme and thorpe , 2001 ; vanrullen and thorpe , 2002 ; vanrullen , 2007 ; liu et al . , 2009 ) . a consequence of rapid feed - forward processing should be that changing the configuration of the stimuli could change the magnitude of the response , but have little or no effect on the latency of the response ( because the computations are so rapid ) . therefore , it is hypothesized that for those specific cases when you change the configuration of visual stimuli , and you change the response magnitude of a visual cortical neuron , but you do not change the response latency , this may indicate the involvement of rapid feed - forward processing . on the other hand , imagine a processing mechanism that integrates inputs over a relatively long period of time before generating a response . in this case , changes in response magnitude should often be coupled with significant changes in response latency . it is difficult to conceive of a mechanism that integrates inputs over a long period of time , where changing the inputs results in changes in response magnitude but not latency . such a system could in principle exist , but it would need to be precisely and deliberately tuned to consistently produce such a result . many researchers have argued that much of visual perception is due to a hierarchical feed - forward system of processing ( fukushima , 1980 ; rolls , 1991 ; riesenhuber and poggio , 1999 ; vanrullen and thorpe , 2002 ) . however , it has also been argued that feedback mechanisms are critical for vision ( lamme and roelfsema , 2000 ; bullier , 2001 ; hochstein and ahissar , 2002 ; garrido et al . , 2007 ) . more work remains to be done , but it is hypothesized that the relationship between changes in response latency and response magnitude as a stimulus configuration is changed , constitutes a temporal signature that can , at least under some conditions , distinguish between these different mechanisms . at the very least , these results should provide powerful constraints on the development of dynamical models of cortical processing . the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "many previous studies have used the presentation of multiple stimuli in the receptive fields ( rfs ) of visual cortical neurons to explore how neurons might operate on multiple inputs . most of these experiments have used two fixed stimulus locations within the rf of each neuron . here the effects of using different positions within the rf of a neuron were explored . the stimuli were presented singly at one of six locations , and also at 15 pair - wise combinations , for 24 v2 cortical neurons in two macaque monkeys . there was considerable variability in how pairs of stimuli interacted within the receptive field of any given neuron : changing the position of the stimuli could result in enhancement , winner - take - all , or suppression relative to the strongest response to a stimulus presented by itself . across the population of neurons there was no correlation between response strength and response latency . however , for many stimulus pairs the response latency was tightly locked to the shortest response latency of any single stimulus presented by itself independent of changes in response magnitude . in other words , a stimulus that by itself elicited a relatively long latency response , would often affect the magnitude of the response to a pair of stimuli , but not change the latency . these results may provide constraints on the development of models of cortical information processing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bilateral renal lymphoma frequently presents as an acute kidney injury ( aki ) 3 . with systematic chemotherapy for renal lymphomahowever , in the case we describe herein , the patient 's kidney function greatly recovered after an open renal biopsy and before systematic chemotherapy . here , we review and discuss this unique case . a 64yearold japanese man was referred to our clinic with gross hematuria , hypertension ( blood pressure 180/75 mmhg ) , and kidney insufficiency ( serum creatinine [ cr ] 2.17 mg / dl ) . magnetic resonance imaging ( mri ) demonstrated multiple bilateral renal tumor lesions , with a low intensity on t1 and t2weighted images ( fig .1 ) . the serum soluble interleukin2 receptor was elevated to 870 u / ml ( normal range 145519 u / ml ) . mri showing kidney enlargement and bilateral renal multiple tumors , with low intensity on t1 and t2weighted images .2 ) . f2fluoro2deoxyglucose positron emission tomography / computed tomography ) fdgpet / ct showed intense uptake in bilateral kidneys , a paraaortic lymph node , and the right atrial appendage . we suspected malignant lymphoma and performed an open right kidney biopsy for a histopathologic diagnosis . the kidney was hard and massively swelled , and the tumor lesions could not be distinguished from the normal renal parenchyma . we freed the entire kidney from gerota 's fascia and made 1 cm incisions in the renal capsule and obtained first and secondcuneiform specimens which were insufficient for diagnosis because of the inadequate number of infiltrating lymphocytes . the third tissue specimen enabled the diagnosis : nonhodgkin 's lymphoma ( diffuse large bcell lymphoma / barkitt lymphoma ) ( fig . ( a ) renal biopsy showed diffuse interstitial infiltration by lymphocytes ( hematoxylineosin stains [ he ] 100 ) , ( b ) diffuse immunoreactivity of lymphocytes to cd10 , ( c ) no immunoreactivity of lymphocytes to cd3 ( he 200 ) . after the open renal biopsy , the aki was unexpectedly getting better and the patient was withdrawn from hemodialysis ( fig . he was treated with doseadjusted systemic chemotherapy ( the rchop protocol : rituximab , cyclophosphamide , doxorubicin , vincristine , and prednisone ) . the patient was discharged after the 1st cycle of chemotherapy , and the systemic chemotherapy was continued . renal involvement is common in hematologic malignancies and lymphomas , and it is observed in approximately 34 % of patients in advanced stages of these cancers 4 . however , primary renal lymphoma ( prl ) is relatively rare , with only a few welldocumented cases reports in the literature 1 , 2 . the term prl is usually defined as when the disease is limited to the renal parenchyma and has not invaded from an adjacent lymphomatous mass 2 . therefore , the status of prl as a primary disease or the first manifestation of a rapidly progressive disease is controversial 2 . proposed the following diagnostic criteria for prl : ( 1 ) renal failure as the initial presentation ; ( 2 ) enlargement of the kidneys without obstruction and without other organ or nodal involvement ; ( 3 ) the diagnosis is made only by renal biopsy ; ( 4 ) absence of other causes of renal failure ; and ( 5 ) the rapid improvement of renal function after radiotherapy or systemic chemotherapy 5 . our patient 's case matched almost all of these criteria , but he could not be diagnosed as having prl due to the involvement of the lymph node and the right atrial appendage . there is no difference in its gender distribution , and the patients ' ages at onset have ranged from 2 to 90 years 7 , 8 . the symptoms of prl are abdominal pain , gross hematuria , fever , and weight loss 7 , 8 . ultrasonography and ct show kidney enlargement and hypovascular tumors . according to cohan et al . , four patterns of renal lymphoma can be identified on ct : ( 1 ) the singlemass type ; ( 2 ) the multiplemass type ; ( 3 ) invasion of the contiguous retroperitonealmass type ; and ( 4 ) the perinephricmass type 9 . mri shows renal tumors with low or isointensity on t1weighted images and low intensity on t2weighted images 10 . in histopathologic sections of renal lymphoma , the prognosis of prl is usually poor , with a 1 year mortality rate of 75 % 11 . many reported cases show renal insufficiency by lymphomatous infiltration of the kidney 3 , 5 , 6 , 12 . according to tornroth et al . , 3 acute renal failure or nephroticrange proteinuria was the principal indication for percutaneous kidney biopsy in 48 ( 87 % ) of their 55 patients with bilateral renal lymphoma . they also proposed a mechanism of acute kidney injury in which an interstitial proliferation of lymphoma increases the interstitial pressure without much destruction of renal parenchymal elements 3 . increased pressure , however , could cause renal insufficiency by tubular obstruction , compression of the peritubular capillaries with increased postglomerular vascular resistance , or modulation of the tubuloglomerular feedback mechanism 3 . in many reports , renal insufficiency by lymphomatous infiltration recovered rapidly after treatment 3 , 11 , 12 , 13 , 14 . in our patient 's case , hemodialysis and multiple incisions of the renal capsule for biopsy may have led to his kidney function recovery ; the treatment also recovered his kidney function as described . to the best of our knowledge , the recovery of kidney function before systematic chemotherapy for a lymphoma has not been reported . in our patient , the dissection of the renal capsule , by chance , may have decreased in the renal internal pressurethis case supported the theory of renal insufficiency by compression of the peritubular capillaries with increased postglomerular vascular resistance or moderation of the tubuloglomerular feedback mechanism by a lymphomatous infiltration of the kidney . both needle biopsies and open biopsiesare used for the diagnosis of renal lymphoma 1 , 12 . in our patient , since his aki worsened rapidly and the flow cytometry for the current precise diagnosis of lymphoma required a substantial amount of malignant cells , we chose an open biopsy . in fact , we needed to cut out renal tissue specimens three times to obtain the final diagnosis , since lymphoma cells infiltrated heterogeneously into the renal parenchyma . based on these observations , we recommended an open biopsy rather than a needle biopsy for the precise and accurate diagnosis if a renal lymphoma is suspected . this case supported the theory that renal insufficiency by lymphomatous infiltration of kidney is caused by compression of peritubular capillaries with increased postglomerular vascular resistance , or modulation of the tubuloglomerular feedback mechanism . rapid diagnosis and treatment initiation are essential to preserve renal function and improve the prognosis . informed consent was obtained from the patient for publishing this case report and accompanying images . we declare that there is no conflict of interests regarding the publication of this article .\noutput:\n" }, { "from": "agent", "value": "key clinical messagerenal lymphoma as an initial lesion is relatively rare . bilateral renal lymphoma frequently presents as acute kidney injury . with systematic chemotherapy for the lymphoma , patients usually recover their kidney function . however , in the case we describe here , the patient 's kidney function recovered greatly after an open renal biopsy . here , we review and discuss this unique case ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the role of steroid hormones in the pathogenesis of periodontal diseases is well established . oral contraceptives ( ocs ) may enhance periodontal breakdown by reducing the resistance to dental plaque and may induce gingival enlargement ( ge ) in otherwise healthy females .1,2 ocs accentuate the gingival response to local irritants similar to that seen in pregnancy .3 the incidence and severity of gingival diseases are positively correlated with plasma sex hormone concentrations and duration of use .4 the long term use of oc may cause increased gingival inflammation , clinical attachment loss ( cal ) and gingival enlargement .2,4,5 in contrast , a clinical study was unable to demonstrate any effect of low dose ocs on gingival tissue .6 human gingiva contains estrogen and progesterone receptors . the latter influence the periodontal tissues to act as target organ for sex hormones .2 in most cases , the ge was reversed when oc was discontinued or the dosage reduced .2 we report here a case of successfully treated oc induced periodontal endocrinopathies ( ocipe ) . in may 2007 , a 32 - year - old , otherwise healthy woman reported in our periodontal clinic , with chief complaint of gum bleeding followed by swelling of gingiva for the last four years . the condition was first noticed by the patient after two years of combined pill ( lynestrenol 2.5 mg plus ethinyl oestradiol 50 g - sukhi , famy care ltd , india ) intake whereas tooth mobility appeared after 3.5 years . she underwent phase - i therapy ( scaling & root planning - srp ) twice by her dentist following withdrawal of oc six months ago that resulted in improvement of bleeding tendency only . the estimated value of plasma estradiol and progesterone level at the stage of oc use was 81pg / ml and 16ng / ml respectively . the plasma estradiol and progesterone level was decreased to 75pg / ml and 12ng / ml respectively after withdrawal of oc . family history of ge , other drug histories and menstrual history were non - contributory . periodontal examination revealed painless , reddish - pink , soft , diffuse ge over severely compromised periodontium , mild to severe generalized cal in spite of fair oral hygiene , insufficient attached gingiva ( ag ) in second and third quadrant along with multiple mobile ( miller s degree 2 ) teeth . the recorded pocket depth and tooth mobility of diseased periodontiumafter thorough history taking and clinical examination , the patient was advised to do necessary blood examinations and orthopantomogram ( opg ) ( figure 1 ) . patient education , motivation and oral hygiene instructions ( ohis ) were explained to her . considering patient s history , oral examination and evaluating the reports of investigations ( i.e. , normal blood picture , normal plasma estrogen - progesterone level , generalized horizontal bone loss in opg ) , the casewas provisionally misdiagnosed as generalized chronic periodontitis ( ignoring patient s drug history ) and traditional phase - i therapy was performed twice at six weeks interval . gingival response was re - evaluated three months thereafter ; when inflammatory condition of gingiva was improved enough but ge was not reversed ( figure 2 ) . when the lesion was not reversed following withdrawal of the pill or by repeated non - surgical measures , incisional biopsies were performed at keratinized gingival tissues , disto - buccal to second molars of each quadrant and submitted for microscopic examination . tissue sections revealed variably thick hyper - keratinized stratified squamous epithelium and elongated , broad retepegs . the connective tissue stroma was thick , edematous but fibrous in nature , containing mature fibroblasts , mild degree of chronic inflammatory infiltrates and numerous , small blood vessels . these characteristic microscopic findings ( figure 3a , b ) were very similar to ge in pregnancy or long standing pyogenic granuloma . extensive patient s history , clinical , radiographic and especially microscopic findings were interpreted as diagnostically consistent with oc induced periodontal endocrinopathies ( i.e. , attachment loss , gingival enlargement ) . surgical intervention was planned for correction of enlarged gingiva to prevent progressive periodontal breakdown and to maintain better access for plaque control . each quadrant was treated according to criteria for surgical method selection [ i.e. , probing pocket depth ( ppd ) , remaining ag , pattern of bone loss , furcation defects in opg ] . periodontal surgical procedures were planned in the following manner for each quadrant : ( a ) right maxillary canine to second molar - modified widman flap surgery ( i.e. , ppd 4 mm , ag 2 mm ) . ( b ) left maxillary canine to second molar apically repositioned flap ( arf ) surgery with modification buccally ( designed to preserve adequate width of ag ) , internal bevel gingivectomy palatally , along with excision of localised gingival excess over maxillary tuberosity . ( c ) left mandibular lateral incisor to second molar - similar arf surgery ( ppd 5 mm , cal 5 mm , ag 2 mm , severe ge buccally ) with modification . ( d ) right mandibular canine to second molar - internal bevel gingivectomy was designed to remove moderate amount of enlarged gingiva ( ppd 4 mm , remaining ag 3 mm , cal 3 mm ) bucco - lingually . standard surgical procedures were performed according to treatment plan .7 basic surgical procedures were modified at second and third quadrant . in either area , split - thickness flap was prepared by sharp dissection up to the level of mucogingival junction to create a thin flap outside as well as to sacrifice entire gingival excess internally ( figure 4a , b ) . then full - thickness flap was elevated apically to facilitate repositioning of flap towards mucobuccal fold . close monthly follow up for first postoperative ( p.o ) year and three monthly thereafter , were scheduled to assess possible relapse , progressive attachment loss and to provide comprehensive maintenance care . pocket depth ( figure 5 ) , tooth mobility and gingival enlargement were reduced remarkably ( table 1 ) but attachment gain was minimal . although periodontal surgery was satisfactory but p.o plaque control and patient compliance provided excellent response to therapy . the patient has been closely followed for over 3 years and to date reveals no evidence of recurrence of ge ( figure6 ) and progressive attachment loss . combined pill is the most popular , most efficacious oc agent and one of the most widely used classes of drugs in the world .8 nonetheless , ocipe are relatively scarce in recent decades , perhaps due to current low dose oc formulations , alternate withdraw / choice of contraception methods , good plaque control and nst . an understanding of the etiology of periodontal endocrinopathies is essential for the prevention and / or treatment of sex steroid hormone induced periodontal diseases . gingival changes are related to the stimulation of specific populations of fibroblasts by estrogen , increased vascular permeability and proliferation .2 both the sex hormones decrease gingival immune response to plaque bacteria .9 inflamed gingival tissues are capable of metabolizing sex hormones to active metabolites at higher rate ; 10 thus , local irritants may exaggerate oc induced gingival changes . therefore , the response of the periodontium in ocipe is probably multifactorial in nature where dose , duration of pill usage , dental plaque and sex hormone - sensitive cells are the key modifying factors .2,5 literatures reported gingival changes with the use of high - dose oc compositions ( 50 g / day estrogen and 4 mg progesterone / day ) prior to the 1980s but rare with current low dose formulations .4,11 in our case , patient received low dose oc formulation over 5 years . lynestrenol is strong synthetic progesterone , which has additional weak estrogenic effect .12 so gingival changes observed in our case are assumed to be related with additional estrogenic and strong progestational effects of the pill . the periodontium would appear to be an odd target of ocs .2 in gingival tissues , estrogen is responsible for keratinization and proliferative changes in epithelium and increased fibroblastic activity .2 progesterone increases proliferation , dilatation , tortuosity and permeability of gingival microvasculatures , facilitates bone resorption , decreases collagen production ; thus promoting tissue catabolism and delaying repair .2,13,14 hence , estrogen and especially progesterone in oc can contribute to periodontal changes similar to pregnancy .3,5 our reported case was in excellent agreement with previous study which demonstrated the possibility of gingival changes with low dose oc formulations .15 an interesting aspect of this case relates to the fact that the ge was not reversed either on discontinuing oc or by repeated srp , though literatures revealed complete disappearance in most cases .6 physiological concentrations of estradiol were found to stimulate gingival fibroblast proliferation in vitro .2 in our case , persistence of ge even after withdrawal of oc questions the role of physiologically fluctuating level of sex hormones related to menstrual cycle on presensitized gingival cells . moreover , presence of deep pockets and ge hinder the adequacy of oral hygiene measures which may be another cause of persistence of ge . therefore , it was necessary to determine the nature of lesion or to rule out diverse causes such as idiopathic ge , and hemopoetic malignancies by incisional biopsies of gingiva prior to surgery . although long standing history limits the possibility of malignant involvement but clinical findings ( gum bleeding , non - reversibility of ge ) led us to consider it for differential diagnosis . light microscopy revealed consistent spectrum of findings similar to that seen in pregnancy and so most likely related to oc use . in retrospect , there was initially a hint of underlying ocipe in patient s history . thus , composite evidences ( i.e. , history , clinical - radiological - histological findings ) led us to interpret the case finally as ocipe . soft , vascular gingival tissues were difficult to manage during surgery but p.o healing was uneventful . osseous resection and regenerative surgery were decided not to be performed in the presence of mobile teeth . curettage and debridement of involved furcations alone were sufficient to maintain the function of those compromised teeth . she remains free of recurrence to date and continues to be monitored on a regular basis . periodontists are in a prime position to counsel the effects of ocs in oral health and to treat unhealthy periodontal conditions . this case reaffirms the fact that periodontal surgery , patient compliance and comprehensive maintenance care are essential to return to healthy periodontal status in such conditions .\noutput:\n" }, { "from": "agent", "value": "the purpose of this article is to report a case of unusual oral contraceptive induced periodontal endocrinopathies and its treatment approach . a 32 - year - old female patient , having fair oral hygiene , presented with painless , soft , diffuse gingival enlargement on severely compromised periodontium ( 4 mm generalized alveolar bone loss and attachment loss ) . the patient had on oral contraceptive over five years that was discontinued six months ago . when the lesion was not reversed following withdrawal of the pill or by repeated non - surgical measures , biopsy was performed to establish the diagnosis that revealed microscopic findings similar to that seen in gingival enlargement in pregnancy . pocket depth , tooth mobility and gingival enlargement were reduced remarkably following periodontal surgery . after surgical intervention , close follow - up for over three years revealed no evidence of recurrence of gingival enlargement and progressive attachment loss . we conclude that periodontal surgery , patient compliance and comprehensive maintenance care are effective to return healthy periodontal status in such conditions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sarcomas are rare mesenchymal malignancies originating in supportive / connective body tissues including muscle ; neural , cartilaginous , vascular , and adipose tissue ; and bone . there are approximately 3200 sarcomas diagnosed in the uk each year ; they account for 1 % of malignant neoplasms in adults and 10 % in children . although sarcomas are infrequent neoplastic manifestations , they impact substantially on mortality ( 50 % 5 - year survival ) . the majority ( 60 % ) of sarcomas originate peripherally , 15 % affect the head / neck / external trunk , and the remainder are in the retroperitoneal abdomen . in the 1970s , amputation was the cornerstone of sarcoma management . presently , limb salvage surgery is often preferential ; this surgical modification along with contemporary furtherance in imaging , biomedical engineering , and the advent of adjuvant chemotherapy has greatly improved survival . with improved survival rates , complications of sarcoma management afflict all aspects of a patient 's health for longer . as many as 73 % of patients have developed a new subjective neural impairment after tumour excision , with the majority experiencing a transient mild sensory loss , while some experienced major sensation impairment . sensory nerve injury has also been documented following other extremity surgeries , such as varicose vein surgery and lower limb arterial surgery . due to the profound detrimental impact that sensory dysfunction has on patients and the contemporary shift in medicolegal conventions towards a litigation culture , it is crucial that patient and clinician are made aware of all aspects of this potential management complication . the present study utilised objective and subjective sensory measurement tools , to specifically assess the likelihood of a sensation deficit occurring after sarcoma excision surgery , and subsequently quantified and characterized these deficits . the study also aimed to establish any apparent predisposing / precipitating factors in the occurrence of both objective and subjective sensory deficit , with a view to informing future management plans . the study also addressed the question of whether subjective sensory dysfunction correlates to objective sensory dysfunction in individual patients , an important matter with regard to the accurate assessment of a patient 's neuropathy . over a period of 12 months , 22 patients who had undergone sarcoma excision surgery were identified and recruited , as they attended a sarcoma follow - up clinic , at the cancer centre in the western general hospital , edinburgh . there were 13 male patients and 9 female patients , with a mean age of 58 ( 1684 ) . there were 9 upper body tumours ( defined as occurring superior to the anterior superior iliac spine ( asis ) ) and 13 lower body tumours ( inferior to asis ) . sarcoma excision surgery was performed by a consultant orthopaedic surgeon ; 20 patients underwent limb - salvage surgery , and 2 had above - knee amputations . having gained written consent , patients were asked to complete a questionnaire about sensation changes following surgery . patients were then asked whether they had experienced any sensory neurological symptoms ( specifically sensation loss , tingling , or numbness ) before / after their surgery and whether these symptoms had spread to other parts of the body . patients were also asked whether , excluding postoperative pain , they had ever experienced pain around their scar , and if so , they were asked to rate this on a pain scale and identify whether any analgesics had been taken . finally , patients were asked whether any of their symptoms after surgery had caused them inconvenience or resulted in a reduction of limb function . the objective evaluation comprised three tests of sensory nerve function . prior to conducting the tests , a cotton wool ball was dabbed on the patient 's skin around the scar , while the patient was blindfolded , and the patient was asked to respond verbally to each touch they felt . the same location on the contralateral ( unoperated ) side of the body was also assessed as the control . a neurotip ( neurological tool to assess pinprick ( pp ) ) was touched on the patient 's skin around the scar ( at the same points the cotton wool was dabbed ) , while the patient was blindfolded , and the patient was asked to respond verbally to each touch they felt . the contralateral side of the body was tested in the same way as in test one for use as a control . for both teststhe cotton wool / neurotip was placed 0.5 cm from the scar and at the same positions along the scar ; if sensation was absent at a point , the stimulus was moved a further 0.5 cm perpendicular to the scar , and sensation was tested at this point . thus the boundaries of the areas with absent sensation could be marked on a diagrammatic representation of the patient 's scar , and utilizing the measurement of scar length and the knowledge of how many points were tested along the scar 's length , the lt / pp area deficit could be calculated . a pair of blunt - ended calipers was placed on the patient 's skin at several positions around the area of the scar , while the patient was blindfolded . both points of the calipers were applied until the first sign of blanching , and the patient was asked whether one / two points were felt ; the minimum separation at which both points were felt was recorded . the same points on the contralateral side of the body were tested for use as a control . the average minimum separation was then calculated for both ipsilateral and contralateral sides , and the difference between the two values was used to calculate a two - point discrimination percentage deficit . the nhs lothian trak system was utilized to obtain the following additional information : tumour volume , tumour grade , operative anaesthetic , and adjuvant radiotherapy . baseline characteristics of study patients were summarized with frequencies and percentages for categorical variables and as mean and standard deviation for continuous variables . the significance of categorical variables was assessed using the chi - squared tests or two - sided fisher 's exact tests ( where less than five cases occurred in a cell ) . the significance of continuous variables was assessed using student 's t - test or mann - whitney u ( mwu ) test for continuous nonparametric data . significance was set