Datasets:

clinicalnlplab

/

PubmedSumm_train

like 0

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the corneal scar is responsible for 8 % of the 1.3 million blind persons in nigeria . most of these are end - stage scars of persisting , non - clearing , vascularized corneal edema from various forms of keratitis , including , viruses and bacteria like chlamydia , fungus , especially in rural uneducated farming population , and parasites like onchocerca volvulus that cause onchocerciasis , and physical as well as chemical agents . beyond the physical disability , pain , discomfort , and economic burden ; the disfiguring appearance of the eye causes a lot of psychological challenges , which in the traditional african setting may reduce the social values of the affected persons , especially when in the female gender . keratitis of viral nature often tends to be recurrent and persistent because of the difficulty of total eradication of the viral gene from the host - infected cells . these recurrent inflammations break down the corneal anti - neovasculogenesis mechanism with a resulting in - growth of capillaries , and in some cases , larger arterioles and feeder vessels . the normal cornea is an avascular , alymphatic , and immunologically privileged tissue in at least its very center . vascular invasion bridges this immune privilege , allowing the diffusion of immune and allergic mediators , including cytokines , immunoglobulins , vasoactive proteins , and lipids , as well as , cellular infiltrates into the cornea . these mediators are capable of inducing increased vascular permeability in the normal vessels and inducing the growth of abnormal leaky vessels , with resulting edema in the surrounding corneal tissues . the resultant effect of all of these changes is loss of corneal clarity , pain and redness in the short run , as well as lipid and other forms of corneal degeneration , scarring , calcification , and finally functional visual loss in the long run . modalities that can rapidly stop the process of corneal edema will therefore be invaluable in preventing visual morbidity and blindness , with its consequent social and economic impact . a 26 - year - old male , unemployed person , presented to the ophthalmology clinic on 14 august , 2012 with a three - week history of blurring , soreness , lacrimation , redness , and pain in the left eye . he had three similar attacks in the last three months , for which he was hospitalized . he had lid edema , cilliary injection , a severely hazy central disciform corneal stromal edema on an old corneal scar , with lipid corneal degeneration , and multiple nummular keratitis at around the 1 oclock position of the left cornea . the anterior chamber of the left eye did not show any cell or flare reaction . the red reflex was poor due to the corneal haze , with no visible details of the fundus . a diagnosis of secondary viral disciform and nummular keratitis was made and patient was put on oral and topical ointment of acyclovir together with a stat dose of cyclopentolate and antibiotics . he was to be followed up in a week by which time a steroid was to be included in his therapy . the patient did not show up until six weeks later when his visual acuity had deteriorated to counting finger in the left eye . he complied with his last medical prescription for only the last two weeks to the date of his presentation . a topical steroid was added to his other medications and he was to be reviewed in another one week . at the scheduled appointment , he was subjectively fine and comfortable , his vision had improved to 6/24 in the left eye and the conjunctiva injection had subsided ; stromal edema had subsided in the superior cornea , and the nummular keratitis had disappeared . he had a prominent feeder vessel into an area of the thick corneal scar in the inferior aspect of the left cornea [ figure 1 ] , with surrounding non - clearing , corneal edema and lipid keratopathy in the inferior - nasal quadrant bordering on the visual axis [ figure 2 ] . he had a deep anterior chamber , but the inferior iris and fundal details were not visible . image of edematous scarred vascularized left cornea image of edematous scarred left cornea the relative quietness of the non - vascularized superior portion of the left cornea contrasted with the active edematous cornea area bordering on the feeder vessel in the inferior portion of the left cornea . it was , therefore , hypothesized that this could be explained by vascular leakage and the inflammatory mediators from the supplying feeder vessel into the adjacent cornea area . after the patient gave informed consent , he was put under a slit lamp microscope . the upper eyelid was manually retracted by the examiners gloved fingers after topical anesthesia with amethocaine . the cautery ballpoint was heated in a spirit lamp and the tip applied to about a 4 mm length of the sclera portion of the feeder vessel , to cauterize and separate the feeder vessel from the scarred and edematous portion of the inferonasal left cornea . the procedure lasted for about four minutes without any complication and was well - tolerated by the patient . the procedure was imaged pre - and post - intervention and the patient was given a stat dose of oral ibuprofenimage of the left eye , immediately post intervention five days post intervention , the patient felt well with no more pain and his vision had improved . on examination , visual acuity od remained 6/9 and osthere were conjunctival petechial hemorrhages in the area of the cautery and the intra - cornea feeder vessel had regressed [ figure 4 ] . on slit lamp examination , the corneal clearity had improved enough to allow easy visualization of the details of the inferior iris and a normal fundus , with c : d = 0.3 , a pink disc , normal macula , and a peripheral normal pink flat retina . image five days post intervention this patient had achieved rapid corneal edema reversal with significant functional improvement and has remained so , via phone conversation , a month later . this patient had progressive worsening of visual acuity from 6/24 to cf in the left eye despite two weeks usage of antiviral ointment of acyclovir , but had a reversal of visual deterioration from cf to 6/24 in the left eye upon one week 's institution of steroid . this evidence supports the dependency of the pathology and its functional performance on immune mechanism , and therefore , the vessel that brings the mediators as a prospective target for immune modulation . the concept of cauterization , embolization , and new vessel regression in control of abnormal blood flow , infective keratitis , enhanced corneal graft tolerance , control of a lipid keratopathy , and even metaplasia , is not new , and numerous agents have been produced to achieve these purposes . some of these include fine needle diathermy , angiosclerotic agents , obliterative radiotherapy , laser therapy , thrombotic sponge , particles and microspheres , and in the eye , anti - vascular endothelial growth factor and steroids . these vessels are usually microvessels that supply inaccessible parts of the body as opposed to prominent macrovessels ( pre - capillary arterioles ) seen in an accessible part of the cornea in this patient . the size and location of the feeder vessel offered an opportunity for a cost - effective and feasible direct localized surgical cauterizing intervention , with wider diffuse corneal impact well away from the site of the burn . following medical intervention with antiviral , antibiotic , and steroid , this patient showed a differential regression of tissue pathology , edema and functional improvement in the vascularized and non - vascularized portion of the cornea , with the vascularized portion lagging behind in the regression of cornea edema and transparency . the rapid thinning out of the vascularized edematous cornea , assessed by the slit lamp beam , was well and beyond the change seen in the non - vascularized portion , coupled with a complete reversal of the relative thickness of the cornea in the vascularized and non - vascularized portions of the cornea following intervention gives a clue to the causealthough the patient had his first post intervention review in five days , the effect of edema regression was probably earlier , but was still adjudged rapid . macrovascular cauterization is affordable , requires no expensive technology , and is feasible even in remote economically poor - resourced regions , as only magnification , a spirit lamp , and a cautery point were required . episcleral and limbal cauterization is a routine procedure in cataract surgery and has not been associated with any significant adverse effect , when correctly applied . this method of cauterization will , however , be more difficult to apply where the panni are multiple , microvascular , and more diffuse . cornea vascularization with edema is an important theme in many important corneal diseases ; therapy can , therefore , achieve a wider application . this case study has demonstrated the accelerated regression of corneal edema and functional corneal performance following cauterization of a cornea feeder vessel . it is a safe , feasible , affordable , and accessible intervention to consider in difficult non - clearing corneal edema of selected patients . we encourage further research on this , to confirm the efficacy of this intervention , as well as researches to develop the applicable intervention of a similar nature for diffuse micropannus diseases of the cornea .\noutput:\n" }, { "from": "agent", "value": "this is a case report of a symptomatic non - clearing , vascularized , disciform , corneal stromal edema with a feeder vessel that has remained refractory to medical therapy of antiviral , steroid , and antibiotics , for a period of three weeks , but showed a rapid improvement in visual acuity of 0.1 log mar within five days of feeder vessel cauterization , together with improvement of two psychometric scales in corneal cloudiness on a scale range of 0 to 3 , clinical evidence of resolution of corneal edema , and subjective resolution of the patient 's symptoms . cauterization was done under magnification with a ball cautery point warmed in a spirit lamp following topical anesthesia . this intervention may become handy in difficult non - clearing corneal edema and prevent blinding consequences , in a low - resource facility , in selected applicable cases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: non - variceal upper gastrointestinal bleeding ( nvugib ) is a common gastrointestinal cause of hospital admission and generates significant morbidity and mortality despite advancements in endoscopic and acid - suppressive therapy ( 1 ) . recent studies have identified rebleeding as a significant predictor of mortality ( 2 - 6 ) . thus , prediction of rebleeding within 30 days helps to differentiate high - from low - risk patients . a recently reported international consensus on nvugib recommended that patients who are at low risk for rebleeding , on the basis of clinical and endoscopic criteria , may be discharged promptly after endoscopy ( 7 ) . therefore , clinical parameters that predict rebleeding should be identified ; these must be easily accessible , accurate , and equally effective in various ethnic groups . some studies have reported risk factors for rebleeding , and several risk scoring models to improve medical decision - making have been developed . however , the risk factors vary widely among reports due to significant heterogeneity in study design . most scoring systems were designed to predict mortality or a combination of mortality and rebleeding rather than only rebleeding ( 5 ) . to deal with the disparity in the quality of studies of nvugib , we attempted to follow these recommendations by applying the suggested clinical and endoscopic criteria , and by including key baseline characteristics . the aims of this study were 1 ) to describe clinical characteristics , endoscopic findings , and clinical outcomes and 2 ) to identify predictive factors for 30 - day rebleeding in patients admitted to the emergency unit for nvugib . all adult patients ( older than 18 yr ) presenting with symptoms or signs of gastrointestinal bleeding at keimyung university dongsan hospital in daegu , korea , between april 2010 and january 2012 were enrolled prospectively in a previously designed database . patients with bleeding from esophageal or gastric varices or lower gastrointestinal causes and those who did not complete an at least 30 - day follow - up period were excluded from the analysis . all endoscopic procedures were performed within 24 hr after arrival at the hospital by experts who had experience with more than 1000 endoscopy cases . variables included demographic data , clinical manifestations of bleeding ( hematemesis , melena , hematochezia , and anemia of acute onset ) , tobacco use , alcohol consumption ( heavy consumption was defined as 40 g per day and 60 g per day for women and men , respectively , for 5 yr ) ( 9 ) , and the use of non - steroidal anti - inflammatory drugs ( nsaids ) , anti - platelet agents ( aspirin , clopidogrel , and cilostazol ) , steroids , and proton pump inhibitors ( ppi ) . comorbidities , such as diabetes mellitus , hypertension , heart failure , cirrhosis , chronic kidney disease ( ckd ) ( ckd was defined as patients with an estimated glomerular filtration rate 60 ml / min for 3 months calculated using the four - variable modification of diet in renal disease study equation ) ( 10 ) , cerebrovascular disease , peripheral vascular disease , and metastatic malignancy , were registered . past history of gastrointestinal bleeding or peptic ulcer disease and hemodynamic instability ( pulse 100 beats / min , hypotension with a systolic pressure 90 mmhg at admission and during the hospital stay ) were recorded . laboratory data including hemoglobin , platelets , prothrombin time , and blood urea nitrogen were collected . in order to avoid the risk of potential multi - collinearity between variables , we used blatchford score12 and rockall score5 as variables for the logistic regression analysis of rebleeding ( 11 , 12 ) . the presence of blood in the stomach when no specific lesion was visualized was classified as bleeding of unidentified cause ( 13 , 14 ) . in all patients , stigmata of recent hemorrhage at the mucosal lesion were classified according to the forrest classification ( 15 ) . active bleeding ( forrest i ) , exposed vessel ( forrest iia ) , and adherent clot ( forrest iib ) were regarded as high - risk endoscopic stigmata . all endoscopic appearances were reviewed and corrected by two expert endoscopists to improve inter - observer agreement . all active bleeding was controlled by endoscopic treatments , including hemoclipping , epinephrine injection , electrocoagulation , or argon plasma coagulation ( apc ) . although the lesions with high - risk stigmata were instructed to be endoscopically treated by a strict hospital protocol , the decision to perform therapeutic endoscopy was at the discretion of the individual endoscopist . survey of gastric biopsies for helicobacter pylori was not performed routinely , but frequencies of practice and detection were recorded . a 30 - day rebleeding was defined as new onset of hematemesis , coffee - ground vomitus , or hematochezia with hypovolemic shock or a decrease in blood hemoglobin of more than 2 g / dl after a 24 - hr period of stable vital signs following successful endoscopic treatment ( 13 , 16 ) within 30 days of the index bleeding episode . categorical variables were compared using pearson 's chi - square test or the fisher 's exact test . a two - tailed p value of less than 0.05 was considered to indicate statistical significance . this study protocol was reviewed and approved by the institutional review board of keimyung university dongsan hospital ( no 11 - 294 ) . categorical variables were compared using pearson 's chi - square test or the fisher 's exact test . a two - tailed p value of less than 0.05 was considered to indicate statistical significance . this study protocol was reviewed and approved by the institutional review board of keimyung university dongsan hospital ( no 11 - 294 ) . bleeding was due to esophageal or gastric varices in 71 patients , and lower gastrointestinal bleeding in 56 patients . therefore , 176 ( 56.4 % ) patients with nvugib were included in the study ( fig . the mean age of the patients was 59.7 yr with a male predominance ( 80.1 % ) . the proportions of positive ng aspiration and digital rectal examination results were 69.2 % ( 117/169 ) and 68.4 % ( 117/171 ) , respectively . a past history of gastrointestinal bleeding was found in 49 ( 27.8 % ) , and of peptic ulcer disease in 57 ( 32.4 % ) . the most frequent comorbidity was hypertension ( 43.8 % ) , followed by diabetes mellitus ( 23.8 % ) . the percentages of current smokers and heavy drinkers of alcohol were 37.5 % and 38.1 % , respectively . thirty - five patients ( 19.9 % ) were taking nsaids . over half of the patients ( 101 , 57.4 % ) had a severe - bleeding - related symptom ( hematemesis or hematochezia ) as the presenting symptom . tachycardia ( pulse 100 beats / min ) and hypotension ( systolic blood pressure 90 mmhg ) during the hospital stay were found in 33.5 % and 22.2 % of patients , respectively . one - hundred and thirty - seven patients ( 77.8 % ) had peptic ulcer disease , which was the most frequent source of bleeding . the causes of bleeding in the other 39 patients were as follows : mallory - weiss syndrome ( 12.5 % ) , stomach cancer ( 1.1 % ) , angiodysplasia ( 1.1 % ) , and hemorrhagic gastritis ( 0.6 % ) . high - risk endoscopic stigmata , such as forrest classifications i , iia , and iib , were documented in 93 ( 52.9 % ) patients . overall , rebleeding occurred in 37 ( 21.0 % ) patients during the median follow - up period of 192 days ( interquartile range 65 - 380 ) ; rebleeding within 1 week and 30 days of admission occurred in 21 ( 11.9 % ) and 27 ( 15.3 % ) patients , respectively ( table 2 ) . male gender ( p = 0.019 ) , a positive ng tube aspiration result ( p = 0.001 ) , past history of peptic ulcer disease ( p = 0.019 ) , ckd ( p 0.001 ) , blatchford score12 ( p = 0.037 ) , lesion location in the body ( p 0.001 ) , high - risk endoscopic stigmata ( p 0.001 ) , and tachycardia ( pulse 100 beats / min ) during admission ( p however , only the following parameters were independent predictors of 30 - day rebleeding in the multivariate analysis : ckd ( or , 10.29 ; 95 % ci , 2.84 - 37.33 ; p 0.001 ) , tachycardia ( pulse 100 beats / min ) during the hospital stay ( or , 3.79 ; 95 % ci , 1.25 - 11.49 ; p = 0.019 ) , and high - risk endoscopic stigmata ( or , 6.14 ; 95 % ci , 1.36 - 27.66 ; p = 0.018 ) ( table 4 ) . male gender ( p = 0.019 ) , a positive ng tube aspiration result ( p = 0.001 ) , past history of peptic ulcer disease ( p = 0.019 ) , ckd ( p 0.001 ) , blatchford score12 ( p = 0.037 ) , lesion location in the body ( p 0.001 ) , high - risk endoscopic stigmata ( p 0.001 ) , and tachycardia ( pulse 100 beats / min ) during admission ( p however , only the following parameters were independent predictors of 30 - day rebleeding in the multivariate analysis : ckd ( or , 10.29 ; 95 % ci , 2.84 - 37.33 ; p 0.001 ) , tachycardia ( pulse 100 beats / min ) during the hospital stay ( or , 3.79 ; 95 % ci , 1.25 - 11.49 ; p = 0.019 ) , and high - risk endoscopic stigmata ( or , 6.14 ; 95 % ci , 1.36 - 27.66 ; p = 0.018 ) ( table 4 ) . in this study , we identified factors that were independently associated with the risk of 30 - day rebleeding in a cohort of 176 patients presenting with nvugib . we found that ckd ; tachycardia ( pulse 100 beats / min ) during the hospital stay ; and high - risk endoscopic stigmata of forrest classifications i , iia , and iib were independently associated with rebleeding within 30 days . these risk factors are easy to identify following the initial bleeding event , are valuable for predicting clinical outcomes , and may be useful for guiding clinical management of patients with nvugib . identifying patients at high risk for rebleeding is important for cost - effective management of nvugib . many risk stratification schemes use both clinical and endoscopic criteria ( 2 , 4 , 17 , 18 ) . the rockall score is the best known of all risk - stratification tools for upper gastrointestinal bleeding . it includes three non - endoscopic ( age , shock , and comorbidity ) , and two endoscopic ( endoscopic diagnosis and presence or absence of endoscopic stigmata of recent hemorrhage ) variables ( 2 ) . the blatchford score , another risk stratification system , does not include an endoscopic parameter , but uses only clinical ( systolic blood pressure , heart rate , melena and / or syncope , hepatic disease and / or cardiac failure ) and laboratory ( blood urea nitrogen and hemoglobin ) variables to predict the need for treatment ( 3 ) . recently reported international consensus recommendations have emphasized the importance of early risk stratification using prognostic scales , such as the rockall or blatchford score ( 7 ) . although univariate analysis showed that only blatchford scores was significantly correlated with 30 - day rebleeding in patients with nvugib , it failed to show statistical significance after adjustment for other variables in a multivariate analysis . this result corresponds with other studies , that the rockall score is unsatisfactory for the prediction of rebleeding ( 19 , 20 ) . also , there are discrepancies in the accuracy of the blatchford score system ( 21 ) . some studies were unable to demonstrate a high specificity for the blatchford score in discriminating high - and low - risk patients with upper gastrointestinal bleeding ( 21 , 22 ) . furthermore , this score was originally designed not to assess risk of rebleeding but to determine whether patients with upper gastrointestinal bleeding require treatment to manage their bleeding ( 23 ) . therefore , it remains to be seen that the rockall and the blatchford score are effective tools for prediction of rebleeding in nvugib . in this study , nvugib patients with ckd had a high risk of rebleeding , which is similar to other reports ( 6 , 24 , 25 ) . it seems that an acquired defect of primary hemostasis caused by platelet dysfunction and an altered platelet - vessel wall interaction is responsible for hemorrhagic tendencies ( 26 , 27 ) . in cheung 's study , end stage renal disease ( esrd ) requiring dialysis was an independent predictor of peptic ulcer rebleeding , and there was no difference in rebleeding between patients with non - dialysis - dependent ckd and a normal control group ( 25 ) . it is possible that some of these patients used anticoagulants routinely ( e.g. , heparin ) during hemodialysis , exhibited accumulation of medications due to poor clearance , and had impaired healing of ulcers caused by sporadic circulation variability in the gastrointestinal tract during hemodialysis ( 28 ) . in the present study , of 27 patients who had ckd , only nine had esrd ( hemodialysis or peritoneal dialysis for 6 months ) . in the context of these results , patients with ckd , not only esrd buta recent study also reported that non - dialysis - dependent ckd patients rebled more frequently than the control group , indicating a significant rebleeding risk in patients with ckd after initial nvugib ( 24 ) . therefore , patients with both esrd and ckd who do not require dialysis might need intensive endoscopic hemostasis combined with ppis and a longer hospital stay under close monitoring , than those without . hemodynamic instability has been reported to be a significant risk factor for rebleeding and mortality . a systolic blood pressure 90 mmhg , tachycardia 100 beats / min , and peripheral signs of shock indicate hemodynamic instability and were evaluated at admission in most studies ( 5 ) . we also evaluated systolic blood pressure , diastolic blood pressure , and pulse rate at admission . however , none of these factors was significantly associated with increased 30 - day rebleeding in the present study . this discrepancy between studies might be attributed to differences in the populations and methods used . we found that patients who had tachycardia during the hospital stay had a high risk of 30 - day rebleeding ( or , 3.79 ; 95 % ci , 1.25 - 11.49 ; p = 0.019 ) . although hemodynamic instability after diagnostic endoscopy might limit its applicability as a prognostic variable for deciding early additional measures , it emphasizes the importance of close monitoring for patients with nvugib . it is well known that the outcome of bleeding from peptic ulcer is dependent partly on the endoscopic stigmata of bleeding as described by forrest ( 15 ) , and endoscopic hemostatic therapy is indicated for patients with high - risk stigmata ( active bleeding or a visible vessel in an ulcer bed ) ( 29 ) . the role of endoscopic therapy for ulcers with an adherent clot ( forrest classification iib ) is controversial ( 7 ) . the risk of rebleeding with adherent clots after washing without endoscopic therapy can be low or high , depending on the presence of concurrent illnesses ( 30 - 32 ) . in the present study , we did not try to shave adherent clots with the snare technique , and usually used water irrigation . therefore , lesions with clots resistant to vigorous irrigation could not be distinguished from ulcers with exposed vessels . therefore , we included forrest iib among the high - risk bleeding stigmata . in our study , patients with forrest classifications i , iia , and iib had a significantly higher risk of rebleeding ( or , 6.14 ; 95 % ci , 1.36 - 27.66 ; p = 0.018 ) . this suggests that particularly in patients with high risk endoscopic stigmata ( including forrest classification iib ) , careful management with close monitoring for the recurrent bleeding according to the guidelines is essential . the strengths of this study were as follows : it was of a prospective observational design , and we evaluated many variables that have been recommended as key baseline characteristics for comparisons across studies ( 8 ) . in addition , risk scoring systems , including rockall and blatchford scores , were calculated . in all cases , endoscopy to evaluate the cause of bleeding was performed within 24 h. limitations of the study include its small size and performance in a single center . hence , the findings should be considered within the context of these limitations . in conclusion , in patients with nvugib , the risk of rebleeding is significantly increased with ckd ; forrest classification i , iia , or iib ; and the occurrence of tachycardia ( 100 beats / min ) during the hospital stay . however , rockall and blatchford scores are not relevant to the prognosis . in these high - risk patients , emergency endoscopic hemostasis , intensive pharmacological therapy , and a longer hospital\noutput:\n" }, { "from": "agent", "value": "the results of studies that evaluated predictive factors for rebleeding in non - variceal upper gastrointestinal bleeding are inconsistent . the aim of this study was to investigate predictive factors for 30 - day rebleeding in these patients . a consecutive 312 patients presenting symptoms and signs of gastrointestinal bleeding were enrolled in this prospective , observational study . clinical and demographic characteristics and endoscopic findings were evaluated for potential factors associated with 30 - day rebleeding using logistic regression analysis . overall , 176 patients were included ( male , 80.1 % ; mean age , 59.716.0 yr ) . rebleeding within 7 and 30 days occurred in 21 ( 11.9 % ) and 27 ( 15.3 % ) patients , respectively . we found that chronic kidney disease ( ckd ) ( or , 10.29 ; 95 % ci , 2.84 - 37.33 ; p < 0.001 ) , tachycardia ( pulse > 100 beats / min ) during the admission ( or , 3.79 ; 95 % ci , 1.25 - 11.49 ; p = 0.019 ) , and forrest classes i , iia , and iib ( or , 6.14 ; 95 % ci , 1.36 - 27.66 ; p = 0.018 ) were significant independent predictive factors for 30 - day rebleeding . however , neither rockall nor blatchford scores showed statistically significant relationships with 30 - day rebleeding in a multivariate analysis . ckd , hemodynamic instability during hospitalization , and an endoscopic high - risk appearance are significantly independent predictors of 30 - day rebleeding in patients with non - variceal upper gastrointestinal bleeding . these factors may be useful for clinical management of such patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: approximately , 40 % of the new drug candidates in development today are water insoluble and associated with poor bioavailability . there were various formulation approaches reported to overcome these problems ; these include the use of drug nanoparticles , solid dispersions , micronization , lipids , surfactants , complexation with cyclodextrin , and permeation enhancers . majority of these approaches have their limitations because of the need for specialized equipment , complicated manufacturing process , longer processing time , and regulatory complexity . lipid - based formulation approaches , particularly the self - microemulsifying drug delivery system ( smedds ) , are well known for their potential as alternative approach for delivery of hydrophobic drugs , which are associated with poor water solubility and low oral bioavailability . lipid - based drug delivery system has gained considerable interest after the commercial success of norvir ( ritonavir ) , fotovase ( saquinavir ) , and neoral ( cyclosporine a ) . olmesartan medoxomil is a novel selective angiotensin ii receptor blocker that is approved for the treatment of hypertension . it is a prodrug that is rapidly deesterified during absorption from the gastrointestinal tract to produce an active metabolite , olmesartan . however , the oral ba of olmesartan medoxomil was only 26 % in healthy humans due to low solubility in water and unfavorable breakage of the ester drug to a poorly permeable parent molecule in the gastrointestinal fluids . olmesartan dose - dependently reduces blood pressure through arterial vasodilatation and reduced sodium retention , as do other angiotensin receptor blockers . smeddss are isotropic and thermodynamically stable solutions consisting of an oil , surfactant , cosurfactant ( cos ; or solubilizer ) , and drug mixtures that spontaneously form oil - in - water ( o / w ) microemulsions when mixed with water under gentle stirring . the motility of stomach and intestine provides the agitation required for self - emulsification in vivo . smedds spreads readily in the gi tract , and the digestive motility of the stomach and the intestine provides the agitation necessary for self - emulsification . this spontaneous formation of an emulsion in the gastrointestinal tract presents the drug in a solubilized form , and the small size of the formed droplet provides a large interfacial surface area for drug absorption . apart from solubilization , the presence of lipid in the formulation further helps improve bioavailability by affecting the drug absorption . selection of a suitable self - emulsifying formulation depends upon the assessment of ( 1 ) the solubility of the drug in various components , ( 2 ) the efficient self - emulsifying region as obtained in the phase diagram , and ( 3 ) the droplet size distribution of the resultant emulsion following self - emulsification . thus , improving solubility and dissolution rate of olmesartan medoxomil can increase clinical efficacy or reduce the oral dosage required to achieve the same effect . therefore , we use smedds formulation with acrysol el135 as oil , tween 80 as a surfactant , and transcutol p as a co - surfactant to enhance the solubility and dissolution velocity of olmesartan medoxomil . the formulation was characterized for its ability to form microemulsions based on droplet size , zeta potential , and dissolution characteristics . , usa , and were used as received : capmul mcm ( glycerol monodicaprylate ) , acconon c - 80 ( polyoxyethylene 80 coconut glycerides ) , captex 200 ( propylene glycol dicaprylocaprate ) , and captex 355 ( glyceryl tricaprylate ) . transcutol p ( highly purified diethylene glycol monoethyl ether ) , plurol oleique ( polyglyceryl - 3 dioleate ) , labrafil m 2125cs ( linoleoyl macrogol - 6 glycerides ) , lauroglycol 90 ( propylene glycol monolaurate ) were received as gift sample from gattefosse , france . acrysol k 140 ( polyoxyl 40 hydrogenated castor oil ) and acrysol el 135 ( polyoxyl 35 castor oil ) were also gifted from corel pharma chem . , ahmedabad , india . tween 80 ( polyoxyethylene sorbitan monooleate ) , tween 60 ( polyoxyethylene sorbitan monostearate ) , and propylene glycol were bought from finar chemical limited , ahmedabad , india . polyethylene glycol 200 ( peg 200 ) and polyethylene glycol 400 ( peg 400 ) were bought from s. d. fine chemical limited , mumbai , india . sunflower oil and castor oil were purchased from gujarat glycol private limited , ankaleshwar , india , and kush proteins private limited , anand , india . solubility of olmesartan medoxomil was determined in various modified oils , surfactants , and cosurfactants . two ml of each component was taken in screw cap vials with known quantity ( 250 mg ) of excess drug . a vortex mixer ( spinix , india ) sealed vials were kept on isothermal mechanical shaker at 402c for 72 hours . after equilibrium , each test tube was centrifuged at 6000 rpm for 20 min using a centrifuge ( r - 8c , remi , india ) . filtered solution was appropriately diluted with methanol , and uv absorbance was measured at 257 nm . briefly , 500 l of surfactant was added to 500 l of oil phase . each mixture , 100 l , was then diluted with 50 ml distilled water in glass stopper conical flask . ease of emulsification was judged by the number of flask inversions required to yield homogenous emulsion . the % transparency was evaluated at 650 nm by a double - beam uv spectrophotometer using distilled water as a blank . mixtures of the co - surfactant , selected surfactant , and the selected oil were prepared and evaluated in similar fashion as described in the above section on surfactants . an ftir - 8400s spectrophotometer ( shimadzu , japan ) equipped with attenuated total reflectance ( atr ) accessory was used to obtain the infrared spectra of drug in the isotropic mixtures of excipients . analysis of pure drug , acrysol el135 , transcutol p , tween 80 , physical admixtures of the drug with the excipients ( in 1 : 2 ratio ) , and their comelts ( in 1 : 2 ratio ) were carried out using diffuse reflectance spectroscopy ( drs ) - ftir with kbr disc . all the samples were dried under vacuum prior to obtaining any spectra in order to remove the influence of residual moisture . for each the spectrum ,8 scans were obtained at a resolution of 4 cm from a frequency range of 4000600 cm as shown in figure 1 . surfactant ( tween 80 ) and co - surfactant ( transcutol p ) were mixed ( smix ) in different volume ratios ( 1 : 1 , 1.5 : 1 , 2 : 1 ) . for each phase diagram , oil ( acrysol el 135 ) and specific surfactant / cosurfactant ( smix ) ratio were mixed thoroughly in different volume ratios from 1 : 9 to 9 : 1 ( 1 : 9 , 2 : 8 , 3 : 7 , 4 : 6 , 5 : 5 , 6 : 4 , 7 : 3 , 8 : 2 , 9 : 1 ) in different glass vials . slow titration with the aqueous phase was performed for each combination of oil and smix separately . the amount of aqueous phase added was varied to produce a water concentration in the range of 5 % to 95 % of total volume at around 5 % time intervals . the calculation for the addition of aqueous phase was done by calculating the percentage of each component of the microemulsion present at each 5 % addition . the beauty of this system is that the scale - up of the proportions is easy , as the system is thermodynamically stable . after each 5 % addition of the aqueous phase to the oil : smix mixture , visual observation was made and recorded . through visual observation , the following categories were assigned : ( 1 ) transparent and easily flowable : oil / water microemulsions ; ( 2 ) transparent gel : microemulsion gel ; ( 3 ) milky or cloudy : emulsion ; ( 4 ) milky gel : emulgel . in a similar manner , calculations for the other ratios of oil and smix were also done . for each smix ratio , a separate phase diagram was constructed , and for each phase diagram visual observations were recorded . the pseudoternary phase diagram ( figure 3 ) was constructed using chemix software based on the visual observations noted . in figure 3 , only microemulsion points are plotted ( shaded area ) , so that there is no overcrowding of the phases in the diagram , as for formulation development only the microemulsion area is of interest . olm ( 20 mg ) was added in accurately weighed amount of oil into a screw - capped glass vial and heated in a water bath at 40c . the surfactant and co - surfactant were added to the oily mix using positive displacement pipette and stirred with magnetic bar . the formulation was further sonicated ( ultrasonic cleaner en -30-us , electroquip , india ) for 15 min and stored at room temperature until its use in subsequent studies . four smedds formulations were prepared , and their self - emulsifying performance was compared . the composition of four formulations is shown in table 1 . the emulsification time ( the time for a preconcentrate to form a homogeneous mixture upon dilution ) was monitored by visually observing the disappearance of smedds and the final appearance of the microemulsion in triplicate . a visual test to assess the self - emulsification properties of smedds formulation was performed by visual assessment as previously reported . in this method , a predetermined volume of formulation ( 1 ml ) was introduced into 300 ml of water in a glass beaker that was maintained at 37c , and the contents mixed gently using a magnetic stirrer . the time to emulsify spontaneously and progress of emulsion droplets were observed . formulations ( s1 to s4 ) each of 1 ml were diluted with 100 ml of water in a volumetric flask . after ensuring complete dispersion of the formulation , the droplet size of resultant microemulsion was determined by photon correlation spectroscopy that analyzes the fluctuation in light scattering due to the brownian motion of the droplets as function of time using a zetasizer nano series ( malvern instruments , dts version 4.10 , serial number mal 500999 ) . zeta potential of the formulations ( s1 to s4 ) with oleylamine , without oleylamine was measured by using malvern zetasizer ( malvern instruments , dts version 4.10 , serial number mal 500999 ) equipped with a 4.0 mw he - ne red laser ( 633 nm ) . zetasizer measures the potential that ranged from 120 to 120 v. for measurement of zeta potential 2 gm of each formulations were diluted with 100 ml water . in vitro dissolution studies . the in vitro drug release of olm from the optimized smedds was performed using usp dissolution apparatus ii ( tdt - 08l , electrolab , mumbai , india ) . hard gelatin capsules , size 00 filled with preconcentrate ( equivalent to 20 mg olm ) and pure drug ( 20 mg ) separately , were put into each of 900 ml phosphate buffer ph 6.8 , at 370.5 c with a 50 rpm rotating speed . samples ( 10 ml ) were withdrawn at regular time intervals ( 5 , 10 , 15 , 30 , 45 , and 60 min ) and filtered using a 0.45 m filter . the methanolic extract was analyzed for the olm content spectrophotometrically ( uv - 1800 , shimadzu , japan ) at 257 nm using standard curve . optical clarity . each formulation ( 1 ml ) was diluted with 100 ml of water in glass beaker . absorbance of each dispersion was measured at 400 nm using a uv spectrophotometer immediately after microemulsions formation , and after 0 hrs , 6 hrs , and 24 hrs , respectively . in vitro drug diffusion . a 4 - 5 cm long portion of the dialysis tubing was made into dialysis sac by folding and tying up one end of the tubing with thread . it was then filled up with phosphate buffer saline ph 7.4 and examined for the leaks . the sac was then emptied and smedds containing olm equivalent to 5 mg diluted to 1 ml transferred into sac . one ml of the plain olm ( 5 mg ) suspension was accurately transferred into separate sac . the sacs were again examined for leak and then suspended in the glass beaker containing 50 ml phosphate buffer saline , which become the receptor compartment . at predetermined time intervals , 5 ml samples were withdrawn from the receptor compartment and analyzed by using uv spectrophotometer . all experiments and protocols described in this study were approved by the institutional animal ethics committee ( iaec ) , and all experiments were conducted as per the norms of the committee for the purpose of control and supervision of experiments on animals ( cpcsea ) , ministry of social justice and empowerment , government of india . one milliliter of the olm smedds and plain drug suspension sample ( 5 mg / ml ) was filled into the intestine which was tied at both ends . the tissue was placed in an organ bath with continuous aeration at 37c . the receptor compartment ( organ tube ) was filled with 30 ml of phosphate - buffered saline ph 7.4 with 1 % sodium lauryl sulphate . at predetermined time intervalsthe study was also repeated with plain olm suspension , and the results were compared . solubility studies were aimed at identifying a suitable oily phase for the development of the olm smedds . identifying the suitable oil having the maximal solubilizing potential for the drug under investigation is very important to achieve optimum drug loading . the solubility of olm in various oils and surfactants is presented in table 2 . among the various oily phases that were screened , acrysol el 135could solubilize maximum amount of olm ( 72.42.31 mg / ml ) . the selection of the surfactant or cosurfactant in the further study was governed by the emulsification efficiency rather than the ability to solubilize olm . results inferred that the oily phase acrysol el 135 exhibited the highest emulsification efficiency with tween 80 for the homogenous emulsion formation . on the other hand , acrysol el 135 showed poor emulsification properties with other surfactants employed , requiring a higher number of flask inversions ( table 3 ) . the aforementioned results suggested the use of acrysol el 135 as an oily phase with tween 80 as a surfactant for further study . addition of a co - surfactant to the surfactant - containing formulation was reported to improve dispersibility and drug absorption from the formulation . as depicted in table 3 , acrysol el 135 exhibited good emulsification with transcutol p showing the maximum transmittance ( 100 % ) followed by pg ( 99.4 % ) amongst all cosurfactants . herein , the solubility of the drug in different cosurfactants may judge the final selection . results of the solubility study demonstrated in table 2 inferred a higher solubility in transcutol p. it is worthy to note that all dispersions exhibited an instantaneous emulsion formation with only five flask inversions ( table 3 ) . this could contend the importance of co - surfactant addition to the surfactant - containing dispersions . pseudoternary phase diagrams were constructed in the absence of olm to identify the self - emulsifying regions and to optimize the concentration of oil , surfactant , and co - surfactant in the smedds formulations . a series of the smeddss were prepared , and their self - emulsifying properties were observed visually . the phase diagrams were constructed at surfactant / co - surfactant ratios of 1 : 1 , 1.5 : 1 , and 2 : 1 ( v / v ) . phase diagram of different surfactant and co - surfactant ratio is shown in figure 2 . the gel - like region was found to become large with the increasing concentration of tween 80 , while the self - microemulsifying region decreased . the maximum self - microemulsifying region had to be at a ratio of 1 : 1 . however , the drug precipitation was observed after several hours at ratios of 1.5 : 1 and 2 : 1 . however , an excessive amount of the co - surfactant will cause the system to become less stable for its intrinsic high aqueous solubility and lead to the droplet size increasing as a result of the expanding interfacial film . hence , the optimal ratio of surfactant to co - surfactant was selected to be 1 : 1 as shown in figure 3 . based on above results , a three - component smedds formulation was established containing 34 % acrysol el 135 as oil ( on the basis of the solubility study and required target amount of olm , 20 mg ) , 33 % tween 80 as the surfactant , and 33 % transcutol p as the co - surfactant ( on the basis of phase diagrams ) . four smedds formulations were prepared , and their self - emulsifying performance was compared . in the self - emulsifying systems , the free energy required to form an emulsion was very low , thereby allowing a spontaneous formation of an interface between the oil droplets and water . moreover , since the drug released will be in nanosize , it will increase the effective surface area for dissolution . the efficiency of self - emulsification could be estimated primarily by determining the rate of emulsification which is an important index for the assessment of the efficiency of emulsification , that is , the smedds should disperse completely and quickly when subjected to aqueous dilution under mild agitation . the emulsification time of these formulations was in the range of 15 to 35 sec ( table 4 ) . the droplet size of the emulsion is a crucial factor in self - emulsification performance because it determines the rate and extent of drug release as well as absorption . as depicted in table 4 , average droplet size was found in water , which ranges from 50.22 to 200.49 nm indicating all the particles were in the nanometer range . the result shows that the higher smix proportion led to decrease in mean droplet size . the smallest particles were observed for formulation s2 ( 50.223.42 , mean sd , n = 3 ) , and largest droplets were obtained for formulation s4 ( figure 3 ) . zeta potential can be defined as the difference in potential between surface of the tightly bound layer ( shear plane ) and the electroneutral region of an emulsion . it has got practical application in the stability of emulsion since - potential governs the degree of repulsion between adjacent , similarly charged , dispersed droplets . if the - potential is reduced below a certain value ( which depends on a particular system being used ) , the attractive forces exceed the repulsive forces , and the particles come together leading to flocculation . the zeta potential of the formulations were from 3.90.42 to 23.890.14 ( mean sd , n = 3 ) as given in table 4 . in general , the zeta potential value of 30 mv is sufficient for the stability of a microemulsion . dissolution studies were performed for the smedds formulations in phosphate buffer ph 6.8 , and the results were compared with the pure drug ( figure 4 ) . there is no any significant difference in dissolution of four smedds formulations . as the emulsification time is below 35 s , about 100 % of the drugis released within 15 min in case of smedds , while plain drug showed only 14.1 % dissolution at the end of 15 min . the dissolution studies were conducted for 1 hr to observe the variation or occurrence of precipitation over a time . the in vitro dissolution studies indicate that formulation of olm in the form of smedds formulation enhances the dissolution properties . irrespective of difference in composition , the drug content of formulations s1 to s7 was found in range of 99.35101.79 % ( table 4 ) . optical clarity measured by directly taking the absorbance of the diluted smedds is a measure of droplet stability . the result indicates that formulation s2 , and s3 were well stable till 24 hrs as their absorbance values did not change at the end of 24 hrs . moderate changes in absorbance values were observed for formulation s1 at the end of 24 hrs . for formulation s4 , a drastic change in absorbance values was observed indicating instability of droplets with time ( table 5 ) . in vitro diffusion of plain drug suspension and optimized smeddsthe plain drug suspension was prepared by dispersing 20 mg of the drug in 5 ml of the distilled water . in vitro drug diffusion profilesthe amount of drug diffuse from smedds was doubled than that of the plain olm suspension . after 8 hours , 86.4 % the drug was diffused from the smedds , as compared with 46.39 % diffused from the olm suspension , indicating almost a twofold increase in the diffusion . the increased solubility and the dissolution rate are the main factors responsible for increased diffusion rates . after 6 h of diffusion , 78.7 % of the drug was diffused from the smedds , while from plain drug suspension the diffusion was found to be 41.3 % . thus , the amount of the drug diffused through the biological membrane has doubled when it is given in the form of a smedds . the enhancement in diffusion is due to formation of microemulsion droplets in nanometer range and improved permeation of the olm because of the presence of surfactant , which reduces the interfacial tension of formulation . it was concluded that smedds formulations containing olmesartan medoxomil significantly increase in the dissolution rate and in vitro diffusion rate compared to plain olm suspension . the ex vivo intestinal permeability results showed that the drug diffusion across the intestinal membrane from the smedds is significantly higher than the plain drug suspension . these observations lead us to the conclusion that smedds seems to be a promising drug delivery system , which can provide an effective and practical solution to the problem of formulating drugs with low aqueous solubility and poor systemic bioavailability .\noutput:\n" }, { "from": "agent", "value": "olmesartan medoxomil ( olm ) is an angiotensin ii receptor blocker ( arb ) antihypertensive agent administered orally that has absolute bioavailability of only 26 % due to the poor aqueous solubility ( 7.75 g / ml ) . the aim of the present investigation was to develop a self - microemulsifying drug delivery system ( smedds ) to enhance the oral absorption of olm . the solubility of olm in various oils , surfactants , and cosurfactants was determined . pseudoternary phase diagrams were constructed using acrysol el 135 , tween 80 , transcutol p , and distilled water to identify the efficient self - microemulsification region . prepared smedds was further evaluated for its emulsification time , drug content , optical clarity , droplet size , zeta potential , in vitro dissolution , and in vitro and ex vivo drug diffusion study . the optimized formulation s2 contained olm ( 20 mg ) , tween 80 ( 33 % v / v ) , transcutol p ( 33 % v / v ) , and acrysol el 135 ( 34 % v / v ) had shown the smallest particle size , maximum solubility , less emulsification time , good optical clarity , and in vitro release . the in vitro and ex vivo diffusion rate of the drug from the smedds was significantly higher than that of the plain drug suspension . it was concluded that smedds would be a promising drug delivery system for poorly water - soluble drugs by the oral route ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: statins , which are 3 - hydroxy -3-methylglutaryl coenzyme a reductase inhibitors , are currently the most popular drugs for the management of dyslipidemia for the primary and secondary prevention of cardiovascular disease .1 their widespread use is driven by a robust body of evidence that supports their efficacy in preventing cardiovascular events .2 their benefits are derived both from reducing atherogenic lipoprotein levels ( ldl - c ) and from increasing antiatherogenic lipoproteins levels ( hdl - c ) .3 in addition to modulating lipid levels , recent clinical and experimental studies have shown that statins have pleiotropic effects , including antiinflammatory , antiproliferative , and antithrombotic effects ; attenuation of nadph oxidase mediated superoxide generation ; and improvement of endothelial vasomotor function . all of these effects may influence cardiovascular outcomes , including hypertension , in high - risk patients .4 statins reduce vascular inflammation , suppress extracellular matrix production , exhibit inhibitory effects on the rho / rho kinase pathway ,5,6 and block small g protein isoprenylation , which is a pivotal step in the activation of rho . renal disease secondary to hypertension progressively develops , culminating in chronic renal failure with a loss of glomeruli and several morphological and quantitative alterations .7,8 the renal lesions caused by nitric oxide ( no ) blockade are glomerulosclerosis , interstitial fibrosis , and microvascular lesions .9,10 the current chronic nephropathy treatments are limited to angiotensin - converting enzyme inhibitors and angiotensin receptor blockers .11 however , similar to observations in the cardiovascular system , increasing clinical12 and experimental13 - 17 evidence indicates that statins have beneficial effects in the course of progressive renal disease . in addition , statins influence intrarenal hemodynamics by reducing angiotensin and aldosterone levels .18 recent studies have shown that chronic administration of l - arginine analogues such as l - nitro - arginine methyl ester ( l - name ) to rats induces dose - dependent systemic arterial hypertension by blocking endothelial nitric oxide synthase ( enos ) and , therefore , no biosynthesis .19,20 the rat hypertension model induced by chronic inhibition of no generation has been shown to be a useful tool for studying both the development and treatment of renal lesions resembling those found in human hypertension , a disease associated with early generalized impairment of endothelial function .21 this hypertension and renal disease model seems to be a suitable model to examine the lipid lowering independent effects of statins because the administration of statins , even at high doses , does not alter serum cholesterol levels in normal rats .22 - 23 the aim of this study was to assess the effects of rosuvastatin on renal injury and inflammation in a model of nitric oxide deficiency . all animals ( n = 40 ; 6 - week - old male wistar rats ) were maintained in standard cages at room temperature ( 223c ) and 6070 % humidity with a 12 h dark / 12 h light cycle and ad libitum food ( nuvilab , paran , brazil ) and water . twelve hours before each experiment , the animals received only water to avoid interference with absorption of the treatments . systolic blood pressure was measured weekly in conscious rats using noninvasive tail - cuff plethysmography ( letica 5001 , panlab , spain ) at baseline and at the end of each week of treatment . this study was conducted in accordance with guidelines set forth by the brazilian association for laboratory animal science ( cobea ) and has been approved by the research commission for ethics and animal experimentation of ufjf . the rats were randomly divided into four groups ( n = 10 / group ) and treated as follows : a control group ( ctrl ) ; 30 mg / kg / day l - name hydrochloride ( sigma , st . louis , usa ) diluted in the drinking water ( l - name ) ; l - name +20 mg / kg / day rosuvastatin ( crestor , astrazeneca , brazil ) delivered by gavage ( l - name + ros - 20 ) ; and l - name +2 mg / kg / day rosuvastatin ( l - name + ros - 2 ) delivered by gavage . the l - name in the drinking water was at a concentration of 500 mg / l , and each non - control rat received 30 mg / kg / day of l - name for 28 days . blood samples were drawn by cardiac puncture from the right ventricle to measure the serum levels of total cholesterol ( tc ) , triglycerides ( tg ) , aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , alkaline phosphatase ( alp ) , and creatinine ( cr ) ( cobas mira , roche ) . the serum level of no was assessed using the griess method .24 the levels of interleukin - 6 ( il - 6 ) and tumor necrosis factor - alpha ( tnf - ) were measured using enzyme - linked immunosorbent assay ( elisa ) ( opt , bd , usa ) according to the manufacturer 's instructions . urine was obtained by bladder puncture to establish the urine albumin : creatinine ratio ( biotecnica kit , cobas mira , roche ) . analyses were performed in duplicate , and samples were stored at -80 c until analysis . after euthanasia , a fixative solution ( 1.27 mol / l of freshly prepared formaldehyde in 0.1 m phosphate buffer ; ph 7.4 ) was perfused through the vascular system using a catheter placed into the left ventricle until the body was rigid . the kidneys were removed , cut into two halves , placed in 10 % formaldehyde for 48 h at room temperature , dehydrated , and embedded in paraffin for histological analysis . sections ( 3 m thick ) were cut and stained with hematoxylin / eosin for morphological analysis or masson 's trichrome to highlight collagen fibers . images were captured ( color coolsnap - pro , media cybernetics ) and analyzed using image pro - plus software ( version 6.0 , media cybernetics , silver spring , usa ) . the sections were evaluated by a pathologist without prior knowledge of the groups to which the animals belonged . tubules ( to study tubular dilation ) , blood vessels ( to identify intimal fibrosis , microthrombosis and fibrinoid necrosis ) , glomeruli ( to identify glomerulosclerosis and glomerular atrophy ) , and the interstitial compartment ( to detect changes in collagen and inflammatory cells ( 400 ) ) were analyzed morphologically to identify the range of changes . the glomerular surface area ( m ) was morphometrically analyzed in at least 50 glomeruli per animal .25 immunohistochemical analysis of renal tissues to detect the number of macrophages in 100 random glomeruli per animal was performed on paraffin - embedded sections as described by hartner et al. 26 using antibodies against macrophages / monocytes ( mouse anti - rat cd68 ; serotec ) . the percentage of glomeruli with macrophages was determined by counting 100 random clusters from nearly 20 microscopic fields , in accordance with pomaro et al. ,27 and was determined by a pathologist without prior knowledge of the groups to which the animals belonged . the data were all normally distributed in each group ( kolmogorov - smirnov test , p 0.05 ) . statistical analysis between groups was performed using an analysis of variance ( one - way anova ) followed by tukey 's test when the data were homoscedastic . if the data were heteroscedastic , the nonparametric kruskal - wallis test followed by the tamhane test was performed . a p - valueanalyses were conducted and graphs were created using graphpad prism version 5.01 for windows ( graphpad software , san diego , ca , usa ) and statistical package for social sciences version 13.0 ( spss , chicago , il , usa ) . all animals ( n = 40 ; 6 - week - old male wistar rats ) were maintained in standard cages at room temperature ( 223c ) and 6070 % humidity with a 12 h dark / 12 h light cycle and ad libitum food ( nuvilab , paran , brazil ) and water . twelve hours before each experiment , the animals received only water to avoid interference with absorption of the treatments . systolic blood pressure was measured weekly in conscious rats using noninvasive tail - cuff plethysmography ( letica 5001 , panlab , spain ) at baseline and at the end of each week of treatment . this study was conducted in accordance with guidelines set forth by the brazilian association for laboratory animal science ( cobea ) and has been approved by the research commission for ethics and animal experimentation of ufjf . the rats were randomly divided into four groups ( n = 10 / group ) and treated as follows : a control group ( ctrl ) ; 30 mg / kg / day l - name hydrochloride ( sigma , st . louis , usa ) diluted in the drinking water ( l - name ) ; l - name +20 mg / kg / day rosuvastatin ( crestor , astrazeneca , brazil ) delivered by gavage ( l - name + ros - 20 ) ; and l - name +2 mg / kg / day rosuvastatin ( l - name + ros - 2 ) delivered by gavage . the l - name in the drinking water was at a concentration of 500 mg / l , and each non - control rat received 30 mg / kg / day of l - name for 28 days . blood samples were drawn by cardiac puncture from the right ventricle to measure the serum levels of total cholesterol ( tc ) , triglycerides ( tg ) , aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , alkaline phosphatase ( alp ) , and creatinine ( cr ) ( cobas mira , roche ) . the serum level of no was assessed using the griess method .24 the levels of interleukin - 6 ( il - 6 ) and tumor necrosis factor - alpha ( tnf - ) were measured using enzyme - linked immunosorbent assay ( elisa ) ( opt , bd , usa ) according to the manufacturer 's instructions . urine was obtained by bladder puncture to establish the urine albumin : creatinine ratio ( biotecnica kit , cobas mira , roche ) . after euthanasia , a fixative solution ( 1.27 mol / l of freshly prepared formaldehyde in 0.1 m phosphate buffer ; ph 7.4 ) was perfused through the vascular system using a catheter placed into the left ventricle until the body was rigid . the kidneys were removed , cut into two halves , placed in 10 % formaldehyde for 48 h at room temperature , dehydrated , and embedded in paraffin for histological analysis . sections ( 3 m thick ) were cut and stained with hematoxylin / eosin for morphological analysis or masson 's trichrome to highlight collagen fibers . images were captured ( color coolsnap - pro , media cybernetics ) and analyzed using image pro - plus software ( version 6.0 , media cybernetics , silver spring , usa ) . the sections were evaluated by a pathologist without prior knowledge of the groups to which the animals belonged . tubules ( to study tubular dilation ) , blood vessels ( to identify intimal fibrosis , microthrombosis and fibrinoid necrosis ) , glomeruli ( to identify glomerulosclerosis and glomerular atrophy ) , and the interstitial compartment ( to detect changes in collagen and inflammatory cells ( 400 ) ) were analyzed morphologically to identify the range of changes . the glomerular surface area ( m ) was morphometrically analyzed in at least 50 glomeruli per animal .25 immunohistochemical analysis of renal tissues to detect the number of macrophages in 100 random glomeruli per animal was performed on paraffin - embedded sections as described by hartner et al. 26 using antibodies against macrophages / monocytes ( mouse anti - rat cd68 ; serotec ) . the percentage of glomeruli with macrophages was determined by counting 100 random clusters from nearly 20 microscopic fields , in accordance with pomaro et al. ,27 and was determined by a pathologist without prior knowledge of the groups to which the animals belonged . the data were all normally distributed in each group ( kolmogorov - smirnov test , p 0.05 ) . statistical analysis between groupswas performed using an analysis of variance ( one - way anova ) followed by tukey 's test when the data were homoscedastic . if the data were heteroscedastic , the nonparametric kruskal - wallis test followed by the tamhane test was performed . analyses were conducted and graphs were created using graphpad prism version 5.01 for windows ( graphpad software , san diego , ca , usa ) and statistical package for social sciences version 13.0 ( spss , chicago , il , usa ) . the initial systolic blood pressure ( sbp ) was similar among the groups . at the end of the first week of treatment with l - name , all l - name - treated groups had an elevated sbp compared with the control group ( p 0.0001 for all of the groups ) . this hypertension was observed for all l - name - treated groups throughout the experiment ( figure 1 ; p 0.0001 for all groups ) . the experimental groups had similar tc , tg , ast , alt , alp , and cr levels ( table 1 ) . compared with the control , the l - name group had increased serum levels of il - 6 ( p 0.001 ) and tnf - ( p 0.01 ) . however , when compared with the l - name group , treatment with 2 or 20 mg / kg / day rosuvastatin inhibited the l - name - induced increase in the serum il - 6 ( p 0.001 for both groups ) and tnf - levels ( l - name + ros - 20 , p = 0.030 ; l - name + ros - 2 , p = 0.028 ) . the l - name group showed a significant reduction in the no level compared with the control group ( p = 0.01 ) . only the l - name + ros - 2 group showed significantly higher levels of no compared with the l - name group ( p = 0.047 ; table 2 ) . the l - name group showed an increase in the urinary albumincreatinine ratio compared with the ctrl group ( p = 0.023 ) . rosuvastatin at both tested doses ( 2 and 20 mg / kg / day ) lowered the urinary albumincreatinine ratio compared with the l - name group ( p = 0.008 and p = 0.047 , respectively ) ( figure 2 ) . histological evaluation following staining with hematoxylin / eosin ( figure 3 a , d , g , f ) or masson 's trichrome ( figure 3 b , e , h , k ) revealed no detectable renal pathology in any of the groups in all of the renal compartments . the cross - sectional glomerular areas were similar among all of the experimental groups ( table 3 ) . the l - name group demonstrated an increased number of macrophages in the renal glomeruli compared with the ctrl group ( p 0.0001 ) . the l - name + ros - 20 and l - name + ros - 2 groups demonstrated decreased infiltration of macrophages into the glomeruli compared with the l - name group ( p 0.0001 ) ( figure 3 c , f , i , l and table 3 ) . the initial systolic blood pressure ( sbp ) was similar among the groups . at the end of the first week of treatment with l - name , all l - name - treated groups had an elevated sbp compared with the control group ( p 0.0001 for all of the groups ) . this hypertension was observed for all l - name - treated groups throughout the experiment ( figure 1 ; p 0.0001 for all groups ) . the experimental groups had similar tc , tg , ast , alt , alp , and cr levels ( table 1 ) . compared with the control , the l - name group had increased serum levels of il - 6 ( p 0.001 ) and tnf - ( p 0.01 ) . however , when compared with the l - name group , treatment with 2 or 20 mg / kg / day rosuvastatin inhibited the l - name - induced increase in the serum il - 6 ( p 0.001 for both groups ) and tnf - levels ( l - name + ros - 20 , p = 0.030 ; l - name + ros - 2 , p = 0.028 ) . the l - name group showed a significant reduction in the no level compared with the control group ( p = 0.01 ) . only the l - name + ros - 2 group showed significantly higher levels of no compared with the l - name group ( p = 0.047 ; table 2 ) . the l - name group showed an increase in the urinary albumincreatinine ratio compared with the ctrl group ( p = 0.023 ) . rosuvastatin at both tested doses ( 2 and 20 mg / kg / day ) lowered the urinary albumincreatinine ratio compared with the l - name group ( p = 0.008 and p = 0.047 , respectively ) ( figure 2 ) . histological evaluation following staining with hematoxylin / eosin ( figure 3 a , d , g , f ) or masson 's trichrome ( figure 3 b , e , h , k ) revealed no detectable renal pathology in any of the groups in all of the renal compartments . the cross - sectional glomerular areas were similar among all of the experimental groups ( table 3 ) . the l - name group demonstrated an increased number of macrophages in the renal glomeruli compared with the ctrl group ( p 0.0001 ) . the l - name + ros - 20 and l - name + ros - 2 groups demonstrated decreased infiltration of macrophages into the glomeruli compared with the l - name group ( p 0.0001 ) ( figure 3 c , f , i , l and table 3 ) . chronic nitric oxide synthesis inhibition induced by the treatment of rats with l - name results in endothelial dysfunction , vascular hypertrophy , cardiac fibrosis , atherosclerosis , perivascular inflammation , renal failure , and increased vascular responses to adrenergic stimuli . several other factors , including renin - angiotensin system , endothelial constrictor factors , arterial remodeling and the sympathetic nervous system are involved in these effects .19,28 additionally , this experimental model is characterized by easy handling and low animal mortality . the dose of 30 mg / kg / day of l - name was sufficient to induce arterial hypertension ,29 and the dose of 20 mg / kg / day of rosuvastatin used in our study is known to have beneficial effects on endothelial dysfunction and systemic and regional hemodynamics .23 at 2 mg / kg / day , rosuvastatin has been shown to significantly increase enos mrna and protein expression and decrease inos mrna and protein expression and nitrite production after ischemia reperfusion .30 the l - name group developed hypertension after the end of the first induction week . at the end of the experiment , there was a decrease in the serum no level and an increase in inflammatory parameters ( the serum il - 6 and tnf - levels ) , macrophage infiltration into the glomeruli and proteinuria . the effects of statins on blood pressure can be dose dependent in some animal models , such as spontaneously hypertensive31 and angiotensin iidependent rats .32 our results did not demonstrate a dose - dependent reduction in blood pressure following treatment with rosuvastatin ( 2 or 20 mg / kg / day ) . a similar findingwas reported by susic et al. 23 in rats , serum lipid levels are usually low , and statins do not change this profile . therefore , rats are an excellent model to study the pleiotropic effects of statins .23 in our study , treatment with rosuvastatin did not alter the serum tg , tc , alt , ast , alp , or cr levels , which indicates that rosuvastatin exerted lipid lowering independent effects . furthermore , in our study , the serum alt , ast , and alp levels indicated no liver toxicity . biochemical markers , particularly markers of vascular inflammation , such as high - sensitivity c - reactive protein ( hs - crp ) , have been suggested to be predictive of cardiovascular events .33 the primary proinflammatory cytokines tnf - and il - 6 are the main inducers of hs - crp . furthermore , according to navarro and mora - fernandez ,34 tnf - and il - 6 have been associated with significant direct renal effects . in this study , treatment with rosuvastatin ( 2 or 20 mg / kg / day ) reduced the serum il - 6 and tnf - levels . experimental and clinical studies have demonstrated the pathogenic role of tnf - in the development of renal injury and the potential benefit of modulating tnf - activity as a therapeutic target in diverse renal diseases .35 il - 6 has been correlated with an increased width of the glomerular basement membrane .35 it also enhances fibronectin expression , affects extracellular matrix dynamics at both the mesangial and podocyte levels , stimulates mesangial cell proliferation , and increases endothelial permeability .36,37 il - 6 plays an important role in vascular remodeling and has been reported to be a useful biomarker in predicting future cardiovascular events .38 tnf - is cytotoxic to glomerular , mesangial and epithelial cells , and it is able to induce direct renal damage .39 furthermore , tnf - stimulates endothelial generation of reactive oxygen species by activating the nadph oxidase subunits gp91 phox , nox - 1 , p47phox , and p22phox . tnf - also activates the transcription of nf - b , which regulates the expression of genes involved in inflammation , oxidative stress and endothelial dysfunction .11,38 animals treated simultaneously with l - name and rosuvastatin ( 2 mg / kg / day ; l - name + ros - 2 ) had an increased serum no level and reduced l - name - induced inflammatory parameters . however , treatment with 20 mg / kg / day rosuvastatin ( l - name + ros - 20 ) did not alter the serum no levels compared with the l - name group . this finding could be because a lower dose ( 2 mg / kg / day ) of rosuvastatin may increase the constitutive endothelial bioavailability of no , which may not occur at higher doses ( 20 mg / kg / day ) . di napoli et al. 30 evaluated the effects of rosuvastatin on reperfusion injury in rat hearts using 0.2 , 2 , and 20 mg / kg / day rosuvastatin . they found that 2 mg / kg / day rosuvastatin significantly increased the mrna expression of constitutive endothelial nos ( enos ) compared with the untreated group and reduced the mrna expression of inducible nos ( inos ) . mg / kg / day rosuvastatin than at 0.2 mg / kg / day rosuvastatin . however , at the highest dosage ( 20 mg / kg / day ) there was a beneficial effects loss in the expression of enos and inos associated with increased mitochondrial damage and microcirculatory dysfunction . the current treatment of chronic nephropathy is limited to angiotensin - converting enzyme inhibitors and angiotensin at1 receptor blockers ; however , evidence indicates that statins can be effective .11 glomerulosclerosis , glomerular ischemia , and interstitial fibrosis were observed in the kidneys of nitric oxidedeficient rats fed a high - salt diet .40 changes in glomerular and vascular densities were also observed in this model using stereological analysis .41 the bps achieved in the animals used in these previous studies were 212 and 200225 mmhg , respectively . however , lecian et al. 42 found no histological abnormalities in the kidneys of rats treated with a nitric oxide synthesis inhibitor , and these animals had a bp of 175 mmhg . in our study , the bp of the hypertensive group only reached 140 mmhg , which may explain the absence of histological abnormalities . statins inhibit several intracellular signaling pathways ( rho / rhoa and mapk pathways ) activated by angiotensin ii that are involved in the regulation of profibrotic factors , connective tissue growth factor and the deposition of extracellular matrix components , which are all modulated by redox processes .43 our data demonstrate that there was a significant increase in the accumulation of macrophages in the glomeruli and proteinuria in l - name - treated rats . rosuvastatin was effective in reducing glomerular macrophage infiltration , which is indicative of an improved inflammatory pattern ; however , this effect was most evident at a dose of 2 mg / kg / day . additionally , rosuvastatin inhibited proteinuria at both of the tested doses ( 2 or 20 mg / kg / day ) . in conclusion , rosuvastatin reduces the serum levels of il - 6 and tnf - , reduces glomerular macrophage infiltration and prevents proteinuria in this experimental model . our data suggest that rosuvastatin may act beneficially in preventing proteinuria and glomerular inflammation in a model of nitric oxide deficiency .\noutput:\n" }, { "from": "agent", "value": "objective : the aim of the present study was to assess the effects of rosuvastatin on renal injury and inflammation in a model of nitric oxide deficiency.methods : male wistar rats were randomly divided into four groups ( n = 10 / group ) and treated for 28 days with saline ( ctrl ) ; 30 mg / kg / day l - name ( l - name ) ; l - name and 20 mg / kg / day rosuvastatin ( l - name + ros - 20 ) ; or l - name and 2 mg / kg / day rosuvastatin ( l - name + ros - 2 ) . systolic blood pressure was measured by plethysmography in the central artery of the tail . the serum total cholesterol , triglycerides , alanine aminotransferase , aspartate aminotransferase , alkaline phosphatase , creatinine , nitric oxide , interleukin - 6 , and tumor necrosis factor alpha levels were analyzed . urine samples were taken to measure the albuminurinary creatinine ratio . kidneys were sectioned and stained with hematoxylin / eosin and masson 's trichrome . immunohistochemical analysis of the renal tissue was performed to detect macrophage infiltration of the glomeruli.results : the systolic blood pressure was elevated in the l - name but not the l - name + rosuvastatin - 20 and l - name + rosuvastatin - 2 groups . the l - name group had a significantly reduced nitric oxide level and an increased interleukin - 6 and tumor necrosis factor alpha level , albuminurinary creatinine ratio and number of macrophages in the renal glomeruli . rosuvastatin increased the nitric oxide level in the l - name + rosuvastatin - 2 group and reduced the interleukin - 6 and tumor necrosis factor alpha levels , glomerular macrophage number and albuminurinary creatinine ratio in the l - name + rosuvastatin - 20 and l - name + rosuvastatin - 2 groups.conclusion : rosuvastatin treatment reduced glomerular damage due to improvement in the inflammatory pattern independent of the systolic blood pressure and serum lipid level . these effects may lead to improvements in the treatment of kidney disease ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the cardiovascular disease mortality rate , especially ischemic heart disease ( ihd ) , has continuously increased over the 30 - year period ( 19832012 ) ( lee et al . , 2015 ) . ihd mortality rises sharply with age and remains the leading cause of death ( finegold et al . , 2013 ) andcoronary artery bypass graft ( cabg ) is one of the therapies generally performed for coronary revascularization in ihd patients ( keenan et al . , 2005 ) . however , a variety of complications including pulmonary complications ( pneumonia , pleural effusion , atelectasis ) and arrhythmia ( atrial fibrillation , atrial flutter ) can occur after cabg ( european heart rhythm association et al . , 2010 ; pasquina et al . , in addition , even after revascularization through operation , the restenosis rate reportedly ranges from 5.9 % 11.5 % ( sumide et al . , 2009 ) . after cardiac surgery , icr contributes significantly to the prevention of lung complication and decondition caused by prolonged bed rest , thus to early recovery ( stiller et al . , 1994 ) . cardiac rehabilitation is a multidisciplinary program that includes medical treatment , nutritional counseling , smoking cessation , risk factor intervention , stress management , and exercise therapy ( mampuya , 2012 ) , among which exercise therapy is the essential component . icr is mainly composed of breathing exercises , early mobilization , and strength exercises ( shaw et al . , 1989 ; westerdahl et al . , exercise therapy improves exercise capacity by about 16 % ( maines et al . , 1997 ) . when the exercise capacity improves by one metabolic equivalent , all - cause mortality decreases 12 % ( myers et al . , 2002 ) . in addition , regular exercise decreases all - cause mortality by 28 % , which is closely associated with improvements in quality of life ( clark et al . , 2005 ) . most previous studies ( anderson et al . , 2016 ; choo et al . , 2007 ; kim et al . , 2011 ; lee et al . ,2016 ) on cardiac rehabilitation , especially exercise therapy , were conducted a focus on applying exercise programs to specific parameters . there has been no national study survey showing the actual practice after cardiac surgery performed in general hospitals . ; westerdahl and mller , 2010 ; westerdahl and olsn , 2011 ) published surveys of the current practice of icr in each nation presenting baseline data with which icr systems between countries can be compared . according to domestic research ( song , 2009 ) that evaluated outpatient cardiac rehabilitation programs , , there is no current baseline data for comparative analysis on the icr systems of domestic hospitals . therefore , this study attempted to understand the status of the inpatient postoperative care systems of south korea s general hospitals practicing cardiac surgery ( i.e. , those awarded first class status in the adequacy assessment by health insurance review & assessment service ) . this study will provide baseline data for upgrading exercise - based icr programs . ten first class cabg hospitals noted by south korea s health insurance review & assessment service in 2011 ( samsung medical center , asan medical center , seoul national university hospital , seoul national university bundang hospital , gangnam severance hospital , severance hospital , ajou university medical center , konkuk university medical center , catholic university hospital , sejong hospital ) were selected for survey . the survey was conducted by emailing a questionnaire to the thoracic and cardiovascular surgery departments of each hospital . cardiac surgery was defined as cabg or valve surgery in which median sternotomy was performed . nurses and physiotherapist caring for patients after cardiac surgery returned the questionnaire written for this study . the questionnaire was developed to question the typical process of a postoperative ward ( appendix 1 ) . the survey information was developed by modifying the survey of previous studies ( firouzabadi et al .2010 ) to focus on the purpose of this study . to verify validity of the completed questionnaire , one professor at s university hospital , one advanced practice nurse of thoracic surgery and five ward nurses of thoracic surgery independently evaluated questionnaire items to verify questionnaire content validity . at this time , unrealistic and unclear items were deleted and more appropriate questions were added to modify the questionnaire . the completed questionnaire was sent to the 10 hospitals via e - mail and the returned questionnaires from nine hospitals were used for study analysis . this study received ethical approval from the internal review board of samsung medical center prior to this research ( approval number : 2013 - 02 - 124 ) . data were analyzed using descriptive statistics and expressed using means , medians , and ranges .20.0 ( ibm co. , armonk , ny , usa ) was used for analysis of the study data . the study was conducted with nine hospitals responding to a questionnaire survey e - mailed to 10 hospitals identified as first class cabg hospitals by health insurance review & assessment service in 2011 . the respondents were nurses in departments of thoracic surgery with at least 6 years of experience in 8 out of 9 cases . on average , 18.2 cases of cardiac surgery were performed per week and the postoperative hospital stay was 8.8 days ( table 1 ) . evaluation of cardiopulmonary function was practiced in five hospitals preoperatively ( 56 % ) and education on deep breathing and coughing was provided in eight hospitals preoperatively ( 89 % ) . evaluation of sustained maximal inspiration was practiced in seven hospitals ( 78 % ) and education on incentive spirometry in eight hospitals ( 89 % ) preoperatively . however , the seven hospitals ( 33 % ) did not practice postoperative manual therapy ( table 2 ) . while eight hospitals practiced education on sternal precautions before exercise , one hospital did not . postoperative bed rest was practiced most on postoperative day ( pod ) 1 ( 33 % ) and on pod 3 in one hospital ( 11 % ) . patient s sitting on the edge of bed was practiced on pod 1 ( 89 % ) in eight hospitals while sit to stand by bed was practiced on pod 1 ( 78 % ) in seven hospitals and on pod 2 ( 22 % ) in two hospitals . sit to stand by chair was practiced on pod 1 ( 68 % ) in six hospitals . walking in the wardwas practiced most on pod 1 ( 68 % ) and walking in the corridor was most frequently practiced on pods 1 and 3 with 33.3 % , respectively . stairs up and down , the final ward exercise therapy , was practiced in only two hospitals ( 22 % ) ( table 3 ) . ward and discharge education were practiced in eight hospitals ( 89 % ) and six hospitals ( 67 % ) , respectively . education methods mainly included face - to - face ( 67 % ) and brochure education ( 22 % ) . ward education content included hospitalization guides , disease education , educations after general admission , intensive care unit / subintensive care unit education , breathing exercises , and walking exercises , occupying 67 % . a high proportion of the discharge education content was occupied by management of surgery sites ( 67 % ) , taking medication ( 56 % ) , and sternal precautions ( 56 % ) ; there was less education on exercise therapy such as walking exercise programs ( 22 % ) , stretching and strengthening exercises ( 44 % ) , and introduction to cardiac rehabilitation and community associations ( 22 % ) ( fig . this study is the first survey study to describe icr practiced by south korea s tertiary care hospitals . a questionnaire with 29 items was e - mailed to 10 hospitals designated as first class cabg hospitals by health insurance review & assessment service and replies were received from nine hospitals . physical activity is generally recommended for lung complication prevention and quality of life improvement after cardiac surgery ( firouzabadi et al . , 2014 ) . in the hospitals surveyed in this study , education on postoperative deep breathing and cough techniques , sustain maximal inspiration , and incentive spirometer ( is ) was initially practiced . according to a previous study by overend et al . ( 2010 ) , education on deep breathing and cough techniques was practiced on pods 1 ( 89 % ) and 2 ( 78 % ) , respectively , while is education was on pods 1 ( 44 % ) or 2 ( 39 % ) . in this study , all participating hospitals ( 100 % ) practiced education on deep breathing and cough techniques preoperatively and five hospitals practiced another time on pod 1 . this is similar to the report of westerdahl and olsn ( 2011 ) in which education on preoperative breathing exercises and cough techniques was completed 88 % of the time . from these results , ward nurses are recognizing breathing exercises and cough techniques as very important factors in postoperative patients functional recovery and the importance of preoperative and pod 1 is especially emphasized . restarting physical activity in the early period after cardiac surgery , especially walking exercise , is recommended since it can prevent complications from long - term bed rest . while physical activity from postoperative bed rest to walking in the corridor was practiced in all hospitals , stairs up and down was practiced only in four hospitals . exercise education was conducted in seven hospitals mostly by face - to - face education with a nurse from the intensive care unit . in two hospitals , exercise education was practiced by an exercise physiologist along with a nurse . in most of the previous studies ( filbay et al . , 2012 ; overend et al . , 2010 ; westerdahl and mller , 2010 ; westerdahl and olsn , 2011 ) , sitting on the edge of the bed and sit to stand were reportedly practiced on pod 1 . in this study , sitting on the edge of the bed was practiced on pod 1 in eight hospitals ( 89 % ) , while walking in the ward and walking in the corridor were practiced on pods 2 and 3 , respectively . however , the stairs up and down exercise was only practiced in two out of nine hospitals . although education encouraged progress as far as walking in the corridor , exercise at the next level of strength was not practiced afterwards . this can be the result of the differences in the icr systems where exercise therapy for cardiac rehabilitation is practiced by physiotherapists in foreign countries . in foreign countries ( table 4 ) , physiotherapists in intensive care units implement all education on rehabilitation after cardiac surgery whereas in korea , ward nurses initially complete it . in korea , during the postoperative admission period , participation in exercise education of exercise specialists and physiotherapists is poor for cardiac rehabilitation . participation of exercise specialist cooperating with ward nurses in the icr may help to facilitate the process of progressive ambulation and thus less deconditioning and faster recovery . ward education was mainly composed of the hospitalization guide and breathing exercises ; walking exercises were the only education that emphasized the importance of postoperative exercise . a high proportion of before - discharge education content addressed management of surgery sites , taking medications , and sternal precautions . according to overend et al . ( 2010 ) , 11 out of the 18 hospitals ( 61 % ) reportedly offered walking programs , upper and lower extremity exercises and stretching , introduction to cardiac rehabilitation , sternal precautions , and physical activity guidelines as before - discharge education . in this study , with walking exercise programs ( 22 % ) , stretching and strength exercises ( 44 % ) , and introduction to cardiac rehabilitation ( 22 % ) as before - discharge education , the ratio of exercise therapy education was less than that in foreign cases . exercise therapy after cardiac surgery plays an important role in improving patients exercise capacity and quality of life ( firouzabadi et al . , 2014 ; maines et al . , 1997 , there was an education content deficit on the importance of exercise in before - discharge education . the contents of the education should be revised to fill this gap and again participation of exercise specialists in the process may be helpful . first , the surveyed hospitals were limited to 10 first class hospitals designated by health insurance review & assessment service . even if not first class , there could be hospitals with well - built postoperative cardiac rehabilitation systems . second , the questionnaire was composed by modifying a previous study s survey ; only the survey items related to the study purpose and specific topics were used . for example , while sternal precaution was described in detail and augmented in foreign survey studies , only its practice was surveyed in this study . one physiotherapist answered our questionnaire because one hospital conducted an exercise education by physiotherapist before discharge . further study needs to survey conducted to various caring staff who works in the ward for patient with recovering from cardiac surgery in same hospital . fourth , surveys on indicators from the patients position , such as patient satisfaction or quality of life , were not performed . in conclusion , this study is the first survey report on icr practiced domestically after cardiac surgery . the main difference in program compared to the foreign hospitals in the exercise therapy , both in the degree of progression and educational contents . overall lack of participation of exercise specialists or physiotherapists seems to be an important difference .