at p 0.05 , and two - tailed p values were reported throughout .86 % of patients had some deficit in lt , pp , or both around the scar compared to the unaffected contralateral side of the body .59 % had deficit in lt sensation , with a mean area deficit of 12.99 cm .73 % had deficit in pp sensation , with a mean area deficit of 14.28 cm .93 % had a decreased discriminatory ability in the affected limb compared with the contralateral side of the body . utilising a wilcoxon 's test , the difference in two - point discrimination between the scar side and contralateral side was shown to be statistically significant ( z = 3.078 , p = 0.002 ) ( figure 1 ) . a spearman 's test was performed to determine the relationship between scar length and objective sensory dysfunction . both lt and pp deficits were significantly positively correlated with the size of the scar ( p = 0.035 and p = 0.04 , resp . ) spearman 's test was performed to determine the relationship between months since operation and two - point discrimination percentage deficit ; there was a negative correlation ( 0.664 ) , which was statistically significant ( p = 0.024 ) . two - point discrimination deficit decreases as time elapses after sarcoma surgery ( i.e. , the difference in two - point discrimination between the operated side and contralateral side of the body decreases over time after surgery ) .91 % of patients had some subjective deficit around the scar compared with the contralateral side . there was a significant relationship between tumour location and numbness , as shown by fisher 's test ( p = 0.027 ) .22 % of upper body tumours occurred with numbness , whereas 77 % of lower body tumours occurred with numbness . mean tumour volume also differed with location ; upper body tumours had a mean volume of 470.5 cm , whereas lower body tumours had a mean volume of 402.7 cm . tumour grade also differed with location ; 100 % of upper body tumours were high grade , whereas 73 % of lower body tumours were high grade . we tested whether any aspect of a subjective deficit was significantly related to any aspect of objective deficit . more patients had a pp deficit and the mean area of pp deficit was larger . this lack of congruence may arise as lt sensation and pp sensation are conveyed via different sensory pathways . pacinian / meissner corpuscles mediate lt , whereas pp is mediated by a - fibre nociceptors . our results suggest that the pp pathway is more likely to be damaged via sarcoma surgery . however another plausible explanation is that both lt and pp pathways are damaged to similar extent , but the lt pathway is more resilient ; indeed lt receptors have been shown to function in an atrophied state for lengthy periods . identification of these resilient features of lt receptors may be valuable in the future for understanding and managing peripheral neuropathies . results show that 93 % had significantly decreased discriminatory ability in the affected limb , indicating that sarcoma surgery disrupts tactile discrimination . this finding is corroborated by a study observing median nerve function after injury , which also reported a tactile discrimination loss . although two - point discrimination is an extremely popular / practical test , some studies highlight procedural flaws . studies show discriminatory ability diminishes with age ; however , the current study shows a nonsignificant relationship between patient age and discriminatory deficit . this phenomenon may have affected our results , as the contralateral ( unaffected ) limb was always tested second , and hence the improved discrimination could be partially due to repetition . future improved methodology would remove this confounding factor via randomising testing order . results also show that patients with no inconvenience had a smaller mean scar length ( 183 mm ) than patients with inconvenience ( 258 mm ) , although this was nonsignificant . other studies have described an increased frequency of complications with larger scars such as increased healing times , psychological issues , and poorer cosmetic results . it may therefore be worthwhile to surgically minimize scar length , without compromising tumour excision . indeed other surgical forms are focusing on reducing scar length to improve outcome , for example , in haemangioma removal and abdominoplasty . results also showed negative correlations between months since operation and two - point discrimination / lt / pp deficits ; however only the relationship between two - point discrimination and months since operation was significant . an explanation is that there is a recovery of sensory function over time ( tolerance to sensory dysfunction , although a recognized phenomenon , is not a plausible explanation , as sensation deficit was objectively measured ) . recovery was also reported in a study on schwannomas , where 73.2 % developed a new neurological deficit after enucleation , but at final follow - up 70 % had no deficit . recovery of neurological function has also occurred after peripheral nerve injury . another study , where sensory recovery occurred , emphasizes the role that injury mechanism , age , and sensory reeducation have . the possibility of sensation recovery demands that sensory reeducation be a mandatory component of the management strategy for those with deficits after sarcoma surgery .91 % had some form of subjective sensory deficit ; in another study 73.2 % had a new subjective neurological deficit following tumour surgery . in both studiesresults showed that numbness was significantly more likely in lower body than upper body tumours . an explanatory theory is that lower body tumours are larger and more often high grade at presentation ( both characteristics are linked with more complications ) . upper body tumours had a larger mean volume ( however , volume data was only obtained for 2 upper body tumours ) ; and 100 % of upper body tumours were high grade , whereas only 73 % of lower body tumours were high grade . a plausible explanation for our results is that , due to the greater density of sensory receptors in the upper body , a surgical excision would damage a smaller proportion of receptors ( although actually a larger total number ) in the upper body ; therefore , less sensory dysfunction occurs . evaluating sensation deficit is fundamental in many neurological examinations , and numerous objective and subjective methods exist ; but should objective / subjective modalities be utilised together to confer a more comprehensive insight into sensory function ? our results show that there were no significant relationships between subjective and objective deficits , indicating that these modalities cover different aspects of sensory dysfunction . there was , however , a smaller mean lt deficit in patients with no sensation loss ( 5.8 cm ) than in patients with sensation loss ( 10.89 cm ) , indicating some overlap in assessment tools . these resultsvalidate findings by other researchers that although objective sensation tests are a useful tool to evaluate sensory dysfunction , they only partially replicate the complex perception of sensation , and hence they must be utilised in conjunction with subjective tools , in order to thoroughly understand a patient 's sensory deficit . we have demonstrated that sensory neuropathy is a relatively common complication of sarcoma excision surgery . our results indicate that as scar size increases , sensation deficit also increases ; therefore , efforts to minimise the length of scar during sarcoma excision surgery are important . our results demonstrate that the sensory neuropathy improves as time after sarcoma surgery elapses ; therefore , there could be an element of sensation recovery . it is therefore important that sensory reeducation techniques be considered as part of the postoperative management plans in these patients . finally our results showed that there were no significant relationships between any objective and subjective deficits ; therefore , when assessing sensation deficits after sarcoma surgery it would be pertinent to use both objective and subjective assessment techniques .\noutput:\n" }, { "from": "agent", "value": "a potential complication of sarcoma excision surgery is a sensory neurological dysfunction around the surgical scar . this study utilised both objective and subjective sensation assessment modalities , to evaluate 22 patients after sarcoma surgery , for a sensory deficit . 93 % had an objective sensory deficit . light touch is less likely to be damaged than pinprick sensation , and two - point discrimination is significantly reduced around the scar . results also show that an increased scar size leads to an increased light touch and pinprick deficit and that two - point discriminatory ability around the scar improves as time after surgery elapses . 91 % had a subjective deficit , most likely tingling or pain , and numbness was most probable with lower limb sarcomas . results also demonstrated that there were no significant relationships between any specific subjective and objective deficits . in conclusion , sensory disturbance after sarcoma surgery is common and debilitating . efforts to minimize scar length are paramount in the prevention of sensory deficit . sensation may also recover to an extent ; thus , sensory reeducation techniques must become an integral aspect of management plans . finally to obtain a comprehensive assessment of sensory function , both objective and subjective assessment techniques must be utilised ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: for example , embryology and genetics were once seen as separate disciplines , divided by their respective goals and emphases and even by geographical location . eventually , the two fields merged as the goals of embryologists and geneticists aligned and their knowledge deepened sufficiently to enable them to speak the same language . cell biology and neurophysiology , and developmental biology and evolutionary biology have undergone similar mergers . when we look back on our current times we will recognize the early 21st century as the great merger of basic and applied biology . of course , basic researchers have always understood that their work informs patient treatments as they explore the mechanisms of development and homeostasis : this box always needed to be checked on grant applications . but a confluence of forces is now accelerating this merger . as our understanding of biological processes deepens , it will aid the development of rational approaches to disease . this enhanced understanding of biological processes must also be applied to animal models of disease . in the past , model organisms were used exclusively for understanding the cellular and molecular basis for disease ; increasingly , they are being used directly to discover new therapies . yet for most major diseases , clinical trials based on preclinical models show a very low success rate . at a time when the non - science public is more involved in funding decisions for science than ever before , we are under pressure to provide cures . fast . one - thesis : isolate and explore the function of a gene and you had a phd . today , we can achieve nanometer resolution in our investigations , for example by imaging individual proteins , but we can also apply a holistic approach , as seen with systems biology . our tools are not only more powerful , their level of improvement itself is accelerating . not surprisingly , we are now trying to imagine how these tools can be applied to disease . what we find remarkable is that the founders of dmm understood these trends years ago . these are developmental biologists , cell biologists , geneticists and other non - clinical scientists who anticipated that their favorite tools would be used to model diseases and search for therapeutics . dmm was arguably the first journal devoted to merging basic and clinical research , and it has established itself as a flagship journal in translational medicine . with its specific focus on the use of model systems to study disease , the journal occupies a unique niche . as predicted by matthew freeman and daniel st johnston in their inaugural editorial entitled wherefore dmm ? ( freeman and st johnston , 2008 ) , the application of basic discoveries in model organisms has accelerated the study of human disease in recent years . this rapid growth is reflected in the number of research articles published in dmm since its launch , and in the breadth of these studies , which encompass a wide range of diseases and model systems . the journal has reported many milestones , including : the discovery of mitochondrial proteases with a role in parkinson s disease ( in drosophila ) ( whitworth et al . , 2008 ) ; insights into the role of the serotonin transporter in depression ( in mice ) ( bartolomucci et al . , 2010 ) ; evidence that melanoma progression can be halted using a pi3k inhibitor ( in zebrafish ) ( michailidou et al . , 2009 ) ; the identification of small - molecule compounds with a protective role in neurodegenerative disease ( in yeast , and c. elegans ) ( su et al . , 2010 ) ; and several patient - derived cell models for disease ( abrahamsen et al . , 2013 ; hick et al . , 2013 ; matigian et al . , 2010 ) . dmm has also published papers reporting on a number of important databases and resources , such as the generation of the dre - rox system in mice ( anastassiadis et al . , 2009 ) . the quality of the primary articles , together with the diversity of its review content , helped dmm achieve a respectable impact factor ( 4.94 in 2011 ) , despite its status as a new journal . undeniably , founding editor - in - chief vivian siegel has played a major part in the success of the journal . with her editorial experience and strong scientific background , vivian provided the initial , critical push that brought the journal to the attention of the research community . she was also involved in establishing the editorial practice that ensured a steady stream of high - quality research papers , and in introducing the journal s open - access policy . the decision to adopt an open - access model was an important step forward in the journal s development . this move facilitated faster publication and wider dissemination of research , maximizing the impact of the work published in dmm . under vivian s guidance , the scope was also expanded to include a broader range of experimental approaches , so that any papers offering insight into disease mechanisms , diagnostics or therapeutics are now considered , regardless of the approach used . in her farewell editorial ( siegel , 2013 ) , no longer a child , we aim to provide a maturing dmm with the nourishment it needs to continue to flourish . so , where do we go from here ? what is the place of dmm in the great merger ? crucially , dmm is focused not only on utilizing disease models to translate basic biology to the clinic but also on examining and improving those models at the most basic level . many of the failures we have seen in translating novel basic biological discoveries to useful medicines are a result of the inadequacies of the animal models we use at the critical juncture between bench and bedside . oncology stands out as a field in which animal models have proven to be exceptionally poor at predicting clinical success , but other disease areas also suffer from a lack of robust and selective preclinical models . why do these models fail ? reasons include physiological differences between the model and humans , a lack of proper model validation and / or a lack of thorough analysis . dmm will provide a dedicated journalistic platform through which scientists can communicate about disease models in order to improve the translation of basic science to the clinic . only through improving translational researchcan we effectively bring to patients the fruits of the astonishing biological discoveries that our new tools have provided . what is great about stepping into this role is that we can play a part in helping dmm reach its full potential we can dream big , and then make those dreams happen . our primary goal is to be the go to journal for research on disease models . but , more than continuing to publish excellent scientific papers , we will work to bridge the gap between basic and applied sciences . to accomplish this , we will strive to educate each side of the divide to speak the same language . we will establish a dialog on the type of science that is needed to push forward disease research and therapeutics . what sorts of model systems are useful and how do we decide if a model is predictive of human disease ? what is the role of genetic background on the phenotype ? how many genetic backgrounds need to be checked ? how can we determine if a drug that is successfully metabolized in a model is similarly metabolized in humans ? how can a model be optimally used to determine the systemic effects of a mutation , a drug or a gene therapy treatment ? druggable , sit in patented chemical space and can be pushed towards clinical trials ? which intellectual property issues should be considered before beginning a drug screen ? for that matter , what is intellectual property exactly , and why should we care ? as basic researchers ( monica and ross ) and a biotechnology industry executive ( george ) , we are already debating these issues and are planning a series of columns to bring them into the public domain . we will also introduce new standards to encourage work on , and publication of , disease models and mechanisms that can be reliably used for the selection of drug candidates to be entered into the expensive and time - consuming next phase of drug development . the pharmaceutical biotechnology industry relies heavily upon the integrity of basic academic research in order to make the large investment in clinical trials necessary to translate these breakthroughs to verified therapeutics . almost without exception , industry bears the burdens ( and the fruits ) of navigating the minefield of clinical development through to marketing approval . typical toxicology testing prior to entering clinical trials can cost up to us $ 5 million , excluding the scale - up involved in manufacturing the clinical grade drug product . early clinical trials are designed solely to measure safety , with efficacy being assessed only with the onset of phase 2 trials . effectively , this means that , prior to any substantial data on efficacy , an investment well in excess of us $ 10 million is required . therefore , robust and determinative preclinical animal testing is an extremely important focus of the drug development industry . recently , two major pharmaceutical companies , bayer and amgen , reported on the lack of reproducibility of published preclinical research ( begley and ellis , 2012 ; prinz et al . , 2011 ) . the basic scientific community has also noted the increasing presence of ascertainment ( sampling ) and publication biases in scientific reports , with data being dismissed or even omitted to promote the findings that are perceived as the most impressive ( ioannidis , 2005 ) . yetdisciplines such as therapeutic oncology benefit from the publication of negative data ; such negative data can be as informative as positive data when exploring therapeutics , particularly when reported in conjunction with other findings . to support this , we will help promote through our publications a change in the scientific culture responsible for the asymmetric publication of positive results . we believe that dmm can play a crucial role in helping the scientific community improve the process for screening appropriate candidates for clinical development by establishing and promoting standards for the preclinical analysis of animal models , and by demanding their rigorous assessment . we are also holding discussions with the pharmaceutical world to determine their publication needs and standards for following up on disease - focused papers . finally , we are thinking of ways for dmm to connect young trainees to new avenues of science . the journal already provides travelling fellowships to help graduate students and postdoctoral researchers travel on collaborative visits to other laboratories . ? we will open a dialogue with students and early stage researchers to help them to search for positions in academia and beyond . most of us train in universities or medical centers : how does one become a pharmaceutical researcher , and is it a good fit for our needs ? in these difficult economic times , we want to help connect trainees to dream positions in the world of biomedical science . in doing so , we hope to help the next generation of scientists pick up the baton and push forward the great merger , moving basic scientific understanding into the realm of cures and medicines . this is work worth doing , a goal worth pursuing , and we want to be your choice when you are ready to share your contributions with the community .\noutput:\n" }, { "from": "agent", "value": "summaryto better translate basic research findings into the clinic , we are moving away from the traditional one - gene one - phenotype model towards the discovery of complex mechanisms . in this editorial , the new editor - in - chief and senior editors of disease models & mechanisms ( dmm ) discuss the role that the journal will play in this transition . dmm will continue to provide a platform for studies that bridge basic and applied science , and , by demanding the rigorous assessment of animal models of disease , will help drive the establishment of robust standards of preclinical testing for drug development ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in late mitosis and g1 , mcm27 complexes are loaded onto replication origins to license ' them for a single initiation event ( blow & dutta , 2005 ; machida et al , 2005 ; arias & walter , 2007 ) . mcm27 are thought to provide the essential helicase that unwinds dna ahead of the replication fork . to prevent dna from replicating more than once in a single cell cycle , it is essential that , once s phase starts , no further mcm27 are loaded onto the dna . however , the inability to license new origins of replication during s phase creates the problem that if two converging forks stall irreversibly and there is no licensed replication origin already present between them , the intervening dna can not be replicated without some more complex event such as recombination . many licensed replication origins are not used during a normal s phase , but instead remain dormant and are passively replicated by forks from neighbouring origins ( taylor , 1977 ; depamphilis , 1999 ; santocanale et al , 1999 ; dijkwel et al , 2002 ; anglana et al , 2003 ; li et al , 2003 ; gilbert , 2007 ) . consistent with this , there are 1020 times more mcm27 molecules loaded onto dna in g1 than there are active replication origins ( burkhart et al , 1995 ; donovan et al , 1997 ; mahbubani et al , 1997 ; edwards et al , 2002 ) . these dormant origins can be activated when replication is inhibited , and become essential for complete replication and cell survival ( woodward et al , 2006 ; ge et al , 2007 ; courbet et al , 2008 ; ibarra et al , 2008 ) . at present , it is unclear what induces the firing of dormant origins when forks are inhibited . one possibility is that this does not involve an active mechanism but occurs as a consequence of the stochastic nature of origin firing ( ge et al , 2007 ; blow & ge , 2008 ) . dormant origins normally have only a certain period of time to fire before they are passively replicated and hence inactivated by a fork from a neighbouring origin . when fork progression is slowed , it takes longer for the dormant origins to be passively replicated and therefore they have an increased probability of firing . the work described here uses a computer model to show that such a mechanism can provide levels of dormant origin activation that are similar to those seen in vivo , and it can thereby protect against the effects of fork stalling . this behaviour is obtained essentially for free ' simply by making origin firing stochastic and without the need for additional regulatory pathways . we modelled the behaviour of a typical replicon cluster ( jackson & pombo , 1998 ; berezney et al , 2000 ) in which 250 kb of dna was replicated from five origins ( fig 1a ) . except at the extreme ends of the chromosomes , any piece of dnacan potentially be replicated by either of two forks coming from opposite directions . to mimic this , and to eliminate end effects , origins were either distributed randomly or evenly spaced ; actual cellular origin distribution probably falls between these extremes . each origin was also assigned an initiation probability . in all the experiments shown here , the initiation probabilities of individual origins were distributed around a specified mean value ( see methods ) , meaning that within one cluster different origins have higher or lower initiation probabilities . this reflects the idea that , in cells , some origins are more efficient than others . broadly similar results were obtained , however , when all the initiation probabilities in a cluster were set to the same value ( data not shown ) . replication was then modelled in a series of discrete time steps , each corresponding to approximately 25 s of a real s phase . each time step comprises an initiation stage and an elongation stage ( lower panel of fig 1a ) . in the initiation stage , a random test is performed on each licensed origin , based on its initiation probability , to determine whether it will initiate . an initiation probability of 0.05 , for example , means that an origin has a 5 % probability of firing in a time step . if an origin passes the test , it initiates a pair of forks and becomes unlicensed . after all licensed origins have been tested for initiation , all active replication forks are advanced 500 bp . if this causes two forks to converge , they terminate . if a fork passes over a licensed origin , the origin becomes unlicensedpassive replication ' . fig 1b shows the replication profile of a typical cluster replicated by five randomly positioned efficient origins ( initiation probability of one per step ) . all origins are initiated in the first step ( black circles ) , and replication forks subsequently moved away from them ; the peaks represent sites where forks terminated . in living cells , the number of origins that are licensed and the probability with which they initiate are currently unknown . fig 1c shows that when the number of origins was increased to 25 while maintaining an initiation probability of 1 , then all 25 origins fired . however , when the initiation probability was reduced to 0.003 per step , then , on average , only 5 of the 25 licensed origins initiated during the replication of the whole cluster . fig 1d shows an example of this , in which five origins fired in different time steps , and the other 20 remained dormant and were passively replicated ( grey circles ) . we varied the number of licensed origins and determined the initiation probabilities that are required to maintain an average of five origins firing in the 250 - kb cluster . the circles in fig 2a show how the initiation probabilities decrease as the total number of licensed origins increases . slightly lower probabilities were required for evenly spaced replication origins as compared with randomly - positioned origins because when evenly spaced , unfired origins tend to be situated closer to termination events . apart from the special case of highly efficient spaced origins , increasing the number of licensed origins in this way only slightly increased the total time required for complete replication of the origin cluster ( supplementary fig s1 online ) . sixteen randomly distributed origins were given a mean initiation probability of 0.00508 so that , on average , only five origins fired . the fork rate was then reduced to 25 % , and the resultant replication profile is shown by the dashed line . the slow - moving forks took longer to reach the 11 origins that were passively replicated at the normal fork rate . consequently , these 11 origins remained licensed for a longer period of time and 3 of them underwent initiation in later time steps . this is an example of dormant origins being activated by a passive ' mechanism in response to fork inhibition ( ge et al , 2007 ) . next , we set out to fit the model to the results obtained when tissue culture cells were treated with hydroxyurea , which reduces the supply of dntps needed for dna replication . dna fibre analysis of human u2os cells showed that 200 m hydroxyurea reduced the replication fork rate to 2533 % of the controls and induced dormant origins to fire ( ge et al , 2007 ) . results from fig 2a were used to establish conditions in which the number of licensed origins varied from 5 to 100 per 250 kb , whereas lowered initiation probabilities maintained an average of five origins fired per cluster ( fig 3b d , circles ) . fork speed was then reduced to mimic the effect of hydroxyurea ( fork slowing to 25 % , 31 % or 33 % of the appropriate controls for each experiment ) , and the number of origins that fired was determined ( fig 3b d , squares ) . the results were then compared with three separate in vivo experiments ( fig 3b d , grey shading ) . the data from fig 3c were also plotted to show the number of origins fired and the origin efficiency ( supplementary fig s2 online ) . to match the in vivo