\noutput:\n" }, { "from": "agent", "value": "inpatient cardiac rehabilitation ( icr ) has been commonly conducted after cardiac surgery in many countries , and has been reported a lots of results . however , until now , there is inadequacy of data on the status of icr in korea . this study described the current status of exercise therapy in icr that is performed after cardiac surgery in korean hospitals . questionnaires modified by previous studies were sent to the departments of thoracic surgery of 10 hospitals in korea . nine replies ( response rate 90 % ) were received . eight nurses and one physiotherapist completed the questionnaire . most of the education on wards after cardiac surgery was conducted by nurses . on postoperative day 1 , four sites performed sitting on the edge of bed , sit to stand , up to chair , and walking in the ward . only one site performed that exercise on postoperative day 2 . one activity ( stairs up and down ) was performed on different days at only two sites . patients received education preoperatively and predischarge for preventing complications and reducing muscle weakness through physical inactivity . the results of the study demonstrate that there are small variations in the general care provided by nurses after cardiac surgery . based on the results of this research , we recommended that exercise therapy programs have to conduct by exercise specialists like exercise physiologists or physiotherapists for patients in hospitalization period ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: after the sars outbreak , the taiwan cdc introduced fever screening and national laboratory monitoring of symptomatic passengers at international airports . before entering the country , passengers are provided with a video asking them to self - report illness before their aircraft lands . if a passenger appears ill onboard , the crew is required to report the event immediately to port authorities , including the border quarantine officer . further assessment may trigger onboard quarantine , aircraft site quarantine , or other measures . upon arrival , if needed , an ear thermometer is used to recheck travelers ' temperatures , and a quick in - person assessment is provided . officials may also investigate travel and health history , symptoms , exposure , and other relevant factors . if the traveler fits the definition of a suspected case of imported dengue or zika , a blood sample will be collected . blood samples undergo the dengue ns1 antigen rapid test at international airports , and remaining blood and urine samples are sent to the taiwan cdc 's laboratory for further active monitoring for flaviviruses . a core value of taiwan 's traveler screening measures is to maximize efficiency and minimize travelers ' inconvenience . the average assessment time is 30 to 40 minutes , which includes an in - depth interview and specimen collection before entering the country . these travelers are also provided with instructions to use insect repellent and other precautions ( eg , safe sex guidance ) . furthermore , they are encouraged to seek medical care within 24 hours , and a local public officer will follow up on their health by phone . all symptomatic passengers ' information is registered either by an ill - passenger health monitoring system or by the national notifiable disease surveillance system ( nndss ) if they meet the conditions for a notifiable condition . relevant control measures in the community will be implemented immediately to prevent further transmission ( figure 1 ) . entry screening for identifying symptomatic passengers from january to october 2016 , taiwan quickly screened a total of 21,083,404 inbound passengers . of these passengers , 21,721 were identified as potentially ill through fever screening or passengers ' self - reporting . upon evaluation , a total of 5 laboratory - confirmed cases of zika ( 4 symptomatic foreign laborers , 1 self - reporting citizen ) , 130 cases of dengue , and 4 cases of chikungunya were found . as table 1 shows , the entry screening program from 2013 to 2016 contributed to the detection of total imported cases of dengue fever with rates of 41 % to 48 % . all cases of chikungunya in taiwan have been imported from overseas , and the majority of cases were detected from points of entry . the imported history can be traced back to 2006 ; the first chikungunya case was identified at taoyuan international airport and originated from singapore , which had previously not reported any cases of the disease . additionally , no zika cases were found prior to 2015 , but the detection rate was 38 % in 2016 . raising travelers ' awareness of potential infectious disease risks is crucial , since prevention is preferable to treatment . taiwan cdc issues travel health notices at weekly press conferences or more often as needed . to reach out to partners and the public , messages and education leaflets are printed and posted on an official website and distributed through traditional and social media . many messages are targeted at pregnant women and those planning to become pregnant and recommend that these individuals postpone travel to affected areas . in addition , there are 26 hospitals with travel medicine clinics , located in each city and county in taiwanthe tourism industry plays an important role in disease prevention . according to a recent investigation of taiwanese travel behaviors ,34 % of travelers join a tour group and 38 % book tickets or hotels through an agency . cooperation between the government and the tourism industry is targeted at raising industry and tourist guide knowledge regarding zika virus and preventive measures , in order to provide tourists with the latest information about disease outbreaks in their destinations and to educate them on precautions in advance , throughout , and after travel . the tourism bureau requires tour guides to attend health courses and report suspected cases of communicable disease through the taiwan cdc 's toll - free hotline . tour guides may be fined if they fail to report cases and rewarded if a reported case is confirmed . as an example , during the lunar new year public holiday in 2016 , some taiwanese tourists planned to travel to central america and the caribbean , an area with active zika virus transmission . the tourism bureau cooperated with the taiwan cdc to provide information on precautions , monitor travelers , and provide refunds if pregnant women and those who were planning on becoming pregnant decided to postpone their travel . in total , 13 tour groups and 254 travelers ( including tour guides ) were monitored following travel . although 1 person presented with a fever after returning to taiwan , laboratory tests ruled out zika infection . although traveler health is one area of focus to reduce the potential for disease spread , taiwan also conducts vector surveillance and control on the vehicles that transport travelers and cargo into the country . on february 22 , 2016 , the who provided recommendations regarding aircraft disinsection as a precautionary measure to control mosquitoes that spread the zika virus based on country - specific risk assessments . in taiwan , trained and licensed professionals are stationed at points of entry and seasonally conduct vector surveillance at points of entry and the surrounding 400 - meter perimeters ( or wider ) according to who guidance . the frequency of surveillance and vector control activities can be increased based on previous results . surveillance findings are provided to the port authorities to ensure that vector density remains below a pre - established baseline . a risk assessment is also completed according to the latest international epidemic data and previous surveillance records to determine if a mosquito sweep should be performed on inbound aircraft from countries with a high prevalence of vector - borne disease . in addition , vector surveillance and control activities also include adult mosquito sweeps and insecticide sprays on airplanes . the adult mosquito sweep takes 10 to 20 minutes per airplane and is primarily focused on overhead compartments , lavatories , and under - seat space without interfering with airline procedures . any captured mosquitoes are sent to the taiwan cdc 's laboratory to undergo species identification and pathogen examination , and the airline is required to carry out vector control procedures and insecticide spraying . the risk of transporting zika - infected travelers through travel aboard ships is considered low in comparison to air travel . however , ships may pose a higher risk in introducing zika - infected mosquitoes to the country . for example , used tires and ornamental plants requiring water during transport have previously led to the spread of mosquito vectors . in responseto zika , tcecc released an official letter requiring that ships implement vector control and clear breeding sites . quarantine officers ensure that these activities have been completed during a ship sanitation inspection . from january to october 2016 , culex quinquefasciatus adult mosquitoes ( n = 74 ) were found on 26 ( 1.82 % ) of 1,426 inbound aircraft from airports in middle and southeast asia . however , because zika virus is primarily transmitted by the aedes mosquito , captured adult mosquitoes were not tested further with pathogen rt - pcr . during the same period , inspection of 870 ships and seasonal vector surveillance showed that infectious risk remained below the previous baseline . these points of entry meet the requirements of ihr 2005 core capacities and are able to cover over 95 % of passenger and cargo movement to ensure national health and safety . these points of entry were established in 2 phases , which were supervised by the homeland security office of executive yuan . the first phase ( 2010 - 2013 ) required that the highest traffic volume airport ( taoyuan international airport ) and seaport ( kaohsiung port ) meet ihr ( 2005 ) core capacities . both of these ports completed a self - assessment and passed their international external evaluation , using the 95 assessment indicators and scoring system provided in the who tool . this successful experience was extended to another 5 points of entry in the second phase of the project ( 2014 - 2016 ) . to ensure that these points of entry are able to maintain core capacities and coordination infrastructure , annual self - assessment is mandatory and an international external evaluation is required every 5 years . in 2016 , taiwan also initiated an external assessment of its national capacity using the joint external evaluation ( jee ) tool . the indicator regarding point of entry core capacity was made up of 2 areas , one focused on routine capacities and another on effective response . routine capacities include quarantine officers , medical evaluation units , established protocol for assessment and care of ill passengers , and referral to designated hospitals , if necessary . inspection programs and vector control also stand as important parts of routine capacities . in order to ensure effective response , protocols have been developed to evaluate public health risks at points of entry , including designated roles and responsibilities for multiple public agencies and private stakeholders . taiwan routinely evaluates the effectiveness and shares lessons learned with internal stakeholders and the international community . the external assessment team gave taiwan points of entry the highest score on both indicators . as an island located in a subtropical zone with a warm and humid environment , taiwan must remain vigilant against imported cases of vector - borne disease . while there is some debate about the effectiveness and opportunity cost of border entry screening , it has proven useful in border disease detection , especially when laboratory examination is included in the procedure . although the core capacity of detection and response infrastructure is yet to be implemented in some countries , in future emerging and remerging disease events , entry surveillance at certain designated points of entry may enable early detection of diseases of international origin and more rapid activation of public health preparedness activities and international collaboration . entry screening reduces community transmission risk and provides opportunities for national prevention and preparedness efforts and risk communication . example 1 : before a community hospital detected the first imported zika case in july 2016 , 3 cases were found at international airports during an initial stage . as of october 31 , 2016 , taiwan has no locally acquired zika infections , but 13 imported cases have been identified , of which 38 % were identified by airport border screening . in one case , a citizen arriving in taiwan self - reported zika - related symptoms and was later confirmed to be infected by zika by a taiwan cdc laboratory diagnosis . each year , more than 160,000 foreign workers arrive in taiwan from thailand , indonesia , vietnam , and the philippines . the taiwan cdc collaborates with the ministry of labour to provide zika precaution education materials in a range of languages . additionally , infected foreign laborers are able to receive the same medical treatment as taiwanese citizens , and their right to work in taiwan is not affected by their infection status , which promotes voluntary reporting of symptoms upon arrival . these border screenings have so far identified 4 imported zika cases among laborers from southeast asian countries . example 2 : in january 2016 , an individual returning from china self - reported being in close contact with a confirmed case of h7n9 prior to arriving in taiwan . the taiwan cdc border quarantine officer provided education at the designated airport , and a local health officer monitored the traveler 's health during the possible incubation period . the role of taiwan citizens switched from receiver to reflector , and it also emphasized the image of border health quarantine as not only being prevention but first - hand protection . important partners include travel medicine clinics , the tourism bureau , and the entire tourism industry . the industry is responsible for educating its members , as well as providing self - monitoring and reporting . two of the confirmed imported zika cases in taiwan were members of the same tour group returning from malaysia . based on in - depth interviewsthese cases highlight that educational briefings and proper precautionary behavior can not wholly eliminate the risk to travelers in zika - affected countries . continued efforts to effectively communicate the risk of zika infection in affected countries will help travelers make informed decisions about their health with respect to their travel plans . another encouraging type of collaboration between the tourism industry and public health has been used before in the case of a diarrhea cluster , which was caused by norovirus occurring in 25 overseas tour groups organized by several agencies with similar schedules . tour guides reported suspected cases in a timely manner and avoided a suspected restaurant that might have been the outbreak source based on the taiwan cdc 's investigation and recommendation ; no additional case was reported and no community case was caused by the event . furthermore , inbound aircraft from a number of specified countries have been required to undergo disinsection measures since february 2016 . this requirement can increase airline industry operational costs and may cause delays or even flight cancellations . the international civil aviation organization has proposed engaging with who to develop performance - based criteria to evaluate aircraft disinsection and relevant control methods . in taiwan , there are routine monitoring measures and surveillance records for inbound aircraft arriving from countries where vector - borne disease is highly prevalent . each year , the average adult mosquito capture rate is 0.89 % to 2.49 % in aircraft arriving from middle and southeast asia ( table 2 ) . taiwan uses surveillance records based risk assessment to implement aircraft mosquito surveillance measures and provides results to airlines to ensure vector management standards are met . this risk assessment method may be a model practice for countries considering implementing a practical vector surveillance and control measure regarding aircraft disinsection . number of mosquitoes captured on aircraft at 4 designated airports , 2013 - 2016 before 2013 , it was regularly conducted in taoyuan international airport . effective vector and zika virus prevention measures , such as port sanitation surveillance , aircraft mosquito sweeps , and ship breeding site inspections , rely on the coordination of a cross - sectoral port sanitation taskforce . the port sanitation taskforce ensures that each stakeholder remains vigilant during public health threats and all the necessary control measures meet the core capacity requirements of ihr ( 2005 ) . zika is an important international public health threat , and travel and border health measures have an important role in taiwan 's disease prevention strategies . active surveillance efforts in points of entry to detect early - stage imported infections may help to accelerate national preparedness and response activities and improve global and regional cooperation . travel and border health measures require cooperation and coordination with the tourism industry , port partners , airlines , multiple government agencies , local government , and international partners . taiwan will continue to conduct risk assessment , adjust procedures , ensure practical implementation , and work in close collaboration with laboratory , local government , and other partners to achieve prevention , detection , and reduction of the international spread of disease without interference in international travel and trade . the authors express special thanks to tara kirk sell for english editing and helpful suggestions . we would especially like to thank the points of entry taskforce and all colleagues in the taiwan cdc for their commitment and contributions to the practice of travel and border health measures in taiwan . additionally , the authors are grateful to all of the partners across multiple agencies and relevant stakeholders for their cooperation .\noutput:\n" }, { "from": "agent", "value": "zika virus has recently emerged as a worldwide public health concern . travel and border health measures stand as one of the main strategies and frontline defenses in responding to international epidemics . as of october 31 , 2016 , taiwan has reported 13 imported cases , 5 of which were detected through routine entry screening and active monitoring at international airports . this article shares taiwan 's disease surveillance activities at designated points of entry and travel and border health measures in response to zika . the taiwan government collaborates with its tourism industry to disseminate information about precautionary measures and encourages tour guides to report suspected individuals or events to activate early response measures . taiwan also engages in vector control activities at points of entry , including targeting aircraft from countries where vector - borne diseases are endemic , implementing mosquito sweep measures , and collecting vector surveillance data . in future emerging and reemerging disease events , entry surveillance at designated points of entry may enable early detection of diseases of international origin and more rapid activation of public health preparedness activities and international collaboration . taiwan will continue to maximize border and travel health measures in compliance with ihr ( 2005 ) requirements , which rely on continued risk assessment , practical implementation activities , and engagement with all stakeholders ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is generally believed that a large number of people suffering from alcohol use disorders either do not seek treatment or do so very late in the course of their illness . moreoverthere is limited literature that has explored pathways to care among individuals with substance dependence globally ( 2 ) . while majority failed to include individuals with alcohol dependence , others have included individuals with alcohol dependence as a small proportion of the overall sample . the proportion of subjects with alcohol dependence in such studies has varied from 0 % - 16 % ( 3 , 4 ) . we could come across only one study that has reported pathways to care exclusively among individuals with alcohol use disorder ( 5 ) . commander et al . ( 5 ) studied the pathways to psychiatric care for alcohol use disorders using the goldberg - huxley model ( 6 ) as the framework in a district in england . community ( level 1 ) ; primary care : total morbidity ( level 2 ) ; at primary care : conspicuous morbidity ( level 3 ) , specialist service use ( levels 4 ) ; and in - patient care ( level 5 ) . on analyzing the ratios of patients moving upwards to a higher level ( in other words , the function of filters ) , it turned out that about half progress at the first two filters and about one - tenth progress at the last two filters each . the study demonstrated that even in developed countries , only half of those with alcohol use problems ever seek even primary care help . the figures given above demonstrated that only a miniscule proportion of these patients receive specialist attention . need to study pathway to care in indian settings among patients with mental disorders has been expressed by researchers earlier as well ( 7 ) . however , there is no published literature that has specifically explored pathway to care among individuals with alcohol use disorder in india . in the present study , the authors explored pathways to care traversed by patients with alcohol use disorders seeking help at a tertiary care substance use disorder treatment center . patients fulfilling dsm - iv - tr criteria for alcohol dependence were recruited from a tertiary care de - addiction center . patients in age range of 18 - 60 years , seeking treatment at the substance use disorder treatment center , willing to provide a written informed consent were recruited . while those with any other comorbid substance use fulfilling dsm - iv - tr criteria for dependence or abuse ( other than nicotine ) , in state of intoxication and those refusing to provide informed consent were excluded from the study . information on socio - demographic profile of the patients was collected using a semi - structured proforma . data on pathways to care were collected using the encounter form used in who pathway study and thereafter extensively used in pathway to care studies across different settings and countries ( 3 , 8 ) . it is a culture neutral questionnaire designed to systematically assess sources of care used by patients before consulting mental health professional . the items included in the questionnaire gather information on profession of each previous carer , length of time since the patient was first seen and the main problem , source of referral , main treatment offered and duration of the patient 's journey to see the carer . the data obtained were analyzed using spss version 21 ( ibm spss statistics for windows , version 21.0 . the kolmogorov - smirnov test ( lilliefors significance criterion ) was used to determine the normality of the data . the t - test was used to compare continuous data with normal distribution whereas the mann - whitney test was used where the distribution was found to be nonnormal . the level of statistical significance was kept at p 0.05 for all the tests . information on socio - demographic profile of the patients was collected using a semi - structured proforma . data on pathways to care were collected using the encounter form used in who pathway study and thereafter extensively used in pathway to care studies across different settings and countries ( 3 , 8 ) . it is a culture neutral questionnaire designed to systematically assess sources of care used by patients before consulting mental health professional . the items included in the questionnaire gather information on profession of each previous carer , length of time since the patient was first seen and the main problem , source of referral , main treatment offered and duration of the patient 's journey to see the carer . information on socio - demographic profile of the patients was collected using a semi - structured proforma . data on pathways to care were collected using the encounter form used in who pathway study and thereafter extensively used in pathway to care studies across different settings and countries ( 3 , 8 ) . it is a culture neutral questionnaire designed to systematically assess sources of care used by patients before consulting mental health professional . the items included in the questionnaire gather information on profession of each previous carer , length of time since the patient was first seen and the main problem , source of referral , main treatment offered and duration of the patient 's journey to see the carer . the data obtained were analyzed using spss version 21 ( ibm spss statistics for windows , version 21.0 . the kolmogorov - smirnov test ( lilliefors significance criterion ) was used to determine the normality of the data . the t - test was used to compare continuous data with normal distribution whereas the mann - whitney test was used where the distribution was found to be nonnormal . the level of statistical significance was kept at p 0.05 for all the tests . the patients were mostly young , married and more often than not from joint families . there were no statistically significant differences between those seeking help from the tertiary level substance use disorder treatment center directly for the first time ever in their lives when compared to those who have had multiple previous help seeking attempts from other treatment facilities except for the travelling time ( from their homes ) to our center . those seeking help for the first time lived closer to the tertiary care de - addiction center with a median travelling time of 0.5 hours ( iqr = 1.77 ) whereas those with prior help seeking attempts from other health services lived farther with a median travelling time of 1.5 hours ( iqr = 2.75 ) from the center . abbreviation : sd , standard deviation . there were no significant differences in the substance use characteristics between those seeking help at a tertiary care center at first level of contact and those seeking tertiary care at second or subsequent contacts . the patients consulted a number of care providers with several consulting more than one provider . first point of contact was with a tertiary care addiction psychiatrist , 15.5 % with a secondary level psychiatrist and 8.6 % with a general practitioner . traditional healers were consulted by about 5.2 % of the patients seeking help for the first time . at all levels of contact with health services , the largest group comprised those consulting a tertiary care addiction psychiatrist , followed by a secondary care psychiatrist with some exceptions . the pathway to care followed by the study subjects has been represented in figure 2 . the mean duration of main problem due to alcohol use was 5.824.95 years . the temporal pattern and travel time for various help seeking attempts are shown in table 3 . the first contact tended to be at place nearer to the patient s residence while further contacts tended to be farther away . a comparison of the travelling times of those seeking tertiary care de - addiction service consultation at first level of contact ( median = 0.5 hours , iqr = 1.68 ) vis - a - vis consultations from other health services at first level of contact ( median = 1.00 hours , iqr = 1.75 ) revealed no statistically significant differences ( p = 0.22 ) . there were no differences between above two groups on any socio - demographic or clinical parameters . family , friends and neighbours together constituted the single largest group suggesting care to be sought ( or referring ) by the patients except at the third contact , where a marginally larger number of patients referred themselves . the patients were mostly young , married and more often than not from joint families . there were no statistically significant differences between those seeking help from the tertiary level substance use disorder treatment center directly for the first time ever in their lives when compared to those who have had multiple previous help seeking attempts from other treatment facilities except for the travelling time ( from their homes ) to our center . those seeking help for the first time lived closer to the tertiary care de - addiction center with a median travelling time of 0.5 hours ( iqr = 1.77 ) whereas those with prior help seeking attempts from other health services lived farther with a median travelling time of 1.5 hours ( iqr = 2.75 ) from the center . abbreviation : sd , standard deviation . there were no significant differences in the substance use characteristics between those seeking help at a tertiary care center at first level of contact and those seeking tertiary care at second or subsequent contacts . the patients consulted a number of care providers with several consulting more than one provider . first point of contact was with a tertiary care addiction psychiatrist , 15.5 % with a secondary level psychiatrist and 8.6 % with a general practitioner . traditional healers were consulted by about 5.2 % of the patients seeking help for the first time . at all levels of contact with health services , the largest group comprised those consulting a tertiary care addiction psychiatrist , followed by a secondary care psychiatrist with some exceptions . the pathway to care followed by the study subjects has been represented in figure 2 . the mean duration of main problem due to alcohol use was 5.824.95 years . the temporal pattern and travel time for various help seeking attempts are shown in table 3 . the first contact tended to be at place nearer to the patient s residence while further contacts tended to be farther away . a comparison of the travelling times of those seeking tertiary care de - addiction service consultation at first level of contact ( median = 0.5 hours , iqr = 1.68 ) vis - a - vis consultations from other health services at first level of contact ( median = 1.00 hours , iqr = 1.75 ) revealed no statistically significant differences ( p = 0.22 ) . there were no differences between above two groups on any socio - demographic or clinical parameters . family , friends and neighbours together constituted the single largest group suggesting care to be sought ( or referring ) by the patients except at the third contact , where a marginally larger number of patients referred themselves . this is the first study from india to systematically assess the pathways to care among patients diagnosed with alcohol dependence syndrome . in spite of the experts opinions on need for pathway to care study in indian setting for individuals with mental disordersthe current study found that the help - seeking attempt at a tertiary care center varied from a median of 9 years ( direct contact ) to a median of 14 years ( indirect contact ) after the onset of alcohol use . ( 5 ) regarding the unsatisfactory help seeking behaviour as well as the abysmally small number of patients availing appropriate health services . interestingly though , in the current study , well over half the sample had consulted a tertiary level addiction psychiatrist at first level of contact with health services and a sizeable number had consulted a secondary level psychiatrist . about one - fourth of the sample had consulted a tertiary level addiction psychiatrist at second contact . the number of patients consulting general practitioners , traditional healers and pharmacists was pretty low in the current study . even prior to the contact at our center , these findings , in a sense , appear to contradict those of commander et al . ( 5 ) this discrepancy could possibly be partly attributed to the fact that this sample was recruited from a tertiary care center and may have preferably picked those patients , who , for various reasons , may have had an inclination to consult a specialist . however , a closer scrutiny of previous literature suggests alternative explanation as discussed subsequently . although no previous studies from india have explored pathways to care exclusively among individuals with alcohol use disorder , there are a few that have focused on other psychiatric disorders ( 9 - 11 ) . a multi - national study ( 12 ) with one center in india also included subjects with substance use disorders ( 18 % of sample ) . all these studies have been conducted among clinical populations in tertiary care teaching hospitals from india . ( 10 ) reported that only around nine percent of the patients in their study sought help directly from a psychiatrist . ( 9 ) also observed that only a small fraction of the patients with mental disorders sought help directly from a psychiatrist . on the contrary , more than seventy percent of the subjects sought help directly from a psychiatrist in the current study . the findings of these previous studies which were also recruited from tertiary care centers indicate that the nature of the sample alone can not explain the discrepant findings of the current study . thus , the observation in the current study is contrary to the earlier expressed views highlighting limited direct access to psychiatric services after the onset of illness in india ( 7 ) . this observation from the current study possibly implies that in case of substance use disorders ( alcohol dependence ) , the rate of nonspecialist help seeking may actually be much less than that observed for other psychiatric disorders . interestingly around two - third ( 6/9 ) of the subjects with substance use disorders as compared to only 27 % of subjects with other psychiatric disorders from the indian site in the multinational study by hashimoto et al . a possible explanation could be the lack of service providers who are willing to treat substance use problems , which might have forced these patients to seek help at a specialized center such as ours . possibility of difference in pathways to care based on the psychiatric diagnosis has been expressed earlier as well . a study from northern part of the country reported psychiatrist to be the first doctor consulted by 58 % of the patients ( 13 ) . additionally , almost one - third of them sought help from faith healers at first contact . about 90 % of the sample in the study was constituted by psychotic and mood disorders explaining the nature of help - seeking . another study from a tertiary care setting ( that did not include patients with substance use disorders ) reported a high rate ( 44 % ) of first contact with a nonpsychiatrist physician ( 11 ) . around 43 % of the sample ( constituting the largest subset ) had a diagnosis of somatoform disorder explaining this help - seeking pattern . the authors argued that the difference in psychiatric diagnoses across these studies and the earlier studies from the country could explain the difference in the preferred first point of contact in help seeking pathway . hence , it is important to study pathway to care separately for individuals diagnosed with different psychiatric disorders including substance use disorders . another common observation across previous indian studies has been a high rate of help seeking from faith healers and religious healers . ( 9 ) also observed that there was a very high rate of help seeking from faith healers , traditional medicine practitioners and quacks for mental disorders other than substance use disorders . however , as mentioned earlier , these studies did not include patients with substance use disorders . direct help seeking from faith healer in the current study was low at five percent . interestingly , a similar low rate of 11 % among patients with substance use disorders ( as compared to 19 % for other psychiatric disorders ) was observed at the indian site of the study by hashimoto et al . ( 12 ) this observation also lends support to possibility of different pathways to care among patients with different psychiatric disorder including substance use disorders . only a small proportion of subjects ( 5 % ) visited a practitioner of alternate system of medicine in the current study . this is comparable to the low rates observed in the earlier studies ( 9 , 10 ) . it seems that most of the patients with psychiatric disorders ( including substance use disorders ) do not seek treatment from alternate systems of medicine in these regions of the country . this observation has important policy implication as over the past few years there has been a growing emphasis on promotion of alternate systems of medicine across the country . ( 5 ) could be explained by the vast differences in the health care system of india and england . it is possible that the treatment provided by nonspecialists for substance use disorders in india may have been perceived as unattractive or ineffective by patients ; or that nonspecialists might prefer treating other disorders rather than substance use disorders . for instance , in case of psychotic disorders , the various socio - cultural beliefs regarding its causation make consulting a faith healer an obvious choice for a large number of people but the same is not true for substance use disorders . yet another possibility could be that there may have been underreporting of prior help seeking attempts in this population . another important finding of the current study was that the only significant difference between patients visiting tertiary care center directly and those visiting indirectly was the distance from the center . all other parameters including the age at onset and duration of substance use ( and therefore possibly the severity ) were not significantly different . it is likely that the utilization of specialized services is likely to be high if such services are made available closer to the place of stay . the fact that the mean travel duration even for the first contact was about 1.55 hours reflects limited availability and poor accessibility of treatment services for substance use disorders . although developing more centers for treatment of substance use disorders ( and thereby decreasing distance to the center ) seems like a logical option , building of such stand - alone services may not be cost effective . therefore , integration of substance use disorder treatment to primary health care services seems to be a better option . effectiveness and feasibility of community - based service delivery for substance use disorder has been documented in the indian setting previously ( 14 - 16 ) . family , friends and neighbours suggested referral in an overwhelming majority of cases , far outnumbering those by doctors or patients themselves . however , the low number of referrals by doctors probably reflects a poor referral mechanism in our health system . a related implication of this observation is an underutilization of primary and secondary care centers and consequent overburdening of tertiary care centers . in the wake of these findings , one needs to revisit the validity of the goldberg - huxley model for indian settings . as has been seen , such systematic referral system is not functional in india , at least for alcohol use disorders . the current study , besides being the first of its kind to be conducted in india , also replicates and confirms some of the findings from western studies in indian setting . more importantly , it also questions some aspects that had been widely regarded to be true in india and demonstrated in western studies . therefore , the current study also makes a larger point by reminding us of the need and importance of systematic data and also that the western data can not be directly applied to indian settings in all cases . notwithstanding the stated need for future studies , it provides an evidence - based platform for addressing the lacunae in our health care delivery system . the study reported findings from a single site that included a small sample of only male subjects . there is a need to replicate findings at other sites , with larger samples as well as to study female subjects before the results could be generalized . future research should also aim at following up these subjects as well as to determine barriers to help seeking which would be of immense help in planning effective mental health interventions . pathways to care for patients diagnosed with alcohol use disorders represent a crucial link in the overall scheme of health care delivery for these disorders . in indiathere is a long time lag between the onset of alcohol use related problems and the first help seeking attempt , even if it was from a nonspecialist . however , of those who do decide to seek help , the proportion of those obtaining specialist help may be higher than believed . referral by the health service providers is low and patients are mostly referred by family , friends and neighbours . distance from treatment center is a crucial factor in treatment seeking and integration of substance use disorder treatment services into primary health care services will go a long way in improving help seeking patterns . pathways to care for patients diagnosed with alcohol use disorders represent a crucial link in the overall scheme of health care delivery for these disorders . in indiathere is a long time lag between the onset of alcohol use related problems and the first help seeking attempt , even if it was from a nonspecialist . the patients often have to travel long distances to avail treatment . however , of those who do decide to seek help , the proportion of those obtaining specialist help may be higher than believed . referral by the health service providers is low and patients are mostly referred by family , friends and neighbours . distance from treatment center is a crucial factor in treatment seeking and integration of substance use disorder treatment services into primary health care services will go a long way in improving help seeking patterns .\noutput:\n" }, { "from": "agent", "value": "backgroundno study from india has examined pathways to care in alcohol using population systematically.objectivesthe present study aimed to understand the pathways to care among alcohol - dependent individuals seeking help at a tertiary care center.patients and methodsit was a cross - sectional , observational study . a total of 58 subjects diagnosed with alcohol - dependence syndrome as per dsm - iv - tr were included in the study . pathways to care were assessed using the world health organization encounter form.resultsfor 56.9 % of the subjects , first point of contact was with a tertiary care addiction psychiatrist . traditional healers were consulted by about 5.2 % of the patients seeking help for the first time . the mean duration of main problems due to alcohol use was 5.82 4.95 years . the first contact tended to be at place nearer to the patient s residence while further contacts tended to be farther away . family , friends and neighbours together constituted the single largest group suggesting patients to seek care.conclusionsthere is a long time lag between the onset of alcohol use related problems and the first help seeking attempt . of those who do decide to seek help , the proportion of those obtaining specialist help is higher than commonly believed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: more than 5 million people in the united states and 24 million worldwide are affected by alzheimer s disease ( ad ) , a disease characterized by memory loss and neurodegeneration . insoluble aggregates of the 42 and 40 amino acid long amyloid peptides ( a42 and a40 , respectively ) are believed to be intimately involved in the onset of ad . however , while amyloid plaques , the ultimate product of a aggregation , have been proposed to promote neurodegeneration and dementia , recent studies have shown that the soluble a oligomers are more neurotoxic both in vitro and in vivo . in addition , while a40 is present in larger amounts in amyloid plaques , the longer and more hydrophobic a42 isoform has a higher tendency to generate neurotoxic oligomeric species . interestingly , unusually high concentrations of copper , iron , and zinc have been found within the amyloid deposits in ad - affected brains . these metal ions have been shown to affect a aggregation , as well as lead to the formation of reactive oxygen species ( ros ) . although many studies have investigated the involvement of metal ions in a aggregation and plaque formation , the molecular mechanisms of metala species interactions , especially for the more neurotoxic a42 , are still not completely understood . exley et al . have used fluorescence assays and transmission electron microscopy ( tem ) to show that both sub - and superstoichiometric concentrations of cu prevent aggregation of a42 into thioflavin t ( tht ) - positive - sheet - rich amyloid fibrils . we have also recently reported that cu ions slow down fibrillization of the a42 peptide and stabilize the soluble a42 species , as observed by native gel electrophoresis / western blotting , tem , cell viability studies , and pulsed hydrogen / deuterium exchange mass spectrometry studies . in this regard , metal chelators have been shown to reduce metal - mediated a aggregation , ros formation , and neurotoxicity in vitro . recent efforts to control abnormal ametal interactions have focused on small molecules , bifunctional chelators ( bfcs ) , that have binding affinity for both metal ions and a aggregates . however , the majority of these bfcs have been studied for their effect on aggregation of the a40 peptide , and fewer studies have focused on their interaction with the more neurotoxic a42 peptide . compounds that inhibit metal - mediated a40 aggregation or promote disaggregation of amyloid fibrils were shown to lead to increased cell viability . however , this approach may not be optimal for the a42 peptide , given the increased toxicity observed for soluble a42 oligomers . our current efforts are aimed at the development of bfcs that control the metalneurotoxicity in vivo and take into consideration the formation of neurotoxic soluble a42 oligomers and their proposed role in ad neuropathogenesis . reported herein are two new bfcs , 2 - [ 2 - hydroxy - 4 - ( diethylamino ) phenyl ] benzothiazole ( l1 ) and 2 - ( 2 - hydroxy -3-methoxyhenyl ) benzothiazole ( l2 ) , that were designed following a previously reported strategy of incorporating metal - binding atoms into the structural framework of an a-interacting compound . l1 and l2 have a modified 2 - ( 2 - hydroxyphenyl ) benzothiazole ( hpb ) molecular framework reminiscent of the amyloid - binding fluorescent dye tht ( scheme 1 ) , which was shown to be promising in the design of new a-binding compounds . the bifunctional character of the two compounds was confirmed by metal - chelating and a-binding studies . the cu complexes of l1 and l2 were isolated and characterized spectroscopically and by x - ray structural determination . the amyloid - binding properties of l1 and l2 were explored by fluorescent titrations and by tht competition assays . while l1 exhibits an acceptable binding affinity for a fibrils , with the higher affinity binding site corresponding to a ki of 260 nm , l2 binds very strongly to a fibrils with a ki of 15 nm . in addition , l1 and l2 moderately inhibit a42 aggregation in the absence of metal ions , yet they promote aggregation in the presence of metal ions , as observed by native gel / western blotting and tem . in addition , l1 and l2 were able to reduce the cell toxicity of preformed a42 oligomers as well as that of soluble copper - stabilized a42 oligomers , which were shown recently to be neurotoxic . these promising properties of l1 and l2 make them suitable candidates for further in vivo investigation . all reagents were purchased from commercial sources and used as received unless stated otherwise . solvents were purified prior to use by passing through a column of activated alumina using an mbraun solvent purification system . all solutions and buffers were prepared using metal - free millipore water that was treated with chelex overnight and filtered through a 0.22 m nylon filter . h ( 300.121 mhz ) and c ( 75 mhz ) nmr spectra were recorded on a varian mercury - 300 spectrometer . chemical shifts are reported in ppm and referenced to residual solvent resonance peaks . uv vis spectra were recorded on a varian cary 50 bio spectrophotometer and are reported as max , nm ( , m cm ) . electrospray ionization mass spectrometry ( esi - ms ) experiments were performed using a bruker m - axis qtof mass spectrometer with an esi source . esi - ms was provided by the washington university mass spectrometry nih resource ( grant p41rr0954 ) , and elemental analyses were carried out at intertek chemical and pharmaceuticals testing and analysis services . suitable crystals of appropriate dimensions were mounted in a bruker kappa apex ii ccd x - ray diffractometer equipped with an oxford cryostream lt device and a fine - focus mo k radiation x - ray source ( = 0.71073 ) . preliminary unit cell constants were determined with a set of 36 narrow frame scans . typical data sets consist of combinations of and scan frames with a typical scan width of 0.5 and a counting time of 1530 s / frame at a crystal - to - detector distance of 4.0 cm . the collected frames were integrated using an orientation matrix determined from the narrow frame scans . apex ii and saint software packages were used for data collection and data integration . final cell constants were determined by the global refinement of reflections from the complete data set . structure solutions and refinement were carried out using the shelxtl - plus software package . the structures were refined with full - matrix least - squares refinement by minimizing w ( fo fc ) . all hydrogen atoms were added in the calculated position and refined using appropriate riding models ( afix m ) . vis ph titrations were employed for determination of the acidity constants of l1 and l2 and their stability constants with cu and zn . for the acidity constants , solutions of bfcs ( 25 m for l1 and 50 m for l2 , 0.1 m nacl , ph 3 ) were titrated with small aliquots of 0.1 m naoh at room temperature . at least 30 uv vis spectra were collected in the ph 311 range . because of the limited solubility of l1 and l2 in water , methanol ( meoh ) stock solutions ( 10 mm ) were used and titrations were performed in a meohwater mixture in which meoh did not exceed 20 % ( v / v ) . similarly , the stability constants for the l1copper system were determined by titrating a solution of l1 ( 25 m ) and cu ( clo4 ) 26h2o ( 12.5 m ) with small aliquots of 0.1 m naoh at room temperature . the acidity and stability constants were calculated using the hypspec computer program ( protonic software gmbh , u.k . ) . speciation plots of the compounds and their metal complexes were calculated using the program hyss2009 ( protonic software gmbh , u.k . ) . a monomeric films were prepared by dissolving commercial a42 ( or a40 for a-fibril - binding studies ) peptide ( keck biotechnology resource laboratory , yale university ) in hfip ( 1 mm ) and incubating for 1 h at room temperature . this solution was then aliquoted out , and hfip was allowed to evaporate overnight . the aliquots were vacuum - centrifuged , and the resulting monomeric films were stored at 80 c . a fibrils were generated by dissolving monomeric a films in dimethyl sulfoxide ( dmso ) , diluting into the appropriate buffer , and incubating for 24 h at 37 c with continuous agitation ( the final dmso concentration was 2 % ) . for metal - containing fibrils , the corresponding metal ions were added before initiation of the fibrillization conditions . for inhibition studies , bfcs ( 50 m , dmso stock solutions ) were added to a solutions ( 25 m ) in the absence or presence of metal salts ( cucl2 or zncl2 , 25 m ) and incubated for 24 h at 37 c with constant agitation . for disaggregation studies , the preformed a fibrils in the absence or presence of metal ions were treated with bfcs and further incubated for 24 h at 37 c with constant agitation . for the preparation of soluble a42 oligomers , a literature protocol was followed . a monomeric film of a42 was dissolved in anhydrous dmso , followed by the addition of dmem - f12 media [ 1:1 ( v / v ) , without phenol red ; invitrogen ] . the solution ( 50100 m ) was incubated at 4 c for 24 h and then centrifuged at 10000 g for 10 min . all fluorescence measurements were performed using a spectramax m2e plate reader ( molecular devices ) . for tht fluorescence studies , samples were diluted to a final concentration of 2.5 m a in phosphate - buffered saline ( pbs ) containing 10 m tht and the fluorescence was measured at 485 nm ( ex = 435 nm ) . for a-fibril - binding studies , a 5 m a fibril solution was titrated with small amounts of compound and their fluorescence intensity measured ( ex / em = 330/450 nm ) . for tht competition assays , a 5 m a fibril solution with 2 mtht was titrated with small amounts of compound and the tht fluorescence measured ( ex / em = 435/485 nm ) . for calculation of ki values , a kd value of 1.17 m was used for the binding of tht to a40 fibrils . glow - discharged grids ( formar / carbon 300 mesh , electron microscopy sciences ) were treated with a samples ( 25 m , 5 l ) for 23 min at room temperature . excess solution was removed using filter paper , and grids were rinsed twice with water ( 5 l ) . grids were stained with uranyl acetate ( 1 % w / v , water , 5 l ) for 1 min , blotted with filter paper , and dried for 15 min at room temperature . images were captured using a fei g2 spirit twin microscope ( 6080 kv , 650097000 magnification ) . all gels , buffers , membranes , and other reagents were purchased from invitrogen and used as directed except where otherwise noted . the gel was transferred to a nitrocellulose membrane in an ice bath , and the protocol was followed as suggested except that the membrane was blocked overnight at 4 c . after blocking , the membrane was incubated in a solution ( 1:2000 dilutions ) of 6e10 anti - a primary antibody ( covance ) for 3 h. invitrogen s western breeze chemiluminescent kit was used to visualize the bands . an alkaline / phosphatase antimouse secondary antibody was used , and the protein bands were imaged using a fujifilm las - 1000ch luminescent image analyzer . mouse neuroblastoma neuro2a ( n2a ) cell lines were purchased from the american type culture collection ( atcc ) . cells were grown in dmem / 10 % fbs , which is the regular growth media for n2a cells . n2a cells were plated to each well of a 96 - well plate ( 2.510 / well ) with dmem / 10 % fbs . after 1 h , the reagents ( 20 m a42 species , compounds , and metals ) were added . because of the poor solubility of the compounds in water or media , the final amount of dmso used was 1 % ( v / v ) . after an additional incubation of 40 h , the alamar blue solution was added in each well and the cells were incubated for 90 min at 37 c . the absorbance was measured at 570 nm ( control optical density = 600 nm ) . for these toxicity studies , three types of a42 species were tested : freshly made monomeric a42 ( ma42 ) , a42 oligomers ( oa42 ) , and a42 fibrils ( fa42 ) . these a42 species were prepared as described above . a mixture of 2 - aminothiophenol ( 2.5 g , 20 mmol ) and ( diethylamino ) salicylaldehyde ( 3.86 g , 20 mmol ) in dmso ( 20 ml ) was heated with stirring at 150 c for 6 h under dinitrogen . then it was cooled to 0 c for 8 h , and the orange solid crystallized out , was collected by filtration , and was washed with hexane ( 2.97 g , yield 50 % ) . h nmr ( cdcl3 ) : 7.85 ( d , 1h , arh ) , 7.81 ( d , 1h , arh ) , 7.46 ( d , 1h , arh ) , 7.43 ( d , 1h , arh ) , 7.30 ( d , 1h , phenol h ) , 6.30 ( d , 1h , phenol h ) , 6.27 ( s , 1h , phenol h ) , 3.41 ( q , 2h , ch2ch3 ) , 1.22 ( t , 3h , ch2ch3 ) . c nmr ( cdcl3 ) : 169.78 , 159.98 , 152.43 , 151.52 , 132.08 , 130.04 , 126.42 , 124.35 , 121.40 , 121.18 , 105.96 , 104.34 , 98.053 , 44.72 , 12.86 . vis [ max , nm , ( , m cm ) ] : in mecn , 262 ( 10300 ) , 380 ( 43000 ) ; in pbs , 272 ( 9500 ) , 375 ( 18000 ) , 405 ( 19500 ) . calcd for [ m + h ] : m / z 299.1218 . found : m / z 299.1225 . a mixture of o - vanilin ( 2.0 g , 0.0131 mol ) and 2 - aminothiophenol ( 1.64 g , 0.0131 mol ) in ethanol ( 15 ml ) was refluxed with stirring for 24 h. then it was cooled to room temperature and poured in water . the sticky yellow solid was crystallized from meoh to obtain yellow crystals ( 1.15 g , yield 37 % ) . h nmr ( cdcl3 ) : 8.02 ( d , 1h , arh ) , 7.91 ( d , 1h , arh ) , 7.52 ( t , 1h , arh ) , 7.42 ( t , 1h , arh ) , 7.33 ( d , 1h , arh ) , 7.01 ( d , 1h , arh ) , 6.99 ( t , 1h , arh ) , 3.97 ( s , 3h , och3 ) . c nmr ( cdcl3 ) : 169.28 , 151.50 , 148.93 , 148.19 , 148.17 , 132.59 , 126.70 , 125.56 , 122.16 , 121.45 , 119.98 , 119.14 , 116.71 , 114.06 , 56.22 . vis [ max , nm , ( , m cm ) ] : in mecn , 307 ( br , 10200 ) , 340 ( sh , 5500 ) ; in pbs , 305 ( 3500 ) , 340 ( sh , 1800 ) , 390 ( 800 ) . hrms . calcd for [ m + h ] : m / z 258.0588 . found : m / z 258.0584 . a solution of cucl22h2o ( 0.011 g , 0.084 mmol ) in mecn ( 2 ml ) was added to the stirring mixture of l1 ( 0.050 g , 0.167 mmol ) and et3n ( 0.036 g , 0.334 mmol ) in mecn ( 5 ml ) . the brown precipitate immediately obtained was filtered , washed with ether , and dried under vacuum ( 0.040 g , yield 54 % ) . vis [ max , nm , ( , mcm ) ] : in mecn , 273 ( sh , 18000 ) , 391 ( 56800 ) , 404 ( sh , 50500 ) , 540 ( 900 ) . hrms . calcd for [ m + h ] : m / z 658.1497 . found : m / z 658.1492 . calcd for c34h34n4o2s2cu0 .5 h2o : c , 61.52 ; h , 5.25 ; n , 8.44 . found : c , 61.63 ; h , 6.11 ; n , 8.44 . a solution of zncl2 ( 0.011 g , 0.084 mmol ) in mecn ( 2 ml ) was added to the stirring mixture of l4 ( 0.050 g , 0.167 mmol ) and et3n ( 0.018 g , 0.167 mmol ) in mecn ( 5 ml ) . the red solution was kept for slow evaporation , and a few single crystals were obtained within 2 days ( 0.052 g , yield 58 % ) . vis [ max , nm , ( , mcm ) ] : in mecn , 265 ( 19900 ) , 391 ( 51000 ) . calcd for [ ( l1 ) zncl + h ] : m / z 397.01 . found : m / z 397.01 . satisfactory elemental analysis data could not be obtained because of the presence of a small amount of free ligand . a solution of cucl22h2o ( 0.013 g , 0.097 mmol ) in mecn ( 2 ml ) was added to the stirring mixture of l2 ( 0.050 g , 0.194 mmol ) and et3n ( 0.078 g , 0.776 mmol ) in meoh ( 10 ml ) . the brown precipitate immediately obtained was filtered , washed with ether , and dried under vacuum ( 0.051 g , yield 91 % ) . vis [ max , nm , ( , mcm ) ] : in mecn , 398 ( 26200 ) , 515 ( sh , 800 ) , 700 ( 350 ) . calcd for [ m + na ] : m / z 598.0 . found : m / z 598.1 . calcd for c28h20n2o4s2cu0 .5 h2o : c , 57.47 ; h , 3.62 ; n , 4.79 . found : c , 57.34 ; h , 3.62 ; n , 4.83 . herein we employed the strategy of developing metal bfcs with amyloid - binding properties as potential therapeutic agents for ad . the fluorescent dye tht is well - known for its amyloid - binding properties because of the 2 - phenylbenzothiazole aromatic framework . previously , an iodinated hpb and a few related compounds were shown to have potential as metal - chelating agents by rodrguez - rodrguez et al . however , in that report , only the solution coordination properties of those compounds were investigated in detail , while the a-binding and antiaggregation properties were only qualitatively evaluated through epifluorecense microscopy and turbidity assays . in contrast , in addition to the solution coordination chemistry , we have also determined the solid - state structure of the copper and zinc complexes of our compounds , and we have also quantitatively determined their a-binding affinities through fluorescence titrations . in addition , we have used both tem and gel electrophoresis / western blotting to provide a complete picture of the effect of our compounds on a aggregation and formation of various sized a aggregates , in both the absence and presence of metal ions . most importantly , we have correlated the in vitro studies with cellular toxicity studies , thus making this work a comprehensive study of these compounds in the context of developing new compounds that can control the toxicity and aggregation of various a species . we have also recently reported 2 - phenylbenzothiazole / vanillin derivatives as bfcs that showed a strong affinity for a fibrils . herein we designed two new molecules , l1 and l2 , that contain a 2 - phenylbenzothiazole moiety for a recognition and oxygen - and nitrogen - atom donors needed for metal chelation . synthesis of l1 and l2 was accomplished upon oxidative cyclization of the corresponding arylaldehyde and 2 - aminothiophenol ( scheme s1 in the si ) . these compounds exhibit uv absorption in mecn at 260 and 380 nm for l1 and at 305 and 345 nm for l2 ( figures s1 and s2 in the si ) . while both l1 and l2 are 2 - phenylbenzothiazole derivatives , l1 exhibits low - intensity emission at 450 nm and a shoulder at 525 nm , yet l2 shows a more intense emission at 525 nm in pbs ( figures s3 and s4 in the si ) . the parent molecule hpb has emission properties similar to those of l2 ( figure s4 in the si ) , which suggests that having a diethylamino group in l1 strongly affects its emission properties . another important aspect of the design of new drug molecules for central nervous system diseases is their ability to cross the blood brain barrier ( bbb ) . both l1 and l2 are small in size , and they also satisfy lipinski srules for crossing the bbb ( table 1 ) . the ability of a compound to cross the bbb can be evaluated by determining the blood brain partitioning parameter log bb that is determined by taking into account the molecular weight of the molecule , charge , lipophilicity , and its hydrogen - bonding capability . molecules having log bb values higher than 0.3 are generally expected to cross the bbb . the calculated log bb values for l1 and l2 are + 0.33 and + 0.087 , respectively , suggesting that these bfcs are expected to cross the bbb . mw = molecular weight ; c log p = calculated octanol water partition coefficient ; hbd = hydrogen - bonding donor atoms ; hba = hydrogen - bonding acceptor atoms ; psa = polar surface area ; log bb = 0.0148 psa + 0.152 c log p + 0.130 ( lipinski , c. a. ; lombardo , f. ; dominy , b. w. ; feeney , p. j. adv . drug delivery rev. 1997 , 23 , 325 ; clark , d. e. ; pickett , s. d. drug discovery today2000 , 5 , 4958 ) . because both l1 and l2 contain functional groups that can undergo protonation , the acidity constants ( pka ) were determined by uv vis spectrophotometric titrations . for both l1 and l2 , uv vis titrations from ph 3.0 to 11.0 reveal several changes in the spectra ( figures 1 and 2 ) . for l1 , the best fit to the data was obtained with pka values of 3.556 ( 2 ) , 8.427 ( 3 ) , and 10.108 ( 2 ) ( table 2 ) . the first and second pka values can be assigned to deprotonation of the nitrogen atoms of the benzothiazole and diethylamino groups , while the largest pka value is likely due to phenol deprotonation . for l2 , the best fit to the data was obtained with two pka values of 3.154 ( 2 ) and 9.360 ( 1 ) ( table 2 ) . these pka values can be assigned to deprotonation of the nitrogen atoms of the benzothiazole and phenol groups , respectively . variable - ph uv spectra of l1 ( 25 m , 25 c , i = 0.1 m nacl ) and the species distribution plot .25 c , i = 0.1 m nacl ) and the species distribution plot . the bfcs l1 and l2 were explored for their ability to chelate metal ions . the stoichiometry of l1cu and l1zn complexes in solution was determined by job s plot analysis . for l1cu , a break in the plot at 0.4 mole fraction of cu suggests the formation of both 1:1 and 2:1 l1cu complexes in solution ( figure s4 in the si ) . for l1zn , the break occurs at 0.3 mole fraction of zn , suggesting the formation of a 2:1 l1zn complex ( figure s5 in the si ) . by contrast to l1 , no job s plot analysis could be performed for l2cu because of the limited solubility of this complex , while no significant spectral change was observed for the l2zn system . the cu complexes of l1 or l2 were synthesized by reacting cucl22h2o with the corresponding ligand in mecn in the presence of an equivalent amount of et3n . the 2:1 complex formation was confirmed by the esi - ms signal at m / z 658.1 corresponding to [ m + h ] , which was further supported by x - ray structural determination ( see below ) . d transition at 700 nm and a more intense band at 540 nm , while a phenolate - to - cu charge - transfer band is observed at 400 nm ( figure s6 in the si ) . similarly , the uv vis spectrum of the l2cu complex 3 shows characteristic dd transition bands at 700 and 515 nm as well as a phenolate - to - cu charge - transfer band at 400 nm ( figure s7 in the si ) . although a single crystal suitable for x - ray crystallography could be obtained from the reaction mixture of l1 and zn , the isolation of the zinc complexes of l1 or l2 did not lead to pure complexes to allow for their complete characterization . spectrophotometric titrations were also performed to determine the stability constants and solution speciation of cu with l1 . the pka values of the ligands were included in the calculations , and the best fit to the data shows that l1 binds cu with a stability constant of 11.99 ( 2 ) for the m + l = ml equilibrium and a value of 20.99 ( 2 ) for the ml + l = ml2 equilibrium ( l represents the deprotonated form of l1 ) . in addition , the concentration of free cu ( pcu = log [ cufree ] ) can be determined at specific ph values and total ion concentrations , with pcu values of 6.7 and 8.2 being determined for the cuthese pcu values are lower compared to those for the analogous hpb compound reported previously , likely because of the strong electron - withdrawing effect of the diethylamine group upon protonation . unfortunately , the spectrophotometric titration of l2 in the presence of cu revealed few spectral changes at micromolar concentrations , while the use of higher concentrations led to precipitation of the l2cu complex . however , it is expected that l2 exhibits a higher binding affinity to cu than l1 because of the electron - donating o - methoxy group present in l2 . in addition , almost no changes were observed in the spectra of both l1 and l2 upon the addition of zn ; therefore , the corresponding stability constants could not be determined . attempts were then made to determine the apparent stability constants for the zn l1 and zna interaction studies and exhibits a kd 10 m for zinc . in our case , the addition of zincon to solutions of zn l1 and znin addition , l1 and l2 do not compete significantly with zincon for zinc binding , even when present in large excess versus zincon , suggesting that they exhibit affinities for zinc that are at least 10 times lower than that of zincon . variable - ph uv spectra of the l1cu system ( [ l1 ] = 25 m ; [ cu ] = 12.5 m , 25 c , i = 0.1 m nacl ) and the species distribution plot . to further characterize the metal - binding properties of compounds l1 and l2 , single - crystal x - ray structures were determined for complexes 13 ( figure 4 and tables s1s3 in the si ) . complex 1 affords single crystals by et2o diffusion into a ch2cl2 solution of 1 that crystallized out in the c2 / c space group . an oxygen atom and a nitrogen atom from two ligand moleculesn1 bond lengths are 1.980 ( 3 ) and 1.876 ( 2 ) , respectively , and the trans angles o1cu1o1 # 1 and n1 # 1cu1n1 are 153.3 ( 2 ) and 154.2 ( 2 ) , respectively , with these parameters suggesting a distorted square - planar geometry for cu . for complex 2 , the zn ion exhibits a distorted tetrahedral geometry and is coordinated to the benzothiazole nitrogen and phenol oxygen atoms of l1 and two chloride ions . the copper complex 3 afforded single crystals by et2o diffusion into a ch2cl2 solution and has structural properties similar to those of 1 , yet it crystallized out in the p2 / n space group . as shown for 1 , in 3 an oxygen atom and a nitrogen atom from two ligand molecules coordinate to cu . n1 bond lengths are 1.873 ( 4 ) and 1.965 ( 4 ) , respectively , and the trans angles o1cu1o1 # 1 and n1 # 1cu1n1 are 145.1 ( 2 ) and 146.2 ( 2 ) , respectively , reflecting a distorted square - planar geometry for cu . all hydrogen atoms , counterions , and solvent molecules are omitted for clarity . selected bond distances : 1 , cu1n11 .980 ( 3 ) , cu1o11 .876 ( 2 ) ; 2 , zn n1cl ( 2 ) 2.222 ( 1 ) ; 3 , cu1n1 / n21 .965 ( 4 ) , cu1o1 / o31 .873 ( 4 ) . both compounds l1 and l2 contain a 2 - phenylbenzothiazole fragment reminiscent of the fluorescent dye tht used to detect the - sheet structure of fibrillar a aggregates . in this context , the affinity of l1 and l2 toward a fibrils was investigated by fluorescence assays . these studies were performed with a40 fibrils , which form more homogeneous fibrillar structures without any nonfibrillar aggregates . titration of l1 with a fibrils was performed , and a saturation behavior is observed . the data were fitted with a one - site binding model to give a kd of 4.700.30 m ( figure 5a ) , which suggests a moderate affinity of l1 for the a fibrils . tht fluorescence competition assays were also performed by the addition of l1 to a solution of a fibrils in the presence of tht . competitive - binding curve fitting yields a ki value of 26040 nm ( figure 5b ) . it should be noted that the ki value for l1 is smaller than the kd value , which is most likely due to the fact that tht binds with different affinities to more than one site to the a fibrils . as such , we propose that l1 replaces tht only from the higher affinity binding site . by constrast , l2 did not show any significant increase in the fluorescence intensity in the presence of a fibrils yet replaces tht from the a fibrils and exhibits a ki value of 1510 nm , indicating a very strong binding affinity to a fibrils ( figure 5c ) . ( a ) fluorescence titration assay of l1 with a fibrils ( [ a ] = 5 m ; ex / em = 330/450 nm ) . tht fluorescence competition assays of a fibrils with ( b ) l1 and ( c ) l2 ( [ a ] = 2 m ; [ tht ] = 1 m ; ex / em = 435/485 nm ) . to investigate the effect of l1 and l2 on a aggregation , we performed both inhibition and disaggregation studies ( scheme 3 ) . importantly , the a42 peptide was employed in these studies because it was shown to form neurotoxic soluble a oligomers . for inhibition experiments , freshly prepared a42 fibrils were treated with metal ions , bfcs , or both , and the reactions was monitored by tht fluorescence , native gel electrophoresis / western blotting analysis , and tem . in inhibition experiments , a reduced tht fluorescence was observed for the cu - and zn - containing fibrils , as reported previously ( figure 6 ) . in the absence of metal ions , the presence of l1 leads to a low tht fluorescence intensity , while l2 has a negligible effect on a42 fibrillization , suggesting that l1 can inhibit fibrillization more efficiently than l2 . in the presence of cu and either l1 or l2 , a very low tht fluorescence intensity is observed , which could be due to either limited a42 fibril formation or fluorescence quenching by the paramagnetic cu ions . by comparison , the presence of zn and either l1 or l2 shows almost no effect on the tht fluorescence intensity ( figure 6 ) . because the tht fluorescence assays do not show a complete picture of the effect of bfcs on a42 aggregation , native gel electrophoresis / western blotting analysis and tem were employed in order to characterize in more detail the various a42 species formed during these aggregation studies . as such , the a42 peptide forms well - defined a42 fibrils , as confirmed by tem ( figure 7 , panel 1 ) , while a42 aggregation in the presence of cu shows the formation of a dramatically reduced number of a42 fibrils ( figure 7 , panel 2 ) , thus supporting the low tht fluorescence intensity observed above . by comparison , aggregation of a42 in the presence of znleads to the formation of large amorphous aggregates ( figure 7 , panel 3 ) . native gel / western blotting analysis shows that aggregation of a42 in the absence of metal ions also forms high - molecular - weight oligomers , along with the insoluble aggregates that are observed at the top of the blot because they do not enter the gel ( figure 7 , lane 1 ) . as reported previously , the presence of cu ions inhibits the formation of large soluble and insoluble a42 aggregates ( figure 7 , lane 2 ) . normalized tht fluorescence of the inhibition of a fibrillization , measured upon incubaton at 37 c for 24 h. samples are as indicated on top of the lanes ( pbs ; [ a ] = 25 m ; [ m ] = 25 m ; [ compound ] = 50 m ) . top : tem images of the inhibition of a42 aggregation by l1 and l2 , in the presence or absence of metal ions ( [ a42 ] = [ m ] = 25 m ; [ compound ] = 50 m ; pbs , 37 c , 24 h , scale bar = 500 nm ) . panels and lanes are as follows : ( 1 ) a42 ; ( 2 ) a42 + cu ; ( 3 ) a42 + zn ; ( 4 ) a42 + l1 ; ( 5 ) a42 + l1 + cu ; ( 6 ) a42 + l1 + zn ; ( 7 ) a42 + l2 ; ( 8 ) a42 + l2 + cu ; ( 9 ) a42 + l2 + zn ; ( 10 ) mw marker . the presence of either l1 or l2 in the absence of metal ions does not seem to significantly inhibit a42 aggregation , although some morphological changes were observed for the a42 fibrils ( figure 7 , panels 4 and 7 ) ; the observed decrease in the tht fluorescence intensity may thus be due to these morphological changes of the a42 aggregates . native gel / western blotting analysis reveals a limited effect of l1 and l2 on a42 aggregation ( figure 7 , lanes 4 and 7 ) . interestingly , the presence of either l1 or l2 has a dramatic effect on the cu - mediated oligomerization of a42 and promotes the formation of larger a42 aggregates , as observed by tem ( figure 7 , panels 5 and 8 ) . importantly , native gel / western blotting analysis reveals bands at the top of the gel , suggesting the presence of insoluble a42 aggregates ( figure 7 , lanes 5 and 8 ) , which were not observed in the presence of cu alone ( figure 7 , lane 2 ) . thus , compounds l1 and l2 reduce the amount of soluble a42 oligomers formed in the presence of cu by promoting the formation of insoluble a42 aggregates . in addition , the presence of either l1 or l2 does not dramatically affect the formation of insoluble a42 aggregates in the presence of zn ( figure 7 , panels 6 and 9 ) , which is supported by native gel / western blotting analysis showing no formation of high - molecular - weight soluble a42 oligomers , although insoluble aggregates are observed at the top of the gel ( figure 7 , lanes 6 and 9 ) . overall , these studies suggest that the presence of either l1 or l2 , in both the presence or absence of metal ions , does not promote the formation of soluble a42 oligomers . because the soluble a42 oligomers are the most neurotoxic species , these compounds are expected to control the neurotoxicity of a42 species in the presence of metal ions ( vide infra ) . although it was shown in previous studies that the a42 peptide is more prone to form neurotoxic soluble a oligomers than the a40 peptide , we have also investigated the effect of l1 and l2 on the metal - mediated aggregation of a40 . tem analysis shows that a40 forms well - defined fibrils either in the absence or presence of l1 or l2 ( figure s9 in the si , panels 1 and 4 ) . importantly , the presence of cu and zn does not inhibit a40 aggregation , yet they change the morphology of the insoluble aggregates that become more amorphous ( figure s9 in the si , panels 2 and 3 ) . moreover , in the presence of cu and either l1 or l2 , a small amount of a40 fibrils are still formed ( figure s9 in the si , panels 5 and 8 ) , while the presence of zn and either l1 or l2 leads to the formation of a larger amount of fibrillar or amorphous aggregates , respectively ( figure s9 in the si , panels 6 and 9 ) . the tem results are also supported by native gel electrophoresis / western blotting analysis ( figure s10 in the si ) , although this is less informative than in the case of the a42 peptide because of the lack of formation of an appreciable amount of soluble a oligomers under any experimental conditions . therefore , because we are particularly interested in evaluating the role of metal ions and bifunctional compounds in controlling the formation of the neurotoxic soluble a oligomers , the a42 peptide was employed in the additional studies described below . the effect of l1 and l2 on preformed a42 fibrils was also investigated in both the absence and presence of metal ions ( scheme 3 ) . for disaggregation studies , a42 fibrils were prepared by incubation for 24 h at 37 c , in both the presence and absence of metal ions . then , l1 or l2 was added and further incubated for an additional 24 h at 37 c . tem and native gel electrophoresis / western blotting characterization was performed on all of these samples . first , either l1 or l2 in metal - free conditions does not disaggregate the preformed a42 fibrils to an appreciable extent . only some morphological changes were observed even after 24 h of incubation , and a significant amount of a42 aggregates were still observed by tem ( figure 8 , panels 4 and 7 ) . native gel electrophoresis / western blotting analysis reveals high - molecular - weight soluble a42 species and insoluble aggregates , although to a lesser extent in the presence of l1 ( figure 8 , lanes 4 and 7 ) . in the presence of cu , either l1 or l2 partially inhibits the cu - promoted formation of small soluble aggregates and allows for enhanced a42 aggregation ( figure 8 , panels 5 and 8 vs panel 2 ) . this is supported by native gel / western blotting , which shows that while there is a slightly increased amount of low - molecular - weight ( 1080 kda ) soluble a42 species , more insoluble aggregates are also observed at the top of the gel ( figure 8 , lanes 5 and 8 ) . in the presence of zn , either l1 or l2 seems to have a limited effect on the morphology of the insoluble a42 aggregates , as observed by both tem and western blotting ( figure 8 , panels / lanes 6 and 9 ) . overall , all of these in vitro studies suggest that compounds l1 and l2 should control the formation of cu - stabilized soluble a42 species and thus should control their neurotoxicity ( vide infra ) . top : tem images of the disaggregation of a42 aggregation by l1 and l2 , in the presence or absence of metal ions ( [ a42 ] = [ m ] = 25 m ; [ compound ] = 50 m ; pbs , 37 c , 24 h for fibrilization and an additional 24 h for disaggregation , scale bar = 500 nm ) . panels and lanes are as follows : ( 1 ) a42 ; ( 2 ) a42 + cu ; ( 3 ) a42 + zn ; ( 4 ) a42 + l1 ; ( 5 ) a42 + l1 + cu ; ( 6 ) a42 + l1 + zn ; ( 7 ) a42 + l2 ; ( 8 ) a42 + l2 + cu ; ( 9 ) a42 + l2 + zn ; ( 10 ) mw marker . a species have been shown to be neurotoxic , the development of metal - binding compounds that control the metal - dependent a toxicity is desired . in this regard , the effect of l1 and l2 on the a42 neurotoxicity in n2a cells was investigated using an alamar blue cell viability assay . first , we examined the toxicity of both l1 and l2 along with ethylenediaminetetraacetic acid ( edta ) and cq at various concentrations ranging from 0.2 to 20 m ( figure s11 in the si ) . both l1 and l2show no appreciable cell toxicity ( 80 % cell survival ) even up to 20 m concentration . by comparison , the clinically tested compound cq was quite toxic to cells even at 2 m concentration , while edta does not show any toxicity up to 20 m . for the preformed a42 fibrils , no significant cell toxicity was observed in either the absence or presence of cu ( figure 9 , lanes 1 and 2 ) , supporting the previously reported diminished toxicity of a42 fibrils . moreover , compounds l1 and l2 do not affect the cell viability when added to the n2a cells in the presence of preformed a42 fibrils ( figure 9 , lanes 3 and 4 ) . even in the presence of preformed a42 fibrils and cu , the cell viability is not affected by either l1 or l2 ( figure 9 , lanes 5 and 6 ) . by contrast , cq shows quite high cell toxicity to cells in the presence of cu and a42 fibrils with a cell survival of only 263 % ( figure 9 , lane 7 ) . thus , these cellular toxicity data suggest that l1 and l2 do not lead to any cell toxicity in the presence or absence of a42 fibrils and cu ions , suggesting that these compounds do not disaggregate a42 fibrils to generate neurotoxic soluble a42 species . as shown previously , the preformed soluble a42 oligomers show a limited cell survival of 456 % ( figure 9 , lane 8 ) . also , we have shown previously that while cu by itself is not toxic to n2a cells , the presence of cu and either monomeric a42 or soluble a42 oligomers exhibits enhanced cell toxicity . however , the addition of either l1 or l2 to the n2a cells along with the preformed a42 oligomers drastically reduces the neurotoxicity of soluble a42 species to 10015 % and 10315 % cell viability , respectively ( figure 9 , lanes 9 and 10 ) . even in the presence of cu , which has been shown to stabilize the soluble a42 oligomers , l1 and l2 were able to eliminate the neurotoxicity of soluble a42 oligomers ( figure 9 , lanes 9 and 10 ) . these results are particularly exciting because , to the best of our knowledge , these are the first bfcs that reduce the toxicity of soluble a42 oligomers , in both the presence or absence of cu ions . these bfcs thus represent promising lead compounds for the development of potential therapeutic agents that can control the metal - mediated neurotoxicity of soluble a42 species in ad and are currently the focus of our ongoing in vivo studies . cell viability ( % dmso control ) of n2a cells determined by the alamar blue assay , upon incubation with ( 1 ) a42 fibrils , ( 2 ) a42 fibrils + cu , ( 3 ) a42 fibrils + l1 , ( 4 ) a42 fibrils + l2 , ( 5 ) a42 fibrils + cu + l1 , ( 6 ) a42 fibrils + cu + l2 , ( 7 ) a42 fibrils + cu + cq , ( 8 ) a42 oligomers , ( 9 ) a42 oligomers + l1 , ( 10 ) a42 oligomers + l2 , ( 11 ) a42 oligomers + l1 + cu , and ( 12 ) a42 oligomers + l2 + cu . conditions : [ compound ] = 20 m ; [ cu ] = 20 m ; [ a42 ] = 20 m . the t - test analysis reveals values of p 0.001 for the pairs of data sets marked with asterisks . in summary , two small bfcs , l1 and l2 , were developed to specifically target the interactions of cu and zn ions with the a42 peptide and to control the formation of neurotoxic soluble a42 oligomers . the bifunctionality of l1 and l2 ( i.e. , metal chelation and a interaction ) was established through various spectroscopic studies such as spectrophotometric titrations , structural characterization , and fluorescent assays . we have previously shown that bfcs , which have high affinity for both metal ions and a fibrils , can cause significant oligomerization via disaggregation of a42 fibrils and lead to enhanced neurotoxicity . however , the bfcs described herein bind to metal ions and a fibrils only with moderate affinity and are having the desired opposite effect of promoting fibrillization of cu - stabilized soluble a42 oligomers , and most importantly they drastically reduce the neurotoxicity of soluble a42 species , in both the presence or absence cu ions . because , to the best of our knowledge , these bfcs are the first to control the metal - mediated neurotoxicity of a42 oligomers , l1 and l2 are promising lead compounds for the development of chemical agents that can control the neurotoxicity of soluble a42 species in ad .