data of fig 3b , the model requires 816 licensed origins per 250 - kb cluster , whereas to match the in vivo data of fig 3c the model requires more than 12 licensed origins and fig 3d requires more than 10 licensed origins . when chromatin - bound mcm27 in u2os cells was reduced approximately twofold by short interfering rna , the number of dormant origins was reduced , so the mean spacing between fired origins in the presence of hydroxyurea was only approximately 40 kb ( fig 3c , 2 mcm knockdown ' ) . to match these in vivo data , the model requires 69 licensed origins per 250 - kb cluster . assuming that a twofold reduction in chromatin - bound mcm27 leads to a twofold reduction in the number of licensed origins , this would imply that there are normally 1218 licensed origins per cluster . taken together , the model is in reasonable agreement with the experimental data if there are approximately 1020 licensed origins per 250 - kb cluster in u2os cells . this means that licensed origins would be , on average , 12.525 kb apart ( 250 / 20250 / 10 kb ) and that there would be 13 dormant origins for each fired origin . this is well within the approximately 10-fold excess of mcm27 complexes over replication origins reported in various eukaryotic cells ( burkhart et al , 1995 ; donovan et al , 1997 ; mahbubani et al , 1997 ) . one explanation for why there might be more mcm27 complexes than licensed origins is that there might be more than two mcm27 complexes present at each licensed origin . alternatively , the number of dormant origins activated in response to hydroxyurea might be limited by checkpoint pathways that suppress origin firing . consistent with this explanation , the in vivo experiment in which dormant origin activation was the smallest ( fig 3b ) is the one in which fork slowing was the greatest , and so checkpoint activity was likely to be highest . the model 's prediction of 13 dormant origins for each fired origin is therefore likely to represent the lower limit of the number of dormant origins actually present in vivo . data from experiments showing that some dormant origins are activated following inhibition of checkpoint kinases also support this idea ( woodward et al , 2006 ; ge et al , 2007 ) . when replication forks encounter damaged dna bases , crosslinks or tightly bound proteins , they can stall irreversibly ( dimitrova & gilbert , 2000 ; tercero & diffley , 2001 ; merrick et al , 2004 ) . we modelled this by giving forks a certain probability of stalling at each base pair ; an example is shown in fig 4a . the rightward fork initiated at a map position of approximately 170 kb stalled after replicating just over 10 kb of dna ( indicated by a horizontal bar ) . this did not prevent the cluster from completing replication because the leftward fork initiated at a map position of 240 kb replicated all the dna up to the stalled fork . in addition , the rightward fork initiated at approximately 5 kb and the leftward fork initiated at approximately 115 kb both stalled . this double stall ' of two converging forks might have made it impossible to replicate the intervening dna ; however , in this case , the presence of a dormant origin between the stalled forks , at approximately 40 kb , allowed all the intervening dna to be replicated . when potential double - fork stalls are rescued by activation of a dormant origin in this manner , the total time taken to complete replication might often be significantly longer than would have been the case in the absence of fork stalling ( fig 4a ; supplementary fig s3 online ) . we used a range of stall rates and measured how often complete replication failed owing to double stalls ; fig 4b summarizes the protocol . as in figs 2 and 3 , the number of licensed origins was varied from 5 to 100 per 250 kb , while lowered initiation probabilities maintained an average of five origins fired per cluster ( fig 4c , d , filled symbols ) . this was compared to the situation in which the same number of efficient origins ( initiation probability of 1 ) was licensed ( open symbols ) . clusters were then replicated with a fork stall rate of either 510 ( fig 4c ) or 510 ( fig 4d ) per base pair . increasing the number of licensed origins decreased the number of replication failures attributable to double - fork stalls ( squares ) at virtually the same rate whether the origins were efficient or inefficient . curve fitting ( dashed lines ) showed that the percentage of replication failures was approximately inversely proportional to the number of licensed origins that is , doubling the number of licensed origins approximately halves the probability of replication failure . the total number of inefficient origins firing under these circumstances increased only slightly owing to fork stalling ( filled circles ) . supplementary fig s4 online shows that evenly spaced origins provide significantly more protection against replication failure than do randomly positioned origins over a range of stall rates . this is probably because the maximum distance between adjacent origins in a cluster , where double - fork stalls are most likely to occur , is minimized if origins are evenly spaced . these results show that protection against double - fork stalling can be achieved by increasing the total number of licensed origins , and that it does not depend on whether these origins are efficient or whether they normally remain dormant . as it requires far fewer resources to assemble a licensed origin than it does to initiate a pair of replication forks ( both of which probably comprise in excess of 50 polypeptides in addition to mcm27 ) , it is clearly preferable to use inefficient origins , most of which will remain dormant . the protection given by replication origins against double - fork stalls can also help to explain why eukaryotes generally use far more replication origins than are strictly required to complete replication in the time allotted for s phase . although more complicated active mechanisms can be imagined for how origins in a replicon cluster are regulated , our model provides results that are in good agreement with experimental data simply by assigning origins a certain initiation probability per unit time . this shows that dormant origins can protect against double - fork stalls without the expense incurred by increasing the number of active replication forks . given the potential simplicity of this control mechanism and the advantages it provides , we anticipate that the use of dormant replication origins will be widespread among various eukaryotic cells . was written in objective c using the cocoa framework and the xcode 3 development environment . the model is controlled by a jbsphasecontroller object that obtains model parameters from a graphical user interface . jbsphasecontroller controls replication origins through a jborigincontroller object and replication forks through a jbforkcontroller object . during the simulation , jborigincontroller first licenses replication origins , which are each represented by a jborigin object . origins are distributed at random points on the dna or else they are evenly spaced . each jborigin contains information about its location , initiation probability and status ( licensed / fired / passively replicated ) . initiation probability is randomly determined from a mean value and a value that determines the variability around the mean , implemented so that the log of the initiation probability is normally distributed . unless stated otherwise , for all experiments reported here , the log normal variability was set to 0.25 so that two standard deviations extended from 1/3 to 3 times the mean . once the licensing phase is over , jbsphasecontroller iteratively executes a series of s phase time steps . in each step , jbsphasecontroller instructs jborigincontroller to initiate licensed origins as appropriate and then instructs jbforkcontroller to advance all the replication forks . if the origin passes the test , the origin is converted to the fired state , and jbforkcontroller is instructed to create a pair of jbfork objects representing the two forks initiated at that location . at initiation , each jbfork is assigned a distance at which it will stall , generated randomly through an exponential decay algorithm . when all origins have been tested , jbforkcontroller instructs each jbfork to advance 500 bp . the 500 - bp elongation distance was chosen so that in most cases no two origins that fire in the same time step are less than this distance apart . each fork maintains a record of how far it has travelled and , if the movement would cause a jbfork to exceed its stall distance , it stalls irreversibly . if a jbfork passes over a licensed origin , it converts the origin to the passively replicated ' status . the simulation continues until there are no more licensed origins and no more unstalled forks . jbsphasecontroller keeps a full record of fork position and origin status for each time step for subsequent statistical analysis . first , examples of all simulations were visually inspected using the graphical output shown in figs 1b , d , 2b and 4a . second , an extensive integrity check was performed by the program during all simulations , which included checking not only the relationship between the positions of all forks , origins and replicated dna , but also that the status of origins was consistent with the replication map . a working version of the model ( for mac os 10.4 and above ) and the source code ( version 1.2.1 ) can be downloaded from http://www.dundee.ac.uk/lifesciences/blow/labsite/resources.html . origin spacing was measured by dna fibre analysis in previously published experiments ( ge et al , 2007 ) . fork rate was measured from fibres generated in these experiments by measuring the length of 100 individual , well - separated bromodeoxyuridine tracks and dividing it by the duration of the bromodeoxyuridine pulse .\noutput:\n" }, { "from": "agent", "value": "replication origins are licensed ' for a single initiation event before entry into s phase ; however , many licensed replication origins are not used , but instead remain dormant . the use of these dormant origins helps cells to survive replication stresses that block replication fork movement . here , we present a computer model of the replication of a typical metazoan origin cluster in which origins are assigned a certain initiation probability per unit time and are then activated stochastically during s phase . the output of this model is in good agreement with experimental data and shows how inefficient dormant origins can be activated when replication forks are inhibited . the model also shows how dormant origins can allow replication to complete even if some forks stall irreversibly . this provides a simple explanation for how replication origin firing is regulated , which simultaneously provides protection against replicative stress while minimizing the cost of using large numbers of replication forks ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: selective serotonin reuptake inhibitors ( ssris ) are one of the most prescribed classes of psychotropics . fluoxetine ( flx ) , one of the most prescribed ssris , was quantified in the aquatic systems via sewage - treatment effluents . concerns were raised after a number of studies demonstrated that flx can have hormonal effects . studies that evaluated flx in aquatic systems showed that it can affect the fecundity , circulating hormone levels and reproductive success of fish . in addition , rodent studies confirmed that flx exposure could lead to adverse endocrine and reproductive effects . erdemir et al showed that paroxetine ( prx ) could affect spermatogenesis , prx and flx decreased the follicle - stimulating hormone ( fsh ) levels , while sertraline ( srt ) lowered the levels of testosterone . ssri therapy during pregnancy was linked to miscarriages , fetal defects and preterm births , but the results were mixed and inconclusive . croen et al presented a possible link between the fetal exposure to ssris , especially during the first trimester , and a modestly increased risk of developing autism spectrum disorders . withdrawal symptoms in the newborn were observed if the exposure to ssris was during the third semester . long - term developmental effects of prenatal and neonatal exposure to ssris is still under investigation . ssris have been shown to cause sexual dysfunctions in patients , with an incidence of over 70 % . the affective dimensions of romantic love and attachment could also be influenced by ad . due to their interfering with normal sexual functionall these demonstrated effects may suggest an endocrine disruptive effect of ssris on the hypothalamic pituitarygonadal axis ( hpt ) , on sexual steroid metabolism or on estrogenic or androgenic receptors , as ssri use can be associated with low free testosterone serum levels . even though the ssris consist of 6 molecules ( citalopram , escitalopram , fluoxetine , fluvoxamine , paroxetine and sertraline ) , only flx was intensively studied for endocrine disruptive effects , while the other ssris received less attention . this study was designed to evaluate the estrogenic / antiestrogenic effect of flx , srt and prx using the t47d - kbluc breast cancer cell line . all compounds were tested individually and in mixtures with 17beta - estradiol ( e2 ) to detect potential additive , synergistic or antagonistic effects . flx was chosen in this study in order to compare , if the case , its potency with the other two molecules from ssris class . fluoxetine , sertraline and paroxetine were purchased from lgc standards ( germany ) , 17 - beta estradiol , resazurin , tricine , edta , dithiothreitol ( dtt ) , and atp were purchased from sigma aldrich ( steinheim , germany ) . ( mgco3 ) 4 mg ( oh ) 2.5 h2o was obtained from acros organics ( geel , belgium ) , 1,2 - diaminocyclohexane - n , n , n,n - tetraacetic acid ( cdta ) and tris were from fluka ( buchs , switzerland ) and luciferin was from roth ( karlsruhe , germany ) . rpmi 1640 + glutamax medium , trypsin , dulbecco s phosphate buffered saline ( pbs ) and charcoal stripped fbs were purchased from gibco ( paisley , uk ) . fetal bovine serum ( fbs ) and dulbecco s modified eagle s medium / nutrient mixture f - 12 ham were obtained from sigma ( steinheim , germany ) . t47d - kbluc human breast cancer cells ( estrogen receptor positive ) were obtained from american type culture collection ( atcc , usa ) . the cells were grown in rpmi 1960 + glutamax medium supplemented with 10 % fetal bovine serum at 37c with 5 % co2 under saturating humidity and passaged every 2 to 3 days . dulbecco s phosphate buffered saline was used to rinse the cells and trypsin was used to detach cells from plastics . during the experiments , the cells were cultured in phenol red - free dulbecco s modified eagle s medium / nutrient mixture f - 12 ham , containing 10 % charcoal stripped fbs . all compounds were prepared as 1000l stock solutions in dimethyl sulfoxide solutions ( dmso , 99.5 % , riedel - de han , seelze , germany ) at a concentration of 30 mm . solutions of 0.005 , 0.015 , 0.05 , 0.15 , 0.5 , 1.5 , 5 , 7.5 , 10 and 15 mm for all three chemicals were obtained from stock solutions that were subsequently diluted with dmso . these serial dilutions were then used to obtain the desired test concentration range for individual compounds . for viability assay , cells were left to attach for 24 h , rinsed with 200l phosphate buffered saline ( pbs ) and then exposed to individual test compounds at increasing concentrations and mixtures compound - estradiol ( 30 pm e2 ) for 24 h. cell viability was evaluated by measuring the capacity of the cells to reduce resazurin ( final concentration 100 m ) , a non - fluorescent reagent , to resorufin , a fluorescent product . the fluorescence was measured at excitation = 530/25 ; emission = 590/35 , using a plate - reader ( synergy 2 multi - mode microplate reader , biotek ) . for luciferase induction , cells were seeded in 96 wells / plates and incubated for 24 h at 37c . after this period , the medium was removed , the cells were rinsed with pbs then 100 ul medium was added together with another 100 ul medium that contained the tested compounds at increasing concentrations and mixtures compound - e2 . e2 at a concentration of 30 pm served as a positive control and was used in combination with test chemicals to screen for anti - estrogenic effect . each chemical was tested in three independent experiments in the presence or absence of e2 . after exposure to test chemicals , the cells were lyzed using a low salt buffer containing 10 mm tris , 1.99 mm dtt and 2 mm cdta . following a 15 - minute incubation at 20c , luciferase activity was measured using a luminometer ( synergy 2 multi - mode microplate reader , biotek ) with automatic injection of 100l luciferin flashmix [ 0.47 mm luciferin , 20 mm tricine , 1.07 mm ( mgco3 ) 4 mg ( oh ) 2.5 h2o , 0.1 mm edta , 2 mm dtt and 5 mm atp , ph 7.8 ] in each well . the results were expressed as mean standard deviation ( s.d . ) . for each experiment , relative light units ( rlus ) in every well were corrected by substracting the mean response of control wells . to compare data , the mean induction of luciferase , obtained at 30 pm e2 , was set at 100 % . statistical analysis origin software ( originlab , northampton , usa ) was used for graphical analyses . differences in p values of 0.05 were considered statistically significant . to test for agonist properties , the signal from the cells treated with compounds was compared to the signal of the cells exposed to medium and dmso ( negative control ) . for estrogen antagonist properties , fluoxetine , sertraline and paroxetine were purchased from lgc standards ( germany ) , 17 - beta estradiol , resazurin , tricine , edta , dithiothreitol ( dtt ) , and atp were purchased from sigma aldrich ( steinheim , germany ) . ( mgco3 ) 4 mg ( oh ) 2.5 h2o was obtained from acros organics ( geel , belgium ) , 1,2 - diaminocyclohexane - n , n , n,n - tetraacetic acid ( cdta ) and tris were from fluka ( buchs , switzerland ) and luciferin was from roth ( karlsruhe , germany ) . rpmi 1640 + glutamax medium , trypsin , dulbecco s phosphate buffered saline ( pbs ) and charcoal stripped fbs were purchased from gibco ( paisley , uk ) . fetal bovine serum ( fbs ) and dulbecco s modified eagle s medium / nutrient mixture f - 12 ham were obtained from sigma ( steinheim , germany ) . t47d - kbluc human breast cancer cells ( estrogen receptor positive ) were obtained from american type culture collection ( atcc , usa ) . the cells were grown in rpmi 1960 + glutamax medium supplemented with 10 % fetal bovine serum at 37c with 5 % co2 under saturating humidity and passaged every 2 to 3 days . dulbecco s phosphate buffered saline was used to rinse the cells and trypsin was used to detach cells from plastics . during the experiments , the cells were cultured in phenol red - free dulbecco s modified eagle s medium / nutrient mixture f - 12 ham , containing 10 % charcoal stripped fbs . all compounds were prepared as 1000l stock solutions in dimethyl sulfoxide solutions ( dmso , 99.5 % , riedel - de han , seelze , germany ) at a concentration of 30 mm . solutions of 0.005 , 0.015 , 0.05 , 0.15 , 0.5 , 1.5 , 5 , 7.5 , 10 and 15 mm for all three chemicals were obtained from stock solutions that were subsequently diluted with dmso . these serial dilutions were then used to obtain the desired test concentration range for individual compounds . for viability assay , cells were left to attach for 24 h , rinsed with 200l phosphate buffered saline ( pbs ) and then exposed to individual test compounds at increasing concentrations and mixtures compound - estradiol ( 30 pm e2 ) for 24 h. cell viability was evaluated by measuring the capacity of the cells to reduce resazurin ( final concentration 100 m ) , a non - fluorescent reagent , to resorufin , a fluorescent product . the fluorescence was measured at excitation = 530/25 ; emission = 590/35 , using a plate - reader ( synergy 2 multi - mode microplate reader , biotek ) . for luciferase induction , cells were seeded in 96 wells / plates and incubated for 24 h at 37c . after this period , the medium was removed , the cells were rinsed with pbs then 100 ul medium was added together with another 100 ul medium that contained the tested compounds at increasing concentrations and mixtures compound - e2 . e2 at a concentration of 30 pm served as a positive control and was used in combination with test chemicals to screen for anti - estrogenic effect . each chemical was tested in three independent experiments in the presence or absence of e2 . after exposure to test chemicals , the cells were lyzed using a low salt buffer containing 10 mm tris , 1.99 mm dtt and 2 mm cdta . following a 15 - minute incubation at 20c , the plates were frozen at 80c for a minimum of 30 minutes . luciferase activity was measured using a luminometer ( synergy 2 multi - mode microplate reader , biotek ) with automatic injection of 100l luciferin flashmix [ 0.47 mm luciferin , 20 mm tricine , 1.07 mm ( mgco3 ) 4 mg ( oh ) 2.5 h2o , 0.1 mm edta , 2 mm dtt and 5 mm atp , ph 7.8 ] in each well . the results were expressed as mean standard deviation ( s.d . ) . for each experiment , relative light units ( rlus ) in every well were corrected by substracting the mean response of control wells . to compare data , the mean induction of luciferase , obtained at 30 pm e2 , was set at 100 % . statistical analysis origin software ( originlab , northampton , usa ) was used for graphical analyses . differences in p values of 0.05 were considered statistically significant . to test for agonist properties , the signal from the cells treated with compounds was compared to the signal of the cells exposed to medium and dmso ( negative control ) . for estrogen antagonist properties , to assess cell viability for the estrogenic assay , the t47d - kbluc cell line was exposed to flx , srt and prx in increasing concentrations ( 0.01 , 0.03 , 0.1 , 0.3 , 1 , 3 , 10 , 15 , 20 m ) for 24 hours . prx was the most toxic compound , with 3m as the highest concentration that did not have a significant decrease in the cell response to resazurin when compared to control . for srt , concentrations lower than 15 m did not decrease cell viability in a significant manner , while for flx it was possible to test for estrogenic activity concentrations up to 15 m . for the antiestrogenic assay , cytotoxicity was assessed by incubating the cells for 24 hours to binary mixtures of the studied compounds ( increasing concentrations ) and 30 pm e2 . the concentration for estradiol was chosen as the minimal concentration where the maximum signal was obtained . the range of tested compound concentrations in the binary mixtures were as follows : flx 0.0115 m , srt 0.0110 m and prx 0.013 m . the maximal induction for flx represented 7 % from the activity of e2 and it was observed at 1m , while for srt the maximal induction represented 8 % from estradiol s activity and was observed at a lower concentration ( at 0.1 m ) than in case of flx . none of the tested concentrations of prx was able to induce a significant luciferase expression , when compared to control . when tested in the presence of e2 , flx and srt presented an antiestrogenic effect by decreasing in a significant manner the estradiol induced signal at 15 and 10m for flx + e2 , and at 10 m in case of srt + e2 exposure ( figure 1a , b ) , but the decrease did not allow us to calculate the ic50 . since at individual testing , in case of srt at 0.01 m and of prx at 0.01 and 0.03 m , no estrogenic effect was observed , the increase in the cellular response obtained during the mixture assay ( compound + e2 ) , at 0.01 m srt ( 112 % ) ( figure 1b ) and at 0.03 and 0.01 m prx ( 112 % and 114 % ) ( figure 1c ) indicate a potential synergistic effect between ssris and e2 . to assess cell viability for the estrogenic assay , the t47d - kbluc cell line was exposed to flx , srt and prx in increasing concentrations ( 0.01 , 0.03 , 0.1 , 0.3 , 1 , 3 , 10 , 15 , 20 m ) for 24 hours . prx was the most toxic compound , with 3m as the highest concentration that did not have a significant decrease in the cell response to resazurin when compared to control . for srt , concentrations lower than 15 m did not decrease cell viability in a significant manner , while for flx it was possible to test for estrogenic activity concentrations up to 15 m . for the antiestrogenic assay , cytotoxicity was assessed by incubating the cells for 24 hours to binary mixtures of the studied compounds ( increasing concentrations ) and 30 pm e2 . the concentration for estradiol was chosen as the minimal concentration where the maximum signal was obtained . the range of tested compound concentrations in the binary mixtures were as follows : flx 0.0115 m , srt 0.0110 m and prx 0.013 m . the maximal induction for flx represented 7 % from the activity of e2 and it was observed at 1m , while for srt the maximal induction represented 8 % from estradiol s activity and was observed at a lower concentration ( at 0.1 m ) than in case of flx . none of the tested concentrations of prx was able to induce a significant luciferase expression , when compared to control . when tested in the presence of e2 , flx and srt presented an antiestrogenic effect by decreasing in a significant manner the estradiol induced signal at 15 and 10m for flx + e2 , and at 10 m in case of srt + e2 exposure ( figure 1a , b ) , but the decrease did not allow us to calculate the ic50 . since at individual testing , in case of srt at 0.01 m and of prx at 0.01 and 0.03 m , no estrogenic effect was observed , the increase in the cellular response obtained during the mixture assay ( compound + e2 ) , at 0.01 m srt ( 112 % ) ( figure 1b ) and at 0.03 and 0.01 m prx ( 112 % and 114 % ) ( figure 1c ) indicate a potential synergistic effect between ssris and e2 . the use of antidepressants ( ad ) has increased considerably in the last decade , ssris being the most widely used class of ad . fluvoxamine was the first ssri introduced in england in 1983 , followed by flx in 1989 , srt in 1991 and prx in 1992 in the united states . the blood concentrations of ssris are highly variable between individuals , but they are in the nanomolar to low micromolar range . even though the medical practice does not encourage the use of drugs during pregnancy or breastfeeding , the ssris representatives are among the drugs accepted , only after a risk - benefit analysis . ssris can pass through the placental barrier and maternal milk affecting the development of the fetus and the neonate , therefore it is of great importance the evaluation of the endocrine disruptive effect of the ssris representatives . studies were performed both in vitro and in vivo ( in different types of fish , rodents ) . studies on fish show that flx can reduce the expression of estrogen receptors ( er ) in the hypothalamus . rodent studied demonstrated that flx can affect sexual brain differentiation , sexual behavior , testicular development and sperm production in rat offspring exposed in utero and / or through lactation . mueller et al showed that flx can act as an estrogen receptor agonist both in vitro and in vivo . , as flx presented estrogenic activity , but at a lower concentration than that reported on mcf -7-ere ( 1 m vs 17 m ) . also , the relative response was smaller ( 20 % vs 7 % ) . in our case , due to cytotoxicity , the maximum concentration tested for flx was 15 m . unlike for muller et al , the cells exposed to flx and e2 revealed an antiestrogenic activity at 15 and 10 m . therefore , flx presented itself as a compound with dual properties : at lower concentrations it acts as a weak estrogen , while at higher concentrations , that could have biological relevance , it acts as a weak antiestrogen . besides flx , an estrogenic effect was also detectable in case of exposure to srt , but at a concentration 10 times lower than the estrogenic concentration for flx . these in vitro results revealed that flx and srt present estrogenic activity without any metabolic activation . in this case , our results do not support the in vivo results of montagnini et al where srt was found not to have any estrogenic properties . this finding could be explained by : a different mechanism , other than the interaction of srt with the estrogenic receptor , when using our in vitro system , or the differences in bioavailability of srt in vivo vs in vitro , or by the possibility that , in vivo , srt could activate more than just one pathway . also , depending on the moment of exposure ( age ) and the duration of exposure , the body could , by its mechanisms of protection , compensate this endocrine disruptive effect . in case of co - exposure to srt + e2 , at the highest concentration tested a decrease in the relative luminescence was noticed , srt being able to antagonize a part of e2 activity . interestingly , at the lowest concentration tested ( 0.01 m ) an increase in the estradiol - mediated transcriptional activity was observed , this increase being statistically significant when compared to the positive control . the concentration where this effect appeared was 10 times lower than the concentration where the estrogenic effect was observed . srt presented thus multiple proprieties , weak estrogen , weak antiestrogen and also modulator of the estradiol - mediated transcription . since the estrogenic effect and also the synergistic effect of srt + e2 were observed at submicromolar concentrations , this might suggest that this compound could interfere with estrogenic signaling at therapeutic plasma concentrations and this could be a reason for concern . an increase in the e2 - mediated transcriptional activity was demonstrated also in case of the cells exposed to prx , 0.03 and 0.01 m being the concentrations where this type of activity was observed . to our knowledge , this is the first time when the selected ssris are analyzed in the same sets of experiments , using the same end - points in order to compare their potency . the limitation of our study would be the lack of testing the compounds in the presence of ers antagonists , or confirming the er interaction by using binding affinity studies . overall , our results indicate a possible interaction of ssris with the estrogen receptor . taking into consideration that the estrogenic effects and the increase in the estradiol - induced activity appear at lower concentrations that can be therapeutically relevant , it would be of help to elucidate the specific mechanism ( s ) of action in case of exposure to ssris in order to estimate to which extent they can affect the endocrine - mediated activity .