\noutput:\n" }, { "from": "agent", "value": "multifunctional metal chelators that can modulate the amyloid ( a ) peptide aggregation and its interaction with metal ions such as copper and zinc hold considerable promise as therapeutic agents for alzheimer s disease ( ad ) . however , specific rather than systemic metal chelation by these compounds is needed in order to limit any side effects . reported herein are two novel small bifunctional chelators , 2 - [ 2 - hydroxy - 4 - ( diethylamino ) phenyl ] benzothiazole ( l1 ) and 2 - ( 2 - hydroxy -3-methoxyphenyl ) benzothiazole ( l2 ) , in which the metal - binding donor atoms are integrated within a molecular framework derived from the amyloid - binding fluorescent dye thioflavin t ( tht ) . the metal - binding properties of l1 and l2 were probed by ph spectrophotometric titrations to determine their pka values and the corresponding metal complex stability constants , and the isolated metal complexes were structurally characterized . the amyloid - fibril - binding properties of l1 and l2 were investigated by fluorescence titrations and tht competition assays . interestingly , l1 and l2 do not lead to the formation of neurotoxic a42 oligomers in the presence or absence of metal ions , as observed by native gel electrophoresis , western blotting , and transmission electron microscopy . in addition , l1 and l2 were able to reduce the cell toxicity of preformed a42 oligomers and of the copper - stabilized a42 oligomers . given their ability to reduce the toxicity of soluble a42 and cu - a42 species , l1 and l2 are promising lead compounds for the development of chemical agents that can control the neurotoxicity of soluble a42 species in ad ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cardiovascular - related diseases are the most serious threat to human health that authorities will have to manage worldwide . all of these pathological outcomes , like stroke , thrombosis , or infarction , are pathological events resulting from the long - lasting and silent process , known as atherosclerosis . atherosclerosis is considered to be a multifactorial pathology where preferential zones within the arteries , such as branches and curvatures , are prone to differential expression of genes with a proatherosclerotic profile , serving as potential substratum for lesions when risk factors are introduced . in this senseepigenetics , defined as the structural adaptation of chromosomal regions so as to register , signal , or perpetuate altered gene activity states might play a significant role in the pathogenicity of cardiovascular risk factors , which could explain the specificity in the establishment and further development of the atherosclerotic lesion . atherosclerosis is a progressive disease characterized by the accumulation of lipids and fibrous elements in susceptible zones in the large and medium arteries . normal arteries are characterized by one internal or luminal surface of nonadherent endothelial cells ( ecs ) over a layer of extracellular matrix ( ecm ) , mainly formed by collagen and proteoglycans , followed by a media layer of smooth muscle cells ( smc ) and an external adventitia layer . diverse stimuli , such as hypercholesterolemia , smoking , or hypertension , lead to a pathological activation of ec , attracting blood monocytes into the intima layer , where they differentiate into macrophages in order to remove cholesterol accumulated in this layer . monocyte chemoattractant protein - 1 ( mcp - 1 ) appears responsible for the direct migration of monocytes into the intima at sites of lesion formation , and macrophage colony - stimulating factor ( m - csf ) contributes to the differentiation of monocytes into macrophages , while vascular cell adhesion molecule - 1 ( vcam - 1 ) expressed earlier on endothelial surface binds monocytes and t lymphocytes . the by - products of cholesterol - loaded macrophages attract other immune cells and promote the phenotypic switching of smc , transforming them from a contractile to aearly atherosclerotic lesions can be found even in the fetal aorta , enhanced greatly by maternal hypercholesterolemia . in eukaryotes , the protection and packaging of the genetic material are largely performed by the histone proteins , which also offer a scaffold for regulating processes such as transcription , replication , and repair of dna . chromatin , the dna - nucleosome polymer , is a dynamic molecule existing in many configurations between heterochromatin , highly compacted and silenced chromatin , and euchromatin , transcriptionally active open chromatin . the basic chromatin unit or nucleosome consists of a protein octamer containing two molecules of each canonical histone ( h2a , h2b , h3 , and h4 ) , around which is wrapped 147 base pairs of dna ( figure 1 ) . nucleosomes may be irregularly packed and fold into higher - order structures that occur in diverse regions of the genome during cell - fate specification or in distinct stages of the cell cycle . the arrangement of nucleosomes can be altered by covalent modification of histones , which can include acetylation , methylation , phosphorylation , ubiquitination , and sumoylation . posttranslational modifications of these proteins are facilitated by different enzymes , whose activities are regulated by other specific modulators . although the enzymes involved in histone modifications are sequence - specific surrounding the target amino acid residue , it is widely believed that they may possess substrates outside the histone molecules . acetylated - lysines in histone 3 ( h3 ) and histone 4 ( h4 ) associated with active transcription are the result of the interplay between histone acetylases and deacetylases ( figure 2 ) . histone acetyltransferase ( hat ; ec 2.3.1.48 ) catalyzes the transfer of an acetyl group from acetyl - coa to specific lysines in histone . transcription coactivators , like p300 / creb - binding protein ( pcaf ) , display acetyltransferase activity . histone deacetylase ( hdac ; ec 3.5.1.98 ) comprises a range of isoenzymes responsible for catalyzing the removal of acetyl groups from lysine residues of histones . they are classified as class i , ii , or iii according to homologous sequence domains . hdac activity is inhibited by butyrate , trichostatin a ( tsa ) , and suberoylanilide hydroxamic acid ( saha ) , with the list of hdac inhibitors growing due to the increasing interest in their effects in a clinical setting as anticancer drugs . tsa is the most potent hdac inhibitor known to date and is frequently used in studies on the role of histone acetylation in gene expression . although it has been approved the use of some hdac inhibitors in cancer therapy , the major concern is their lack of specificity . the lysine residue modified can be mono - , di - , or trimethylated and , depending on the position in the histone chain , methylated lysines are associated with transcriptional activation or gene suppression .2.1.1.43 ) catalyzes the transfer of a methyl group from s - adenosyl - l - methionine to a lysine residue either on h3 or h4 , while histone demethylases eliminate methyl groups . on the other hand , dna itselfcan be modified covalently by methylation at the cytosine residue of cpg dinucleotides , which commonly leads to suppression of gene expression when occurring in a regulatory region . dna methylation at the promoter region can control gene transcription by recruiting methylcytosine - binding proteins ( mbps ) which recognize methylated dna sequences . thus , dna methyltransferases ( dnmt , ec 2.1.1.37 ) catalyze the transfer of methyl groups to dna from s - adenosylmethionine ( sam ) . dnmt can be grouped into four distinct families based on sequence homology within their c - terminal catalytic domains : dnmt1 , dnmt2 , and dnmt3 families and the chromomethylase family , unique to the plant kingdom . in mammals , dnmt1 is the maintenance methyltransferase , which preferentially methylates hemimethylated double - stranded dna , whereas dnmt3 is known as the de novo methyltransferase , which methylates unmethylated or hemimethylated double - stranded dna . the mammalian genome encodes two functional cytosine methyltransferases of the dnmt3 family , dnmt3a and dnmt3b , and a third homologue , dnmt3l , which lacks cytosine methyltransferase activity and functions as a regulatory factor in germ cells . dnmt3a and dnmt3b are expressed in a range of adult tissues but at lower levels than dnmt1 . more than one hundred atherosclerosis - related genes have been discovered through different approaches such as genetically modified organisms ( apoe or ldl receptor knockout mice ) or nutritional overload ( fat - feeding ) . many of the genes encode for coagulation factors , apolipoproteins and lipoprotein receptors , the blood pressure axis , ecm proteases , and inflammatory modulators , among others . however , the establishment of a proatherogenic profile is strongly correlated with the presence of one or more risk factors , including cholesterol , homocysteine , oxidative stress , and diabetes . the molecular effects of these risk factors on ec , smc , and monocyte / macrophages have been widely studied ; however the study of the effects on histone or dna modifications is still growing . the causal relationship between hypercholesterolemia and atherosclerosis was identified over 100 years ago , but evidence was not clear enough to be considered by physicians until three or four decades ago ( reviewed in ) . the discovery of the plasma cholesterol - carriers ( i.e. , lipoproteins ) and the association of different kinds of lipoproteins with cardiovascular disease development was a major milestone in the atherosclerosis research field . thus , both elevated low - density lipoprotein ( ldl ) and reduced high - density lipoprotein ( hdl ) lead to an enhanced risk of coronary heart disease . a comparative evaluation of the two risk factors in the atherosclerosis risk in communities ( aric ) study supports the idea that the degree of coronary risk is similarly affected by high ldl - c and low hdl - c . in an in vivo model , alkemade et al . demonstrated that both in utero programming and diet - induced hypercholesterolemia affected histone methylation modifications and expression of accompanying lysine methyltransferases in vascular ec and smc , in 20 - week old female apoe mouse offspring from apoe and wild - type mothers.furthermore , these epigenetic modifications were different in each cell type , which suggest cell - specific epigenetic effects in response to a similar stimuli . homocysteine is a nonessential sulfur - containing amino acid involved in methionine metabolism that has been gaining greater interest during the last four decades due to its association with cardiovascular diseases . the pathogenetic mechanism for hyperhomocysteinemia is complex , since it requires the coexistence of genetic defects of the enzymes in the homocysteine - methionine metabolic pathway and a disturbed nutritional state regarding folic acid , vitamin b12 , and vitamin b6 , which act as cofactors of the enzymes regulating the metabolism of homocysteine . hyperhomocysteinemia has been associated with a global reduction in genomic dna methylation , as well as a downregulation of the intracellular sam / s - adenosylhomocysteine ( sah ) ratio , which is a marker of the methylation status of the cell . in addition , an increase in dnmt3a and dnmt3b has been reported in smc as a compensatory mechanism , since sah inhibits sam - dependent methyltransferases . dna hypomethylation has been found on the cyclin a promoter of ec in the presence of 50 um homocysteine , which leads to decreased binding of mecp2 and increased binding of acetylated h3 and h4 to the cyclin a promoter in ec . on the other hand , some critical promoter regions , such as ppar and ppar , undergo cytosine methylation when human monocytes are incubated with higher levels of homocysteine . t cells , monocytes - macrophages , and chemokines are the immune components involved in the formation of the atherosclerotic lesion . thus , binding of monocytes to ec and smc represents a key step in the pathogenesis of inflammation and atherosclerosis as well as antigen presentation by macrophages to t lymphocytes . most of the cytokines and chemokines are regulated by the nuclear factor kappa b transcription factor ( nfb ) . nfb in the latent form exists in the cytoplasm of unstimulated cells comprising a transcriptionally active dimer bound to an inhibitor protein , ikb . the currently known subunit members of the nfb family in mammals are p50 , p65 ( rela ) , c - rel , p52 , and relb . chromatin modifications , such as histone lysine acetylation and arginine methylation , are key regulators of nfb activity . p65 protein is a key transcriptionally active component of nfb whose transactivation potential is enhanced by several coactivators , including pcaf and src1 , which have histone acetyltransferase activity , and carm1 , which has arginine methyltransferase activity . monomethylation of h3k4 ( active transcription marker ) by the histone methyltransferase set7 can regulate the expression of a subset of key nfb downstream proinflammatory genes , such as mcp - 1 and il - 8 , by interacting with nfb and modulating chromatin remodeling events at their promoters . set7 short hairpin ( sh ) rna blocked the expression of proinflammatory genes in hek - 293 cells , as well as thp - 1 monocytes . set7 may therefore act as a novel coactivator of proinflammatory genes , opening the chromatin for enhanced transcription of a subset of nfb - dependent genes in diseases , such as atherosclerosis and diabetes . the oxidation - reduction state of the cells is usually a balance between the generation of reactive oxygen species ( ros ) and the specific molecular mechanisms to remove them . once this equilibrium is in favor of higher levels of ros , it is a condition known as oxidative stress . ros include superoxide anion ( o2 ) , hydrogen peroxide ( h2o2 ) , hydroxyl radical ( oh * ) , hypochlorous acid ( hocl ) , nitric oxide ( no ) , and peroxynitrite ( onoo ) . ros can be generated in a variety of cell types , including smc , ec , and mononuclear cells , and they are produced by various oxidase enzymes , including nicotinamide - adenine dinucleotide phosphate ( nadph ) oxidase , xanthine oxidase , uncoupled endothelial no synthase ( enos ) , cyclooxygenase , glucose oxidase , and lipoxygenase , as well as via mitochondrial electron transport . cells also have antioxidant mechanisms to protect themselves from the burden of ros , such as superoxide dismutase ( sod ) , glutathione peroxidase ( gpx ) , and catalases . enhanced oxidative stress has been shown to be an exacerbating factor in pathologies including inflammation , reperfusion injuries , and ageing . uncoupling of enos in the endothelium may lead to oxidative stress and endothelial dysfunction via numerous mechanisms . firstly , the enzymatic production of no is diminished , allowing the radicals that it normally might react with to attack other cellular targets . finally , it is likely that enos can become partially uncoupled , such that both o2 and no are produced simultaneously . under these circumstances , enos may become a peroxynitrite generator , leading to a dramatic increase in oxidative stress . oxidation of ldl ( oxldl ) produces minimally modified ldl , which has been involved in promotion of proatherosclerotic pathways . stimulation of huvecs with oxldl time dependently induced global , as well as specific il - 8 and mcp - 1 promoter acetylation of h4 and phosphorylation / acetylation of h3 at ser - 10 / lys - 14 , probably via the lox - 1 / erk1 / 2 signaling pathway . preincubation of cells with statins blocked oxldl - related modification of h3 ( ser - 10 / lys - 14 ) as well as h4 . these posttranscriptional modifications were accompanied by recruitment of nfb p65 / rela and rna polymerase ii to the promoters . in addition , exposure of vascular smcs to oxidative stress results in repression of the insulin - like growth factor 1 receptor ( igf1r ) , key receptor in the survival of many cells , as a result of epigenetic modifications involving the phosphorylation of p53 and its increased association with hdac1 . the hyperglycemia associated with diabetes can lead to modifications of macromolecules , for example , ldl , by forming advanced glycation end products ( age ) , which can bind to surface receptors , such as rage ( receptor for ages ) . these age - modified proteins can augment the production of proinflammatory cytokines and other inflammatory pathways . the diabetic state also promotes oxidative stress and hyperglycemia , which increases the expression of mcp - 1 in ec and smc . moreover , it has been shown that high glucose levels promote foam cell formation , not only in macrophages but also in human cultured smc . inflammatory pathway activation in ec and smc by high glucose levels has been related to epigenetic modifications , and these modifications persisted after the return of the ec to physiological levels of glucose . the study of the epigenetic profile associated with proatherogenic gene activation or silencing in the vasculature may be complicated by the many distinct cell types involved in the process , as well as their genetic background , not to mention dietary and other environmental factors that could be involved ( figure 3 ) . dna methylation is an important epigenetic mechanism that selectively regulates gene expression and is associated with cardiovascular disease . specific changes in dna methylation pattern occur prior the appearance of vascular lesions in apoe mice , particularly in the aorta and circulating inflammatory cells . the estrogen receptors and ( er and er ) are steroid hormone receptors that can act as transcription factors , both in vascular and nonvascular cells . er and er are important candidate genes to study epigenetic changes in atherosclerosis and vascular ageing as they have classical cpg islands in their promoter region , which can potentially modulate estrogenic cardiovascular protective effects . hypermethylation of er was observed in senescent vascular ec and smc as well as in atherosclerotic lesions . choi et al . showed that tsa markedly exacerbated atherogenesis in hyperlipidemic mice , but without changing plasma lipid profiles . in addition , expression of mrnas encoding cd36 , sra , tnf - alpha , and vcam - 1 was significantly elevated in aortic homogenates , although expression of mcp - 1 , il - 6 , and il - 1 mrna was decreased . furthermore , the expression of cd36 and the uptake of oxldl were increased in a mouse monocyte - macrophage cell line incubated with 1 to 10 ng / ml of tsa . hdac2 is implicated in the transcriptional inactivation of class ii transactivator ( ciita ) , the transcriptional factor responsible for collagen promoter repression ( col1a2 ) in smc and activation of major histocompatibility complex ll ( mhcii ) promoter in macrophages and smc , in response to ifn - . hdac2 interacts with and deacetylates ciita , targeting it to proteasomal degradation , and antagonizing the transcriptional activity in macrophages and smc . therefore , hdac2 may delay the atherogenic process by blocking t - cell activation and stabilizing the atherosclerotic plaque . hdac3 expression is upregulated in ec in areas close to branch openings where there is disturbed flow . hdac3 knocked down in ec had a dramatic effect in vitro on ec morphology and survival , probably through interaction with akt . an in vivo mouse aortic isograft model was used to study the effect of hdac3 , and it confirmed a prominent role for the deacetylase enzyme in maintaining the integrity of the vessel . moreover , hdac3 sirna decreased the expression of vcam - 1 in endothelial cells and the adhesion of monocytes . in steady laminar flow experiments , phosphorylation of hdac5 was stimulated both in huvec and bovine aortic ec . this phosphorylation was ca2 + / calmodulin dependent and also promoted the export of hdac5 from the nucleus to the cytoplasm . the translocation of this hdac released the transcriptional factor mef2c , which could induce the expression of kruppel like factor 2 ( klf2 ) , considered as an atheroprotective transcription factor . given that epigenetics could represent the link between phenotype and genotype , it may be feasible to manipulate the epigenetic marks targeting the enzymes responsible for them to treat or prevent atherosclerosis , or at very least these biomarkers could be used as a measure of individual susceptibility to a given complication . there is evidence that each of the major risk factors linked to the atherosclerotic process has some degree of influence on the modulation of epigenetic tags that can be found on the promoter regions of transcription factors involved in the atherosclerotic process ( i.e. , nfb ) . it is the subsequent promotion or repression of transcription that controls expression of downstream genes in the associated pathway . further studies should be directed both to the activation of protective genes in ec and / or smc in sensitive zones of the vascular tree and the development of gene - specific silencing therapy through the regulation of cellular epigenetics .\noutput:\n" }, { "from": "agent", "value": "hypercholesterolemia , homocysteine , oxidative stress , and hyperglycemia have been recognized as the major risk factors for atherogenesis . their impact on the physiology and biochemistry of vascular cells has been widely demonstrated for the last century . however , the recent discovery of the role of epigenetics in human disease has opened up a new field in the study of atherogenic factors . thus , epigenetic tags in endothelial , smooth muscle , and immune cells seem to be differentially affected by similar atherogenic stimuli . this paper summarizes some recent works on expression of histone - modifying enzymes and dna methylation directly linked to the presence of risk factors that could lead to the development or prevention of the atherosclerotic process ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cri - du - chat syndrome , or \" cat - cry syndrome , \" is due to a large deletion of the terminal short arm of chromosome 5 . characteristic clinical manifestations of this syndrome are cat - like high - pitched cries , psychomotor retardation , microcephaly and hypertelorism . cri - du - chat syndrome is a rare genetic abnormality , and to the best of our knowledge , the associated neuroradiological findings are rarely being reported . we herein report brain abnormalities observed in mri of a 1 - year - old girl with cri - du - chat syndrome . a girl aged 1 year and 4 months was admitted for evaluation of psychomotor retardation and an operation for exotropia . she was born at term ( gestational age : 40 weeks ) by cesarean delivery after an uneventful pregnancy , and was the first child of healthy , unrelated parents . she was able to sit unassisted but unable to stand ; her developmental characteristics lagged behind for the normal chronologic age . on neurologic examination , she had left leg hypotonia , with normal tendon reflexes and normal cranial nerve signs . when she was 6 months old , the ventricular septal defect was detected by echocardiography . chromosome analysis revealed 46 , xx , del ( 5 ) ( p15 .2 ) one month after delivery , resulting in a diagnosis of 5p - syndrome . when the patient was 1 - year - old , mri revealed brain stem hypoplasia ( most prominently in the pons ) , with normal cerebellum , diffuse mild atrophy of the deep white matter of both cerebral hemispheres , as well as mild thinning of the corpus callosum and mega cisterna magna . the anterior limb of the internal capsules on both sides showed reduced myelination , which decreased as compared to normal myelination patterns for 1 - year - old infants ( fig . neuroradiological findings , particularly mri findings , regarding cri - du - chat syndrome are rarely being reported . currently , there are only six studies reporting mr features of its associated brain abnormalities ( 1 - 6 ) . in our case , the mri revealed hypoplasia of the brain stem , which was most prominent in the pons . reported neuroradiological findings are mainly brain stem atrophy ( with predominant pontine involvement ) , with or without cerebellar atrophy ( 1 - 6 ) . other associated findings were thinning ( or agenesis ) of the corpus callosum , mega cisterna magna , fourth ventricle enlargement , lateral ventricle dilatation , cerebellar vermian atrophy ( or agenesis ) , cerebellar cortical thickening and incompleted arborization of white matters ( 1 - 6 ) . our case showed hypoplasia of the brain stem ( prominent in the pons ) with normal cerebellum , diffused mild atrophy of the deep white matter in both cerebral hemispheres , mild thinning of the corpus callosum and mega cistern magna . pontine hypoplasia was the most common finding and was sometimes associated with cerebellar hypoplasia , microcephaly , and corpus callosum anomalies . cri - du - chat syndrome was one cause of brain stem hypoplasia . according to previous case reports , including our case , supratentorial abnormalities such as atrophic changes in cerebral white matter and corpus callosumatrophy are often accompanied by pontine hypoplasia and could be explained as secondary changes resulting from brain stem hypoplasia ( 1 - 6 , 7 ) . some reports have described skull base malformations and their relationships to brain stem hypoplasia in this syndrome . in a report of skull base malformation in 23 patients with cri - du - chat syndrome , sella turcica and clivus malformations and reduced cranial base angles were described ( 8 ) . the authors suggested that derangements during notochord developments around the specific cranial base region , from ventral neuron migration to the larynx and dorsal development of the rhombencephalic - derived brain stem , pons , and cerebellum , are related to malformations of the cranial base - brain stem and laryngeal region resulting in high - pitched cries in patients with cri - du - chat syndrome . although brain mri findings of cri - du - chat syndrome are rarely reported , the most common finding was pontine hypoplasia according to previous case reports , as well as our current report ( 1 - 6 ) . we suggested that cri - du - chat syndrome should be included in a differential diagnosis of brain stem hypoplasia for children with a history of high - pitched cries .\noutput:\n" }, { "from": "agent", "value": "cri - du - chat syndrome , also called the 5p - syndrome , is a rare genetic abnormality , and only few cases have been reported on its brain mri findings . we describe the magnetic resonance imaging findings of a 1 - year - old girl with cri - du - chat syndrome who showed brain stem hypoplasia , particularly in the pons , with normal cerebellum and diffuse hypoplasia of the cerebral hemispheres . we suggest that cri - du - chat syndrome chould be suspected in children with brain stem hypoplasia , particularly for those with high - pitched cries ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: accessory spleens result from the failure in the fifth week of foetal life of groups of mesodermal cells in the dorsal mesogastrum . they are relatively common , with an autopsy study involving 3000 patients identifying 364 accessory spleens , of which 61 were found in the pancreatic tail . whilst the pancreatic tail and the splenic hilum are the most common sites , accessory spleens can be found in the stomach , jejunum , mesentery as well as the ovaries and testis . despite being common , accessory spleens themselves have no clinical consequence unless a patient suffers from a disease like idiopathic thrombocytopaenic purpura . however , as they are commonly mistaken for tumours , patients undergo needless operations for removing the lesion . consequently , it is important to accurately differentiate an accessory spleen from other pancreatic lesions requiring more aggressive treatment . a 76 - year - old male presented to his general practitioner with nausea , weight loss and change in bowel habit . a recent colonoscopy was unremarkable , a computed tomography ( ct ) abdomen and pelvis showed a homogenously enhancing 13 - mm lesion in the tail of the pancreas , with the reported differentials including neuroendocrine tumour or a pancreatic adenocarcinoma . a subsequent magnetic resonance imaging ( mri ) illustrated the lesion enhancing homogenously in the portal venous post - contrast phase suggesting a solid neoplastic lesion , likely to be primary ( fig . 1 ) . pathology revealed a splenunculus with no evidence of malignancy ( fig . 2 ) . figure 1 : mri : small round lesion in the pancreatic tail measuring 11 cm , enhancing homogenously in the portal venous post - contrast phase suggesting a solid neoplastic lesion . the differential includes primary pancreatic lesion such as a small mucinous cystic pancreatic tumour or an islet cell tumour figure 2 : histology of the lesion showing the normal pancreas on the left with the accessory spleen on the right mri : small round lesion in the pancreatic tail measuring 11 cm , enhancing homogenously in the portal venous post - contrast phase suggesting a solid neoplastic lesion . the differential includes primary pancreatic lesion such as a small mucinous cystic pancreatic tumour or an islet cell tumour histology of the lesion showing the normal pancreas on the left with the accessory spleen on the rightpancreatic cancer was the fifth leading cause of cancer - related deaths in australia in 2010 . surgery offers the only chance of cure ; however , most patients have unresectable disease at the time of presentation . in potentially resectable disease , the high false - negative biopsy rate of 20 % and the potential complications arising from the biopsy generally discourage most surgeons from pre - operative tissue biopsy . because of thismri , ct , ultrasound scan ( uss ) and scintigraphy are all used for this purpose . ultrasound usually shows an accessory spleen as a round , mildly echogenic mass with homogenous texture and posterior enhancement . importantly , doppler uss has a sensitivity of 90 % when a vascular hilum entering the lesion is identified . also , inhomogenous enhancement due to the differing flow rates between the red and white pulp of the accessory spleen may indicate splenic tissue . during the other phases , triple - phase ct is usually performed to differentiate pancreatic lesions , and the attenuation of accessory spleens in the pancreas is usually identical to that of the spleen in all three phases . generally , this means that the splenic tissue will be brighter than the normal surrounding pancreatic tissue . in comparison , most pancreatic tumours ( including islet cell tumours ) are brighter on the arterial phase , and lower on the venous phase . pancreatic tumours share signal characteristics with that of the spleen , which makes differentiation difficult . despite this , the fact that the signal intensity ( si ) of accessory spleens is usually identical to that of the spleen can lead to the diagnosis . in rare instances , the si is different due to differing amounts of the red and white pulp in the accessory spleen . another differentiation can be found with the fact that tumours usually contain areas of haemorrhage and necrosis , which is readily demonstrated with mri . scintigraphy using tc - 99 m heat - damaged red blood cells ( hdrbcs ) is a highly specific medium used to detect accessory spleen tissue . the technique uses autologous hdrbcs which are converted into rigid spherocytes , injected and then sequestered in the spleen , as well as any functioning accessory splenic tissue . despite this , the sensitivity is poorer than other modalities as it requires a certain amount of functioning splenic tissue . endoscopic ultrasound ( eus ) with fine needle aspirate ( fna ) is increasingly used to characterize both solid and cystic lesions in the pancreas and obtain specimens for pathological diagnosis . there is minimal literature on pre - operative diagnosis of intrapancreatic accessory spleens ( ipas ) with isolated case reports of confirmation on histology and immunohistochemical staining for cd3 and cd20 to distinguish from adenocarcinoma of the pancreas . adequate sampling with confident pathological reporting may result in the avoidance of distal pancreatectomy and also of prolonged surveillance if amodern radiological techniques will lead to an increasing number of ipas identified and this poses a significant diagnostic and treatment challenge . pre - operative diagnosis based on radiological findings can be difficult and aspiration cytology can be misleading . identifyingthe ipas is very important as it can mimic either primary or secondary lesions of the pancreas which may result in an unnecessary operation with the involved risks entailed . in our case , emerging imaging modalities may have resulted in an operation being avoided with confident radiological / cytological diagnosis . emerging techniques such as eus with fna may provide confident diagnosis of ipas ; however , equivocal pathological findings will continue to lead to unavoidable operations for ipas .\noutput:\n" }, { "from": "agent", "value": "intrapancreatic accessory spleens are common asymptomatic masses that generally cause no problems . usually , they are incidentally found on imaging as a pancreatic mass and they pose a diagnostic and management dilemma due to equivocal imaging findings . evolving imaging modalities and increasing use of endoscopic ultrasound with fine needle aspirate may result in the avoidance of unnecessary operations and surveillance . we report a case of distal pancreatectomy and splenectomy for a pancreatic tail solid lesion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this retrospective study included 25 patients with idiopathic genu varum ( 50 lower limbs ) who underwent plh on the proximal lateral tibia for a varus angular deformity from 1997 to 2010 . the study was approved by the institutional review board of samsung medical center . the need for informed consentthe inclusion criteria were patients aged 16 years who underwent plh on the proximal lateral tibia for idiopathic genu varum and were followed until skeletal maturity . indications of surgery were ( 1 ) varus deviation of a mechanical axis at the knee joint level of more than 5 with a proximally migrated fibular head above the epiphysis of tibia ; ( 2 ) more than 5 cm of intercondylar distance ( icd ) in the knee joint ; ( 3 ) appropriate remaining growth of tibia on the anderson and green graph ; 5 ) and ( 4 ) normal range of mechanical lateral distal femoral angle ( mldfa ; 86 to 89 ) . five patients who did not have follow - up data until skeletal maturation were excluded . the median and interquartile range ( iqr ) of bone age at the time of surgery was 144 months ( iqr , 144 to 150 months ) and 168 months ( iqr , 168 to 174 months ) in girls and boys , respectively . the mean body mass index ( bmi ) was 18.3 kg / m ( iqr , 18.0 to 18.8 kg / m ) . the median follow - up period was 33.6 months ( range , 24 to 48 months ) .1 ) : 1 ) correctable angle = 360 { remaining growth ( cm ) } 2 { width of physis ( cm ) } the bone age was checked at the preoperative visit . subsequently , the remaining growth of tibia was calculated from the anderson and green graph .5 ) for example , a girl of 144 - month - old ( bone age ) with 10 of hip - knee - ankle ( hka ) angle has a 6 cm of physis width ; the remaining growth of tibia was 1 cm by using the anderson and green graph . finally , the result was 9.5 . we considered that the timing for operation was appropriate if the hka angle matched the calculated correctable angle by the above equation . the lower extremity was surgically prepared under general anesthesia with a pneumatic tourniquet on the operated limb . the proximal one third lateral tibia epiphyseal plate was removed with drills of increasing bit size . after thorough irrigation , we removed any bony material from the soft tissues to prevent the formation of heterotopic bone .6 ) postoperatively , patients used a cylinder splint for 1 week . preoperative and postoperative full - length hip - to - ankle radiographs were used to measure the hka angle . standing radiographs ( from the femoral head to the ankle joint ) were obtained using standard protocols . postoperative radiographs were taken at 6 weeks and every 3 months after surgery , and as required , until skeletal maturation was evident . radiographic measurements were evaluated by using a picture archiving and communications systems ( pacs ; general electric , chicago , il , usa ) monitor that computed lengths and angles automatically . the following were measured : ( 1 ) the degree of pre - and postoperative knee deformity or hka angle was determined on the standing full - length radiographs as the angle between the mechanical axis of the femur ( center of the femoral head to the center of the knee ) and the mechanical axis of the tibia ( center of the knee to the center of the ankle plafond ) 7 ) and ( 2 ) tibial growth was measured by calculating the differences of tibial length between the preoperative and final follow - up periods . tibial lengths were measured from the lowest point of the intercondylar eminence of the tibia ( tibial spine ) to the center of the ankle formed by the tibia and the fibula .8 ) we reviewed the medical records of all patients . the clinical assessment consisted of intercondylar distance and postoperative complications such as wound problems , nonunion , delayed union , leg length difference and overcorrection . icd was measured as the gap between the medial femoral condyle in keeping feet together . furthermore , we investigated secondary deformities in sagittal plane , such as procurvatum or recurvatum despite the attempts to correct the deformity in coronal plane . the percent ratio of the correction was defined as the ratio of the amount of angular correction to the preoperative angular deformity . the amount of angular correction was determined as the difference between the preoperative and final hka angles . although operation was bilateral in all patients , data were selected from right single limb for analysis to ensure statistical independency . the wilcoxon rank sum test was used to determine significant differences in angulation between the preoperative and final hka angles . the correlation between preoperative factors and the amount of angular correction with pearson correlation analysis was analyzed . all statistical analyses were carried out using ibm spss ver . 21.0 ( ibm co. , armonkthe percent ratio of the correction was defined as the ratio of the amount of angular correction to the preoperative angular deformity . the amount of angular correction was determined as the difference between the preoperative and final hka angles . although operation was bilateral in all patients , data were selected from right single limb for analysis to ensure statistical independency . the wilcoxon rank sum test was used to determine significant differences in angulation between the preoperative and final hka angles . the correlation between preoperative factors and the amount of angular correction with pearson correlation analysis was analyzed . all statistical analyses were carried out using ibm spss ver . 21.0 ( ibm co. , armonk , ny , usa ) . the amount of coronal deformity of lower limb was significantly improved , as compared to the preoperative values . the median values of the hka angle improved from 8.0 ( iqr , 7.0 to 10.0 ) preoperatively , to 3.0 ( iqr , 2.5 to 4.0 ) at the final follow - up ( p 0.001 ) . the median value of the percent ratio of the correction of the hka angle was 60.0 % ( iqr , 50.0 % to 71.4 % ) . we obtained one case with 100 % of the percent ratio of the correction ( complete correction ) and one case with 0 % of the percent ratio of the correction ( failure of correction ) . the median icd at final follow - up was 3.0 cm ( iqr , 2.0 to 3.3 cm ) and the amount of improvement was 3.0 cm ( iqr , 2.0 to 4.0 cm ) . there were significant correlations between the bone age , preoperative hka angle , growth remaining of tibia or calculated correctable angle and the actual correction angle . the correlation coefficients for the bone age , preoperative hka angle , growth remaining of tibia , and calculated correctable angle were 0.537 , 0.832 , 0.791 , and 0.685 , respectively . however , there were no significant correlations between body mass index or chronological age and actual correction angle ( p 0.05 ) ( table 2 ) . we identified one case of temporal knee joint pain and two cases of temporal hypoesthesia . there were no cases of persistent non - union of proximal tibia , wound problems , leg length differences , or other minor or transient complications . plh is a reasonable procedure with low morbidity for treating young age patients with coronal angular deformity of the knee . nevertheless , there is uncertainty regarding the degree of correction due to the individuality of patients . thus , reports on plh and the angular correction of knee joint are valuable for patient consultation and management . we accordingly investigated factors that correlated with the actual correction angle in idiopathic genu varum patients . the most important finding of the present study is that plh of the proximal tibia can achieve misalignment correction in idiopathic adolescent genu varum . our results indicated that plh performed on a proximal tibia had an approximately 60 % correction power to the coronal deformity of whole lower limbs . a previous report showed outcomes for plh of the combination of both distal femur and proximal tibia ; however , our results showed that plh performed only on the proximal tibia provided a reliable correction of angular deformity .49 ) since all our patients had normal mldfa , the normal femoral structure was not manipulated . the mean error of angular correction ( actual versus predicted ) of the genu varum deformities was 3.2 ( range , 0 to 6 ) . the correction error of our procedure was more than the results of a previous report . inan et al. 9 ) reported about 1.5 of correction error with combined plh on the distal femur and proximal tibia in idiopathic genu valgum . plh on only the proximal tibia has an expectedly weaker correction power than plh on both the distal femur and proximal tibia . plh requires an accurate calculation of the remaining growth in order to determine the exact timing of the procedure .1011 ) hemiepiphysiodesis is a challenging procedure and surgeons can not guarantee definite postoperative corrections . the inaccurate timing of surgery in plh can lead to a miscorrection of the deformity . however , although we obtained almost the exact timing window for conducting the procedure , numerous factors such as a disease of physis , and various union periods could lead to under - or over - correction of the deformity .41213 ) therefore , khoury et al. 14 ) suggested that close follow - up is a necessity . we suggest that patients undergo plh on the proximal tibia at an earlier point than that based on correctable angle . given our results , that over 80 % of the cases showed a corrective outcome greater than 50 % relative to the preoperative values , there was still an amount of residual deformity ( fig . the bone needs time for union or healing ; and this interval could be the potential cause of under - correction . however , because of the limitation of small sample size , we could not determine at what earlier time point the surgery is required , as compared to the calculated operation timing . thus , further investigation is required .6 ) in this study , we determined the correlation of surgical results with bone age , preoperative hka angle , calculated expected values of tibial growth , and angle of correction . in contrast , case no. 11 , which showed no correction , had the smallest tibial growth ( fig . these results suggested that residual growth potential and bone age are critical to the success of plh . gradual correction of genu varum is possible by temporary hemiepiphysiodesis such as stapling ,15 ) applying transphyseal screws16 ) or the eight - plate .11 ) however , permanent hemiepiphysiodesis was performed because of better outcomes in morbidity , cosmetics , and cost , as compared to temporary hemiepiphysiodesis . as noted above , plh has low morbidity because it is a less invasive method and requires short hospital stay . temporary hemiepiphysiodesis requires a second operation for hardware removal unlike plh .1 ) plh reduces not only the financial burden , but also the anesthetic risk of the patients . we did not perform plh in the patients younger than 120 months of bone age , because it is difficult to predict the remaining angular growth or determine of proper time for hemiepiphysiodesis in young patients . also , thus , in this study , surgery was not performed in patients younger than 120 months of bone age . first , it included had a relatively small number of patients and no control group . however , to the best of our knowledge , this study was conducted on the largest idiopathic genu varum patient cohort . additionally , we conducted the operation only for the tibial lesion in patients with normal femoral anatomy . we used skeletal maturation as the end point for our study for follow up in all patients . in conclusion , plh on the lateral tibia is a simple , safe and cosmetically excellent procedure for adolescent idiopathic genu varum patients . however , this operation had a limited correction effect in most of the patients . for optimum results , this surgery should be performed a few months earlier than the calculated operation time . after careful growth calculation , surgery should be performed only in patients with sufficient remaining growth .\noutput:\n" }, { "from": "agent", "value": "backgroundpercutaneous lateral hemiepiphysiodesis of the lower extremity is a simple and excellent method to correct the angular and length problems cosmetically . however , the efficacy of percutaneous lateral hemiepiphysiodesis is not well established in the literature . the purpose of this study was to evaluate the efficacy of percutaneous lateral hemiepiphysiodesis for angular corrections in adolescent idiopathic genu varum patients with proximal tibia vara and identify the factors affecting the amount of deformity correction of the lower limb in the coronal plane.methodswe retrospectively reviewed 20 patients ( 40 lower limbs ) who had percutaneous lateral hemiepiphysiodesis on the proximal lateral tibia between 1997 and 2010 . radiographic evaluations were made using ( 1 ) the hip - knee - ankle angle and ( 2 ) the length of the tibia . furthermore , the intercondylar distance was evaluated at the level of the knee joint . preoperative factors ( gender , age , body mass index , intercondylar distance , preoperative hip - knee - ankle angle , remaining growth of tibia , and calculated correctable angle ) were analyzed , as well as their correlation with the degree of the actual correction angle.resultsthe amount of coronal deformity of the lower limb was improved from its preoperative state . the median average of hip - knee - ankle angle improved from 8.0 ( interquartile range [ iqr ] , 7.0 to 10.0 ) preoperatively to 3.0 ( iqr , 2.5 to 4.0 ) at the final follow - up ( p < 0.001 ) . the median percent ratio of the angular correction was 60 % ( iqr , 50 % to 71.3 % ) . the correlation coefficients were 0.537 , 0.832 , 0.791 , and 0.685 for the bone age , preoperative hip - knee - ankle angle , the remaining growth of tibia , and calculated correctable angle , respectively.conclusionsdespite the excellent cosmetic outcome of percutaneous lateral hemiepiphysiodesis on the proximal lateral tibia in adolescent idiopathic genu varum , the effect was limited in most cases . for optimum results , surgery a few months earlier is recommended , rather than at the calculated operation time ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pain is a commonly experienced symptom among people in the community as well as in the clinical population . it leads to tremendous cost on any country 's resources in terms of health care costs , lost worker productivity , poor quality of life , as well as financial difficulty . back pain is the leading cause of disability in america under 45 year old , where 27 % experienced low back pain , 15 % severe headache or migraine pain or neck pain , and 4 % facial ache or pain . in the indian context , backache ( 25.8 % ) , headache ( 20.1 % ) , and abdominal pain due to acid peptic disease ( 12.5 % ) are the most prevalent painful conditions . female sex , age of 30 years , lack of formal schooling , smoking habit , and dependent status has higher prevalence of pain . nineteen percent of them are unable to go to work due to complaints of pain . eighty percent of the cases visited physician for consultation , those who did not seek treatment , did so because they considered health professionals could not help in reducing the distress . due to man ( m should be small ) - days , loss attributed to pain are 1.37 days / month . there is a need to explore pain complaints among the normal general population as well as the clinical group . aim : to explore pain complaints among the normal general population as well as the clinical group sample : cross - sectional design was used to include 529 subjects of 18 years and above ( 119 male and 110 female normal and 200 male and 100 female clinical subjects ) . subjects were taken from the outpatient and inpatient psychiatry setting of the hospital and person resident of bangalore , karnataka , india during 2012 and 2013 . normal group includes literate and illiterate subjects having ability to speak and read english / hindi / kannada and subject with history of nicotine use , neurological and psychiatric illness including substance use were excluded . whereas in clinical group , along with above - mentioned criteria , person seeking consultation for psychological problems including substance use were included and subjects with a history of neurological problem and language deficits were excluded . procedure : the sample for the current work has been taken from the ongoing study on development and validation of nimhans screening instrument for psychological problems . it screen anxiety , depression , obsessive - compulsive disorder , mania , psychosis , substance use , and pain in the last seven days . it is a 21 items instrument ( 3 items for each diagnosis ) for assessing psychiatric caseness in the past one week with specificity of 0.92 and sensitivity of 0.83 . socio - demographic datasheet was used to collect demographic information , and clinical group was also evaluated for psychiatric diagnosis using international classification of disease - 10 ( icd - 10 ) . five hundred and twenty nine subjects ( in the age range of 18 - 45 years ) were interviewed to identify those who report of experience of pain in the past one week and got the score of two and above were taken . sixty five percent of the subjects were in the age range from 30 - 39 years . twenty seven percent ( 16 % females and 11 % males ) reported having experienced pain in the normal group , whereas in clinical categories , 14.5 % of anxiety disorder ( 9.5 % in females and 5 % in males ) , 13.9 % of depression ( 8.9 % in females and 5 % in males ) , 17.9 % of obsessive compulsive disorder ( ocd ) ( 8.5 % in females and 9.4 % in males ) , and 13.9 % male substance users reported pain in last seven days . the barriers were observed in the form of problems can be managed by using available local ointment ( 60 % ; 35 females and 25 % males ) , use of over the counter analgesics ( 20 % ; 11 % females and 9 % males ) and by relaxing oneself ( 10 % ; 6 % females and 4 % males ) , taking off from work . ( 5 % ; 3 % females and 2 % males ) , and others ( 5 % ; 2 % females and 3 % males ) . the present work revealed that 27 % ( 16 % females and 11 % males ) reported having experienced pain in the normal group , whereas in clinical categories , 14.5 % of anxiety disorder ( 9.5 % in females and 5 % in males ) , 13.9 % of depression ( 8.9 % in females and 5 % in males ) , 17.9 % of obsessive compulsive disorder ( ocd ) ( 8.5 % in females and 9.4 % in males ) , and 13.9 % males substance users reported pain in last seven days [ figure 1 ] . the work also indicates the higher percentage of experienced complaints of pain among the general community in comparison to clinical group . it is more among females ( normal and clinical condition except ocd ) in comparison to males . low treatment - seeking behavior could be because of presence of barriers in form of using available local oilmen / use of over the counter analgesics / by relaxing oneself , and taking off from work [ figure 2 and table 1 ] .36.5 % reported complaints of pain / swelling of joints and 17.4 % with backache in a survey to assess the morbidity in the community among elderly subjects . among women , 16.8 % to 81 % had dysmenorrhea ; dyspareunia was present among 8 % to 21.8 % , and 2.1 % to 24 % experienced non - cyclical pain . people who have chronic pain are four times more likely to suffer from depression and anxiety . this study has limitations in the form of absence of information about various types of pain in the normal group , absence of assessment of affective features and its relationship with clinical psychiatric diagnosis in the clinical group ; barriers for not seeking help could have been explored further to facilitate understanding about these behaviors as well as develop plan to facilitate treatment initiation . it has implications for exploration of pattern of usages of analgesics , prevalence of pain across various age groups and gender . percentage of people reported having experienced pain in terms of gender percentage of different barriers in terms of gender percentage of barriers reported\noutput:\n" }, { "from": "agent", "value": "pain is a commonly experienced complaint in the general population . it aims to determine the occurrence of pain complaints among the general population as well as the clinical group . the sample for the current study was drawn from the ongoing study on development of nimhans screening tool for psychological problems . it includes males and females ( 119 males and 110 normal and 200 males and 100 clinical subjects ) above age 18 years . subjects were assessed on the question related to frequent experience of body ache and headache in the past one week in an individual setting . data was analyzed using percentage scores . it indicate that 27 % ( 16 % in females and 11 % in male ) experience pain in the normal group , whereas in clinical categories , 14.5 % of anxiety disorder ( 9.5 % in females and 5 % in males ) , 13.9 % of depression ( 8.9 % in females and 5 % in males ) , 17.9 % of obsessive compulsive disorder ( ocd ) ( 8.5 % in females and 9.4 % in males ) and 13.9 % of substance users reported pain in last seven days . it implies the need for sensitization among professionals and general population to identify pain complaints ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: polymethyl methacrylate ( pmma ) as denture base material has many advantages including adequate mechanical strength , esthetics , low toxicity , easiness of repair , and can be cured by simple procedures , therefore , pmma has been the most commonly used for fabricating denture base since it was developed in the mid - 1945.12 however , pmma resin also has some disadvantages as denture base , and one of these is dimensional change after processing was completed . dimensional change of denture base resin can be occurred by curing shrinkage and expansion through water absorption ,3 and other former studies stated that dimensional change would be a result of polymerization shrinkage ,45 thermal shrinkage ,46 internal stress release ,6 water absorption ,78 and dry shrinkage .9 the denture base after curing may have shrunk linearly as much as approximately 0.5 % .10 it could lead distortion of the denture , and although this shrinkage may be compensated with expansion by water absorption , this change would result in poor adaptation of the denture to its tissue , and decrease of denture stability and retention .611 concerning water absorption , some studies demonstrated that the greatest dimensional changes was occurred during the first month and no remarkable changes took place after two months .12 due to pmma denture base should be influenced by water absorption , some authors insisted that occlusal adjustment of denture would be delayed until pmma has become saturated with water .7 however , some authors researched about changes in dentures during storage in water and in service for 18 months , and concluded a posterior linear expansion of heat curing resin was less than 1.0 % and the dimensional changes did not affected the fit of denture ,8 and other studies also reported that there was no significant volumetric deformation in denture when denture was being stored in water .13 most of previous studies tried to measure deformation and accuracy of the denture 2 - dimensionally .141516 nowadays , some authors tried to investigate the dimensional stability , and it is possible to compare two objects three - dimensionally by using surface matching program and scanning device .17 it is well known that denture should be stored in the water in order to minimize distortion and shrinkage , when they are once removed from the mouth .714 however , it was not known shrinkage was occurred in certain pattern of form when denture was kept in dry condition , nor which portion of the denture should be watched carefully , if the patient who stores his denture in the air comes and want to relieve discomfort due to his denture . the purpose of this study was to evaluate whether there is any typical deformation pattern of complete denture that was stored in the air , and if any , to find out what typical pattern would be by using the 3d scanner and surface matching program . for fabricating upper and lower denture base , maxillary and mandibular edentulous models with little undercut were selected . additional silicone material ( honigum , dmg , hamburg , germany ) the silicone molds were poured with improved stone ( fujirock ep pastel yellow ; gc america inc . , alsip , il , usa ) thus total 28 master casts , including 14 maxillary and 14 mandibular models , were fabricated . after trimming the master cast , recording base with 2.0 mm thickness was made with auto - polymerizing resin ( quicky , nissin dental product , inc . , , each recording base was sit onto the corresponding cast and gap between recording base and master cast was sealed with molten baseplate wax . after waxes were washed out with boiling water , heat polymerized acrylic resin ( lucitone 199 , dentsply international inc , york , ny , usa ) was packed into the mold and polymerized for 9 hours at 72 and maintained for 30 minutes at 100 . flasks were cooled down to room temperature in the water for 12 hours . after denture base was removed from the cast , any nodule or fin edge on the denture base are carefully removed with acrylic bur . total 28 denture bases were fabricated , and 14 denture bases ( 7 upper and 7 lower denture bases ) were stored in the water bottle ( water stored ) , and another 14 denture bases were stored in the air ( dry stored ) .3 d laser scanner ( myscan specification , raphabio , seoul , korea ) , which could detect 0.02 mm difference was used for digitizing the denture base . to confirm that denture specimenwas mounted on the similar position of the scan table , silicone putty index was fabricated for each denture base specimen and each denture base was mounted with it . scanned data was saved as stereolithography ( stl ) file using data compatible program ( mydesign , raphabio , seoul , korea ) . internal surface of each specimen was scanned at 1 day , 14 day and 28 day after deflasking .3 d scan data of internal surface of denture base were categorized depending on the storage method ( w ; water storage , d ; dried storage ) , and subdivided into t1 , t2 , and t3 according to duration from deflasking to scanned time ; 1 day after deflasking , 14 day after deflasking , and 28 day after deflasking , respectively . three dimensional deformation patterns were acquired by overlapping the scanned data between t1 and t2 , t2 and t3 , and t1 and t3 of each storage group by 3d surface matching program ( geomagic qualify ; raindrop geomagic , research triangle park , nc , usa ) . before performing best - fit alignment , unnecessary portion of the imported image except internal surface was eliminated . best - fit alignment is the arranging process via matching repeatedly the closest points of corresponding images in the virtual space on the program , and permits to measure morphologic differences in form .17 in this study , 300,000 to 600,000 random points were used for this alignment . after best - fit alignment procedure , the images of t1 and t2 , t2 and t3 , and t1 and t3 within each storage group ( w and d ) were compared , and the results of surface matching in storage group w and d were named as group wa , group wb and group wc , and group da , group db and group dc , respectively , in each upper and lower denture bases . as a result ,7 color - coded maps were created in each image group ( table 1 ) . when 3d compare was conducted , the maximum and minimum nominal values were set at 0.05 mm and the maximum and minimum critical values were set at 1.0 mm . on color - coded map , positive deformation that represent internal surface of the test model ( the latter ) was located above that of the reference model ( the former ) was expressed in the red to yellow color segments and negative deformation that represent internal surface of the test model was located lower than that of the reference model was expressed in color from cyan to deep blue . for evaluating the deformation pattern in detail , cross - sectional 2 - d comparison was also performed . cross sectional view was created in med - palatal area ( sagittally ) and posterior molar area ( frontally ) . statistical analyses were performed by ibm spss ( spss v. 22 , ibm corp . , armonk , ny , usa ) . the median , inter - quartile range , the maximum and minimum values of the positive and the negative deformation were measured . for evaluating differences between groups , these data were statistically compared at 95 % significance level using kruskal - wallis test and mann - whitney u test for post hoc analysis . generally , when evaluating 3d deformation of denture base in upper denture bases major deformation pattern could not be seen in group w according to the elapse of time . also , in lower denture bases , major and repeating deformation could be seen in group d. figure 1 , 2 represent the typical case of the color - coded map of groups and shows deformation pattern of both storage groups of upper denture bases , and figure 3 , 4 represent deformation pattern of both storage groups of lower denture bases . in the water storage group , although little deformation was observed at some area of all groups , area of deformation was very small and any repeated or specific pattern was not found ( fig . 1 , fig . when compared between first 2 weeks , deformation was found in the bilateral posterior buccal flange area ( yellow ) which means decrease in distance between posterior flanges , and also found in posterior palatal seal area ( cyan ) which means negative deformation was occurred in that area . however , when compared between second 2 weeks , significant deformation pattern was reduced . therefore , results of color - coded map of subgroup mda and mdc showed similar pattern ( fig . these findings were repeatedly confirmed with results of 2 d compare procedure . in the dry - stored group of lower denture bases , more obvious deformation was observed at posterior buccal flange area ( cyan ) and buccal shelf and retromolar pad ( yellow ) than in water - stored group . result of kruskal - wallis test demonstrated that there are no significant differences in overall , positive , and negative deformation among subgroups in both maxillary and mandibular water storage group ( table 2 and table 3 ) . in the maxillary dried storage group , there were significant different between subgroups and mann whitney u test was performed . ( table 4 ) when overall deformation between subgroups was compared , significant differences were found between mda ( median : 0.040 mm ) and mdb ( median : 0.000 mm ) , and also between mdb and mdc ( median : 0.040 mm ) . when positive deformation was only concerned , statistical results were similar with that of overall deformation ( median of mda : 0.032 mm , median of mdb : 0.017 mm , median of mdc : 0.039 mm ) . however , when negative deformation was compared , there are no significant differences among subgroups . in the mandibular dried storage group , likewise , no significant difference was found in positive , negative and overall deformation among subgroups ( table 3 ) . the median , interquartile range , maximum and minimum values , of overall , positive , and negative deformation of denture bases for all groups were presented in figure 5 , and figure 6 . it is obvious that the denture fabricated with a great care would be secured to patient 's comfort , retention and stability of denture depending on the intimate contact between denture base and its basal tissue . however , to wear the denture longer and maintain good oral health , minimizing unexpected distortion of the denture is also an important factor as much as fabricating denture precisely . thus , once the denture was fabricated precisely , maintaining of its accuracy would be a key factor for the longevity of denture . pmma is the most popularly used denture base material , and heat curing resin has some advantage such as less deformation after fabrication and better color stability compared to self - cured resin . however , among various molding methods , no method is free from dimensional deformation due to polymerization contraction , heat contraction , stress deformation , and water absorption , and compression molding is still frequently applied to fabricating denture . therefore , heat - cured resin and compression molding method was utilized in this study . upon polymerization of resin , monomers contract as much as 21 vol % , so total contraction would be estimated about 5 to 7 vol % because monomers constitute 25 % of the total volume .4 in the previous study , regarding the influence of cooling time , more linear deformation was observed in fast cooling group compared to slow cooling group . the reported reasons were , inadequate time to compensate contraction by water absorption , and lack of emission of stress inside the denture base caused during curing .18 thus , this study was conducted after slowly cooling the denture bases for 24 hours in water . many previous studies were conducted for evaluating the deformation occurred in the denture base and its fitting accuracy . majority of previous studies employed optical microscope for measuring distance between landmark points of dentures , and some of those were conducted by using simple calipers .1920 these methods were limited for the overall deformation because measuring the two points was merely linear analysis . from the results and statistical analyses of this study , the fact that no significant deformation was observed during water storage resembles that of previous studies . some previous studies reported expansion was occurred during water storage due to the water absorption . expansion in the previous studies means increase in dimension , yet in this study , contraction was defined as the test surface being above the reference surface , and expansion was defined as being below the reference surface . in the study concerning the water absorption of acrylic resin , it was observed that 0.42 % of expansion was observed over 3 weeks , and it takes about 17 days to be completely saturated .21 however , when water percentage was measured with digital scale and calculated with weight ratio , water percentage of 1.66 - 1.77 mass % was observed at deflasking , and water storage increased water percentage by only 0.46 - 0.50 mass % , indicating that high water percentage was already reached at deflasking .6 in the group of upper denture bases in water storage , no significant difference according to the storage period was observed . as the result from color - coded maps of overlapping week 0 , 2 , and 4 , no significant changes could be observed . this could suggest that after the procedure of flasking , curing , deflasking , cooling , denture bases were already saturated with water that water storage after deflasking had no big influence on dimensional deformation since movement of water molecules is ignorable . in the group of upper denture bases in dry storage , week 0 and 2 showed significantly big difference in positive deformation ( p = .026 ) and overall deformation ( p = .011 ) compared to those of week 2 and 4 , and week 0 and 4 also showed significant difference in positive deformation ( p = .007 ) and overall deformation ( p = .038 ) compared to those of week 2 and 4 . this was the result of evaporation of water diffused into resin molecules , and more deformation took place during the first two weeks , indicating that most of the contraction occurred at that time . it can be said that deformation increases by time . upon observing deformation patterns with color - coded map , most contraction occurred at bilateral posterior buccal flange area somewhere between the week 0 - 2 and week 0 - 4 , and as a result , the distance between the flanges decreased . the reasonthat significant deformation could not be seen in lower denture bases is thought that lower denture bases have broader surface than upper denture base , therefore enough water sorption could occur until deflasking . deformation patterns could be observed more clearly with two - dimensional analysis . in upper denture bases , at the sagittal section of the image , no repeating deformation patterns were observed except for expansion at posterior palatal seal , but more clear and repeated bilateral contraction was seen at the frontal section . in this waynowadays , it is possible to analyze denture bases at a virtual space using digital scanner and computer software .16 to measure an object 3 - dimensionally , contact and non - contact types are present , and basically , contact type has excellent accuracy , but is more appropriate to measure narrow area such as teeth , than to measure broad area such as denture bases . optical laser scanner used in this study is 2 - axis type with z axis on rotating plate and y axis at swing arm , and the scanned data was saved as stl file to digitalize . in other studies of analyzing discrepancies 3 - dimensionally , performed surface overlap alignment after placing reference points at specific places , such as palatal portion of denture , alveolar ridge crest or cusp tip .1620 however , these techniques need assumption that no deformation occurs at the reference points during curing or storage , but there is no proof of it . therefore , best - fit alignment can be utilized to minimize the errors of comparing and analyzing two denture bases , because this method uses scanned data of the whole surface .17 through this study , the overall deformation and its pattern in cured upper and lower denture bases in dry and water storage was compared 3 - dimensionally and analyzed in timely manner . to further evaluate the clinical effect , experiment protocol and program development is required to evaluate the adaptation of oral tissue and denture base . in addition , long - term and intensified studies are required to evaluate dimensional deformation during curing , deflasking and storage as they can be evaluated in 3 - dimensional manner . following conclusions were attained from this study . during dry storage of upper denture bases , significant deformation was observed as time passed from week 0 , 2 , to 4 . it occurred mostly in first two weeks , contraction was observed at bilateral posterior flange , and expansion at posterior palatal seal region . although no significant differences were found in both storage of lower denture bases , obvious 3d deformation pattern were observed in dry storage denture bases , contraction at posterior buccal flange area and expansion at buccal shelf and retromolar pad .\noutput:\n" }, { "from": "agent", "value": "purposethe aim of this study was to evaluate whether there is any typical deformation pattern existing in complete denture when it was dried by using the 3d scanner and surface matching program.materials and methodsa total of 28 denture bases were fabricated with heat curing acrylic resin ( each 14 upper and lower denture bases ) , and 14 denture bases ( each 7 upper and lower denture bases ) were stored in the water bottle ( water stored ) , and another 14 denture bases were stored in the air ( dry stored ) . each specimen was scanned at 1st day after deflasking , 14th day after deflasking , and 28th day after deflasking , and digitalized . three dimensional deformation patterns were acquired by comparison of the data within storage group using surface matching program . for evaluating differences between groups , these data were compared statisticallyusing kruskal wallis and mann whitney - u test ( = .05 ) . resultswhen evaluating 3d deformation of denture base , obvious deformations were not found in maxillary and mandibular water storage group . however , in dry stored group , typical deformation pattern was detected as storage time passes . it occurred mostly in first two weeks . major deformations were found in the bilateral posterior area in both maxillary and mandibular group . in maxillary dry stored group , a statistical significance was found.conclusionit was proved that in both upper and lower denture bases , dry storage caused more dimensional deformation than water storage with typical pattern ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tetrahydrofurans and pyrrolidines represent important classes of heterocycles due to their diverse biological activities , and numerous natural products and pharmaceuticals incorporate chiral tetrahydrofuran1 and pyrrolidine2 rings . many synthetic routes have been developed to these compound classes , among them methodologies making use of visiblelight photocatalysis ( scheme 1 ) .3 strategies towards photochemical tetrahydrofurans and pyrrolidines by visiblelightmediated transformations3 these routes involve the formation of a c x ( x = o , npg ; pg = protecting group ) bond in the cyclization step starting from appropriately substituted alcohols or amines , in contrast to the approach reported here that features cyclization through c c bondforming reactions starting from monoallylated 1,2 diols or nallylated amino alcohols , being readily available either from the chiral pool or by various synthetic routes such as the sharpless asymmetric aminohydroxylation or dihydroxylation or epoxide ringopening reactions . following our interest in the catalytic conversion of renewable resources ,4 we recently reported a photoredoxcatalyzed radical deoxygenation of alcohols via 3,5 bis ( trifluoromethyl ) benzoates . [ 5a ] in the current study , we additionally evaluated ethyl oxalate as activating group , being pioneered by utley and coworkers for electrochemical deoxygenations ,6 and which we find also allows efficient c o bond activation under photochemical conditions ( scheme 2 ) . however , rather than performing just simple reductive deoxygenations , we investigated horizontal functionalizations aiming at the synthesis of chiral tetrahydrofurans and pyrrolidines . we started our investigation by exploring the deoxygenative , intramolecular cyclization reactions of modified tartrate derivatives , readily available in either enantiomerically pure form ( scheme 3 ) . a 5exotrig cyclization to a tetrahydrofuran would be conceivable if one of the hydroxy groups is allylated and the other is activated for deoxygenation . testing 1a , in which deoxygenative radical formation was envisioned with 3,5 bis ( trifluoromethyl ) benzoate as activating group , indeed gave rise to tetrahydrofuran 2a , albeit only in moderate yield .7 as an alternative , we tested 3a , in which radical deoxygenation was envisioned to occur with ethyl oxalate as activating group .8 indeed , 2a could be obtained in considerably improved yields under optimized reaction conditions . the transformations of both 1a and 3a can be carried out in either the presence of a sacrificial amine ( scheme 3 , top part : reductive quenching cycle ) or in the absence of such an agent ( scheme 3 , bottom part : oxidative quenching cycle ) . although longer irradiation times are required when amines are omitted , the cyclizations typically proceed much more cleanly . also , from an economic point of view , it is more attractive to avoid the use of relatively costly amines ( ipr2net ) . lowpriced ethyl oxalate activation9 without sacrificial amines ( conditions b ) therefore seemed to be the parameters of choice for this transformation . however , ethyl oxalate esters are sometimes unstable and tend to decompose or hydrolyze quite easily , making the employment of 3,5 bis ( trifluoromethyl ) benzoyl derivatives a valid alternative ( see below ) . in combination with sacrificial electron donors , very short reaction times for challenging substratescost aspects with respect to the benzoate group are mitigated as the auxiliary can easily be recycled and reused after activation and deoxygenation .5 the highly reductive photocatalyst fac [ ir ( ppy ) 3 ] [ e red ( ir / ir * ) = 1.73 v vs. sce ] 10 was crucial for transforming ethyl oxalate activated 3a into cyclized compound 2a ( table 1 , entry 1 ) without employing a sacrificial amine . lessreducing iridiumbased photocatalysts , such as [ ir ( ppy ) 2 ( dtbbpy ) ] pf6 [ ( dtbbpy ) = 2 ( 2,4 difluorophenyl ) 5 ( trifluoromethyl ) pyridine , e red ( ir / ir ) = 1.51 v vs. sce ] or [ ir { df ( cf3 ) ppy } 2 ( dtbbpy ) ] pf6 { df ( cf3 ) ppy = 3,5 difluoro2 [ 5 ( trifluoromethyl ) 2pyridyl ] phenyl } [ e red ( ir / ir * ) = 1.21 v vs. sce ] 11 were not capable of reducing oxalate tartrate 3a ( e red = 1.65 v vs. sce ) and yielded only negligible amounts of product ( entries 2 and 3 ) 7 likewise , [ ru ( bpy ) 3 ] cl2 [ e red ( ru / ru ) = 1.28 v vs. sce ] 12 and [ cu ( dap ) 2 ] cl [ dap = 2,9 bis ( 4anisyl ) 1,10 phenanthroline , e red ( cu / cu * ) = 1.43 v vs. sce ] 13 were not suitable catalysts for promoting the formation of 2a ( entries 4 and 5 ) . attempts to perform the reaction at ambient temperature or at 40 c ( entry 6 ) gave no conversion of starting material 3a at all . applying higher temperatures was key for the photoinduced cyclization ; higher temperatures should increase the rotational freedom in the substrate and thus may lead to a more favorable conformation for cyclization . indeed , 89 % conversion and 51 % yield were achieved at 60 c ( entry 7 ) and 100 % conversion and 70 % yield at 80 c ( entry 1 ) .14 catalyst screening , temperature dependence , and control experiments for the cyclization of compound 3a a reagents and conditions : oxalate ester 3a ( 0.1 mmol ) , fac [ ir ( ppy ) 3 ] ( 2.0 mol % ) , and dmf ( 0.1 m ) at 80 c and 455 nm led irradiation under n2 for 20 h. determined by gcfid integration over all diastereomers with an internal standard . control experiments corroborated our assumption that the deoxygenation of 3a is nevertheless a photochemically induced process ; when either light or the photocatalyst ( entry 8 ) was absent , no reaction was observed ( for full optimization of oxalates as well as benzoates , see the supporting information ) . because the reaction time for the batch setup on a 0.1 mmol scale was in the range of 1 d , it would take considerably longer to reach full conversion on a larger scale . indeed , when we scaled up the reaction to 1.0 mmol keeping the substrate concentration constant , a prolonged reaction time of 7 d was required to achieve full conversion and 54 % isolated yield of 2a with a batch setup ( table 2 , entry 1 ) . setting up the reaction in a microreactor should therefore be advantageous , as demonstrated previously for photoredox processes15 comparison of yield and reaction time for the cyclization of 3a in a batch reaction and microreactora reagents and conditions : oxalate ester 3a ( 1.0 mmol ) , fac [ ir ( ppy ) 3 ] ( 1.0 mol % ) , and dmf ( 0.1 m ) at 80 c and 455 nm led irradiation under n2 . owing to the higher surface / volume ratio in the microreactor and improved miscibility , the continuousflow mode typically offers shorter reaction times , higher yields , lower catalyst loadings , and facile upscaling . this was also true for the cyclization reaction of 3a . by using a microreactor , full conversion was achieved after only 28 h and gave 2a in 73 % yield ( entry 2 ) . to explore the scope of the synthesis of tetrahydrofurans by deoxygenative cyclization , a number of tartrate derivatives were synthesized and subjected to the optimized reaction conditions ( table 3 ) . reactions with 3,5 bis ( trifluoromethyl ) benzoateactivated substrates 1 were allowed to react in a batch setup ( conditions a ) , and substrates with ethyl oxalate as the activation group 3 were performed in a flow setup ( see above , conditions b ) . procedure b generally gave cleaner reactions and higher yields than procedure a , for which often minor amounts of simple reductive deoxygenation products were formed5 the diastereomeric ratios are typically similar for both procedures , because the reactions were run at identical temperatures . in all cases , high anti selectivity was obtained with respect to the stereocenters in the diol backbone , whereas the new stereocenter formed through the cyclization involving the allyl sidechain gave rise to epimers ( see below ) . the asymmetric center at the allylated hydroxy center during the photoredox process is preserved , as is evident from the comparison between 2a and ent2a ( entries 1 and 2 ) . a switch from the diethyl tartrate 3a to the more bulkyisopropyl derivative 3b resulted in a slightly decreased product yield ; however , a higher diastereomeric ratio of the products could not be achieved ( entries 1 and 3 ) . the introduction of an additional methyl group at the position of the allyl system had only a minor influence on both the reaction yield and the diastereomeric ratio ( dr ; entry 4 ) . a further increase in the steric bulk at the position with a second methyl group ( entry 6 ) diminished the product yield from 38 to 31 % under conditions a and from 75 to 53 % under conditions b , but exclusively gave rise to the alltransconfigured tetrahydrofuran derivative 2e . in the case of oxalate activation using 3e , major amounts of the alkene were also observed that originate from elimination of a hydrogen atom from one of the methyl groups rather than reduction by abstraction from an external hydrogen source after cyclization . this mixture could be hydrogenated with h2 and pd / c to give 2e in 53 % overall yield . methyl substitution at the position in 1f and 3f again gave good yields of the cyclization product with excellent diastereomeric induction ( entry 7 ) . by employing cyclohexenylsubstituted 1h and 3h as substrates , the synthesis of cyclohexylannulated tetrahydrofuran 2h was possible in acceptable yields but with high stereoselectivity ( entry 9 ) ; the product diastereomeric ratio mirrors the ratio in the starting materials ( 1:1 ) . neither procedure a nor b tolerates , unsaturated esters ( entries 5 and 8 ) ; decomposition of the starting materials was observed . attempting the cyclization with oxalylcontaining 3i gave no conversion , but the corresponding 3,5 bis ( trifluoromethyl ) benzoateactivated derivative 1i resulted in the formation of benzylsubstituted tetrahydrofuran 2i ( entry 10 ) in 48 % yield . tetrahydrofuran products were also obtained when either only one or both of the ester groups in the tartrate backbone were substituted with phenyl groups ( entries 11 and 12 ) . substrate scope of the photoredoxcatalyzed synthesis of chiral tetrahydrofurans 2 a e = co2et unless otherwise noted . reagents and conditionsa : 3,5 bis ( trifluoromethyl ) benzoate ester ( 0.20.5 mmol ) , et3n ( 2.0 equiv . ) , fac [ ir ( ppy ) 3 ] ( 2.0 mol % ) , h2o ( 100 equiv . ) , and mecn ( 0.04 m ) at 80 c under 455 nm led irradiation under n2 for 1 h in a batch setup . reagents and conditions b : oxalate ester ( 0.41.0 mmol ) , fac [ ir ( ppy ) 3 ] ( 1.0 mol % ) , and dmf ( 0.1 m ) at 80 c under 455 nm led irradiation under n2 in a flow setup ( flow rate 0.300.35 ml / h , 2933 h ) . an alkane / alkene mixture ( 25:75 ) was initially formed , which was quantitatively hydrogenated ( h2 , pd / c ) . a series of pyrrolidines were also synthesized by using this methodology by switching from 1,2 diols to the corresponding amino alcohol derivatives 4 and 5 ( table 4 ) . optimizing the reaction conditions ( conditions b ) for the pyrrolidine synthesis revealed that the oxidative quenching cycle was the best choice for both activation groups . the yields and diastereomeric ratios are typically similar for both benzoates 4 and oxalates 5 , and for the cases in which diastereomers are formed , they can be readily separated . using ( ) 4a or ( ) 5a as substrate led to the formation of two separable diastereomers ( ) 6a and ( ) 6a in yields of 6162 % ( entry 1 ) . the introduction of an additional methyl group at the position of the allyl system had a significant influence on the yield and diastereoselectivity . although the yield dropped from 62 to 47 % for the oxalates and from 61 to 52 % for the benzoates , a higher diastereoselectivity was observed ( entry 2 ) . a further increase in the steric bulk at the position with a second methyl group ( entry 3 ) caused no further decrease in the reaction yield but a reduction in the stereocontrol at the isopropylbearing stereocenter . major amounts of the alkene were observed , similarly to the synthesis of the analogous tetrahydrofuran ( see above ) . subsequent hydrogenation with h2 and pd / c gave the desired product ( ) 6c in yields of 4853 % . methyl substitution at the position in ( ) 4d and ( ) 5d gave moderate yields of the cyclization product with excellent diastereomeric induction ( entry 4 ) . exchanging the phenyl group at the 1position witha methyl group caused only a slightly higher yield and low diastereoselectivity ( entry 5 ) , whereas exchanging the ester moiety for an additional phenyl group had a moderate influence on diastereoselectivity and allowed ( ) 6f to be obtained in 50 % yield ( entry 6 ) . employing substrates ( + ) 4 g or ( + ) 5 g , synthesized from a commercially available , enantiopure amino diol , led to low yields of 2830 % and slightly higher diastereoselectivity . furthermore , 5exodig cyclization with ( ) 4h or ( ) 5h was possible , giving a slightly lower yield compared with the corresponding 5exotrig reaction ( entry 1 ) , but excellent diastereoselectivity ( entry 8 ) . substrate scope of the photoredoxcatalyzed synthesis of pyrrolidines 6 a reagents and conditions b : 3,5 bis ( trifluoromethyl ) benzoate ester 4 or oxalate ester 5 ( 0.41.0 mmol ) , fac [ ir ( ppy ) 3 ] ( 1.0 mol % ) , and dmf ( 0.1 m ) at 80 c under 455 nm led irradiation under n2 in a flow setup ( flow rate 0.301.0 ml / h , 1033 h ) . given as the sum of the isolated yield of both diastereomers ; dr is based on the isolated yields of the diastereomers . after hydrogenation , initial alkane / alkene ratio = 23:77 for ( ) 6c , 15:85 for ( ) 6c . dr determined by h nmr integration , inseparable diastereomers . although the method presented here produces epimers with respect to the stereocenter formed when cyclization at a prochiral allyl group takes place , enantiomeric and diastereomeric pyrrolidines with biologically relevant cores , that is , and prolines , can be readily prepared as pure stereoisomers that would otherwise be difficult to obtain . for example , the asymmetric epoxidation of ethyl cinnamate 716 followed by ringopening with allylamine ,17 nboc protection , and oxalyl activation readily gave rise to 5a in good yield and in 93 % ee ( scheme 4 ) . photocyclization as described above gave rise to the readily separable diastereomers 6a and 6a . strategy for the enantioselective synthesis of substituted proline esters . reagents and conditions : ( a ) 16 shi catalyst ( 0.3 equiv . ) , na2 ( edta ) ( 410 m ) , bu4nhso4 ( 0.06 equiv . ) , oxone ( 5.0 equiv . ) , nahco3 ( 15.5 equiv . ) , ch3cn / h2o , 0 c to room temp . , 24 h , 59 % ; ( b ) 17 allylamine ( 1.0 equiv . ) , etoh , reflux , 24 h , 58 % ; ( c ) boc2o ( 1.2 equiv . ) , et3n ( 1.2 equiv . ) , ch2cl2 , room temp . , 24 h , 54 % ; ( d ) ethyl oxalyl chloride ( 1.5 equiv . ) , pyridine ( 1.5 equiv . ) , ch2cl2 , 0 c to room temp . , 20 h , 93 % ; ( e ) fac [ ir ( ppy ) 3 ] ( 1.0 mol % ) , led ( 455 nm ) , dmf , 80 c , 1.0 ml / h , 60 % . the mechanism for both deoxygenation protocols likely involves electron uptake by the activating group from excited ir * species18 followed by carbon oxygen bond mesolysis giving rise to a carboncentered radical . this can then be trapped either by hydrogen atom abstraction leading to undesired simple deoxygenation ( not depicted ) or in a 5exotrig fashion to give the tetrahydrofuran or pyrroldiine core structure . the primary radical thus formed undergoes hydrogen abstraction from the solvent or from a sacrificial amine radical cation ( only when present , conditions a ) . regeneration of the photocatalyst is accomplished by reduction with either ethyl oxalate ,19 solvent ( conditions b ) , or sacrificial triethylamine ( conditions a ) . hydrogen abstraction from the solvent could be verified through a deuteriation experiment ( scheme 5 ) : the cyclization of 3a using [ d7 ] dmf gave compound 11 with single deuteriation at the terminal methyl group . the stereochemistry observed can be rationalized by competing chair or boattype transition states ( scheme 6 ) , as has been discussed for analogous radical cyclizations to cyclopentanes .20 a high preference for anti orientation of the substituents r and r at the diol or amino alcohol core appears to be the dominating control element , whereas the two possible conformations of the allyl sidechain suffer from 1,3 interactions with r in the chair orientation and with x in the boat orientation . a protocol for the visiblelightmediated deoxygenation of monoallylated diols and amino alcohols followed by an intramolecular 5exotrig / 5exodig cyclization has been developed for the synthesis of chiral tetrahydrofuran and pyrrolidine derivatives . the method features inexpensive , readily available starting materials , and a sustainable , halogenfree activation of the hydroxy group towards radical reactions was realized by its transformation into either recyclable 3,5 bis ( trifluoromethyl ) benzoate or inexpensive ethyl oxalate esters . ethyl oxalate activated tartrates and ethyl oxalate or 3,5 bis ( trifluoromethyl ) benzoate activated amino alcohols only require heat , a photoredox catalyst , and visible light to form chiral tetrahydrofuran or pyrrolidine derivatives in reasonable to good yields . general : all chemicals were used as received or purified according to standard procedures21 if necessary . glassware was dried in an oven at 110 c or flamedried and cooled under a dry atmosphere prior to use . bluelight irradiation in batch processes was performed by using a cree xlamp xpe d515 led ( = 450465 nm ) . in microreactor processes , eight osram oslon black series ld h9gp leds ( = 45510 nm ) were employed . analytical tlc was performed on merck tlc aluminium sheets coated with silica gel 60 f254 . reactions were monitored by tlc and visualized by a shortwave uv lamp and stained with a solution of potassium permanganate , panisaldehyde , ninhydrin , or seebach 's stain . column flash chromatography was performed by using merck flash silica gel 60 ( 0.0400.063 mm ) . melting points were measured with an automated meltingpoint system ( mpa 100 ) with digital image processing technology by stanford research systems . atrir spectroscopy was carried out with a cary 630 ftir spectrometer or a biorad excalibur fts 3000 spectrometer , equipped with a specac golden gate diamond single reflection atr system . chemical shifts ( ) for h nmr are reported in parts per million ( ppm ) relative to the signal of chcl3 at = 7.26 ppm , the dmso quintet at = 2.50 ppm , or the water signal at = 4.79 ppm . chemical shifts ( ) for c nmr are reported in parts per million ( ppm ) relative to the centerline signal of the cdcl3 triplet at = 77.2 ppm and the [ d6 ] dmso septet at = 39.5 ppm . the following notations indicate the multiplicity of the signals : s = singlet , br . s = broad singlet , d = doublet , t = triplet , q = quartet , quint = quintet , sept = septet , and m = multiplet , and combinations thereof . dept135 analysis for the avance 400 spectrometer shows ch3 and ch peaks down and ch2 peaks up . dept135 analysis for the avance 300 spectrometer shows ch3 and ch peaks up and ch2 peaks down . mass spectra were recorded at the central analytical laboratory at the department of chemistry of the university of regensburg with a varian mat 311a , finnigan mat 95 , thermoquest finnigan tsq 7000 , or agilent technologies 6540 uhd accuratemass qtof lc / ms spectrometer . gas chromatographic analyses were performed with a fisons instruments gas chromatograph equipped with a capillary column ( 30 m 250 m 0.25 m ) and a flame ionization detector . enantiomeric excesses were determined by chiral hplc ( phenomenex lux cellulose2 , 4.6250 mm , particle size 5 m ) . general procedure for reactions with oxalates without a sacrificial electron donor : a schlenk tube equipped with a magnetic stirring bar was charged with ethyl oxalate ester ( 1.0 mmol , 1.0 equiv . ) and fac [ ir ( ppy ) 3 ] ( 6.55 mg , 10.0 mol , 1.0 mol % ) , dissolved in dmf ( 10 ml , 0.1 m ) , sealed with a screw cap , and subsequently evacuated for 15 min and backfilled with n2 . the screw cap was replaced with a teflonsealed inlet for a glass rod , through which irradiation with a 455 nm highpower led took place from above while the reaction mixture was magnetically stirred and heated in an aluminium block at 80 c from below . afterwards , the reaction mixture was diluted with etoac ( 300 ml ) and extracted with water ( 5100 ml ) . the combined organic layers were dried with na2so4 , the solvent was evaporated under reduced pressure , and the residue purified by flash column chromatography . general procedure for reactions with 3,5 bis ( trifluoromethyl ) benzoates with a sacrificial electron donor : a schlenk tube equipped with a magnetic stirring barwas charged with 3,5 bis ( trifluoromethyl ) benzoate ester ( 0.50 mmol , 1.00 equiv . ) and fac [ ir ( ppy ) 3 ] ( 6.6 mg , 10 mol , 2.0 mol % ) , sealed with a screw cap , and subsequently evacuated and backfilled with n2 ( 3 ) . mecn ( 12.5 ml ) , et3n ( 0.35 ml , 0.25 g , 2.5 mmol , 5.0 equiv . ) , and degassed water ( 0.90 ml , 0.90 g , 50 mmol , 100 equiv . ) were added , and the reaction mixture was magnetically stirred until a homogeneous solution was obtained . the reaction mixture was degassed by using the freezepumpthaw method ( 5 ) , and the screw cap was replaced with a teflonsealed inlet for a glass rod , through which irradiation with a 455 nm highpower led took place from above while the reaction mixture was magnetically stirred and heated at 80 c in an aluminium block from below . after completion of the reaction , as judged by tlc ( typically 1 h ) , the mixture was concentrated under reduced pressure and the residue purified by flash silica gel column chromatography . general procedure for the reaction of ethyl oxalyl esters and 3,5 bis ( trifluoromethyl ) benzoate esters in a microreactor setup : a schlenk tube equipped with a magnetic stirring bar was charged with ethyl oxalate ester ( reaction b , 1.0 equiv . ) or 3,5 bis ( trifluoromethyl ) benzoate ester ( reaction a ; 1.0 equiv . ) , fac [ ir ( ppy ) 3 ] ( 1.0 mol % ) , and dmf ( 0.1 m ) . the reaction mixture was degassed by sparging with n2 through a needle and a septum for 30 min or by the freezepumpthaw method ( 3 ) and pumped through a microreactor ( which was also sparged with n2 ) equipped with eight leds at a flow rate of 0.151.00 ml / h through a syringe pump while heated at 80 c . afterwards , the reaction mixture was diluted with diethyl ether ( 150 ml ) or etoac ( 300 ml ) and washed with brine ( 3100 ml ) or water ( 5100 ml ) . the combined organic layers were dried with anhydrous na2so4 , the solvent was evaporated under reduced pressure , and the residue purified by flash column chromatography . compound 2a : elution with hexanes / etoac ( 6:1 ) ; colorless oil ; yield : 45 mg ( 39 % with 1a , dr = 61:30:9 ) and 167 mg ( 73 % with 3a , dr = 62:28:8:2 ) ; r f ( hexanes / etoac , 1:1 ) = 0.81 . h nmr ( major diastereomer , 400 mhz , cdcl3 ) : = 4.80 ( d , j = 6.1 hz , 1 h ) , 4.264.16 ( m , 4 h ) , 4.164.08 ( m , 1 h ) , 3.63 ( dd , j = 8.3 , 6.2 hz , 1 h ) , 3.24 ( dd , j = 8.3 , 6.1 hz , 1 h ) , 2.67 ( dquint , j = 13.4 , 6.8 hz , 1 h ) , 1.321.23 ( m , 6 h ) , 1.01 ( d , j = 7.0 hz , 3 h ) ppm . h nmr ( minor diastereomer 1 , 400 mhz , cdcl3 ) : = 4.72 ( d , j = 7.4 hz , 1 h ) , 4.264.16 ( m , 4 h ) , 4.164.08 ( m , 1 h ) , 3.58 ( t , j = 8.7 hz , 1 h ) , 2.77 ( dt , j = 11.1 , 5.6 hz , 1 h ) , 2.622.51 ( m , 1 h ) , 1.321.23 ( m , 6 h ) , 1.161.10 ( m , 3 h ) ppm . h nmr ( minor diastereomer 2 , 400 mhz , cdcl3 ) : = 4.65 ( d , j = 8.3 hz , 1 h ) , 4.264.16 ( m , 4 h ) , 4.164.08 ( m , 1 h ) , 3.48 ( t , j = 8.0 hz , 1 h ) , 2.95 ( t , j = 8.4 hz , 1 h ) , 2.67 ( dquint , j = 13.4 , 6.8 hz , 1 h ) , 1.321.23 ( m , 6 h ) , 1.01 ( d , j = 7.0 hz , 3 h ) ppm . h nmr ( minor diastereomer 3 , 400 mhz , cdcl3 ) : = 4.59 ( d , j = 2.3 hz , 1 h ) , 4.264.16 ( m , 4 h ) , 4.164.08 ( m , 1 h ) , 3.41 ( d , j = 7.3 hz , 1 h ) , 2.77 ( dt , j = 11.1 , 5.6 hz , 1 h ) , 2.622.51 ( m , 1 h ) ,1.321.23 ( m , 6 h ) , 1.01 ( d , j = 7.0 hz , 3 h ) ppm . c nmr ( major diastereomer , 101 mhz , cdcl3 ) : = 172.0 , 171.2 , 78.7 , 75.7 , 61.5 , 61.1 , 52.3 , 36.9 , 14.4 , 14.3 , 13.4 ppm . c nmr ( minor diastereomer 1 , 101 mhz , cdcl3 ) : = 172.2 , 171.9 , 79.9 , 76.0 , 61.4 , 61.4 , 55.8 , 39.8 , 15.9 , 14.3 , 14.3 ppm . ir ( neat ) : = 2979 , 2939 , 2877 , 2190 , 1731 , 1464 , 1372 , 1275 , 1180 , 1095 , 1027 , 939 , 858 , 462 cm . hrms ( esi ) : calcd . for c11h19o5compound ent2a : elution with hexanes / etoac ( 6:1 ) ; colorless oil ; yield : 163 mg ( 71 % with ent3b , dr = 57:37:6 ) ; r f ( hexanes / etoac , 1:1 ) = 0.81 . h nmr ( major diastereomer , 300 mhz , cdcl3 ) : = 4.75 ( d , j = 6.1 hz , 1 h ) , 4.234.02 ( m , 5 h ) , 3.633.48 ( m , 1 h ) , 3.20 ( dd , j = 8.3 , 6.1 hz , 1 h ) , 2.682.44 ( m , 1 h ) ,1.301.17 ( m , 6 h ) , 0.96 ( d , j = 7.0 hz , 3 h ) ppm . h nmr ( minor diastereomer 1 , 300 mhz , cdcl3 ) : = 4.68 ( d , j = 7.4 hz , 1 h ) , 4.234.02 ( m , 5 h ) , 3.633.48 ( m , 1 h ) , 2.73 ( dd , j = 8.8 , 7.4 hz , 1 h ) , 2.682.44 ( m , 1 h ) , 1.301.17 ( m , 6 h ) , 1.08 ( dd , j = 6.6 hz , 3 h ) ppm . h nmr ( minor diastereomer 2 , 300 mhz , cdcl3 ) : = 4.61 ( d , j = 8.3 hz , 1 h ) , 4.234.02 ( m , 5 h ) , 3.44 ( t , j = 8.0 hz , 1 h ) , 2.91 ( t , j = 8.4 hz , 1 h ) , 2.682.44 ( m , 1 h ) , 1.301.17 ( m , 6 h ) , 1.07 ( d , j = 6.7 hz , 3 h ) ppm . c nmr ( major diastereomer , 75 mhz , cdcl3 ) : = 172.0 , 171.2 , 78.7 , 75.7 , 61.5 , 61.2 , 52.3 , 36.9 , 14.4 , 14.3 , 13.4 ppm . c nmr ( minor diastereomer 1 , 75 mhz , cdcl3 ) : = 172.2 , 171.9 , 79.8 , 76.0 , 61.5 , 61.4 , 55.8 , 39.8 , 15.8 , 14.4 , 13.4 ppm . hrms ( esi ) : calcd . for c11h19o5 [ m + h ] 231.1227 ; found 231.1230 . compound 2b : elution with hexanes / etoac ( 3:1 ) ; colorless oil ; yield : 168 mg ( 65 % with 3b , dr = 60:32:5:3 ) ; r f ( hexanes / etoac , 1:1 ) = 0.83 . h nmr ( major diastereomer , 300 mhz , cdcl3 ) : = 5.104.91 ( m , 2 h ) , 4.69 ( d , j = 6.3 hz , 1 h ) , 4.07 ( ddd , j = 8.3 , 6.7 , 4.3 hz , 1 h ) , 3.643.47 ( m , 1 h ) , 3.11 ( dd , j = 8.4 , 6.3 hz , 1 h ) , 2.712.55 ( m , 1 h ) , 1.251.13 ( m , 12 h ) , 0.96 ( d , j = 7.0 hz , 3 h ) ppm . h nmr ( minor diastereomer 1 , 300 mhz , cdcl3 ) : = 5.104.91 ( m , 2 h ) , 4.61 ( d , j = 7.6 hz , 1 h ) , 4.07 ( ddd , j = 8.3 , 6.7 , 4.3 hz , 1 h ) , 3.643.47 ( m , 1 h ) , 2.712.55 ( m , 1 h ) , 2.552.40 ( m , 1 h ) , 1.251.13 ( m , 12 h ) , 0.96 ( d , j = 7.0 hz , 3 h ) ppm . h nmr ( minor diastereomer 2 , 300 mhz , cdcl3 ) : = 5.104.91 ( m , 2 h ) , 4.54 ( d , j = 8.2 hz , 1 h ) , 4.07 ( ddd , j = 8.3 , 6.7 , 4.3 hz , 1 h ) , 3.42 ( t , j = 8.0 hz , 1 h ) , 2.85 ( t , j = 8.3 hz , 1 h ) , 2.712.55 ( m , 1 h ) , 2.85 ( t , j = 8.3 hz , 1 h ) , 1.251.13 ( m , 12 h ) , 0.96 ( d , j = 7.0 hz , 3 h ) ppm . h nmr ( minor diastereomer 3 , 300 mhz , cdcl3 ) : = 5.104.91 ( m , 2 h ) , 4.49 ( d , j = 3.3 hz , 1 h ) , 4.07 ( ddd , j = 8.3 , 6.7 , 4.3 hz , 1 h ) , 3.643.47 ( m , 1 h ) , 2.712.55 ( m , 2 h ) , 1.251.13 ( m , 12 h ) , 0.96 ( d , j = 7.0 hz , 3 h ) ppm . c nmr ( major diastereomer 1 , 75 mhz , cdcl3 ) : = 171.4 , 170.5 , 78.775.6 , 68.8 , 68.6 , 52.3 , 36.7 , 21.9 , 21.9 , 21.8 , 21.7 , 13.3 ppm . c nmr ( major diastereomer 2 , 75 mhz , cdcl3 ) : = 171.5 , 171.4 , 79.8 , 75.9 , 68.8 , 68.6 , 56.1 , 39.8 , 21.9 , 21.8 , 21.8 , 21.7 , 15.5 ppm . ir ( neat ) : = 2980 , 2940 , 2879 , 1727 , 1469 , 1375 , 1273 , 1180 , 1145 , 1103 , 989 , 944 , 902 , 829 cm . hrms ( esi ) : calcd . for c13h23o5 [ m + h ] 259.1540 ; found 259.1545 . compound 2c : elution with hexanes / etoac ( 6:1 to 2:1 ) ; colorless oil ; yield : 28 mg ( 38 % with 1c , dr = 65:21:14 ) and 183 mg ( 75 % with 3c , dr = 60:34:5:1 ) ; r f ( hexanes / etoac , 1:1 ) = 0.92 . h nmr ( major diastereomer , 300 mhz , cdcl3 ) : = 4.71 ( d , j = 5.0 hz , 1 h ) , 4.184.08 ( m , 5 h ) , 3.64 ( dt , j = 13.8 , 8.2 hz , 1 h ) , 3.21 ( dd , j = 8.4 , 5.0 hz , 1 h ) , 2.482.32 ( m , 1 h ) , 1.661.28 ( m , 2 h ) ,1.271.20 ( m , 6 h ) , 0.88 ( ddd , j = 7.5 , 6.1 , 3.9 hz , 3 h ) ppm . c nmr ( major diastereomer 1 , 75 mhz , cdcl3 ) : = 171.9 , 171.4 , 79.1 , 73.3 , 61.4 , 61.0 , 51.6 , 44.1 , 21.0 , 14.3 , 14.2 , 12.8 ppm . c nmr ( major diastereomer 2 , 75 mhz , cdcl3 ) : = 172.5 , 171.6 , 79.9 , 74.3 , 61.3 , 61.3 , 54.2 , 46.5 , 25.1 , 14.3 , 14.2 , 12.4 ppm . ir ( neat ) : = 2970 , 2938 , 2878 , 1729 , 1464 , 1372 , 1266 , 1179 , 1135 , 1095 , 1028 , 943 , 857 , 433 cm . hrms ( esi ) : calcd . for c12h21o5 [ m + h ] 245.1384 ; found 245.1388 . compound 2e : elution with hexanes / etoac ( 5:1 ) ; colorless oil ; yield : 41 mg ( 31 % with 1e , dr 95:5 ) and 137 mg ( 53 % with 3e , dr 95:5 ) ; r f ( hexanes / etoac , 3:1 ) = 0.48 . h nmr ( 400 mhz , cdcl3 ) : = 4.62 ( d , j = 7.2 hz , 1 h ) , 4.284.16 ( m , 4 h ) , 4.13 ( t , j = 8.2 hz , 1 h ) , 3.76 ( t , j = 8.7 hz , 1 h ) , 2.90 ( t , j = 7.8 hz , 1 h ) , 2.40 ( q , j = 8.2 hz , 1 h ) , 1.731.61 ( m , 1 h ) , 1.28 ( t , j = 7.1 hz , 6 h ) , 0.94 ( d , j = 6.7 hz , 3 h ) , 0.89 ( d , j = 6.7 hz , 3 h ) ppm . c nmr ( 101 mhz , cdcl3 ) : = 173.1 , 171.4 , 80.7 , 73.0 , 61.3 , 61.2 , 52.6 , 51.6 , 30.7 , 20.9 , 20.7 , 14.2 , 14.1 ppm . ir ( neat ) : = 2963 , 2876 , 1732 , 1468 , 1447 , 1372 , 1263 , 1221 , 1192 , 1106 , 1026 , 969 , 861 , 715 , 575 cm ; hrms ( esi ) : calcd . for c13h23o5compound 2f : elution with hexanes / etoac ( 6:1 ) ; colorless oil ; yield : 56 mg ( 46 % with 1f , dr 95:5 ) and 68 mg ( 70 % with 3f , dr 95:5 ) ; r f ( hexanes / etoac , 1:1 ) = 0.80 . h nmr ( 300 mhz , cdcl3 ) : = 4.89 ( d , j = 8.0 hz , 1 h ) , 4.274.12 ( m , 4 h ) , 3.69 ( s , 2 h ) , 2.89 ( d , j = 8.0 hz , 1 h ) , 1.311.23 ( m , 6 h ) , 1.20 ( s , j = 3.9 hz , 3 h ) , 1.02 ( s , 3 h ) ppm . c nmr ( 75 mhz , cdcl3 ) : = 172.3 , 170.6 , 81.6 , 78.8 , 61.4 , 61.1 , 58.1 , 43.7 , 24.9 , 22.0 , 14.4 , 14.3 ppm . ir ( neat ) : = 2978 , 2874 , 1729 , 1466 , 1371 , 1337 , 1264 , 109 , 1179 , 1093 , 1028 , 968 , 940 , 860 , 716 , 441 cm . compound 2h : elution with hexanes / etoac ( 6:1 ) ; colorless oil ; yield : 35 mg ( 32 % with 1h , dr = 53:47 ) and 170 mg ( 63 % with 3h , dr = 57:43 ) ; r f ( hexanes / etoac , 3:1 ) = 0.60 . h nmr ( major diastereomer , 300 mhz , cdcl3 ) : = 4.91 ( d , j = 8.4 hz , 1 h ) , 4.234.14 ( m , 4 h ) , 3.36 ( dd , j = 8.3 , 6.5 hz , 1 h ) , 2.372.27 ( m , 1 h ) , 2.152.05 ( m , 1 h ) , 1.751.29 ( m , 7 h ) , 1.281.22 ( m , 6 h ) ppm . h nmr ( minor diastereomer , 300 mhz , cdcl3 ) : = 4.72 ( d , j = 5.9 hz , 1 h ) , 4.234.14 ( m , 4 h ) , 3.01 ( dd , j = 5.7 , 4.9 hz , 1 h ) , 2.372.27 ( m , 1 h ) , 1.911.79 ( m , 1 h ) , 1.751.29 ( m , 7 h ) , 1.281.22 ( m , 6 h ) ppm . c nmr ( major diastereomer , 75 mhz , cdcl3 ) : = 173.0 , 170.3 , 79.2 , 76.4 , 61.3 , 61.1 , 53.3 , 41.3 , 27.7 , 24.2 , 23.2 , 19.8 , 14.4 , 14.3 ppm . c nmr ( minor diastereomer , 75 mhz , cdcl3 ) : = 172.9 , 172.0 , 78.7 , 78.3 , 61.4 , 61.3 , 53.2 , 42.7 , 28.1 , 27.0 , 23.3 , 21.0 , 14.3 , 14.3 ppm . ir ( neat ) : = 2970 , 2938 , 2878 , 1729 , 1464 , 1372 , 1266 , 1179 , 1135 , 1095 , 1028 , 943 , 857 , 433 cm . hrms ( esi ) : calcd . for c14h23o5 [ m + h ] 271.1540 ; found 271.1543 . compound 2i : elution with hexanes / etoac ( 10:0 to 8:2 ) ; colorless oil ; yield : 70 mg ( 48 % with 1i , dr = 78:22 ) ; r f ( hexanes / etoac , 4:1 ) = 0.27 . h nmr ( major diastereomer , 400 mhz , cdcl3 ) : = 7.347.10 ( m , 5 h ) , 4.84 ( d , j = 5.9 hz , 1 h ) , 4.284.15 ( m , 4 h ) , 3.95 ( dd , j = 8.5 , 6.1 hz , 1 h ) , 3.78 ( dd , j = 8.5 , 6.2 hz , 1 h ) , 3.35 ( dd , j = 8.0 , 5.8 hz , 1 h ) , 2.842.76 ( m , 2 h ) , 2.53 ( dd , j = 13.5 , 10.3 hz , 1 h ) , 1.29 ( t , j = 7.1 hz , 3 h ) , 1.27 ( t , j = 7.1 hz , 3 h ) ppm . h nmr ( minor diastereomer , 400 mhz , cdcl3 ) : = 7.347.10 ( m , 5 h ) , 4.69 ( d , j = 6.9 hz , 1 h ) , 4.284.15 ( m , 2 h ) , 4.154.00 ( m , 3 h ) , 3.783.71 ( m , 1 h ) , 2.842.76 ( m , 4 h ) , 1.28 ( t , j = 7.2 hz , 3 h ) , 1.21 ( t , j = 7.0 hz , 3 h ) ppm . c nmr ( major diastereomer , 101 mhz , cdcl3 ) : = 171.7 , 171.0 , 139.3 , 128.7 , 128.6 , 126.5 , 78.9 , 73.1 , 61.4 , 61.2 , 51.5 , 43.7 , 34.1 , 14.3 , 14.2 ppm . c nmr ( minor diastereomer , 101 mhz , cdcl3 ) : = 172.0 , 171.5 , 138.9 , 128.8 , 128.6 , 126.5 , 79.9 , 74.1 , 61.4 , 61.3 , 53.8 , 46.0 , 37.9 , 14.2 , 14.1 ppm . ir ( neat ) : = 2983 , 2942 , 1729 , 1455 , 1372 , 1262 , 1178 , 1097 , 1027 , 951 , 860 , 746 , 700 , 493 cm . hrms ( esi ) : calcd . for c17h23o5 [ m + h ] 307.1540 ; found 307.1543 . compound 2j : elution with hexanes / etoac ( 25:1 ) ; colorless oil ; yield : 20 mg ( 42 % with 1j , dr = 49:42:9 ) ; r f ( hexanes / etoac , 6:1 ) = 0.55 . h nmr ( major diastereomer , 400 mhz , cdcl3 ) : = 7.387.20 ( m , 10 h ) , 5.34 ( d , j = 5.4 hz , 1 h ) , 4.36 ( dd , j = 8.3 , 7.1 hz , 1 h ) , 3.75 ( t , j = 8.0 hz , 1 h ) , 3.34 ( dd , j = 7.6 , 5.3 hz , 1 h ) , 2.68 ( sept , j = 7.3 hz , 1 h ) , 0.72 ( d , j = 7 hz , 3 h ) ppm . c nmr ( major diastereomer , 101 mhz , cdcl3 ) : = 143.6 , 139.7 , 128.9 , 128.4 , 128.3 , 127.1 , 126.6 , 125.4 , 85.1 , 74.8 , 57.4 , 37.4 , 13.5 ppm . ir ( neat ) : = 2968 , 2930 , 2874 , 1742 , 1603 , 1495 , 1453 , 1382 , 1279 , 1245 , 1182 , 1140 , 1069 , 1047 , 1027 , 925 , 803 , 748 , 698 , 611 , 580 , 528 cm . hrms ( esi ) : calcd . for c17h18ocompound 2k : elution with hexanes / etoac ( 10:1 ) ; colorless oil ; yield : 26 mg ( 57 % with 1k , dr = 67:19:14 ) ; r f ( hexanes / etoac , 6:1 ) = 0.25 . h nmr ( major diastereomer , 300 mhz , cdcl3 ) : = 7.417.14 ( m , 5 h ) , 4.46 ( d , j = 8.5 hz , 1 h ) , 4.324.25 ( m , 1 h ) , 4.234.09 ( m , 2 h ) , 3.72 ( dd , j = 10.1 , 8.4 hz , 1 h ) , 2.93 ( dd , j = 10.1 , 8.5 hz , 1 h ) , 2.572.39 ( m , 1 h ) , 1.18 ( t , j = 7.2 hz , 3 h ) , 0.99 ( d , j = 6.5 hz , 3 h ) ppm . c nmr ( major diastereomer , 75 mhz , cdcl3 ) : = 172.7 , 139.6 , 128.8 , 127.8 , 127.2 , 84.1 , 76.3 , 60.9 , 58.3 , 43.5 , 14.2 , 14.2 ppm . c nmr ( minor diastereomer 1 , 75 mhz , cdcl3 ) : = 172.5 , 142.4 , 128.4 , 127.2 , 125.0 , 83.6 , 75.5 , 61.2 , 55.8 , 36.5 , 15.5 , 14.3 ppm . c nmr ( minor diastereomer 2 , 75 mhz , cdcl3 ) : = 171.4 , 137.4 , 128.3 , 127.7 , 124.7 , 82.0 , 76.0 , 60.4 , 56.4 , 42.4 , 38.2 , 13.6 ppm . ir ( neat ) : = 2962 , 2873 , 1745 , 1603 , 1456 , 1377 , 1270 , 1187 , 1108 , 1083 , 1029 , 965 , 939 , 864 , 754 , 700 , 520 cm . hrms ( esi ) : calcd . for c14h19o3 [ m + h ] 235.1329 ; found 235.1331 . compounds ( ) 6a and ( ) 6a : elution with npentane / diethyl ether ( 20:1 to 3:1 ) ; colorless oils ; yield : 131 mg ( 39 % ) of 6a and 79 mg ( 23 % ) of 6a using 5a ; 126 mg ( 38 % ) of 6a and 76 mg ( 23 % ) of 6a using 4a ; r f ( 6a , npentane / etoac , 3:1 ) = 0.20 ; r f ( 6a , npentane / etoac , 3:1 ) = 0.25 . h nmr ( 6a , 400 mhz , cdcl3 ) : = 7.337.14 ( m , 5 h ) , 5.06 ( m , 1 h ) , 4.253.98 ( m , 2 h ) , 3.843.66 ( m , 1 h ) , 3.583.33 ( m , 1 h ) , 3.062.82 ( m , 1 h ) , 2.712.54 ( m , 1 h ) , 1.45 ( br . s , 3 h ) , 1.26 ( t , j = 7.2 hz , 3 h ) , 1.12 ( m , 6 h ) , 1.01 ( d , j = 7.0 hz , 3 h ) ppm . h nmr ( 6a , 400 mhz , cdcl3 ) : = 7.357.11 ( m , 5 h ) , 5.164.85 ( m , 1 h ) , 4.243.98 ( m , 3 h ) , 3.18 ( t , j = 10.7 hz , 1 h ) , 2.632.40 ( m , 2 h ) , 1.461.01 ( m , 15 h ) ppm . c nmr ( 6a , 101 mhz , cdcl3 ) : = 171.6 , 154.6 , 143.8 , 128.4 , 127.1 , 127.1 , 126.0 , 79.6 , 62.3 , 60.8 , 57.9 , 53.5 , 33.9 , 28.6 , 28.2 , 14.6 , 14.4 ppm . c nmr ( 6a , 101 mhz , cdcl3 ) : = 172.3 , 154.1 , 143.9 , 128.4 , 127.1 , 125.9 , 79.7 , 65.2 , 61.9 , 61.0 , 54.6 , 37.4 , 28.1 , 16.0 , 14.4 . ir ( 6a , neat ) : = 2974 , 2930 , 1730 , 1685 , 1480 , 1398 , 1282 , 1256 , 1230 , 1185 , 1141 , 1036 , 1006 , 887 , 760 , 701 cm . ir ( 6a , neat ) : = 2978 , 2933 , 1733 , 1692 , 1480 , 1394 , 1279 , 1163 , 1126 , 1025 , 951 , 895 , 861 , 760 , 701 cm . hrms ( 6a , esi ) : calcd . for c19h28no4 [ m + h ] 334.2013 ; found 334.2020 . hrms ( 6a , esi ) : calcd . for c19h27nnao4 [ m + na ] 356.1832 ; found 356.1838 . compounds ( ) 6b and ( ) 6b : elution with npentane / diethyl ether ( 20:1 to 3:1 ) ; colorless oils ; yield : 128 mg ( 38 % ) of 6b and 32 mg ( 9 % ) of 6b using 5b ; 106 mg ( 41 % ) of 6b and 27 mg ( 11 % ) of 6b using 4b ; r f ( 6b , npentane / etoac , 3:1 ) = 0.33 ; r f ( 6b , npentane / etoac , 3:1 ) = 0.40 . h nmr ( 6b , 400 mhz , cdcl3 ) : = 7.347.16 ( m , 5 h ) , 5.294.93 ( m , 1 h ) , 4.18 ( m , 2 h ) , 3.843.61 ( m , 1 h ) , 3.583.29 ( m , 1 h ) , 3.092.81 ( m , 1 h ) , 2.38 ( q , j = 7.2 hz , 1 h ) , 1.531.08 ( m , 14 h ) , 0.980.84 ( m , 3 h ) ppm . h nmr ( 6b , 400 mhz , cdcl3 ) : = 7.367.12 ( m , 5 h ) , 5.084.81 ( m , 1 h ) , 4.224.02 ( m , 3 h ) , 3.20 ( t , j = 10.7 hz , 1 h ) , 2.63 ( t , j = 10.0 hz , 1 h ) , 2.472.31 ( m , 1 h ) , 1.741.53 ( m , 2 h ) , 1.511.30 ( m , 3 h ) , 1.21 ( t , j = 7.1 hz , 3 h ) , 1.10 ( s , 6 h ) , 0.92 ( t , j = 7.5 hz , 3 h ) ppm . c nmr ( 6b , 101 mhz , cdcl3 ) : = 172.2 , 154.6 , 143.6 , 142.5 , 128.6 , 128.4 , 127.1 , 125.8 , 125.6 , 79.6 , 63.7 , 63.3 , 60.7 , 56.7 , 55.2 , 51.4 , 50.8 , 41.2 , 40.8 , 28.6 , 28.2 , 22.2 , 14.4 , 14.3 , 12.7 , 12.2 ppm . c nmr ( 6b , 101 mhz , cdcl3 ) : = 172.7 , 154.2 , 143.9 , 128.5 , 127.1 , 125.8 , 79.8 , 65.5 , 61.0 , 60.4 , 52.9 , 44.0 , 28.2 , 25.0 , 14.4 , 12.2 ppm . ir ( 6b , neat ) : = 2989 , 2930 , 2863 , 1733 , 1681 , 1480 , 1405 , 1279 , 1163 , 1074 , 1014 , 928 , 898 , 865 , 768 , 705 cm . ir ( 6b , neat ) : = 3034 , 2989 , 2930 , 2866 , 1733 , 1685 , 1480 , 1405 , 1279 , 1163 , 1107 , 1070 , 1010 , 961 , 928 , 895 , 764 , 705 cm . hrms ( 6b , esi ) : calcd . for c20h29nnao4 [ m + na ] 370.1989 ; found 370.1992 . hrms ( 6b , esi ) : calcd . for c20h29nnao4 [ m + na ] 370.1989 ; found 370.1991 . compounds ( ) 6c and ( ) 6c : elution with npentane / diethyl ether ( 20:1 to 1:1 ) ; colorless oils ; yield : 49 mg ( 25 % ) of 6c and 45 mg ( 23 % ) of 6c using 5c ; 57 mg ( 28 % ) of 6c and 51 mg ( 25 % ) of 6c using 4c ; r f ( 6c , npentane / etoac , 3:1 ) = 0.35 ; r f ( 6b , npentane / etoac , 3:1 ) = 0.40 . h nmr ( 6c , 400 mhz , cdcl3 ) : = 7.367.14 ( m , 5 h ) , 5.11 ( d , j = 65.5 hz , 1 h ) , 4.304.07 ( m , 2 h ) , 3.76 ( dt , j = 45.3 , 9.5 hz , 1 h ) , 3.44 ( td , j = 10.7 , 4.0 hz , 1 h ) , 2.91 ( dd , j = 14.8 , 6.6 hz , 1 h ) , 2.172.00 ( m , 1 h ) , 1.641.51 ( m , 1 h ) , 1.47 ( s , 3 h ) , 1.29 ( t , j = 7.1 hz , 3 h ) , 1.22 ( s , 6 h ) , 0.91 ( d , j = 6.6 hz , 3 h ) , 0.89 ( d , j = 7.2 hz , 3 h ) ppm . h nmr ( 6c , 400 mhz , cdcl3 ) : = 7.816.80 ( m , 5 h ) , 4.984.77 ( m , 1 h ) , 4.13 ( ddq , j = 10.8 , 7.2 , 3.7 hz , 2 h ) , 4.073.91 ( m , 1 h ) , 3.29 ( t , j = 10.9 hz , 1 h ) , 2.71 ( t , j = 9.9 hz , 1 h ) , 2.40 ( tt , j = 10.9 , 7.6 hz , 1 h ) , 1.68 ( dd , j = 13.7 , 6.6 hz , 1 h ) , 1.501.35 ( m , 2 h ) , 1.20 ( t , j = 7.1 hz , 3 h ) , 1.09 ( s , 7 h ) , 0.93 ( d , j = 6.7 hz , 3 h ) , 0.89 ( d , j = 6.8 hz , 3 h ) ppm . c nmr ( 6c , 101 mhz , cdcl3 ) : = 172.9 , 172.8 , 154.7 , 154.5 , 143.2 , 142.3 , 128.6 , 128.4 , 128.4 , 127.2 , 127.1 , 125.6 , 125.5 , 64.7 , 64.5 , 60.7 , 60.7 , 55.0 , 54.0 , 50.7 , 50.1 , 47.0 , 46.1 , 28.9 , 28.9 , 28.7 , 28.3 , 22.0 , 21.8 , 21.6 , 21.6 , 14.4 ppm . c nmr ( 6c , 101 mhz , cdcl3 ) : = 173.4 , 154.2 , 143.8 , 128.5 , 127.2 , 125.7 , 79.7 , 66.5 , 61.0 , 58.8 , 50.8 , 48.4 , 30.3 , 28.1 , 21.0 , 19.9 , 14.3 ppm . ir ( 6c , neat ) : = 3034 , 2967 , 1733 , 1696 , 1476 , 1390 , 1275 , 1163 , 1126 , 1018 , 951 , 898 , 865 , 768 , 701 cm . ir ( 6c , neat ) : = 2967 , 2937 , 1730 , 1696 , 1476 , 1390 , 1256 , 1215 , 1163 , 1115 , 1040 , 943 , 902 , 772 , 701 cm . hrms ( 6c , esi ) : calcd . for c21h31nnao4 [ m + na ] 384.2145 ; found 384.2153 . hrms ( 6c , esi ) : calcd . for c21h31nnao4 [ m + na ] 384.2145 ; found 384.2151 . compound ( ) 6d : elution with npentane / diethyl ether ( 7:1 to 1:1 ) ; colorless oil ; yield : 61 mg ( 38 % with 5d ) and 59 mg ( 45 % with 4d ) ; r f ( npentane / etoac , 3:1 ) = 0.29 . h nmr ( 400 mhz , cdcl3 ) : = 7.407.09 ( m , 5 h ) , 5.11 ( d , j = 9.5 hz , 1 h ) , 4.303.98 ( m , 2 h ) , 3.69 ( d , j = 10.8 hz , 1 h ) , 3.38 ( d , j = 10.7 hz , 1 h ) , 2.74 ( d , j = 9.5 hz , 1 h ) , 1.41 ( s , 2 h ) , 1.261.19 ( m , 6 h ) , 1.09 ( s , 7 h ) , 1.03 ( s , 3 h ) ppm . c nmr ( 101 mhz , cdcl3 ) : = 170.5 , 154.4 , 144.1 , 128.3 , 127.0 , 126.1 , 79.6 , 64.0 , 62.8 , 61.0 , 60.7 , 40.6 , 28.5 , 28.1 , 25.3 , 22.4 , 14.4 ppm . ir ( neat ) : = 3034 , 2974 , 2933 , 2874 , 1730 , 1692 , 1457 , 1394 , 1364 , 1297 , 1264 , 1226 , 1185 , 1156 , 1007 , 1028 , 898 , 861 , 757 , 701 cm . hrms ( esi ) : calcd . for c20h29nnao4 [ m + na ] 370.1989 ; found 370.1995 . compounds ( ) 6e and ( ) 6e : elution with npentane / diethyl ether ( 20:1 to 3:1 ) ; colorless oils ; yield : 80 mg ( 35 % ) of 6e and 71 mg ( 31 % ) of 6e using 5e ; 48 mg ( 35 % ) of 6e and 43 mg ( 31 % ) of 6e using 4e ; r f ( 6e , npentane / etoac , 3:1 ) = 0.29 ; r f ( 6e , npentane / etoac , 3:1 ) = 0.40 . h nmr ( 6e , 400 mhz , cdcl3 ) : = 4.11 ( m , 3 h ) , 3.44 ( dd , j = 10.6 , 6.7 hz , 1 h ) , 3.21 ( s , 1 h ) , 2.55 ( m , 2 h ) , 1.43 ( s , 9 h ) , 1.291.19 ( m , 6 h ) , 0.94 ( d , j = 6.7 hz , 3 h ) ppm . h nmr ( 6e , 400 mhz , cdcl3 ) : = 4.15 ( q , j = 7.1 hz , 2 h ) , 3.89 ( s , 1 h ) , 3.80 ( s , 1 h ) , 2.82 ( t , j = 10.7 hz , 1 h ) , 2.31 ( tt , j = 10.6 , 6.6 hz , 1 h ) , 2.20 ( dd , j = 10.8 , 8.4 hz , 1 h ) , 1.42 ( s , 9 h ) , 1.30 ( d , j = 6.0 hz , 3 h ) , 1.24 ( t , j = 7.1 hz , 3 h ) , 1.03 ( d , j = 6.4 hz , 3 h ) ppm . c nmr ( 6e , 101 mhz , cdcl3 ) : = 172.4 , 154.6 , 79.2 , 60.5 , 55.0 , 52.6 , 33.8 , 28.6 , 20.7 , 14.4 , 14.1 ppm . c nmr ( 6e , 101 mhz , cdcl3 ) : = 172.8 , 154.2 , 79.4 , 60.9 , 59.8 , 57.0 , 53.2 , 36.5 , 28.6 , 21.03 , 16.2 , 14.4 ppm . ir ( 6e , neat ) : = 2974 , 2937 , 2876 , 1733 , 1692 , 1457 , 1390 , 1282 , 1252 , 1174 , 1107 , 1062 , 1029 , 954 , 869 , 775 cm . ir ( 6e , neat ) : = 2974 , 2933 , 2876 , 1733 , 1692 , 1457 , 1394 , 1290 , 1256 , 1163 , 1096 , 1033 , 910 , 869 , 772 cm . hrms ( 6e , esi ) : calcd . for c14h25nnao4 [ m + na ] 294.1676 ; found 294.1678 . hrms ( 6e , esi ) : calcd . for c14h25nnao4 [ m + na ] 294.1676 ; found 294.1683 . compound ( ) 6f : elution with npentane / diethyl ether ( 1:1 ) ; colorless oil ; yield : 82 mg ( 50 % with 4f , dr = 74:26 ) ; r f ( npentane / diethyl ether , 1:1 ) = 0.13 . h nmr ( major diastereomer , 400 mhz , cdcl3 ) : = 7.407.08 ( m , 10 h ) , 5.12 ( s , 1 h ) , 3.99 ( dd , j = 12.1 , 7.9 hz , 1 h ) , 3.41 ( dd , j = 12.1 , 10.2 hz , 1 h ) , 3.253.18 ( m , 1 h ) , 2.822.62 ( m , 1 h ) , 1.91 ( s , 3 h ) , 0.68 ( d , j = 6.8 hz , 3 h ) ppm . h nmr ( minor diastereomer , 400 mhz , cdcl3 ) : = 7.407.08 ( m , 10 h ) , 5.50 ( s , 1 h ) , 3.89 ( dd , j = 9.9 , 7.6 hz , 1 h ) , 3.32 ( t , j = 10.0 hz , 1 h ) , 3.253.18 ( m , 1 h ) , 2.822.62 ( m , 1 h ) , 2.24 ( s , 3 h ) , 0.70 ( d , j = 6.8 hz , 3 h ) ppm . c nmr ( major diastereomer , 101 mhz , cdcl3 ) : = 170.6 , 142.8 , 140.4 , 129.1 , 128.9 , 128.1 , 127.7 , 127.2 , 125.6 , 69.1 , 58.7 , 52.4 , 33.2 , 22.5 , 13.9 ppm . c nmr ( minor diastereomer , 101 mhz , cdcl3 ) : = 169.5 , 142.6 , 139.9 , 128.7 , 128.6 , 128.2 , 127.1 , 127.0 , 125.5 , 66.5 , 56.5 , 53.9 , 35.0 , 23.0 , 13.9 ppm . ir ( neat ) : = 3063 , 3030 , 2963 , 2930 , 2874 , 1722 , 1648 , 1495 , 1454 , 1409 , 1357 , 1279 , 1245 , 1178 , 1137 , 1081 , 1029 , 973 , 913 , 865 , 801 , 749 , 701 cm . hrms ( apci ) : calcd . for c19h22no [ m + h ] 280.1696 ; found 280.1702 . compound ( + ) 6ga : elution with npentane / diethyl ether ( 2:1 ) ; colorless oil ; yield : 132 mg ( 30 % with 5 g , dr = 73:27 ) ; isolation of major diastereomer by additional column chromatography , yield : 96 mg ( 22 % ) ; r f ( npentane / diethyl ether , 1:1 ) = 0.33 ; d = + 1.7 ( c = 1.0 , chcl3 ) . h nmr ( 400 mhz , cdcl3 ) : = 8.20 ( d , j = 8.6 hz , 1 h ) , 7.42 ( d , j = 8.7 hz , 1 h ) , 4.764.51 ( m , 1 h ) , 4.37 ( d , j = 10.9 hz , 1 h ) , 4.28 ( q , j = 7.1 hz , 2 h ) , 4.233.87 ( m , 2 h ) , 3.062.81 ( m , 2 h ) , 2.27 ( s , 1 h ) , 1.49 ( s , 9 h ) , 1.33 ( t , j = 7.1 hz , 3 h ) , 0.93 ( d , j = 6.4 hz , 3 h ) ppm . c nmr ( 101 mhz , cdcl3 ) : = 157.7 , 154.3 , 151.6 , 147.6 , 147.4 , 129.3 , 129.1 , 125.6 , 124.2 , 80.9 , 80.4 , 66.0 , 65.4 , 63.3 , 56.9 , 55.7 , 54.5 , 53.9 , 41.5 , 41.0 , 40.4 , 34.4 , 32.0 , 31.6 , 30.5 , 29.8 , 28.6 , 14.9 , 14.0 ppm . ir ( neat ) : = 2967 , 2930 , 2874 , 1771 , 1745 , 1692 , 1603 , 1521 , 1394 , 1346 , 1305 , 1252 , 1159 , 1129 , 1014 , 853 , 753 , 701 cm . hrms ( esi ) : calcd . for c13h16n2o5 [ m + h c4h8 ] 381.1292 ; found 381.1293 . compound ( + ) 6 gb : elution with npentane / diethyl ether ( 2:1 ) ; colorless oil ; yield : 88 mg ( 28 % with 4 g , dr = 68:32 ) ; isolation of major diastereomer by additional column chromatography , yield : 56 mg ( 18 % ) ; r f ( npentane / diethyl ether , 1:1 ) = 0.61 ; d = + 2.5 ( c = 1.0 , chcl3 ) . h nmr ( 400 mhz , cdcl3 ) : = 8.238.08 ( m , 4 h ) , 8.01 ( s , 1 h ) , 7.40 ( d , j = 8.7 hz , 2 h ) , 4.71 ( dd , j = 10.9 , 3.6 hz , 1 h ) , 4.654.43 ( m , 1 h ) , 4.424.19 ( m , 1 h ) , 4.193.97 ( m , 1 h ) , 3.072.72 ( m , 2 h ) , 2.342.19 ( m , 1 h ) , 1.50 ( s , 9 h ) , 0.92 ( d , j = 6.4 hz , 3 h ) ppm . c nmr ( 101 mhz , cdcl3 ) : = 163.5 , 154.5 , 153.9 , 147.7 , 147.3 , 132.8 , 132.5 , 132.1 , 131.8 , 129.6 , 128.9 , 126.6 , 124.2 , 121.5 , 81.1 , 80.6 , 66.7 , 66.1 , 63.1 , 58.5 , 57.6 , 54.6 , 54.0 , 42.0 , 41.6 , 28.6 , 14.9 ppm . ir ( neat ) : = 2971 , 2930 , 2874 , 1733 , 1692 , 1603 , 1525 , 1457 , 1394 , 1349 , 1279 , 1249 , 1170 , 1133 , 984 , 913 , 846 , 753 cm . hrms ( esi ) : calcd . for c26h26f6n2nao6 [ m + na ] 599.1587 ; found 599.1587 . compound ( ) 6h : elution with npentane / diethyl ether ( 7:1 to 1:1 ) ; colorless oil ; yield : 140 mg ( 47 % with 5h ) and 97 mg ( 45 % with 4h ) ; r f ( npentane / etoac , 3:1 ) = 0.34 . h nmr ( 400 mhz , cdcl3 ) : = 7.407.04 ( m , 5 h ) , 5.395.13 ( m , 3 h ) , 4.36 ( dq , j = 15.0 , 2.2 hz , 1 h ) , 4.284.12 ( m , 3 h ) , 3.46 ( s , 1 h ) , 1.561.13 ( m , 12 h ) ppm . c nmr ( 101 mhz , cdcl3 ) : = 171.2 , 154.1 , 143.1 , 142.0 , 128.5 , 127.3 , 125.7 , 111.2 , 79.9 , 65.9 , 63.9 , 61.4 , 58.4 , 51.2 , 28.3 , 14.2 ppm . ir ( neat ) : = 3064 , 2978 , 2933 , 2870 , 1733 , 1696 , 1454 , 1390 , 1320 , 1252 , 1159 , 1111 , 1033 , 898 , 753 , 701 cm . hrms ( apci ) : calcd . for c19h26no4 [ m + h ] 332.1856 ; found 332.1861 . compound 11 : elution with hexanes / etoac ( 6:1 ) ; colorless oil ; yield : 167 mg ( 73 % with 3a , dr = 59:32:9 ) ; r f ( hexanes / etoac , 1:1 ) = 0.81 . h nmr ( major diastereomer , 400 mhz , cdcl3 ) : = 4.80 ( d , j = 6.1 hz , 1 h ) , 4.264.16 ( m , 4 h ) , 4.164.08 ( m , 1 h ) , 3.63 ( dd , j = 8.3 , 6.2 hz , 1 h ) , 3.24 ( dd , j = 8.3 , 6.1 hz , 1 h ) , 2.67 ( dquint , j = 13.4 , 6.8 hz , 1 h ) , 1.321.23 ( m , 6 h ) , 1.040.98 ( m , 2 h ) ppm . h nmr ( minor diastereomer 1 , 400 mhz , cdcl3 ) : = 4.72 ( d , j = 7.4 hz , 1 h ) , 4.264.16 ( m , 4 h ) , 4.164.08 ( m , 1 h ) , 3.58 ( t , j = 8.7 hz , 1 h ) , 2.77 ( dt , j = 11.1 , 5.6 hz , 1 h ) , 2.622.51 ( m , 1 h ) ,1.321.23 ( m , 6 h ) , 1.151.10 ( m , 2 h ) ppm . h nmr ( minor diastereomer 2 , 400 mhz , cdcl3 ) : = 4.65 ( d , j = 8.3 hz , 1 h ) , 4.264.16 ( m , 4 h ) , 4.164.08 ( m , 1 h ) , 3.48 ( t , j = 8.0 hz , 1 h ) , 2.95 ( t , j = 8.4 hz , 1 h ) , 2.67 ( dquint , j = 13.4 , 6.8 hz , 1 h ) , 1.321.23 ( m , 6 h ) , 1.151.10 ( m , 2 h ) ppm . c nmr ( major diastereomer , 75 mhz , cdcl3 ) : = 172.0 , 171.2 , 78.7 , 75.7 , 61.5 , 61.2 , 52.3 , 36.8 , 14.5 , 14.3 , 13.4 ppm . hrms ( esi ) : calcd . for c11h18do5 [ m + h ] 232.1290 ; found 232.1288 .\noutput:\n" }, { "from": "agent", "value": "the synthesis of chiral tetrahydrofurans and pyrrolidines starting from 1,2 diols or amino alcohols , respectively , by visiblelightmediated deoxygenation is described . easily accessible monoallylated / propargylated substrates were activated either as inexpensive ethyl oxalates or as recyclable 3,5 bis ( trifluoromethyl ) benzoates to generate alkyl radicals suitable for 5exotrig / 5exodig cyclizations under visiblelight irradiation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: diabetes mellitus is a serious social problem . according to the world health organization ( who ) , in 2030 the number of people with diabetes worldwide will increase to 360 million , representing 4.5 % of the global population . diabetic nephropathy is the most frequent complication of diabetes that develops in up to 3040 % of patients . the main change of diabetic nephropathy is a thickening of the glomerular basement membrane and expansion of ecm proteins . hyperglycemia results in the activation of tissue angiotensin ii , which plays an important role in the pathogenesis of kidney disease , through inflammation , fibrosis , vascular wall remodeling , and oxidative stress . it was shown that blocking the at1 receptor and angiotensin ii - converting enzyme reduces the levels of inflammatory factors ( nf - kb , il - 6 , and tnf - 1 ) and is responsible for the processes of fibrosis ( ctgf and tgf - 1 ) . fibronectin is a glycoprotein present in the extracellular matrix , basal membranes , plasma , and other body fluids . the gene expression of fn in tissues of healthy adults is generally low and increases in areas of wound healing and damaged tissue . hyperglycemia causes increased expression of genes responsible for synthesis of fn .22.1 ) belongs to a class of cysteine proteinases and has optimum activity in acidic environment but can also be active in other ph ranges . it degrades structural proteins and enzymes in the cell , degrades the main elements of the basement membrane , and activates proenzymes , hormones , and growth factors involved in the induction phase and the executive apoptosis . it has been shown that the decrease of the activity of proteolytic enzymes in the states of hyperglycemia is genetically determined as type 2 diabetes in rats and in isolated glomeruli of diabetic rats . the aim of this study was to assess the impact of multilevel blocking of the raas using an ace inhibitor , at1 receptor antagonist , administered separately and together , an inhibitor of aldosterone on the activity of cathepsin b , and fibronectin accumulation in the glomerular in the course of diabetic nephropathy in the diabetes model in rats . this study was performed in accordance with the ethical committee affairs experiments on animals of the medical university of warsaw ( opinion number 5/2006 ) . rats in the 4 groups were treated with inhibitors of the raa system , drugs were administered in drinking water in the morning : en : enalapril 3.2 mg / kg / day ; los : losartan 15 mg / kg / day ; en + los : enalapril and losartan , respectively , 3.2 and 7.5 mg / kg / day ; spir : spironolactone 15 mg / kg / day . another group received dih , dihydralazine , 2.7 mg / kg / day and the dm group did not receive any drug . the animals were followed up for six weeks ( five weeks , the duration of action of drugs ) , and blood glucose was regularly analyzed . when blood glucose was above 700 mg / dl , insulin was administered at a dose of 0.251.0 iu / day . in the last week of the experiment , rats ' blood pressure was measured using a pressure sensor apm mk - 9301 ( mk - design , usa ) . a 24 hr urine collection was obtained at the end of the 6 - week study using metabolic cages and urinary creatinine and microalbumin were measured . one of the kidneys was stored in saline in an ice bath until the isolation of glomeruli . the plasma biochemical tests performed are the following : glucose , total protein , albumin , creatinine , urea , and bicarbonate . isolated glomeruli were homogenized with a homogenizer labsonic u ( b braun , usa ) . dna in homogenates of glomeruli was determined using the fluorometric reagent bisbenzimide h 33258 ( hoechst , germany ) as previously described . protein in homogenates of glomeruli was determined spectrophotometrically using the bca assay ( bicinchoninic acid ) , protein assay reagent ( pierce , beijerland , netherlands ) . cathepsin b activity in glomerular homogenates , urine , and plasma was measured fluorometrically using the synthetic substrate z - arg - arg - amc ( n - co2 - l - arginyl - arginine -7-amino-4-methylocoumarin salt ) ( bachem , biochemica gmbh , heidelberg , germany ) as previously described . fn concentration was determined by elisa ( enzyme - linked immunosorbent assay ; immunoenzyme test ) as previously described . immunohistochemical staining was performed in paraffin sections of kidney with an antibody against fibronectin ( chemicon international , usa ) . immunohistochemical analysis began with the assessment of the entire tissue section to determine representative areas . we evaluated 20 subsequent glomeruli within the renal cortex of representative areas . in relation to the glomerular vascular loops , each immunohistochemical reaction assessment was based on an analysis of two features : the intensity of the antibody reaction and the percentage of immunopositive vascular loops . immunohistochemical expression was evaluated semiquantitatively using a 4 - point scale : ( 0 ) no reaction or very weak and focal ( 1 % ) expression ; ( 1 + ) low intensity reaction , with moderate intensity expression of 50 % of vascular loops and high intensity expression being segmental and in 25 % of vascular loops ; ( 2 + ) moderate intensity expression involving 50 % of vascular loops and high - intensity expression being segmental or continuous involving 2575 % of vascular loops ; ( 3 + ) high intensity expression that is continuous and includes 75 % of vascular loops.immunohistochemical expression of all markers tested within the mesangium was evaluated in a similar fashion . the final evaluation for each specimen was the average ( rounded to unity ) from the analysis of 20 glomeruli . ( 0 ) no reaction or very weak and focal ( 1 % ) expression ; ( 1 + ) low intensity reaction , with moderate intensity expression of 50 % of vascular loops and high intensity expression being segmental and in 25 % of vascular loops ; ( 2 + ) moderate intensity expression involving 50 % of vascular loops and high - intensity expression being segmental or continuous involving 2575 % of vascular loops ; ( 3 + ) high intensity expression that is continuous and includes 75 % of vascular loops . the results obtained were analyzed using statistica , version 9.0 which is available at the medical university of warsaw . statistical nonparametric tests were used : anova rank kruskal - wallis . obtaining a result of analysis of the level of significancep 0.05 was an indication for the use of post hoc test , duncan . the value of kidney weight given as a percentage of final body weight in the group of untreated diabetic rats was 0.600.06 % and was significantly higher compared to the group of diabetic rats treated dihydralazine ( 0.540.05 % , p = 0.01 ) . in addition , statistically significant differences were demonstrated between the group of diabetic rats treated dihydralazine and groups with diabetes treated enalapril ( p = 0.01 ) , losartan ( p = 0.0001 ) , enalapril and losartan in combination ( p = 0.01 ) , and spironolactone ( p = 0.04 ) , and between group of diabetic rats treated with spironolactone and losartan ( p = 0.03 ) ( table 3 , figure 1 ) . the coefficient protein / dna in homogenates of glomeruli in the group of untreated diabetic rats was 23.36.50 g / g and was significantly higher compared to a group of diabetic rats treated losartan 15.685.71 g / g , p = 0.01 , and a group of rats treated spironolactone 17.314.2 g / g , p = 0.045 ( table 3 , figure 2 ) . activity of cathepsin b in terms of microgram of dna in homogenates of glomeruli in the group of untreated diabetic rats was 30.609.65 iu / g and was lower compared to the group of diabetic rats treated with enalapril and losartan in combination ( p = 0.04 ) and a group of rats diabetes treated with spironolactone ( ns ) and , respectively , was 51.7920.37 and 44.8832.18 iu / g . in the groups , diabetic rats treated with enalapril , losartan , and dihydralazine cathepsin b activity per g of dna were insignificantly lower compared with untreated diabetic rats and were , respectively , 25.9916.75 , 21.7114.32 , and 22.7014.97 iu / g . in addition , statistically significant differences were demonstrated between the group of diabetic rats treated with enalapril and losartan together , a group of diabetic rats treated with enalapril ( p = 0.01 ) , losartan ( p = 0.01 ) , and dihydralazine ( p = 0.01 ) , and groups of diabetic rats treated with spironolactone and enalapril ( p = 0.05 ) , losartan ( p = 0.02 ) , and dihydralazine ( p = 0.03 ) . similar results were obtained converting activity of cathepsin b in homogenates of glomeruli in microgram of protein , table 3 , figure 3 . fibronectin concentration values per 1 g of protein in homogenates of glomeruli in the untreated diabetic rats and the other treated diabetic rats showed no statistically significant differences . similar results were obtained converting the concentration of fibronectin in glomerular homogenates for the presence of dna ( table 3 , figure 4 ) . the content of fibronectin in kidney glomeruli evaluated immunohistochemical staining in the untreated diabetic rats was 2.330.52 score and was higher compared to the other groups examined , including significantly higher ( p = 0.003 ) compared to the diabetic rats treated spironolactone 0.900.99 score . additionally , statistically significant differences have been shown between groups of diabetic rats treated with spironolactone and enalapril ( p = 0.02 ) and diabetic rats treated with spironolactone and losartan and enalapril in combination ( p = 0.003 ) ( table 3 , figures 5 and 6 ) . our study , performed on an animal model of diabetes mellitus induced by streptozotocin , aimed at assessing the impact of raas blocking on the activity of cathepsin b and the accumulation of fn . rats of groups 15 were treated with an ace inhibitor , at1 receptor antagonist , administered separately and together , and an inhibitor of aldosterone and dihydralazine . the rats in group number 6 were not treated and they constituted the control group . in the renal cortex of diabetic rats treated and untreated , performed immunohistochemical evaluation of fibronectin was observed . the activity of cathepsin b and the concentration of fn were assessed in homogenates of glomeruli , in 24 hour urine and plasma . fibronectin is a protein of the extracellular matrix , produced by the cells and endothelial mesangium . in mild and moderate diabetic nephropathy , accumulation of fn in the matrix mesangium has been shown and increased excretion in the urine does appear up earlier than microalbuminuria . in previous studies , the correlation between the accumulation fn and cathepsin b activity in the kidney glomerulus in diabetic rats has been shown . the genetically determined type ii diabetes in rats showed an increased accumulation of fibronectin ( fn ) in the kidney glomerulus . cumulative increase in ecm proteins in glomeruli depends on the increase of synthesis and / or reduces protein degradation . proteolytic enzymes are responsible for maintaining the balance of synthesis and degradation of components of the extracellular matrix ( ecm ) . . showed a decrease of fn immunoreactivity in the kidney glomerulus in rats with hypertension that have blocked aldosterone and angiotensin ii . in the present study the contents of the fn , determined by immunohistochemical staining in renal glomeruli of diabetic rats treated with enalapril , losartan , spironolactone , and dihydralazine were lower compared to the amount of fn in the renal glomeruli of rats with untreated diabetes . the largest decrease in the content fn was obtained in the group of diabetic rats receiving spironolactone ( p = 0.003 ) . no fn obtained reduction in kidney glomerulus of diabetic rats was treated with enalapril and losartan together . the concentration of fibronectin in glomerular homogenates , based on dna , in groups of diabetic rats treated has only a slight decrease compared to untreated diabetic rats . similarly to the fibronectin excretion in the urine per mg creatinine , it has slightly decreased in the groups treated diabetic rats compared to untreated diabetic rats , while the concentration of fn in plasma of rats in all groups examined were in similar extent . rao et al . giving the rats streptozotocin diabetes acei and at1 blocker received separately and together decrease the concentration of fn in the plasma . the reduction ratio kidney weight / body weight , reflecting the development of kidney hypertrophy , was obtained only in the group of diabetic rats treated with dihydralazine . the coefficient of protein / dna , reflecting glomerulosclerosis , was decreased in the group with diabetic rats treated with losartan ( p = 0.01 ) and spironolactone ( p = 0.045 ) . in the other groupstreated diabetic rats have shown a downward trend compared to the group of untreated diabetic rats . a significant reduction of albuminuria has been shown in diabetic rats treated with dihydralazine compared to untreated diabetic rats . in other groups of diabetic rats receiving treatment , a decreasing trend of albuminuria has been shown in relation to untreated diabetic rats . rao et al . demonstrated reduction in daily urinary albumin excretion in treated diabetic rats compared to untreated diabetic rats . angiotensin ii stimulates the synthesis of ecm proteins and causes a decrease activity of proteolytic enzymes .22.1 ) belongs to a class of cysteine proteinases and plays many functions in physiological and pathological processes . reduction of the activity of proteolytic enzymes in the states of hyperglycemia in the genetically determined type 2 diabetes in rats and in streptozotocin diabetic rats has been shown . multilevel blocking of the raa system significantly increased activity of cathepsin b in homogenates of glomerular in diabetic rats treated with spironolactone ( p = 0.02 ) and in combination with therapy with losartan and enalapril ( p = 0.001 ) compared to the untreated diabetic rats . dihydralazine administration , enalapril , or losartan in rats with diabetes did not lead to the expected results . showed a beneficial effect of treatment acei to restore the activity of cathepsin b in the heart and kim et al . demonstrated that combination therapy acei and arb ( angiotensin - ii receptor blocker ) can effectively prevent or reverse myocardial fibrosis . . showed that the development of an end - stage renal failure and change micro - to macroalbuminuria were significantly reduced after treatment of acei versus placebo and arb versus placebo . this effect is not present in combined therapy ( acei + arb ) versus monotherapy . assessing the activity of cathepsin b in 24 - hour urinehas shown a downward trend in the values of individual treatment groups compared to diabetic rats which are not treated . the values of cathepsin b in the plasma of rats in all groups studied were similar and showed no tendency . recently it is proved that the process of autophagy and activity of cathepsins are strictly linked to the process of inflammation .\noutput:\n" }, { "from": "agent", "value": "hyperglycemia results in the activation of tissue angiotensin ii . angiotensin ii stimulates the synthesis of ecm proteins and causes a decrease activity of proteolytic enzymes . the aim of this study was to assess the impact of multilevel blocking of the raas , cathepsin b activity , and fibronectin accumulation in the glomerular in the rats diabetes model . sixty male wistar rats were initially included . diabetes was induced by intravenous administration of streptozotocin . the animals were randomized to six groups of ten rats in group . rats in the four groups were treated with inhibitors of the raas : enalapril ( en ) , losartan ( los ) , enalapril plus losartan ( en + los ) , and spironolactone ( spir ) ; another group received dihydralazine ( dih ) and the diabetic rats ( dm ) did not receive any drug . after six weeks , we evaluated blood pressure , 24 h urine collection , and blood for biochemical parameters and kidneys . in this study , fluorometric , elisa , and immunohistochemical methods were used . administration of en + los increased activity of cathepsin b in homogenates of glomeruli compared to dm . losartan treatment resulted in reduction of the ratio kidney weight / body weight compared to untreated diabetic rats . spir resulted in the increase activity of cathepsin b in the homogenate of glomeruli . the values of cathepsin b in the plasma of rats in all studied groups were similar and showed no tendency ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is accompanied by inflammatory cellular infiltration with lymphocytes , plasma cells , macrophages , and mast cells of interstitial tissues , orbital fat , and lacrimal glands associated with accumulation of glycosaminoglycans and retention of fluid . this causes increase in the volume of orbital contents and secondary elevation of intraorbital pressure . increased intraorbital pressure and the swelling of the extraocular muscles at the apex cause compressive optic neuropathy and visual loss . it was shown that optic disc function may be affected in tao patients without obvious optic neuropathy and extraocular muscle swelling . so some diagnostic and follow - up tests were previously used to evaluate the visual function of the patients with tao , such as visual field test , contrast sensitivity test , visual evoked potential , and color sensation test . optical coherence tomography ( oct ) is an alternative and noninvasive test to evaluate the macula and the optic disc . previously , only three studies investigating retinal nerve fiber layer thickness and optic disc morphology measured by oct in tao patients were reported and there is no study evaluating macular thickness by oct in tao patients . in this study , we have examined retinal nerve fiber thickness , macula , and optic nerve head by oct in tao patients and compared the measurements of tao patients with those of age - and sex - matched healthy subjects . sixty - six patients with ophthalmopathy who were diagnosed as thyroid pathology by the department of endocrinology , ondokuz mays university , samsun , turkey , and were sent to ophthalmology clinic for eye involvement and 36 healthy volunteers who formed the control group were included in our study . written informed consents were obtained from all subjects . the study was approved by the human research ethics committee of ondokuz mays university , samsun , turkey , and was conducted in accordance with the tenets of the declaration of helsinki . the control group was chosen among healthy volunteers who did not have any eye pathology , who had a 20/20 vision ( corrected or uncorrected ) , and who were age - and sex - matched with the patient group . in both groups , those who had significant sight impairment , high myopia ( 5 d ) , high hyperopia ( + 3 d ) , optic disc anomaly , vitreoretinal interface disease , vascular and degenerative retinal diseases , cornea or lens opacity , ocular surgery history , glaucoma , neurological diseases that can affect the visual field , history of trauma , amblyopia , diplopia , keratitis , and history of topical or systemic steroid use were not included in the study . medical history of all the cases was taken , and the cases underwent a detailed ophthalmologic examination which included best - corrected visual acuity , color vision , biomicroscopic anterior segment examination , and intraocular pressure measurement in sitting position with the goldmann applanation tonometry and dilated fundus examination . the proptosis levels of all cases included in the study were measured with hertel exophthalmometer . ophthalmic involvement of the patients with thyroid - associated ophthalmopathy was scored according to the nospecs classification . the patients in the research group were grouped according to their measurements of hertel exophthalmometer . the first group was those between 21 and 23 mm , the second group was those 23 mm , and the third group was those with a difference of more than 2 mm between the eyes . , dublin , california , usa ) ( software version 4.4 ) was employed to measure the eyes of tao patients and control group . the differences between the right and left eyes were examined and they were separately compared with the control group . whether there was correlation between the period of time that passed between the time when the diagnosis of thyroid was made and the time ophthalmopathy was seen , the data obtained from the study was transferred to computer and analyzed with spss 15.0 ( spss , chicago , ii , usa ) package program . the normality test in patient and control groups was checked and paired samples t - test was used for the values which were normally distributed while the wilcoxon rank test was used for the values which were not normally distributed . the values with p 0.05 were considered to be statistically significant . in the comparison of the patient and control groups , student 's t - test was used for data with parametric distribution while mann - whitney u test was used for data with no parametric distribution . one hundred and thirty - two eyes of 66 patients who were diagnosed as thyroid ophthalmopathy and the 72 eyes of 36 healthy volunteers were included in the study . mean ages were 40.112.6 years ( range : 1273 years ) and 38.39.7 ( range : 1369 years ) for the tao and control groups , respectively , while no significant difference was found between the two groups ( p 0.05 ) . forty - three ( 65.2 % ) of the tao group were female while 23 ( 34.8 % ) were male and 25 ( 69.4 % ) of the control group were female while 11 ( 30.6 % ) were male . no statistically significant differences were found between the two groups in terms of demographic features ( p 0.05 ) . mean hertel exophthalmometer values were 19.13.0 mm and 15.21.2 mm for the tao and control group , respectively , and the difference was statistically significant ( p 0.05 ) . all of the patients had bilateral tao and the nospecs score of the patients was 2.40.9 ( range : 15 ) . mean intraocular pressure was 14.32.7 mmhg for the tao patients . the averages were 14.32.6 mmhg and 14.32.7 mmhg for the right and the left eye , respectively ( p 0.05 ) . mean iop was 13.01.9 mmhg and 12.72.0 mmhg for the right and the left eye of control group , respectively ( p 0.05 ) . when the patient group with tao and the control group were compared for iop , the difference between the mean iop values was statistically significant ( p = 0.011 ) . in addition , the difference was also statistically significant when the right and left eyes of the tao and the control group were compared with each other ( p 0.05 ) ( table 1 ) . mean temporal and inferior rnfl thicknesses of the tao group were 72.115.4 m and 124.814.8 m , respectively , for the right eye while they were 65.110.7 m and 116.517.8 m , respectively , for the left eye and the difference between the left and right eyes was statistically significant ( p 0.05 ) . mean inferior rnfl thicknesses of the control group were 130.620.4 m and 123.318.3 m , respectively , for the right and the left eye and the difference was statistically significant ( p = 0.021 ) . no significant difference was found between tao patients and the controls for the other rnfl values . no significant difference in rnfl thicknesses for both right and left eyes separately was found between the groups ( table 1 ) . when both eyes of the patients in the control and patient groups were assessed together for rnfl , only the difference between the inferior rnfl values of the patient and the control group was found to be statistically significant . mean inferior rnfl thicknesses were 120.716.8 m and 127.019.6 m for the patient and the control groups , respectively ( p 0.05 ) ( table 2 ) . only mean superior macula thickness of the patient group showed significant difference between the right and left eyes ( p = 0.031 ) although there was no difference between the eyes for exophthalmometer measurements ( p 0.05 ) . mean of superior macula thicknesses in tao group was 254.014.2 m and 256.114.5 m for the right and left eye , respectively . no significant difference was found between the right and left eye for any macula parameters in control group . the right mean macula thickness and central , temporal , superior , and nasal quadrant thicknesses of the patient group were found to have significant thinning when compared with the right eye of the control group ( p 0.05 ) ( table 1 ) . in the left eye , this thinning was seen in mean macula thickness and central and temporal macula thicknesses ( p 0.05 ) . when both eyes of the patients in the control and patient groups were assessed together , a thinning was observed in the macula thicknesses of all quadrants in the study group ( p 0.05 ) ( table 2 ) . in terms of optic disc , when the right disc area and the left disc area were checked , a significant increase was seen in the patient group ( p 0.05 ) ( table 1 ) . no significant difference was found between the right and the left eyes in terms of other disc values . when both eyes of the patients in the control and tao groups were assessed together , a statistically significant increase was found in the patient group in terms of disc area and c / d ratio ( p 0.05 ) ( table 2 ) . a total of 47 patients who had proptosis values of 21 mm and over 21 mm were grouped in three and compared with the control group . in the classification of the patient group with tao , there were 33 eyes in the first group ( 2123 mm ) , 10 eyes in the second group ( 23 mm ) , and 4 eyes in the third group ( 2 mm difference ) . when the intraocular pressure values were analyzed , mean iop measurements were 15.12.4 mmhg in the first group , 16.32.0 mmhg in the second group , and 17.04.5 mmhg in the third group and no statistically significant differences were found between the groups ( p 0.05 ) . the mean iop measurements of the control group and the three groups were 12.91.9 mmhg and 15.52.5 mmhg , respectively , and the difference between them was statistically significant ( p = 0.000 ) ( table 2 ) . in the comparison of the three groups separately with the control group in terms of iop values , the differences were found to be statistically significant ( p = 0.000 ) ( table 3 ) . in the comparison of tao groups with one another in terms of iop values , when the correlation between iop and proptosis values was analyzed , no important correlation was found in group 1 . group 2 was found to have a moderate positive correlation ( r = 0.68 , p = 0.27 ) while group 3 was found to have a poor positive correlation ( r = 0.19 , p 0.05 ) . in the comparison of the three groups ( 47 eyes ) with the control group ( 72 eyes ) , inferior rnfl thicknesses were 120.017.5 m and 127.019.6 m in the tao and control group , respectively ( p = 0.05 ) . in the comparison of macula values , mean and central macula thicknesses of the patient group were found to be thinner than the control group ( p 0.05 ) . in the comparison of disc parameters , disc area and c / d ratiowere found to be greater in the patient group when compared with the control group ( p 0.05 ) . no significant difference was found in terms of other rnfl , macula , and disc values ( p 0.05 ) . when groups 1 and 2 were compared , vertical c / d ratio was found to be 0.470.15 and 0.330.18 , respectively , and the difference between them was found to be statistically significant ( p = 0.016 ) . disc areas were 2.660.48 mm and 2.150.53 mm , respectively , and the difference was found to be statistically significant ( p = 0.007 ) . when the 10 eyes in the second group which had hertel exophthalmometer values of 23 mm were compared with the control group , only the thinning in the rim areano statistically significant difference was found for the other values ( p 0.05 ) . when groups 1 and 3 and groups 2 and 3 were compared in terms of rnfl , macula , and disc values , no statistically significant difference was found . when the correlations between the time that passes between the diagnosis of thyroid and the occurrence of ophthalmopathy ( 15.441.7 months ) , nospecs and clinical activity score , and the oct measurements were analyzed , statistically insignificant and poor correlation was found ( r between 0.05 and 0.30 , p 0.05 ) . thyroid - associated ophthalmopathy ( tao ) is a progressive and organ specific autoimmune disease . in tao patients , one of the most important circumstances that need to be assessed before the decision of treatment is the activity of the disease . tao starts with an active progressive phase and then it moves to the inactive phase . clinical activity scoring ( cas ) system is used to find out the disease activity . in our study , the mean cas of the tao patient group was 1.41.1 . although most of the patients were at early phase of the disease in the study , we found that mean inferior rnfl was significantly thinner in the tao group when compared with the controls and there was no statistically significant difference for mean rnfl thickness between groups . wei et al . studied 151 eyes of 76 tao patients with eye movement restriction in any 1 of 4 primary directions . they reported that the cross - sectional area of all rectus muscles obtained by computerized tomography was not significantly correlated with logmar or proptosis , nor with the total thickness of the peripapillary nerve fiber layer ( rnfl ) , and the sum of all quadrants of the peripapillary nerve fiber layer thickness was not significantly correlated with other visual function parameters . wei et al . did not use the rnfl parameters ( superior , inferior , temporal , and nasal ) separately for the analysis in their study and they used the sum of all quadrants of rnfl thickness , and they performed the measurements in chinese people . it was known that normative data of rnfl measurements may show some varieties in different races . so we measured rnfl thicknesses of age - and sex - matched healthy caucasians for the comparison in our study . in some cases , there are some cases of dysthyroid optic neuropathy with progressive visual field loss , but with normal - sized or minimally enlarged extraocular muscles . inferior and temporal rnfl values of the left eye in tao group and inferior rnfl values of the left eye in control group were found significantly thinner than the right eye . although there were no statistically significant differences between the right and the left eyes in terms of proptosis and iop values , it was thought that the difference in rnfl thickness within the groups could be resulting from the fact that tao affected eyes in the same patient in different degrees because of the factors other than iop and proptosis . although tao frequently shows bilateral involvement , studies have shown that the involvement can also be asymmetric . it has been stated that orbital structural differences may cause asymmetric blood flow , lymphatic drainage , or tissue enlargement and , as a result of this , bilateral but asymmetric involvement can be seen . it was reported that there was a statistically significant difference between right and left eyes in terms of inferior rnfl thickness in healthy people . similarly , a statistically significant difference was found between inferior rnfl thicknesses in the control group and this difference was thought to be physiological since none of the patients in the group had ophthalmologic diseases . there are studies which show that glaucoma prevalence in patients with thyroid pathology is higher when compared with the normal population . some of the studies show increases in iop while some show no differences . it was shown that when the patients with hypothyroidism were treated , a decrease in iop may be observed after the treatment and there was a possible effect of thyroid disease on iop . , ganglion cell damage was shown in macula . in sesar 's study , as a result of the decrease in iop after glaucoma filtration surgery , macular thicknesses increase within a month . they thought that this occurred as a result of the physiological response of retina to the sudden decrease in iop . tan et al . found that the macula thicknesses in perimetric glaucoma patients were thinner . in their study , arvanitaki et al . compared patients with a suspicion of glaucoma who have early manifest glaucoma and nontreated iop averages of 17 mmhg . they found that although there was no peripapillary rnfl change , there was a significant thinning in the superior , inferior , nasal , and temporal macular thicknesses of the patient group when compared with the control group . it has been suggested that the localized thinning in inferior and superior macula thicknesses might reflect the retinotopic distribution of the affected ganglion cells . in our study , thinning was observed in all segments of the macula of the tao group when compared with the control group . it was thought that the decreases in the macula thickness could be due to the higher values of iop and proptosis in tao groups when compared with the control group . it was also thought that optic nerve damage could occur as a result of fixed orbital volume despite the enlargement of retrobulber connective tissue , and as a result of this ganglion cell damage could occur which could first be seen with the thinning in macular thicknesses . nevertheless , it may be thought that the higher levels of iop in tao groups , even in normal limits , could cause ganglion cell damage and macular thinning , and the mechanical stress caused by the increase in iop could affect the macula before peripapillary nerve fiber damage because of a malady in retina inner dynamics . hypoxia and ischemia caused by the edema in the orbital soft tissues were thought to cause retinal changes before optic nerve compression developed . there are studies in literature which show thinning in the macula thicknesses in parallel with the severity of glaucoma and it was thought that macular ganglion cell complex thickness could be a more accurate indicator than peripapillary nerve fiber thicknesses in early glaucoma cases and this is used in monitoring the progression of the disease . it may be thought that the thinning of macular thickness in our study may be caused by thinning in macular ganglion complex . macular ganglion cell complex thickness should be investigated by spectral - domain oct in thyroid ophthalmopathy patients to detect the level of the thinning and the effect of the disease on the macular ganglion complex . poostchi et al . found an expansion in the disc area as a result of iop increase in patients who did not have glaucoma . in our study , it was thought that the increase in iop could be responsible for the expansion in disc area , c / d ratio and vertical and horizontal c / d ratio , and the thinning in the rim area . when the eyes of the patient group and the control group were compared , the mean iop in both eyes of the tao group was found significantly higher . reported that iop was higher in the tao patients and mean rnfl thickness of tao patients was thinner than those of control group . even if relatively milder cases according to the nospecs classification were included in our study , the increase in the iop of the patient group may be caused by the increased volume of intraorbital structures . . found that the plasma et - 1 levels were higher than normal levels in thyroid hormone disorders caused by graves ' disease . et - 1 , which is a strong vasoconstrictor , can show a decreasing effect on the blood flow of optic nerve head . peripapillary rnfl may be influenced by ischemic situations which are caused by the vasoconstrictor effect of et - 1 . even in the absence of glaucoma , this vascular deficiency in peripapillary area and retina can trigger some changes in the optic nerve head and macula . forte et al . found that there was a decrease in rnfl in patients with graves ' ophthalmopathy and ocular hypertension when compared with the control group and this decrease was found to be significantly higher in inferior and superior quadrants . in our study , a significant thinning was found in inferior rnfl thickness in tao patients when compared with healthy controls . in the study , we found that the macula and retinal nerve fiber layer thicknesses were thinner and intraocular pressure , disc area , and c / d ratio were higher in the patients with thyroid - associated ophthalmopathy . the study is the first one that shows the effects of thyroid ophthalmopathy on the macular thicknesses obtained by time - domain oct . the patients in our study were in early phases and oct parameters were not monitored for a long time . further longitudinal follow - up studies performed by spectral oct with homogenous sample are needed to see the long term effect of the disease on the rnfl thickness , optic disc , and macula .\noutput:\n" }, { "from": "agent", "value": "aim . to compare the measurements of retinal nerve fiber layer ( rnfl ) , macula and optic disc parameters obtained by optical coherence tomography ( oct ) , and intraocular pressure ( iop ) between the patients with thyroid - associated ophthalmopathy ( tao ) and healthy controls . methods . one hundred and thirty - two eyes of 66 patients with tao and 72 eyes of 36 healthy controls were included in the study . proptosis level was determined by hertel exophthalmometer . optic disc , peripapillary retinal nerve fiber layer , and macula parameters were measured by oct . all measurements of the patients were compared with those of age - and sex - matched healthy controls . results . no statistically significant difference was found between the patients with tao and control group in terms of demographic characteristics ( p > 0.05 ) . exophthalmometer measurements and iop were higher in tao group ( p < 0.05 ) . mean macula thicknesses in tao and control groups were 239.3 29.8 m and 246.6 31.8 m , respectively , and the difference between the groups was statistically significant ( p = 0.000 ) . tao group had thinner inferior rnfl thickness and macular thicknesses ( superior , inferior , temporal , and nasal ) and higher disc area and c / d ratio when compared with the control group ( p < 0.05 ) . conclusion . iop , disc area , and c / d area ratio were higher in the patients with tao and the thicknesses of macula and inferior rnfl were thinner when compared with healthy controls . this trial is registered with registration number at clinicaltrials.gov nct02766660 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: peripheral t - cell lymphoma ( ptcl ) represents a small , heterogeneous group of non - hodgkin lymphoma ( nhl ) which is derived from more mature t - cells and natural killer ( nk ) cells , and accounts for approximately 10 % of nhl cases in western countries and for approximately 20 % 25 % of those in japan . ptcl , a collective entity of nearly 20 different subtypes defined according to morphology , immunophenotype , genotype , and clinical features , can be largely classified into the following two groups according to clinical features including the sites of lesions : ( 1 ) cutaneous t - cell lymphoma ( ctcl ) , which is the general term for diseases that initially or mainly occur in the skin , and ( 2 ) ptcl other than ctcl . rituximab , an anti - cd20 monoclonal antibody , was developed for the treatment of b - cell lymphomas . the introduction of this agent into clinical practice has greatly improved the prognosis of patients with b - cell lymphoma . recently , bendamustine , which has little cross resistance with other chemotherapeutic agents presumably associated with its unique chemical structure of an alkylating agent and a nucleoside analog , has been developed as effective treatment of relapsed or refractory b - cell lymphoma , considering its lack of cross resistance with other chemotherapeutic agents . however , ptcl remains extremely difficult to treat , because most ptcl subtypes become refractory to even aggressive chemotherapy regimens or relapse , with the exception of anaplastic lymphoma kinase - positive anaplastic large cell lymphoma ( alk alcl ) , which responds well to the cyclophosphamide , doxorubicin , vincristine , and prednisone ( chop ) regimen . among the various entities of ptcls , adult t - cell leukemia - lymphoma ( atl ) , we will discuss novel agents that have been developed for the treatment of atl and other ptcls , mainly focusing on mogamulizumab / kw - 0761 , which is a humanized monoclonal antibody targeting cc chemokine receptor 4 ( ccr4 ) that has been actively developed for clinical use in japan and the united states . ptcl - not otherwise specified ( ptcl - nos ) and angioimmunoblastic t - cell lymphoma ( aitl ) , which are the most common subtypes of ptcl ( ptcl - nos , 26 % ; aitl , 19 % ) , show a poor prognosis with 5 - year overall survival ( os ) and failure - free survival ( ffs ) of about 30 % and 20 % , respectively . several new agents have recently been developed for the treatment of ptcl , mainly in patients with relapsed or refractory disease . such agents have various mechanisms of action , including an immunomodulator ( lenalidomide ) , a proteasome inhibitor ( bortezomib ) , histone deacetylase inhibitors ( vorinostat , romidepsin , panobinostat ) , antifolate ( pralatrexate ) , and biologics including antibodies and antibody - toxin / drug conjugates ( alemtuzumab , siplizumab , denileukin diftitox , and brentuximab vedotin ) as well as nucleoside analogs such as fludarabine , gemcitabine , nelarabine , and forodesine . of these agents , pralatrexate and romidepsin have been recently approved by the u.s . food and drug administration ( fda ) and are now being used in the u.s . for the treatment of relapsed or refractory ptcl . in 2011 , brentuximab vedotin ( formerly known as sgn - 35 ) was also approved for the treatment of relapsed or refractory alcl and hodgkin lymphoma . atl has the worst prognosis among ptcl , with 5 - year os and ffs of 14 % and 12 % , respectively . atl is a peripheral t - cell malignancy associated with human t - cell lymphotropic virus type i ( htlv - 1 ) , and is relatively frequent in southwestern japan , west africa , the caribbean islands , and brazil , which are htlv - 1 endemic areas . it is estimated that there are about 1.2 million htlv - 1 carriers in japan , of whom a few percent develop atl , and approximately 700 to 1000 people die of this disease per year . atl is classified into four disease subtypes ( acute , lymphoma , chronic , and smoldering ) , based on clinical features including leukemic changes , high lactate dehydrogenase , hypercalcemia and organ infiltration , and the median survival time varies according to the disease type : acute type , 6 months ; lymphoma type , 10 months ; chronic type , 24 months ; and smoldering type , 3 years or more . it is recommended that treatment strategies should be selected according to the disease subtype . in japan , the acute type , lymphoma type , and chronic type with unfavorable prognostic factors have been regarded as aggressive atl subtypes requiring immediate treatment , and intensive combination chemotherapy or allogeneic hematopoietic stem - cell transplantation are generally recommended therapeutic options . the japan clinical oncology group - lymphoma study group ( jcog - lsg ) has been investigating the efficacy of combination chemotherapy for aggressive lymphomas including atl or for atl alone since the early 1980s . at the start of the investigation , chop - like regimens were evaluated because atl was considered to be a type of nhl , but the outcome was poor . then , the lsg15 regimen consisting of the drugs used in the chop regimen plus four other drugs ( ranimustine , vindesine , etoposide , and carboplatin ) with the prophylactic use of granulocyte colony - stimulating factor ( g - csf ) was evaluated . in a phase iii trial , jcog9801 , this dose - intensified multiagent chemotherapy regimen was shown to be more effective than chop - 14 regimen , with a complete response rate of 40 % , 3 - year os of 24 % , and median survival time of 12.7 months . however , since the outcome of this dose - intensified regimen was still inferior to that in other ptcls and b - cell lymphomas , further improvement is necessary . in western countries , combination therapy with interferon - anda recently published meta - analysis suggested the effectiveness of this combination therapy for atl , especially leukemic forms such as acute and chronic types . several new antibodies are currently under development for the treatment of t - cell lymphoma . they are based on the unique immunophenotypic features of atl cells , which express mature t - cell antigens such as cd2 , cd25 ( interleukin [ il ] - 2 receptor ) , and cd52 . because of the unique intense expression of cd25 compared to that in other ptcl , monoclonal antibodies targeting the il - 2 receptor ( anti - tac ) , either radiolabeled or unlabelled ( daclizumab ) , have been tested in patients with relapsed or refractory atl . an anti - cd2 monoclonal antibody ( siplizumab ) , anti - cd52 antibody ( alemtuzumab ) , and anti - transferrin receptor antibody ( a24 ) are also under development , but data are currently limited . pentostatin and sobuzoxane are chemotherapeutic agents that were previously approved for the treatment of atl in japan . pentostatin , a purine nucleoside analog that inhibits adenosine deaminase , has been reported to be effective for t - cell malignancies , including t - cell prolymphocytic leukemia , ctcl , and ptcl . the clinical efficacy of pentostatin was evaluated in patients with atl from the 1980s to 1990s , and a phase ii study of pentostatin revealed a response rate of 32 % ( 10 of 31 ) in patients with relapsed or refractory atl . other drugs that are often used in patients with relapsed or refractory atl are some combination chemotherapy regimens , including epoch ( etoposide , prednisolone , vincristine , cyclophosphamide , and doxorubicin ) and eshap ( etoposide , methylprednisolone , high - dose cytarabine and cisplatin ) ; however , there is no apparent evidence of an advantage of these combination chemotherapies over other therapeutic options . in the u.s . , pralatrexate and romidepsin have been approved for the treatment of ptcl and can also be used for atl . the efficacy of these drugs for atl is not clear because they have been evaluated only in a very limited number of patients ( the efficacy of pralatrexate was evaluated in a clinical study in one patient ) . chemokines act as signaling molecules in the migration and tissue homing of various leukocytes . among them , thymus and activation - regulated chemokine ( tarc ) and monocyte - derived chemokine ( mdc ) induce the selective recruitment of distinct subsets of t - cells through triggering of a chemokine receptor , ccr4 . ccr4 is a seven - transmembrane g - protein coupled receptor and selectively expressed on th2 cells and regulatory t cells . the expression on normal cells such as th2 cells can be partly regulated by the ligand , especially mdc , while the regulation by the ligands on cancer cells are not yet understood . ishida et al . analyzed 103 patients with atl , and found that tumor cells from about 90 % of patients showed ccr4 expression . they also found that patients with ccr4 - positive atl were more likely to have skin infiltration and had a worse outcome than those with ccr4 - negative atl , indicating that ccr4 played an important pathogenetic role in atl . in addition , yoshie et al . found that the expression of ccr4 was increased in association of htlv - 1 and showed a relationship to fra - 2 / jun d which induces downstream genes such as c - myb and sox4 , and mdm2 which promotes growth and inhibits apoptosis . ccr4 is also expressed on other types of ptcl ( 29 % of total cases ; ptcl - nos , 38 % ; aitl , 35 % ; alk alcl , 67 % ; mycosis fungoides [ mf ] , 41 % ) . jones et al . independently reported that some types of ptcl expressed ccr4 , as well . in addition , analysis of 50 patients with ptcl - nos revealed that ccr4 - positive patients had significantly shorter survival than ccr4 - negative patients . nakagawa et al . analyzed 51 patients with ptcl - nos using the array comparative genomic hybridization technique , and found that patients with ptcl - nos with genomic aberrations had a significantly higher frequency of ccr4 positivity and a worse outcome than those with ptcl - nos without genomic aberrations . although the role of ccr4 in the tumorigenesis and progression of ptcl - nos has not been fully elucidated , ccr4 seems to be a promising target molecule in the treatment of ptcl as well as in atl . mogamulizumab / kw - 0761 is a humanized monoclonal antibody that recognizes the n - terminal region of human ccr4 . it is a therapeutic antibody produced using a novel glycoengineering technology that enhances antibody - dependent cellular cytotoxic ( adcc ) activity . mogamulizumab and its human - mouse chimeric version , km2760 , showed potent antitumor activity mediated by enhanced adcc against atl cell lines and primary atl cells in vitro and in vivo . a phase i clinical study ( 07610501 study : clinicaltrials.gov identifier nct00355472 ) has been conducted in patients with ccr4 - positive relapsed ptcl , including atl . the primary objectives of the study were to assess the safety of mogamulizumab , and analyze its maximum tolerated dose ( mtd ) and pharmacokinetics . the secondary objectives were to determine the best overall response rate ( orr ) and progression - free survival ( pfs ) . mogamulizumab was intravenously administered once a week for 4 weeks at four dose levels ( 0.01 , 0.1 , 0.5 , and 1.0 mg / kg ) according to the conventional 3 + 3 design . enrolled in the study were 16 patients , of whom 13 had atl ( 11 acute type , 2 lymphoma type ) , 1 had tumor - stage mf , and 2 had ptcl - nos . no dose - limiting toxicity ( dlt ) was observed in any of the 13 patients who received mogamulizumab at a dose of 0.011.0 mg / kg , and thus mtd was not reached . then , three additional patients were enrolled to receive 1.0 mg / kg , the highest dose . one patient showed grade 4 neutropenia , grade 3 febrile neutropenia , and grade 3 skin eruption , but these adverse events occurred in only 1 of the 6 patients who received a dose of 1.0 mg / kg , indicating that this drug would be tolerated at least up to 1.0 mg / kg . the best orr in the total 16 patients was 31 % ( of those , 2 had complete response [ cr ] and 3 had partial response [ pr ] ) , and the best orr was also 31 % in patients with atl ( of those , 2 had cr and another 2 had pr ) . pharmacokinetic analysis revealed a plasma mogamulizumab trough concentration of 7.519.6 g / ml after the 1st to 4th administration of mogamulizumab at a dose of 1.0 mg / kg . these concentrations were sufficient to kill primary atl cells by adcc activity in vitro ( 10 g / ml ) . after the 4th administration of mogamulizumab at a dose of 1.0 mg / kg , its plasma half - life was approximately 18 days , which is comparable to the half - life ( 14 to 21 days ) of endogenous human igg . lastly , although mtd was not reached , a tendency toward an increased incidence of grade 3 or higher toxicity was observed at 1.0 mg / kg . therefore , it was concluded that a dose of 1.0 mg / kg should be recommended for a subsequent phase ii trial of this novel agent . a subsequent phase ii study of mogamulizumab ( 0761002 study : clinicaltrials.gov identifier nct 00920790 ) the primary endpoint was the best orr , and the secondary endpoints included the best response of each disease site such as peripheral blood atl cells , skin and nodal / extranodal lesions as well as pfs and os . it was planned for 25 patients to be enrolled for efficacy analysis , assuming the expected orr of 30 % with a 5 % threshold response rate . mogamulizumab was intravenously administered once a week for 8 weeks at a dose of 1.0 mg / kg . in this study , 28 patients in total were enrolled . of these , 27 patients who received mogamulizumab were included in the safety analysis , and 26 patients , excluding 1 patient who was judged ineligible for enrollment after starting mogamulizumab administration , were evaluated in the efficacy analysis . of the 27 patients who received mogamulizumab , 14 had acute type , 6 lymphoma type , and 7 chronic type with unfavorable prognostic factors . the best orr was 50 % ( 13/26 ) including 8 cr . with the lower limit of the 95 % confidence interval ( 30 % to 70 % ) exceeding the threshold response rate of 5 % , the clinical efficacy of mogamulizumab was confirmed . responses according to disease sites were 100 % ( of 13 patients , all cr ) for peripheral blood , 63 % ( of 8 patients , 3 cr and 2 pr ) for skin , and 25 % ( of 12 patients , 3 cr / cru ) for nodal and extranodal lesions . the best orr was also calculated for each disease subtype , giving 43 % in patients with acute type ( of 14 patients , 5 cr and 1 pr ) , 33 % in patients with lymphoma type ( of 6 patients , 1 cr and 1 pr ) , and 83 % in patients with unfavorable chronic type ( of 6 patients , 2 cr and 3 pr ) . thus , it was demonstrated that mogamulizumab induced favorable responses in patients with any disease subtype of atl . in addition , for each age group , the best orr was 39 % ( of 13 patients , 3 cr and 2 pr ) in patients younger than 65 years , and 62 % ( of 13 patients , 5 cr and 3 pr ) in patients 65 years or older . the most common adverse events observed during the study were lymphopenia ( 96 % ) , neutropenia ( 52 % ) , and thrombocytopenia ( 52 % ) as hematologic toxicity , and acute infusion reaction ( 89 % ) and skin eruption ( 63 % ) as non - hematologic toxicity . there was no death related to mogamulizumab in either the phase i or phase ii study . of 8 serious adverse events with a relationship to mogamulizumab in the phase i and ii studies , 5 events including 4 cases of skin eruption and 1 case of stevens - johnson syndrome occurred during the phase ii study . however , these reactions were manageable with supportive measures including corticosteroid or other drugs in all patients . considering the seriousness of the disease , even skin eruption might be considered acceptable for the treatment of atl by treating physicians , while close and appropriate follow - up of the event is necessary . elucidation of the mechanism of skin eruption and preventive measures against it are awaited . in the u.s . , a phase i / ii study ( clinicaltrials.gov identifier : nct00888927 ) in patients with relapsed or refractory ptcl including ctcl has been conducted . mogamulizumab was well tolerated at doses of 0.11.0 mg / kg in 42 patients including 1 with ptcl - nos . mtd was not reached and thus 1.0 mg / kg was chosen for subsequent studies . a promising orr of 42 % ( of 38 evaluable patients with ctcl , 3 cr and 13 pr ) was achieved , although expression of ccr4 on lymphoma cells was not mandatory for patient enrolment in this particular phase i / ii study . regarding subtypes of ctcl , orr in sezary syndrome ( ss ) patients was 50 % and in mf patients was 36 % . eighty - seven percent of ss patients had a response in peripheral blood , with 50 % cr . further study of mogamulizumab is warranted in patients with nodal ptcl as well as ctcl . it is evident that there are limitations to improvement of the treatment outcome of ptcl , especially atl , with the currently available chemotherapeutic agents alone . mogamulizumab has a less severe toxicity profile and induces a high response rate in patients with atl , even in elderly patients . therefore , it may provide an effective treatment option for the disease , especially for elderly patients who are not eligible for intensive chemotherapy or hematopoietic stem - cell transplantation . in japan , based on the results of the clinical studies mentioned above , a single - arm phase ii study of mogamulizumab monotherapy in patients with ctcl and ptcl ( clinicaltrials.gov identifier : nct01192984 ) and a randomized phase ii study of dose - intensified combination chemotherapy ( mlsg15 regimen ) with or without mogamulizumab in untreated patients with atl ( clinicaltrials.gov identifier : nct01173887 ) are being conducted as shown in fig . 