\noutput:\n" }, { "from": "agent", "value": "background and aimsselective serotonin reuptake inhibitors ( ssris ) are one of the most prescribed classes of psychotropics . even though the ssri class consists of 6 molecules ( citalopram , escitalopram , fluoxetine , fluvoxamine , paroxetine and sertraline ) , only fluoxetine was intensively studied for endocrine disruptive effects , while the other ssris received less attention . this study was designed to evaluate the estrogenic / antiestrogenic effect of fluoxetine , sertraline and paroxetine.methodsthe in vitro ( anti ) estrogenic activity was assessed using a firefly luciferase reporter construct in the t47d - kbluc breast cancer cell line . these cells express nuclear estrogen receptors that can activate the transcription of the luciferase reporter gene upon binding of estrogen receptor agonists.resultsall three compounds were found to interact with the estrogen receptor . fluoxetine had dual properties , weak estrogenic at lower concentrations and antiestrogenic effect at higher concentrations . sertraline shared the same properties with fluoxetine , but also increased the estradiol - mediated transcriptional activity . paroxetine presented only one type of effect , the ability to increase the estradiol - mediated transcriptional activity.conclusionsoverall , our results indicate a possible interaction of ssris with the estrogen receptor . as ssris are being used by all categories of population , including pregnant women or children , establishing whether they can affect the endocrine mediated mechanisms should be a priority ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: anterior cervical discectomy and fusion ( acdf ) is a common surgical procedure used in the treatment of many cervical spine disorders ; herniated discs , spondylosis , fractures , and neoplastic lesions15 ) . since initially reported in 1955 by robinson and smith19 ) , acdf has become an accepted procedure for decompression of nerve root , spinal cord and spinal stabilization in the treatment of above diseases . the selection of the appropriate graft substrate is imperative to achieve successful bone fusion and an optimal clinical outcome20 ) . the gold standard for cervical fusion material is autologous iliac crest bone , however many complications of autograft substrates have been reported2 ,12 ) . the harvest site for autogenous iliac crest bone grafts is associated with an amplified risk of morbidity , operative time , hospital stay and postoperative recovery21 ) . on the other hand , the allogenic graft substitutes have shown to reduce postoperative morbidity and shorten hospital stay11 ,26 ) . although it is known that autograft increases the fusion rate and decreases the collapse rate , a debate still exists between the efficacy of autograft versus allograft and its relationship to clinical outcome in acdf20 ) . the purpose of this study is to determine efficacy of autograft versus allograft in radiographic and clinical outcome in early period after operation . from 2006 to 2009 , thirty - eight patients underwent oneor two - level cervical anterior fusion with rigid anterior plate fixation . amongthe patients , 17 patients ( 44.7 % ) underwent acdf with autograft bone and 21 patients ( 55.3 % ) received with allograft bone . three patients had two - level acdf in the autograft group and one patient in the allograft group . there were 14 males and 3 females ranging in age from 29 to 78 years ( mean age , 51.9 years ) in autograft group , 12 males and 9 females ranging in age from 23 to 72 years ( mean age , 54.3 years ) in allograft group . the mean follow - up period of these patients was 12.4 months ( range , 11 to 20 months ) in autograft group , 12.8 months ( range , 10 to 17 months ) in allograft group . bone mineral density ( bmd ) , body mass index ( bmi ) , status of smoking and operated cervical level were compared , and bmd was performed only in patients above age 50 ( table 1 ) . one senior surgeon and junior surgeon performed all procedures by means of a standard smith - robinson anteromedial approach to the cervical spine and using microsurgical technique . preparation of the vertebra endplates was achieved by cartilage removal with a curette and the endplate for graft insertion in all patients . autografts were harvested with a low - speed oscillating saw at the anterior iliac crest . application of an anterior variable type cervical plate ( maxima ) was performed in all patients without using distractor during the surgery . usage of non - steroidal anti - inflammatory drugs ( nsaids ) was within one month after the surgery and patients were kept in a philadelphia collar for 4 weeks after the surgery . for the evaluation of interbody fusion , the fusion rate was assessed by bridwell interbody fusion grading system4 ) ( table 2 ) , and we considered grade i or ii as successful fusion . the graft collapse rate was evaluated comparing the initial graft height with last follow - up graft height in the plain radiographs . the graft collapse height was measured by the distance connecting the line drawn on the upper and lower end - plates of the fusion segment and the center of the superior and inferior end - plates . statistical analysis was performed with paired t - test , chi - squared test , and mann - whitney u - test . forty two interspaces were fused in 38 patients : 20 levels with autograft bone in 17 patients ( 3 patients had two - level acdfs ) , 22 levels with iliac crest allograft bone in 21 patients ( 1 patient had two - level acdfs ) . statistical analysis of the age , follow - up period , bmi , bmd , and status of smoking between two groups showed no significance ( p 0.05 ) ( table 1 ) . the overall radiographic successful fusion rate in our series was 47.6 % , based on the bridwell interbody fusion grading system .65 % of the patients with autograft achieved successful fusion , whereas only 31.8 % of the patients with allograft achieved successful fusion ( fig 1 ) . statistical significant difference was noted between autograft and allograft in the fusion rate ( p 0.05 ) ( table 3 ) . the mean fused interspace height was less well maintained in cases using allograft bone than autograft bone . the mean collapse in cases using allograft was 2.0 mm ( 24.7 % change ) between the initial and last follow - up radiograph , a statistically significant difference ( p 0.05 ) ( fig .2 ) . whereas , the mean interspace collapse in cases using autograft was 1.3 mm ( 15.5 % change ) , which resulted in no statistically significant difference ( p 0.05 ) ( table 4 ) . the postoperative clinical outcome was assessed in all patients , based on odom 's criteria . excellent results were reported in 41.2 % , good results in 52.9 % , and fair results in 5.9 % in the autograft group . andexcellent results were reported in 38.1 % , good results in 52.4 % , and fair results in 9.5 % in the allograft group . since the 1950s , acdf has been a widely accepted procedure for the treatment of degenerative disc disease and spondylosis of the cervical spine2 ,3,7,10,12,20,24 ) . cervical interbody fusion is used after surgery to help minimize postoperative morbidity , maintain cervical spinal alignment , eliminate potential instability , and preserve interspace height and angulation3 ) . cervical spine interbody fusion has achieved favorable clinical outcomes and is the gold standard for treating patients with degenerative disc disease and spondylosis . robinson et al. 19 ) reported the first large series of patients with cervical radiculopathy treated with anterior interbody fusion , in this series 73 % of the patients achieved good or excellent outcomes . other authors have reported clinically good to excellent results in 80 - 90 % of cases7 ,10 ) . bone healing and fusion at an interbody fusion site are dependent on three main factors . there are recipient site condition , fusion substrate , and regional and systemic host features3 ) . among these , selection of the appropriate graft substitutes to optimize fusion rate and bone healing is essential . graft substitutes have been developed including xenograft , allograft , cages , ceramics , bioabsorbable implants that may produce as comparable fusion rates as autograft bone2 ) . autologous iliac crest graft and freeze - dried allograft are commonly used in clinical practice during acdf . osteogenesis requires live bone cells , mature osteoblasts and osteocytes , that remain viable after transplantation by diffusion in the graft6 ,15 ) . autogeneic grafts can participate actively in bone healing through osteogenesis , whereas allogeneic bone contains no live cells , and thus does not promote bone healing through osteogenesis18 ) . osteoinduction , the ability of the graft to stimulate adjacent bone at the recipient site to initiate vascular ingrowth and the transformation and recruitment of osteogenic cells is a property unique to organic bone substrates . the osteoinductive capability of allograft bone is thought to be less than that of autogeneic bone13 ,18 ) . little controversy exists over the ability of both autogeneic and allogeneic bone to provide osteoconduction1 ,25 ) . in brief , for this reason , autograft is a better interbody fusion substrate than allograft substrates biologically . autograft fusion rates after cervical interbody fusion have been reported to range between 73 % and 97 % . in comparison , most studies showed better to similar fusion rate in autograft compared to allograft . in our cases , autograft showed 65 % successful fusion rate and 31.8 % in allograft in short term follow - up period . reason for such results are related to weak osteoinductive and poor osteogenic property in allograft which lead to prolonged fusion time after the surgery12 ) . in addition to a high fusion rate , successful treatment depends on maintenance of interspace height and angle3 ,28 ) . the reduced compressive strength , caused by a more rapid rate of bone resorption , may exacerbate graft collapse11 ) . pelker et al17 ) found that freeze - dried iliac crest graft material had a 10 % loss of compression strength and a 70 % reduction in torsion strength compared to autogeneic iliac crest bone . an average interspace collapse rate 14 % to 24.4 % in the autograft group , and 24 % to 50 % in the allograft group were reported3 ,5,28 ) . in our study , the collapse rate in the autograft group ( 15.5 % ) was less than in the allograft group ( 24.7 % ) . the mean fused interspace height was less well maintained in cases using allograft fusion substrate than autograft bone . although autografts had higher fusion rate and lower interspace collapse rate than allografts , they had disadvantages , such as graft harvesting complications , including hematoma , infection , lateral femoral cutaneous nerve injury , and persistent donor site pain , fracture of graft bone , prolonged operation time , and longer hospitalization12 ) . graft harvesting complications have been reported with a rate of 15 - 20 % of patients undergoing acdf with autograft8 ,18 ) . in our casesalthough allograft group showed lower fusion rate and higher collapse rate compared with autograft group , these factors did not effect the clinical outcome . in our study ,94.1 % of patients in autograft group achieved satisfactory results , compared with 90.5 % of patients in allograft group . likewise , other studies reported no significant difference in clinical outcome between both groups24 ) . the ratio of gender in two groups is different , and female gender can show the difference in bmd score and it can influence the fusion rate and collapse rate . also there was limitation of interpreting the results of bone fusion through only simple radiographs and the number of enrollment was too small to represent the accurate outcome . for more precise outcome , the longer follow - up result of postoperative patients with various radiographic images such as computed tomography ( ct ) and larger number of patients would be necessary . finally , freeze - dried allograft bone was diminished in resistance to bending and torsion compared to autograft bone and with less probability , the risk of possibility of aids virus infection with weakened immunogenicity should be considered . in practically , autologous iliac crest graft and freeze - dried allograft are commonly used in acdf . although autograft is ideal graft substrate for interbody fusion , it has several disadvantages and complications . allograft demonstrate lower fusion and higher collapse rate compared with autograft in the short - term follow - up study , but clinical outcome showed similar results in between both groups .\noutput:\n" }, { "from": "agent", "value": "objectivethe purpose of this study is to verify the usefulness of autograft versus allograft in the radiographic and clinical outcome in early period after the surgery.methodswe performed a retrospective review of 38 patients who had undergone one - or two - level anterior cervical discectomy and fusion ( acdf ) with rigid anterior plate fixation from march 2006 to may 2009 . interbody graft materials were iliac autograft ( n = 17 ) or with allograft ( n = 21 ) . fusion rate and graft collapse rate were assessed by radiographic analysis and clinical outcome was based on odom 's criteria.resultsin autograft group , 13 patients achieved successful bone fusion ( 65 % ) , whereas 7 patients ( 31.8 % ) in allograft group . there was statistically significant between two groups ( p < 0.05 ) . comparing immediate postoperative radiograph with last follow - up , the mean graft collapse was noted 1.3 mm ( 15.5 % change ) in autograft group , whereas 2.0 mm ( 24.7 % change ) in allograft group . there was no statistically significant collapse rate in autograft group ( p > 0.05 ) , but statistically significant in allograft group ( p < 0.05 ) . clinical outcome was excellent or good in 94.1 % in autograft group , and 90.5 % in allograft group.conclusionin study , anterior cervical interbody fusion with an allograft got a result of lower fusion rate and higher collapse rate compared with autograft in early period after surgery , and clinical outcome showed similar results in both groups ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: chronic heart failure ( chf ) is a major cause of morbidity and mortality . apart from the many causes of chf , a slow reduction intherefore , inhibiting cardiomyocyte apoptosis may have implications for the treatment of heart failure ( hf ) . ghrelin , a gut - derived 28 - amino acid peptide hormone was first identified in 1999 by kojima as an endogenous ligand for the gh secretagogue receptor ( ghs - r ) , an endogenous stimulator of gh and is now implicated in a number of physiological processes . cardioprotective effects of ghrelin , especially in its acylated form have been demonstrated on hf models and exploratory human clinical studies . clinical studies have reported that ghrelin confers a variety of potentially beneficial cardiovascular effects , which includes reduction of mean arterial blood pressure , increase in myocardial contractility , protection of endothelial cells , and improvement of energy metabolism of myocardial cells . exogenous administration of ghrelin also results in improvement in coronary flow , heart rate , dilatation of peripheral blood vessels , constriction of coronary arteries , and improvement in ventricular and endothelial function . clinical studies have reported that exogenous administration of ghrelin decreases muscle wasting , improves exercise capacity , inhibits cardiomyocyte apoptosis , inhibits sympathetic nerve activity , and protects from hf induced by myocardial infarction . importantly , administration of ghrelin has been demonstrated to improve the cardiac function and prognosis in patients suffering from end - stage chf . in vitroghrelin reverses cardiac cachexia by promoting a positive energy balance and also by enhancing direct cardioprotective effects of ghrelin . these cardioprotective effects are independent of growth hormone release and likely involve binding to cardiovascular receptors . there is a widespread distribution of ghrelin and its receptors ( ghsr 1a ) in the cardiovascular tissues , which provides a definitive evidence of its cardiac actions . the protective effects of ghrelin on heart are mediated through direct effects on the heart and blood vessel and through its growth - hormone - releasing effect . in normal individuals , acute increases in ghrelindo not alter cardiac metabolism , whereas in patients with hf , they enhance oxidation of free fatty acids and reduce the oxidation of glucose , thus partly correcting its metabolic alterations . this interesting mechanism of action of ghrelin may contribute to the cardioprotective effects of ghrelin in hf . however ; the precise mechanisms by which ghrelin regulates sympathetic activity are still unclear and needs further investigation . peripheral ghrelin may act on ghsr 1a at the cardiac vagal nerve ending , which goes to the nucleus of tractus solitarius ( nts ) and inhibit the renal sympathetic nerve activity ( sna ) . ghrelin can also act directly on the central nervous system ( cns ) and alter the sensitivity of cns to other hormones participating in regulation of sympathetic activity . administration of ghrelin brings down the plasma levels of epinephrine and dopamine and shifts the balance of autonomic nervous activity toward parasympathetic nervous activity . ghrelin increases the size of cardiomyocytes , prolongs their survival , and protects the cardiomyocytes against apoptosis and myocardial injury induced by endoplasmic reticulum stress ( ers ) through a ghs - r1a , calmodulin - dependent protein kinase kinase ( camkk ) , and adenosine monophosphate ( amp ) - activated protein kinase ( ampk ) pathway . administration of ghrelin lowers the release of lactate dehydrogenase ( ldh ) and myoglobin by the cardiomyocytes , indicating protection against cardiomyocyte injury . so also , ghrelin may have other cardiovascular beneficial effects in the form of prevention of atherosclerosis as well as protection from ischemia and reperfusion injury . levels of angiotensin ii ( ang ii ) and ghrelin are both significantly increased in patients with hf . ghrelin also inhibits the at1 receptor up - regulation induced by ang ii , thereby playing a role in preventing hf . elevated levels of ghrelin in patients with hf can be a protective compensatory mechanism for reduced body weight in order to enhance appetite and weight gain in cachexia patients with hf . however , chang et al . has reported that plasma ghrelin levels are significantly lower in patients with hf and also differ with the severity of hf and that higher levels of ghrelin is an indicator of a better prognosis for hf . thus ; ghrelin can be considered as a new biomarker of severity as well as prognostic predictor for patients with chf . ghrelin , a gut - derived 28 - amino acid peptide hormone was first identified in 1999 by kojima as an endogenous ligand for the gh secretagogue receptor ( ghs - r ) , an endogenous stimulator of gh and is now implicated in a number of physiological processes . cardioprotective effects of ghrelin , especially in its acylated form have been demonstrated on hf models and exploratory human clinical studies . clinical studies have reported that ghrelin confers a variety of potentially beneficial cardiovascular effects , which includes reduction of mean arterial blood pressure , increase in myocardial contractility , protection of endothelial cells , and improvement of energy metabolism of myocardial cells . exogenous administration of ghrelin also results in improvement in coronary flow , heart rate , dilatation of peripheral blood vessels , constriction of coronary arteries , and improvement in ventricular and endothelial function . clinical studies have reported that exogenous administration of ghrelin decreases muscle wasting , improves exercise capacity , inhibits cardiomyocyte apoptosis , inhibits sympathetic nerve activity , and protects from hf induced by myocardial infarction . importantly , administration of ghrelin has been demonstrated to improve the cardiac function and prognosis in patients suffering from end - stage chf . in vitroghrelin reverses cardiac cachexia by promoting a positive energy balance and also by enhancing direct cardioprotective effects of ghrelin . these cardioprotective effects are independent of growth hormone release and likely involve binding to cardiovascular receptors . there is a widespread distribution of ghrelin and its receptors ( ghsr 1a ) in the cardiovascular tissues , which provides a definitive evidence of its cardiac actions . the protective effects of ghrelin on heart are mediated through direct effects on the heart and blood vessel and through its growth - hormone - releasing effect . in normal individuals , acute increases in ghrelindo not alter cardiac metabolism , whereas in patients with hf , they enhance oxidation of free fatty acids and reduce the oxidation of glucose , thus partly correcting its metabolic alterations . this interesting mechanism of action of ghrelin may contribute to the cardioprotective effects of ghrelin in hf . however ; the precise mechanisms by which ghrelin regulates sympathetic activity are still unclear and needs further investigation . peripheral ghrelin may act on ghsr 1a at the cardiac vagal nerve ending , which goes to the nucleus of tractus solitarius ( nts ) and inhibit the renal sympathetic nerve activity ( sna ) . ghrelin can also act directly on the central nervous system ( cns ) and alter the sensitivity of cns to other hormones participating in regulation of sympathetic activity . administration of ghrelin brings down the plasma levels of epinephrine and dopamine and shifts the balance of autonomic nervous activity toward parasympathetic nervous activity . ghrelin increases the size of cardiomyocytes , prolongs their survival , and protects the cardiomyocytes against apoptosis and myocardial injury induced by endoplasmic reticulum stress ( ers ) through a ghs - r1a , calmodulin - dependent protein kinase kinase ( camkk ) , and adenosine monophosphate ( amp ) - activated protein kinase ( ampk ) pathway . administration of ghrelin lowers the release of lactate dehydrogenase ( ldh ) and myoglobin by the cardiomyocytes , indicating protection against cardiomyocyte injury . so also , ghrelin may have other cardiovascular beneficial effects in the form of prevention of atherosclerosis as well as protection from ischemia and reperfusion injury . levels of angiotensin ii ( ang ii ) and ghrelin are both significantly increased in patients with hf . ghrelin also inhibits the at1 receptor up - regulation induced by ang ii , thereby playing a role in preventing hf . elevated levels of ghrelin in patients with hf can be a protective compensatory mechanism for reduced body weight in order to enhance appetite and weight gain in cachexia patients with hf . however , chang et al . has reported that plasma ghrelin levels are significantly lower in patients with hf and also differ with the severity of hf and that higher levels of ghrelin is an indicator of a better prognosis for hf . thus ; ghrelin can be considered as a new biomarker of severity as well as prognostic predictor for patients with chf . future researches are needed to evaluate the efficacy of ghrelin as a new biomarker and prognostic tool and for exploring its therapeutic potential in patients suffering from chf .\noutput:\n" }, { "from": "agent", "value": "chronic heart failure ( chf ) is a major cause of morbidity and mortality . cardioprotective effects of ghrelin , especially in its acylated form have been demonstrated in heart failure ( hf ) models and exploratory human clinical studies . hence , it has been proposed for the treatment of hf . however , the underlying mechanism of its protective effects against hf remains unclear . future researches are needed to evaluate the efficacy of ghrelin as a new biomarker and prognostic tool and for exploring its therapeutic potential in patients suffering from chf ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: homeobox genes have crucial roles during embryogenesis and have been deeply studied from the point of view of the evolution of development . changes in their number and regulation may have been instrumental in body - plan evolution and diversification . whether the physical linkage of many homeobox genes is maintained by regulatory constraints oris simply a reflection of their evolutionary origin by tandem gene duplication has not yet been fully elucidated . the clustering of the antennapedia superclass of homeobox genes in contemporary genomes is proposed to be the outcome of tandem gene duplication and cluster duplications from an ancestral urarchehox gene during metazoan evolution . however , genome rearrangements , clade - specific duplications and gene losses obscure the complete evolutionary chronicle . the analysis of the human genome led pollard and holland to suggest that four such clusters , namely the extended hox , the parahox , the nkl and the ehgbox clusters , arose by successive tandem gene duplications and cluster duplications from an ancestral urarchehox gene early in metazoan evolution . the extended hox array includes the hox cluster genes plus the former orphan classes evx and mox . the evolutionary sister of the hox cluster , the parahox cluster , is believed to have resulted from the non - tandem duplication of a four - gene protohox cluster that gave rise to the primordial hox and parahox clusters . although extensive studies have been performed to trace the origin and evolution of the hox genes and more recently the parahox plus hox genes , evx and mox have rarely been considered in these analyses . they have been unified into the extended hox group , owing to their linked disposition in the genome of certain organisms ; for example , evx genes are closely linked to the 5 ' end of the hox gene cluster in most vertebrates and in a cnidarian species . likewise , mox genes map near the opposite extreme of the hoxa and hoxb clusters in the human genome . these linkage data prompted pollard and holland to propose that evx and mox genes originated during the tandem duplication events that produced the ancestral hox cluster genes . in a phylogenetic tree , hox genes alonedo not form a monophyletic clade , but a clade containing both hox and parahox genes . evx genes fall basal to the hox / parahox clade , while the mox gene has vaguely been referred to as a parahox gene and suggested to represent the missing parahox gene related to the central group ( pg4 to pg8 ) of hox genes . . unfortunately , most studies on hox / parahox relationships do not include the mox class . nonetheless , the two views of the evolutionary relationship between the mox and the hox and parahox genes ( hox - related or parahox - related ) are contradictory . if mox genes are derived from the tandem duplication of a particular hox gene ( and thus linked to the hox gene cluster ) , they are not parahox genes . if mox is a descendant of the missing central parahox gene , it is not a hox gene , although it is linked to the hox cluster . following the same reasoning , if evx is the sister of hox plus parahox genes , it can not have originated from the tandem duplication of a hox gene . all these discordant points of view led us to construct phylogenetic trees and search for data backing up the proposed evolutionary relationships between the extended hox group ( including evx and mox ) and parahox genes . we discuss outlines that may not have been considered yet , and draw an evolutionary scenario , which attests that both evx and mox were generated in the same duplication event that gave rise to the hox and parahox clusters . phylogenetic trees constructed with the homeodomain and the homeodomain plus flanking residues showed similar topologies . figure 1 shows a neighbor - joining ( nj ) unrooted tree with the homeodomain plus flanking residues of amphioxus , mouse and drosophila sequences . maximum parsimony ( mp ) trees showed the same relationships ( data not shown ) . the resulting quartet puzzling ( qp ) tree was a comb - like tree without any clear internal relationship . qp is based on