1 . patient enrollment has already been completed in these phase ii studies . in the u.s . , based on the aforementioned phase i / ii study in patients with relapsed or refractory ctcl , a pivotal phase iii study in patients with relapsed or refractory ctcl is being planned . in conclusion , mogamulizumab is expected to provide new , promising treatment options in patients with atl and other t - cell lymphomas.fig .1 ongoing clinical studies of mogamulizumab / kw - 0761 for peripheral t - cell lymphomas in japan ongoing clinical studies of mogamulizumab / kw - 0761 for peripheral t - cell lymphomas in japan\noutput:\n" }, { "from": "agent", "value": "peripheral t - cell lymphoma ( ptcl ) is a group of lymphoid malignancy that remains difficult to treat , as most ptcl becomes refractory or relapses , and thus there is an unmet medical need for novel treatment modalities . cc chemokine receptor 4 ( ccr4 ) is expressed in various types of ptcl including adult t - cell leukemia - lymphoma ( atl ) , which has the worst prognosis among them . a phase ii study of a defucosylated , humanized anti - ccr4 monoclonal antibody , mogamulizumab ( kw - 0761 ) , yielded an overall response rate of 50 % ( 13/26 ) and a median progression - free survival of 5.2 months in relapsed patients with ccr4 - positive atl who had been previously treated with chemotherapy . mogamulizumab also showed potential efficacy for cutaneous t - cell lymphoma in a us phase i / ii study . further preclinical and clinical investigations are needed to examine whether concomitant use of this novel agent with other agents with different mechanisms of action would be more effective for atl and other ptcls ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pediatric physiological interactions differ from those of the adult population ; there is therefore an inherent danger when utilizing products in children that have only been tested in adults . policymakers and healthcare professionals recognize the need to increase the number of pediatric randomized controlled trials ( rcts ) and have responded by creating policies and incentives for industries and organizations to engage in conducting trials in children . despite governmental incentives , there is still a dearth of pediatric trials , primarily due to the difficulty in recruitment of participants . an electronic search of rcts published between 19852004 found that only 701 ( 13 % ) of all rcts were pediatric , compared to 3,328 published adult trials .1 literature reviews identify recruitment as the single most challenging obstacle in conducting pediatric trials .2,3 the drink study ( decreasing the rates of illness in kids ) , was a clinical trial examining the role of probiotics in infectious diseases . consenting parents or caregivers were asked to have their participating child consume a strawberry flavored dairy drink for 90 days . due to seasonal variation on illness , this paper describes a paradigm shift in recruitment design , developed from experience with grassroots political campaigns . importantly , as community research is now being highlighted by the nih , new techniques for recruiting need to be explored . this shift allowed the project to successfully enroll 638 participants in four months , while utilizing less than 70 % of the original six - figure recruitment budget . additionally this approach , which reallocated funds from a mass media campaign into grassroots techniques , contributed to a retention rate of 92 % throughout the 90 - day trial . this technique was largely developed from the experience of the project coordinator who worked on developing coalitions in the 2004 presidential campaign , as well as a statewide gubernatorial race in 2005 . the original recruitment budget and protocol for this trial utilized costly mass media , primarily radio and newspaper advertisements .4,5 this method would generally yield several hundred callers to a screening line daily . however , mass media does not target specific populations and generally a large percentage of callers are ineligible .6 screening ineligible callers takes study personnel away from other necessary project tasks and more productive means of recruitment . in conjunction with the media campaign , like most clinical trials drink intended to emphasize the utilization of a flyer campaign at various physician and health care locations for recruitment . again , this approach is not targeted and results in poor time management for research personnel . the fundamentals of all grassroots campaigns rely on effective messages being delivered by effective messengers ; the 2004 presidential campaign further refined and improved upon these message - messenger techniques . in 2004 , compiled polling data from the previous twenty years revealed that persuadable swing voters had decreased from 20 % to 7 % of the voting population . the focus for campaigns became one of voter turn out rather than voter conversion . to accomplish this , both democrats and republicans had to 1 ) identify their voters , and 2 ) mobilize them to the polls . thus , the 2004 elections were about mobilizing specific voters on specific issues through the use of coalition and community leaders . slogans and spokespersons for these specific voter groups like veterans for kerry , w stands for women , catholics for kerry and ypw ( young professionals for w ) emerged . on the ground , grassroots representatives were commissioned among different demographics , coalitions and communities focused on mobilizing the within reach fruitvoters to the polls ; these voters identified voters among the networks and associations of the grassroots leaders and representatives . under this grassroots campaign technique , most successful campaign staffs were not comprised of political analysts or persons with in - depth understanding of political science ; but rather , persons who could identify , talk with , and were trusted among specific voter groups . like a grassroots campaign , drink s recruitment strategy relied on tailored messaging . believing that families would be more receptive to participating in the study and motivated to call the recruitment line if 1 ) they received flyers and information about the study from a known contact or 2 ) received study information designed to inspire trust and comfort , the goal was to have known persons in the community , daycare providers , physicians from our practice based research network ( pbrn ) and community leaders from religious groups and other community institutions deliver hand tailored and institutional review board ( irb ) - approved information directly to families . information with tailored images outlining clear concise study details yields more eligible callers to recruitment lines , rather than flyers received in the mail or posted on the wall . this direct method reduced the risk of a high proportion of ineligible families being solicited for the study , and allowed for more personnel time in the field . there were a total of only 872 calls to the screening line , of which 741 candidates were screened and 681 met eligibility criteria ( 91 % ) . the fundamentals of all grassroots campaigns rely on effective messages being delivered by effective messengers ; the 2004 presidential campaign further refined and improved upon these message - messenger techniques . in 2004 , compiled polling data from the previous twenty years revealed that persuadable swing voters had decreased from 20 % to 7 % of the voting population . the focus for campaigns became one of voter turn out rather than voter conversion . to accomplish this , both democrats and republicans had to 1 ) identify their voters , and 2 ) mobilize them to the polls . thus , the 2004 elections were about mobilizing specific voters on specific issues through the use of coalition and community leaders . slogans and spokespersons for these specific voter groups like veterans for kerry , w stands for women , catholics for kerry and ypw ( young professionals for w ) emerged . on the ground , grassroots representatives were commissioned among different demographics , coalitions and communities focused on mobilizing the within reach fruitvoters to the polls ; these voters identified voters among the networks and associations of the grassroots leaders and representatives . under this grassroots campaign technique , most successful campaign staffs were not comprised of political analysts or persons with in - depth understanding of political science ; but rather , persons who could identify , talk with , and were trusted among specific voter groups . like a grassroots campaign , drink s recruitment strategy relied on tailored messaging . believing that families would be more receptive to participating in the study and motivated to call the recruitment line if 1 ) they received flyers and information about the study from a known contact or 2 ) received study information designed to inspire trust and comfort , the goal was to have known persons in the community , daycare providers , physicians from our practice based research network ( pbrn ) and community leaders from religious groups and other community institutions deliver hand tailored and institutional review board ( irb ) - approved information directly to families . information with tailored images outlining clear concise study details yields more eligible callers to recruitment lines , rather than flyers received in the mail or posted on the wall . this direct method reduced the risk of a high proportion of ineligible families being solicited for the study , and allowed for more personnel time in the field . there were a total of only 872 calls to the screening line , of which 741 candidates were screened and 681 met eligibility criteria ( 91 % ) . traditionally clinical trials primarily identify study candidates by recruiting patients already receiving care through the institution conducting the trial . an alternate traditional method places study personnel in sites like clinics , ambulatory care , and emergency rooms , to enroll potential participants in person . typically data is collected at one site , requiring participants to travel to the research study . trials often are budgeted to reimburse the travel costs of the participant , but despite these provisions recruiting from a university primarily results in a biased participant population .7 additionally , data collected in a laboratory or that of a medical center , often varies from data collected in the community . less than 10 % of drink population identified themselves as learning about the study through a physician or healthcare center , but eighty - four percent of participants indicated that they learned about the study through their daycare / school or other grassroots methods ( ie , from another participant , community centers , church , website or listserv ) . we provided cars and cell phones to research personnel , allowing more face time in the community . we believe this approach is a paradigm shift in recruitment because most sponsors and institutions are willing to spend several thousand dollars on printing and media , but have more reservations when investing in community time of personnel . by providingthe staff with tools such as cell phones and cars , they have much greater access to the community and can spend more time in the community . the benefit of this approach is multifold , as research collected in the field over a laboratory increased the external validity of the study and by providing research assistants ( ras ) with cell phones ; participants could more easily get in contact with the ras , limiting missed follow - ups . thus , more study personnel time in the community lead to greater trust , increasing recruitment and retention . however , the nih has strict rules on expenses like travel and food for offices , often making this approach difficult when using government funds . however , we have successfully worked with nih project officers , explained the grassroots approach and have subsequently been granted permission to spend funds for these types of expenses . drink study personnel promoted the study by presenting at various meetings and gatherings and by meeting with community leaders while enrolling participants in their home or community . to identify points of contacts within the communities , the research team networked with churches , synagogues and community groups scheduling opportunities to go out and present to these different groups increased face time among potential recruitment sites thus , getting different communities comfortable with the project while continuing to network for contacts within the schools and daycare centers . less than 10 % of drink population identified themselves as learning about the study through a physician or healthcare center , but eighty - four percent of participants indicated that they learned about the study through their daycare / school or other grassroots methods ( ie , from another participant , community centers , church , website or listserv ) . we provided cars and cell phones to research personnel , allowing more face time in the community . we believe this approach is a paradigm shift in recruitment because most sponsors and institutions are willing to spend several thousand dollars on printing and media , but have more reservations when investing in community time of personnel . by providing the staff with tools such as cell phones and cars , they have much greaterthe benefit of this approach is multifold , as research collected in the field over a laboratory increased the external validity of the study and by providing research assistants ( ras ) with cell phones ; participants could more easily get in contact with the ras , limiting missed follow - ups . thus , more study personnel time in the community lead to greater trust , increasing recruitment and retention . however , the nih has strict rules on expenses like travel and food for offices , often making this approach difficult when using government funds . however , we have successfully worked with nih project officers , explained the grassroots approach and have subsequently been granted permission to spend funds for these types of expenses . drink study personnel promoted the study by presenting at various meetings and gatherings and by meeting with community leaders while enrolling participants in their home or community . to identify points of contacts within the communities , the research team networked with churches , synagogues and community groups scheduling opportunities to go out and present to these different groups increased face time among potential recruitment sites thus , getting different communities comfortable with the project while continuing to network for contacts within the schools and daycare centers . based on extensive personal research the pi ( daniel merenstein ) has assessed the typical clinical trial will cost $ 1050,000 per patient . a substantial part of these costs is recruitment and retention of subjects . the original protocol for drink created by the pi and sponsor set aside 10 % of the entire budget for recruitment , of which 80 % was allocated for the utilization of a mass media campaign . the original budget was reconfigured ( table 1 ) to emphasize grassroots techniques , establishing relationships within the community . this reconfiguration began with providing staff with more appropriate tools and functional support to increase their availability and access to the community ; over - time pay , project cell phones , and two additional cars were included . these additional items cost 57 % less than the total original budget and 37 % less than the media budget alone . drink saved 30 % of the total recruitment budget , only utilizing 16 % toward media instead of the original 80 % by engaging in a focused and specifically targeted media campaign . the original budget was reconfigured ( table 1 ) to emphasize grassroots techniques , establishing relationships within the community . this reconfiguration began with providing staff with more appropriate tools and functional support to increase their availability and access to the community ; over - time pay , project cell phones , and two additional cars were included . these additional items cost 57 % less than the total original budget and 37 % less than the media budget alone . drink saved 30 % of the total recruitment budget , only utilizing 16 % toward media instead of the original 80 % by engaging in a focused and specifically targeted media campaign . recruiting minorities and overcoming issues of mistrust for research is a common costly challenge for all clinical trials .8 utilizing mass media and practice based research networks ( pbrn ) for recruitment present challenges to overcoming these obstacles . there is a strong body of evidence suggesting a general mistrust of the medical / scientific community among minorities and healthcare providers do not always have the time to explain clinical trials to patients , and help them overcome this mistrust .9 minorities are more likely to enroll in studies when approached by a trusted known healthcare professional than a faceless flyer .10 overcoming barriers for families to enroll their children due to concern and mistrust was equally challenging for drink as in other pediatric clinical trials . like a grassroots campaign , drink recruitment messages were delivered by a trusted messenger and relationships were established throughout several different communities . drink staff members were not hired for their in - depth understanding of probiotics or clinical trials but rather for their personal experience and professional work histories that pointed to excellent interpersonal skills and an interest in community health . in addition to networking in schools and daycares , drink staff established relationships with communities like head start and religious organizations . the experiences of drink team members indicated competence in effectively communicating with communities of potential research populations , as well as ease and ability to move within these communities with comfort . often staff members were culturally matched with the communities they were recruiting , eg , 30 % of the staff members were native spanish speakers . if staff members had intimate knowledge of certain communities based on prior experience , they were assigned these areas . again , this technique was developed from lessons from the 2004 campaign trail , which implored different community leaders to deliver political campaign messages within their respective communities and associates ; for example , the evangelical christian leaders speaking out at mega - churches and gatherings of christian communities throughout the country . traditional trials are designed top - down with the principal investigator and sponsor making decisions on how to allocate the budget for recruitment . alternatively , drink sought input from the community as well as the staff members who were most intimately connected with different communities . those recruiting in the field are the representatives of the study , and much of the recruitment success or failure is determined by how confidently they represent the project among different groups . evidence in other pediatric trials confirms the critical contribution of staff in the field to recruitment success . smith and colleagues , recruiting families with asthmatic children between 212 years old from the emergency department to partake in a two - week study , report that their high rate of enrollment was primarily due to two dedicated enrollers . the enrollers interacted with the families and emergency department staff with ease and competence , yielding successful enrollment of 527 families in sixteen months .11 the backgrounds of the drink ras were essential in the recruitment success for this project . as table 2 indicates , the grassroots approach was a success ; families represented diverse demographics , social economic status , race and ethnicity . additionally 19 % of the study population identified themselves as hispanic or latino , and conducted interviews in spanish . efforts and resources were aimed at developing a trusted brand identity for the study within the community . every participant received a t - shirt with the drink logo , as well as magnets to keep study papers together and easily accessible . all research personnel used a canvas bag with the logo when they went on recruitment site visits or home visits . effective campaign messages must be authentic and representative of the messenger . although socially conservative evangelical christians may be interested in the same issues and essentially the same message as socially conservative catholics , it would not benefit a campaign to use a message with catholic imagery for a group of evangelicals ; in fact utilizing similar imagery among both groups would most likely result in deterring voters to the polls , rather than motivating them . similarly for drink , the flyer distributed by physicians offices needed a professional look and feel , congruent to the environment of a physician office , while flyers distributed by daycares and schools needed to represent the nurturing environment caring for primary - aged children . the phrase clinical trial orword probiotic could appear intimidating to parents ; recruitment information had to be presented in a manner that would set caregivers concerns at ease and with an appearance that would avoid the impression that they were unwillingly being solicited , while at the same time adhering to strict but important irb regulations . potential participants needed to trust the source of the flyer and avoid questioning the legitimacy or integrity of those conducting the project ; it was believed that developing specific flyers for specific groups would help promote confidence in those conducting the trial , and motivate potential participants to call screening lines . working closely with the irb and identifying points of contact from the community , a grassroots website was developed and versions of the flyer were tailored specific to the organization or recruitment site type . the website color scheme reflected our logo and although different versions of flyers utilized different and specific colors , every flyer carried the logo in the lower right corner . like a grassroots campaign , drink recruitment messages were delivered by a trusted messenger and relationships were established throughout several different communities . drink staff members were not hired for their in - depth understanding of probiotics or clinical trials but rather for their personal experience and professional work histories that pointed to excellent interpersonal skills and an interest in community health . in addition to networking in schools and daycares , drink staff established relationships with communities like head start and religious organizations . the experiences of drink team members indicated competence in effectively communicating with communities of potential research populations , as well as ease and ability to move within these communities with comfort . often staff members were culturally matched with the communities they were recruiting , eg , 30 % of the staff members were native spanish speakers . if staff members had intimate knowledge of certain communities based on prior experience , they were assigned these areas . again , this technique was developed from lessons from the 2004 campaign trail , which implored different community leaders to deliver political campaign messages within their respective communities and associates ; for example , the evangelical christian leaders speaking out at mega - churches and gatherings of christian communities throughout the country . traditional trials are designed top - down with the principal investigator and sponsor making decisions on how to allocate the budget for recruitment . alternatively , drink sought input from the community as well as the staff members who were most intimately connected with different communities . those recruiting in the field are the representatives of the study , and much of the recruitment success or failure is determined by how confidently they represent the project among different groups . evidence in other pediatric trials confirms the critical contribution of staff in the field to recruitment success . smith and colleagues , recruiting families with asthmatic children between 212 years old from the emergency department to partake in a two - week study , report that their high rate of enrollment was primarily due to two dedicated enrollers . the enrollers interacted with the families and emergency department staff with ease and competence , yielding successful enrollment of 527 families in sixteen months .11 the backgrounds of the drink ras were essential in the recruitment success for this project . as table 2 indicates , the grassroots approach was a success ; families represented diverse demographics , social economic status , race and ethnicity . additionally 19 % of the study population identified themselves as hispanic or latino , and conducted interviews in spanish . efforts and resources were aimed at developing a trusted brand identity for the study within the community . every participant received a t - shirt with the drink logo , as well as magnets to keep study papers together and easily accessible . all research personnel used a canvas bag with the logo when they went on recruitment site visits or home visits . effective campaign messages must be authentic and representative of the messenger . although socially conservative evangelical christians may be interested in the same issues and essentially the same message as socially conservative catholics , it would not benefit a campaign to use a message with catholic imagery for a group of evangelicals ; in fact utilizing similar imagery among both groups would most likely result in deterring voters to the polls , rather than motivating them . similarly for drink , the flyer distributed by physicians offices needed a professional look and feel , congruent to the environment of a physician office , while flyers distributed by daycares and schools needed to represent the nurturing environment caring for primary - aged children . the phrase clinical trial or word probiotic could appear intimidating to parents ; recruitment information had to be presented in a manner that would set caregivers concerns at ease and with an appearance that would avoid the impression that they were unwillingly being solicited , while at the same time adhering to strict but important irb regulations . potential participants needed to trust the source of the flyer and avoid questioning the legitimacy or integrity of those conducting the project ; it was believed that developing specific flyers for specific groups would help promote confidence in those conducting the trial , and motivate potential participants to call screening lines . working closely with the irb and identifying points of contact from the community , a grassroots website was developed and versions of the flyer were tailored specific to the organization or recruitment site type . the website color scheme reflected our logo and although different versions of flyers utilized different and specific colors , every flyer carried the logo in the lower right corner . the internet is looked upon by many as a new and exciting means of recruitment . often studies will be advertised at sites that investigators feel may attract the desired population . however even with this targeted population , web advertising may lead to many individuals contacting recruitment lines that are far beyond the catchment area . clinical trial websites often utilize a contact form which allows interested candidates to submit their contact information to learn more about the study . although this is a useful tool , many individuals are hesitant to supply personal contact information over the internet . we used the internet in drink but as a tool , rather than a substitute , to provide more face time in the community for research personnel and to increase trust while branding the study identity . we developed a website , www.thedrinkstudy.com , which contained pictures and short biographies of the drink staff , allowing screened participants to view the pictures of staff who would be meeting them in - person to obtain written consent and gather baseline data . additionally , the website contained the general data collection forms for the project , allowing interested families to review in advance the nature of the study and eligibility and criteria for participation . most importantly , a website link is a fast and inexpensive way for recruitment information to be circulated to several different networks . this allowed participating parents the ability to notify their friends and family effortlessly by forwarding in an email the study s website address or post the site link on networks and listservs frequented by parents . we used the internet in drink but as a tool , rather than a substitute , to provide more face time in the community for research personnel and to increase trust while branding the study identity . we developed a website , www.thedrinkstudy.com , which contained pictures and short biographies of the drink staff , allowing screened participants to view the pictures of staff who would be meeting them in - person to obtain written consent and gather baseline data . additionally , the website contained the general data collection forms for the project , allowing interested families to review in advance the nature of the study and eligibility and criteria for participation . most importantly , a website link is a fast and inexpensive way for recruitment information to be circulated to several different networks . this allowed participating parents the ability to notify their friends and family effortlessly by forwarding in an email the study s website address or post the site link on networks and listservs frequented by parents . although our recruitment goals were met efficiently in the short time allowed and at a reduced budget , this approach requires time and resources to establish rapport with communities and develop trust . most importantly , this approach is only successful with staff members who are competent at networking in the community . safety concerns also must be considered when placing staff in the field , particularly when entering foreign and possibly high violence neighborhoods . sponsors must be willing to allow researchers the freedom to use funds in the community . fortunately , we had a sponsor that trusted university guidelines and the research team but current nih guidelines make much of this approach nearly impossible to accomplish . there is an additional risk of potential participants feeling coerced to participate , just as historically belonging to certain groups required a vote for a certain candidate or participation in group activities . in our study , this was avoided as community members or leaders were not involved beyond their sharing of enrollment flyers and general information regarding the purpose and nature of the study . only the team of ten research assistants could conduct screening and enrolling , and as in all irb - approved studies , participant information was kept confidential . it was never reported back to head - start , daycare centers , churches or pediatric offices which families had enrolled . our study was limited to healthy children , which made recruiting in the community ideal . however , the pediatric epidemics under increased investigation such as asthma , obesity , type ii diabetes have environmental and social correlations allowing for targeted community recruitment . as recent public policies and literature suggest , there is a shortage of pediatric trials being conducted . many pediatric trials fail to recruit an adequate sample size for clinical significance and conducting clinical trials is costly . through the utilization of a grassroots approach and targeting potential populations , projects can meet demanding recruitment goals more efficiently and effectively , while retaining their study population and simultaneously reducing recruitment costs . they have to be willing to invest in personnel and communities , adequately for time and experience working within communities . in addition , research departments and sponsors must allow for funds to support human resources with the tools necessary to work in the field , such as cell phones , cars and fuel for transportation . we believe this investment ultimately saves money , produces studies with greater validity and respectfully involves communities . many of daycares centers , schools and the coalition of head start centers have been eager to work with us on future projects .\noutput:\n" }, { "from": "agent", "value": "background : literature reviews have identified recruitment as the single most challenging obstacle in conducting pediatric trials . this paper describes a paradigm shift in recruitment design , developed from experience with grassroots campaigns through the drink study ( decreasing the rates of illness in kids ) . the objective of this study was to explain a new method for recruiting in clinical trials based on lessons learned from grassroots political campaigning.methods and findings : the study described is a randomized controlled trial of 638 36 year olds from the washington , dc area . the design involved a comparison between new recruiting approaches modeled after grassroots campaigns and traditional techniques . traditional techniques for the purpose of this paper are defined by the use of physician referral , mass media such as radio and television advertisements , along with posters in public places like the subway . grassroots approaches alternatively developed and utilized community contacts and employed targeted small market media community . the main outcome measures were the percentage of budget used and the number of eligible participants recruited.conclusions : the results showed that the grassroots recruitment approach saved 30 % of the budget , recruited 638 kids in 4 months and retained over 90 % for the 90 day trial . new techniques need further exploration as community studies are stressed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: despite the progress in diagnosis and advancement in management of head and neck squamous cell carcinoma ( hnscc ) , long - term survival rates have not improved very much over the past decade . even after combining chemotherapy and radiation for advanced stage disease , the prognosis of hnscc still remains desolate and more than 50 % of patients die of this disease or complications within 5 years under current therapies . recurrence and treatment failures continue to be a major concern of hnscc patients and late stage diagnosis accounts to be the major cause still . the initiation , growth , recurrence , and metastasis of hnscc and other cancers have recently been related to the presence of cancer stem cells ( cscs ) or tumor initiating cells ( tics ) , they have been demonstrated as a distinct subpopulation of tumor cells , pertaining the ability to undergo self - renewal and differentiation which further initiates the properties of normal stem cells . hence , they possess the capacity to promote tumorigenesis and tumor growth leading to recurrence also . hnscc appears to be supported by such cells with stem - like properties making it a significant point to be further emphasized on for eliminating the disease . we , the authors , have hereby put an effort through this minireview to correlate the cscs properties , its efficacy for tumorigenesis in hnscc , and how to manage this entity for treatment protocols . a tumor can be seen as an organ composed of transformed cells that interact with stromal cells within the tumor microenvironment . the process of tumorigenesis requires multistep initiation of cellular and molecular pathways leading to a series of mutations resulting in the acquisition of replication and growth factor independence , resistance to growth - inhibitory signals , tissue invasion , and metastasis . does every cancer cell within the tumor having the tumor / cancer - initiating capability ? related theories suggest that there are currently two accepted models for cancer development ( figure 1 ) as follows.the stochastic model suggests that every cancer cell is able to initiate new tumor growth equally.the alternate hypothesis is that every tumor contains a rare population of cells termed cscs or cancer - initiating cells ( cics ) . the stochastic model suggests that every cancer cell is able to initiate new tumor growth equally . the alternate hypothesis is that every tumor contains a rare population of cells termed cscs or cancer - initiating cells ( cics ) . the most recent key features of the cancer stem cell hypothesis were described by prince and ailles in 2008 : only a small fraction of the cancer cells within a tumor have tumorigenic potential when transplanted into immunodeficient mice ; the cancer stem cell subpopulation can be separated from the other cancer cells by distinctive surface markers ; tumors resulting from the cancer stem cells contain the mixed tumorigenic and nontumorigenic cells of the original tumor ; the cancer stem cell subpopulation can be serially transplanted through multiple generations , indicating that it is a self - renewing population . only a small fraction of the cancer cells within a tumor have tumorigenic potential when transplanted into immunodeficient mice ; the cancer stem cell subpopulation can be separated from the other cancer cells by distinctive surface markers ; tumors resulting from the cancer stem cells contain the mixed tumorigenic and nontumorigenic cells of the original tumor ; the cancer stem cell subpopulation can be serially transplanted through multiple generations , indicating that it is a self - renewing population . the concept of cscs first began 150 years ago when robert virchow , a german pathologist , found similarities between embryonic and tumor tissues . the csc hypothesis postulates that tumor heterogeneity with regard to initiation , progression , response to therapy , and metastasis is the result of mutations which either render a normal somatic tissue stem cell cancerous or cause a cancer cell to become stem cell - like . this population of tumor cells consists of rapidly dividing cells ( similar to the transient amplifying ( ta ) cell population in normal tissue ) as well as additional cscs and more differentiated tumor cells . al - hajj et al . , in 2003 , using breast tumors cells concluded that cscs were heterogeneous in nature and a few cells isolated from primary breast cancers were capable of initiating tumors , whereas tens of thousands of phenotypically different cells did not . the most common characteristics of cscs were described as those cells having anchorage independent growth and metastasizing capacity , active membrane transporter activity , ability to survive for a long time , resistance to damaging agents , self - renewal capacity , active telomerase expression ( telomere shortening leads to chromosomal instability ) , and differentiation capacity to mature progeny . gao in 2008 identified precancerous stem cells ( pcscs ) in cancer and suggested that both pcsc and csc might also serve as precursors of tumor stromal components such as tumor vasculogenic stem / progenitor cells ( tvpcs ) . thus , he suggested , the developing process of tumor - initiating cells ( tic ) is initiated from pcsc leading to csc and later cancer , a cellular process that parallels the histological process of hyperplasia / metaplasia ( tic ) from precancerous lesions ( pcsc ) into malignant lesions ( csc cancer ) . some of the most important signals enumerated in maintaining stem cell proliferation in tumorigenesis are oct - 4 , notch , wnt / catenin , bone morphogenic protein ( bmp ) , sonic hedgehog signalling pathway , mushashi - 1 ( msi - 1 ) , and so forth . oct - 4 is normally expressed in the inner cell mass of the embryo and maintains totipotency . wnt / catenin affects orientation of chromosomes during mitotic divisions and plays a role in proliferation and inhibits apoptosis . bone morphogenic proteins ( bmp ) are members of tissue growth factor - ( tgf - ) superfamily and function as oncogenes and tumour suppressors sometimes . sonic hedgehog signalling pathway is a major regulator of some of the fundamental processes including stem cell maintenance , cell differentiation , tissue polarity , and cell proliferation . csc expresses specific markers that vary considerably depending on tumor type or tissue of origin the discovery of a universal marker has not yet been made . general methods for the identification of cscs in solid malignancies are similar to those strategies employed to differentiate normal stem cells from their differentiated progeny . the list of potential markers of cscs includes cd133 , cd44 , cd24 ( in combination with cd44 ) efflux of hoechst or rhodamine dyes , cd90 , cd117 , cd34 , and cd20 . this list also includes the efflux of vital dyes by multidrug transporters , the enzymatic activity of aldehyde dehydrogenase ( aldh ) , colony and sphere - forming assays utilizing specific culture conditions , and the expression of specific cell surface antigens known to enrich for stem cells . the most commonly applied among them are as follows.xenotransplantation assays , the gold - standard for identification of cscs , are used to assess the tumorigenicity and self - renewing potential of the putative csc population.cd44 , the most well - recognized csc marker , is a large cell surface glycoprotein that is involved in cell adhesion and migration.aldh ( aldehyde dehydrogenase , an intracellular enzyme normally present in the liver ) activity is known to enrich hematopoetic stem / progenitor cells and recently has been revealed to enrich cells with increased stem like properties in solid malignancies . xenotransplantation assays , the gold - standard for identification of cscs , are used to assess the tumorigenicity and self - renewing potential of the putative csc population . cd44 , the most well - recognized csc marker , is a large cell surface glycoprotein that is involved in cell adhesion and migration . aldh ( aldehyde dehydrogenase , an intracellular enzyme normally present in the liver ) activity is known to enrich hematopoetic stem / progenitor cells and recently has been revealed to enrich cells with increased stem like properties in solid malignancies . hypoxia instigates cell demise by apoptosis / necrosis , it also prevents cell death by provoking adaptive responses that , in turn , facilitate cell proliferation or angiogenesis , causative to tumor progression . in addition , studies confirm that hypoxia inhibits tumor cell differentiation and promotes maintenance of cancer stem cells and blocks the differentiation of mesenchymal stem / progenitor cells , a potential source of tumor - associated stromal cells . so an undifferentiated hypoxic microenvironment may be the initiator of cellular interactions and environmental signals for the preferential maintenance of cancer stem cells . evidence till date is suggestive of the fact that these hypoxic areas within a tumor are considered as a niche where cscs reside . it is stated that effects of hypoxia on stem cell function are directly mediated by the hypoxia inducible factors ( hif ) . the molecular relationship between hif signaling pathway with the biology of cscs and epithelial mesenchymal transition ( emt ) remains unclear although nf - b , pi3k / akt / mtor , notch , wnt / - catenin , and hedgehog signaling pathways have been recognized as important regulators of cscs and emt . the links between the hifs , notch , and oct - 4 have revealed specific molecular mechanisms whereby oxygen responses can inhibit differentiation and promote stem cell identity . by stimulating the expression or activity of oct - 4 , notch , and other critical signaling pathways , hif stabilization in hypoxic tumor cells enhances stem cell properties , including self - renewal and multipotency . emerging experimental evidence indicates that hypoxia also plays an important role in the regulation of the phenotype and function of cscsit has been shown that hypoxia is able to maintain the stem - like phenotypes in neuroblastomas and activate signaling pathways that are associated with undifferentiated phenotypes of normal stem cells , including sex determining region y box 2 ( sox2 ) , oct - 4 , and notch - 1 signaling . both hif - 1 andhif - 2 are associated with tumor aggressiveness ; hif - 1 promotes the phenotype and function of cscs , whereas hif - 2 is highly expressed in cscs ; also known as tic of neuroblastoma , glioblastoma , renal cell carcinoma , and breast carcinoma are associated with unfavorable disease outcome . the csc niche main role is to dedifferentiate nontumorigenic cells into tumorigenic cscs and to induce the emt , leading to dissemination of tumor cells from the primary tumor and further seeding at the metastatic place . supporting cells of these niche release a number of molecular factors that have been identified to control stem cell identity . these factors include components of the bmp , notch , wnt , jak - stat , and shh signaling pathways , which provide intercellular cues that regulate stem cell identity and differentiation . it has been unveiled that a premetastatic niche is established by the attraction of bone marrow derived cells to the future site of metastases by the secretion of factors from cancer cells . the niche protects cscs via differentiation and apoptosis and maintains self - regeneration via cell - cell and cell - matrix interactions which play a fundamental role in resistance to chemotherapy and radiotherapy and contribute to the genetic instability of cscs . the hypothesis of this niche , possibly for the arrival of cscs to form a metastasis , appears to be a crucial step in metastatic spread . emt is a process by which epithelial cells lose their polarity and are converted to a migrant mesenchymal phenotype . in recent times , it has been considered as one of the fundamental steps that induces invasion and metastasis of tumors during cancer progression . similarly in hnscc tumor microenvironment , connection between emt and stem cell ( scs ) / cscs properties has drawn a great deal of research effort . in head and neck tumors , the overexpression of tyrosine kinase receptor b corresponds to an altered expression of the molecular mediators of emt , including the downregulation of e - cadherin and the upregulation of twist ( a transcription factor that regulates differentiation , adhesion , and proliferation ) . along with these modifications , the unique stem cell niche or environment is necessary to support the growth of stem cells . till datemarkers such as aldehyde dehydrogenase ( aldh ) , cd133 , and cd44 have been successfully used to identify highly tumorigenic cancer stem cells in hnscc . prince et al . , in 2007 , were the first ones to unveil the presence of highly tumorigenic , stem - like cells in hnscc using primary tumor specimens as one - third of their samples . in a follow - up study evaluating aldh activity as a csc marker in hnscc , later , chen et al . showed that aldh activity correlated with disease staging in hnscc and that higher enzymatic activity correlated with expression of emt genes as well as enriching cells with csc properties . in addition , aldh activity appears to enrich cscs in hnscc to a higher degree than that currently provided by cell sorting based on surface antigen expression . in table 1 , we have tried to summarize the molecular markers that have been used for detection of cancer stem cells mostly in head and neck region . though cd44 is generally accepted as a surrogate marker for head and neck squamous carcinoma cancer stem cells ( hnsc cscs ) , in a recent study by oh et al . , in 2013 , comparing in vitro stem - like cell characteristics , chemoresistance , and in vivo tumour formation capacity of cd44 + and cd44 hnsc cells obtained from primary hnscc patient specimens , it was suggested that cscs themselves hold the ability to be heterogenous due to various genetic alterations and hence can not be used as a selective marker of spheroid - forming , tumour - initiating , or chemoresistant cell populations . as suggested by zhang et al . , in 2009 , hoechst 33342 dye by the atp - binding cassette transporter ( abc ) can also be used to identify side - population cells in hnscc which have been shown to increase clonality and tumorigenic potential . later isolated sphere - forming cells ( squamospheres ) from primary hnsccs and characterized their stem cell properties like self - renewal , stem cell marker expression , aberrant differentiation , and tumor - initiating potential . furthermore , these hnscc - driven squamospheres appeared to be chemoresistant to cisplatin , 5 - fluorouracil ( fu ) , paclitaxel , and doxetaxel and showed increased levels of abcg2 , one of the atp - binding cassette ( abc ) transporters . so accordingly the functional analysis of these squamospheres may provide a new insight into the tumorigenic process of hnscc . but irrespective of all the above data , another study by ishizawa et al . demonstrated a counteracting result that tics are rare in human pancreatic adenocarcinoma , lung squamous cell carcinoma , lung adenocarcinoma , and hnscc , despite the use of highly permissive xenotransplantation conditions . oral mucosa consists of a number of distinct layers and has self - renewing capacity , such as bone marrow and skin . mostly the basal layer cells are in the process of preparing for cell division , which later remain or move to a suprabasal position and become committed to terminal differentiation and stratification . the first hypothesis recommended that the cscs in oral squamous cell carcinoma ( oscc ) could be from local basal layer - derived adult sc or progenitor , which accumulate additional genetic alterations with time , within the tumor . the other proposed mechanism suggested the origin of cscs to be either putative nonepithelial stem cell sources in the oral mucosa ( which include vessel wall - derived cells , blood - derived stem cells , muscle - derived stem cells , and adipose - derived stem cell ) or due to cell fusion between a hematopoietic stem cell and a mutated oral keratinocyte or can also originate through dedifferentiation of mature cells . after understanding the possible role of cscs in hnscc , oliveira et al . tried to find the possible influences of these cscs in oral squamous cell carcinoma using cd44 and cd24 . they suggested in their result that the absence of immunoexpression of these two investigated markers can be used in combination with other clinicopathologic information to improve the assessment of prognosis in oscc . costea et al . in their hypothesis suggested a potential involvement of the stromal microenvironment oscc progression . as already known , the activated fibroblasts ( myofibroblasts ) inside the tumor stroma stimulate the transformed keratinocytes , thus influencing stem cell division patterns and with further genetic alterations of these keratinocytes leads to evolution of more invasive clones . focal hypoxia which is found in oscc also may be due to quantitative and qualitative alterations in tumor vasculature , leading to local reduction of oxygen availability . cscs seem to harbor mechanisms that are found to be responsible for therapy resistance in glioblastoma and pancreatic cancer , and recently in colon cancer as well . it has been concluded that stromal environment and csc niche play a vital role in the behavior of cancer cells . so , targeting the stem cell niche directly can weaken the source of nutrition and change the essential signals needed by cscs to proliferate . therapeutic strategies as suggested by tang et al . included targeting candidate cancer stem cells and their microenvironmental niche , which contributes to self - renewal of these cells along with the reactive oxygen species ( ros ) status of these cells , and tweaking their intracellular milieu to facilitate apoptotic death signals over proliferative effects may facilitate a new prospective towards target therapy in cancers . similarly , krishnamurthy and nor proposed a hypothetical model for the response of hnscc to different therapeutic strategies . as earlier established , these slow - growing cancer stem cells in hnscc evade conventional therapies , so targeting the cancer stem cells either directly or viatheir niche could lead to a more definitive response . they suggested an emerging concept of combining the use of conventional chemotherapy and cancer stem cell - targeted therapy . hypoxia has been understood to play a key role in tumor progression and hypoxic tumor microenvironment in turn has a control over the cscs . so , when the antiangiogenic agents are administered in combination with csc - targeted drugs , more effective results are attained in cancer therapy , along with inhibiting hypoxia inducible factors ( hif ) . they contribute to tumor dormancy by having a slow cell cycle kinetics ( quiescent state ) which protects cscs from chemoradiotherapy . iwasaki and suda postulated that cscs are resistant to traditional chemotherapy , because most of the current anticancer drugs target tumor growth by inhibiting dna synthesis or cell division of actively dividing cancer cells , as cscs are frequently in a quiescent state . so missing these quiescent cscs can lead to resistance and relapse and may even enrich cscs for a more resistant state . so , the therapeutic aspect should lead to target hypoxia curbing these hypoxic niches by hif - inhibitors , nfb - inhibitors , nutraceuticals , and antioxidant therapy . nfb degradation by inhibitor of b ( ib ) proteins may be a useful therapeutic solution under such circumstances . it has also been suggested that treatment with echinomycin blocks the hypoxia - induced stroma . the confrontation in the years to come will be how to determine the contribution of each model to tumor growth in a given patient and how we can use that information to design more effective therapeutic strategy . identification of reliable markers is required to characterize cscs in hnscc and oscc in particular as this could ensure the clinical effectiveness of future targeted treatments , possibly resulting in a more effective outcome .\noutput:\n" }, { "from": "agent", "value": "cancer stem cells ( cscs ) play a major role in local recurrence and metastatic spread in head and neck squamous cell carcinomas ( hnscc ) . evidence suggests that cancer stem cells are resistant to conventional therapy . so the emerging concepts of the role of cancer stem cells in the pathobiology of hnscc should be understood carefully to be able to create new paradigms in treatment plans ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the majority of suicides ( 85 % ) in the world occur in low and middle - income countries . non - fatal suicide attempts occur mostly in young persons and are up to 10 - 40 times more frequent than suicides . persons with a history of previous suicide attempt are at a high risk of dying by suicide with up to 2 % dying within one year and up to 7 % within 10 years . over 100,000 people die by suicide in india every year . in the last two decadestwo large epidemiological verbal autopsy studies in rural tamil nadu revealed that the actual suicide rate is six to nine times the official rate . if these figures are extrapolated it is estimated that half a million suicides occur every year and at least 5 million attempt suicide each year in india . there are many studies on attempted suicide in india that discuss the various sociodemographic , clinical , psychosocial factors in attempted suicide but studies on interventions are sparse . most research about intervention for attempted suicides is conducted in developed countries and little is known about the burden of attempted suicide and effectiveness of intervention for suicide attempters in developing countries . the suicide - prevention multisite intervention study on suicidal behaviors ( supre - miss ) , launched by the world health organization ( who ) in 2000 , aimed at increasing the knowledge about suicidal behaviors and the effectiveness of brief interventions for suicide attempters in culturally diverse places around the world and chennai was the centre in india . the brief intervention and contact ( bic ) employed in the supre - miss trial is an adaptation of brief interventions used for alcohol problems . brief interventions were found to be effective in reducing alcohol - related problems and facilitating treatment referral of problem drinkers and in reducing suicide in high - risk patients . regular contact has been found to reduce suicidal behavior in those who have attempted suicide . compared to the usual psychological and medical interventions employed for suicide attempters , the advantage of this type of intervention is that it requires little space , equipment or highly trained personnel . given the resource limitations of low and middle - income countries , interventions that involve highly trained staff are not feasible while bic interventions are easily implementable . consequently , the supre - miss study aimed at assessing the potential benefits of bic as an add - on to the usual care for suicide attempters . the current paper discusses the effectiveness of bic in reducing suicides and attempted suicide in chennai , india . persons who attempted suicide were initially seen in the emergency department and all were routinely admitted to the intensive medical care unit of the hospital . all those over the age of 12 years who attempted suicide , identified from january 2002 to january 2004 , were invited to participate in the study . the interviews were conducted face - to - face and took place in the intensive medical care unit . two experienced psychiatrists conducted the interview after the interviewee was medically stable , at the most three days after admission . those who were over the age of 12 years and were medically unable to give consent or interview or refused were excluded . the 680 enrolled participants were randomly assigned to the bic ( n = 320 ) or treatment as usual ( tau ) ( n = 360 ) group . the allocation sequence was based on random number table and maintained in a separate location to ensure that the clinician responsible for the assignment of the subject could not bias the assignment throughout the duration of study . the bic procedure included a standard one - hour individual information session as close to the time of discharge as possible combined with periodic follow - up contacts after discharge . the individual session provided information about the psychological and social distress that often underlies suicidal behavior , risk and protective factors for suicidal behaviors , basic community - specific epidemiology of suicide , repetition of suicidal behaviors , alternatives for constructive instead of self - destructive coping strategies , and contacts / referral options . follow - up contacts involved visits at 1 week , 2 , 4 , 7 , 11 weeks and 4 , 6 , 12 and 18 months after discharge . during each visit the subjects in the bic group were asked how they felt and whether they perceived the need for any support . if they reported needing support they would be referred to an appropriate service agency . if a person denied the need for support , but was considered to be at current suicide risk , referral to a local treatment service was suggested . these visits were conducted by two psychologists with a one - day special training and documented using a short one - page form . the goal was to check - in with the patients and to determine their current status . if the individual had died , the cause of death as reported by relatives or other informants was recorded ; if the individual was alive , information on subsequent suicide attempts ( if any ) was recorded . typically , treatment was limited to acute management of the somatic squeal of the suicide attempt and did not include psychiatric or psychological assessment or treatment , or any psychological or social consultation . if there were no physical complications , patients were usually discharged after somatic treatment was completed , typically within 24 h. rarely , patients were discharged with a referral to outpatient mental health services . subjects in the tau group were contacted at six months and eighteen months after discharge to assess the suicidal behaviour using the same questionnaire used for the bic group . flow chart of recruitment the questionnaire , based on the european parasuicide study interview schedule ( epsis ) of the who / euro multicentre study on suicidal behavior was used . it covered detailed sociodemographic information , the history of suicidal behavior and family data , physical health , contact with health services , mental health , questions related to social support , substance use , hopelessness , traumatic events , legal problems , antisocial behavior , beck suicide intent scale , beck depression inventory , spielberger trait anger scale , who wellbeing index , who psychiatric disability assessment schedule and eysenk impulsiveness scale . all the instruments were translated , backtranslated and field - tested in the regional language and the interviewers were trained in the administration of the instruments . the bic procedure included a standard one - hour individual information session as close to the time of discharge as possible combined with periodic follow - up contacts after discharge . the individual session provided information about the psychological and social distress that often underlies suicidal behavior , risk and protective factors for suicidal behaviors , basic community - specific epidemiology of suicide , repetition of suicidal behaviors , alternatives for constructive instead of self - destructive coping strategies , and contacts / referral options . follow - up contacts involved visits at 1 week , 2 , 4 , 7 , 11 weeks and 4 , 6 , 12 and 18 months after discharge . during each visit the subjects in the bic group were asked how they felt and whether they perceived the need for any support . if they reported needing support they would be referred to an appropriate service agency . if a person denied the need for support , but was considered to be at current suicide risk , referral to a local treatment service was suggested . these visits were conducted by two psychologists with a one - day special training and documented using a short one - page form . the goal was to check - in with the patients and to determine their current status . if the individual had died , the cause of death as reported by relatives or other informants was recorded ; if the individual was alive , information on subsequent suicide attempts ( if any ) was recorded . typically , treatment was limited to acute management of the somatic squeal of the suicide attempt and did not include psychiatric or psychological assessment or treatment , or any psychological or social consultation . if there were no physical complications , patients were usually discharged after somatic treatment was completed , typically within 24 h. rarely , patients were discharged with a referral to outpatient mental health services . subjects in the tau group were contacted at six months and eighteen months after discharge to assess the suicidal behaviour using the same questionnaire used for the bic group . the questionnaire , based on the european parasuicide study interview schedule ( epsis ) of the who / euro multicentre study on suicidal behavior was used . it covered detailed sociodemographic information , the history of suicidal behavior and family data , physical health , contact with health services , mental health , questions related to social support , substance use , hopelessness , traumatic events , legal problems , antisocial behavior , beck suicide intent scale , beck depression inventory , spielberger trait anger scale , who wellbeing index , who psychiatric disability assessment schedule and eysenk impulsiveness scale . all the instruments were translated , backtranslated and field - tested in the regional language and the interviewers were trained in the administration of the instruments . appropriate statistical measures and tests were carried out using the spss version 13 . detailed description of the method and instruments can be ascertained in a prior publication . the study tried to include all suicide attempters consequently seen at the emergency care department . various factors like rapid departure of the patients , delayed notification of research staff , inadequate recording , constraints in hospitalization , etc . made it difficult to include all eligible patients . other reasons were refusals , clinical condition not allowing an interview , leaving against medical advice etc . hence out of the eligible 1691 personathose who did not participate in the study were similar in age and sex to those who participated . there were no significant differences between the bic and tau groups in sociodemographic factors like age , sex , marital status , educational status , employment status and religion as shown in table 1 . sociodemographic variables the groups were also comparable in the duration of stay in the hospital , history of previous suicide attempt , number of previous attempts and family history of suicide and suicide attempt [ table 2 ] . also , there was no difference in the method used . table 3 reveals that there were no differences in the psychological and clinical variables , thus suggesting that the bic and tau groups are comparable . completed and attempted suicide was found to be significantly lower in the bic group after intervention at 18 months follow - up compared to the tau group [ table 4 ] . in the intervention group , the one completed suicide occurred in the first week itself . while in the tau group , five occurred before six months and four before 18 months . one attempted suicide occurred in week 1 , three at six months , one at 12 months and three at 18 months during followup in the bic group while in the tau group there were three attempts in six months and 14 at 18 months follow - up . for the first time a randomized controlled study evaluating the effectiveness of bic in suicide attempters with suicide and attempted suicide as the primary outcome measure has been carried out in india . the findings demonstrate that a brief intervention session combined with a systematic long - term contact after discharge can have a positive effect on preventing subsequent suicide and suicide attempts . bic might have acted in a variety of ways to reduce suicidality by acting as a social support network ; by increasing awareness about the problems that led to the suicidal act and hence helping in formulating an alternate coping mechanism , by enhancing a feeling of connectedness and a feeling of being cared for . carter et al . , have also shown in a randomized trial that intervention using postcards reduced repetition of hospital - treated deliberate self - harm poisoning . fleischmann et al . , ( 2008 ) have shown that mortality was reduced in the bic group compared to the tau group in all the five sites of the supre - miss study . the problem of accurate collection of data in india is compounded by the fact that attempted suicide continues to be a punishable offence unlike in the majority of the countries in the world . the follow - up of subjects proved to be a major challenge due to the complex setting and high mobility . so ideally although the tau group should have been seen only after 18 months , they were seen at six months and 18 months to reduce the number of lost to follow - up patients . another limitation was that the ascertainment of suicidal behavior during follow - up was from the subject and family members with no corroborating official records . maselk and patel have suggested that combination strategies that reduce domestic violence , provide poverty relief and strengthen the health system in identification and treatment of mental disorders will contribute to the reduction of suicidal behavior , particularly in women . taking into consideration the human and economic resource limitations in india , interventions like bic are readily implementable in the healthcare sector . bic can be a cost - effective strategy to reduce subsequent suicidal behavior after a suicide attempt . this paper is based on the data and experience obtained during the participation of the authors in the who multisite intervention study on suicidal behaviours ( supre - miss ) , a projected funded by the world health organization and the participating field research centres .\noutput:\n" }, { "from": "agent", "value": "aim : to determine whether brief intervention and contact ( bic ) is effective in reducing subsequent suicidal behavior among suicide attempters.materials and methods : suicide attempters ( n = 680 ) admitted in a general hospital in chennai were randomly allocated to treatment as usual and bic whose components include brief intervention at the time of discharge and contact for 18 months.results : completed suicide was significantly lower in the bic group , or 35.4 ( ci 18.4 78.2 ) as also attempted suicide , or 17.3 ( ci 10.8 - 29.7 ) . conclusions : this low - cost intervention which can be readily implemented may be an important suicide prevention strategy in healthcare settings in india ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bartonella henselae infection is relatively common , and ocular involvement is seen in 510 % of the infected patients . ocular bartonellosis should always be considered in children and adolescents presenting with conjunctivitis , neuroretinitis or focal retinochoroiditis regardless of a history of cat or flea exposure . contamination of skin wounds or mucus membranes with flea feces and inhalation of infected material are alternative modes of transmission . infection through conjunctiva often presents as parinaud 's oculoglandular syndrome , which consists of a follicular , granulomatous conjunctivitis with associated regional tender lymphadenopathy and fever . another ocular manifestation is neuroretinitis , with mild to moderate vision loss during the acute phase , which follows a benign , self - limiting course . vascular occlusion is an atypical feature , but immune - compromised patients are at an increased risk . a 15 - year - old female presented with a 4 - week history of progressive , painless loss of vision and inferior visual field defect in the left eye ( os ) . her history was negative for red eye and discharge , but she reported having a fever and sore throat without other constitutional symptoms . the best - corrected visual acuity was 20/20 in the right eye ( od ) and 20/40 os . color vision was also impaired os , and a confrontation visual field test revealed an inferior field defect os . the anterior chamber and vitreous showed trace cells , and her intraocular pressure was 14 mm hg in both eyes at presentation . the posterior segment exam was normal od , but significant disc and retinal edema , peripapillary serous retinal detachment and vascular congestion were observed os . a characteristic partial macular star sparing the area temporal to the fovea was also observed os ( fig . a branch of the superior - temporal retinal artery was occluded , but the arteriole supplying the superior part of the macula remained patent ( fig . 1 , fig .2 ) . venous tortuosity and peripapillary telangiectasia were present , but there was no sign of concomitant vein occlusion ( fig . 1 , fig . lyme and syphilis serologies and a purified protein derivative skin test were negative . while not routine in cases with a high clinical suspicion of b. henselae infection , an mri of the brain and orbits as well as a chest x - rayafter 2 months of doxycycline therapy , the disc and retinal edema had improved significantly and most retinal vessels returned to normal caliber ( fig .2 ) . visual acuity improved to 20/20 with improved color vision , but the left afferent pupillary defect was still present . central visual field defects improved with the resolution of macular edema , but the branch retinal artery occlusion resulted in inner retinal infarct with a persistent inferior arcuate scotoma ( fig . this was a case of b. henselae neuroretinitis with occlusive vasculitis in an immunocompetent patient with persistent visual field defect and an absent history for cat scratch disease or parinaud 's oculoglandular syndrome . the diagnosis was not made based on an elevated b. henselae titer alone , but in the context of a strong clinical suspicion of b. henselae infection and an exclusion of other common infectious etiologies . b. henselae - associated neuroretinitis typically follows a benign and self - limited course , but the potential for significant visual complications can not be overlooked . previous studies have reported vascular occlusive events in as high as 1721 % of patients with posterior segment manifestations of a b. henselae infection . the efficacy of antibiotic regimens in patients with b. henselae neuroretinitis has not been proven with controlled studies . b. henselae should be considered in adolescents or young adults with vascular occlusion , optic disc edema and macular fluid . an elevated b. henselae titer is supportive of a diagnosis despite a negative history of cat scratch or bite .\noutput:\n" }, { "from": "agent", "value": "we report a case of bartonella henselae neuroretinitis with significant disc and peripapillary edema , branch retinal artery occlusion without macula involvement and well preserved central vision . a 15 - year - old female presented with loss of vision over 4 weeks in the left eye . she had a history of cat exposure , but a cat scratch , insect bite or conjunctivitis was not reported . an inferotemporal arcuate scotoma developed during the acute phase and persisted over the course of the follow - up ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: invasive mycotic infections and respiratory viral infections are of a rising concern in hiv seropositive population . cryptococcus neoformans is the most common fungal infection in hiv patients , and a concurrent rise has also been seen in the number of hiv patients suffering from pandemic influenza a virus . apart from protean manifestations of upper respiratory tract symptoms and malaise , rare manifestation such as seizures , encephalopathy , guillain - barre syndrome , acute disseminated encephalomyelitis , transverse myelitis and aseptic meningitis are also encountered pandemic influenza . we describe an unusual case of concomitant pandemic influenza a and cryptococcal meningitis in an hiv - seropositive patient , who later succumbed to the dual infection . a 34 - year - old adult male presented to the emergency department with complaints of high - grade fever , breathlessness , and cough for 15 days . the patient was conscious , oriented to time , place and person , had tachypnea , tachycardia , pallor , and edema . he had suffered from pulmonary tuberculosis ( tb ) 2 years back and had taken a full course of anti - tubercular therapy . the hematological parameters , liver and kidney function tests were normal except low hemoglobin of 6 % . computed tomography of the chest revealing bilateral air space consolidation , ground - glass opacities , and bilateral parenchymal lesions suggestive of bilateral pneumonitis [ figure 1 ] . he was diagnosed with pandemic influenza a h1n1 by real - time polymerase chain reaction as per centers for disease control and prevention guidelines . a sputum pyogenic culture was positive for escherichia coli , and it was sensitive to meropenem and ertapenem . a provisional diagnosis of pandemic influenza pneumonitis with adult respiratory distress syndrome was made , and patient 's management initiated . india ink examination of cerebrospinal fluid ( csf ) and pleural fluid demonstrated capsulated budding yeast cells [ figure 2 ] . latex agglutination test was positive for the cryptococcal antigen . c. neoformans was isolated in fungal cultures of csf , sputum , and pleural fluid . the patient was also declared positive for hiv by three different elisa kits using three different antigens . his partner was also hiv positive , and she gave a history of contact in her spouse . on 14 day , computed tomography of chest revealing bilateral air space consolidation , ground glass opacities , bilateral parenchymal lesions suggestive of bilateral pneumonitis gram 's stain smear of pleural fluid sample showing broad base budding yeasts cells and exudatehiv and other immunocompromised individuals suffer from a number of opportunistic bacterial , viral , fungal and parasitic diseases . the infections with c. neoformans spar a varied clinical spectrum in immunocompromised host , from meningitis , pneumonia , soft tissue and bone infections . pandemic influenza is also a major cause of morbidity and mortality in hiv - infected individuals , and also in patients undergoing treatment with highly active antiretroviral therapy . the meningeal signs and symptoms have also been attributed to pandemic influenza in a small number of cases . in this case , the patient developed meningitis after being diagnosed by pandemic influenza . the compromised pulmonary functions with past history of tb in this case also provided an ideal breeding ground for a respiratory infection , e.g. influenza and cryptococcosis . hiv seropositive patients should be vaccinated for influenza annually to improve their prognosis . in the medical literature , he was hiv seronegative , a normal cd4 count , responded to antiviral treatment with oseltamivir and survived . the striking similarity between the first reported and our case was the onset of symptoms . both the patients were immunocompromised , the first one due to prolonged influenza infection and use of corticosteroids , and our patient due to hiv infection and history of tb . both cases developed cryptococcal meningitis after they were diagnosed with pandemic influenza a h1n1 . this suggests that lungs of an immunocomprised patient can play a breeding for an opportunistic fungal or bacterial infection . contrast to the previous case , our patient died , which could be due to oseltamivir resistance . as both c. neoformans and influenza virus can present with meningeal symptoms , it is essential to diagnose the primary pathogen so that a proper treatment in proper time can be instituted . hence , this case highlights the fact that an aids patient is a microbiological zoo and all the parameters should be assessed and opportunistic infection specific treatment and anti - retroviral therapy instituted to prevent mortality .