a maximum likelihood analysis of quartets and is believed to be too conservative . furthermore , none of the clades below 50 % support is retrieved at the final tree , which may be due to the few amino - acid positions of the data , the current lack of any reliable amino - acid model for the evolution of homeodomain - containing proteins and the stringency of the qp method . first is the consistent grouping of the already proposed relationship for the hox and parahox genes : that is , cdx is the posterior parahox gene more closely related to the posterior group of hox genes ; xlox / pdx1 is the parahox gene more closely related to group 3 of hox genes ; and gsx is the parahox gene more closely related to the anterior group of hox genes . second is the lack of a parahox central gene , as only hox genes are grouped within the central group . the bootstrap value that supports this relationship is 60 % , higher than values reported elsewhere for hox / parahox relationships . two major conclusions can be drawn from the analyses : mox is not the central parahox gene , and not only evx but also mox genes are equally related to both hox and parahox genes , suggesting an early origin for both classes . the tree relates the amino - acid sequences of the homeodomain plus 10 flanking residues on both sides in the hox , parahox , evx and mox protein sequences from mouse , amphioxus and drosophila . note that mox and evx group together in a monophyletic group . to investigate these relationships further , we constructed various phylogenetic trees to which we added the sequences of other closely related antennapedia - type homeobox genes , which have been shown to be linked to the extended hox cluster in certain mammalian genomes , that is , the dlx and the msx classes of nkl homeobox genes and the engrailed , the gbx and hb - 9 classes of ehgbox homeobox genes . as before , similar topologies were obtained when trees were constructed with the homeodomain or with the homeodomain plus 10 flanking residues each side , and by nj or mp analyses . figure 2 shows an unrooted nj tree ( figure 2a ) or the same tree rooted with selected ehg class genes ( en ) as outgroup sequences ( figure 2b ) . again , none of the trees revealed a close relationship between mox and the central hox genes . besides , the resulting trees groups together evx and mox classes , in a basal position with respect to the monophyletic hox and parahox group . the trees ' topology suggests that evx and mox group together as a sister group of the hox / parahox clade . kourakis and martindale have pointed out that if a sister of the urprotohox gene ( which gave rise to the protohox cluster by tandem duplication ) was linked to it , the association of evx with the hox cluster in certain phyla might be the remnant of such linkage . if this is so , a parahox evx - type gene is expected to be adjacent to and 5 ' of the cdx gene , provided the hox / parahox split involved genes adjacent to the protohox cluster . this is supported by the presence of genes for tyrosine kinase receptors and collagens , among others , in the vicinity of both hox and parahox clusters ( and figure 3 ) . furthermore , careful checking of the mouse and human genomes revealed that , with the exception of mouse mox2 , mox and evx genes are linked to the hox clusters , but at either side of it : whereas evx is tightly linked to the 5 ' end of the hox cluster ( under 50 kb ) , mox is loosely linked to its 3 ' end ( more than 5 mb ) ( figure 3 ) . the boxes represent the genes ( only the 3 ' - and the 5 ' - most hox genes have been depicted for clarity ) . hox and parahox genes are depicted in purple , mox in blue , evx in green and non - homeobox genes such as those for collagens and tyrosine kinase receptors in light and dark gray , respectively . linkage data and phylogenetic trees allow us to envisage a feasible scenario for the extended hox / parahox cluster origin and evolution ( figure 4 ) . we propose that an ancestral precursor of mox and evx genes ( here referred to as the evx / mox ancestor ) was linked to the urprotohox gene ( step 1 ) . the protohox cluster was then generated by tandem duplication of the urprotohox gene , thus forming , with the evx / mox ancestor gene , an ancestral hox - like cluster ( step 2 ) . tandem duplication of the whole cluster and adjacent regions gave rise to the ' coupled ' hox - like cluster ( evx plus primordial hox cluster and mox plus primordial parahox cluster , step 3 ) . thereafter , chromosomal breakage between mox and the primordial parahox cluster caused the loose linkage of mox at the anterior end of the hox cluster ( step 4 ) . finally , the further independent evolution of the primordial hox and parahox clusters ( expansion by internal tandem duplications in the former and loss of the central gene in the latter ) accounts for the current composition of the extended hox and the parahox arrays in chordates ( step 5 ) . note that steps 4 and 5 are interchangeable , and that hox cluster expansion and parahox reduction may have preceded chromosomal breakage . evolutionary scenario proposed for the origin and evolution of the extended hox and parahox gene clusters . it implies an evx / mox ancestor gene initially linked to the urprotohox gene ( step 1 ) that gives rise after duplication to evx and mox genes , which is paralleled by the generation of primordial hox and parahox clusters , forming a continuous array containing all the hox - like genes ( the ' coupled ' hox - like cluster ; step 3 ) . alternative scenarios that include the non - tandem duplication of the ancestral hox - like cluster would require further steps , including the jumping of mox across clusters . an ancient duplication of the evx / mox ancestor gene , followed by inversion of eux / protohox plus a local ( non - tandem ) duplication restricted to the protohox cluster , would account as well for the present situation . although they can not be formally discarded , these scenarios seem unlikely , as they demand more events of gene duplication and local rearrangements than the model proposed here . furthermore , current linkage data for non - homeobox genes in the vicinity of the hox and parahox clusters ( see below ) suggest that a larger region was implicated in these duplication events . the evolutionary scenario proposed here stresses not only the ancient origin of both mox and evx classes but also the necessity of a tandem duplication event to originate the extended hox and parahox clusters . moreover , not only the protohox cluster , but also neighboring regions ( including the evx / mox ancestor gene ) , were tandemly duplicated . it has been proposed that a segmental ( non - tandem ) duplication restricted to the protohox cluster was involved in the genesis of the extended hox and parahox gene clusters . this seems unlikely , as in the neighborhood of the mammalian hox and parahox clusters , there are members of other gene families ( for example , tyrosine kinase receptors and collagens ( and figure 3 ) , implying that a larger syntenic region can be traced back to the time of protohox cluster duplication . this evolutionary scenario nicely squares linkage data on hox and parahox syntenic regions with phylogenetic evidence . it involves regional tandem duplication and chromosomal breakage but no polyploidization events or gene losses at either side of the parahox cluster . such breakage can be dated before the duplication of the hox and parahox clusters at the origins of vertebrates , since mox1 and mox2 are linked to the hoxb and hoxa clusters in humans , respectively ( figure 3 ) . however , current linkage data in protostomes do not allow us to trace such breakage further back or determine whether such breakage took place independently in specific lineages . the drosophila evx homolog , even - skipped , is not linked to the hox cluster and the mox homolog , buttonless , is not in the proximity of the hox cluster nor close to the cad and ind parahox genes . the fly genome is probably highly derived from the protostome ancestor , as is the caenorhabditis elegans genome , which lacks two parahox genes and the mox gene . moreover , cnidarians probably have hox and parahox clusters derived from the primordial clusters ( step 4 in figure 4 ) . interestingly evx is linked to hox genes in anthozoans , but nothing is known about the chromosomal position of the cnidarian mox homolog with respect to hox or parahox genes . thus , the existence of cnidarian mox and evx genes , plus hox and parahox , places the tandem duplication of the ancestral hox - like cluster in early metazoan evolution , before cnidarian divergence . phylogenetic trees constructed with the homeodomain and the homeodomain plus flanking residues showed similar topologies . figure 1 shows a neighbor - joining ( nj ) unrooted tree with the homeodomain plus flanking residues of amphioxus , mouse and drosophila sequences . maximum parsimony ( mp ) trees showed the same relationships ( data not shown ) . the resulting quartet puzzling ( qp ) tree was a comb - like tree without any clear internal relationship . qp is based on a maximum likelihood analysis of quartets and is believed to be too conservative . furthermore , none of the clades below 50 % support is retrieved at the final tree , which may be due to the few amino - acid positions of the data , the current lack of any reliable amino - acid model for the evolution of homeodomain - containing proteins and the stringency of the qp method . first is the consistent grouping of the already proposed relationship for the hox and parahox genes : that is , cdx is the posterior parahox gene more closely related to the posterior group of hox genes ; xlox / pdx1 is the parahox gene more closely related to group 3 of hox genes ; and gsx is the parahox gene more closely related to the anterior group of hox genes . second is the lack of a parahox central gene , as only hox genes are grouped within the central group . the bootstrap value that supports this relationship is 60 % , higher than values reported elsewhere for hox / parahox relationships . two major conclusions can be drawn from the analyses : mox is not the central parahox gene , and not only evx but also mox genes are equally related to both hox and parahox genes , suggesting an early origin for both classes . the tree relates the amino - acid sequences of the homeodomain plus 10 flanking residues on both sides in the hox , parahox , evx and mox protein sequences from mouse , amphioxus and drosophila . note that mox and evx group together in a monophyletic group . to investigate these relationships further , we constructed various phylogenetic trees to which we added the sequences of other closely related antennapedia - type homeobox genes , which have been shown to be linked to the extended hox cluster in certain mammalian genomes , that is , the dlx and the msx classes of nkl homeobox genes and the engrailed , the gbx and hb - 9 classes of ehgbox homeobox genes . as before , similar topologies were obtained when trees were constructed with the homeodomain or with the homeodomain plus 10 flanking residues each side , and by nj or mp analyses . figure 2 shows an unrooted nj tree ( figure 2a ) or the same tree rooted with selected ehg class genes ( en ) as outgroup sequences ( figure 2b ) . again , none of the trees revealed a close relationship between mox and the central hox genes . besides , the resulting trees groups together evx and mox classes , in a basal position with respect to the monophyletic hox and parahox group . the trees ' topology suggests that evx and mox group together as a sister group of the hox / parahox clade . kourakis and martindale have pointed out that if a sister of the urprotohox gene ( which gave rise to the protohox cluster by tandem duplication ) was linked to it , the association of evx with the hox cluster in certain phyla might be the remnant of such linkage . if this is so , a parahox evx - type gene is expected to be adjacent to and 5 ' of the cdx gene , provided the hox / parahox split involved genes adjacent to the protohox cluster . this is supported by the presence of genes for tyrosine kinase receptors and collagens , among others , in the vicinity of both hox and parahox clusters ( and figure 3 ) . furthermore , careful checking of the mouse and human genomes revealed that , with the exception of mouse mox2 , mox and evx genes are linked to the hox clusters , but at either side of it : whereas evx is tightly linked to the 5 ' end of the hox cluster ( under 50 kb ) , mox is loosely linked to its 3 ' end ( more than 5 mb ) ( figure 3 ) . the boxes represent the genes ( only the 3 ' - and the 5 ' - most hox genes have been depicted for clarity ) . hox and parahox genes are depicted in purple , mox in blue , evx in green and non - homeobox genes such as those for collagens and tyrosine kinase receptors in light and dark gray , respectively . linkage data and phylogenetic trees allow us to envisage a feasible scenario for the extended hox / parahox cluster origin and evolution ( figure 4 ) . we propose that an ancestral precursor of mox and evx genes ( here referred to as the evx / mox ancestor ) was linked to the urprotohox gene ( step 1 ) . the protohox cluster was then generated by tandem duplication of the urprotohox gene , thus forming , with the evx / mox ancestor gene , an ancestral hox - like cluster ( step 2 ) . tandem duplication of the whole cluster and adjacent regions gave rise to the ' coupled ' hox - like cluster ( evx plus primordial hox cluster and mox plus primordial parahox cluster , step 3 ) . thereafter , chromosomal breakage between mox and the primordial parahox cluster caused the loose linkage of mox at the anterior end of the hox cluster ( step 4 ) . finally , the further independent evolution of the primordial hox and parahox clusters ( expansion by internal tandem duplications in the former and loss of the central gene in the latter ) accounts for the current composition of the extended hox and the parahox arrays in chordates ( step 5 ) . note that steps 4 and 5 are interchangeable , and that hox cluster expansion and parahox reduction may have preceded chromosomal breakage . evolutionary scenario proposed for the origin and evolution of the extended hox and parahox gene clusters . it implies an evx / mox ancestor gene initially linked to the urprotohox gene ( step 1 ) that gives rise after duplication to evx and mox genes , which is paralleled by the generation of primordial hox and parahox clusters , forming a continuous array containing all the hox - like genes ( the ' coupled ' hox - like cluster ; step 3 ) . alternative scenarios that include the non - tandem duplication of the ancestral hox - like cluster would require further steps , including the jumping of mox across clusters . an ancient duplication of the evx / mox ancestor gene , followed by inversion of eux / protohox plus a local ( non - tandem ) duplication restricted to the protohox cluster , would account as well for the present situation . although they can not be formally discarded , these scenarios seem unlikely , as they demand more events of gene duplication and local rearrangements than the model proposed here . furthermore , current linkage data for non - homeobox genes in the vicinity of the hox and parahox clusters ( see below ) suggest that a larger region was implicated in these duplication events . the evolutionary scenario proposed here stresses not only the ancient origin of both mox and evx classes but also the necessity of a tandem duplication event to originate the extended hox and parahox clusters . moreover , not only the protohox cluster , but also neighboring regions ( including the evx / mox ancestor gene ) , were tandemly duplicated . it has been proposed that a segmental ( non - tandem ) duplication restricted to the protohox cluster was involved in the genesis of the extended hox and parahox gene clusters . this seems unlikely , as in the neighborhood of the mammalian hox and parahox clusters , there are members of other gene families ( for example , tyrosine kinase receptors and collagens ( and figure 3 ) , implying that a larger syntenic region can be traced back to the time of protohox cluster duplication . this evolutionary scenario nicely squares linkage data on hox and parahox syntenic regions with phylogenetic evidence . it involves regional tandem duplication and chromosomal breakage but no polyploidization events or gene losses at either side of the parahox cluster . such breakage can be dated before the duplication of the hox and parahox clusters at the origins of vertebrates , since mox1 and mox2 are linked to the hoxb and hoxa clusters in humans , respectively ( figure 3 ) . however , current linkage data in protostomes do not allow us to trace such breakage further back or determine whether such breakage took place independently in specific lineages . the drosophila evx homolog , even - skipped , is not linked to the hox cluster and the mox homolog , buttonless , is not in the proximity of the hox cluster nor close to the cad and ind parahox genes . the fly genome is probably highly derived from the protostome ancestor , as is the caenorhabditis elegans genome , which lacks two parahox genes and the mox gene . moreover , cnidarians probably have hox and parahox clusters derived from the primordial clusters ( step 4 in figure 4 ) . interestingly evx is linked to hox genes in anthozoans , but nothing is known about the chromosomal position of the cnidarian mox homolog with respect to hox or parahox genes . thus , the existence of cnidarian mox and evx genes , plus hox and parahox , places the tandem duplication of the ancestral hox - like cluster in early metazoan evolution , before cnidarian divergence . most studies dealing with the origin and evolution of hox and parahox clusters have not included the hox - related genes mox and evx . we have constructed phylogenetic trees with hox , parahox , mox and evx genes and analyzed the available linkage data in mammalian genomes . we support an evolutionary scenario in which an ancestor of evx and mox was linked to the protohox cluster , and that a tandem duplication of a large genomic region early in metazoan evolution generated the hox and parahox clusters , plus the cluster - neighbors evx and mox . the large ' coupled ' hox - like cluster euxhox / moxparahox was subsequently broken , thus grouping the mox and evx and the hox clusters , and isolating the parahox cluster . whether this breakage happened only once early in evolution , or multiple times in several places is unknown . it is tempting to speculate that a particular extant lineage retains an unbroken version of the ' coupled ' cluster . hox , parahox , evx , mox , msx , gbx and dlx sequences were obtained from public databases . gene names and accession numbers are as follows : mouse mox2 ( mmox2 , p32443 ) ; mouse mox1 ( mmox1 , p32442 ) ; amphioxus mox ( amphimox , aam09689 ) ; drosophila buttonless ( btn , aaf56025 ) ; mouse evx1 ( mevx1 , p23683 ) ; mouse evx2 ( mevx2 , p49749 ) ; amphioxus evxa ( amphievxa , aak58953 ) ; amphioxus evxb ( amphievxb , aak58954 ) ; drosophila even - skipped ( eve , p06602 ) ; mouse gsh1 ( mgsh1 , p31315 ) ; mouse gsh2 ( mgsh2 , p31316 ) ; amphioxus gsx ( amphigsx , aac39015 ) ; drosophila ind ( ind , aak77133 ) ; mouse hoxa1 ( mhoxa1 , p09022 ) ; mouse hoxa2 ( mhoxa2 , p31245 ) ; amphioxus hox1 ( amphihox1 , baa78620 ) ; amphioxus hox2 ( amphihox2 , baa78621 ) ; drosophila labial ( lab , p10105 ) ; drosophila proboscipedia ( pb , p31264 ) ; drosophila zerknllt ( zen , aaf54087 ) ; mouse pdx1 ( mpdx1 , p52946 ) ; amphioxus xlox ( amphixlox , aac 39016 ) ; mouse hoxa3 ( mhoxa3 , p02831 ) ; amphioxus hox3 ( amphihox3 , caa48180 ) ; mouse hoxa4 ( mhoxa4 , p06798 ) ; mouse hoxa5 ( mhoxa5 , p20719 ) ; mouse hoxa6 ( mhoxa6 , p09092 ) ; mouse hoxa7 ( mhoxa7 , p02830 ) ; mouse hoxb8 ( mhoxb8 , p09078 ) ; amphioxus hox4 ( amphihox4 , baa78622 ) ; amphioxus hox5 ( amphihox4 , baa78622 ) ; amphioxus hox6 ( amphihox4 , baa78622 ) ; amphioxus hox7 ( amphihox4 , baa78622 ) ; amphioxus hox8 ( amphihox4 , baa78622 ) ; drosophila deformed ( dfd , p07548 ) ; drosophila sex combs reduced ( scr , p09077 ) ; drosophila fushi tarazu ( ftz , p02835 ) , drosophila antennapedia ( antp ; p02833 ) ; drosophila ultrabithorax ( ubx , p02834 ) ; drosophila abdominal - a ( abda , p29555 ) ; mouse cdx1 ( mcdx1 , p18111 ) ; mouse cdx2 ( mcdx1 , p43241 ) ; mouse cdx4 ( mcdx4 , q07424 ) ; amphioxus cdx ( amphicdx , aac39017 ) ; drosophila caudal ( cad , p09085 ) ; mouse hoxa9 ( mhoxa9 , p09631 ) ; mouse hoxa10 ( mhoxa10 , p31310 ) ; mouse hoxa11 ( mhoxa11 , p31311 ) ; mouse hoxd12 ( mhoxd12 , p23812 ) ; mouse hoxa13 ( mhoxa13 , q62424 ) ; amphioxus hox9 ( amphihox9 , s47607 ) ; amphioxus hox10 ( amphihox10 , caa84522 ) ; amphioxus hox11 ( amphihox11 , aaf81909 ) ; amphioxus hox12 ( amphihox12 , aaf81903 ) ; amphioxus hox13 ( amphihox13 , aaf81904 ) ; amphioxus hox14 ( amphi - hox14 , aaf81905 ) ; and drosophila abdominal - b ( abdb , p09087 ) . selected antennapedia - type homeobox genes ( because of their linkage disposition to the hox gene cluster in certain genomes ) , that also were used are : amphioxus distal - less ( amphidll , p53772 ) ; amphioxus msx ( amphimsx , caa10201 ) ; amphioxus engrailed ( amphien , aab40144 ) ; drosophila msh ( dmmsh , caa59680 ) ; drosophila distal - less ( dmdll , aab24059 ) ; drosophila engrailed ( dmen , p02836 ) ; drosophila hb9 ( dmhb9 , np648164 ) ; mouse dlx1 ( mdlx1 , q64317 ) ; mouse dlx2 ( mdlx2 , p40764 ) ; mouse dlx3 ( mdlx3 , q64205 ) ; mouse dlx4 ( mdlx4 , p70436 ) ; mouse msx1 ( mmsx1 , p13297 ) ; mouse msx2 ( mmsx2 , q03358 ) ; mouse msx3 ( mmsx3 , p70354 ) ; oryzias latipes msx4 ( olmsx4 , baa88311 ) ; human gbx1 ( hgbx1 , q14549 ) and mouse gbx2 ( mgbx2 ; p48031 ) ; mouse engrailed1 ( men1 , p09065 ) ; mouse engrailed2 ( men2 , p09066 ) ; mouse hb9 ( mhb9 , np064328 ) . sequences from other organisms were omitted as the full set of genes is not available or the homeobox is not fully sequenced . trees were constructed using the homeodomain sequence alone or the homeodomain plus ten flanking residues on both sides . the phylogenetic methods used were maximum parsimony ( mp ) , neighbor joining ( nj ) and quartet puzzling ( qp ) . first , an alignment was constructed using the clustalx program and was then edited by eye . nj trees were inferred by either clustalx or mega 2.0 using a poisson model for amino - acid evolution . mp trees were inferred using the mega 2.0 program , by applying the close - neighbor - interchange method with 1,000 bootstrap replicates . a qp tree was inferred by tree - puzzle 5.0 , using the jtt model with a gamma distribution ( eight categories inferred from the data ) and 10,000 replicates . the alignments used to construct the trees in figure 1 and figure 2 are available ( alignment for figure 1 and alignment for figure 2 ) . alignment used to construct the tree in figure 1 click here for additional data file alignment used to construct the trees in figure 2 click here for additional data filewe are indebted to iaki ruiz , gemma marfany and ricard albalat for many discussions , robin rycroft and ivana mio for checking the english version of the manuscript , and josep gardenyes for help with figures . this study was supported by grants pb98 - 1261 - c02 - 02 and bmc2002 - 03316 ( ministerio de ciencia y tecnologa , spain ) . and by the departament d'universitats , recerca i societat de la informaci de la generalitat de catalunya .\noutput:\n" }, { "from": "agent", "value": "the origin and evolution of genes belonging to the extended hox group of homeobox - containing genes , namely mox and evx , is obscure . here , a scenario is proposed in which an evx / mox ancestor gene linked to a protohox cluster was involved in a segmental tandem duplication event that generated an array of all hox - like genes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we obtained formalin - fixed , paraffin - embedded tissue sections from 30 leiomyosarcoma patients at the university of texas md anderson cancer center ( mdacc ; houston , texas , usa ) . these included samples from the retroperitoneum ( n = 12 ) , gastrointestinal tract ( n = 9 ) , uterus ( n = 6 ) , and skin ( n = 3 ) . to validate the results obtained with the mdacc samples , another cohort of 45 formalin - fixed , paraffin - embedded tissues from patients with leiomyosarcoma were retrieved from tianjin medical university cancer institute & hospital ( tmucih ) for further study . the patients ' clinicopathologic characteristics , including sex , age , clinical stage , degree of cell differentiation , tumor location , tumor size , the presence or absence of hemorrhage / cyst , and histopathologic subtype , were also collected . the tissues had been acquired from 18 male and 27 female patients with a mean age of 55.8 years . histopathologic subtypes were assigned based on the 2002 world health organization classification of tumors of soft tissue and bone , . overall survival time was defined from the date of diagnosis or the first treatment to the date of death or last follow - up . overall survival ranged from 1 to 74 months , and the median survival was 19 months . the study protocol was approved by the institutional review boards of both hospitals , and consent was obtained from each patient . briefly , tissue sections ( 4 m ) were dewaxed with xylene , rehydrated with ethanol , soaked in citrate buffer solution ( 10 mmol / l , ph = 6 ) , and boiled in a pressure cooker for 2.5 min to repair the antigen . the sections were then blocked for 20 min with normal serum ( vector laboratories , burlingame , ca ) and incubated overnight at 4c with rabbit polyclonal anti - prune2 antibody ( abcam company , abcam , cambridge , uk ; diluted 1:100 ) . secondary antibody was applied for 60 min ( one drop of biotinylated anti - rabbit with three drops of normal rabbit serum ) . dab ( dako corporation , carpinteria , ca ) staining was applied for 510 min and monitored by microscopy . two pathologists blinded to clinical information evaluated and scored prune2 staining based on staining extent and intensity . ten random high - power fields , each containing approximately 100 cells , were observed under the microscope ( 40 ) . first , staining extent was scored according to the proportion of positive tumor cells : 0 % ( score 0 ) , 10 % ( score 1 ) , 11 % to 25 % ( score 2 ) , 26 % to 50 % ( score 3 ) , 51 % to 75 % ( score 4 ) , and 75 % ( score 5 ) . second , staining intensity was scored based on the color observed : no color ( score 0 ) , yellow ( score 1 ) , tan ( score 2 ) , and brown ( score 3 ) . final scores were calculated by adding the extent and intensity scores , and the results were used to divide patients into two groups : low expression group , for final scores of 04 , and high expression group , for final scores 4 . kaplan - meier survival analysis ( log - rank test ) and multivariate cox regression analysis were used to examine the relationship between overall survival and prune2 protein expression . we obtained formalin - fixed , paraffin - embedded tissue sections from 30 leiomyosarcoma patients at the university of texas md anderson cancer center ( mdacc ; houston , texas , usa ) . these included samples from the retroperitoneum ( n = 12 ) , gastrointestinal tract ( n = 9 ) , uterus ( n = 6 ) , and skin ( n = 3 ) . to validate the results obtained with the mdacc samples , another cohort of 45 formalin - fixed , paraffin - embedded tissues from patients with leiomyosarcoma were retrieved from tianjin medical university cancer institute & hospital ( tmucih ) for further study . the patients ' clinicopathologic characteristics , including sex , age , clinical stage , degree of cell differentiation , tumor location , tumor size , the presence or absence of hemorrhage / cyst , and histopathologic subtype , were also collected . the tissues had been acquired from 18 male and 27 female patients with a mean age of 55.8 years . histopathologic subtypes were assigned based on the 2002 world health organization classification of tumors of soft tissue and bone , . overall survival time was defined from the date of diagnosis or the first treatment to the date of death or last follow - up . overall survival ranged from 1 to 74 months , and the median survival was 19 months . the study protocol was approved by the institutional review boards of both hospitals , and consent was obtained from each patient . , tissue sections ( 4 m ) were dewaxed with xylene , rehydrated with ethanol , soaked in citrate buffer solution ( 10 mmol / l , ph = 6 ) , and boiled in a pressure cooker for 2.5 min to repair the antigen . the sections were then blocked for 20 min with normal serum ( vector laboratories , burlingame , ca ) and incubated overnight at 4c with rabbit polyclonal anti - prune2 antibody ( abcam company , abcam , cambridge , uk ; diluted 1:100 ) . secondary antibody was applied for 60 min ( one drop of biotinylated anti - rabbit with three drops of normal rabbit serum ) . dab ( dako corporation , carpinteria , ca ) staining was applied for 510 min and monitored by microscopy . two pathologists blinded to clinical information evaluated and scored prune2 staining based on staining extent and intensity . ten random high - power fields , each containing approximately 100 cells , were observed under the microscope ( 40 ) . first , staining extent was scored according to the proportion of positive