\noutput:\n" }, { "from": "agent", "value": "respiratory viral infections , especially influenza have a potential to form a fatal association with cryptococcosis in the setting of compromised immunity . considering the lethality of these two infections , we report an unusual case of dual infection of pandemic influenza a h1n1 and disseminated cryptococcosis in an hiv seropositive individual ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: portal hypertension is associated with severe and often life - threatening complications . increased intrahepatic resistance results in increasing splanchnic blood flow and development of venous collaterals , which may bleed , anda hyperdynamic circulation develops with an increased cardiac output and a decrease in systemic vascular resistance . pooling of splanchnic blood may result in a systemic hypovolemia , which can trigger activation of vasoactive systems , mainly vasoconstrictors . this in turn may lead to sodium retention , ascites , and ultimately hepatorenal syndrome . the correction of severe portal hypertension by portacaval shunt surgery has been used for many years , but the morbidity and mortality were high . moreover , this technique was contraindicated in the presence of liver failure . the transjugular intrahepatic portosystemic shunt ( tips ) was used for the first time by rsch et al . in 1969 in dogs and in a cirrhotic patient by colapinto in 1982 . originally , a tract was created by balloon dilatation of the parenchyma between the hepatic vein and the portal vein after transjugular portal vein catheterization . unfortunately , this communication closed within days after the procedure . in 1989 , the first case of tips created with a metallic stent was published by rssle et al . . many papers were published in the following years , which led to technical improvements and definition of the best indications for this promising treatment of complications of portal hypertension . in the present paper , technical aspects of this procedure will be described , and the current indications based on the existing literature will be discussed . contraindications ( absolute and relative ) will be reported and the potential complications following the tips procedure as well as their treatment will be mentioned . tips is a hemodynamic equivalent of a side - to - side small diameter surgical portacaval shunt . the experience gained over the last 20 years allows thorough evaluation of the complications of this technique and of its contraindications and indications . this technique is preferably done under general anesthesia but can be performed with deep sedation ( particularly for emergency cases ) . antibiotic prophylaxis is given even if the literature has not proven the usefulness of this approach , and coagulation defects are corrected before the procedure . after puncture of the jugular vein ( most often the right jugular vein ) under echographic guidance , a catheter is introduced into one hepatic vein and wedged in the liver parenchyma . gentle injection of dye allows the retrograde visualisation of intrahepatic portal vein branches ( figure 1 ) . the intrahepatic portal vein then is entered with a modified ross needle ( cook medical , bloomington , in , usa ) . the tract between the hepatic and the portal vein is dilated with an angioplasty balloon catheter ( 810 mm ) ( figure 2 ) followed by stent placement to maintain the communication between both vessels patent ( figure 3 ) . various tips stents can be used ( bare stents and ptfe - covered stents ) . the portacaval gradient after tips must be be lower than 12 mmhg ( the cut - off level associated with complications of portal hypertension ) . the use of ultrasound or transhepatic portography can help localize the intrahepatic portal vein , particularly when anatomic variants or marked liver distortion is observed particularly in cirrhotic patients . over the years , ptfe - covered stents have replaced bare stents as they markedly improved the long - term patency of the shunt and also prevent portobiliary fistulae . the metallic stent should be placed near the junction between the hepatic vein and the vena cava and no more than 1 - 2 cm below the bifurcation of right and left portal veins . moreover , the covered part of the stent should not be inside the portal vein as it can block the retrograde intrahepatic portal flow , which may result in intrahepatic portal vein thrombosis . provided that these principles are followed , liver transplantation can be performed safely without interference of the stent at the time of portal vein and vena cava clamping . as mentioned previously , portal hypertension is associated with a hyperdynamic circulation ( increased cardiac output , increased splanchnic blood flow and decreased systemic resistances ) . hemodynamic changes induced by tips are spectacular , with a sudden increase in the cardiac output secondary to diversion of splanchnic blood flow into the systemic circulation . therefore , any impairment in the right ventricle function before tips is a problem , as congestive liver failure may be observed after tips - induced increase in cardiac output . an evaluation of cardiac function is required before tips . on the other hand , even if the hyperdynamic circulation worsens after the procedure , this phenomenon is often transient . pre - tips chronic recurrent disabling hepatic encephalopathy ( he ) is an absolute contraindication , but the onset of an episode of he induced by precipitants ( such as bleeding , sepsis , electrolyte imbalance ) before tips does not preclude the use of this procedure . the presence of portal vein cavernoma or portal vein thrombosis is no longer an absolute contraindication and may even become an indication as technical advances allow recanalization of the portal vein in some selected cases . a transhepatic or a transplenic approach can be helpful to catheterize the main portal vein and facilitates the tips procedure . many prognostic studies have been published for the prediction of short - term survival after tips . it is now well recognized that a pugh score higher than 12 most often represents a contraindication as multiorgan failure occurs in a vast majority of these cases after tips . the meld score has been initially validated as the best predictor of the 3 months survival rate . however , tips may be performed as a temporary hemostatic measure in a patient already placed on the waiting list for liver transplant . comparison of complication frequency is difficult to evaluate in the literature due to the patient characteristics , the expertise of the center and the study period . acute complications might occur during tips placement or within hours or days after the procedure and include neck hematoma , arrhythmia , stent displacement , hemolysis , bilhemia , and shunt thrombosis . neck hematoma can be prevented by haematological preparation and ultrasound - guided puncture of the jugular vein . arrhythmia may occur but is self - limited when the distal tip of the guide wire is removed from the right atrium . it must be suspected when a sudden rise of direct bilirubin occurs without any symptoms . it can be proven by shuntography or ercp and treated by a covered stent across the fistula . hemolysis is transient and is related to the fragmentation of red blood cells in the metallic stent before endothelialization . the obstruction of a small hepatic vein by a ptfe - covered stent may induce athis phenomenon is self - limited in a majority of the cases . acute shunt thrombosis ( less than 5 % ) is rare and it is usually due to a portobiliary fistula or in some cases to stent malfunction . the shunt can be recanalized but at the same time the fistula must be closed with a covered stent . life - threatening complications are very rare ( less than 1 % ) and include hemoperitoneum , hemobilia , liver ischemia , cardiac failure , and sepsis . hemoperitoneum is most often related to a puncture of the liver capsule ; it is usually self - limited . a dissection of the portal vein in its extrahepatic part is life threatening and can be treated with a covered stent . hemobilia results from a procedure - related fistula between a hepatic artery and the biliary tract . liver ischemia may follow an accidental catheterization of an intrahepatic artery followed by its thrombosis . cardiac failure is due to a rapid increase in cardiac output ; it may be severe and diuretics can be tried but , in life threatening cases , the obstruction of the shunt may be needed . finally , sepsis is a potential complication , but antibioprophylaxis can prevent it in a vast majority of cases . chronic complications are more frequent and their management may be difficult . congestive heart failure is related to a high cardiac output following tips . clinically the patients develop sodium retention and right sided heart failure ; in severe cases , treatment with diuretics and vasodilators does not work and obstruction of the shunt may be necessary . it occurs more often when the stent is not correctly placed inside the portal or the hepatic vein , thus obstructing the shunt flow . it may be observed in patients with a hypercoagulable state and in this situation life - long anticoagulation is needed . as observed after surgical portacaval shunt , progressive liver failure may follow tips implantation . the first sign is a progressive increase in the serum bilirubin , which is then followed by a rise in inr , onset of encephalopathy , and death due to multiorgan failure within weeks after tips . even if poor pre - tips liver function is a risk factor , some patients with a good hepatic reserve may also develop this serious complication after tips . tips is a portacaval shunt ; therefore , not surprisingly post - tips he remains a problem . he episodes are observed in 3040 % of cirrhotic patients , and as opposed to that observed in patients without tips , no precipitant can be identified in a majority of cases . chronic recurrent disabling he can occur in 510 % and may lead to a complete loss of the patient 's autonomy . several pre - tips parameters have been tested to predict post - tips hepatic encephalopathy ( table 4 ) . age , pre - tips encephalopathy , and the pugh score are probably the most useful predictors . the medical management is difficult and in many cases the only option is to reduce the diameter of the stent or preferably to occlude it . he clears quickly after the obstruction , but portal hypertension recurs with its associated potential complications ( ascites and variceal bleeding ) . the direction of intrahepatic portal flow , the flow volume in the stent , and the presence of increased velocity in the stent are useful criteria to detect shunt dysfunction and to decide if a shunt revision is needed with an angiographic intervention . however , the sensitivity and specificity of this modality are only 8085 % . shunt dysfunction results from an intimal hyperplasia in the stent and is more frequent in the hepatic vein part of the shunt ( figure 4 ) . this phenomenon was observed at 1 year in nearly 80 % of cases treated with bare stents and could not be prevented with acetyl salicylic acid or trapidil + ticlopidine . when ptfe - coated stents are used the one - year rate of shunttreatment includes dilatation of the stenoses and / or implantation of a new covered stent in this area . tips involves a foreign material chronically implanted in the liver , and cirrhotic patients are often immunocompromised and therefore susceptible to infection . but , surprisingly , the infection of the stent ( the so - called tipsitis ) is exceptional . the relative efficacy of tips has been tested with randomized controlled trials , ( refractory ascites , variceal bleeding ) , whereas other indications have been evaluated in uncontrolled case series . prevention of the initial bleeding can be achieved in a number of cases by endoscopic variceal ligation or - blocker treatment . however , tips has never been tested in this situation as previous experience with surgical portacaval shunts has clearly demonstrated that this approach is associated with higher morbidity and mortality rates . prevention of the initial bleeding can be achieved in a number of cases by endoscopic variceal ligation or - blocker treatment . however , tips has never been tested in this situation as previous experience with surgical portacaval shunts has clearly demonstrated that this approach is associated with higher morbidity and mortality rates . when an initial bleeding occurs , it is usually controlled with less invasive endoscopic treatment and / or pharmacological therapy . in rare cases bleedingremains uncontrollable , and tips has been used as a rescue treatment with good results for bleeding control . however , prognosis relies on the general condition of the patient , the value of the liver function reserve , and the associated comorbidities . however , a recent randomized controlled trial evaluated the use of emergent tips as compared to standard medical therapy in patients with severe portal hypertension and a pugh score of 7 to 13 . treatment failure was more frequent in the medical group ( 50 % versus 12 % ) and the survival rate was better in the tips group ( 11 versus 38 % ) . this approach could justify the use of tips early after bleeding episodes in patients with moderate or severe liver failure and severe portal hypertension . these promising results are in line with that observed in a case series of cirrhotic patients child a or b who underwent emergency portacaval shunt surgery but should be confirmed by other controlled trials . bleeding tends to recur frequently after a first episode . - blockers and variceal band ligation have both been demonstrated to lower the incidence of rebleeding . tips has been tested against these two modalities in several prospective controlled trials . meta - analyses have demonstrated that tips was more efficient in preventing rebleeding but it was more frequently followed by episodes of encephalopathy , and survival was not different between groups ( table 5 ) . tips has also been compared with surgical shunts or oesophageal transaction , but results are difficult to interpret because all the patients were good operative risks , and the studies were performed before the introduction of ptfe - coated stents . therefore , tips is not recommended as a first - line therapy for secondary prophylaxis of variceal bleeding . bleeding from gastric varices is often severe and difficult to control , particularly when fundal varices are involved . tips has been used in a number of uncontrolled trials in patients in whom endoscopic therapy failed . a recent controlled trial has shown that tips is more efficient than cyanoacrylate in prevention of rebleeding ( secondary prophylaxis ) from large gastric varices . this interesting finding must be confirmed by other groups and after a long - term followup . it should be mentioned that due to the large size of fundal varices , the risk of rupture is still present even at a low portacaval gradient ( 12 mmhg ) after tips . this is probably best explained by the relationship between the variceal tension ( and therefore the risk of rupture ) and the variceal size . for this reason , it is now recommended to embolize gastric varices at the time of tips placement ( figures 5 and 6 ) . varices may develop anywhere along the digestive tract in patients with portal hypertension ( duodenum , jejunum , colon , rectum , stomies ) and may bleed . the best approach is the tips procedure , which can be combined with embolization of the varices ( figure 7 ) . however , tips does not help to control haemorrhage , probably because these vascular lesions are related to liver disease and not to portal hypertension . it may become resistant to medical treatment in nearly 510 % of cases , and the tips procedure has been evaluated for this situation in case series and several prospective randomized controlled trials . tips - induced decrease in portal pressure leads to a good control of ascites in a majority of cases and more often than repeated large volume paracentesis . however , hepatic encephalopathy is observed more frequently , and survival is not improved in a majority of trials ( table 6 ) . however , a recent meta - analysis showed different results after analysing individual data . moreover , a recent study demonstrated that survival was better in the tips group as compared to the paracentesis group ; it should be mentioned that in this study , the patients had good liver and renal function . therefore , this issue is still controversial . there is no clinical controlled trial on the long - term efficacy of ptfe - covered stents in the treatment of refractory ascites . it is now agreed that tips may be offered to cirrhotic patients with moderately impaired liver function , without organic kidney disease and preferably in younger patients ( less than 65 years ) . the quality of life must be also be considered in the decision making process if transplantation is not an option . this is an equivalent of ascites , but the tolerance is poor as only a limited amount of fluid in the pleural may induce disabling dyspnea . repeated pleuracentesis is risky and chronic drainage is often associated with infection of the fluid . tips is a good option , but the risks of severe hepatic encephalopathy and / or liver failure following tips are similar to that observed in ascitic patients . the chronic form of functional renal failure associated with ascites ( hepatorenal syndrome type 2 ) is usually reversible after tips ; by contrast , hepatorenal syndrome type 1 which is progressive , more severe , and associated with progressive liver failure usually responds less well as tips may aggravate the liver insufficiency . it has no role in these patients except for highly selected cases as a bridge to liver transplantation . the management of this syndrome includes diuretic therapy and chronic anticoagulotherapy . in refractory cases , surgical side - to - side portacaval shunt has been used in the past but is no longer used due to the operative risks and the conflicting results . tips , which is a nonsurgical equivalent , has been widely tested and demonstrated promising results ( control of ascites , reversal of liver failure ) in large series ; however , the technique of tips placement is difficult given the absence of hepatic veins and the caudate lobe hypertrophy ( figures 8 , 9 and 10 ) . there is no controlled trial comparing tips with liver transplantation , but the good results observed after tips justify its use first , transplantation being considered in tips failure . several case reports have evaluated the tips procedure in the treatment of veno - occlusive disease with some good results . it has been suggested that relief of portal hypertension before abdominal surgery in cirrhotic patients could decrease the perioperative bleeding and postoperative complications , such as , ascitic leak . however , tips - associated complications are not infrequent ; the best candidates for preoperative tips are cirrhotic patients with well - preserved or moderately impaired liver function ( pugh class a or b ) and a significant amount of venous collaterals in the operative area . it should also be mentioned that preoperative tips would prevent the formation of stomal varices after surgery , which often induce recurrent bleeding ( figure 7 ) . a recent review reports 6 cases of hepatopulmonary syndrome with an improvement in oxygenation after tips placement in 5 patients . the rationale of this approach is difficult to understand as worsening of vasodilatation usually follows the tips procedure , which could aggravate hypoxemia . experience with this procedure over last 20 years clearly demonstrates the need for a multidisciplinary approach . first of all , the indications for tips should be discussed rigorously according to a risk benefit approach ; preoperative evaluation should include not only the liver function parameters , the cardiac function , but also the assessment of the comorbidities and the evaluation of the risks of post - tips chronic encephalopathy . therefore , hepatologists ( or gastroenterologists ) , cardiologists , interventional radiologists , intensive care specialists , and transplant surgeons play a role in the decision making process . primary patency higher than 90 % after the tips placement is a prerequisite in such a tips unit . followup is also crucial as post - tips complications may occur and must be treated . ideally , these patients must be followed regularly in a specialized tips clinic , and the surveillance of the tips function as well as screening for hepatocarcinoma is mandatory . the tips procedure is now a well - established treatment of complications of portal hypertension . technical advances and well - designed clinical studies provide a scientific basis to define the best indications . cost effectiveness analysis must be done in the future taking into account recent developments ( technical improvements , better selection of patients , and better management after tips ) . however , severe complications still exist and have to be addressed as stated in a recent editorial .\noutput:\n" }, { "from": "agent", "value": "the transjugular intrahepatic portosystemic shunt ( tips ) represents a major advance in the treatment of complications of portal hypertension . technical improvements and increased experience over the past 24 years led to improved clinical results and a better definition of the indications for tips . randomized clinical trials indicate that the tips procedure is not a first - line therapy for variceal bleeding , but can be used when medical treatment fails , both in the acute situation or to prevent variceal rebleeding . the role of tips to treat refractory ascites is probably more justified to improve the quality of life rather than to improve survival , except for patients with preserved liver function . it can be helpful for hepatic hydrothorax and can reverse hepatorenal syndrome in selected cases . it is a good treatment for budd chiari syndrome uncontrollable by medical treatment . careful selection of patients is mandatory before tips , and clinical followup is essential to detect and treat complications that may result from tips stenosis ( which can be prevented by using covered stents ) and chronic encephalopathy ( which may in severe cases justify reduction or occlusion of the shunt ) . a multidisciplinary approach , including the resources for liver transplantation , is always required to treat these patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: psoriasis is a chronic , immune - mediated skin disorder with an established association with increased metabolic and cardiovascular disease ( cvd ) risk in adults ( armstrong et al . , 2013 ; 2013 ) . mechanisms linking these conditions remain to be fully understood , but systemic inflammation in psoriasis appears to predispose to abnormalities that include a pro - atherogenic lipoprotein profile , large vessel inflammation , and adipokine dysregulation ( li et al . , 2014 ; mehta et al .2015 ) . as psoriatic disease begins in childhood in approximately one - third of cases , several studies have demonstrated that obesity , insulin resistance , and dyslipidemia are present at higher rates in affected children ( augustin et al . , 2010 ; ferretti et al . , 1993 ; koebnick et al . , 2011 ; paller et al . , 2013 ; torres et al . , 2014 ) , but additional study is needed on the timing , magnitude , and factors influencing and underlying such dysfunction . to further characterize cardiometabolic risk in affected children , detailed lipoprotein characterization was performed with comparison to healthy controls . beyond traditional lipid concentration , nuclear magnetic resonance ( nmr ) spectroscopy can accurately detect lipoprotein particle composition , size , and number ( otvos et al . , 1992 ) . in particular , this includes low density lipoprotein ( ldl ) particle concentration ( ldl - p ) , which has recently been shown to be a superior marker of cvd risk to ldl cholesterol concentration ( ldl - c ) , particularly when the two values are discordant ( cromwell et al . , 2007 ; otvos et al . , 2011 ; rizzo et al . , 2013 ) . high density lipoprotein ( hdl ) particle composition and size can also be assessed , which have been shown to be altered and related to vascular inflammation in adult psoriasis ( holzer et al . , 2012 ; yu et al . , 2012 ) . a key function of hdl is transportation of cholesterol from peripheral tissues , such as the arterial wall , to the liver for excretion into the bile . we and others have utilized a reliable assay to estimate this important property of hdl - promoted cholesterol efflux capacity ( cec ) , which may be more significant than traditional hdl cholesterol concentration ( hdl - c ) in predicting risk of cvd ( khera et al . , 2011 ; khera and rader , 2013 ; rohatgi et al . , 2014 ) . these advanced measures of lipoprotein composition and function may be useful for early detection of cardiometabolic aberrations in the pediatric population , where changes are likely to be more subtle . we hypothesized that psoriasis in children would promote a more atherogenic pattern , consisting of an elevated apolipoprotein b - 100 ( apo b ) level , increased number of smaller ldl particles , a reduction in larger hdl particles , and reduced cec after adjusting for known risk factors for cvd . standard deviation , unless otherwise noted ) , with near equal percentage of the two sexes ( additional demographics in table 1 ) . standard error ) , with 25 % having mild , 36 % moderate , and 39 % severe disease based on bsa .6.1 kg / m2 , with 20 % being overweight ( bmi between 85 and 94 percentile , inclusive ) and 27 % being obese ( bmi 95 percentile ) . one psoriasis subject had rheumatologist - confirmed psoriatic arthritis , one had polycystic ovarian syndrome , and a third had diagnosed hypertension on drug therapy .4.3 kg / m2 ; p = 0.03 ) , with 16 % being overweight and only 9 % obese , along with a lower waist to hip ratio . smoking and alcohol history were not significantly different between the two groups ( one current smoker in each , one case and 3 controls reported occasional alcohol intake ) . the psoriasis group also had a significantly higher incidence of hypertension , type 2 diabetes , dyslipidemia and coronary artery disease in the family . children with psoriasis demonstrated a trend toward higher homeostasis model assessment of insulin resistance ( homa - ir ) values ( 2.41 vs. 1.99 ; p = 0.11 ) , which was more apparent after log - transformation of homa - ir to fit the gaussian distribution ( 0.65 vs. 0.41 ; p = 0.07 ) . bmi was the strongest predictor of homa - ir ( beta 0.49 , p 0.001 compared to beta 0.13 , p = 0.05 for presence of psoriasis and beta 0.29 , p 0.01 for waist to hip ratio ) in unadjusted regression analyses and on adjustment for age , sex , glucose , systolic blood pressure , and hdl - c . four of the psoriasis patients had elevated c - reactive protein ( crp ) levels , while no controls had abnormal values ( p = 0.02 ) ; these 4 psoriasis subjects were also overweight or obese . traditional lipid concentrations were not significantly different between children with psoriasis and controls and nmr - measured ldl particle concentration ( ldl - p ) and size ( ldl - z ) also did not differ ( table 2 ) . serum apo b levels , however , were increased in the psoriatic group ( 72.4 + / - hdl particles tended to be smaller in general ( p = 0.02 ) , and the number of large hdl particles was decreased in those with skin disease ( 5.3 + / - the same findings were noted on exclusion of the two psoriasis subjects on systemic therapy and on analysis of plaque type disease alone and guttate and other mixed types alone , compared to their respective controls ( data not shown ) . while increased very low density lipoprotein ( vldl ) particle size was mainly noted in overweight and / or obese psoriasis subjects , the trend toward smaller hdl particles and decreased number of large hdl particles became significant only when the normal bmi group was added in addition to the overweight and obese groups . moreover , apo b levels were elevated even in normal bmi cases compared with their controls ( 75.420.4 vs. 64.217.5 , p = 0.02 ) . psoriasis subjects with a positive family history of type 2 diabetes had increased number of small and total ldl particles relative to those without such family history ( p = 0.002 and p = 0.04 , respectively ; see table s2 ) . a full list of correlations of cholesterol efflux capacity with all cardiometabolic parameters can be found in supplemental table 1 . as noted in prior studies , hdl - c and apolipoprotein a-1 ( apo a-1 ) levels were strong predictors of efflux capacity ( p 0.001 for both ) , while higher bmi , waist circumference , and homa - ir were associated with decreased efflux . in unadjusted analyses , cec was found to be significantly different between the psoriasis group and controls ( 0.90 + / - 0.15 vs. 0.95 + / - 0.12 ; p = 0.02 ) , and this decrease in efflux in children with psoriasis remained after adjusting for age , sex , fasting glucose , homa - ir , systolic blood pressure , bmi , apo a-1 , and hdl - c ( beta -0.22 , p = 0.021 ; table 3 ) . these primary estimates did not change when children currently undergoing systemic therapy for psoriasis , including those receiving biologic agents , were excluded . presence of psoriasis had greater effect on efflux capacity than having a bmi percentile in the overweight and / or obese range ( = 9.12 , p = 0.003 ; table 4 ) . those with 5 % bsa or greater involvement or psoriasis area and severity index ( pasi ) scores 6 or greater showed decreased efflux capacity compared to those with less skin involvement ( p = 0.02 and p = 0.02 , respectively ; see figure 1a and 1b ) . cec grouped by mild , moderate , and severe skin disease is depicted in figure s1 . stratified analysis did not demonstrate any ethnic differences in efflux capacity within the psoriasis group ( p = 0.19 ) , nor any differences based on family history of psoriasis ( p = 0.10 ) , coronary heart disease ( p = 0.66 ) , hypertension ( p = 0.76 ) , or dyslipidemia ( p = 0.89 ) ( table s3 ) . however , children with psoriasis and a positive family history of type 2 diabetes mellitus had significantly lower cec measurements when compared to those with no such family history ( 0.83 + / - likelihood ratio testing to understand which nmr - estimate hdl parameters best predicted efflux capacity showed that hdl particle size ( hdl - z ) , particle concentration ( hdl - p ) , and cholesterol concentration ( hdl - c ) were all important factors , but hdl - z had the largest effect of the three ( = 19.72 , p 0.0001 ; table 5 ) . here we provide , to our knowledge , previously unreported advanced lipoprotein compositional and functional assessments in pediatric psoriasis subjects . our findings demonstrate an adverse cardiometabolic risk profile even in the early years of skin disease , with a tendency toward increased insulin resistance , a more atherogenic lipoprotein particle profile , and lipoprotein dysfunction as assessed by cholesterol efflux , compared to non - psoriatic controls . systemic inflammation has been tied to insulin resistance in murine and human studies , with worsening of both as bmi increases ( esser et al . , 2014 ; li et al . , 2011 ) . our pediatric psoriasis subjects showed such clustering of inflammation ( measured by crp ) , overweight and obesity , and greater insulin resistance as estimated by log transformed homa - ir . homa - ir was used given strong correlation with the gold standard hyperinsulinemic euglycemic clamp technique and easier performance in young children ( henderson et al . , 2011 ) . in multivariate regression analyses , bmi was by far the strongest predictor of homa - ir , but presence of psoriasis and waist to hip ratio also had some effect . adult studies have also noted insulin resistance even in non - obese patients with psoriasis ( ucak et al . , 2006 ) . using the euglycemic clamp technique , gyldenlove et al . found that in normal glucose - tolerant adults , moderate to severe psoriasis subjects demonstrated greater insulin resistance than healthy controls of comparable bmi and body composition ( gyldenlove et al . , 2015 ) . decreasing calculated or measured ldl cholesterol concentration has for many years been the major goal of lipid - modulating therapies , yet a significant number of cvd - related events occur despite having traditional ldl - c at optimal levels ( cromwell et al . , 2007 ) . studies have shown direct quantification of lipoprotein particles to be more sensitive than ldl - c in identifying future cardiometabolic risk , particularly in chronic conditions with low - grade inflammation such as metabolic syndrome and type 2 diabetes mellitus ( cromwell and otvos , 2006 ; otvos et al . , 2011 ; rosenson et al . , 2010 ) . consistent with this observation , we found no difference in ldl - c estimates in our pediatric psoriasis cohort but observed an elevation in a more sensitive metric , apo - b levels . the apo - b concentration corresponds to the total number of atherogenic lipoprotein particles , including vldl , intermediate density lipoprotein ( idl ) , and ldl . on the other hand , no significant differences were found in either ldl particle concentration or size in our subjects relative to controls . this is in contrast to our adult psoriasis study , where these parameters were negatively altered , despite more psoriasis patients being on lipid - lowering therapy ( mehta et al . , 2012 ) . ldl particle measurements are influenced by traditional cvd risk factors , such as hypertension , dyslipidemia ( as measured by traditional lipids ) , and tobacco use , which were present in the adult psoriasis cohort with increased frequency . these disorders , however , were not yet prominent in our much younger population , where there was mainly excess adiposity but minimal overt clinical disease . these findings suggest that ldl - p may take longer duration of exposure to cardiometabolic diseases to manifest differentially . additional tendency toward an atherogenic profile was noted on examining hdl composition in our pediatric subjects . there was a trend toward smaller hdl particle size , and fewer large , hdl particles , similar to the pattern seen in adult psoriasis ( yu et al . , 2012 ) . such profiles have been noted to correlate with coronary atherosclerosis ( arsenault et al . , 2009 ; el harchaoui et al . , 2009 ) . lower lecithin - cholesterol acyltransferase ( lcat ) activity may contribute to the smaller hdl particle size and distribution measured . lcat is a key enzyme in hdl metabolism and mediates cholesterol esterification , resulting in their partitioning into the core of the hdl particle which increases particle size . effective therapy for psoriasis has been demonstrated to increase lcat activity ( holzer et al . , 2014 ) . moreover , vascular inflammation in adult psoriasis has been observed to be associated with these hdl particle changes , as assessed by measuring macrophage activity in atherosclerotic plaques of large vessels using [ 18f ] - fluoro - deoxyglucose - positron emission tomography ( yu et al . , 2012 ) . our study findings suggest that hdl particle size may capture early cardiometabolic effects with greater sensitivity than traditional lipid metrics . although traditional hdl cholesterol levels are inversely correlated with cvd events , therapies increasing hdl - c have not shown substantial effect in decreasing their risk , sparking the concept that hdl function is more important to disease outcome than the quantity of hdl ( barter et al . an important anti - atherogenic function of hdl is reverse cholesterol transport , whereby hdl particles accept cholesterol from lipid - laden macrophages , such as those within atherosclerotic plaques , for transport and eventual biliary excretion . ex vivo measurement of cholesterol efflux capacity using apob - depleted serum from subjects assesses this property and has been demonstrated in two distinct cohorts to be more influential than hdl - c or apo a-1 levels in predicting atherosclerotic burden and the incidence of cvd events ( khera et al . , 2011 ; efflux from macrophages and other aspects of hdl function , such as the anti - oxidative activity of hdl - associated paraoxonase protein , have been shown to be impaired in adults with psoriasis , with improvement in function with effective topical or systemic psoriasis therapy ( holzer et al . , 2014 ; marsche et al . , 2014 ; mehta et al . , , children with psoriasis had significantly decreased cec relative to healthy matched controls before and after adjusting for confounding variables , suggesting that reverse cholesterol transport defects start early in life even with very low levels of chronic inflammation . this provides further evidence of independent negative effects of psoriasis on lipoprotein function and associated unfavorable cardiometabolic risk . more severe skin disease also correlated with greater impairment of cec , which is in line with other studies that have shown increased metabolic abnormalities with greater psoriasis severity scores ( armstrong et al . , 2013 ; langan et al . , 2012 ) . in our study , children with psoriasis and normal bmi appeared to have an atherogenic profile even if on a lesser scale , including having elevated apo b levels compared to their normal bmi controls and a trend toward decreased large hdl particle number and hdl size . in addition , our data suggested that aberrations may not be unique to only plaque psoriasis , which is an important finding . use of nmr spectroscopy provides reliable and more detailed lipoprotein phenotyping beyond traditional lipid concentration . a main goal of our study was to understand how these more sensitive parameters may detect abnormalities earlier in the pediatric population . in fact , the characterization of lipoprotein particle composition demonstrated that hdl features were different between psoriasis and healthy controls even at this young age . our study also demonstrated that cec may be best predicted by hdl particle size , and given the labor involved in assays of cholesterol efflux , nmr spectroscopy may in fact identify multiple features of lipoprotein dysfunction . the use of particle number and size may therefore augment our detection of aberrations in this population at high risk for dyslipidemia in later life . overall , our findings support the concept that psoriasis , a condition characterized by a low - level systemic inflammatory state , predisposes to a more atherogenic profile early in the course of disease , and that outcomes which have been well studied in adults , such as obesity , diabetes , and atherosclerotic disease , may start early with precursor changes . this highlights the need to educate physicians ( primary care and dermatologists ) , patients , and families alike regarding these co - morbid conditions and potential future risks and to periodically assess young psoriasis patients for cardiometabolic risk . while screening guidelines have existed for adult psoriasis patients for several years , comparable recommendations are only now in development for children . our study was limited by a relatively small sample size ; however , this is the largest undertaking in pediatric psoriasis lipoprotein characterization to date . furthermore , since this was a cross - sectional study , a cause and effect relationship between psoriasis and measured aberrations can not be proven . a positive family history of type 2 diabetes showed correlation with lipoprotein abnormalities noted in psoriatic subjects , including increased number of small ldl particles , fewer large hdl particles , and decreased cholesterol efflux capacity , and it may therefore itself contribute to risk , or it may serve as a marker for other factors at play ( e.g. polymorphic variants of the apo genes ) . other potential confounders to address with additional research include ethnic background , effects of previous treatments , and more detailed lifestyle habits including activity and diet . ongoing prospective studies will better inform a potential temporal relationship . in conclusion , we demonstrate that there is systemic inflammation , obesity , and a pattern toward insulin resistance , lipoprotein composition abnormalities , and lipoprotein functional modulation in pediatric psoriasis . studying a larger cohort of children with assessment of cholesterol transport pathways can give insight to underlying pathogenesis , while comparison with affected adults can delineate the impact of disease duration . further understanding the mechanisms linking these co - morbidities to skin disease ( e.g. shared signaling pathways , shared proinflammatory cytokines and adipokines ) , stratifying patients by risk , and early counseling on lifestyle and other modifications can aid in mitigation of their effects . future studies should also evaluate whether more vigilant psoriasis therapy will lead to improved cardiometabolic health . the study complied with the declaration of helsinki protocols and was approved by the university of california , san diego institutional review board . written informed consentforty - four children and adolescents , age 0 to 18 years , with active psoriasis and 44 age - and sex - matched healthy controls were enrolled at a dermatology clinic . all races , ethnicities , and psoriasis types ( with or without psoriatic arthritis ) were allowed , with diagnosis clinically confirmed as typical psoriasis by a dermatologist or pediatric dermatologist . subjects could not have a diagnosis of congenital heart disease ; any prior cardiac catheterizations or surgeries ; have taken any cardiac medications ( calcium channel blockers , beta blockers , vasotropic medicines ) within the past 2 years , other than for hypertension ; have other systemic inflammatory disease ( including active atopic dermatitis , severe acne , inflammatory bowel disease , juvenile idiopathic arthritis , and connective tissue / autoimmune disease ) ; or have active infection or malignancy . in addition , control subjects could not have a personal or first - degree family history of psoriasis , and they usually presented for evaluation of nevi , birthmarks , warts , or molluscum . psoriasis subjects were examined and the % bsa involvement and psoriasis area and severity index ( pasi ) score determined . anthropometric , bmi , and blood pressure measurements were obtained on all subjects and venous blood samples collected after at least 10 hours of fasting . we utilized auto - analyzers to measure serum insulin , glucose , and traditional lipid concentrations , and automated turbidimetric immunoassays for apolipoprotein a-1 and b concentrations ( mayo medical laboratories , rochester , mn ) . the homeostasis model assessment of insulin resistance ( homa - ir ) index was used to estimate the degree of insulin resistance [ homa - ir = fasting glucose ( mg / dl ) * fasting insulin ( mu / ml ) / 405 ) ] . cholesterol efflux capacity ( cec ) was determined as per previously published methods ( khera et al . , 2011 ; mehta et al . , 2012 ) , with slight modifications . j774 cells derived from a murine macrophage cell line were plated and radiolabeled with 2 microcuries ( ci ) of h - cholesterol / ml . atp - binding cassette transporter a1 ( abca1 ) was up - regulated by means of a 6 - hour incubation with 0.3 subsequently , efflux mediums containing 2.8 % apo b - depleted serum from study subjects ( prepared as per mehta et al . , 2012 ) were added for 4 hours . efflux was calculated by using the following formula : [ ( ci of h - cholesterol in media containing 2.8 % apob - depleted subject serum ci of h - cholesterol in serum - free media ) ( ci of h - cholesterol in media containing 2.8 % apob - depleted pooled control serum ci of h - cholesterol in serum - free media ) . the pooled serum was obtained from five healthy volunteers and run on each plate in duplicates . all assays were performed in duplicate and the mean coefficient of variation of this assay in psoriasis subjects was 4.3 % and in controls 3.3 % . normally distributed continuous variables were compared using student 's t - test , while those lacking a normal distribution were compared using the mannrelationships between variables were determined using spearman correlation analysis and are reported as spearman ( r ) values . multivariate linear regression analysis was performed using cholesterol efflux capacity ( cec ) as the dependent variable and cvd risk factors ( age , sex , fasting glucose , homa - ir , systolic blood pressure ( bp ) , bmi , apo a-1 ) and psoriasis evident by skin lesions as independent variables . sex and psoriasis were adjusted as dichotomous variables in the models ; all other variables were continuous . similar findings were revealed in independent analyses designating sex and psoriasis as dichotomous variables and age , bmi , fasting glucose , homa - ir , systolic bp , cec as continuous variables . because the magnitude of the estimates of cec did not differ when fixed - and random - effects regression analyses were performed , we report - coefficients ( ) and p - values for the fixed effects models after adjustment for cvd risk factors . the relative value of the presence of psoriasis compared to elevated bmi in predicting cec was determined with likelihood ratio testing applied to nested multivariate regression models . finally , because nmr spectroscopy may be more readily available than cholesterol efflux assays and to understand the factor with the strongest contribution to efflux levels , we assessed which nmr - estimate parameters best predicted cec . likelihood - ratio testing was performed in nested tobit models to determine the incremental value of psoriasis as well as hdl - particle size ( hdl - z ) , particle concentration ( hdl - p ) , and cholesterol concentration ( hdl - c ) in estimation of cec above and beyond traditional cvd risk factors . the threshold of statistical significance was p0 .05 , and all analyses were performed using stata 12 ( college station , tx ) . supplemental figure 1 : cholesterol efflux capacity by psoriasis severity this figure depicts cholesterol efflux capacity with psoriasis severity ( measured by percent body surface area , bsa ) , with 11 subjects with mild disease , 16 with moderate , and 17 with severe disease . efflux capacity is expressed as a proportion normalized to a known pooled serum sample from five healthy volunteers . data expressed as meansd ; supplemental table 1 : spearman 's correlational analysis of cholesterol efflux capacity as the outcome with cardiometabolic variables supplemental table 2 : lab parameters and nmr spectroscopy profile of the psoriasis group stratified by family history of diabetes mellitus supplemental table 3 : cholesterol efflux stratification of psoriasis group based on positive family history of cv risk factors supplemental table 4 : raw cholesterol efflux capacity values for children with psoriasis and their matched controls\noutput:\n" }, { "from": "agent", "value": "psoriasis is associated with increased cardiovascular disease ( cvd ) in adults , but the risk profile of children with psoriasis remains to be fully characterized . we measured lipoprotein composition and function in 44 pediatric psoriasis patients and 44 age - and sex - matched healthy controls , using nmr spectroscopy and a validated ex vivo assay of high density lipoprotein ( hdl ) cholesterol efflux capacity ( cec ) . mean age was 13.0 years and the population was ethnically diverse . children with psoriasis had higher waist - hip ratios ( 0.85 vs. 0.80 ; p < 0.002 ) and insulin resistance measures ( log transformed homa - ir 0.65 vs. 0.41 ; p = 0.07 ) . despite comparable traditional lipid values , having psoriasis was associated with higher apolipoprotein b concentrations ( 72.4 vs. 64.6 ; p = 0.02 ) , decreased large hdl particles ( 5.3 vs. 6.7 ; p < 0.01 ) , and reduced cec after adjusting for age , sex , fasting glucose , homa - ir , systolic blood pressure , body mass index , apolipoprotein a-1 , and hdl cholesterol concentration ( beta -0.22 , p = 0.02 ) . pediatric psoriasis patients have a more atherogenic cardiometabolic risk profile , with evidence of insulin resistance and lipoprotein dysfunction by particle size , number , and functional assessment . these findings may provide a basis for the observed link later in life between psoriasis and cvd and support the need to screen and educate young patients to minimize later complications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the prevalence of major depression in primary care practice is 4.8 % to 9.2 % rendering mood disorders to be the most important psychiatric illness in primary care settings . though some psychiatrists believe that psychotic depression is uncommon , studies continue to demonstrate that 16 % to 54 % of depressed patients have psychotic symptoms ; delusions occur without hallucinations in about half to two thirds in adults with psychotic depression , while hallucinations are unaccompanied by delusions in 3 % to 25 % of those patients . major depression with psychotic features seems to present a distinct disorder from major depression without psychotic features ; the presence of psychosis , independent of depression or level of general psychopathology , is predictive of response to antidepressants monotherapy , supporting such distinction . the continuous performance test has been used to demonstrate deficits in core attentional functioning in schizophrenia , mania , and major depression . some authors have demonstrated attentional performance to be poor particularly in psychotic depression and schizophrenia rather than in depression lacking psychosis , providing another asset to strengthen the similarity of psychotic depression with schizophrenia rather than nonpsychotic depression . deficits in sustained attention in continuous performance test are shown to represent stable vulnerability indicators for schizophrenia and state - dependant indicator for major depression . the wisconsin card sorting test ( wcst ) , a widely used neuropsychological index of prefrontal cortical function , demonstrated depressed patients to have significant deficits on multiple wcst measures compared to healthy individuals . these deficits were correlated with the severity of depression and were less severe than those demonstrated by patients with schizophrenia , providing neuropsychological evidence for significant prefrontal cortical dysfunction in depression . though wcst has been utilized to assess frontal lobe functions in schizophrenia and depression , specific emphasis on wcst performance in major depression with psychotic features subtype is lacking . our work attempts to utilize wcst as potential differentiating tool between schizophrenia and psychotic depression .60 patients aged between 18 and 50 yrs were randomly recruited from the outpatient psychiatric service of alexandria university hospital . the study was approved by the ethics committee of alexandria faculty of medicine and patients signed a written consent form . diagnosis was made by structured clinical interview ( scid i for dsm iv ) in conformity with criteria of dsm iv ( diagnostic and statistical manual of mental illness in its 4th edition ) . only patients scoring 4 or more on the clinical global impression for severity cgi - s scale were included so that only severe cases were recruited . to minimize the effect of medications on wcst performance , only patients who were not taking their medication for at least 1 week before presenting or being brought by a family member to the outpatient servicepatients having chronic debilitating diseases , mental retardation , and handicap rendering assessment unreliable were excluded . subjects included 30 patients with schizophrenia and 30 patients with major depression with psychotic features chronic course . all were rated on the brief psychiatric rating scale ( bprs ) , a valid and reliable questionnaire to assess some demographic data as well as duration of illness and wcst computerized version 128 card produced by psychological assessment resources par inc . diverse measures on the wcst were assessed including number of administered trials , completed sets , percentage of correct answers and errors , percentage of perseverative errors , number of trials to achieve the first completed category , and number of failed categories . data were analyzed using pc with statistical package for social sciences spss version 13 ; the 0.05 was used as cutoff value for statistical significance . to assess comparison between schizophrenic and depressed patients regarding the whole set of parameters measured by the wcstthe bonferroni correction could be applied by setting the level of significance at 0.01 , instead of 0.05 , for each wcst parameter assessed . parametric testing was used to compare between independent groups as regards means and frequencies for various parameters . both schizophrenic and psychotically depressed patients who participated in our study showed no statistical difference in terms of gender distribution , age , duration of illness , severity as assessed by cgi - s , and finally bprs as a general psychometric tool commonly applied to mental illness ( table 1 ) . as regards the different parameters assessed by the wcst , no statistical difference could be found apart from percentage of perseverative errors which was the only parameter to show statistical difference ( p 0.05 ) ( table 2 ) . the application of bonferroni adaptation to the significance level for the whole set of items included in the wcst eliminates such difference ( table 3 ) . the wcst is one of the most widely used psychological testing tools to assess executive functioning such as problem solving , decision making , inhibitory control , and working memory . wcst performance was consistently found to be lower in patients with schizophrenia ; however , it does not seem to be specific to that disorder , because schizophrenia is characterized by a broad base of cognitive impairment , with varying degrees of deficit in all ability domains , as measured by standard clinical tests . since the wcst assesses various functions , it is difficult to differentiate its part in working memory from problem - solving capacity or other executive functions . therefore , it is not surprising that patients with unipolar depression performed poorly on the wcst . in one systemic review , 14 out of 15 studies demonstrated impairments of executive functioning in major depression . several brain regions in addition to the prefrontal cortex were shown to affect performance on the wcst . the disturbances in prefrontal areas that were demonstrated may be a necessary but not sufficient condition for a poor wcst performance . authors found that the performance of patients with chronic schizophrenia improved on the wcst when they received explicit card - by - card instructions . they concluded that patients with schizophrenia were unable to learn the wcst , suggesting unremediable deficits that were probably linked to a prefrontal dysfunction ; they also proposed that their failure did not result from not knowing but from not doing ; in other words , the necessary information was received but was not used to change behaviour . the patients were able to learn to perform other , nonprefrontal tasks , suggesting that the performance deficit on the wcst was not due to inattention or lack of effort . such improvement in wcst performance in schizophrenic patients has been also shown in recent studies . to integrate these notions , the model shows a failure in acute schizophrenia to integrate stored memories of past regularities of perceptual input with ongoing motor programs . some authors reported that there was no evidence of transfer of training effects across problem - solving tests , despite the similarity in the cognitive demands imposed by the instruments patients tested on . some authors found improvements after monetary reinforcements ; others found greater improvement after instructions without monetary reinforcement . studies reported by bellack et al . revealed that performance improved on the wcst when they combined monetary reinforcement with detailed instructions . these findings indicate that some patients with schizophrenia may be able to learn the wcst , suggesting that theiralthough the frontal lobe hypothesis of schizophrenia has a venerable history , we have seen that there are still gaps in our understanding of the precise nature of the deficit involved , as well as the reversibility of this deficit through reinforcement . though many authors tackled the poor wcst performance in schizophrenia and depressed patients with potential clinical applications for that but literature evaluating wcst in the subtype of psychotic depression is scarce and whether wcst can serve as a potential differentiation tool aiding diagnosis was not evoked in the literature . our study is limited by small sample so that extrapolation and generalization of the results are difficult and a definite need for replication on larger numbers to support our findings . although there were high numerical differences between the 2 groups , they were not significant , probably due to the low power / low sample size . another weak point is attributed to the fact that patients were not drug nave even if they were off medication for at least 1 week when presenting to the outpatient service , spontaneously or with a family member , before recruitment . , wcst could not serve as additional tool helping in differential diagnosis . due to limitations of our study , more studies are needed on larger samples and medication nave patients to explore this area .\noutput:\n" }, { "from": "agent", "value": "background . differentiating between schizophrenia and major depression with psychotic features often reveals diagnostic dilemma . both share psychotic features and severe impairment in occupational functions . severe psychomotor retardation , not uncommon in psychotic depression , may simulate negative symptoms of schizophrenia . our work aims at utilizing wisconsin card sorting test ( wcst ) performance as a potential differentiating neurocognitive tool . subjects and methods . 60 patients were recruited randomly from the outpatient service at alexandria university hospital : 30 patients with schizophrenia and 30 patients with chronic psychotic depression . they were subjected to clinical global impression for severity ( cgi - s ) scale and wisconsin card sorting test ( wcst ) 128 card computerized version . results . both groups were balanced in terms of gender distribution , severity and duration of illness . the study compared all parameters of wcst . only perseverative errors showed mild significant difference ( p < 0.05 ) that disappeared when applying bonferroni adaptation , setting significance level at 0.01 instead of 0.05 . conclusion . performance on wcst is similar in schizophrenia and severe depression with psychotic features in most of the measured parameters and hence could not serve as a supplementary tool differentiating between both diagnoses in our study ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in the conventional impression technique , impression materials on a tray are used to take an impression of intraoral structures , after which model materials are poured on to obtain a working model . this impression technique has been established over hundreds of years and recognized as a method of fabricating an accurate restoration .1 however , in this conventional technique , the impression materials may cause discomfort and there is a risk of cross - infection . in addition , it may be impossible to take accurate simultaneous impressions in multiple sites according to the clinician 's competence level due to the complexity of the impressiontaking process .2 in the digital - type impression technique , teeth are scanned with an intraoral scanner to produce an imaginary model on a monitor . then the imaginary model is modified and its occlusion is checked , after which it is sent online to fabricate a working model using a computer - aided manufacturing ( cam ) method . with this digital - type impression technique , the discomfort caused by impression materials decreases and the appropriate reduction amount can be determined immediately . in addition , it is easy to educate patients because the images of abutment formation are shown on the monitor . moreover , the risk of cross - infection decreases , accurate raw data can be sent to the dental laboratory , and the data can be stored permanently .3 cerec ( sirona dental co. , gmbh , bensheim , germany ) , which was developed by mrmann in zurich university , is the world 's first intraoral scanner . it was first used only for the fabrication of inlays and onlays , and its use has later been extended to the fabrication of crowns and fixed partial dentures .4 however , the digital - type impression technique using an intraoral scanner has not been widely used because it requires a private program for restoration , and an intraoral scanner and a milling machine . accordingly , however , since the intraoral scanners such as itero ( cadent inc . , carlstadt , nj , usa ) , lava cos ( 3 m espe , st . paul , mn , usa ) and e4d dentist ( d4d technologies , richardson , tx , usa ) , which provide an open architecture for processing data using non - private programs , were introduced , the intraoral scanner has been reviewed .56 in cerec , an active triangulation method with blue leds is used for intraoral scanning ; in lava cos , a 3d - inmotion technology with blue leds ; and in e4d dentist , a red laser technique . in itero , images are obtained through the parallel confocal and telecentric principles . according to the parallel confocal principle , light that passes through a small pinhole is reflected after it contacts an object , and the reflected light again passes through the pinhole to be sensed by a sensor . in itero ,100,000 rays of a parallel red laser beam are irradiated to an object to measure the distance through 300 layers of various depths for representing images without dental coating powder . according to the telecentric principle , the effects of the z axis are minimized by having only the light parallel to the light axis passing through an aperture installed on the lens focus . when objects have different depths , their image sizes may vary due to the difference in their distances ; but according to the telecentric principle , the visual field of the scanned area can be evenly maintained regardless of the distance to the objects . accordingly , it is unnecessary to further adjust the magnifying power for the contact scanning of the teeth . as a result , accurate images are more easily obtained with itero than with other intraoral scanners .567 one of the important factors of the success of a fabricated restoration is marginal adaptation .8 poor marginal adaptation can cause plaque accumulation , periodontitis , or dental caries , which may result in restoration failure .8910111213 in the cases of precious metal crowns , the theoretical marginal gap needed to achieve satisfactory marginal adaptation is 20 - 50 m ; 14151617 however , considering the lifespan of the restoration , 100 - 200 m is acceptable .18192021 internal fit is another factor that must be considered when fabricating accurate restorations .22 to enhance internal fit , an appropriate and uniform cement space must be considered . when the cement space is excessive , the long - term stability can be compromised due to the dependence on the cement itself rather than on the tooth shape , and the direction can be lost while setting and cementing the restorations .23 on the other hand , insufficient cement space may cause incomplete setting of the restorations and reduce their retention .24 in a previous study on the marginal adaptation of restorations fabricated using the digital and conventional impression techniques ,25 zirconia - based all - ceramic crowns that were fabricated using the computer - aided design / computer - aided manufacturing ( cad / cam ) system were used as restorations . their suitability was affected by the information entering process , the software to compensate for the contraction errors that occurred during the sintering process , the accuracy of the cutting instruments , and the competence of the clinicians .262728 therefore , it was difficult to evaluate the effects of the impression technique and the model preparation on the restoration suitability . previous studies have reported the suitability of restorations fabricated using digital and conventional impression techniques , but few studies have been conducted that compared marginal adaptation with internal fit in artificial teeth and patient abutments . in this study , the marginal and internal fit of precious metal crowns prepared with the digital impression technique using itero was compared with the marginal and internal fit of precious metal crowns fabricated with the conventional impression technique using addition silicone impression materials in artificial teeth and patient abutments , to investigate the clinical usefulness of the digital impression technique . tokyo , japan ) was prepared using a tapered round - ended diamond bur ( tr 13 ; mani inc . , a chamfer margin was prepared at the cementoenamel junction , and the axial plane was reduced by about 1.0 mm ; the occlusal surface , by about 1.5 mm ; and the axial inclination , by about 6 degrees . finishing was conducted using a small grain - sized diamond bur ( tr 13f & 13ef ; mani inc . , tochigi , japan ) and a stone point ( shofu composite finishing kit ; shofu inc . , the root area of the prepared tooth was fixed to a 10 mm - thick autopolymerizing acrylic resin ( orthoresin ; degudent , hanau - wolfgang , germany ) in the long - axis direction of the tooth to expose the lower end of the margin by 2 mm ( fig . the approval of the institutional review board of pusan national university dental hospital was obtained ( application no . of the patients who visited the department of prosthodontics of pusan national university dental hospital , 10 patients ( two males and eight females ) who wanted cast gold crown were selected for this study . to minimize the patient factors , only one restoration was fabricated for each patient . after the tooth preparation , a temporary restoration was fabricated using polymethyl methacrylate resin ( tokuso curefast ; tokuyama dental co. , tokyo , japan ) and cemented with tempbond ( kerr , romulus , mi , usa ) . the tray was made 24 hours before taking the impression to prevent any error caused by the polymerization contraction of the tray resin . inside the tray , an adhesive ( tray adhesive express , 3 m espe , st . paul , mn , usa ) was evenly coated before the impression was taken using the addition silicone impression material ( imprint ii garant ; 3 m espe , st . five minutes later , when the impression material had hardened , the impression body was removed and a gypsum cast was fabricated using an improved dental stone ( fujirock ep ; gc corp . , before the impression was taken , a double gingival cord procedure was performed on the soft tissues in the abutment area . gingival retraction cords ( ultrapak # 000 & # 0 ; ultradent prod . inc . , south jordan , ut , usa ) were used after they were soaked in aluminum chloride ( hemodent ; premier dental prod . , an impression was taken using an addition silicone impression material , and a gypsum cast was fabricated ( fig . the impression of the antagonist tooth was taken using a typical metal tray ( frontier metal tray , frontier dental industrial co. , seoul , korea ) and alginate ( tokuyama ap - 1 , tokuyama dental corp . tokyo , japan ) , and a gypsum cast was fabricated using a dental stone . the interocclusal record was taken using an addition silicone occlusal registration material ( futar d ; kettenbach gmbh , eschenburg , germany ) , and the gypsum cast was mounted at the semi - adjustable articulator ( hanau modular model 190 - 291111 ; waterpik , buffalo , ny , usa ) . for the digital method , the impression of the artificial tooth was taken using itero . the 45 occlusal , buccal , lingual , mesial , and distal planes of the tooth were scanned maximum 10 times . after the imaginary model was evaluated , the data were transmitted to the itero center for the fabrication of a polyurethane model ( sikablock m1000 ; sika deutschland gmbh , stuttgarter str . , germany ) using a five - axis computerized numerically controlled milling machine ( vf - 2tr ; hass automatic inc . , oxnard , usa ) . when the polyurethane models were fabricated , separate burs were used for each model . the soft tissues in the abutment area had been prepared before the impression was taken . the buccolingual , mesiodistal , and occlusal surfaces of the abutment were scanned five times using itero , and the occlusal , buccal , and lingual surfaces of each tooth other than the abutment were scanned once to take impressions of them . after the imaginary model was evaluated , the data were sent to the itero center for the fabrication of a polyurethane model ( fig . kyoto , japan ) was coated twice 1 mm superior to the margin to secure a cement space , and a die hardener ( stone die & plaster hardener resin ; george taub prod . , jersey city , nj , usa ) was coated inferior to the margin . following the typical method , a wax pattern was prepared , and 40 cast gold crowns ( type iv gold alloy c - 55 ; shinhung dental gold alloy , seoul , korea ) were prepared ( fig . the cast gold crowns that were fabricated using the conventional impression technique were assigned to the conventional group , and those fabricated using the digital impression technique , to the digital group . after the cast gold crowns were filled with light body addition silicone ( aquasil ultra xlv ; dentsply - caulk , milford , ct , usa ) , they were positioned on the teeth . to implement the clinical luting restoration process , regular body addition silicone ( aquasil ultra lv ; dentsply - caulk , milford , de , usa ) was injected inside the crowns and hardened to stabilize the thin silicone film . after the silicone replica was cut at the buccolingual midpoint and the mesiodistal trisection point using a sharp razor blade ( fig .7 ) , the measurement points ( marginal , marginal - axial plane transition , center of the axial plane , and occlusal surface quadrisection points ) were determined ( fig . a , i , a , i , 1 , and 9 ) , which is the distance between the restoration margin and the abutment margin , and the internal marginal gap ( fig . 8 . b , h , b , h , 2 , and 8 ) , which is the perpendicular distance between the restoration and the tooth surface in the marginal - axial plane transition area , were measured to evaluate the marginal adaptation . the internal fit was evaluated by measuring the perpendicular distance between the inner wall of the restoration and the tooth and measuring the internal gap width ( internal gap ) , on the axial plane ( fig . 8 . c , g , c , g , 3 , and 7 ) and on the occlusal surface ( fig . 8 . d , e , f , d , e , f , 4 , 5 , and 6 ) . after photos were taken using a microscope ( olympus bx 51 ; olympus , tokyo , japan ) at 100 magnification and a digital camera ( polaroid dmc2 digital microscope camera ; polaroid co. , cambridge , ma , usa ) , the gap width was measured using i solution ( imt i - solution ver . dajeon , korea ) ( fig . 9 ) . a trained experimenter measured each area thrice , and the mean values were recorded . the mean and sd of the margin and the internal gap width between the cast gold crown and the tooth surface were calculated . the kolmogorov - smirnova test andthe shapiro - wilk test were used as the normality tests for the impression techniques . when the normality was satisfactory , the t - test was used ; otherwise , wilcoxon 's signed rank test was used . to test the difference among the measurement points in the impression techniques , anova ( one - way analysis of variance ) was used . as an ad hoc testthe mean and sd of the digital group and the conventional group are shown in table 1 and table 2 . the mean of the gap widths at all the measurement points was defined as thethe mean gap widths of the digital group and the conventional group are shown in table 3 . the mean gap width was in a clinically acceptable range , and that of the digital group was significantly greater than that of the conventional group ( p .05 ) . the statistical analyses significant differences were observed in measurement points c , d , e , f , e , f , h , 4 , 5 , and 6 of the master models ( p .05 ) ( table 1 ) ; and in the patients , measurement points d , e , f , d , e , f , 1 , 4 , 5 , and 6 ( p .05 ) ( table 2 ) . in the marginal adaptation , the analyses of the absolute marginal discrepancy and the internal marginal gap in the master model showed that the internal marginal gap of the digital group was significantly less than that of the conventional group ( p .05 ) ( table 4 ) . the internal fit of the digital group was significantly greater than that of the conventional group ( p .05 ) . the analyses of the axial surface and the occlusal surface showed no difference in the gap width on the internal axial surface ( p .05 ) , but a significantly greater gap width on the internal occlusal surface in the digital group than in the conventional group ( p .05 ) ( table 5 ) . significant differences were observed among the measurement points in the impression techniques ( p .05 ) ( table 6 ) . in the conventional group , the master model showed a significantly smaller gap width in the margin than the patient in the axial surface . both the master model and the patients showed significantly greater gap widths on the occlusal surface ( p .05 ) . in the digital group , both the master model andthe patients showed significantly less gap widths in the margin and the axial surface than on the occlusal surface ( p .05 ) . the gap widths measured in the artificial tooth and the patient abutments showed a similar tendency . however , the mesiodistal section analysis ( p .05 ) showed that unlike in the master model , the absolute marginal discrepancy and the internal axial surface gap width in the digital group patient were significantly less than those in the conventional group patients ( table 7 ) . restorations should obtain accurate marginal fit , structural rigidity , and intraoral stability with the harmony between their functions and esthetics . marginal adaptation is particularly important for the long - term success of a restoration .8 poor marginal adaptation of a restoration results in an increase in plaque and food deposition , and in gingival tissue inflammation and dental caries , which reduce the lifespan of the restoration .8910111213 internal fit is important in the fabrication of accurate restorations .22 an appropriate and uniform cement space is required to enhance the internal fit . when the cement space is excessive , retention depends more on the cement than with the tooth , which decreases the long - term stability .23 when the cement space is not enough , the restoration is incompletely seated , which hinders the retention .24 in the clinical application of a restoration , evaluations of the marginal and internal fit are required , and the evaluation standards such as the measurement methods , number of measurement points for significance , and measurement criteria must be considered . extracted human teeth show changes in their physical properties according to their storage condition and the lapsed time after their extraction , which make it difficult to maintain the uniformity of the sample . in addition , it is impossible to obtain multiple samples from a single patient .2930 therefore , in most margin measurement studies , artificial teeth are used instead of natural teeth , and one master model is reproduced into multiple samples before their marginal gaps are measured . in this study , an artificial tooth was used to evaluate the difference between the impression techniques . through model experiments , research conditions such as the tooth preparation , impression - taking method , and experiment processcan be uniformly obtained , whereas through clinical trials , various clinical manifestations can be included and realistic evaluations can be made .26 in this study , both the model experiments using an artificial tooth and the clinical trials using the patients ' intraoral abutments were conducted . commonly used restorations include cast gold crowns , porcelain fused gold crowns , and zirconia - based all - ceramic crowns . porcelain fused gold crowns , which are made of a gold alloy , have good fit due to their metal coping fabrication , but require a multi - step ceramic - plasticity process that has been reported to have caused transformations in the metal coping and ceramics during the preparation process and have degraded their fit .3132 zirconia - based all - ceramic crowns show a wide variation in suitability due to the errors in the abutment - form scan , coping fabrication , and zirconia processing processes , the contraction in the zirconia sintering process , and the differences in the levels of competence of the clinicians .262728 cast gold crowns have been known to have the best fit among restorations due to their excellent castability and adhesiveness as gold alloys .1617 in this study , cast gold crowns were selected as the experimental restorations . to exclude the subjective factors of the dental technician , only one dental technician who was experienced in fabricating cast restorations conducted the experiments . the factors that affect the fit include the cement space , the pressure generated during the cementation , and the margin shapes .33 appropriate cement space is required to achieve excellent suitability . the cement space reduces the initial - stage hydraulic pressure during the cementation process and increases the cement distribution effect with minimal frictional resistance to accomplish perfect seating of the restoration .3334 according to gardner35 the cement thickness increased by up to 100 m when the hydraulic pressure was not reduced . the methods of reducing the hydraulic pressure include venting and internal relief .3637 internal relief can be attained through internal reductions of the wax pattern and the framework , the internal etching process of the framework , the electrochemical milling process , and die spacer coating .8 in this study , the die spacer was coated to provide the restoration with a space . a previous study reported that there was no correlation between the cementation pressure and the fit ,38 but the cementation pressure is a major factor that affects the marginal adaptation .39 in most model experiments , devices such as universal testers , which can produce a uniform force , are used to prevent any change in the fit during the restoration cementation process .40 however , in this study , the model experiments and clinical trials were conducted in the same condition . to simulate the restoration cementation process in the clinical setting , a previous study reported that there was no correlation between the margin form and the suitability .41 regarding the effect of the margin form on the suitability , pera et al. 42 compared the margin adaptation in the chamfer , and the 50 shoulder and 90 shoulder margins using a stereomicroscope . a 50 m or less marginal adaptation was observed in all the clinical cases regardless of the reduction form , but the chamfer and the 50 shoulder margin showed better marginal adaptation than the 90 shoulder margin . the experimental methods of measuring marginal fit include direct measurement , sectional measurement , evaluation through impression - taking , evaluation through probing , and simulation method .43 through the microscopic observation method , repeated measurements are available and additional measurement sites can be chosen , but the measurements may be inaccurate .43 the methods using impression taking and probing is inaccurate .4445 moon et al. 44 reported that the sectional measurement method is the most accurate method , but in such method , it is difficult to increase the number of measurement sites ; to do so , additional samples are needed . therefore , molin and karlsson used the replica technique on restoration margin fit in the comparative study .46 this method is simple because the restorations do not need to be sectioned , the margin deformity during sectioning can be prevented , the number of the measurement sites can be easily increased , and repeated measurements are available .46 in addition , the marginal and internal fit can be accurately measured . this method is also ethically acceptable for use in a marginal fit study that targets patients .47 accuracy of the replica technique have been known to have been low , but it is now widely used to measure the accuracy of restorations because materials with enhanced accuracy such as addition silicone are used . according to rahm et al. ,48 there was no significant difference in accuracy between the conventional method of sectioning the restoration and the replica technique . in this study , the marginal fit of restoration was measured using the replica technique . in measuring the gap width between a tooth and a restorationthe use of few measurement points is convenient and fast , but the deviation according to the measurement site increases ; on the other hand , the use of many measurement points can provide reliable results , but it is time - consuming . to calculate a representative value of the marginal fit of a samplenevertheless , no appropriate measurement number for the significance of the restoration suitability has been reported yet . in the gap analysis of a single crown , gassino et al. 49 measured minimum 18 times , and groten et al. 50 did more than 50 times . in the fixed abutment measurement , yoonet al. 51 measured each of 8 measurement points thrice ( a total of 24 measurements ) ; vigolo and fonzi52 measured each of 8 measurement points once ( total : 8 measurements ) ; and gonzalo et al. 53 measured each of 4 measurement points 30 times ( total : 120 measurements ) . in this study , 9 measurement points on each of three sectional planes were measured three times . the standards for measuring restoration marginal fit have been defined in many studies . holmes et al. 54 defined the perpendicular distance between the axial plane of an abutment and the internal surface of a restoration as the internal gap , and particularly , they called the distance from the marginal area to the internal surface of the restoration the marginal gap . according to them , since the absolute marginal discrepancy , which is the distance between the abutment margin and the restoration margin , was the greatest among the marginal errors , the discrepancy was suggested as a clinically useful standard . in this study , the internal marginal gap between the absolute marginal errors and the marginal - axial plane transition was measured in the marginal area , and the internal gap was evaluated by measuring the perpendicular distance between the abutment axial plane and the internal surface of the restoration on the axial plane and the occlusal surface . the american dental association ( ada ) 14 determined the clinically acceptable range as 25 - 40 m in ada specification # 8 . sorensen et al. 15 suggested a 50 m or less marginal gap for inhibiting bone loss caused by marginal errors , and christensen16 suggested an appropriate marginal gap of 40 m . ostlund17 suggested a less than 50 m level . in the case of restorations using the conventional casting method , a 50 m or less marginal gapnevertheless , according to moon et al. ,44 marginal fit is merely a standard for experiments , and it can not be a standard for clinically acceptable margins . in the study of mclean and vonfraunhofer18 the marginal gap of 80 m or less was hardly detectable with radiologic methods , and a 200 m gap width was undetectable even with a 80 m probe . they investigated 1,000 intraoral restorations that were used for more than five years and confirmed that a 100 m marginal discrepancy was clinically not a problem , so they suggested 160 m as a clinically acceptable marginal gap . from the study of kydd et al. 21 on the marginal leakage in teeth extracted due to periodontal diseases , they reported that the restorations could be used for more than 20 years with the margin with a 74 m cement thickness , 432 m leakage , and 244 m marginal gap . therefore , the marginal suitability may be clinically acceptable with the maximum 200 m marginal gap in the 100 - 200 m range . in this study , the mean gap width and the marginal gap of the metal crownsthese results correspond with those of syrek et al. 25 the internal gap width affects the retention of restorations . jrgensen and esbensen55 confirmed a moderate effect of a 20 - 140 m difference in the cement thickness on the retention and observed a significant decrease in the retention only in the cases of a 140 m or greater difference . passon et al. 56 reported no change in the metal crown retention with a 151 m - thick cement . in this study , only the conventional group showed a clinically acceptable internal fit in the model experiments , consistent with the results of previous studies . in the case of single molar crowns , the internal axial plane gap width more significantly affected the restoration retention than any other internal gap width , and the evaluation of the internal axial plane gap widths in both groups showed that they were both clinically acceptable . the wide internal gap width was mainly caused by the wide internal occlusal surface gap width . in this study , this was deemed to have been due to the finger pressure applied to the restoration for its seating on the tooth in the gap width measurement using the replica technique . the luting pressure is an important factor that affects the marginal adaptation .39 in the model experiments , devices such as a universal tester were used ; in other clinical studies , a device that could apply a 50 n even force to the restoration was used .26 since this force could not be realized with finger pressure , the gap width in this study was greater than those in previous studies . although the marginal gap was in the clinically acceptable range , the measured gap width was greater than those of previous studies , which was deemed to have been due to the lack of luting pressure that caused incomplete seating of the restoration on the tooth . however , the internal occlusal surface gap width in the digital group was significantly greater than that in the conventional group . considering that the digital group showed a slightly smaller internal axial plane gap width than the conventional group , the restoration of the digital group was not completely seated due to its smaller internal axial plane gap width . in this case , the marginal gap of the digital group should have been observed to have been greater than that of the conventional group , but the marginal gap did not show a significant difference among the impression techniques . itero is based on the telecentric principle with an aperture at the lens focus through which only the light parallel to the light axis passes .567 although itero could minimize the z axis effects compared with other intraoral scanners ,7 its perpendicular marginal fitness was insufficient compared with the conventional impression technique . in both the model experiment and clinical trials , the internal marginal gap was observed to have been greater than the absolute marginal errors . based on the internal occlusal surface gap width in the digital group , which was significantly greater than that in the conventional group , the digital group was considered perpendicularly greater than the conventional group . this meant that the digital group showed a closer contact with the abutment in the internal axial plane than the conventional group . accordingly , the digital group should have had more absolute marginal errors than the conventional group , but the internal marginal gap was observed to have been greater than the absolute marginal errors in this study . this result might have been due to the factors associated with laboratory work and with the error corrections in the marginal area finishing process . to verify this assumption , since the restoration retention is enhanced with better marginal fit in the axial plane of the same abutment , the retention in the conventional group might have been lower than that in the digital group if the assumption was correct . no significant difference in the margin and internal axial plane gap widths was observed among different impression techniques . however , in the clinical trials , no significant difference in the absolute marginal errors and the internal axial plane gap width was observed in the buccolingual direction . on the other hand , in the mesiodistal direction , a greater gap width was observed in the conventional group than in the digital group . the addition silicone impression material must be 2 mm thick for volume stability .57 in the model experiments , individual trays were prepared for the 2 mm uniform impression material spaces given to all the tooth surfaces . the individual trays were prepared in the clinical trials ; a uniform impression material space was given to the buccolingual direction , but could not be given to the mesiodistal direction due to the adjacent teeth . moreover , since the nearby impression body that was not supported by the tray while the impression body was removed from the oral cavity was removed through the maximum bulging area of the nearby tooth , a deformity could have developed during removal , had the minimal thickness for volume stability not been secured . as a result , in the clinical trials , the mesiodistal absolute marginal errors and internal axial plane gap width in the digital groupwere observed to have been greater than those of the conventional group . to enhance the clinical validity , the adjacent teeth may need to be considered in the model experiment planning stage . in this study , the stability of the precious metal crowns that were prepared using the digital impression technique was compared with that using the conventional impression technique . the comparison of the marginal fit of the artificial teeth and the patient abutment using the replica technique showed that the precious metal crowns that were prepared using either impression technique had clinically acceptable marginal fit . however , kunii et al. 58 reported that the larger the restoration was , the more inaccurate it was . further studies on the restoration length , the length of the edentulous area , and the forms and shapes of the restoration may be needed . in this study , the marginal and internal fit values of precious metal crowns that were prepared using the digital and conventional impression techniques in an artificial tooth and patient abutments were compared . both prostheses presented clinically acceptable results with comparing the fit . the prostheses fabricated from the digital impression technique showed more gaps , in respect of occlusal surface .