tumor cells : 0 % ( score 0 ) , 10 % ( score 1 ) , 11 % to 25 % ( score 2 ) , 26 % to 50 % ( score 3 ) , 51 % to 75 % ( score 4 ) , and second , staining intensity was scored based on the color observed : no color ( score 0 ) , yellow ( score 1 ) , tan ( score 2 ) , and brown ( score 3 ) . final scores were calculated by adding the extent and intensity scores , and the results were used to divide patients into two groups : low expression group , for final scores of 04 , and high expression group , for final scores 4 . kaplan - meier survival analysis ( log - rank test ) and multivariate cox regression analysis were used to examine the relationship between overall survival and prune2 protein expression . in the 30 leiomyosarcoma tissues from mdacc , prune2 protein staining was predominantly in the cytoplasm of cells ( figure 1 ) . low expression was discovered in 63.3 % ( 19/30 ) of the samples ( figure 1a ) , while high expression was observed in 36.7 % ( 11/30 ) ( figure 1b ) . to investigate the prognostic role of prune2 , we analyzed the association between prune2 protein expression and overall survival . univariate analysis showed that prune2 protein expression had no significant association with overall survival ( = 0.246 , p = 0.62 ) ( figure 2a ) . a , low expression of prune2 protein ; b , high expression of prune2 protein . to validate these results andfurther evaluate the prognostic role of prune2 in leiomyosarcoma , we used a larger cohort of leiomyosarcoma tissue samples from tmucih . in this set of 45 samples , prune2 was also predominantly detected in the cytoplasm ; and 62.2 % ( 28/45 ) had low expression , while 37.8 % ( 17/45 ) had high expression . we also analyzed the association between prune2 protein expression and clinicopathologic factors , and found that prune2 protein expression was significantly associated with tumor size ( p = 0.03 ) and the absence of hemorrhage / cyst ( p = 0.014 ) ( table 1 ) . in addition , univariate analysis showed that there was a significant association between prune2 protein expression and overall survival ( = 5.399 , p = 0.02 ) ( figure 2b ) , with longer survival noted among patients with high levels of the protein . furthermore , multivariate analysis revealed that high prune2 protein expression was an independent , favorable prognostic factor for overall survival ( hr = 0.373 , p = 0.025 ) . a , prune2 protein expression is not significantly associated with overall survival in patients from md anderson cancer center ; b , prune2 protein expression is significantly associated with overall survival in patients from tianjin medical university cancer institute & hospital . in the 30 leiomyosarcoma tissues from mdacc , prune2 protein staining was predominantly in the cytoplasm of cells ( figure 1 ) . low expression was discovered in 63.3 % ( 19/30 ) of the samples ( figure 1a ) , while high expression was observed in 36.7 % ( 11/30 ) ( figure 1b ) . to investigate the prognostic role of prune2 , we analyzed the association between prune2 protein expression and overall survival . univariate analysis showed that prune2 protein expression had no significant association with overall survival ( = 0.246 , p = 0.62 ) ( figure 2a ) . a , low expression of prune2 protein ; b , high expression of prune2 protein . to validate these results and further evaluate the prognostic role of prune2 in leiomyosarcoma , we used a larger cohort of leiomyosarcoma tissue samples from tmucih . in this set of 45 samples , prune2 was also predominantly detected in the cytoplasm ; and 62.2 % ( 28/45 ) had low expression , while 37.8 % ( 17/45 ) had high expression . we also analyzed the association between prune2 protein expression and clinicopathologic factors , and found that prune2 protein expression was significantly associated with tumor size ( p = 0.03 ) and the absence of hemorrhage / cyst ( p = 0.014 ) ( table 1 ) . in addition , univariate analysis showed that there was a significant association between prune2 protein expression and overall survival ( = 5.399 , p = 0.02 ) ( figure 2b ) , with longer survival noted among patients with high levels of the protein . furthermore , multivariate analysis revealed that high prune2 protein expression was an independent , favorable prognostic factor for overall survival ( hr = 0.373 , p = 0.025 ) . a , prune2 protein expression is not significantly associated with overall survival in patients from md anderson cancer center ; b , prune2 protein expression is significantly associated with overall survival in patients from tianjin medical university cancer institute & hospital . the most important contribution of this study is that we found a significant association between prune2 protein expression and overall survival , and that prune2 protein expression was an independent prognostic factor for leiomyosarcoma . more specifically , leiomyosarcoma patients with higher prune2 protein expression exhibited a better survival trend , suggesting that increased levels of the protein might be a favorable prognostic factor for leiomyosarcoma . similarly , in neuroblastoma and prostate cancer , prune2 protein is highly expressed and also plays a prognostic role , . on the other hand , we found no statistically significant association between prune2 mrna expression and survival time in tissue samples from patients at mdacc in our previous study . here , kaplan - meier survival analysis revealed no significant relationship between overall survival time and prune2 protein expression in samples from mdacc , which is consistent with our previous result . nevertheless , in the larger cohort of samples from tmucih , prune2 protein expression showed a significant association with overall survival and was an independent prognostic factor . possible causes are the differences in race among the patients from each center and in the number of cases . we also found that prune2 protein expression was significantly associated with tumor size and hemorrhage / cyst . specifically , prune2 protein expression was higher in the smaller tumor size group ( 10 cm ) . because prune2 plays an important role in regulating cell differentiation and apoptosis , this result suggests that patients with larger tumors may have worse survival . leiomyosarcoma is a rare soft tissue tumor that can occur anywhere in the human body . several factors have been reported to predict poor outcomes in patients with leiomyosarcoma , including advanced age , vascular invasion , dna aneuploidy , and c - myc expression , , . in particular , c - myc expression was reported to be a marker for poor prognosis in leiomyosarcoma . in this study , we have identified that prune2 protein expression level can serve as a prognostic factor for leiomyosarcoma . in conclusion , we report the association between prune2 protein expression and prognosis in human leiomyosarcoma . survival time was longer in tmucih leiomyosarcoma patients with higher expression of prune2 protein . this suggests that prune2 may be involved in the process of leiomyosarcoma development and can be regarded as a biomarker for favorable prognosis . further study is necessary to better understand the role that racial factors play for the relationship between prune2 protein expression and prognosis in patients with leiomyosarcoma , and discover new therapeutic strategies against aggressive leiomyosarcoma .\noutput:\n" }, { "from": "agent", "value": "prune2 plays an important role in regulating tumor cell differentiation , proliferation , and invasiveness in neuroblastoma . our previous study revealed that prune2 / obscn two - gene relative expression classifer accurately differentiated leiomyosarcoma from gastrointestinal stromal tumor . however , the association between prune2 expression and prognosis in leiomyosarcoma is poorly understood . in this study , we evaluated the prognostic role of prune2 in leiomyosarcoma . prune2 expression was detected using immunohistochemistry in 30 formalin - fixed , paraffin - embedded leiomyosarcoma tissues from md anderson cancer center , and high expression was detected in 36.7 % ( 11/30 ) of the samples . to validate these results , immunohistochemistry was performed on another cohort of 45 formalin - fixed , paraffin - embedded leiomyosarcoma tissues from tianjin medical university cancer institute & hospital , and high prune2 protein expression was detected in 37.8 % ( 17/45 ) of the samples . moreover , elevated prune2 expression was significantly associated with tumor size ( p = 0.03 ) and hemorrhage / cyst ( p = 0.014 ) , and was an independent favorable prognostic factor for overall survival in leiomyosarcoma patients from tianjin medical university cancer institute & hospital ( p < 0.05 ) . these data suggest that increased prune2 protein expression may serve as a favorable prognostic marker in human leiomyosarcoma ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: brazil is the world 's second largest producer of cattle , with a total herd of 217.4 million head ( fao , , cider , 2014 ) . recently , the cattle industry has experienced a rise in intensity and productivity , as shown by a 50 % increase in occupancy rate ( animal / hectare ) and a 3.4 % decrease in pasture area from 1990 to 2011 ( instituto fnp , 2012 ) . particularly in the state of rio grandedo sul , beef cattle production occurs predominantly on native pastures , often without considering the effects on sustainability ( beretta et al . ,2002 ) and the environmental changes caused by increased population density and restriction of livestock movement . in addition , genetic selection for desired production characteristics has led to changes in the natural parasite / host balance , resulting in increased susceptibility of cattle to parasites ( waller , 2002 ) . infections by gastrointestinal nematodes affect the well - being and productivity of hosts , causing decreased reproductive performance , a low growth rate , weight loss , and poor food conversion ( mello et al . , 2006 , , 2009 , de graef et al . , 2013 ) . in brazil , anthelmintics are generally used at farmers ' discretion , with no restrictions to access to commercially available drugs and without any assistance from veterinarians . thus , inadequate use of anthelmintics is not rare ; indeed , animals are often treated excessively , interfering with production , accelerating selection of resistant parasites , and posing significant problems for the cattle industry ( delgado et al . , 2009 , zanetti lopes et al . , 2013 ) . parasite resistance has gradually become a significant problem facing cattle producers in several regions worldwide , including brazil ( de souza et al . , 2008 , demeler et al . , 2009 ) . limited information exists regarding parasite resistance status in local cattle herds in the brazilian state of rio grande do sul ; however , there is strong evidence that gastrointestinal nematodes infecting brazilian herds have gained resistance to the main available classes of anthelmintics ( soutello et al . , 2007 , cezar et al . this study aimed to verify the existence of populations of gastrointestinal nematodes resistant to several commercially available anthelminthic compounds by evaluating naturally infected beef cattle from herds located in the state of rio grande do sul , brazil . in addition , the efficacies of some two - drug combinations were tested to assess their potential as alternative to control the multi - drug resistant parasite populations found in the studied herds . the study was conducted on ten farms located in eight counties of the rio grande do sul state in southern brazil : so martinho da serra , dilermando de aguiar ( two farms ) , cacequi ( two farms ) , so gabriel , itaqui , so borja , santiago , and so vicente do sul ( fig . 1 ) . additionally , the following technical criteria were considered : the extensive system used to raise beef cattle ; the availability of bos taurus / bos indicus crossbred calves of both genders ( aging from 7 to 9 months ) ; the presence of 70100 calves or more per farm with counts of 200 eggs per gram of feces ( epg ) ; and the absence of anthelmintic treatment for 60 days before the experimental period . first , all calves available at each farm were included in the study ; however , animals with fewer than 200 epg before treatment were excluded prior to the formation of the experimental groups . calves were weaned approximately six months after birth and kept in the same grazing area before and during the study on each farm . the use of animals was approved by the committee of ethics in animal experimentation of the federal university of santa maria under protocol no . in the first part of the study , ten commercially available anthelmintic compounds were tested on each farm . all treatments were administered by a veterinarian participant of the study following the manufacturer 's recommendations : ivermectin 1 % ( 0.2 mg / kg , subcutaneous , hipramectin hipra ) , doramectin 1 % ( 0.2 mg / kg , subcutaneous , dectomax zoetis ) , eprinomectin 0.5 % ( 500 g / kg , pour - on , eprinex merial ) , moxidectin 1 % ( 0.2 mg / kg , subcutaneous , cydectin ford dodge ) , levamisole 7.5 % ( 3.75 mg / kg , subcutaneous , ripercol l fort dodge ) , albendazole 15 % ( 3.4 mg / kg , subcutaneous , agebendazol gener ) , nitroxynil 34 % ( 9.7 mg / kg , subcutaneous , dovenix supra , merial ) , disophenol 20 % ( 5 mg / kg , subcutaneous , pradoverme prado ) , fenbendazole 10 % ( 5 mg / kg , oral , panacur intervet ) , and closantel 10 % ( 10 mg / kg , oral , diantel hipra ) . after determining the efficacy of each single anthelmintic treatment , six combinations of two drugs were tested at four of the ten farms as a second part of this study . for this purpose , the drug combinations were based on the results of the first part of this study and selected according to the recommendations of cezar et al . , 2011 , geary et al . , 2012 , and pivoto et al . the choice of two - drug combinations was made with a focus on including different modes of action and efficacy against different genera of gastrointestinal nematodes . the tested combinations were : moxidectin 1 % ( 0.2 mg / kg , subcutaneous , cydectin ford dodge ) + levamisole 7.5 % ( 3.75 mg / kg , subcutaneous , ripercol l fort dodge ) , moxidectin 1 % ( 0.2 mg / kg , subcutaneous , cydectin ford dodge ) + albendazole 15 % ( 3.4 mg / kg , subcutaneous , agebendazol gener ) , albendazole 15 % ( 3.4 mg / kg , subcutaneous , agebendazol gener ) + closantel 10 % ( 10 mg / kg , oral , diantel hipra ) , doramectin 1 % ( 0.2 mg / kg , subcutaneous , dectomax zoetis ) + closantel 10 % ( 10 mg / kg , oral , diantel hipra ) , doramectin 1 % ( 0.2 mg / kg , subcutaneous , dectomax zoetis ) + fenbendazole 10 % ( 5 mg / kg , oral , panacur intervet ) , and levamisole 7.5 % ( 3.75 mg / kg , subcutaneous , ripercol l fort dodge ) + closantel 10 % ( 10samples were collected directly from the rectum of each calf 2 days prior to treatment ( d2 ) and on day 14 after treatment ( d +14 ) according to the recommendations of coles et al . all samples were collected in plastic bags , labeled , stored in isothermal boxes for transport to the laboratory , maintained at 10 c for up to 12 h after collection , and processed , as recommended by mckenna ( 1998 ) . all samples were maintained under controlled humidity and temperature before processing and during the larvae culture procedures . counting of epg was performed by a mcmaster modified technique , with a sensitivity of 50 epg . briefly , each sample of 4 g of homogenized feces was mixed and diluted in 56 ml of saturated solution , re - suspended , sifted , and transferred to a mcmaster chamber for epg counting by microscopic identification . these calves were distributed into 10 randomized blocks based on epg at each farm , to balance the mean and the frequency distributions of epg countings among the groups before the treatments . each of the ten groups was randomly treated with a single drug in the first part of this study . at the four farms included in the second part of this study , six additional groups were treated with a combination of two anthelmintic compounds as described previously . the number of animals in each experimental group ranged from 7 to 10 depending on the available calves at each farm . the total number of calves used per farm was : 257 ( farm 1 ) , 110 ( farm 2 ) , 205 ( farm 3 ) , 108 ( farm 4 ) , 127 ( farm 5 ) , 138 ( farm 6 ) , 264 ( farm 7 ) , 184 ( farm 8 ) , 181 ( farm 9 ) , 130 ( farm 10 ) . on each collection day , fecal samples from all calves in each experimental group were pooled , mixed with sterile wood shavings , and stored for larvae cultures ( moisturized daily with sterile water under incubation for seven days at 2227 c and 80 % humidity ) , according to the recommendations of coles et al . after incubation , larvae were recovered by baermanization , after which 100 third - stage larvae in each culture were identified ( by genera ) following the criteria described by van wyk and mayhew ( 2013 ) . on each farm , pre - treatment and post - treatment epg counts were used to calculate the efficacy of each treatment based on the reduction in epg . for this purpose , the selected approach incorporated random sampling error and aggregations between individual hosts in the treatment groups to provide 95 % confidence intervals , which were taken as the 2.5 and 97.5 percentiles of the resulting efficacy distribution . the efficacy of each treatment against each genus of gastrointestinal nematodes was calculated based on the proportion of each genus of nematode in the larvae cultures at d2 and d +14 using the following formula : pr = 100 ( 1perfinal / perinitial ) , where pr is the percentage reduction by genus ; and perinitial and perfinal are the percentages of each genus before ( d2 ) and 14 days after ( d +14 ) treatment , respectively ( coles et al . , 1992 , coles et al . , 2006 , neves et al . , 2014 ) . ( 2014 ) and based on the world association for the advancement of veterinary parasitology ( waavp ) guidelines on anthelmintic resistance ( coles et al . , 1992 ) , considering the epg reduction percentage and the upper ( ucl ) and lower ( lcl ) 95 % confidence limits . therefore , each treatment was classified as effective ( when the epg reduction percentage and upper 95 % confidence limit were both equal or above 95 % and the lower 95 % confidence limit was equal or above 90 % ) , ineffective ( parasite resistance confirmed , when the epg reduction percentage and upper 95 % confidence limit were below 95 % and the lower 95 % confidence limit was below 90 % ) , or inconclusive ( when none of the other criteria were fulfilled ) . moreover , multi - drug resistant parasites were defined as parasite populations of gastrointestinal nematodes that were resistant to anthelmintic drugs of different chemical classes according to the recommendations of james et al . arithmetic means , minimum epg counts , maximum epg counts , and the percentages of each genus of gastrointestinal nematodes found before treatment in each herd are shown in table 1 . table 3 shows the percentage reduction of each genus after each treatment at each farm . the presence of gastrointestinal nematodes with resistance to multiple anthelmintic compounds was detected in all evaluated herds ; on 60 % ( 6/10 ) of the farms , nine of the ten active compounds tested had efficacy 90 % ( table 2 ) . fenbendazole was the most effective compound in the studied herds , followed by levamisole , disophenol , and moxidectin . larvae cultures from animals from all herds showed the presence of mixed infections containing the following genera : haemonchus , cooperia , oesophagostomum , trichostrongylus , and ostertagia ( table 1 ) . were the most susceptible of the identified genera to anthelmintic compounds , whereas cooperia spp . treatment of the animals with avermectin compounds did not result in satisfactory epg reduction in any herd . moxidectin was fully effective at one farm , but unsatisfying reductions in epg counts were observed in the other nine herds . with regard to the benzimidazoles employed in this study , albendazole was ineffective against gastrointestinal parasites at nine farms and showed an inconclusive result at the farm 10 . fenbendazole was effective at farms 2 and 10 and resulted in lower , but not negligible , epg reductions of approximately 90 % at farms 1 , 5 , 7 , 8 , and 9 . in the same way , levamisole exhibited outstanding efficacy greater than 95 % at farms 9 and 10 ; however , levamisole produced no similar reduction in epg count at the other six tested farms . considering the narrow spectrum compounds tested , closantel had unsatisfying results at 90 % ( 9/10 ) of the farmshowever , closantel was effective against haemonchus spp . at farms 1 , 5 , 6 , 8 , and 10 , while it showed no action against cooperia spp . nitroxynil was ineffective at all farms when epg reduction was considered , mainly because it had little effect on cooperia spp . , but it was effective against haemonchus spp . on farms 1 , 6 , 8 , and 9 . disophenol was not effective at six farms , showed inconclusive results at three farms ( 1 , 6 , and 10 ) , and had an efficacy of 96.3 % at farm 9 . the most effective treatment was moxidectin 1 % + levamisole 7.5 % , followed by doramectin 1 % + fenbendazole 10 % , which presented some inconclusive results with efficacy of approximately 90 % . table 6 shows the effect of each anthelmintic combination on each genus of gastrointestinal nematodes at each farm . table 7 shows the mean efficacy of each anthelmintic combination against gastrointestinal nematode genera found at all farms . in general , the same genera identified as resistant to single drugshowever , some groups showed large reductions in epg counts after treatment with anthelmintic combinations , resulting in a lack of viable larvae after treatment ( d +14 ) ( table 6 , table 7 ) . resistance of gastrointestinal nematodes infecting cattle to some classes of anthelmintic compounds has been demonstrated in brazilian herds in the states of santa catariana , so paulo , and mato grosso do sul by souza et al . , 2008 , ( 2013 ) , respectively . however , the results of the present study indicate a worrying situation in relation to the control of gastrointestinal nematodes infections in cattle herds from rio grande do sul because of the high level of multi - drug resistance of the parasite populations found in all farms studied . the broad detection of parasite resistance to several anthelmintics recognized as good quality commercial drugs suggests that parasite populations have developed resistance to the main classes of anthelmintic drugs available in brazil . macrocyclic lactones ( mls ) , especially avermectins , were not effective in any of the herds assessed in this study , with the exception of moxidectin at one farm . similar results were found in other cattle herds by mello et al . , 2006 , cezar et al . ( 2009 ) reported that mls are the most commonly used class of compounds for the control of gastrointestinal helminths in ruminants because of their broad spectrum and endectocide activity , which encourage excessive use and have led to resistance . in the farms evaluated here , no detailed information was obtained regarding the history of each drug at each farm because of a lack of available data . drug use on brazilian farms is often not based on established criteria , while trademarks and compound names are not well recognized by the farmers . as an exception , ivermectin is well recognized and the most widely used anthelmintic , followed by other avermectins , benzimidazoles , levamisole , and cydectin . commercial availability , endectocide action , and price are generally considered most important criteria influencing the choice of drugs by farmers . proportionally to the other genera of gastrointestinal nematodes found in the tested herds , cooperia spp . larvae showed lower susceptibility to mls ( table 3 , table 4 ) . to mls is not rare ; however , treatment failure is often not perceived by farmers because of the low pathogenicity of some species of cooperia ( except , for example , c. oncophora and c. punctata ) ( cezar et al . , 2010b , fazzio et al . , 2014 , zanetti lopes et al . , 2014 ) nevertheless , massive infections by cooperia spp . can lead to loss of appetite , diarrhea , and decreased weight gain ( demeler et al . , 2009 ) . despite the presence of resistant populations of cooperia spp . in the studied herds , clinical signs were not apparent in calves . moreover , larvae of the genera trichostrongylus , haemonchus , ostertagia , and oesophagostomum were identified as resistant after treatment with mls ; however , these genera were not present in samples from all farms ( table 3 ) . levamisole , an imidazothiazole derivative , was a good alternative for the treatment of gastrointestinal nematodes at some farms , in line with reports by duarte et al . ( 2012 ) and gasbarre ( 2014 ) . while farmers reported knowledge of levamisole in the present study , it was not frequently used , indicating low selection pressure . ( 2013 ) regarding sheep in brazil , where reintroduction of levamisole in a flock that had not been exposed to it for 10 years resulted in efficacy of more than 95 % . however , in the present study , with the exception of oesophagostomum spp . , other genera were not fully controlled by levamisole , corroborating the data obtained by de souza et al . phenolic substitutes nitroxynil and disophenol are narrow spectrum anthelmintics that are not recommended in the presence of infections by cooperia spp . , trichostrongylus spp . , or ostertagia spp . ; however , they are indicated to control haemonchus spp . , which is associated with a decrease in food consumption , weight loss , and loss of productivity in cattle ( mckellar and jackson , 2004 , gasbarre , 2014 ) . nitroxynil and disophenol were ineffective in reducing the epg in most herds , mainly because of the presence of genera of gastrointestinal nematodes that were not sensitive to these compounds . were susceptible to nitroxynil and disophenol ; however , resistance of haemonchus spp . to nitroxynil and disophenol was detected in some herds . nitroxynil was effective against haemonchus spp . at farms 1 , 6 , 8 , and 9 , whereas disophenol was effective against haemonchus spp . at farm 1 and ostertagia spp . at farms 1 , 4 , 5 , and 7 . these results show that phenolic - substituted drugs have limited applicability in the studied cattle herds . benzimidazoles ( bzs ) , including albendazole and fenbendazole , are broad - spectrum drugs widely used as anthelmintics in ruminants worldwide ( de graef et al . , 2013 ) . however , in the present study , albendazole had efficacy 90 % at all tested farms , while fenbendazole was highly effective at only 2 farms . frequent use of bzs at the studied farms may have resulted in the establishment of benzimidazole - resistant parasite populations . considering the location of the farms , these data suggest that parasite resistance to bzs may be spreading in rio grande do sul , similar to the situation observed for avermectins in several brazilian herds . the resistance of cooperia spp . to bzs at most farms was similar to the results reported by yazwinski et al . closantel presents a narrow spectrum of action against gastrointestinal nematodes of ruminants . in brazil , thus , closantel can be considered as a treatment for controlling gastrointestinal nematodes in certain conditions ( costa et al . although closantel was not previously used in any of the studied cattle herds , it did not control infection by gastrointestinal nematodes at 90 % of the tested farms . ( the least sensitive genus ) , trichostrongylus spp . , and ostertagia spp . were not susceptible to closantel in most cases . closantel was effective against haemonchus spp . at farms 1 , 5 , 6 , 8 , and 10 , but haemonchus spp . while this is the first report of gastrointestinal nematode resistance to closantel in cattle herds of the state of rio grande do sul , resistance to this compound has been reported by costa et al . , 1986 , furthermore , closantel resistance is very common in sheep , as reported at several studies , due to its intensive use on small ruminants ( cezar et al . , 2010a , sczesny - moraes et al . , 2010 , verissimo et al . , 2012 ) . multi - drug resistance occurs when multiple classes of anthelmintics no longer control certain parasitic populations that originally consisted of a large majority ( more than 95 % ) of susceptible genotypes ( taylor et al . , multi - drug resistance is very common among the main types of gastrointestinal nematodes that infect sheep and goats ; indeed , multi - drug resistance is an emerging issue in cattle around the world , including those raised in brazil and a number of european countries ( rangel et al . , 2005 , the low efficacy of each single drug and the presence of multi - drug resistant gastrointestinal nematodes infecting cattle are major problems that prevent adequate anthelmintic control at the farms evaluated in this study . thus , more sustainable strategies of anthelmintic control in ruminants are required to overcome the problem of multi - drug resistance ( cezar et al . , 2011 , geary et al . , 2012 ) . given that the main classes of anthelmintics did not reduce the epg of treated calves , combinations of active compounds were administered as an alternative treatment approach ( bartram et al . , 2012 ) . ( 2011 ) in sheep , two - drug combinations of anthelmintics were tested on cattle herds in the present work based on previous tests of the efficacy of single drugs . therefore , previous knowledge regarding parasite resistance was used as a tool to inform the choice of potentially efficacious combinations of drugs . the use of combinations of two anthelmintic compounds with good efficacy as single drugs could be an effective means of delaying the development of drug resistance in parasites . however , this study was focused on situations in which two effective drugs were unavailable to farmers . thus , combinations of two anthelmintics that were not fully effective as single drugs , had different modes of action , had broad spectra of action ( when possible ) , and were effective against different genera of gastrointestinal nematodes were tested . some of the anthelmintic combinations were effective against multi - drug - resistant parasite populations , reaching epg reduction percentages 95 % ( table 5 , table 6 ) . despite the unsatisfying efficacies of moxidectin and levamisole as single drugs , the combination of moxidectin 1 % + levamisole 7.5 % was effective in all four evaluated herds . the combination of doramectin 1 % + fenbendazole 10 % was highly effective at farm 8 . acceptable efficacy was shown by some combinations : moxidectin 1 % + albendazole 15 % at farms 3 and 8 , doramectin 1 % + fenbendazole 10 % at farm 3 , and levamisole 7.5 % + closantel 10 % at farm 1 . the success of this practice can be justified by the fact that combinations of drugs belonging to unrelated chemical groups ( with different mechanisms of action ) can effectively control parasite genotypes which are not simultaneously resistant to both anthelmintic compounds ( geerts and gryseels , 2000 , hu et al . , 2010 ) . many of the tested combinations were not effective , probably because of the presence of genotypes of gastrointestinal nematodes resistant to both drugs used in the combinations . the results of this study showed the presence of gastrointestinal nematodes resistant to the main commercially available anthelmintic drugs on cattle farms evaluated in the state of rio grande do sul , brazil . in critical situations of parasite resistance , in which no options of effective drugs are commercially available , combinations of two anthelmintic compounds with different mechanisms of action and unsatisfying efficacy as single drugs can effectively control multi - drug - resistant gastrointestinal nematodes . however , such combinations should be evaluated under the particular conditions unique to each farm . the authors of this manuscript have no financial or personal relationships with other people or organizations that could inappropriately influence or bias the content of the paper .\noutput:\n" }, { "from": "agent", "value": "gastrointestinal nematodes resistant to anthelmintics have been reported in several regions of brazil , and they may be associated with economic losses for the cattle industry . this study aimed to evaluate the resistance status of gastrointestinal nematodes from naturally infected beef cattle to several commercially available anthelmintics , as well as to test the efficacy of combinations of anthelmintics against multi - resistant gastrointestinal nematodes . ten farms located in rio grande do sul state were selected by : farmers ' consent ; extensive raising system ; availability of calves aged from 7 to 9 months naturally infected by gastrointestinal nematodes ; absence of anthelmintic treatment for 60 days before the study ; and presence of 70100 calves or more of both genders with 200 eggs per gram of feces ( epg ) ( sensitivity of 50 epg ) . these calves were distributed into 10 groups ( of 710 animals ) per farm and treated with ivermectin , doramectin , eprinomectin , fenbendazole , closantel , nitroxynil , disophenol , levamisole , albendazole , or moxidectin . feces were collected 2 days before treatment and 14 days after treatment . additional groups of 710 calves were used to test six different two - drug combinations at four of the studied farms . in general terms , fenbendazole was the most effective drug , followed by levamisole , disophenol , and moxidectin . however , parasite resistance to multiple drugs was found in all herds , especially in the genera cooperia spp . , trichostrongylus spp . , and haemonchus spp . . some of the two - drug combinations were effective against nematode populations identified as resistant to the same compounds when used as single drugs . the most effective combinations were moxidectin + levamisole , doramectin + fenbendazole , and levamisole + closantel . in this study , parasites resistant to the main commercially available anthelmintics were found in all herds , and some combinations of two active components belonging to different chemical groups were effective against multi - drug resistant gastrointestinal nematodes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: primary goitrous hypothyroidism was diagnosed in a 12 - month - old cat examined because of small stature , mental dullness , severe lethargy , generalized weakness and gait abnormalities . diagnosis of primary hypothyroidism was confirmed by low serum concentrations of total and free thyroxine ( t4 ) with high thyroid - stimulating hormone ( tsh ) concentrations . thyroid scintigraphy revealed severe enlargement of both thyroid lobes , as evidenced by a seven - fold increase in calculated thyroid volume above the reference interval . in addition , this bilateral goiter had an extremely high radionuclide uptake , about 10-fold higher than the normal feline thyroid gland . treatment with twice - daily levothyroxine ( l - t4 ) , administered on an empty stomach , resulted in increased alertness , playfulness , strength and improvement in gait , as well as an increase in body length and weight . l - t4 replacement also led to normalization of serum thyroid hormone and tsh concentrations , and complete resolution of goiter . spontaneous hypothyroidism is rarely reported in cats , with congenital hypothyroidism in kittens diagnosed most frequently . despite the fact that this cat was a young adult , it likely had a form of congenital hypothyroidism caused by dyshormonogenesis ( defect in thyroid hormone synthesis ) that led to compensatory development of goiter . in hypothyroid cats , treatment with l - t4 is best given twice daily on an empty stomach to ensure adequate absorption . normalization of serum tsh and shrinkage of goiter , as well as improvement in clinical signs , is the goal of treatment for cats with goitrous hypothyroidism . naturally occurring , adult - onset primary hypothyroidism is an extremely rare clinical disorder in cats , with only three reported cases diagnosed in the prime to senior stage of life ( aged 5 , 5 and 12 years , respectively ) . however , congenital hypothyroidism ( cretinism ) is also rare but is one of the most common causes of disproportionate dwarfism in kittens and is much better characterized than the adult - onset form . of the 60 or so cats with congenital hypothyroidism that have been reported , only two were older than 12 months of age at time of diagnosis , whereas another two cats were diagnosed at 7 and 8 months of age , respectively . all of the remaining cases were diagnosed as kittens , generally at 24 months of age . of these cats with congenital hypothyroidism , about half were reported to have palpable enlargement of the thyroid ( goiter ) , which is likely a compensatory response associated with an intrathyroidal defect in thyroid hormone biosynthesis ( dyshormonogenesis ) . whether this feline goiter shrinks or resolves with thyroid hormone replacement therapy is not clear , butthe purpose of this case study was to describe the diagnostic testing , treatment and long - term outcome of a young adult domestic longhair cat first diagnosed with spontaneous goitrous hypothyroidism at the age of 12 months ( in the middle of the junior life stage ) . for this cat , we used the clinical features , serum concentrations of thyroid hormone and thyroid - stimulating hormone ( tsh ) , and results of both qualitative and quantitative thyroid scintigraphy to aid in both the diagnosis and long - term monitoring of thyroid hormone replacement therapy . a 12 - month - old neutered male domestic longhair cat was examined for small stature , mental dullness , lethargy , inactivity , weakness and inability to jump or walk normally . the owner reported that the back legs tended to splay out on smooth flooring , although the cat could walk better on a rug or carpeted surface . the cat had always been dull and inactive ( never played , ran , jumped ) , but the weakness and gait abnormalities had progressively worsened over the past 10 months . the owner had adopted the cat at 19 days of age as a stray kitten . at 5 weeks of age , scrotal and umbilical hernias were surgically repaired , and the kitten was also neutered at that time . initially , the kitten was bottle - fed a commercial liquid milk replacer ( kmr liquid milk replacer ; petag ) and then transitioned over a period of a few weeks to a variety of flavors and brands of canned commercial cat foods ( eg , wellness cat food [ wellpet llc ] ; evo [ natura pet products ] ; and precise naturals [ precise pet products ] ) . the cat had continued to be fed this variety of commercial foods up to the time of initial evaluation . on initial physical examination , the cat weighed 2.3 kg with a normal body condition score ( 3/9 ) and muscle condition score ( 3/3 ) . the cat had an unkempt hair coat and was small in stature , with a body length of 34.5 cm from the tip of the nose to base of tail ( figure 1 , table 1 ) . the rectal temperature was 38.3 c , the heart rate 170 beats per minute and the abdomen palpated normally . oral examination revealed normal adult dentition . bilateral enlargement ( goiter ) affecting both thyroid lobes was detected on cervical palpation . ( a ) cat at time of diagnosis ( 12 months of age ) showing mental dullness , lethargy , small stature and unkempt hair coat ; ( inset ) cat showing rear leg weakness , with splaying of the hindlegs into a frog - leg position on smooth surfaces . ( b ) cat at 24 months of age after treatment with levothyroxine for 1 year serial measurements of body weight , serum thyroid hormone concentrations and quantitative thyroid scintigraphic parameters in a young adult domestic longhair cat with primary hypothyroidism t4 = serum thyroxine ; tsh = serum thyroid - stimulating hormone ; tctu = percent thyroidal uptake of tco4 ; t / s = thyroid - to - salivary ratio ; l - thyroxine = levothyroxine when encouraged , the cat could walk but did so in a crouched posture with a slightly arched back ; the gait was slow , deliberate and short strided . the cat tired quickly and would lie down with the hindlegs splayed out in a frog - leg position ( figure 1a , inset ) . on neurologic examination , mental dullness , decreased menace response and generalized weakness were detected . radiography of the spine and rear legs revealed generalized delayed closure of the ossification centers of the long bones and vertebrae ( figure 2 ) . blood was collected for a complete blood cell count , serum biochemical profile and total thyroxine ( tt4 ) concentration . hematologic evaluation demonstrated a mild normocytic , normochromic anemia , as evidenced by slightly low values for the red cell count , hemoglobin and hematocrit ( table 1 ) . all results of the complete serum biochemistry analysis were within the respective reference intervals ( ris ) ; however , the serum cholesterol concentration was at the high end of normal ( 5.46 mmol / l ; table 1 ) . the serum tt4 concentration was low ( 6 nmol / l ; ri 1249 nmol / l ) . based on the clinical signs and test results , hypothyroidism was suspected and the cat referred to the animal endocrine clinic for further evaluation . notice generalized delayed epiphyseal ossification ( open physes ) of the vertebra and long bones ( arrows ) , as well as failure of fusion of the ischium , ilium and acetabulum , and poorly developed patellae . ( b ) same cat at 24 months of age after treatment with levothyroxine for 1 year . notice that the ossification centers ( physes ) of all vertebrae , long bones and pelvis are now closed and the patellae appear normal physical examination again revealed a small , quiet cat with bilateral goiter . serum for a complete thyroid panel was collected and tt4 , free t4 by dialysis ( ft4 ) , triiodothyronine ( t3 ) and tsh were determined by techniques previously validated for use in the cat . these results confirmed the low tt4 concentration , but also revealed a low ft4 concentration and a markedly high tsh concentration ( table 1 , month 0 ) . thyroid scintigraphy was next performed by injecting 111 mbq of sodium tc - pertechnetate ( tco4 ) intravenously and imaging an hour later , as previously described . quantification of thyroid activity was investigated by calculation of both the thyroid - to - salivary gland ratio ( t / s ) and the percent thyroidal uptake of the injected tco4 ( tctu ) . the estimated thyroid volume was also calculated from the scintigraphic image , as previously described . analysis of the thyroid scintigram revealed both thyroid lobes to be greatly enlarged ( table 1 ) , with the larger left thyroid lobe extending through the thoracic inlet well into the thoracic cavity ( figure 3a , b ) . the uptake of the radionuclide by the massive amount of goiter tissue was much higher than normal , as was confirmed by calculating high values for the t / s ratio and the percent tctu ( table 1 , day 0 ) . thyroid scintigraphy in a cat with goitrous hypothyroidism , before and 1 year after treatment with levothyroxine ( l - t4 ) . both scintigrams were obtained 1 h after intravenous administration of 110 mbq of sodium pertechnetate ( tco4 ) , as previously described . ( a ) thyroid scintigram ( right lateral view ) at time of diagnosis of hypothyroidism , before any thyroid hormone supplementation . the thyroid gland is greatly enlarged and extends through the thoracic inlet ( indicated by dashed line ) into the thoracic cavity . the uptake of the radionuclide by the hyperplastic goiter is much higher than normal , as seen by the increased intensity of uptake by the goiter compared with the salivary glands ( indicated bythe radionuclide uptake in the normal thyroid closely approximates the uptake in the salivary glands , with an expected intensity ratio of 1:1 . the high radionuclide uptake in this cat was confirmed by calculating high values for the thyroid : salivary ( t / s ) ratio and the percent uptake of tco4 ( tctu ; table 1 , day 0 ) . the larger left thyroid lobe extends through the thoracic inlet ( dashed horizontal line ) into the thoracic cavity . again , the uptake of the radionuclide by the hyperactive goiter is much higher than normal , as seen by the increased intensity of uptake by the goiter compared with the salivary glands . ( c ) ventral thyroid image of the same cat after supplementation with l - t4 for 12 months and normalization of serum concentrations of total thyroxine , free thyroxine ( t4 ) and thyroid - stimulating hormone . the thyroid scintigram demonstrates dramatic shrinkage of the hyperplastic thyroid tissue with complete resolution of the large goiter . both thyroid lobes are now within normal limits for size , shape and position in the cervical area . radioactivity uptake in these thyroid lobes has decreased dramatically and now closely approximates activity in the salivary glands , with an expected t / s ratio of approximately 1:1 ( table 1 ) . s = salivary gland ; h = heart ; dashed line = region of thoracic inlet overall , the clinical signs , laboratory results , radiological findings and scintigraphic findings were considered diagnostic for primary , congenital goitrous hypothyroidism . treatment was initiated with an oral solution of levothyroxine ( l - t4 ) ( leventa ; merck animal health ) at a dose of 50 g po q12h , administered on an empty stomach . at the 3 month follow - up time , the cat was reported to be much less lethargic and more active . weight gain and a subjective increase in body length were apparent but the gait abnormality continued . repeat hematological analysis revealed that the mild anemia had resolved , as evidenced by normalization of the total red cell count , hemoglobin concentration and hematocrit . serum cholesterol remained within the ri , but the concentration had fallen to the middle of the ri ( 3.42 mmol / l ) . follow - up endocrine testing revealed that tt4 and ft4 concentrations had risen to only the low end of the ri , whereas tsh had fallen but remained at the high end of the ri ( table 1 ; 3 months ) . because of these endocrine results , the l - t4 dose was increased to 75 g q12h ( table 1 ) . at the 6 month follow - up , the cat was found to be more alert and active , with continued body growth and an increase in body weight ( table 1 ) . serum thyroid hormone monitoring now revealed that tsh concentration was suppressed but concentrations of both tt4 and ft4 concentrations were high . therefore , the daily l - t4 dose was again reduced to 50 g q12h ( table 1 ) . at the 12 month follow - up treatment time ( 24 months of age ) , the cat was reported to continue to be more alert , interactive and affectionate . although the cat could still not jump normally , the body posture and gait were much improved , and the cat was markedly stronger and did not tire easily . the cat had continued to gain weight and body length had increased 1.4-fold from the pretreatment measurement ( table 1 ) . repeat radiographs revealed complete closure of the physes of the vertebrae and long bones ( figure 2 ) . follow - up thyroid scintigraphy demonstrated a normal size and intensity of radionuclide uptake by both thyroid lobes , with complete resolution of the cat s intrathoracic goiter and normalization of thyroid uptake ( figure 3c , table 1 ) . at the time of this submission , the cat is 28 months old , has near - normal overall strength and gait , and is leading a relatively a normal life on an l - t4 dose of 50 g q12h ( table 1 ) . although the cat of this report was not diagnosed until 12 months of age ( during the junior life stage ) , it is likely that the underlying cause of the hypothyroidism was a congenital disorder rather than a spontaneous form of juvenile - or adult - onset hypothyroidism . both the cat s small stature and delayed closure of the ossification centers of vertebra and long bones point to long - standing hypothyroidism , likely starting as a very young kitten . in addition , the fact that this cat had a palpable goiter indicates the presence of intact thyroid tissue ( not characteristic for adult - onset hypothyroidism ) , and the massive size of this goiter suggests a process that was ongoing for many months , most likely since birth . acquired causes for goitrous hypothyroidism , such as iodine deficiency or environmental goitrogens , were considered highly unlikely based on the cat s life - long history and diet of a variety of commercial canned foods . we did not , however , test any of the commercial diets for iodine levels or goitrogens , so this still remains a remote possibility . in cats , congenital hypothyroidism can result from a defect in thyroid gland development ( ie , thyroid aplasia or hypoplasia ) or a defect or a block in thyroid hormone production ( dyshormonogenesis ) by an anatomically intact thyroid gland . in this latter instance , thyroid dyshormonogenesis is associated with an inability to secrete adequate amounts of t4 and t3 , which leads to the loss of normal negative feedback inhibition on pituitary thyrotropes with persistent secretion of excessive amounts of tsh . the unrelenting stimulation of intact thyroid follicular cells by the high circulating concentrations of tsh results in thyroid hyperplasia , enlargement of the intact thyroid and a clinically palpable goiter . obviously , our cat had a form of thyroid dyshormonogenesis rather than aplasia or hypoplasia , based on the presence of goiter . the development of a palpable goiter in cats , dogs or humans with dyshormonogenesis takes time , however , and may be delayed in onset . for example , in one family of affected kittens , goiter was not recognized within the first few weeks of life , but the enlarged thyroid could be readily palpated in all kittens by 56 months of age . this again provides evidence that the massive amount of goiter tissue found in our cat likely indicates very long - standing hypothyroidism , starting most likely at time of birth . a prominent clinical feature of hypothyroidism in this cat was the inability to jump or walk normally , which appeared to be due to generally neuromuscular weakness . in human infants , congenital hypothyroidism can also cause a range of other neuromuscular sequelae , including abnormal muscle tone , severe muscle weakness , ataxia and motor incoordination . although the exact pathogenesis of these neuromuscular signs in our cat is not clear , marked improvement was evident with successful thyroid hormone replacement therapy . in kittens and young juvenile cats , a presumptive diagnosis of congenital hypothyroidismcan be made on the basis of clinical features ( eg , dwarfism , mental dullness , open bone plates ) and low serum tt4 concentrations . however , the definitive diagnosis should never be based on a low tt4 alone , as many concurrent non - thyroid illnesses can also suppress the serum t4 concentration thus leading to a false - positive test result . in addition , although the ris for kittens may change as they move into their junior stage of life , most laboratories have not established age - related ris for the thyroid hormones , at least for kittens or juvenile cats . in the cat of this report , we measured a complete serum thyroid profile , which included tt4 , ft4 , t3 and tsh concentrations . our results , which showed low to lowwe believe that finding high concentrations of tsh is the single most important endocrine test for diagnosis of feline hypothyroidism for two reasons : high tsh concentrations have been reported in all of the hypothyroid cats in which it was measured , and falsely high values for tsh are not generally seen in cats with non - thyroidal illness . thyroid scintigraphy was performed in our cat to better define the diagnosis and to differentiate thyroid aplasia or hypoplasia from dyshormonogenesis . in cats with thyroid aplasia or hypoplasia , no thyroid tissue is visible on scintigraphy , and thyroid uptake of the radioisotope is low or undetectable . in contrast , cats with dyshormonogenesis have an increased uptake of radioiodine into the thyroid gland , as we documented in this cat by calculation of high values for the t / s ratio and tctu ( table 1 ) . although obvious from the subjective assessment of the thyroid scintigram ( figure 3a , b ) , calculation of the cat s pretreatment thyroid volume also confirmed an approximately seven - fold increase above the ris . cats with congenital hypothyroidism treated with l - t4 should have a relatively normal life expectancy , but the long - term prognosis may be dependent on etiology and age at initiation of treatment . the findings in this cat indicate that even with delayed diagnosis , l - t4 treatment can improve or resolve most of the clinical signs , leading to a marked increase in overall body growth and an improvement in strength , activity and mentation . the final l - t4 dose needed to treat cats with hypothyroidism can vary tremendously , with some cats showing an apparent resistance to even relatively high doses ( 200400 g / day ) and others ( including our cat ) responding well to lower doses ( 50100 g / day ) . if resistance to l - t4 supplementation occurs , with persistently high serum tsh concentrations , it can be helpful to administer the dose on an empty stomach ( as we did in our cat ) , as food can interfere with l - t4 absorption . in addition , use of an oral solution of l - t4 ( as we employed in this cat ) , rather than a tablet , may lead to an increased absorption of thyroid hormone . for monitoring of thyroid hormone supplementation in cats with congenital hypothyroidism , the l - t4 dose should be adjusted to normalize both serum tt4 and tsh concentrations . if the serum tt4 remains in the lownormal range and tsh remains high , the dose should be gradually increased and administered on an empty stomach , if possible . if the serum tsh falls but tt4 increases into the hyperthyroid range , the dose should be decreased , as overdosing can blunt the expected weight gain and growth . with adequate treatment ( and normalization of high serum tsh concentrations ) , in the cat of this report , diagnosis of primary hypothyroidism was confirmed by low serum concentrations of tt4 and ft4 with high tsh concentrations . thyroid scintigraphy revealed severe enlargement of both thyroid lobes , as evidenced by a seven - fold increase in calculated thyroid volume above the ri . in addition , this bilateral goiter had an extremely high radionuclide uptake , about 10-fold higher than the normal feline thyroid gland . despite the fact that this cat was a young adult , the author believes the cat had a form of congenital hypothyroidism caused by dyshormonogenesis ( defect in thyroid hormone synthesis ) that led to compensatory development of goiter . treatment with twice - daily l - t4 , administered on an empty stomach , resulted in increased alertness , playfulness , strength and improvement in gait , as well as an increase in body length and weight . thyroid hormone replacement also led to closure of the open epiphyseal ( growth ) plates , normalization of high serum tsh concentrations and complete shrinkage of the goiter .