\noutput:\n" }, { "from": "agent", "value": "purposethe purpose of this study was to compare the fit of cast gold crowns fabricated from the conventional and the digital impression technique.materials and methodsartificial tooth in a master model and abutment teeth in ten patients were restored with cast gold crowns fabricated from the digital and the conventional impression technique . the forty silicone replicas were cut in three sections ; each section was evaluated in nine points . the measurement was carried out by using a measuring microscope and i - soultion . data from the silicone replica were analyzed and all tests were performed with - level of 0.05 . results1 . the average gaps of cast gold crowns fabricated from the digital impression technique were larger than those of the conventional impression technique significantly . 2 . in marginal and internal axial gap of cast gold crowns , no statistical differences were found between the two impression techniques . 3 . the internal occlusal gaps of cast gold crowns fabricated from the digital impression technique were larger than those of the conventional impression technique significantly.conclusionboth prostheses presented clinically acceptable results with comparing the fit . the prostheses fabricated from the digital impression technique showed more gaps , in respect of occlusal surface ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the world health organization has described nonadherence to medications as the leading cause of preventable morbidity and mortality . for instance , 50 % of those treated for hypertension experience clinically significant medication non - adherence , leading to worse blood pressure control , cardiovascular morbidity , higher medical costs , and increased all - cause mortality . a recent analysis by ho et al . found that non - adherence to treatment for hypertension was associated with higher hospitalization rates and all - cause mortality among persons with diabetes . improving adherence has been called the next frontier in ( healthcare ) quality improvement . despite decades of research , poor adherence to treatment recommendationsremains prevalent across a range of disease targets , types of treatment , and populations . factors thought to be causally related to non - adherence vary broadly and include regimen complexity , poor patient - provider communication , depression , minimal social support , and financial barriers . despite this knowledge , a 2008 cochrane review concluded that most interventions to improve medication adherence did not neither achieve sustained improvements in adherence nor lead to better clinical outcomes . steiner has recommended that improving interventions will likely depend upon better understanding of behavioral factors , as opposed to socioeconomic or clinical factors , and their relation to non - adherence . we previously observed and reported an association between a behavioral factor ( emotional response orer ) and medication non - adherence ( to antidepressant medication ) . in the current study , we ascertained baseline er in a sample of complex patients with diabetes and comorbid hypertension . we were interested in the effect of er on adherence to medication for hypertension and on blood pressure improvement . because emotions and emotional disorders are complex phenomena , their effects on outcomes may vary by factors such as gender . for instance , in a cross - sectional study of persons with diabetes , depressive symptoms exerted a substantially more negative effect on medication adherence among men than that among women . therefore , to maximize our ability to detect interactive effects , we analyzed the data with kraemer 's moderator - mediator approach , a systematic method we have implemented previously in a national dataset . in a sample of patients with diabetes and comorbid hypertension , we conducted an analysis to explore how a measure of emotion , er , was associated with adherence to blood pressure medication and with change in systolic blood pressure ( sbp ) over time . based upon previous findings , we hypothesized that er ( positive or negative versus neutral ) would be associated with worse adherence to blood pressure medication for men than that for women . participants were patients with diabetes and comorbid hypertension ( icd code 401.9 ) who were invited to join the study if they were receiving care at one of 7 participating clinics in an urban us community health care system . subjects were excluded if they were not english speaking , were pregnant or lactating , or exhibited poor 30 - day recall . the colorado multiple institutional review board approved the study ( protocol number 07 - 1180 ) . we obtained prospective data on pharmacy prescription refills for antihypertensive medications beginning at baseline interview and extending to 90 days . refill compliance is a broadly used , reliable and valid method to estimate adherence and has been significantly associated with other measures of compliance ( self - report , pill counts ) , with measures of drug presence ( e.g. , serum drug levels ) , and with physiologic drug effects . ( pdc ) as the specific method of assessing refill compliance . the pdc was calculated as the number of days ' supply obtained during the 90 - day interval divided by the number of pill - days prescribed . pdc ranges from 0 % to 100 % , and can exceed 100 % if more than 90 days of pills are obtained for the interval . we obtained baseline and follow - up sbp values from the medical record to determine change in sbp . the follow - up 90 - day sbp values were collected from the measurement at the first clinic visit , if any , between 90 and 150 days after baseline . we ascertained variables referenced in previous studies as associated with postbaseline non - adherence , or having a plausible theoretical association with non - adherence . ( 1 ) emotional response ( er ) ( variable of primary interest ) . measures of emotion are linked theoretically to adherence , and er has been associated with non - adherence to antidepressant medication in a prospective study . we assessed er with a grey - scale normalized , neutral ekman facial expression monograph . the ekman monographs are reliable and valid regardless of the rater 's age , gender , race / ethnicity , or cultural background . disgusted , angry , and sad ( negative ) , surprised and happy ( positive ) , andwe dichotomized er ( positive or negative emotional response versus neutral / no response ) and also examined the effects of all three levels . a total of 17 other possible sociodemographic and clinical risk factors were determined from the electronic medical record and questionnaires . ( 2 ) medication beliefs . we measured medication beliefs with general - overuse and general - harm scales from the beliefs about medication questionnaire , ( bmq ) which have been associated with medication non - adherence in complex patients . ( 3 ) patient - clinician relationship . a collaborative relationship between the patient and their clinicianwas measured with a 3 - item scale from the helping alliance questionnaire ( haq ) . self - efficacy was measured with the general self - efficacy ( gse ) scale . ( 510 ) age , race / ethnicity ( non - hispanic white , non - hispanic black , hispanic ) , gender , smoking status ( current versus former or never ) , insurance ( private , medicaid or medicare , none ) , and total medication copay / month . a single item inquired how mental or physical health problems affect social activities , and a 2 - item bodily pain score assessed pain severity . body mass index ( bmi ) was categorized according to national heart lung and blood institute criteria . baseline systolic blood pressure ( sbp ) was assessed from the medical record by averaging the 2 most recent measures . ( 15 - 16 ) medication complexity . from pharmacy records , we calculated the average number of antihypertensive pills taken daily over the month prior to the initiation of the study . we also ascertained the total number of prescriptions for all medications taken for chronic conditions over the previous month . we used a valid and reliable instrument , the patient health questionnaire - 2 ( phq - 2 , 06 points ) , to assess depressive symptoms and probable major depression ( phq - 24 , sensitivity 0.76 , specificity 0.87 ) . ( 18 ) prebaseline adherence . prebaseline adherence to medication for hypertension over the 90 days prior to baseline was determined in a manner analogous to the measurement of postbaseline adherence . published reliabilities for the phq - 2 , haq collaboration subscale , and the bmq scales were acceptable ( cronbach alpha coefficients 0.70 ) . for descriptive purposes , a coronary heart disease ( chd ) risk score was generated in the electronic health record ( her ) using patient age , gender , presence of diabetes , total and high density lipoprotein cholesterol , smoking status , systolic blood pressure , and whether the patient was currently taking any medication for high blood pressure . this framingham chd risk has been reported to be moderately effective at identifying persons with diabetes who are at high risk for chd , performing similarly in this regard to the united kingdom prospective diabetes study ( ukpds ) risk engine . the ukpds chd risk score was not available in the study site 's electronic health record . because we planned to explore for possible pathways to medication adherence and change in blood pressure , we chose to analyze data with kraemer 's moderator - mediator approach . step 1we organized the possible predictors of adherence and blood pressure change by time and domain . those possible risk factors determined prior to baseline , for example , gender which occur at conception , were flagged as potential moderatormoderator variables define for whom or under which conditions a risk factor is clinically significant or not . we organized the possible predictors of adherence and blood pressure change by time and domain . those possible risk factors determined prior to baseline , for example , gender which occur at conception , were flagged as potentialmoderator variables define for whom or under which conditions a risk factor is clinically significant or not . step 2we examined the univariate association between each possible predictor , and the outcomes adherence and change in sbp . possible predictors that were significantly associated with outcome ( spearman 's r 0.10 and p 0.20 ( ordinal , dichotomous variables ) or kruskal wallis p 0.20 ( categorical variables ) ) were selected for further analysis . we examined the univariate association between each possible predictor , and the outcomes adherence and change in sbp . possible predictors that were significantly associated with outcome ( spearman 's r 0.10 and p 0.20 ( ordinal , dichotomous variables ) or kruskal wallis p 0.20 ( categorical variables ) ) were selected for further analysis . step 3 in steps 3 and 4 , we examined possible predictors surviving step 2 for interactions occurring across time . the dependent variable for these tests was either adherence or change in sbp ; the two predictors of interest and their interaction were independent factors . if two risk factors occurring at different time points were not correlated ( spearman 's r 0.10 ) , we tested for moderators . if the interaction effect was statistically significantly different than zero , the earlier occurring predictor was considered a moderator . correlated risk factors ( spearman 's r 0.10 ) can be assessed for mediation with the same approach ( mediator occurs after the mediated variable ) . in steps 3 and 4 , we examined possible predictors surviving step 2 for interactions occurring across time . the dependent variable for these tests was either adherence or change in sbp ; the two predictors of interest and their interaction were independent factors . if two risk factors occurring at different time points were not correlated ( spearman 's r 0.10 ) , we tested for moderators . if the interaction effect was statistically significantly different than zero , the earlier occurring predictor was considered a moderator . correlated risk factors ( spearman 's r 0.10 ) can be assessed for mediation with the same approach ( mediator occurs after the mediated variable ) . step 4because predictors for an outcome often vary within moderator subgroups , if a moderator variable was noted , the algorithm was repeated within each subgroup defined by the moderator . because predictors for an outcome often vary within moderator subgroups , if a moderator variable was noted , the algorithm was repeated within each subgroup defined by the moderator . statistical significance . to limit probability of type i error in the moderator - mediator analyses , we set the two - tailed alpha at p 0.025 . for other analyses , for example , a simple correlation between adherence and change in sbp , we set the significance level at p 0.05 . for analyses within moderator subgroups we conducted backward regression , entering variables associated with adherence at spearman 's r 0.10 and p 0.20 , and removing variables for p 0.20 . for multivariate analyses , we used sas 9.2 and proc surveyreg nested by clinic site with variables centered . we recruited 101 subjects , 54 at the time of their visit with their primary care clinician and 47 by telephone invitation . there were no differences in mean clinical parameters ( hemoglobin a1c , sbp ) between patients recruited at the time of the visit or by telephone . the mean age of the participants was 52.2 years , and 39 % were non - hispanic white , 27 % were non - hispanic black , and 34 % were hispanic . fifty - one ( 50.5 % ) had no insurance , and 49.5 % were on medicaid , medicare , or private insurance . the mean depressive symptom score was 2.0 ( sd 1.7 , range 06 ) , and 15.8 % had probable major depression . among patients age 30 or higher without a documented history of cardiovascular disease in the electronic health record , average framingham coronary heart disease risk was 13.4 % . patients were prescribed a total of 6.4 ( sd 2.8 , range 216 ) prescriptions for medications , and averaged 1.9 ( sd 1.9 range 16 ) medications for blood pressure . ninety ( 90.1 % ) subjects were taking an angiotensin - converting enzyme inhibitor or angiotensin receptor blocker medication , 41 ( 40.6 % ) were taking a blood pressure medication with beta - blocking activity , and 17 ( 16.8 % ) were taking a calcium channel - blocking antihypertensive medication . four participants did not fill any prescriptions for antihypertensive medication during the study and received a 0 % adherence score . four different subjects were not taking medication for diabetes ( insulin or oral antihyperglycemic medication ) and were presumably diet controlled as only one of these 4 had a hemoglobin a1c over 8.0 % , demonstrating suboptimal control . the mean baseline sbp and hemoglobin a1c were 135.9 mm hg and 9.0 % , respectively . at baseline , men and women were taking an identical number of blood pressure pills daily ( 1.9 versus 1.9 , f value = 0.0001 , p = 0.99 ) . similar to previous findings , about one - third ( 34 % ) of subjects reported an emotional response ( n = 1 with missing er ) . one - fourth endorsed a negative er , 9 % a positive response , and 66 % a neutral response . the mean postbaseline percent , of days covered ( pdc ) adherence score was 71.6 % ( sd 31.4 , range 0 % 130 % ) . univariate factors associated with adherence to blood pressure medications included ( 1 ) gender ; ( 2 ) race / ethnicity ; ( 3 ) depressive symptoms ; ( 4 ) probable depression ; ( 5 ) er ; ( 6 ) prebaseline adherence . gender was not correlated with depressive symptoms , depression , or er ( r values 0.1 , p values = ns ) . the moderating effect remained significant ( p = 0.016 ) when pre - baseline adherence was omitted from the model . males and females with any er had similar pdc adherence scores , 70.1 % ( sd 35.1 ) and 72.4 % ( sd 34.1 ) , respectively . the differential effect of gender on prospective adherence was specific to those participants endorsing neutral er . notably , males endorsing neutral er were adherent ( pdc = 85.6 % , sd 24.1 , n = 34 ) , while their female counterparts were less adherent ( pdc = 57.1 % , sd 34.1 % , n = 32 ) , a highly significant difference ( f value = 15.3 , p = 0.0002 ) . because gender moderated the effect of er on adherence , we repeated the analytical approach for males and females separately . among males , positiveer ( n = 7 ) was associated with a mean adherence score of 50.8 % , while neutral ( n = 34 ) and negative ( n = 10 ) er were associated with 85.6 % and 83.6 % adherence , respectively . we dichotomized the variable as positive er versus neutral or negative er for further analysis . univariate correlates of adherence included ( 1 ) total number of prescriptions received / month ; ( 2 ) depressive symptoms ; ( 3 ) probable depression ; ( 4 ) positive er ; ( 5 ) pre - baseline adherence . in the final model , pre - baseline adherence ( f value = 28.1 , p 0.0001 ) was associated with better prospective adherence , and positive er ( f value = 12.3 , p = 0.001 ) and depressive symptoms ( f value = 5.1 , p = 0.03 ) were associated with worse adherence . the 7 males with a positive response included in the analysis had a lower average adherence than their 44 counterparts with a neutral or negative response , 50.8 % ( sd 40.3 ) versus 85.1 % ( sd 23.4 ) , respectively ( cohen 's d = 1.04 , large es ) . no mediator variables were uncovered . among females , negative er ( n = 15 ) was associated with a mean pdc of 74.3 % , while neutral ( n = 32 ) and positive ( n = 2 ) er were associated with 57.1 % and 57.8 % pdc , respectively . we dichotomized er as negative versus neutral or positive er for further analysis . univariate correlates associated with adherence included : ( 1 ) age ; ( 2 ) total medication copay / month ; ( 3 ) negative er ; ( 4 ) any insurance ; ( 5 ) bodily pain ; ( 6 ) pre - baseline adherence . independent predictors of better adherence in the final model included pre - baseline adherence ( f value = 14.4 , p = 0.0005 ) , negative er ( f value = 6.3 , p = 0.02 ) , and age ( f value = 3.4 , p = 0.07 ) . females with negative er averaged a 74.3 % ( sd 24.3 ) adherence , while their counterparts with neutral or positive er averaged 57.1 % ( sd 33.6 ) adherence ( d = 0.58 , medium es ) . the effects of er on postbaseline adherence remained significant when pre - baseline adherence was omitted from the models for both males and females . the mean improvement in sbp across the population was 5.9 mm hg ( sd 17.8 ) ( n = 95 ) . males and females endorsing neutral er realized average improvements in sbp of 2.5 ( sd 16.5 ) and 4.7 ( sd 16.2 ) mm hg , respectively . relative to subjects endorsing negative or neutral er , those endorsing positive er had the worst adherence rate of 52.3 % ( sd 39.3 ) , yet paradoxically appeared to experience the most improvement in sbp at 14.8 ( sd 15.8 ) mm hg . for subjects endorsing negative er , the improvement in sbp averaged 10 mm hg . univariate correlates associated with change in sbp included ( 1 ) baseline sbp ; ( 2 ) er ( 3 levels ) ; ( 3 ) depressive symptoms ; ( 4 ) self - efficacy ; ( 5 ) non - hispanic white race / ethnicity ; ( 6 ) number of blood pressure pills taken per day . there were no moderator variables , and there was no association between er and adherence across the complete sample ( r = 0.06 , p = 0.54 ) . because negative er was associated with excellent adherence and blood pressure improvement , we tested whether prospective adherence mediated the effect of negative er on improvement in sbp . in other words , we examined whether adherence might explain why er was significantly associated with change in sbp for at least a subset of subjects , those with baseline negative er . in an adjusted model , adherence ( p = 0.003 ) and the interaction between negative er and adherence ( p = 0.018 ) predicted improvement in sbp , while negative er ( p = 0.048 ) was not significant . the results suggest that adherence mediated or explained some of the effect of er on change in sbp ( figure 2 ) . for subjects endorsing negative er , better adherence was closely associated with improvement in sbp ( r = 0.49 , p = 0.02 ) . associations between adherence and change in sbp were small and not significant for groups of subjects endorsing positive er ( r = 0.18 , p = 0.7 ) or neutral er ( r = 0.04 , p = 0.8 ) . adherence explained the effect of er on change in sbp for subjects with negative er , but not for subjects with neutral or positive er , demonstrating that adherence appeared to partially mediate the effect of er on blood pressure improvement . non - adherence to medications for hypertension and other chronic health conditions is a public health problem , and most efforts to improve adherence have not led to sustained improvements in adherence or in clinical outcome . improving outcomes for complex patients with hypertension will likely depend upon uncovering and clarifying the effects of moderators and mediators that comprise pathways to adherence and blood pressure improvement . in this study , we provide initial descriptions of two factors , gender and er , that defined pathways to adherence . three factors , gender , er , and adherence , defined pathways to blood pressure improvement . gender appeared to moderate the effect of er on adherence , and adherence appeared to mediate the effect of er on blood pressure improvement , at least for patients with baseline negative er . this is the first study of which we are aware to use a moderator - mediator analysis in order to begin mapping pathways to blood pressure medication adherence , and from adherence to change in blood pressure . although the relationship between er and adherence was somewhat more complex than hypothesized , we found that the predictors of worse adherence for males depression and positive er were different than the primary predictor among femalesneutral er . the results suggest that development of more effective interventions to improve adherence to antihypertensive medication might need to be tailored according to gender . we learned that for male and female subjects endorsing negative er , but not neutral or positive , er , adherence and improvement in blood pressure were tightly correlated . with the exception of males with neutral er , paradoxically , these two groups of subjects were characterized by a lack of correlation between adherence score and change in sbp , yet essentially normalized their sbp over the study period . pathways to blood pressure improvement among complex patients with hypertension endorsing neutral or positive er may involve other factors , for example , change in diet or weight , that we did not measure . such patients may be more likely to take their blood pressure medications just prior to a visit with their doctor , thus appearing to normalize their blood pressure despite experiencing overall poor adherence . similar to findings from nau et al . , we found that depressed males but not females experienced diminished adherence relative to their nondepressed counterparts . however , depression is not necessarily causally related to medication non - adherence : in one study , improving depressive symptoms among persons with hypertension did not lead to improved adherence to medication for high blood pressure or to improved blood pressure improvement . the associations between negative er , high adherence to antihypertensive medication , and improvement in blood pressure may be explained in several ways . on the one hand , patients with hypertension may directly endorse negative er as a physiological consequence of elevated blood pressure , that is , elevated blood pressure may shift some persons into a state of negative er , which then drives corrective behaviors such as improved medication adherence to address the threat to health . on the other hand , negative er may represent a trait that is consistent over time and is typified by vigilant attention to environmental cues such as recommendations to take medication . neutral er may serve as a maintenance factor steering the individual to follow a default behavior pattern . lower adherence for females and higher adherence for males endorsing neutral er was associated with somewhat elevated baseline sbp . however , both males and females endorsing neutral er experienced similar 25 mm improvements in sbp over 90 days , leading to a normalized average sbp of 130 mm hg for persons with diabetes . low adherence in the 57 % range for females endorsing neutral er may not in itself be maladaptive , as sbp was normalized over time . positive er appears to be relatively uncommon , occurring in about 10 % of primary care patients in both this and one previous study . because of its low prevalence , future studies of the effects of positive er on adherence will require substantially expanded recruitment . ( 1 ) patients were recruited with 2 approaches by phone or prior to a clinical visit . ( 2 ) this is a modest and highly heterogeneous convenience sample with patients of different race - ethnicities from one health system . however , despite these limitations we were able to demonstrate significant effects of er on adherence . the sample 's overall glucose control was relatively poor at 9.0 % , while baseline average systolic blood pressure was more modestly elevated at 135.9 mm hg . while it is unclear why patients with diabetes in the sample appeared to have better blood pressure than diabetes control , it should be noted that the relative difference extended to all persons with diabetes attending the health care system , where the average sbp was 135.0 mm hg and average a1c was 8.5 % in 2008 . it is possible that confounders might better explain the associations between er , adherence , and blood pressure improvement that we describe , and only larger studies powered for exclusive stratification and subgroup analyses will allow researchers to fully address this potential issue . it is likely that kraemer 's emphasis on interaction tests allowed the research team to avoid some potential pitfalls associated with extensive stratification , including limited extent of data available and premature claims of subgroup findings . threats to internal validity include the use of a brief measure of probable major depression , the phq - 2 . however , the phq - 2 has been shown to perform similarly to the full phq - 9 to detect depression in primary care . while the theoretical underpinning of the role of emotion in human behavior is extensively researched , the use of a specific measure , emotional response to neutral facial expression , is relatively novel . however , the ekman monographs used to ascertain emotional response are highly valid and reliable tools , and prospective associations with adherence to blood pressure medication and with blood pressure improvement demonstrate additional face and predictive validity . it would be important to conduct comprehensive reliability and validity testing of the er construct . because no gold standard for ascertaining medication adherence exists , future studies would include multiple measures . this is the first study of which we are aware to investigate how er may be associated with medication adherence and clinical outcome . it is also the first study to demonstrate that negative er may positively influence both adherence to antihypertensive medication and subsequent improvement in sbp among complex primary care patients . the results of this investigation should be considered hypothesis generating , and future studies would further validate er and evaluate these initial descriptions of effects of er on adherence to blood pressure medication and on blood pressure improvement .\noutput:\n" }, { "from": "agent", "value": "background . developing interventions to improve medication adherence may depend upon discovery of novel behavioral risk factors for nonadherence . objective . explore the effects of emotional response ( er ) on adherence to antihypertensive medication and on systolic blood pressure ( sbp ) improvement . design . we studied 101 adults with diabetes and hypertension . the primary outcome , 90 - day percentage of days covered adherence score , was determined from pharmacy refill records . the secondary outcome was change in sbp over 90 days . er was classified as positive , negative , or neutral . results . average adherence was 71.6 % ( sd 31.4 % ) , and negative and positive er were endorsed by 25 % and 9 % of subjects , respectively . gender moderated the effect of positive or negative versus neutral er on adherence ( interaction p = 0.003 ) ; regardless of gender , negative and positive er were associated with similarly high and low adherence , respectively , but males endorsing neutral er had significantly higher adherence than their female counterparts ( 85.6 % versus 57.1 % , f value = 15.3 , p = 0.0002 ) . adherence mediated er 's effect on sbp improvement : among participants with negative , but not positive or neutral , er , increasing adherence and sbp improvement were correlated ( spearman 's r = 0.49 , p = 0.02 ) . conclusions . negative , but not positive or neutral , er predicted better medication adherence and a correlation between medication adherence and improvement in sbp ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: genome - scale transcriptional regulatory network ( trn ) for any specific microbial organism is a critical component on the way to the next big milestone in system biology building an integrated metabolic and regulatory model that can accurately predict cellular growth phenotypes . several approaches and associated web resources have been developed for genome - wide reconstruction of metabolic pathways for a number of microbial genomes . biocyc maintains an encyclopedia of experimentally defined metabolic pathways in model organisms and uses it for reconstruction of metabolism in other sequenced genomes ( 1 ) . model seed allows user to submit any complete genome to the annotation pipeline to generate a draft metabolic model ( 2 ) . at the same time , the large - scale trns so far are available only for a limited number of model organisms , such as escherichia coli ( 3 ) , bacillus subtilis ( 4 ) , corynebacterium glutamicum ( 5 ) and mycobacterium tuberculosis ( 6 ) . a fundamental difference between the reconstruction of trns and metabolic pathways is that regulatory interactions are much less conserved across bacterial genomes than metabolic pathways ( 7 ) . to address the challenging problem of propagation of regulatory interactions between distant genomes , we recently developed a strategy enabling the genomic reconstruction of large - scale trns in diverse microbial genomes ( 8 ) . the bacterial species tree is subdivided into small taxonomic families , and a subset of 512 representative genomes is selected for each family ; then the comparative genomics techniques are used to reconstruct a collection of reference regulons in these genomes . at the next stage , these reference regulons are used for an automatic annotation of regulatory interactions in the remaining genomes from the same taxonomic group . in 200910 , with a goal of building collections of taxonomy - specific reference regulons , we developed two web resources for large - scale inference and analysis of regulatory interactions in prokaryotes : the regprecise database ( http://regprecise.lbl.gov ) to capture and visualize manually curated regulons ( 9 ) and the regpredict web server ( http://regpredict.lbl.gov ) for fast and accurate regulon reconstruction ( 8 ) . the community - based approach for regulon reconstruction implemented in the regpredict web server enabled fast accumulation of a large number of curated regulatory interactions ( 1013 ) . the current release of regprecise 2.0 captures the detailed descriptions of 1000 regulogs controlled by protein transcription factors ( tfs ) in 13 taxonomic groups of bacteria ( 147 genomes total ) and 400 regulogs controlled of conserved ribonucleic acid ( rna ) regulatory motifs ( e.g. riboswitches ) in 22 taxonomic groups ( 255 genomes total ) . the total number of effectors of analyzed regulators in regprecise exceeds 200 and includes the following major classes of metabolites : amino acids , carbohydrates , nucleotides , lipids and fatty acids , co - enzymes , peptides and antibiotics , secondary metabolites and inorganic chemicals . beside tf regulons , the last release of regprecise includes a large collection of curated regulons controlled by rna regulatory elements ( such as riboswitches ) annotated by the regpredict web server using rna models from the rfam database ( 14 ) . we anticipate that the content of regprecise database will continue fast growing due to large - scale regulon annotation projects conducted by scientific community using regpredict . regprecise serves as a core resource on transcriptional regulation for the microbial domain of the doe systems biology knowledgebase ( 15 ) , a community - driven cyber infrastructure for sharing and integrating data and analytical tools to accelerate predictive biology . in the context of this project , we developed a comprehensive set of restful web services for programmatic access to the whole scope of transcriptional regulatory data provided by regprecise . the hierarchical organization of the regprecise database has three major levels : i ) a regulon , ii ) a regulog and iii ) a collection of regulogs . a regulon is the basic unit of regprecise that represents a set of genes in a particular genome that are co - regulated by the same tf or rna regulatory motif . the major types of output in the regprecise web services application programming interface ( api ) are represented by six objects that provide the detailed information about reconstructed regulatory interactions ( figure 1 ) . the regulon object , being a basic unit , provides the general description of regulon , including the name of genome , the common name of regulator , its protein family and predicted effector molecule and the metabolic pathway ( or biological process ) controlled by the regulator . the regulationtype property of the regulon object identifies the type of mechanism of regulation , which is either by transcription factor ( tf ) or by rna regulatory element ( rna ) . the regulator object represents the actual gene encoding tf and provides its gene name , locus tag and vimssid [ gene identifier in microbesonline ( 16 ) database ] . in rare cases , comparative genomics does not allow unambiguous selection of true cognate regulator between several homologous tfs . in this case , more than one regulator can be assigned to a particular regulon . in the case of regulation by rna elementsthe gene object represents a regulated gene and provides general information , such as gene name , locus tag , gene vimssid and function . the site object represents either tf - binding site or rna regulatory element and provides its sequence , score , position relative to the translational gene start and downstream gene identifiers . the regulog object combines several regulons , controlled by orthologous regulators , that were reconstructed in a set of closely related genomes . similar to the regulon object , the general information about regulator , effector and metabolic pathway is available for the regulog object . in addition , the taxonname property describes the name of ncbi taxon representing all genomes analyzed in a given regulog . finally , the regulogcollection object represents the highest level in the regprecise hierarchical data organization . there are six types of collections available in regprecise : by taxonomy , orthologous tf , tf family , rna regulatory family , effector molecule of a regulator and regulated metabolic pathway . the collectiontype property of the regulogcollection object encodes the type of collection and can possess one of the following values : pathway . several types of collections , such as collection by effector and by metabolic pathway , have two - level hierarchical structure , and thus , the classname property representing the upper level is provided in addition to the collection name . the developed web services api enables programmatic access to the whole content of the regprecise database . the api is implemented as a set of restful web services providing data in either javascript object notation ( json ) or extensible markup language ( xml ) , two of the most popular formats . the base uniform resource locator ( url ) for all web services is http://regprecise.lbl.gov / services / rest / . the current version of regprecise web services api includes 14 resources that can be classified into four categories ( table 1 ) . the core resources provide access to the regulators ( genes encoding either tfs or rna motifs ) , target regulated genes and sites ( either tf - binding sites or rna regulatory elements ) . these three resources together provide complete information about the content of a particular regulon and can be queried by regulon identifier . at the same time , if a user is interested in all genes regulated by orthologs of a particular tf in a group of closely related genomes , the genes resource can be queried by an identifier of a corresponding regulog . the regulog and regulon resources can be used to obtain summary information about the intrinsic attributes of a regulog / regulon , such as the associated metabolic pathway ( or biological process ) , effector molecules , the regulation mode ( activation or repression ) , the regulation type ( tf or rna ) and regulator family . table 1 . list of resources available in regprecise web services api 1.0 resourcesdescriptioncore resources / regulatorsrepresents a list of analyzed regulators that belong to either a given regulon or regulog . / genesrepresents a list of regulated genes that belong to either a given regulon or regulog . / sitesrepresents a list of tf - binding sites or rna regulatory elements that belong to either a given regulon or regulog . / regulonrepresents a regulon.navigation resources / regulogcollectionsrepresents various types of regulog classifications : by taxonomic group , orthologous tf , tf family , rna regulatory element , metabolic pathway or biological process , effector molecule or environmental signal . / regulogsrepresents a list of regulogs in a collection of a given type and identifier . / regulonsrepresents a list of regulons in either a particular regulog or a genome.statistics resources / regulogcollectionstatsrepresents general statistics on regulog collections of a particular type . / genomestatsrepresents general statistics on genomes that have at least one reconstructed regulon.utility resources / searchregulonssearch regulons by the name or locus tag of either regulator or target regulated genes . / releaserepresents the version and the release date of the current version of regprecise . list of resources available in regprecise web services api 1.0 the navigation resources allow traversing through the hierarchical organization of the regprecise data ( table 1 ) . the list of the available regulog collections can be retrieved for each of these types using the regulogcollections resource . subsequently , the list of regulogs that belong to a particular collection can be obtained by the regulogs resource . it is important that the collection identifiers are unique only within the space of regulog collections of a particular type . thus in addition to these identifiers , it is necessary to provide the type of a collection as a parameter in a query . finally , a list of regulons analyzed for a particular tf of rna motif in a set of closely related genomes can be accessed by the regulons resource given regulog identifier . the alternative navigation route starts from a list of genomes that have at least one reconstructed regulon . the same regulons resource can be used to get a list of all reconstructed regulons for a particular genome . to get an overview of the regprecise content , we developed two resources providing the general statistics for regulog collections ( regulogcollectionstats resource ) and genomes ( genomestats resource ) . the statistics includes the number of genomes , reconstructed regulogs , regulons , and regulatory sites for the tfs and rna elements . finally , the utility resources allow for searching for regulons by locus tags of the target regulated genes or tfs ( searchregulons resource ) . the searchextregulons resource takes ncbi taxonomy i d of a genome and comma - separated list of gene locus tags and returns the non - redundant list of regulons that contain at least one of the provided genes . in particular , this resource can be used for automatic validation of gene clusters reconstructed by the analysis of expression data . the current version of the regprecise database underlying the web services api can be obtained by the release resource . first , we provide a template program in perl that can be run to access several of the web services and parse the output data . the program is organized in two perl scripts : ( i ) regpreciseadapter.pma perl module that provides access to the individual web services and ( ii ) regulons.plan example of workflow that can be implemented using a combination of several web services . both scripts can be easily modified to access all the web services available . at the same time , each web service is accompanied with an example of accessing api using curl command - line tool . in this study , we provide two examples of the possible scenarios of using regprecise web services api . scenario 1obtaining information on a trn available for a particular genome . to check the availability of regulatory interactions for a given genome , the user can query the genomes resource . by analyzing the output for the presence of the ncbi taxonomy i d of the genome of interestfor instance , the ncbi taxonomy i d of shewanella baltica os155 is 325240 , which corresponds to the internal genome identifier genomeid = 7 . the list of all reconstructed regulons in this genome can be retrieved by querying regulons?genomeid = 7 . analysis of the regulationtype property of each regulon in the output will show that 63 regulons are regulated by tfs , whereas 14 regulons are controlled by rna regulatory elements . among tf - operated regulons , the tryptophane regulon trpr has regulonid = 6378 . scenario 2obtaining all genes that are regulated by a particular rna motif in any genome . analysis of the regulogcollections?collectiontype = rnafam query output identifies the corresponding regulog collection ( collectionid = 25 ) . list of all reconstructed regulogs in this collection can be retrieved by querying regulogs?collectiontype = rnafam & collectionid = 25 . finally , by iterating through each regulog , the complete list of genes regulated by fmn riboswitch can be retrieved by genes resource by providing regulog identifier as a parameter , e.g. genes?regulogid = 1450 . we are currently working on the automatic conservative propagation of all regulons inferred in the reference set of genomes to all closely related genomes from the same taxonomic group . we will develop new web services to enable programmatic access to the results of propagation . this work was supported by the office of science , office of biological and environmental research , of the us department of energy ( doe ) under contract no . [ de - ac02 - 05ch11231 ] , as part of the doe systems biology knowledgebase , and under contract no . [ de - sc0004999 ] with sanford - burnham medical research institute and lawrence berkeley national laboratory , as part of genomic science program .\noutput:\n" }, { "from": "agent", "value": "web services application programming interface ( api ) was developed to provide a programmatic access to the regulatory interactions accumulated in the regprecise database ( http://regprecise.lbl.gov ) , a core resource on transcriptional regulation for the microbial domain of the department of energy ( doe ) systems biology knowledgebase . regprecise captures and visualize regulogs , sets of genes controlled by orthologous regulators in several closely related bacterial genomes , that were reconstructed by comparative genomics . the current release of regprecise 2.0 includes > 1400 regulogs controlled either by protein transcription factors or by conserved ribonucleic acid regulatory motifs in > 250 genomes from 24 taxonomic groups of bacteria . the reference regulons accumulated in regprecise can serve as a basis for automatic annotation of regulatory interactions in newly sequenced genomes . the developed api provides an efficient access to the regprecise data by a comprehensive set of 14 web service resources . the regprecise web services api is freely accessible at http://regprecise.lbl.gov/regprecise/services.jsp with no login requirements ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although it is well known that lymph node ( ln ) metastasis is an important factor in the prognosis of gastric cancer , the optical extent of ln dissection remains controversial . previous reports suggested that gastrectomy with splenectomy resulted in better survival than gastrectomy alone in gastric cancer patients .10 in proximal gastric cancer was 1520 % , and the 5 - year survival rate was 2025 % . total gastrectomy with splenectomy is considered to be a standard procedure for proximal advanced gastric cancer in gastric cancer treatment guidelines . but two large prospective randomized trials in western countries reported that splenectomy was a risk factor for morbidity and mortality . preservation of the spleen during extended lymphadenectomy decreases complications with no clear evidence of improvement or detriment to overall survival . then modified d2 lymphadenectomy avoiding splenectomy is now accepted as a standard procedure in the west countries . our retrospective study was designed to investigate the significance of splenectomy by evaluating postoperative morbidity , frequency of the each ln metastasis , and long - term surgical outcomes of locally advanced proximal gastric cancer patients who underwent total gastrectomy with r0 resection . nodes were assigned to the appropriate anatomical stations according to japanese classification of gastric carcinoma ( jcgc ) of the 2nd english edition . nodes found at each station were labeled and immediately sent for histological examination . from 1994 to 2004 , 505 patients with a single gastric adenocarcinoma located in the upper third portion underwent curative total gastrectomy at niigata cancer center hospital . among them , 240 patients underwent total gastrectomy with splenectomy ( st ) , because the tumor involved the greater curvature or enlarged ln of no . the remaining 265 patients underwent spleen - preserving lymphadenectomy ( t ) and remove no . the clinicopathological features , stage and 5 - year survival rates according to jcgc were compared between st group and t group . total gastrectomy with d2 and more extensive lymphadenectomy was performed according to the rules of the jcgc . when the tumor involved the greater curvature and / or enlarged ln suspected metastasis at splenic hilum was found before or during operation , splenectomy was performed simultaneously as r0 resection . the index of estimated benefit from lymphadenectomy was calculated by multiplying the incidence of each nodal station by the 5 - yer survival rate of patients with metastasis to that nodal station . all statistical analyses were conducted using the statistical program spss version 19 for windows ( spss , chicago , il , usa ) . clinicopathological variables were analyzed using the chi - square test and the student 's t - test . cumulative survival rates were calculated by the kaplan - meier method , and the significance of the differences in survival was determined by the log - rank test . there was no statistical difference in age and gender between st group and t group . but there were significant differences between two groups regarding gross type , tumor location , and histological type , depth of the tumor invasion , and status of lymph node metastasis . namely , type 3 and type 4 , uml ( u ; the upper , m ; the middle , l ; the lower ) , undifferentiated type , pt3 and pt4 , and pn2 and pn3 , are found frequently in st group . the incidence of surgical complications regarding anastomotic leakage , pancreatic fistula , postoperative ileus , and intra - abdominal bleeding was higher in st group than in t group . but there was no statistical difference except for pancreatic fistula ( p = 0.008 ) .10 metastasis and 50.8 % in patients without its metastasis in st group ( figure 3 ) . the therapeutic value of extended lymph node dissection was estimated by multiplication of incidence of lymph node metastasis and 5 - year survival rate of patients with metastasis for each station .10 was 4.2 , which was similar to that of no . 9 ( 4.8 ) ,11 d ( 3.9 ) , and no . 16 ( 3.7 ) ( figure 4 ) . almost all the regional lymph nodes of upper third portion of the stomach had high effect index of lymphadenectomy , but the treatment index of no . according to depth of tumor invasion , st group revealed lower prognosis compared with t group , but there was no significant difference between two groups in t2a and t2b ( figure 5 ( a ) ) . but the survival rate for patients with pse ( t3 : tumor penetration of serosa ) , there was significantly difference between st group ( 48.1 % ) and t group ( 67.7 % ) . in the survival rate according to lymph node metastasis , there was no significant difference in the cumulative survival rates between two groups in pn0 and pn1 ( figure 5 ( b ) ) . but in the survival rate for patients with pn2 , there was significantly difference between st group ( 46.1 % ) and t group ( 66.7 % ) . as for the survival rate according to stage , the survival of st group was lower than that of t group in stages ii , iiia , and iiib , but there was no significant difference ( figure 5 ( c ) ) . the current standard treatment for proximal advanced gastric cancer in japan is total gastrectomy with d2 lymphadenectomy . in order to accomplish d2 lymphadenectomy , extended resection which is regarded as a standard procedure in asian countries is not effective in western countries . the splenectomy caused high morbidity and mortality , and it was shown to be an independent prognostic risk factor on multivariate analysis in node - negative patients in previous studies . on the other hand , the splenectomy is considered to be a safe procedure that does not decrease surgical mortality . a korean trial has also reported that postoperative morbidity after splenectomy for d2 lymphadenectomy was not higher than simple total gastrectomy , but there was no significant difference in 5 - year survival between with and without splenectomy . patients with proximal advanced gastric cancer localized on the greater curvature and type 4 might obtain relatively high survival benefits from no . the splenectomy has become a safe technical procedure , but the surgical procedure of a total gastrectomy with splenectomy should be performed at a high volume hospital to avoid the postoperative complications .10 metastasis was reported to be high in proximal advanced gastric cancer located on the greater curvature or in the posterior wall of the stomach , and lymphatic pathways along the posterior gastric artery , splenic artery , short gastric vessels , and / or gastroepiploic vessels were suggested to be important for no . lymphography has demonstrated that the lymphatic flow from the left upper region of the stomach enters the lymph node in the splenic hilum and travels to the nodes around the celiac trunk along the splenic artery . in our study , the location involving the greater curvature , pn3 and no . furthermore , splenectomy does not improve survival of patients with proximal advanced gastric cancer even though curative resection was performed . multivariate analysis demonstrated that nodal metastasis was independent prognostic factor , but splenectomy was not . accordingly , the splenectomy for d2 lymphadenectomy may be unnecessary in all the patients with advanced gastric cancer . on the contrary , some authors have found the survival benefit and recommended splenectomy for no . the splenectomy was one of the independent prognostic factors , and total gastrectomy with splenectomy is recommended for patients with no . the splenectomy was recommended when the tumor was located on the greater curvature or posterior wall of the stomach and had no . in fact , it is difficult to detect the depth of tumor invasion and no .10 metastasis was observed only in advanced cancer , particularly in tumors located in the greater curvature and / or type 4 tumors . our current study showed that splenectomy adversely affected survival in pse and pn2 , while there was no significant difference in survival rates in pmp , pss , pn0 , and pn1 and among stage ii , iiia , and iiib . though there were limitations of our study which was retrospectively conducted in a single institute , and there was selection bias , our study would suggest the benefit of spleen preservation on postoperative morbidity and long - term surgical outcomes . the overall survival rate stratified by stagewas analyzed in a prospective randomized controlled trial , in which the 5 - year overall survival rates of patients with stagei , stage ii , and stage iii were not significantly different between the 2 groups . until 2005 , our institute preferred to perform a total gastrectomy with splenectomy in advanced proximal gastric cancer for complete d2 lymphadenectomy .10 enlargement in the splenic hilum suggesting metastasis or tumor located in greater curvature or encircling in upper third portion of the stomach . a randomized controlled trail to evaluate total gastrectomy with splenectomy for proximal advanced gastric carcinoma with r0 resection ( jcog0110 - mf ) has already recruited 505 patients and resulted that splenectomy was associated with higher morbidity and larger blood loss and was safely performed by specialized surgeons with low mortality . the precise impact of splenectomy on prognosis remains uncertain and the impact on long - term survival should be awaited . in conclusion , although splenectomy for patients with proximal advanced gastric cancer was not an important risk factor for postoperative morbidity , splenectomy was not effective for patients with no . spleen - preserving total gastrectomy will be feasible and be enough to accomplish radical surgery for locally advanced proximal gastric cancer .\noutput:\n" }, { "from": "agent", "value": "objectives . the significance of splenectomy in advanced proximal gastric cancer is examined retrospectively . methods . from 1994 to 2004 , 505 patients with advanced proximal gastric cancer underwent curative total gastrectomy with preserving spleen ( t ) for 264 patients and total gastrectomy with splenectomy ( st ) for 241 patients . results . patients who underwent splenectomy showed more advanced lesions . the metastatic rate of lymph node ( ln ) in the splenic hilus ( no . 10 ) in st was 18.3 % . as for the incidence of surgical complications , there was not statistically difference except for pancreatic fistula . the index of estimated benefit of ( no . 10 ) ln was 4.2 , which was similar to that of ( no . 9 ) , ( no . 11p ) , ( no . 11d ) , and ( no . 16 ) lns . 5 - year survival rate of ( no . 10 ) positive group was 22.2 % . 5 - year survival rates of pse and pn2 in t group were better than that of pse and pn2 in st , respectively . the superiority of st was not confirmed even in stage ii , iiia , and iiib . conclusion . splenectomy was not effective for patients with ( no . 10 ) metastasis in long - term survival . spleen - preserving total gastrectomy will be feasible and be enough to accomplish radical surgery for locally advanced proximal gastric cancer ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: since high resolution comparative genomic hybridization techniques are increasingly available in the diagnostic procedures for patients with developmental disorders , several novel microdeletion and microduplication syndromes have been identified .13 one of these is the 16p11 .2 microdeletion syndrome ( online mendelian inheritance in man [ omim ] : 611913 ) . as reviewed by the research groups of battaglia and barge - schaapveld , the typical 16p11 .2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay , symptoms from the autism spectrum , epilepsy , congenital anomalies , and obesity .4,5 these phenotypes are often related to a proximal 16p11 .2 deletion of approximately 600 kb ( bp4bp5 ) encompassing 29 genes ,610 of which the sh2b1 gene ( omim : 608937 ) is reported to be causative for morbid obesity .1113 battaglia et al4 stated that this more centromeric deletion is most strongly related to autism spectrum susceptibility and is functionally different from the more distal region ( 16p12 .2 p11 .2 ; omim : 613604 ) which includesthe so called atypical 16p11 .2 deletion ( approximately 220 kb ) presenting with developmental delay , behavioral problems , and mild facial dysmorphisms .5 in the present paper , an adult male with a long history of maladaptive behaviors , later associated with recurrent mild depressive and autistic symptoms , is described ; the patient was referred for reevaluation of his clinical picture , particularly the amotivational features . the referred patient , a 33 - year - old male , is the second son of non - consanguineous parents . apart from recurrent depression in his mother , there is no family history of intellectual disability , congenital anomalies , or neuropsychiatric disorders . the patient was born after an uncomplicated pregnancy and he had a normal birth weight and length ( 2,730 g and 48 cm , respectively ; 0 standard deviation ) . during early primary school years , both parents and teachers noticed social withdrawal tendencies and , incidentally , disproportionate reactions like clownish and impulsive behaviors to minor social stress , especially in novel and unstructured situations . aged 16 , a preliminary diagnosis of pervasive developmental disorder was made by a remedial educationalist at a community mental health center . because of persistent behavioral problems , regularly accompanied by compelling and angry attitudes , secondary school education was fragmented ; however , after several school changes , he finally completed high school at age 20 . one year later , the patient discontinued his university studies because of problems with initiative and structuring of daily life . he was then admitted to a sheltered home facility . at the age of 2425 years , marked motivational problems and recurrent mild depressive symptoms and / or ideas of reference necessitated several hospitalizations . ultimately , the patient was diagnosed with asperger s syndrome , a pervasive developmental disorder , and he was admitted to a specialized department for autism spectrum disorders . neither somatic and neurological examination nor hematological and biochemical parameters disclosed any abnormalities . electroencephalogram ( eeg ) - registration , magnetic resonance imaging ( mri ) , and dopamine transporter single photon emission computed tomography ( dat - spect ) of the brain were all normal . the diagnosis of asperger s disorder was confirmed and the patient subsequently entered a specialized sheltered home facility . at the age of 32 , he was referred for detailed reevaluation of his persistent amotivational behavior , for which no explanation could be given . therefore , apart from somatic and neurological reexamination , extensive neuropsychological assessment including a kaufman adolescent and adult intelligence test ( kait ) and a minnesota multiphasic personality inventory 2 restructured form ( mmpi -2-rf ) restructured clinical scale profiling was performed ,14,15 as well as high density resolution , genome - wide array analysis . the referred patient , a 33 - year - old male , is the second son of non - consanguineous parents . apart from recurrent depression in his mother , there is no family history of intellectual disability , congenital anomalies , or neuropsychiatric disorders . the patient was born after an uncomplicated pregnancy and he had a normal birth weight and length ( 2,730 g and 48 cm , respectively ; 0 standard deviation ) . during early primary school years , both parents and teachers noticed social withdrawal tendencies and , incidentally , disproportionate reactions like clownish and impulsive behaviors to minor social stress , especially in novel and unstructured situations . aged 16 , a preliminary diagnosis of pervasive developmental disorder was made by a remedial educationalist at a community mental health center . because of persistent behavioral problems , regularly accompanied by compelling and angry attitudes , secondary school education was fragmented ; however , after several school changes , he finally completed high school at age 20 . one year later , the patient discontinued his university studies because of problems with initiative and structuring of daily life . he was then admitted to a sheltered home facility . at the age of 2425 years , marked motivational problems and recurrent mild depressive symptoms and / or ideas of reference necessitated several hospitalizations . ultimately , the patient was diagnosed with asperger s syndrome , a pervasive developmental disorder , and he was admitted to a specialized department for autism spectrum disorders . neither somatic and neurological examination nor hematological and biochemical parameters disclosed any abnormalities . electroencephalogram ( eeg ) - registration , magnetic resonance imaging ( mri ) , and dopamine transporter single photon emission computed tomography ( dat - spect ) of the brain were all normal . the diagnosis of asperger s disorder was confirmed and the patient subsequently entered a specialized sheltered home facility . at the age of 32 , he was referred for detailed reevaluation of his persistent amotivational behavior , for which no explanation could be given . therefore , apart from somatic and neurological reexamination , extensive neuropsychological assessment including a kaufman adolescent and adult intelligence test ( kait ) and a minnesota multiphasic personality inventory 2 restructured form ( mmpi -2-rf ) restructured clinical scale profiling was performed ,14,15 as well as high density resolution , genome - wide array analysis . somatic and neurological examination did not disclose any abnormalities . length and weight were 183 cm and 80 kg , respectively . the patient s behavior showed autistic - like elements such as diminished social reciprocity , paucity of speech , poor pragmatic language , and enhanced sensory perception . neuropsychological assessment revealed a kait14 total intelligence quotient of 112 and undisturbed attention , memory , and executive functioning . mmpi -2-rf testing15 disclosed poor reality testing , marked feelings of distrust , and an anxious disposition with excessive worrying ( figure 1 ) . genome wide array analysis with an average resolution of approximately 20 kb was performed using the affymetrix cytoscan hd array platform ( affymetrix inc . , santa clara , ca , usa ) with 2.6 million markers , including 750,000 genotype - able single nucleotide polymorphisms and 1.9 million nonpolymorphic probes . the array results showed a 970 kb microdeletion in the short arm of chromosome 16 . subsequent carrier testing by array analysis in the parents revealed that the 16p11 .2 microdeletion had occurred de novo in their child , resulting in the karyotype : arr [ hg19 ] 16p11 .2 ( 28,461,879 - 29,428,533 ) x1 dn . this novel 16p11 .2 bp1bp4 microdeletion encompasses 20 known protein coding genes and two micrornas ( figure 2 ) . the patient s behavior showed autistic - like elements such as diminished social reciprocity , paucity of speech , poor pragmatic language , and enhanced sensory perception . neuropsychological assessment revealed a kait14 total intelligence quotient of 112 and undisturbed attention , memory , and executive functioning . mmpi -2-rf testing15 disclosed poor reality testing , marked feelings of distrust , and an anxious disposition with excessive worrying ( figure 1 ) . genome wide array analysis with an average resolution of approximately 20 kb was performed using the affymetrix cytoscan hd array platform ( affymetrix inc . , santa clara , ca , usa ) with 2.6 million markers , including 750,000 genotype - able single nucleotide polymorphisms and 1.9 million nonpolymorphic probes . the array results showed a 970 kb microdeletion in the short arm of chromosome 16 . subsequent carrier testing by array analysis in the parents revealed that the 16p11 .2 microdeletion had occurred de novo in their child , resulting in the karyotype : arr [ hg19 ] 16p11 .2 ( 28,461,879 - 29,428,533 ) x1 dn . this novel 16p11 .2 bp1bp4 microdeletion encompasses 20 known protein coding genes and two micrornas ( figure 2 ) . in the present paper , a 33 - year - old , non - obese male with normal intelligence is described in whom a de novo , distal 16p11 .2 bp1bp4 microdeletion was demonstrated ; this microdeletion can be regarded as causative for his pattern of anxiety - driven withdrawal behaviors , which result in recurrent episodes with referential thoughts . at this moment , no losses of similar size have been reported in healthy individuals ( database of genomic variants ; http://dgv.tcag.ca/dgv/app/home ) . so far , seven patients have been reported with a de novo microdeletion of 1.78.2 mb in size , encompassing the 16p11 .2 region and including the distal 16p11 .2 deletion ; in contrast , in six other patients a de novo distal ( previously called atypical ) 16p11 .2 deletion was demonstrated ( table 1 ) . recently , guha and et al reported the results of a large association study with a cohort of 790 patients with schizophrenia spectrum disorders .16 they found 13 patients with 16p11 .2 deletions ranging from bp1bp4 which are not overlapping the proximal locus ( bp4bp5 ) that is connected to autism . this finding is in line with other copy - number variation studies and suggests this locus to be implicated in obesity and various neuropsychiatric disorders .12,17,18 the distal 16p11 .2 deletion between bp1 and bp4 , as reported here , encompasses 20 known protein - coding genes , ie , cln3 , apobr , il27 , nupr1 , ccdc101 , sult1a2 , sult1a1 , eif3c , eif3cl , atxn2l , tufm , sh2b1 , atp2a1 , rabep2 , cd19 , nfatc2ip , spns1 , lat , rrn3p2 , and snx29p2 . four of these are disease - causing genes : cd19 ( omim : 107265 ) ; tufm ( omim : 602389 ) ; cln3 ( omim : 607042 ) ; and atp2a1 ( omim : 141750 ) , without , however , any neuropsychiatric sequelae . in conclusion , the distal 16p11 .2 deletion phenotype is neither exclusively related to developmental delay nor to autism spectrum disorders . rather , it has a highly variable presentation that may include , as demonstrated in the neuropsychological profile of the present patient , high average intelligence and social cognitive dysfunctions referring to asperger s syndrome .\noutput:\n" }, { "from": "agent", "value": "the 16p11 .2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay , symptoms from the autism spectrum , epilepsy , congenital anomalies , and obesity . these phenotypes are often related to a proximal 16p11 .2 deletion of approximately 600 kb ( bp4bp5 ) that includes the sh2b1 gene that is reported to be causative for morbid obesity . this more centromeric deletion is most strongly related to autism spectrum susceptibility and is functionally different from the more distal 16p12 .2 p11 .2 region , which includes the so - called atypical 16p11 .2 bp2bp3 deletion ( approximately 220 kb ) presenting with developmental delay , behavioral problems and mild facial dysmorphisms . here , an adult male with a long history of maladaptive behaviors is described who was referred for diagnostic assessment of his amotivational features . extensive neuropsychological examination demonstrated rigid thinking , anxious beliefs , and ideas of reference in the presence of normal intelligence . microarray analysis demonstrated a de novo 970 kb 16p11 .2 bp1bp4 microdeletion that can be regarded as explanatory for his behavioral profile . it is concluded that microdeletion syndromes are not exclusively related to intellectual disabilities and genetic testing is of putative relevance for the understanding of neuropsychiatric and neuropsychological phenomena ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 14 - year - old female patient presented to our clinic with the symptom of hollowness that had been present in both gluteal areas for 6 months . the patient , who did not have any history of topical medication , redness , pain or itching in the hollowed area and did not describe any signs , had been receiving corticosteroid injections due to urticaria for the last 6 months . the patient did not have any particularities in her personal history , and there were no persons in her family with similar symptoms . the patient 's dermatological physical examination revealed an atrophic , oval and plaque - like lesion symmetrically localized on both thighs with a diameter of approximately 34 cm linearly overlaid by two flesh - colored striae with a diameter of approximately 14 cm . the patient 's laboratory values were normal , and the deep incisional biopsy collected from the patient was found to be consistent with acquired localized lipoatrophy ( all ) . histopathological examination revealed partly necrotic - looking adipocytes embedded among fibrous septa in the subcutaneous tissue interspersed with a few inflammatory cells . the option of spontaneous healing was taken into account , and control visits at the dermatology outpatient clinic once every 3 months were recommended for our patient . lipoatrophy is characterized by a preceding inflammatory period and consequent fat loss in the subcutaneous tissue . as for lipodystrophy , it refers to the absence of subcutaneous fat tissue without any signs of inflammation . lipoatrophy may be congenital or acquired and localized or diffused depending on the area of involvement . primary and idiopathic lipoatrophy has clinical forms such as lipoatrophia semicircularis , lipodystrophia centrifugalis abdominalis infantilis and involutional lipoatrophy . secondary lipoatrophy develops due to reasons such as pyogenic abscesses , connective tissue diseases ( lupus erythematosus , morphea , dermatomyositis or overlap disease ) , neoplasm ( t - cell lymphoma ) and iatrogenic ( subcutaneous , intramuscular and dermal injections ) factors . all frequently develops secondary to dermal or intramuscular drug injections of corticosteroids as seen with our case . additionally , all has also been reported following insulin , vasopressin , recombinant growth hormone , adrenal cortex hormone and methotrexate injections . lipoatrophy that develops due to subcutaneous corticosteroid injection results in two different histopathological pictures . in the first histopathological picture , there are small , retracted , slightly acidophilic or albuminous fat tissues surrounding the septal connective tissue accompanied by sparse inflammatory cells and prominent blood vessels . in the second histopathological picture , there are small , atrophic fat tissues around vascular structures . decreased adipocyte counts and small - sized lobulesall diagnosis is based on the basis of clinical signs , physical examination , including deep incisional biopsy , and anamnesis . primary localized lipoatrophy is generally self - limiting and may not require treatment . if the clinical signs persist and the patient has cosmetic concerns , liposuction and localized fat transplantation can be performed in a combined fashion .\noutput:\n" }, { "from": "agent", "value": "lipoatrophy is characterized by inflammation and tissue loss in fatty tissue . this disease may be congenital or acquired , primary or secondary . secondary lipoatrophy develops with infections , collagen tissue diseases , tumors and drug injections . in this report , we present the case of a 14 - year - old female patient who developed lipoatrophy following intramuscular steroid injection to both buttocks ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: psoriasis is a chronic inflammatory skin disease characterized by hyperproliferation of epidermal keratinocytes and resulting in scaly , red and well - demarcated skin lesions . hyperproliferation is driven by the additive and synergistic activities of a plethora of cytokines and growth factors ( baliwag et al . ,2015 ) acting on , and driving changes in the architecture of the epidermis , keratinocytes , resident and infiltrating immune cells as well as fibroblasts and vascular endothelium in the dermis ( elder et al . , 2010 ) . in this issue of the journal , sun et al . add another ingredient to the inflammatory recipe responsible for driving this disease ; they report that the expression of ccn1 , a multifunctional non - structural protein found in the extracellular matrix ( ecm ) , is elevated in the skin of patients with psoriasis , as well as in psoriasis - like mouse models . importantly , blocking ccn1 function by either lentiviral - based sh - rna knockdown of ccn1 or anti - ccn1 neutralizing antibodies attenuated the epidermal hyperplasia and inflammation seen in the psoriasis - like mouse models . thus , they concluded that ccn1 participates in the pathogenesis of psoriasis and that targeting ccn1 could be an important therapeutic strategy . although the mechanisms by which ccn1 promotes epidermal hyperplasia and inflammation are not fully understood , sun et al . ccn1 is a secreted protein that interacts with the ecm , making it a member of a large family of matricellular proteins . based on structural homology , ccn proteins comprise a family of six members , ccn1 - 6 ( perbal , 2004 ) . the ccn acronym is taken from the names of the first three members of the family to be discovered : cyr61 / ccn1 ( cysteine - rich protein 61 ) , ctgf / ccn2 ( connective tissue growth factor ) and nov / ccn3 ( nephroblastoma overexpressed gene ) . members of the ccn family exhibit diverse cellular functions , such as regulation of cell proliferation , chemotaxis , apoptosis , adhesion , motility , ion transport , and ecm regulation ( chen and lau , 2009 ) . ccn1 has been reported to regulate cell adhesion , migration , chemotaxis , inflammation , cell - matrix interactions , synthesis of ecm proteins , and wound healing in a variety of cells in culture ( jun and lau , 2010 ; lau , 2011 ) . ccn1 exerts this range of functions through interaction with multiple integrins in a cell - type and context - dependent manner [ figure 1 ] ( lau , 2011 ) . during embryonic development , ccn1 plays a critical role in vascular development and blood vessel formation in the placenta . ccn1 knockout in mice is embryonic lethal primarily due to a failure in vascular development caused by impaired ecm homeostasis . studies in animal models and in patients have confirmed that deregulation of ccn1 protein is found in several diseases associated with chronic inflammation and / or tissue injury , including rheumatoid arthritis , atherosclerosis , diabetes - related nephropathy and retinopathy , and many forms of cancer ( chen and lau , 2009 ; kular et al . , 2011 ) . the study by sun et al . reveals elevated ccn1 in the skin of patients with psoriasis and its potential role as a driving force for epidermal hyperplasia and inflammation . obviously , their findings raise the question of what drives the sustained elevation of ccn . several recent studies have shown that the ccn1 expression is regulated directly by the transcriptional co - activator yes - associated protein ( yap ) , a major downstream effector of the hippo signaling pathway . in mouse skin , yap plays a critical role in regulating keratinocyte proliferation , differentiation , and survival through up - regulation of ccn1 ( zhang et al . , 2011 ) . in the human skin cancer , basal cell carcinoma ( bcc ) , yap and its downstream transcriptional target ccn1this inhibition of proliferation and survival is rescued by restoration of ccn1 expression ( quan et al . , 2014 ) . these data provide evidence that up - regulation of yap promotes aberrant keratinocyte proliferation through up - regulation of ccn1 in bcc . although the expression of yap in psoriasis is unknown , these data suggest that yap may be involved in up - regulating ccn1 in psoriasis . additionally , a positive feedback loop between ccn1 and the cytokine network may also contribute to the sustained elevation of ccn1 in psoriatic skin . ccn1 not only promotes the production of cytokines ( qin et al . , 2014 ) , it is also induced by cytokines , growth factors and environmental stressors ( chen and lau , 2009 ) , suggesting that a positive feedback loop may contribute to sustained elevation of ccn1 found in psoriatic skin . therefore , targeting ccn1 could be an effective therapeutic strategy by inhibiting such a positive feedback loop in psoriasisccn1 could be an important regulator in skin biology since it impacts both epidermal keratinocytes and dermal fibroblasts . in normal adult human skin , ccn1is substantially elevated in the dermis by aging , as well as under the influence of ultraviolet ( uv ) - irradiation ( quan and fisher , 2014 ) . elevated expression of cyr61 / ccn1 in the dermis leads to reduced collagen production by impairing tgf - signaling ( quan and fisher , 2014 ) and increasing collagen fibril fragmentation through the production of multiple matrix metalloproteinase proteins ( mmps ) ( quan and fisher , 2014 ) . thus , elevated ccn1 promotes skin thinning and fragility , two prominent features of aged skin , but interestingly this is not seen in long - standing psoriasis , suggesting the involvement of other mitigating factors , as well . abnormal regulation of ccn1 expression has been observed in several skin diseases , including wound healing and fibrosis ( jun and lau , 2010 ) . studies in a mouse model have demonstrated that ccn1 exerts anti - fibrotic activity via induction of dermal fibroblast senescence during cutaneous wound healing . elevated ccn1 may also have significant impact on the delayed wound healing seen in elderly patients . laser ablation , which causes partial thickness wounding , rapidly and markedly induces ccn1 in human skin dermis in vivo ( quan and fisher , 2014 ) . timing of the elevated ccn1 levels corresponds to the inflammatory phase ( ecm breakdown ) , and the timing of cyr61 / ccn1 diminution corresponds to the ecm remodeling phase ( collagen production ) of wound healing responses . also of note , ccn1 - regulated factors such as proinflammatory cytokine ( il - 1 ) , collagen - degrading mmps ( mmp - 1 , mmp - 3 , and mmp - 9 ) , and type i procollagen are well - known components of the wound healing response . these data suggest that ccn1 may play a critical role in regulating wound repair in human skin . further support comes from mouse studies , which have reported that ccn1 is induced by cutaneous wounding and that it participates in both the inflammatory and remodeling phases of repair ( jun and lau , 2010 ) . therefore , the constitutive elevation of ccn1 in aged human skin may delay wound healing by extending the inflammatory phase and delaying the remodeling phase . these findings highlight ccn1 as a possible therapeutic target , not only for psoriasis , but also for improving wound healing in the elderly and in skin cancer . the results reported by sun et al . in this issue reveal the potential role of ccn1 in the pathogenesis of psoriasis . this study , together with other emerging data , suggests that ccn1 may function as an important regulator in skin biology , by modulating key functions of keratinocytes and fibroblasts . clearly , there remains much to be learned about the regulation of ccn1 and its functions in skin physiology and pathology . it should be noted that ccn1 is one of six members of the ccn family . however , little is known regarding the roles of ccn3 - 6 in skin biology . certainly the article by sun et al . should spur new appreciation of the importance of the ccn family of proteins in skin biology .