\noutput:\n" }, { "from": "agent", "value": "case summaryprimary goitrous hypothyroidism was diagnosed in a 12 - month - old cat examined because of small stature , mental dullness , severe lethargy , generalized weakness and gait abnormalities . radiographs of the long bones and spine revealed delayed epiphyseal ossification and epiphyseal dysgenesis . diagnosis of primary hypothyroidism was confirmed by low serum concentrations of total and free thyroxine ( t4 ) with high thyroid - stimulating hormone ( tsh ) concentrations . thyroid scintigraphy revealed severe enlargement of both thyroid lobes , as evidenced by a seven - fold increase in calculated thyroid volume above the reference interval . in addition , this bilateral goiter had an extremely high radionuclide uptake , about 10-fold higher than the normal feline thyroid gland . treatment with twice - daily levothyroxine ( l - t4 ) , administered on an empty stomach , resulted in increased alertness , playfulness , strength and improvement in gait , as well as an increase in body length and weight . l - t4 replacement also led to normalization of serum thyroid hormone and tsh concentrations , and complete resolution of goiter.relevance and novel informationspontaneous hypothyroidism is rarely reported in cats , with congenital hypothyroidism in kittens diagnosed most frequently . despite the fact that this cat was a young adult , it likely had a form of congenital hypothyroidism caused by dyshormonogenesis ( defect in thyroid hormone synthesis ) that led to compensatory development of goiter . in hypothyroid cats , treatment with l - t4 is best given twice daily on an empty stomach to ensure adequate absorption . normalization of serum tsh and shrinkage of goiter , as well as improvement in clinical signs , is the goal of treatment for cats with goitrous hypothyroidism ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although renal embolization is reported to be a safe and effective therapeutic procedure for embolization of small branches of renal artery , it is mainly used for urological purposes , i.e. vascular malformations , angiomyolipomas , and renal tumors that are not amenable to surgical resection . a search of the literature for the past 20 years reveals that only a few cases of renal amyloidosis and severe nephrotic syndrome have resulted in bilateral renal artery embolization ( rae ) for severe proteinuria . the limited use of bilateral rae for nephrological purposes may be partly related to its tendency to destroy renal function , which results in anuria and subsequent regular dialysis . regular dialysis is usually stressful for patients , so some patients may be reluctant to receive bilateral rae for severe proteinuria , which can induce hypoalbuminemia and increase the risk of morbidity and mortality . therefore , doctors and patients with renal amyloidosis and proteinuria face a difficult dilemma in deciding whether to use bilateral rae or supportive treatments . this study reports a 66 - year - old patient with renal amyloidosis and severe proteinuria , who received delayed bilateral rae , until a life - threatening pulmonary edema occurred . finally , bilateral rae , followed by regular hemodialysis ( hd ) , successfully cured the severe proteinuria and its related symptoms . a 66 - year - old man diagnosed with chronic lymphocytic leukemia had been treated with prednisolone 5 mg per day and cyclophosphamide 25 mg per day since 1995 . he was referred to our clinic because he had been suffering from renal amyloidosis - related heavy proteinuria ( 21.77 g / day ) , hypoalbuminemia ( 1.4 g / dl ) , and anasarca edema for 6 months . because bilateral rae was not performed , progressive anasarca edema , increased proteinuria ( 31.2 g / day ) , reduced serum albumin ( 0.9 g / dl ) , and dyspnea developed after further conservative treatment with bed rest , salt and water restriction , diuretics such as furosemide 80 mg and hydrochlorothiazide 50 mg trice daily , ramipril 1.25 mg once daily , indomethacin 25 mg trice daily and albumin infusion , for 1 month . the serum bun ( normal range 820 mg / dl ) and creatinine ( normal range 0.81.5 mg / dl ) levels were increased to 43 and 4.8 mg / dl from 36 and 3.0 mg / dl , respectively . on physical examination , body weight was 55 kg , body height 162 cm , blood pressure 7080/5060 mm hg , pulse rate 84 beats per minute , respiratory rate 20 breaths per minute , and body temperature 37c . laboratory investigation revealed white blood cells ( wbc ) , 4.310 / l ( normal range 4.51110 / l ) ; hemoglobin , 92g / l ) , and platelets , 21210 / l ( normal range 15035010 / l ) . unfortunately , further breathing difficulty developed in hospital , despite aggressive treatment with intravenous furosemide and albumin infusion . therefore , the patient underwent bilateral rae ; pure alcohol mixed with lipidol was injected via the orifices of the right and left renal arteries to obliterate the arteries and their branches ( fig .1 ) . after bilateral rae , no proteinuria was noted , due to anuria . there was only mild nausea , flank pain , and mild fever for 1 day after embolization . the serum albumin level was increased from 0.9 to 3.5 g / dl within 3 months ( fig . an increase in muscle mass ( the arm girth increased from 18 to 23 cm , thigh girth from 25 to 35 cm , waistline from 60 to 71 cm , and dry weight from 46 to 57 kg ) was noted during the follow - up period . hospitalization and protein substitution were no longer needed in the following 2 years ( fig . , blood pressure was increased from about 7080/5060 to 100120 / 6070 mm hg in the first year , and 120135 / 7080 mm hg in the second year after bilateral rae . although our case had developed severe proteinuria ( 20 g / day ) , hypoalbuminemia ( 1.4 g / dl ) , and anasarca edema under aggressive diuretic treatment , bed rest , fluid control , angiotensin converting enzymes , and nonsteroid anti - inflammatory drugs and albumin infusion , the patient and family agreed to bilateral rae when the conditions worsened ( urine protein 31.2 g / day and serum albumin 0.9 g / dl ) and a pulmonary edema occurred . after bilateral rae and following regular hd , the patient 's refractory proteinuria , leg edema , and respiratory distress subsided ( fig . because of the successful outcome in this case and previous reports , it is suggested that treatment with bilateral rae as early as possible may be worthwhile for patients with severe proteinuria resistant to medical therapy . in our case , concerns about the subsequent regular hd meant that the patient and family refused early bilateral rae . the patient and family were anxious and wary of further loss of renal function and the stress of regular hd as a result of treatment with rae . however , prolonged severe proteinuria resistant to medical therapy had caused the patient to reach a life - threatening cachexic state . in contrast , bilateral rae and subsequent regular hd not only rapidly alleviated proteinuria , anasarca edema , and pulmonary edema , but also resulted in an increase in serum albumin level , with an obvious improvement in nutritional status , muscle mass and body weight , and clinical condition , with an obvious improvement in quality of life . the patient maintained a steady status for at least the next 2 years . in the meantime , no specific complications have occurred , except for the mild , self - limiting symptoms of post - infarction syndrome , which presented as mild flank pain , fever , and nausea for 1 day after the bilateral rae . this case and selected previous reports reveal important information for physicians and patients in discussing prognoses and considering the pros and cons of bilateral rae . in conclusion , bilateral rae is an alternative , effective , rapid , and safe procedure for the treatment of heavy proteinuria with nephrotic syndrome . bilateral rae with subsequent hd is useful in breaking a vicious circle and can improve nutritional status and alleviate the life - threatening complications associated with hypoalbuminemia .\noutput:\n" }, { "from": "agent", "value": "in the case reported here , after prolonged medical therapy resistance , severe proteinuria subsided following bilateral renal artery embolization ( rae ) . thereafter , respiratory distress , anasarca edema , muscle mass , and serum albumin level improved after regular hemodialysis . although rae is reported to be a safe and effective therapeutic procedure , it is rarely used for severe proteinuria with prolonged medical therapy resistance . the limited use of bilateral rae for nephrological purposes may be partly related to its tendency to destroy renal function , which results in anuria and subsequent regular dialysis . however , delayed rae could cause the patient to reach a life - threatening cachexic state and could increase the risk of morbidity and mortality due to severe proteinuria - induced hypoalbuminemia . our case and selected previous reports reveal important information for physicians and patients while discussing prognoses and considering the pros and cons of bilateral rae ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: alzheimer 's disease ( ad ) is one of the most common age - related disorders ( bachman et al . , 1993 ) . ad is classified into two forms : sporadic ad , which is correlated to aging , and a rare familial early - onset ad ( fad ) , caused by gene mutations . the pathological hallmarks of the disease are intraneuronal neurofibrillary tangles ( nfts ) composed of hyperphosphorylated tau protein and deposition of amyloid - ( a ) fibrils in the extracellular space . central to the disease is the altered proteolytic processing of the a precursor protein ( app ) , resulting in overproduction and aggregation of neurotoxic forms of a. app is an integral membrane protein with a single , membrane spanning domain , a large , extracellular , n - terminus , and a shorter , cytoplasmic c - terminus . the amyloidogenic processing of app involves two sequential cleavages operated by the - and - secretases at the n - and c - termini of a respectively . the - secretase ( bace1 ) cleaves app at the beginning of the sequence of a , generating an extracellular soluble fragment , called sapp , and an intracellular c - terminal end , termed c99 . the - cleavage produces a fragments of different length , these being predominantly a 40 and a 42 . the central role of a in the pathogenesis of ad is supported by two major clues . aggregates of a are neurotoxic and initiate a series of events , including the hyperphosphorylation of tau , which results in neuronal dysfunction and cell death ( yankner , 1996 ) . all genes bearing mutations that cause fad , app and presenilins ( ps ) 1 and 2 , facilitate the accumulation of a 42 , increasing its production and aggregation ( citron et al . , 1992 , 1997 ; the cause of modified app processing and a 42 accumulation in sporadic cases of ad is unclear , but is likely to include oxidative stress ( os ) . os and a are linked each other because a induces os in vivo and in vitro ( hensley et al . , 1994 ; mark et al . , 1997 ; murakami et al . , 2005 ; tabner et al . , 2005 ) , and os increases the production of a ( paola et al . , 2000 ; os increases is believed to be an early event in ad pathology ( nunomura et al . , 2001 ; cutler et al . , 2004 ) as it contributes to membrane damage , cytoskeleton alterations and cell death ( perry et al . , 2000 ) . thus , the identification of a large number of oxidatively modified proteins in common ad and ad animal models ( sultana et al . , 2009 ) suggests that os plays an important role in ad pathogenesis . moreover , extensive oxidative damage observed in mild cognitive impairment ( mci ) brain regions ( lovell and markesbery , 2001 ) suggest that os may be an early event in progression from normal aging to ad pathology . based on these notions , it seems likely that increased production of oxygen free radicals ( reactive oxygen species , ros ) may act as important mediators of synaptic loss and eventually promote neurofibrillary tangles and senile plaques formation ( kern and behl , 2009 ) . our studies , as described below , strengthen the hypothesis that os may be a basic common pathway of a accumulation and toxicity , which is in turn common to most ad risk factors ( zhu et al . , 2004 ) . growing attention has been focused on oxidative mechanisms of a toxicity as well as the search for novel neuroprotective agents . the ability of toxic a peptides to induce protein oxidation and to inhibit the activity of oxidation - sensitive enzymes is consistent with the hypothesis that a can induce severe oxidative damage . transition metals , cu ( ii ) , zn ( ii ) and fe ( iii ) favor the neurotoxicity of a , through their reduction , that yields hydrogen peroxide ( h2o2 ) ( huang et al . , 1999 ) . using density functional theory calculations , it has been shown that a residue tyr - 10 is a pivotal residue in driving the catalytic production of h2o2 in the presence of cu ( ii ) . it has been found that the phenoxy radical of a tyr - 10 produced by the reaction with ros causes neurotoxicity and results in the formation of dityrosines which , in turn , accelerate the aggregation of a peptides ( barnham et al . , 2004 ) . another crucial a residue is met - 35 ; the substitution of met - 35 with cysteine resulted in no protein oxidation in c. elegans model ( yatin et al . , 1999 ) . moreover , it has been suggested that inhibition of cytochrome c oxidase by a 42 could involve the formation of a redox active methionine radical ( crouch et al . , 2006 ) . lipid peroxidation induced by a peptides impairs the function of ion - motive atpases , glucose and glutamate transporters and of gtp - binding proteins , as the result of their covalent modification by aldehydic end products such as 4 - hydroxynonenal ( hne ) ( mattson , 1997 ) . moreover , toxic forms of aggregated a peptides favor ca influx into neurons by inducing membrane - associated os , rendering neurons vulnerable to excitotoxicity and apoptosis ( bezprozvanny and mattson , 2008 ) . a is able to create oxidative modifications of proteins involved in cellular defense mechanisms against noxious stimuli and in proteins involved in energy pathways . in a murineknock - in model of ad , entailing app and ps1 mutations , a direct correlation was demonstrated between the excessive production of a species and the impairment of antioxidant enzymes , with consequent mitochondrial dysfunction ( anantharaman et al . , 2006 ) . these are further demonstrations of how increased os caused by a can lead to increased oxidative modification of proteins and lipids , leading to impaired cellular function and cell death , and consequently to cognitive impairment and ad - like pathology ( sultana et al . , it is still controversial whether the most deleterious form of a peptide in the early stage of ad is represented by the fibrillar or the soluble oligomeric peptide form ( drouet et al . , 2000 ) . recent literature data suggest that small soluble aggregates of a , including protofibrils and oligomers , may be more toxic than a fibrils ( gong et al . , 2003 ; kayed et al . , 2003 ; resende et althese data may help explain , for example , why neurodegeneration and specific spatial learning deficits may occur in ad animal models before the appearance of amyloid plaques ( chui et al . oxidant agents and oxidative products increase app expression ( cheng and trombetta , 2004 ; patil et al . , 2006 ) and intracellular and secreted a levels in neuronal and non neuronal cells like astrocytes ( frederikse et al . , 1996 ; misonou et al . , 2000 ; atwood et al . , 2003 ; murray et al . , 2007 ) . we and others have shown that the expression and activity of bace1 is increased by oxidants ( tamagno et al . , 2002 , 2003 , 2005 ; , 2004 ; tong et al . , 2005 ) . moreover , there is a significant correlation of bace1 activity with oxidative markers in sporadic ad brain tissue ( borghi et al . , 2007 ) , in which a significant increase of bace1 expression has been shown ( fukumoto et al . , 2002 ; we have proposed that a sequence of events link os , bace1 induction and apoptotic cell death through an overproduction of a. initially we have shown that oxidant agents and hne significantly increase the expression , protein levels and activity of bace1 in nt2 neurons , without affecting the levels of app ( tamagno et al . , 2002 , 2003 ) . these events are followed by an overproduction of a peptides as well as by morphological signs of apoptotic cell death ( tamagno et al . , 2005 ) . then , we have found that os increases the - secretase activity in cultured cells and in vivo , and that the increased expression of bace1 induced by os is regulated by the - secretase ( tamagno et al . , 2008 ) . first , they suggest that os , as effect of aging , can increase the expression of both presenilin 1 ( ps1 ) and bace1 , thereby enhancing a production . os is the only known factor able to augment the - secretase cleavage by increasing the expression of ps1 , the catalytic subunit of the endoprotease . secondly , our data reveal the existence of a positive feedback loop in which increased - secretase activity results in up - regulation of bace1 expression . ( 2007 ) demonstrated a correlation between the induction of os and the increase of - secretase cleavage on app . given that os can mediate both - secretase and bace1 activities , we suggest that os is the molecular link between - and - secretase and that , as a consequence , the activities of the two endoproteases are also linked . our findings suggested a sequence of pathological events that could contribute to the pathogenesis of the common , sporadic , late onset form of ad . in this review we will examine the role of os in three of major risk factors for ad , such as aging , hypoxic insults ( stroke ) and hyperglycemia ( diabetes mellitus ) . our hypothesis is that os could be considered a basic common pathway for a accumulation induced by different ad risk factor . the major non - genetic risk factor for development of late - onset sporadic ad is aging but the pathological circumstances causing it are still under debate . os increases with age through variations in ros generation , ros elimination or both ( barja , 2004 ) . the free radical hypothesis of aging implies that accumulation of ros results in damage of the major cell components : nucleus , mitochondrial dna , membranes and cytoplasmic proteins ( harman , 1992 ) . it has been proposed that mitochondria play a central role in this process because they are the primary site of ros formation . recently , the central role of os in aging was further confirmed by showing that the depletion of mitochondrial cysteine is directly correlated with life span in aerobic organisms ( moosmann and behl , 2008 ) . the brain is particularly vulnerable to os because of its high consumption of oxygen , high levels of polyunsaturated fatty acids , and relatively low levels of antioxidants ( floyd and hensley , 2002 ; mattson et al . , 2002 ) . accumulation of oxidative damage in the brain is particularly deleterious since it is a post - mitotic tissue with neurons exhibiting only a weak self - renewal potential due to their low proliferative capacity . an increased oxidative burden has been observed in the brain of non - demented elderly and of sporadic ad patients ( behl and moosmann , 2002 ; moosmann and behl , 2002 ) . membrane lipids are commonly attacked by ros and peroxidation of lipids is the most frequently analyzed oxidative marker that is increased during aging ( zhu et al . , 2006 ) . the oxidative modification of fatty acids leads to a structural damage membranes and to the generation of several aldehydic end products , such as hne , which have a high oxidative potential themselves and can severely impair cellular function ( keller and mattson , 1998 ) . post mortem analysis of the brains of ad patients found increased levels of lipid peroxidation in brain regions that are affected by an early neurodegeneration ( mielke and lyketsos , 2006 ) . several studies have shown that protein oxidation also increases exponentially with brain aging ( abd el mohsen et al . , 2005 ) and is associated with a decreased capacity of the antioxidative defense machinery ( rodrigues siqueira et al . , 2005 ) . importantly , also levels of oxidized proteins correlate with cognitive performance and ad patients exhibit increased levels of protein carbonylation , a key marker for protein oxidation ( keller et al . , 2005 ) . mutations in mitochondrial dna cause a respiratory chain dysfunction , which can increase cellular os . it is well established that mitochondrial mutations accumulate during brain aging and neurodegenerative diseases ( corral - debrinski et al . brain regions , considered a transition stage between normal aging and dementia , suggests that os may be an early event in progression from normal aging to ad pathology ( sultana et al . it has been shown that in mci patients , plasma levels of non - enzymatic antioxidants and activity of antioxidant enzymes appeared to be decreased when compared to those of controls ( guidi et al . , 2006 ; sultana et al . ,2008 ) , moreover , levels of oxidative markers were showed increased ( lovell and markesbery , 2001 ; williams et al . , 2006 ; cenini et al . , 2008 ) . based on os and histopathological similarities , studies of mci may provide clues about ad pathogenesis and progression , as well as about the development of therapeutics to treat or delay this disorder . in summary , the oxidative burden observed in healthy brain aging and in early stages of dementia , confirms that the accumulation of oxidatively modified biomolecules is a general hallmark of brain aging and could be an early event in the progression of mci to ad . it is known that patients with stroke and cerebral infarction are at risk of ad ( rocchi et al . , 2009 ) . hypoxia is a direct consequence of hypoperfusion , which plays a role in the a accumulation . prolonged and severe hypoxia can cause neuronal loss and memory impairment ( koistinaho and koistinaho , 2005 ) . recent studies have shown that a history of stroke can increase ad prevalence by approximately twofold in elderly patients ( schneider et al . , 2003 ; vermeer et al . , the risk is higher when stroke is concomitant with atherosclerotic vascular risk factor ( jellinger , 2002 ) . recently , it has been proposed that hypoxia can alter app processing , increasing the activity of the - and the - secretases . sun et al . , ( 2006 ) showed that hypoxia significantly up - regulates bace1 gene expression , resulting in increased - secretase activity . moreover , the same authors found that hypoxia increases a deposition and neuritic plaque formation , as well as memory deficits , providing a molecular mechanistic link of vascular factors with ad . more recently , sequence analysis and gel shift assays revealed binding of hypoxia inducible factor ( hif ) - 1 , a molecule that regulates oxygen homeostasis ( sharp and bernaudin , 2004 ) , to the bace1 promoter . it has been demonstrated that overexpression of hif - 1 in neuronal cells increases bace1 mrna and protein levels ( zhang et al . , 2007 ) . hypoxia was also found to increase - secretase activity : hif - 1 binds to the promoter of anterior pharynx - defective phenotype ( aph - 1 ) , a key component of the - secretase complex , to up - regulate its expression ( wang et al . , 2006 ; li et al . , 2009 ) . collectively these data show that hypoxia increases the - and the - secretase activities , which facilitate the abnormal cleavage of app , resulting in the acceleration of a production and plaque formation both in vivo and in vitro . although it is generally accepted that intracellular ros levels change during hypoxia , the direction in which this change occurs is still debated . levels of intracellular ros increase under hypoxia ( chandel et al . , 1998 ; dirmeier et al . , 2002 ; guzy et al . , ( 1998 ) suggested that mitochondria are the source of ros involved in the hypoxic response . the electron transport chain , which is embedded in the inner membrane of mitochondria , consists of five multiprotein complexes . complexes i and ii oxidize the energy - rich molecules nadh and fadh2 , respectively , and transfer the resulting electrons across the inner mitochondrial membrane to cytochrome c , which carries them to complex iv . complex iv uses the electrons to reduce oxygen to water . along with carrying electrons , complexes i , ii and iii generate ros ( turrens , 2003 ; klimova and chandel , 2008 ) . it is now accepted that hypoxia increases ros via the mitochondrial transport chain and specifically by the function of complex iii ( bell et al . , 2007 ) . the mitochondria - derived ros are both necessary and sufficient to stabilize and activate hif - 1 . it has been demonstrated that antioxidants reverse hypoxia - induced hif - 1 activation ( hwang et al . , 2008 ) . recent anti - tumorigenic effects of antioxidants have been attributed to the inhibition of hif -1-dependent events ( gao et al . , 2007 ) . moreover , the addition of oxidants , such as hydrogen peroxide , induces hif - 1 activity up - regulation in normoxia ( pag et al . , 2008 ) . we recently showed , both in vivo and in vitro , that hypoxia up - regulates bace1 expression in a biphasic manner , through two distinct mechanisms : ( 1 ) an early release of ros from mitochondria and ( 2 ) a late activation of hif - 1 ( guglielmotto et al . , 2009 ) . the data suggests that the early post - hypoxic up - regulation of bace1 depends on the generation of ros mediated by sudden interruption of the mitochondrial electron transport chain . the involvement of ros released by mitochondria was confirmed by complete protection exerted by compounds , such as rotenone and diphenyl - phenylen iodonium , that affect complex i of the mitochondrial electron transport chain ( li and trush , 1998 ; hglinger et al . , 2005 ) . this early post - hypoxic up - regulation of bace1 recapitulates the cascade of events induced by oxidant agents and hne both in vivo and in vitro ( tamagno et al . diabetes mellitus , a complex metabolic disorder characterized by hyperglycemia , is a risk factor for ad , and multiple mechanisms connecting the two diseases have been proposed ( granic et al . , 2009 ; jones et al . , 2009 ; kojro and postina , 2009 ) hyperglycemia enhances the formation of advanced glycation end products ( ages ) , senescent protein derivatives that result from the auto - oxidation of glucose and fructose ( bucala and cerami , 1992 ) . thus , reducing sugars , such as fructose , glucose and glyceraldehyde are known to react non - enzymatically with the amino groups of proteins to form irreversible schiff bases and then amadori products ( takeuchi and makita , 2001 ) . the early glycation products undergo further complex reactions such as rearrangement , dehydration , and condensation to become irreversibly cross - linked , heterogeneous fluorescent derivatives termed ages ( brownlee et al . , 1988 ) . accumulation of ages in various tissues is known to occur in normal aging , and , at an extremely accelerated rate , in diabetes mellitus and renal failure ( jerums et al . , 2003 ; ahmed and thornalley , 2007 ; goh and cooper , 2008 ) . ages have been detected in vascular walls , lipoproteins and lipid constituents where they lead to macro and microangiopathy and amyloidosis ( schmidt et al . the involvement of ages in brain aging and in ad was reported more than 10 years ago , in studies showing that the microtubule associated protein tau and a , were substrates for glycation ( ledesma et al . , 1994 ; smith et al . , 1994 ; tau is preferentially glycated at its tubulin - binding site , suggesting that glycation may be one of the modifications able to hamper this interaction ( ledesma et al . , 1994 ) . increased extracellular ages formation was demonstrated in amyloid plaques in different cortical areas ( kimura et al . , 1995 ) , were they may have a role in accelerating the conversion of a from monomers to oligomers or higher molecular weight forms ( loske et al . , 2000 ) . besides post - translational protein modifications , ages have other pathologic effects , at the cellular and molecular levels . among these are the production of ros , particularly superoxide and hydrogen peroxide ( carubelli et al . , 1995 ; ortwerth et al . indeed , glycated proteins increase the rate of free radical production compared to the native proteins ( neeper et al . , 1992 ) . another mechanism through which ages mediate the production of os is the interaction with rage , which is a multiligand receptor of the immunoglobulin superfamily of cell surface molecules ( neeper et al . , 1992 ; schmidt et al . , 1992rage is up - regulated in an age - dependent fashion in human tissue ( simm et al . , 2004 ) , and increased age - rage interaction causes os which it believed to be relevant in the pathogenesis of many age - related diseases , such as diabetes , cardiovascular disease and ad ( heine and dekker , 2002 ; zlokovic , 2008 ) . the role of rage in the pathogenesis of ad has been extensively studied , since it also binds a ( yan et al . , 1996 ) , increasing its influx into the brain through the blood - brain barrier ( arancio et al . , 2004 ; takuma et al . ,2009 ) . the role of rage in a-mediated toxicity was assessed by in recent study performed using a murine transgenic model , with targeted neuronal overexpression of rage and mutant app ( arancio et al . , 2004 ) . these mice displayed early abnormalities in spatial learning / memory , accompanied by altered activation of markers of synaptic plasticity , and exacerbated neuropathological findings , indicating that rage is an important co - factor for a-induced neuronal perturbation . moreover , pre - treatment of cultured neurons from wild type mice with neutralizing antibody to rage determined decreased up - take of a and protection from a-mediated mitochondrial dysfunction ( takuma et al . , 2009 ) . very recently , a role of rage in the up - regulation of bace1 , the rate limiting enzyme of a production , was reported in an ad animal model ( cho et al . , 2009 ) . bace1 up - regulation was reported in cells over - expressing rage and in rage - injected brains of tg2576 mice , harboring a human app transgene with the swedish mutation ( cho et al . , 2009 ) . it is expected that , taken into account the increase in life expectancy , the population will continuously age in the next years and virtually everybody has a high probability to become demented . although this correlation is obvious , the molecular details of the link between aging and cognitive decline are not fully understood . the data here reviewed strongly supported the hypothesis that os could be a basic common pathway of a accumulation , as determined by different age - related risk factors ( figure 1 ) . the links between aging and the development of subtle but continuous cellular changes , such as protein , nucleic acids and lipid oxidation have been known for years , and are ever so clear today . it is also evident how such changes have the potential to further undermine the cellular self defense strategies . in the case of ad , these events translate into different mechanisms that lead to impaired clearance , increased accumulation and aggregation of a , and a series of molecular signals that lead to the up - regulation of the enzymes that process app to generate a itself . in this view , if enough time is allowed for such events to take place , ad pathology and dementia will eventually develop in every brain . the need to understand and controlamyloid production and accumulation is ever so necessary now , as the world population is aging at a fast pace . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "alzheimer 's disease ( ad ) is a progressive neurodegenerative disorder affecting the elderly population . mechanistically , the major cause of the disease bases on the altered processing of the amyloid - ( a ) precursor protein ( app ) , resulting in the accumulation and aggregation of neurotoxic forms of a. a derives from the sequential proteolytic cleavage of the - and - secretases on app . the causes of a accumulation in the common sporadic form of ad are not completely known , but they are likely to include oxidative stress ( os ) . os and a are linked to each other since a aggregation induces os in vivo and in vitro , and oxidant agents increase the production of a. moreover , os produces several effects that may contribute to synaptic function and cell death in ad . we and others have shown that the expression and activity of - secretase ( named bace1 ; - site app cleaving enzyme ) is increased by oxidant agents and by lipid peroxidation product 4 - hydroxynonenal and that there is a significant correlation between bace1 activity and oxidative markers in sporadic ad . os results from several cellular insults such as aging , hyperglycemia , hypoxic insults that are all well known risk factors for ad development . thus , our data strengthen the hypothesis that os is a basic common pathway of a accumulation , common to different ad risk factors ." } ]