\noutput:\n" }, { "from": "agent", "value": "the complex pathogenesis of psoriasis is still not fully understood . the study by sun et al . ( sun et al . , 2015 ) in this issue of the journal suggests that cyr61 ( now named ccn1 ) , a secreted matricellular protein , plays a role in the pathogenesis of psoriasis , and thus targeting ccn1 represents a potential therapeutic strategy in its treatment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a longstanding hypothesis in the field of behavioral medicine holds that individuals who are prone to experiencing large increases in blood pressure ( bp ) during psychological stress are at increased risk for developing preclinical and clinical cardiovascular disease ( cvd ) states . indeed , evidence from prospective studies of the association of stress - associated bp reactivity with preclinical disease , such as atherosclerosis or left ventricular hypertrophy , a recent meta - analysis showed that greater cardiovascular responses ( systolic or diastolic bp ) to laboratory - based psychological stress tasks are associated with greater risk of incident hypertension and progression of carotid intima - media thickening . individual studies have likewise found that excessive bp responses to the threat of shock or to a cold pressor task predict 10 - year elevated blood pressure among initially normotensive young men with a family history of hypertension . moreover , bp reactivity to psychological stress has been shown to predict incident hypertension at 4 - year , 10 - year , and 13 - year follow - ups among 508 normotensive finnish middle - aged men , 796 english male civil servants , and more than 4,100 multiethnic participants in the coronary artery risk development in young adults ( cardia ) study , respectively . elevated bp reactivity to stress has also been linked to carotid intima - media thickness in middle - aged finnish men , progression of carotid atherosclerosis among non - medicated patients with existing atherosclerotic disease , and coronary artery calcification among a cohort of healthy young adults . these preclinical disease states are notable health outcomes , but it is essential to consider whether bp reactivity to psychological stress ultimately predicts cvd events . longitudinal studies of the association between bp reactivity and clinical endpoints , which are scarce , have shown mixed results . for example , the findings of one study that linked stress - related increases in diastolic bp to myocardial infarction or cardiac mortality were not replicated in either of two subsequent studies . the interpretation of these equivocal results is complicated by methodological issues , such as differing assessments and definitions of bp reactivity , a lack of time - to - event data in some studies , failure to control for traditional cvd risk factors that may confound the bp reactivity - cvd association , and a reliance on the cold pressor task as a psychological stressor rather than on tasks that are analogues of real - world situations such as anger recall and structured interviews . further , participants were typically not from epidemiologic samples , limiting the generalizability of the results to the general population . in this study , we examined the association between bp reactivity to a structured anger provocation interview and 10 - year incident cvd events in a population - based sample of 1.470 cvd - free individuals from nova scotia , canada . the 1995 nova scotia health survey ( nshs95 ) is a population - based survey implemented by heart health nova scotia and the nova scotia department of health to estimate the distributions of selected health indicators and preventive practices of nova scotians . participants were selected based on a probability sample designed by statistics canada , the national statistical agency and census bureau , and are representative of the nova scotian population in terms of age , sex , and geographic location . study participants were non - institutionalized nova scotians , 18 years of age or older , and listed in the medical services insurance registry , the government - sponsored universal health insurance plan . is comparable to those reported in other large health surveys , with a final survey sample size of 3,227 participants . although demographic shifts have occurred in nova scotia , including a decreased rate of population growth , greater immigration than emigration , and an increasing median age , we have no reason to suspect that these changes would alter the results of the analyses reported below . we restricted our analysis to participants who had attended the clinic session and those without hospital discharge diagnoses of cvd during the 5 years before the baseline survey , as determined by international classification of diseases , ninth revision ( icd - 9 ) codes 410.x through 414.x ( ischemic heart disease ) , 443.x ( peripheral vascular disease ) , and 430.x through 435.x ( cerebrovascular disease ) . survey respondents were excluded because of refusal to permit linkage to medical outcomes ( n = 312 ) , preexisting cvd ( n = 451 ) , failure to attend the clinic visit ( n = 388 ) , failure to complete the expanded structured ( anger provocation ) interview ( n = 391 ) , or lack of a resting bp or bp reactivity assessment ( n = 215 ) . eight additional participants did not have data on diastolic bp reactivity , leaving 1,470 participants for the primary analysis of systolic bp reactivity ( 746 males , 724 females ) , and 1,462 participants for the secondary analysis of diastolic bp reactivity ( 743 males , 719 females ) . participants who were excluded from our analyses had significantly higher levels of hdl cholesterol and were more likely to be female , a current smoker , and not have a high school education compared to those who were included . a group of 29 registered public health nurses were trained in standardized data collection and contacted potential survey participants by telephone from march through november 1995 . consenting participants were interviewed at home and then seen in clinic , approximately one week later , for measurement of height and weight and to provide a fasting blood sample . during the clinic assessment , participants completed a videotaped structured anger provocation interview that was subsequently reviewed and scored . participants provided consent to store and use videotapes and to link future ischemic heart disease events with prior health care utilization . this study was approved by the institutional review boards of dalhousie university , halifax , nova scotia , and columbia university , new york , ny . at baseline , each component of the framingham risk score was assessed , including sex , age , total and high - density lipoprotein ( hdl ) cholesterol levels , blood pressure , history of diabetes , and cigarette smoking . total and hdl cholesterol levels were assayed from plasma samples by the lipid research laboratory , university of toronto , toronto , ontario . registered nurses used manual sphygmomanometers to measure resting systolic and diastolic bp . two readings were obtained in the participant 's home , two readings were obtained during the clinic visit ( approximately 1 week later ) , and the average of these four readings was computed as a measure of resting systolic and diastolic bp . history of diabetes and completion of a high school education ( yes versus no ) were ascertained by self - report . as per the framingham risk score calculation , those who reported smoking currently or in the past year were categorized as smokers ; all others were categorized as nonsmokers . weight and height were measured twice , averaged , and used to calculate body mass index ( bmi ; calculated as weight in kilograms divided by height in meters squared ) . hypertension was defined as current use of antihypertensive medication or resting systolic bp 140 or diastolic bp 90 ( using the aforementioned measure of resting bp obtained during home and clinic visits ) . the expanded structured interview ( esi ) is a 12 - minute , interpersonally stressful interview designed to elicit anger and stress by asking participants about their characteristic responses to a variety of different situations ( e.g. , performing a task at work while under pressure , waiting in traffic , and playing a competitive game ) . the interview is based on the original type a structured interview , with additional questions on anger expression and interpersonal stress at work . recent analyses of the nshs95 data document that a substantial majority ( 89.9 % ) of participants who completed the esi was judged by trained observers as having displayed at least some hostility , either in the content of their responses or the tone of their speech . nurse interviewers measured bp just prior to the esi , at the midpoint of the interview , and at the end of the interview with a manual sphygmomanometer . given that the esi is designed to elicit maximal anger at its midpoint , the second of the three interview - based bp measures described above was selected as the measure of peak reactive bp . systolic and diastolic bp reactivity were defined by subtracting resting bp from the second of the three interview - based bp assessments ( i.e. , a change score was computed ) . nurse interviewers were trained on how to properly conduct the esi during a four - part training procedure : ( 1 ) an esi workshop , ( 2 ) esi practice , ( 3 ) feedback after reviewing the esi practice tapes , and ( 4 ) feedback during the nshs95 study . the esi administration training workshop used methods that were similar to the training used by the cardia investigation , in which investigators were taught voice emphasis , question pacing , interview length , general question and probe content , and demeanor . after the training workshop , nurses completed 10 practice esis that were rated on five structured interview quality control measures ( elaborations , empathy , length , presentation , and overlap ) . written and oral feedback was provided to each esi interviewer after the practice esis , and nurses began data collection only when their esi interviewing skills were considered acceptable . during nshs95 data collection , a random 5 % of each nurse interviewer 's esis were coded for the esi quality control measures . oral feedback about the quality control results was provided periodically throughout data collection to ensure that all interviewers maintained adequate esi administration competence . the main study outcome measure was the time - to - first - event defined as incident fatal or nonfatal cvd as determined by the icd hospital discharge codes defined above and / or by death certificates . events data were gathered from the provincial health care database through march 31 , 2005 , the 10 - year period after the initial enrollment of subjects . given that nova scotia provides universal health care insurance , and events occurring outside of nova scotiaare reimbursed and captured , the accuracy of this measure of outcome assessment is high . in the canadian single - payer health system , physicians indicate underlying and contributing causes of death , which are subsequently recorded and submitted by nosologists as icd codes upon death or discharge . a data quality committee from the nova scotia department of health meets with health records personnel to ensure accuracy , to conduct random chart reviews , and to adjudicate discrepancies in data entry . all deaths are reported to provincial offices and subsequently to the national census bureau ( statistics canada ) , which applies a nationally consistent process of determining the underlying cause of death . specifically , these data were converted to the icd - 9 codes by staff at statistics canada ; and only those codes listed above ( or the equivalent international statistical classification of diseases , 10th revision ( icd - 10 ) codes ) qualified as fatal cvd . when a limited number of items were missing for the framingham risk score , we used a previously published regression - based approach to determine the best linear - predicted score based on the non - missing items . for a given combination of missing items , scores were imputed only if the imputation equation predicting the total framingham risk score from the non - missing items had an r 75 % ; this condition was satisfied when data were available for at least five items from the framingham risk score . the cohort was divided into deciles on the basis of the distribution of systolic bp reactivity ( primary measure of reactivity ) and diastolic bp reactivity ( secondary measure of reactivity ) . participants ' baseline characteristics and their correlations with deciles of systolic and diastolic bp reactivity were examined using zero - order pearson correlation coefficients for continuous variables and point - biserial correlation coefficients for binary variables . for the analysis of the association between bp reactivity and incident cvd events , cox proportional hazards regression analyseswere used to calculate the unadjusted and adjusted hazard ratios and 95 % confidence intervals ( ci ) of cvd associated with deciles of systolic bp reactivity , controlling for age and sex in one model and additionally controlling for framingham risk score , bmi , and high school education in a second model . the fifth decile , which contained individuals with zero systolic bp reactivity , was selected as the referent group for the systolic bp reactivity analyses . the fourth decile , which contained individuals with zero diastolic bp reactivity , was selected as the referent group in the diastolic bp reactivity analyses . the chi - square statistic ( ) was used to test whether the risk of incident cvd events varied by decile of systolic bp reactivity . all analyses were repeated using diastolic bp reactivity as a secondary measure of bp reactivity . additional analyses considered bp reactivity as a continuous variable and also examined possible interactions of bp reactivity ( top 3 deciles ( 30 % ) versus middle 4 deciles ( 40 % ) and bottom 3 deciles ( 30 % ) versus middle 4 deciles ( 40 % ) ) with traditional cvd risk factors , including age ( median split ) , sex , baseline hypertension status , quartile of framingham risk score , being overweight or obese based on bmi , and resting bp . finally , to determine the robustness of the primary analyses , we conducted three additional sensitivity analyses using alternate definitions of bp reactivity and resting bp . in the first , resting bp was included as a covariate in all models given that some researchers have recommended the use of residualized change as a measure of reactivity rather than absolute change . in the second , bp reactivity was defined as the average of the second and third bp readings taken during the structured anger provocation interview relative to resting bp , as averaging may enhance the reliability of this measure of reactivity . in the third , resting bp was defined as the average of clinic bp readings with the exclusion of the bp readings obtained at home . the results for all three sensitivity analyses were similar to the results obtained from the primary analyses . as such , we do not herein report further on these analyses , as the results do not alter the findings of the study . baseline characteristics of the 1,470 nshs95 participants and their correlations with deciles of systolic and diastolic reactivity are reported in table 1 . the mean bp reactivity was 1.1211.04 mm hg for systolic bp reactivity ( range , 3948 mm hg ) and 2.217.36 mm hg for diastolic bp reactivity ( range , 2227 mm hg ) . mean age and framingham risk score were both positively correlated with deciles of systolic bp reactivity . current smoking status , prevalence of hypertension , and mean resting systolic and diastolic bp were negatively correlated with deciles of systolic bp reactivity . prevalence of hypertension and mean systolic and diastolic bp were also negatively correlated with deciles of diastolic bp reactivity . a total of 161 nonfatal and 10 fatal incident cvd events occurred during the 10 years of follow - up for the 1,470 participants included in these analyses . in the unadjusted cox proportional hazards regression model , systolic bp reactivity significantly predicted risk of incident cvd ( = 18.44 , df = 9 , p = 0.03 ) ( figure 1 ) . specifically , those in the lowest and highest deciles of systolic bp reactivity were , respectively , 2.2 ( 95 % confidence interval ( ci ) = 1.104.53 , p = 0.03 ) and 2.3 ( 95 % ci = 1.154.69 , p = 0.02 ) times as likely to develop incident cvd relative to those in the decile with no systolic bp reactivity . however , systolic bp reactivity no longer significantly predicted incident cvd events when age and sex were added to the model ( = 5.22 , df = 9 , p = 0.79 ) and it remained nonsignificant with further adjustment for framingham risk score , bmi , and education level ( = 4.33 , df = 9 , p = 0.89 ) . results were similar when systolic bp reactivity was treated as a continuous rather than a categorical variable ( data not shown ) . diastolic reactivity did not predict incident cvd events in unadjusted ( = 10.37 , df = 9 , p = 0.32 ) , age - and sex - adjusted ( = 9.55 , df = 9 , p = 0.39 ) , or fully adjusted ( = 8.90 , df = 9 , p = 0.45 ) cox regression models ( figure 2 ) . we next considered whether exaggerated bp reactivity interacted with age , sex , hypertension status , being obese or overweight based on bmi , quartiles of framingham risk score , or resting bp in the prediction of incident cvd . neither systolic nor diastolic bp reactivity significantly interacted with any of these variables in the prediction of incident cvd ( all p 's for interaction terms 0.16 ) . we evaluated whether bp reactivity to a structured anger provocation interview predicted incident cvd disease events in a prospective population - based study . in an unadjusted model , systolic bp reactivity to anger provocation significantly predicted risk of incident cvd such that those in the lowest and highest deciles of systolic bp reactivity were more than twice as likely to develop incident cvd compared to those in the decile with no reactivity . however , systolic bp reactivity , at any decile level , did not predict incident cvd events above and beyond traditional cvd risk factors , including age , sex , framingham risk score , bmi , and completion of a high school education . further , diastolic bp reactivity , at any decile level , did not predict cvd in unadjusted and adjusted models . these results are supported by a strong study design , including a large , population - based sample that was randomly selected , careful capture of cvd events at 10 - year follow - up using hospital records , and the use of a psychological stressor that individuals will most likely experience in the natural environment . in addition , important potential confounders were considered , and analysis of possible interactions of bp reactivity with traditional cvd risk factors was conducted to elucidate whether certain subgroups were at risk . research examining the relation between bp reactivity to a psychologically stressful interview and either preclinical or clinical cvd outcomes is limited . the single study that examined whether bp reactivity to a type a structured interview predicts cvd events did not find a significant association in a small sample of participants with pre - existing cvd . more recent evidence suggests that bp reactivity to being interviewed about a recent , stressful interpersonal situation predicts future bp . although this finding suggests that increased bp reactivity to a psychologically stressful interview may be associated with hypertension onset , there is little evidence that it is associated with clinically evident cvd . a few additional studies have examined prospective associations of bp reactivity to other psychological stressors of questionable ecological validity with cvd events . for example , one study reported a positive association of systolic bp reactivity with incident stroke and another reported an association of diastolic bp reactivity with both myocardial infarction and total cvd . however , the former study was limited to middle - aged men and the stressor was anticipation of an exercise test while the latter study enrolled only patients with hypertension , defined bp reactivity as the difference between nurse and physician assessments ( a variant of the white - coat effect ) , and did not include any other type of psychological stressor . other studies that have reported significant associations of bp reactivity with cvd events have been limited to patients with preexisting cvd , included relatively small samples of fewer than 100 participants , have not controlled for age , sex , and other traditional cvd risk factors , and / or have relied on cognitive tasks such as mental arithmetic and the stroop test that likely have less ecological validity than the anger provocation interview used in the current study . additional prospective studies of the possible cardiovascular effects of bp reactivity have defined reactivity in response to the cold pressor task , with some of these showing that reactivity does predict incident cvd events and others failing to replicate this finding . given the use of the cold pressor task in these studies , however , their comparability to the current study is unknown . we elicited bp reactivity to a psychological stressor that is a laboratory analogue of a real - world situation rather than relying on a mixed physical / psychological stressor such as the cold pressor task . although few , if any , studies have tested whether bp reactivity to anger provocation is a more valid method of eliciting reactivity than the use of a cold pressor task , people are more likely to experience anger in their daily lives than they are to hold their hands in near - freezing water for several minutes . in addition , the cold pressor task risks producing primarily reflex hemodynamic changes . as such , our study findings likely have greater lab - to - field generalizability , with respect to psychological stress , than those of studies that have used the cold pressor task . although systolic bp reactivity predicted 10 - year incident cvd events in an unadjusted cox proportional hazards regression model in the current study , this finding was no longer significant after simple adjustment for age and sex . in addition , age was significantly correlated with deciles of systolic bp reactivity in bivariate analyses , suggesting that age is an important confounder of the relation between stress - related systolic bp reactivity and incident cvd events . indeed , previous studies have demonstrated significant associations of age with systolic bp reactivity , lending support to the idea that age confounds the association of systolic bp reactivity with incident cvd events . moreover , although some studies have suggested that the predictive validity of bp reactivity may differ for men and women , the association between bp reactivity and incident cvd in the current study was not modified by gender as well as other important characteristics such as age , hypertension status , resting bp , framingham risk score , or being overweight or obese . first , our primary measure of bp reactivity was defined in relation to a single bp reading during the structured anger provocation interview . previous studies have shown that the aggregation of cardiovascular responses across multiple time points and multiple stressful situations improves the reliability and generalizability of such measures . although we replicated our null finding using a measure of reactivity based on the average of the second and third interview - based bp readings , the reliability of our reactivity measure would have been increased even further if we had additional measures of bp during the esi . second , although some studies suggest that cardiac reactivity to an anger provocation interview in the laboratory is associated with reactivity in real life , such evidence is limited . indeed , the manual ascertainment of blood pressure in the middle of the anger provocation interview may not be comparable to typical experiences elicited in the natural environment . third , this study did not include ascertainment of incident hypertension diagnosis or other preclinical disease endpoints as outcomes . although future studies could examine whether reactivity to anger provocation is associated with hypertension and other preclinical outcomes , additional studies such as these may not be needed if bp reactivity does not ultimately lead to incident cvd events . although we found that age of the participant at baseline did not interact with the relation between bp reactivity and incident cvd events , it is unclear whether our results can be extended to a population of elderly participants without initial cvd . neither systolic nor diastolic bp reactivity to anger provocation significantly predicted incident cvd events independent of traditional cvd risk factors , including age , sex , framingham risk score , bmi , and education in a population - based study . these results suggest that bp reactivity to a laboratory - induced structured anger provocation interview does not play a major role in the development of cvd .\noutput:\n" }, { "from": "agent", "value": "we examined the association between blood pressure ( bp ) reactivity to an anger provocation interview and 10 - year incident cvd events in 1,470 adults from the population - based 1995 nova scotia health survey ( nshs95 ) . in an unadjusted model , those in the highest decile of systolic bp reactivity were more than twice as likely to have an incident cvd event compared to those in the decile with no reactivity ( hr = 2.33 , 95 % ci = 1.15 4.69 , p = 0.02 ) . however , after adjusting for age and sex , and then also for framingham risk score , body mass index , and education , this relationship was attenuated and not statistically significant . diastolic bp reactivity was not associated with cvd incidence in any model . individual differences in bp reactivity to a laboratory - induced , structured anger provocation interview may not play a major role in clinical cvd endpoints ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it relies primarily on the restriction of high concentrations of its gtp form to the nucleus . the differential distribution of rangtp between the nucleus and the cytoplasm is safeguarded by the integrity of the nuclear envelope . in the nucleus , rangtp regulates the binding properties of the family of importin like nuclear transport receptors , promoting the dissociation of import receptors from their cargo proteins and participating in complex formation of export receptors with their cargos . this governs the directionality of nucleocytoplasmic transport ( mattaj and englmeier , 1998 ; grlich and kutay , 1999 ) . there is now substantial evidence indicating that these activities are important for spindle assembly as well . experiments in xenopus egg extracts have shown that the dissociation of import receptors from their cargos by rangtp is one of the mechanisms that renders several proteins competent to function in spindle formation ( gruss et al . , 2001 ; nachury et al . recently , there have been some direct ( askjaer et al . , 2002 ; bamba et al . , 2002 ) and indirect evidence supporting a role for the ran system in spindle assembly in mitosis in vivo ( gruss et al . , 2002 ; moore et al . , 2002 ; trieselmann and wilde , 2002 ; li et al . , 2003 ) . in addition , the ran system has been demonstrated to be involved in other cell cycle regulated events , such as nuclear envelope assembly ( hetzer et al . , 2000 ; zhang and clarke , 2001 ) and kinetochore function ( arnaoutov and dasso , 2003 ) . moreover , yamaguchi and newport ( 2003 ) have recently shown that in the presence of high levels of rangtp the export receptor crm1 inhibits rereplication by sequestering replication proteins inside the nucleus without exporting them to the cytoplasm . interestingly , this situation is like a mirror image of mitosis when ran releases proteins from inhibitory import receptors . as the cell enters mitosis and the nuclear envelope breaks down the nucleoplasm and the cytoplasm mix , diluting the high concentration of nuclear rangtp . however , because rcc1 , the gef for ran associates with the chromosomes in m - phase , the concentration of rangtp may still be high enough in the vicinity of chromatin to dissociate complexes of importins and cargo proteins . a local high rangtp concentration may therefore provide positional information for the formation of the spindle around the chromosomes . to test this idea kalab et al . ( 2002 ) used fret - based biosensors to monitor the binding of rangtp to its partners in xenopus egg extracts and visualized a high local concentration of rangtp around the mitotic chromatin , providing the first experimental support for the rangtp gradient model for spindle assembly . however , it was not clear whether this only occurred in a large cytoplasm like the xenopus egg or if such a gradient could also exist in somatic cells . indeed , mathematical modeling based on known kinetic parameters of the components of the ran system ( grlich et al. , 2003 ) predicted that a gradient of rangtp could exist around chromosomes in a large cytoplasm but not in an average 20 - m large somatic cell . recently , li and zheng ( 2004 ) have provided evidence for the existence of a gradient of rangtp around chromosomes in somatic cells . therefore , there is now evidence supporting the existence of a gradient in different systems . it still remains to be determined how the localization of various components of the ran system to specific cellular compartments influence this gradient . indeed it has been reported that ran localizes to the chromatin ( bilbao - cortes et al . , 2002 ; li and zheng , 2004 ) , the kinetochores ( bamba et al . , 2002 ) , the spindle ( trieselmann and wilde , 2002 ) and with the centrosomes ( forgues et al . in addition , rangap1 as well as ranbp2 colocalize with spindle microtubules and kinetochores ( joseph et al . , 2002 , 2004 ) , and the export receptor crm1 can associate with centrosomes ( forgues et al . , 2003 ; keryer et al . , 2003 ) whether and how the localization of ran or components of the ran system may affect the shape of the ran gradient during mitosis and how different factors involved in spindle assembly react to a given rangtp concentration remains to be determined . a strong prediction of the ran gradient model is that chromosomes are essential determinants for spindle assembly . this idea was initially supported by experiments showing that injection of chromatin or dna into xenopus metaphase arrested eggs triggered spindle assembly whereas injection of centrosomes did not ( karsenti et al . , 1984 ) . later experimental support came from the observation of spindle assembly around dna - coated beads in xenopus egg extracts ( heald et al . , these results however posed the question of whether spindle assembly around chromatin could just be a specialized pathway existing in systems that naturally lack centrosomes , like in vertebrate female meiosis and in plants . inhibition of rangtp production in xenopus egg extracts leads to severe defects in spindle assembly even in the presence of centrosomes ( carazo - salas et al . , other manipulations in different cellular systems ( meiotic and mitotic ) also support the view that chromosomes are important determinants for spindle assembly in general ( karsenti et al . , 1984 ; mckim and hawley , 1995 ; zhang and nicklas , 1995 ; khodjakov et al . , 2000however , reports on spindle formation in the absence of chromosomes have challenged this idea ( brunet et al . , 1998 ; 2003 ) and have led some authors to propose that the organization of microtubules into two antiparallel arrays is an intrinsic property of mitotic microtubules ( brunet et al . , 1998 ) . it is conceivable that when two or more dynamic microtubule asters come into proximity in an m - phase cytoplasm , some antiparallel interactions may be established and become stabilized through the recruitment of some mitotic factors . spindle - like structures have indeed been reported to form in the absence of chromosomes ( faruki et al . , 2002 ; bucciarelli et al . , however , unlike the finely temporally and spatially controlled process of spindle formation around chromosomes , spindle - like structures formed in the absence of chromosomes arise randomly in the cellular space ( brunet et al . , computer simulations have recently been used to analyze theoretically the minimal requirements for the establishment of stable antiparallel interactions between two microtubule asters ( nedelec , 2002 ) . thus , it may not be surprising that in a mitotic cytoplasm two or more microtubule asters may establish antiparallel interactions . one important question is then whether these structures could be as functional as real spindles . recently , drosophila secondary spermatocytes lacking chromosomes have been reported to assemble a spindle and go through anaphase and cytokinesis like wild - type cells ( bucciarelli et al . , 2003 ) . this suggests that except for the obvious lack of chromosome segregation the spindle - like structure that formed retained the other functions attributed to spindles . in fact , a closer look at microtubule organization in these cells suggests that the two microtubule asters nucleated by the centrosomes barely interact . because of the space restriction imposed by the cell membrane most microtubules nucleated by the centrosomes can only grow toward the center of the cell and thus adopt a spindle - like topology . however , the density of microtubules in the central region is much lower than in bona fide spindles suggesting that there are no interactions between antiparallel microtubules . although the later assembly of the central spindle and cytokinesis could suggest that a spindle had indeed previously assembled , in fact these are most certainly independent events . first , in this meiotic system the spindle checkpoint is nonexistent or very weak ( rebollo and gonzalez , 2000 ) . second , the central spindle does not derive from the spindle itself but forms from newly assembled microtubules that grow in the central cortical region of the cell ( c. gonzalez , personal communication ) . ( 2004 ) have shown that in this system the plane of cytokinesis is not determined by the spindle itself but by the position of the two centrosomal asters . interestingly , these authors have also shown that spindles can assemble in drosophila spermatocytes without any contribution from centrosome nucleated microtubules ( rebollo et al . , 2004 ) 2003 ) have demonstrated recently that contractile ring positioning in rat kangaroo cells can even occur in the presence of just one monopolar array of microtubules , indicating that bipolar organization of antiparallel microtubules is indeed not needed for cytokinesis in general . therefore , these data suggest that these late events do not depend on the previous formation of a spindle . in summary , although some antiparallel interactions may be established between two or more microtubule asters in an m - phase cytoplasm , chromosomes appear as important determinants to direct spatially the formation of a robust spindle . during mitosis rangtp regulates the activity of factors involved in microtubule nucleation , stabilization and organization ( wilde and zheng , 1999 ; zhang et al . , 1999 ; carazo - salas et al . , 2001 ; wilde et al . , 2001 ; hetzer et al . , importin was found to mediate the effect of rangtp on mitotic factors . at present , we know of three proteins that bind to importin via the adaptor protein importin in mitosis : the kinesin - like protein ( klp ) xctk2 and two microtubule - associated proteins , targeting protein for xklp2 ( tpx2 ) and nuclear protein of the mitotic apparatus ( numa ) . these proteins have been proposed to be targets of rangtp in the spindle assembly pathway ( gruss et al . , 2001 ; nachury et al . , 2001 ; wiese et al . , 2001 ; ems - mcclung et al . , 2004the predominant interacting partners of tpx2 and xctk2 in xenopus m - phase extracts are indeed importins and ( gruss et al . dynactin complex ( merdes et al . , 1996 ) indicating that only a small subset of numa could be regulated by the ran system through the binding to importins . proteins regulated by rangtp during spindle assemblya wittmann et al . , 2000 ; gruss et al . , 2001 ; gruss et al . , 2002 ; garrett et al . , 2002 ; trieselmann et al . , 2003 ; , 2003 ; tsai et al . , 2003 ; eyers and maller , 2004 ; bayliss et al . , 2003 ; merdes et al . , 1996 ; nachury et al , 2001 ; wiese et al . , 2001 ; walczak et al . , 1997 ; wilde et al . , 2001 ; antonio et al . , 2000 ; funabiki and murray , 2000 ; yajima et al . likely candidate factors involved in cell division are those sequestered into the nucleus in interphase and thus interacting with importins . the microtubule binding capacity of the nuclear klp kid was recently found to be modulated by ran and the importins in vitro ( trieselmann et al . , 2003 ; see fig . 2 , and table i ) . ( 2001 ) have shown that the kinesin like protein eg5 is regulated by rangtp and involved in the organization of microtubules into mini - spindles , spindle - like structures unique to the ran pathway because they do not form after addition of taxol or centrosomes to an m - phase egg extract . a general picture is starting to emerge in which rangtp coordinates the activities of numerous factors that collectively direct the formation of the spindle around the chromosomes ( fig . 1 and table i ) . moreover , many recent data suggest that the regulation of tpx2 is important for several steps in spindle assembly . we will focus on tpx2 in the last part of this review . during mitosis rangdpis converted into rangtp in the proximity of the chromosomes by the nucleotide exchange factor rcc1 . in a first step , rangtp binds to importin releasing it from importin . the affinity of importin for nls sequences is reduced and a complex of importin cas and rangtp forms releasing tpx2 . although tpx2 was first identified as an antigen specific for mitosis ( heidebrecht et al . , 1997 ) and as the tpx2 ( wittmann et al . , 2000 ) , a major breakthrough came with the discovery that it is one of the targets of rangtp during mitosis ( gruss et al . , this complex is dissociated by rangtp and once released tpx2 promotes microtubule assembly ( gruss et al . , 2001 ; tpx2 behaves as a microtubule associated protein ( map ) in all biochemical assays and it colocalizes with spindle microtubules in m - phase in vivo and in vitro ( heidebrecht et al . , 1997 ; wittmann et al . , 2000 ; garrett et al . , 2002 ; gruss et al . , 2002 ; trieselmann et al . , . however , tpx2 does not stabilize microtubules like other maps but probably plays a yet poorly understood role in the early steps of microtubule nucleation ( gruss et al . , 2002 ) . in fact , bacterially expressed tpx2 can initiate microtubule polymerization in a solution of pure tubulin , an activity regulated by importins ( schatz et al . , 2003 ) . together , these data indicate strongly that an essential early role of tpx2 is to promote microtubule assembly in the vicinity of chromosomes . accordingly , tpx2 has been found to be crucial for spindle formation in xenopus egg extracts and in tissue culture cells ( gruss et al . , 2001 , 2002 ; garrett et al . , these studies indicate that microtubule assembly induced by tpx2 around the chromosomes is a general requirement for spindle assembly a conclusion in sharp contrast with the idea that two centrosomal asters are sufficient to organize a spindle ( see spindle assembly without chromosomes ? factors proposed to be regulated by rangtp during mitosis and their role in spindle assembly . ( a ) nucleation : in the initial phases chromosomes generate an environment enriched in rangtp ( b ) organization : microtubules assembled around the chromosomes coalesce and start to organize . two proteins were suggested to be regulated by rangtp and to participate in these events : eg5 and kid . tpx2 accumulates at the poles of metaphase spindles in a dynein dynactin - dependent way . this localization does not depend on rangtp because tpx2 accumulates at the center of microtubule asters induced in xenopus egg extracts by addition of centrosomes , or agents like taxol or dmso and binds to pure microtubules in the presence of importins ( wittmann et al . in contrast to numa ( merdes et al . , 1996 ) , that has a very similar localization at spindle poles , a direct interaction between tpx2 and the dynein dynactin complex has not been described . in any case , the spindle pole localization of tpx2 may be important functionally because tpx2 is required for spindle pole integrity ( wittmann et al . the function of tpx2 at spindle poles could also be related to its targeting activities . two proteins have been shown to be targeted by tpx2 , the klp xklp2 ( wittmann et al . , 2000 ; garrett et al . , 2002 ) and the kinase aurora a ( kufer et al . , 2002 ) . the targeting of xklp2 by tpx2 to microtubule minus ends of asters assembled in xenopus m - phase extracts occurs in the absence of rangtp ( wittmann et al . , 2000 ; garrett et al . , 2002 ) suggesting that its targeting to the spindle poles is independent of the ran system as well . by contrast , the interaction between tpx2 and aurora a is stimulated by rangtp ( kufer et al . , 2002 ; eyers et al .1 ) . interestingly , this interaction leads to the activation of the kinase and , in turn , the phosphorylation of tpx2 by aurora a ( eyers et al . , 2003 ; tsai et al . , structural and biochemical studies have helped to understand the precise mechanism by which tpx2 activates the kinase ( bayliss et al . , 2003 ; eyers and maller , 2004 ) . the binding of a short nh2 - terminal sequence of tpx2 to the catalytic domain of aurora a locks the kinase into an active conformation . first , it positions the activation segment into a more favorable conformation for substrate binding and second by inducing the swinging of a critical phosphorylated residue into a buried position protecting it from dephosphorylation by pp1 and thus inactivation ( bayliss et al . , 2003 ) . therefore , the interaction of tpx2 with aurora a could be a mechanism to translate the rangtp signaling network into a phosphorylation network . although few substrates for aurora a have been identified , one of them is the klp eg5 ( giet et al . , 1999 ) and the other is tpx2 itself ( bayliss et al . , 2003 ; eyers and maller , 2004 ) . interestingly , eg5 is activated by rangtp and it has been suggested that it is regulated by aurora kinase phosphorylation ( giet and prigent , 2000 ) . in contrast , it is not clear whether and how aurora a mediated phosphorylation of tpx2 affects its activities . in any case , the rangtp - dependent microtubule assembly activity of tpx2 as well as its rangtp - mediated interaction with aurora a that leads to the activation of the kinase reveal important mechanisms by which rangtp can control directly and indirectly the activity of factors required for spindle assembly . the central role of ran in spindle formation reflects the general importance of the regulation of nuclear proteins in this process . in fact , nuclear proteins , all set free early in mitosis upon nuclear envelope breakdown , are involved at all stages of m - phase . thus , it will be interesting to see whether and how ran works to regulate the accessibility of nuclear proteins for late functions in cell division like chromosome segregation and cytokinesis .\noutput:\n" }, { "from": "agent", "value": "recent work has provided new insights into the mechanism of spindle assembly . growing evidence supports a model in which the small gtpase ran plays a central role in this process . here , we examine the evidence for the existence of a rangtp gradient around mitotic chromosomes and some controversial data on the role that chromosomes play in spindle assembly . we review the current knowledge on the ran downstream targets for spindle assembly and we focus on the multiple roles of tpx2 , one of the targets of rangtp during cell division ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the alkene ring - closing metathesis ( rcm ) reaction has enabled many complex and important molecules to be constructed in new ways . the popularity of the rcm reaction has been driven by the commercial availability of highly active and stable ruthenium precatalysts such as 13 . industry has seized upon the potential of the technology , and reactions have now progressed from the realm of the discovery chemist into chemical development and scale - up . the boehringer - ingelheim group have prepared biln 20614 on a multikilogram scale using rcm of diene 5 to form 15 - membered macrocycle 6 as a key step ( scheme 1 ) . during the course of the campaign , extensive optimization studies involving changes of solvent , precatalyst and substrate structure were carried out , and cyclization efficiency was quantified using the method described by ercolani et al . ; plotting the concentration of cyclic product squared versus the concentration of cyclic dimer yields a linear plot with slope ( emproduct ) / ( emdimer ) ( eq 1 ) , which can be used to compare different reaction conditions quantitatively .1 the study showed that the quantification of reaction outcomes required some care , as the process of product isolation can change the reaction yield unless all the metathesis - active species are quenched before samples are concentrated . the increasing concentration during solvent removal can result in secondary metathesis events that may be complex in nature and demonstrates the difficulty involved in using reaction yields from the synthetic chemistry literature to draw firm conclusions about the interplay between structure and reactivity . we have used h nmr , a less invasive method , to quantify the outcomes of small - scale metathesis reactions of simple , - dienes and to follow the course of their rcm reactions in kinetic studies . we have also modeled the potential energy surfaces for these reactions in some detail using the m06 - l functional . it should be possible to interpret the concentration / time data obtained from kinetic experiments using a combination of computational insights and quantitative data obtained from fundamental studies of precatalyst systems . an appropriate kinetic model that takes account of precatalyst initiation and active catalyst decomposition would allow the interpretation of this concentration / time data ( which very rarely correspond to a simple kinetic order ) and comparisons between different reaction solvents and precatalyst systems . the 2008 study published by adjiman , taylor and co - workers was therefore of great interest . the study applied a very simple kinetic model to the cyclization of diethyl diallylmalonate 7 to form product 8 ( using grubbs second generation precatalyst 1 ) and promoted acetic acid as an unexpectedly effective solvent for rcm reactions on the basis of the findings ; the model took account of precatalyst initiation and active catalyst decomposition explicitly ( scheme 2 , l = h2imes ) . the model comprises reversible initiation of 1 to form 14e benzylidene 9 , reversible rcm of 7 to form 8 and irreversible decomposition of two molecules of 9 to form 10 . numerical integration software was used to analyze and simulate concentration / time data from reactions that were carried out under reaction conditions similar to those used for the majority of target synthesis projects . the meticulous exclusion of oxygen and water from reactions using glovebox techniques is required for maximum rigor , but such procedures bear almost no resemblance to the way rcm reactions are carried out in the synthetic laboratory . indeed , the relative robustness of ruthenium - based precatalysts represents one of the reasons for their wide appeal and ubiquity compared to the more active but far more fragile molybdenum - based systems . while synthetic chemists would use dried ( and typically degassed ) solvents , they would not usually do more , so the level of rigor employed by adjiman , taylor and co - workers is entirely appropriate and relevant . if their model could be applied to other systems , it could be used by synthetic chemists to predict conditions under which maximum reaction yield could be obtained at optimal substrate concentration , with the most appropriate precatalyst at the lowest practical loading and reaction time , with obvious and considerable advantages to those involved in scale - up campaigns . we therefore set out to apply the published model to our own systems of interest and investigate its scope and limitations ; we report our findings in this manuscript . reaction concentration / time data were collected for the rcm reactions of diethyl diallylmalonate 7 to form product 8 , heptadiene 11 to form cyclopentene 12 and octadiene 13 to form cyclohexene 14 ( scheme 3 ) catalyzed by 1 and 2 , by h nmr ( at 400 or 600 mhz ) following the procedures described previously . dichloromethane - d2 ( dcm - d2 ) was used initially as it is the default solvent for synthetic rcm ; however , we also used chloroform - d for many experiments because it is a fraction of the cost of dcm - d2 and precatalyst initiation occurs at similar rates in the two solvents ( vide infra ) . stock solutions of substrates and precatalysts were prepared in dried solvents ( solvents were allowed to stand over activated 4 molecular sieves overnight , then degassed before use by sparging with dry oxygen - free nitrogen ) using dried volumetric glassware so that weighing and dilution errors would be minimized . for more dilute reactions , concentrated stock solutions were prepared and diluted down immediately before use . solid 1 and 2 and their solutions were handled with care under a flow of nitrogen . reactions were carried out in nmr tubes fitted with pierced caps , allowing free egress of ethene . the published model ( scheme 2 , eqs 26 ) was constructed in both berkeley madonna and micromath scientist software packages ( using the default runge kutta fourth - order integration method for each ) and reaction concentration / time data ( for dienes 7 , 11 and 13 and products 8 , 12 and 14 ) were imported as text files or spreadsheets , respectively . each experiment was checked for mass balance : the reactions treated in this manuscript all convert diene to cycloalkene ( plus ethene ) without the formation of oligomers or side - products . initially , attempts were made to reproduce the experiment in dcm - d2 reported by adjiman and taylor ( 120 mm 7 , 6.7 mm 1 ) and obtain the published rate constants through fitting .23456 unfortunately , the concentration / time profile recorded indicated a faster reaction than the one published ( figure 1 ) . a slower reaction took place in dcm - d2 from a freshly opened ampule , although this did not match the literature concentration / time profile either . karl fischer titration showed that the drying procedure had been effective , with a water content of ca .30 ppm before drying ( untreated chloroform - d and dcm - d2 ) but less than 10 ppm afterward . it is clear that commercial nmr solvents from ampules must be treated with some caution if relatively significant amounts of water are not to be introduced . straightforward drying of solvents using molecular sieves reduced the water content of the deuterated solvents to a level similar to that found in dcm obtained from widely used solvent purification systems ; for example , dcm from the innovative technologies puresolv system used in - house contains water at no more than 5 ppm . although the kinetic data were not consistent with the published literature profile , we fitted the data set ; diene and cycloalkene concentration were both fitted , but only cycloalkene concentration is shown for clarity . an excellent fit was obtained for both species . however , quite different values for all rate constants were required ( table 1 ) , prompting further investigation with this data set . experimental concentration / time data and simulations thereof obtained using the adjiman and taylor model and rate constants for the rcm of 7 in dry dcm - d2 ( red , red line ) and wet dcm - d2 ( , black line ) at 298 k. diene and cycloalkene concentration were both fitted , but only cycloalkene concentration is shown for clarity . diethyl diallylmalonate 7 is used as a benchmark substrate to assess the performance of new precatalyst systems because it is assumed to cyclize irreversibly and via rate - limiting precatalyst initiation . the absolute values of k1 and k1 should be very influential on the predicted concentration / time profiles , so the value of k1 was stepped in factors of 10 between fixed values from 10 to 10 s in the fitting , allowing k2 and k2 to optimize . the k2 and k2 constants represent many events comprising the ring - closing metathesis process ; this is an inherent weakness in a fitting approach but it represents one way to achieve significant simplification without recourse to unrealistic reaction conditions . was fixed to zero and once where k3 was allowed to vary in the fitting . good fits were obtained for all values of k1 from 10 to 10 s when k3 was fixed , and from 10 to 10 s when k3 was allowed to change , which is very surprising given the importance of precatalyst activation . the values of other rate constants changed smoothly with changes in k1 ( figure 2 ) . testing the flexibility of k1 in the model with ( a ) k3 fixed to zero and with ( b ) k3 allowed to change in the fitting routine . it is clear these rate constants are correlated ; the model will tolerate quite large changes in k1 by readjusting the value of other rate constants in direct proportion to the change in k1 , because the rate constants in the model are all dependent on k1 . the irrelevance of the absolute value of k1 is a source of considerable concern ; unconstrained fitting of even moderately complex reactions is unwise because of the number of variables and the dependencies between them . the absolute values of strongly correlated rate constants can not be obtained from fitting . with these results in hand , concentration / time data were recorded for the rcm reactions of diethyl diallylmalonate 7 over a range of reaction conditions ( 10 to 500 mm 7 , 1 to 10 mol % 1 , table 2 ) . kinetic data collected using h nmr at 600 mhz with 2 scans per data point . multiple data sets were imported into berkeley madonna and fitted simultaneously ( batch fitted ) to the adjiman model , on the basis that fitting a number of the data sets in table 2 would yield a set of rate constants that could describe a wider range of conditions . unfortunately , a fit that described all data sets at once could not be achieved through this batch fitting approach . the rate constants corresponding to the best fit are in table 3 . while the best fit described the shapes of the concentration / time profiles well for some data sets ( where 250 mm ) , fitting of the experimental data was moderate or poor for others . figure 3 shows excellent ( = 500 mm ) , moderate ( = 120 mm ) and poor ( = 50 mm ) fits from the batch fitting results . we refer to the maximum difference between experimental and simulated concentrations during the reaction . at this point , it is clear that the flexibility of the model with respect to diene concentration is a major limitation ; at a give diene concentration , precatalyst concentration can be varied with good fits obtaining ( vide infra ) . different best fits can be found for each data set ; either these are not global but local minima , or the model simply fails to describe a range of conditions . testing the quality of fitting as a function of diene concentration for ( a ) = 500 mm ( 1 mol % 1 ) ( = data points , solid line = simulation ) and ( b ) = 120 mm ( 5.5 mol % 1 ) ( , red solid line ) and = 50 mm ( 2.5 mol % 1 ) ( blue , blue solid line ) . attention then turned to constraining the value of k1 in the fitting , reflecting the importance of the precatalyst initiation event . the kinetics of the initiation of precatalysts 1 , 2 and 3 have been studied in some depth and the initiation rate of 2 in dcm at 298 k is already known ( 0.0263 l mol s ) . values of 1.4010 and 4.510 s were obtained for 1 in dcm and chloroform , respectively , and 0.0234 l mol s for 2 in chloroform ( see the supporting information for details ) by following the reaction of the precatalyst with ethyl vinyl ether at 298 k by either h nmr ( for 1 ) or uv / vis spectroscopy ( for 2 ) . these modest differences in initiation rate render chloroform - d a cost - effective solvent for the study of rcm . though the 14e complex 9 is an accepted intermediate on the energy surfaces for metathesis pathways , the barriers to alkene coordination or phosphane recoordination are very small . the value of k1 / k2 ( where k2 refers to the rate of alkene coordination ) is close to 1 from the experimental work of sanford et al . , however , complex 9 undergoes barrierless forward and backward reactions , so it follows that k1 / k1 should reflect this in a very low numerical value . p bond separation ; k1 / k1 = k 10 at 298 k follows from this . the ratios of k1 / k1 derived by adjiman and taylor ( k1 / k1 = 0.18 in dichloromethane , table 1 ) are therefore inconsistent with detailed experimental and theoretical studies on the phosphane dissociation event . the values of k3 , which represent the rate of a bimolecular decomposition of active catalyst , also varied considerably with solvent . according to the work of hong et al . , phosphane - bound methylidene 15 decomposes via 14e methylidene 16 to yield diruthenium complex 10 ( scheme 4 ) ; two molecules of 16 and one of tricyclohexylphosphane are consumed to produce one molecule of 10 , with tricyclohexylphosphane being converted to tricyclohexylphosphonium chloride in the process . in the adjiman model , this pathway is represented by the term k3 , but inspection of the high - field region of the h nmr spectrum of a 500 mm rcm of 7 ( 2.5 mol % 1 ) did not reveal 10 , whereas 1 and 15 are clearly visible . formation of the diruthenium hydride complex 10 has been observed in concentrated solutions ( 20 mm ) of phosphane - bound methylidene 15 at higher temperatures ( 322 k ) , or in the presence of a large excess of ethene , so the formation of 10 ( which requires two bimolecular steps ) would be expected to be slow under the mild and more dilute conditions used here and in most synthetic rcm experiments . the decomposition pathway characterized by hong et al . has not yet been shown to account for significant quantities of ruthenium - carbene loss in synthetic rcm experiments . the value of k1 was then fixed to the experimentally determined value ( for the relevant precatalyst / solvent combination ) for subsequent fitting . simultaneous fitting of the 13 rcm reaction concentration / time profiles ( with k3 fixed to zero ) in table 2 yielded a new set of rate constants ( table 4 ) . once again , these rate constants failed to describe a range of concentrations and only described reactions well when 250 mm . at this point , the limitations appear to follow from the way in which the model is constructed ( that is , the differential equations used to set it up ) . the literature model was also constructed in micromath scientist , which provides a number of useful statistics with which to evaluate and compare reaction models , in order to evaluate how flexible the model was with a fixed value for k1 . three data sets covering a wide concentration range ( entries 3 , 7 , and 12 in table 2 ) were fitted to the model in turn , providing good fits in each case but requiring vastly different rate constants ( entries 1 , 2 , and 3 in table 5 ) . analysis of the fitting statistics showed that all rate constants were highly correlated , in agreement with the previous result ( figure 2 ) , and that 95 % confidence limits for each rate constant were very wide indeed . the confidence limits for k3 are so wide ( and encompass zero ) as to suggest that its value has very little bearing on the reaction , as would be expected for a bimolecular process occurring under very dilute conditions . attempts at fitting multiple data sets using scientist were unsuccessful ; fitting the three data sets which had been examined separately yielded a good fit for the 500 mm reaction but underestimated the rates of the 120 and 50 mm reactions by ca . it is now useful to examine the model in more detail , understand more fully the importance of k1 and identify the scope and utility of the model in its current form . one of the important predictions of adjiman , taylor and co - workers concerns the extent to which precatalyst 1 dissociates , and the concentration / time profile of active catalyst 9 . the published paper does not report any measurements of the concentration of 1 , even though the solution concentration would have allowed the benzylidene proton to be observed ( h = ca .19.2 ppm in chloroform - d and dcm - d2 ) and integrated with confidence . when spectra were recorded over a 20 ppm chemical shift range , the change in concentration of 1 was seen to be modest during the course of the reaction . most of the initial charge of 1 remains well after complete conversion of 7 to 8 , in agreement with previous literature reports , indicating clearly that the reaction conditions are not causing extensive catalyst decomposition on the time scale of the rcm ( figure 4 ) . concentration / time profiles of 8 ( ) , precatalyst 1 ( ) and inactive phosphane - bound methylidene 13 ( red ) during the rcm of 7 ( 120 mm , 5.5 mol % 1 ; entry 9 in table 2 ) . complete dissociation of phosphane clearly does not occur ; the simulated catalyst concentration / time profile presented by adjiman and taylor is an artifact arising from the use of an excessively large value of k1 ( 6.1710 s ) . a second alkylidene species was observed to form slowly during rcm reactions , with a chemical shift consistent with metathesis inactive methylidene complex 15 ( h = 17.8 ppm ) , formed by irreversible recapture of 16 by phosphane ; despite recent and detailed low - temperature nmr studies by van der eide ,16 has not yet been detected by nmr . capture of 16 by phosphane is slow because the concentrations of 16 and phosphane are very low ; substrates , ethene and products , all competitive and reversibly binding ligands , are all present at much higher concentrations . in the reaction profile in figure 4 , complete turnover of 7 has been achieved at the expense of ca . the continued decrease in the concentration of precatalyst 1 even after the reaction has finished is due to reaction with ethene , which is known to yield a low energy metallocyclobutane after reaction with two molecules of ethene . this initiation behavior was confirmed by following the decay of the precatalyst 1 in ethene - sparged solvent , which occurred at the same rate as precatalyst initiation with ethyl vinyl ether . adjiman and taylor present a simulation of active catalyst concentration which shows rapid and complete precatalyst dissociation followed by active catalyst decomposition at various rates in each solvent , which is not consistent with experimental observations . for each of the reactions in table 2 , the precatalyst concentration after approximately 2000 s was measured by h nmr integration and compared to the values obtained at the same time point using simulations with rate constants from adjiman and taylor , or using our best fit set of rate constants from table 4 ( figure 5 ) .2000 s in experiments in table 2 ( except data set 13 ) using ( a ) rate constants in table 1 , entry 2 ( ) or ( b ) rate constants in table 4 ( red ) ; the black line represents identity between simulated and measured values ( i.e. , slope = 1 ) . it can be concluded that the rate constants in table 4 represent the behavior of the precatalyst more effectively , but still do not completely account for its behavior in rcm reactions . various values of k1 , k2 and k2 can still be obtained , depending on which data set is fitted , presumably due to the large number of local minima for the fitting method . further changes to the model are required before a wide range of concentrations can be described . attempts were therefore made to fit multiple data sets within a narrower range of concentrations and explore the concentration range over which the approximations and simplifications of the model hold . rate constants were obtained ( through data fitting ) that describe all experiments with 250500 mm 7 ( table 6 , entry 1 ; data sets 1 to 6 in table 2 ) and a second set that describe all experiments with 50120 mm 7 ( table 6 , entry 2 ; data sets 7 to 12 in table 2 ) ; k1 and k3 were fixed in the fitting . rate constants in table 6 describe experiments at ( a ) 500 mm , using entry 1 , and ( b ) 50 mm , using entry 2 , relatively well , even when the precatalyst concentration varies . there are clear differences between the rate constants required to fit the different concentration regimes , with higher k1 and k2 values required to successfully model the lower concentration reactions . the different value of k1 is required due to the incorrect modeling of the 14e species ( methylidene 16 does not capture phosphane reversibly ) and the absence of ethene from the reaction model means that [ ethene ] is effectively embedded in k2 . however , the rate constants successfully fit different precatalyst loadings and substrate concentrations within these ranges and are therefore useful for predicting the effect of changing these parameters , for example , to predict the lowest loading of 1 that will effect complete reaction within a given time frame . the extraction of rate constants for different substrates was the original aim of this project , so attention turned to assessing different substrates in rcm reactions quantitatively from reactions conducted at the same initial diene concentration . concentration / time data for the rcm of 7 ( table 2 , data set 13 ) , heptadiene 11 to form cyclopentene ( in duplicate ) and octadiene 12 ( in duplicate ) in dcm - d2 , all with 10 mm substrate and 0.1 mm 1 , were imported into berkeley madonna and fitted to the simple model in scheme 2 . the values of k1 ( 1.410 s ) and k3 ( zero ) were fixed and the data was fitted with a common k1 , k1 and k3 ( substrate independent rate constants ) but a different k2 and k2 for each substrate . fitting concentration / time data for the rcm reactions of heptadiene ( = data points , solid black line = simulation ; , dashed black line ) , octadiene ( red , solid red line and red , dashed red line ) and diethyl diallylmalonate ( blue , solid blue line ) ; the initial substrate concentration was 10 mm ( 1 mol % 1 ) . the model is therefore useful for deriving quantitative conclusions about the relative rate of rcm of different substrates . interestingly , the rcm of diethyl diallylmalonate appears to occur at half the rate of theparent heptadiene substrate , despite the gem - disubstitution ; this order of reactivity was confirmed by a competition rcm experiment ( 5 mm heptadiene , 5 mm diethyl diallylmalonate , 0.1 mm 1 ) in which the heptadiene cyclized more rapidly ( see the supporting information ) . small scale rcm experiments at up to = 4 m showed that despite the fact that 7 undergoes rcm slower than heptadiene 11 , it is a far more efficient reaction ( higher emt ) and does not produce oligomeric material even when run almost neat . this is in stark contrast to heptadiene which produces oligomeric material even at concentrations as low as 10 m , further highlighting the need for a quantitative understanding of the effects of substrate structure on rcm rate and efficiency ; trends in rcm rate are not always the same as those in rcm efficiency . fitting of a batch of data in chloroform - d ( 11/13 mixtures , each with 0.1 mm 1 : 10/0 , 9/1 , 7.5 / 2.5 , 5/5 , 2.5 / 7.5 , 1/9 , 0/10 ) with k1 fixed ( 4.510 s ) yielded a set of rate constants for heptadiene and octadiene rcm in chloroform - d ( table 8 , entry 1 ) . measured by following the reaction of 2 with ethyl vinyl ether in chloroform at 298 k by uv / vis spectrometry following the experimental procedure in ref ( 18 ) and fixed in the fitting . many studies have been conducted to understand the effects of precatalyst on reaction rate and outcome , so the ability of the model to predict the effect of changing the precatalyst was investigated . precatalyst 2 generates the same active species as 1 after the first turnover , so two competition reactions ( in duplicate in chloroform - d with either 0.1 mm 1 or 0.1 mm 2 , plus 5 mm heptadiene and 5 mm octadiene ) were conducted and the data were imported into berkeley madonna . the four experiments were fitted with common k2 , k2 , k2 and k2 ( forward and backward rates for heptadiene and octadiene respectively , the superscript refers to the product ring size ) with k1 and k1 to model the behavior of 1 and k1 to model the initiation of 2 ; although the initiation of 2 has been shown to proceed via an interchange mechanism , a dissociative mechanism ( the simplest model ) was trialled first to see if a correctly shaped concentration / time plot could be generated . fitting the data ( k3 fixed to zero ) yielded a set of rate constants similar to those obtained for the various chloroform / 1 data ( table 8 , entry 1 ) that approximately described the data from reactions with 1 but more accurately described the octadiene / cyclohexene profiles from reactions with 2 ( table 8 , entry 2 ) . recently , the timing of events involved in the initiation of grubbs - hoveyda second generation precatalyst 2 has been re - evaluated . vorfalt et al . have recently shown that precatalyst initiation is irreversible , in disagreement with the more established boomerangthe way in which the initiation behavior is modeled for 2 may therefore be appropriate ; an interchange mechanism , ( eqs 712 ) was therefore explored .789101112 the model was set up to allow simulation of rcm of binary mixtures of dienes 11 and 13 with 2 , and to see how the model behaved for data obtained with 1 . values of k2 , k2 , k2 , k2 and k1 were allowed to vary ( table 8 , entry 3 ) . the fitting was quite successful for 2 , though less successful for 1 ; the exact shape of concentration / time profile can not be simulated ( figure 8 ) . experimental data points and simulated concentration / time profiles for the rcm reactions of a 5 mm / 5 mm solution of 11 and 13 with either 1 ( red = data points for 14 ; solid red line = simulation of 14 , red = data points for 12 , dashed red line = simulation of 12 ) or 2 ( , solid black line and , dashed black line ) ; diamonds / dashed lines represent 12 and triangles / solid lines represent 14 . it does not appear that the same model can be used for both precatalysts , which may suggest strongly that there are significant mechanistic differences between the processes involving 1 and 2 . nevertheless , these initial successes for the simulation for the interchange mechanism are extremely promising . we have found that the kinetic model published by adjiman and taylor significantly simplifies the canonical mechanism for rcm at some cost . specifically , the treatment of the ruthenium species is not detailed enough , the precatalyst initiation rates obtained in the original paper through data fitting are inconsistent with literature knowledge , the prediction of active catalyst concentration is incorrect , and ethene is not considered at all . consequently the model does not describe even a modest range of substrate concentrations well . however , when constrained with measured initiation rate constants , concentration / time profiles can be simulated accurately , albeit over relatively narrow ( ca .100 to 300 mm ) concentration ranges , and changes in precatalyst loading can be described . pleasingly , from kinetic experiments on different substrates ( at a common concentration , and with a constant k1 / k1 in the fitting ) , relative rates can be extracted , and thus useful quantitative performance comparisons can be made between rcm substrates . unfortunately , it is not possible to use a common model for accurate simulation with precatalysts 1 and 2 , consistent with recent findings on the mechanism of initiation of 2 . these studies show the need for the development of a more robust modeling approach for rcm if kinetic data are to be interpreted successfully and fully . we are currently working on further development and elaboration of these models for applications over wider concentration ranges and with different precatalysts . kinetics experiments were followed by h nmr , either by observation at 400 mhz with a bbfo - z - atma probe or at 600 mhz with a tbi - z probe ( inverse probe ) . glove box conditions were not employed , but the precatalysts and solutions thereof were handled with care under nitrogen . all solutions were prepared in dry volumetric glassware and carefully transferred using dry gastight syringes . dcm - d2 was purchased from goss scientific and chloroform - d from sigma - aldrich ; solvents were dried on activated 4 molecular sieves for at least 24 h before use . the internal standard ( 1,3,5 - trimethoxybenzene ) andprecatalysts 1 and 2 were purchased from sigma - aldrich and used as supplied . for low concentration reactions , the substrate / internal standard solution was used to tune , match , lock and shim the instrument . a small ( ca .5 to 20 l ) volume of a concentrated precatalyst solution was added and the tube was shaken . for higher concentration reactionsthe substrate / internal standard solution and precatalyst solution were prepared , a t0sample was prepared from x l solvent plus ( 500 x ) l substrate / standard solution and this was used to prepare the instrument and acquire the first spectrum . following this , in a separate tube , xl precatalyst solution was added to ( 500 x ) l substrate / standard solution and the tube was shaken . nmr spectra were then acquired periodically until after the rcm reaction had finished ; a d1 setting of 35 s was used ( 5 times the largest t1 measured : 7 s , see supporting information ) .\noutput:\n" }, { "from": "agent", "value": "a published model for revealing solvent effects on the ring - closing metathesis ( rcm ) reaction of diethyl diallylmalonate 7 has been evaluated over a wider range of conditions , to assess its suitability for new applications . unfortunately , the model is too flexible and the published rate constants do not agree with experimental studies in the literature . however , by fixing the values of important rate constants and restricting the concentration ranges studied , useful conclusions can be drawn about the relative rates of rcm of different substrates , precatalyst concentration can be simulated accurately and the effect of precatalyst loading can be anticipated . progress has also been made toward applying the model to precatalyst evaluation , but further modifications to the model are necessary to achieve much broader aims ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: there is a mounting research literature showing a mortality and health disadvantage after spousal bereavement . elevated risks of death after conjugal loss among middle - and old - aged persons were found for all - cause mortality and most major causes of death , such as cancers , cardiovascular diseases ( cvd ) , respiratory diseases , accidents , and violence in finland , uk , and the us . this excess mortality among the bereaved usually occurs within the first six months following the death of a spouse ; however , some studies have suggested that it remains high many years after bereavement . in addition to mortality , the loss of a spouse was found to be associated with higher levels of depressive symptoms , poorer physical and cognitive function , worse self - rated health , and an increased risk of institutionalization in the us , chinese , and finish middle - and old - aged surviving spouses . the adverse effects of spousal loss on health and mortality were independent of socioeconomic and health characteristics . previous research has shown significant sex differences in the widowhood effects : greater adverse effects on mortality and health have been found among widowers . nevertheless , a few studies reported excess all - cause mortality after spousal loss to be very similar in men and women . there is also conflicting evidence regarding sex differences in the effects of bereavement on depressive symptoms and other dimensions of mental health . although the literature on widowhood effects on health and mortality in denmark is limited , available data suggest that , as in the predominantly north american literature , the excess mortality is substantially higher among middle - aged and elderly widowers than among the same - aged widows . a register study among the total danish population aged 50 and over found that the oldest - old widowers had substantially higher suicide risks than the same - aged widows , but the sex differences were less pronounced in the younger age groups . however , another register - based study in denmark among 2560 years old individuals revealed that the relative risk of suicide and risk of death from other causes after conjugal loss was substantially higher in men than in women . a study based on the total danish twin population aged 50 to 70 indicated higher hazard rates after the death of a spouse and co - twin among men than among women , although the timing patterns were similar in both sexes . evidence for sex differences in widowhood effects on cancer incidence and cancer mortality in other scandinavian countries is inconclusive . although cancer incidence changed in the same direction among swedish widowers and widows , the risk of esophageal , lung , and all cancers was higher in men than in women , whereas the risk of pancreatic cancer significantly increased and the risk of melanoma , skin , cancer and non - hodgkin 's disease significantly decreased in women only . first , as most studies have generally demonstrated greater longevity and health benefits for married men than for married women , it has been suggested that conjugal loss may be more stressful for widowers compared with widows . however , it is still unclear why physiological changes underlying reactivity to stressful life events should differ by sex . second , it has been suggested that the adverse effects of widowhood on health and mortality may be due to the loss of social , material , and task support . finally , there has been some investigation of the impact of losing a spouse on health behaviors , such as smoking , alcohol consumption , diet , and interaction with healthcare services . despite growing research on the adverse widowhood effects on health and mortality , existing studies that examined sex differences in lifestyle behaviors and social assistance as explanations for sex differential effect of widowhood on health and mortality had small sample size , short follow - up period , excluded old - aged individuals , had no information on nonrespondents , and were based on cross - sectional data . studies on the changes in health maintaining behavior around the time of widowhood as underlying mechanism for adverse bereavement effect on health and mortality are scarce . the present study aimed to investigate sex differences in short - and longer - term healthcare use following conjugal loss by comparing medication and primary healthcare use before and after a spouse 's death . we hypothesized that after a spouse 's death elderly men will reduce medication use and visits to general practitioners ( gps ) , while women will maintain or increase their healthcare utilization compared to their preloss level . if so , such reduction in medication use and number of gp visits among men may contribute to the explanation of more adverse health outcomes after conjugal loss among men than women . in april 1968 , the civil registration system ( crs ) was introduced in denmark , where each resident is assigned the 10 - digit unique personal identifier , the central personal register ( cpr ) number . the cpr - number was used to link the diverse computerized registers covering the total danish population : danish demographic database ( ddb ) ( demographics , residence , migration , and civil status since 1968 ) , the prescription medicine register ( medicine - related information since 1995 ) , the health insurance register ( information on primary care services since 1997 ) , and the danish twins register ( demographics , residency , zygosity ) . prior studies have proved the register data in denmark to be reliable and valid with no linkage problems among registers . the study is based on the 5 % sample of the total danish population and all danish twins identified through the crs and the danish twin register , respectively . the total twin population was included to increase the sample size of older people , especially men , who became widowed in the period from january 1 , 1996 to january 31 , 2003 . previous research in denmark demonstrated that twins are representative of general populations in terms of health trajectories , psychological function , and all - cause and cardiovascular mortality and , thus , are good population models for epidemiological and demographic research . additionally , the analysis of age - specific death rates in the twin and 5 % population by marital status in 1998 and 2000 showed patterns similar to that in the total danish population ( data not shown ) . all individuals alive and aged at least 60 years by january 1 , 1996 were initially selected . further we selected all individuals who became widowed in the period from january 1 , 1996 to january 31 , 2003 . this observation period was chosen as the prescription medicine register is only available from 1995 onwards , and the updated civil status was available until january 31 , 2003 . furthermore , the analysis of primary healthcare use was restricted to the period from january 1 , 1997 to january 31 , 2003 because the health insurance register only began in 1997 . the prescription medicine register contains detailed anatomical therapeutic chemical classification system ( atc ) codes of prescribed medications and their sublevels , dates of purchase , daily defined dose ( ddd ) , and other drug - related information . the defined daily dose of a medication is based on the accepted average dose per 24 hours for that medicinal product facilitating comparison of consumption across different medications . all - cause medication use was estimated within 1 year before and up to 5 years after spousal death in the average daily defined dose ( ddd ) by dividing the total ddds dispensed for all medications combined within 1 year to 365.25 days . if a surviving spouse died within a follow - up year , the average ddd was calculated by dividing the total ddd dispensed during that follow - up year to the number of days survived . because previous studies showed sex differences in cause - specific medication use , the medication use was also assessed for several major system - specific medications ( the anatomical main group level 1 ) : cardiovascular ( atc - c ) , nervous ( atc - n ) , respiratory ( atc - r ) , and alimentary tract and metabolism ( atc - a ) medications . the use of primary healthcare was assessed as the average number of visits to gps per year within 1 year before and up to 4 years after spouse 's death . similar to the estimation of medication use , the average number of gp visits in the follow - up years was adjusted to the time at risk . additional analyses of all - cause and system - specific medication use before and after widowhood among individuals conditional on their survival to the third and fifth follow - up years were conducted to investigate whether selective dropout due to death has an effect on the trajectories of healthcare use . the age at widowhood was categorized into three groups to avoid small number of users in each age group : 6069 , 7079 , and 80 + years . chi - square tests were used to examine sex differences in the prevalence of medication use and two independent sample t - tests were used to examine sex differences in the average medication use and number of gp visits 1 year before and 1 year after widowhood and the sex gap in the change of healthcare use over the two time points . in total , there were 6421 individuals ( 66.5 % women ) aged at least 60 by january , 1996 and became widowed during the observation period from january 1 , 1996 to january 31 , 2003 . table 1 presents the percentage of men and women taking prescription medications 1 year before and 1 year after widowhood . in general , all - cause and system - specific medication use 1 year before and 1 year after a spouse 's death was more frequent among women than men ( table 1 ) . however , there were almost no gender differences in the prevalence of atc - a medications either one year before or after widowhood ( table 1 ) . table 2 shows the average ddd for atc medications dispensed 1 year before and after widowhood and the mean difference in the average ddd between the two time periods . generally , the highest average ddd was found for atc - c medications , followed by atc - n and atc - r medicines in both men and women . women had higher average ddds for all - cause and atc - n medications compared with men in both the year before and after widowhood . men , generally , had higher average ddds for atc - r medications , although sex differences were not always statistically significant . the sex - specific patterns for atc - c and atc - a medications were less clear ( table 2 ) . as expected , at each cross - sectional time point , the average ddd was higher in older age groups . the average ddd for all - cause and systems - specific atc medications increased from 1 year before to 1 year after widowhood for both men and women ( table 2 ) . the highest increase in average ddd was observed in the atc - c and atc - n medication use , followed by atc - r and atc - a medications . the increase in all - cause , atc - c , and atc - r medication use was slightly higher in men . however , the sex difference was statistically significant in the oldest age group for all - cause ( p - value = 0.02 ) , atc - c ( p - value = 0.04 ) , and atc - a ( p = 0.02 ) medications . further analysis was done to examine whether there was a sex - specific pattern in all - cause and system - specific medication use up to 5 years after conjugal loss . the average ddd for all - cause medications increased between the year before and the third or fourth year following widowhood and remained almost constant or slightly decreased afterwards ( figure 1 ) . similar patterns were indicated for system - specific medication use , although with much smaller variations over time ( figure 2 ) . however , there was no sex - specific pattern in the change of all - cause and systems - specific medication use over 1 year before and up to 5 years after widowhood . among system - specific medications , the most pronounced changes were observed for atc - c agents , except for the 6069 years old age group , followed by atc - n and atc - a medications . the increase in the atc - n medication use seems to be steeper within the first year after widowhood , but the pattern was similar in both sexes and all age groups . the smallest changes over the follow - up period were indicated for atc - r medication use . analogous findings were obtained when the average number of gp visits per year was considered as an indicator of healthcare utilization ( figure 1 ) . women had slightly more gp visits in all age groups compared with men . the average number of visits increased with advancing age , but these changes were similar in men and women . similar patterns were indicated when the median number of gp visits was considered . to investigatewhether selective dropout due to death has an effect on the trajectories of healthcare use , we analyzed all - cause and system - specific medication use and number of gp visits before and after widowhood among individuals conditional on their survival to the third and fifth follow - up years . the trajectories for all - cause ( figure 3 ) and system - specific medication use remained unchanged when the analysis was restricted to three - and five - year survivors after spousal loss . also , these results remained unaltered when the change in medication use 1 year before and after widowhood was evaluated among users only or when medication use was estimated for several therapeutic subgroups ( e.g. , psycholeptics , psychoanaleptics , cardiac therapy , diuretics , beta blocking agents , calcium channels blockers , and agents acting on rennin - angiotensin system ) ( data available on request ) . the present study aimed at comparing medication and primary healthcare use around the time of widowhood among men versus same - aged women . it showed that all - cause and major medication use , as well as primary healthcare use , increased shortly after conjugal loss , as well as in the 3 - 4 years following spousal bereavement , and remained constant or slightly decreased thereafter . the trajectories of all - cause and system - specific medication use and the annual number of gp visits over the period from 1 year before and up to 5 years after conjugal loss were similar in men and women . therefore , we found little support for the hypothesis that widowers reduce medication use or visits to gps , while widows utilize healthcare services to a degree similar to that of a preloss level . the increasing number of gp visits and all - cause and system - specific medication use is likely to reflect the effect of age on the healthcare use rather than the effect of spousal loss . compared to the growing research on widowhood - mortality association , the number of studies that investigated the underlying mechanisms responsible for poor outcomes following the death of a spouse , and , in particular , the reasons why widowers fare worse than widows is less extensive . thompson and colleagues revealed that although within 2 - month period bereaved persons aged 5583 years had increased medication use , more severe illness , and worse perceived general health , the number of physician visits and hospitalizations was similar in bereaved and nonbereaved groups . the authors found no sex differences in the increased risk of medication use , although women were more likely to report new and / or deteriorated health compared with men regardless of marital status . another us study found that old - aged widowed persons with traumatic grief were less likely to use all types of healthcare services within 2 months after spouse 's death compared with the bereaved subjects without traumatic grief . williams found that widowhood increased the risk of having unhealthy lifestyle behavior , developing a serious illness , and reporting worse general health only among those widowed persons who had a substantial decline in the frequency of health reminders . transition to widowhood was found to increase the first - time use of domiciliary care services among 70 years and over participants of the british household panel survey . however , no sex differences in the change of healthcare use associated with widowhood were reported in most studies . a recent study among medicare beneficiaries showed substantial drop in obtaining preventive services , such as diabetic monitoring , cancer screening , and vaccination , but considerable increase in the rates of preventable hospitalization and early readmissions . like in our study , there were little gender differences in obtaining preventive services , although widowed men had substantially higher rates of preventable hospitalizations and early readmissions than widows and no long - term detrimental effects of spousal loss on individual abilities to obtain preventive healthcare services were indicated . the present study adds to the previous research evidence in denmark and other nordic countries showing that all - cause and system - specific medication use was more frequent and the average daily dose for all - cause and nervous system medications was higher among women compared with same - aged men . the average daily use of respiratory medications was slightly higher among men , whereas no sex - specific pattern was observed for atc - c medication use . a major strength of this study is the size , representativeness , and completeness of the danish register data and its longitudinal nature that enabled us to examine sex differences in medication and primary healthcare use over a longer follow - up period after the event . because the data on medication and primary healthcare use were obtained for all individuals from the 5 % population sample and the twin population aged 60 + by january 1 , 1996 and who became widowed in the period from 1996 to 2003 , there was no room for selection bias due to nonparticipation or loss to follow - up inherent in longitudinal surveys . the present study had a sufficiently large sample size and , thus , good power to detect sex - specific pattern in health behaviors before and after spousal bereavement . the analysis of medication use and number of gp visits over the follow - up years reflects both the effect of age on the health care utilization and the effect of conjugal bereavement . however , it is unlikely to bias the analysis of male - female differences in healthcare utilization before and after spouse 's death . clearly , our findings may be country - specific and may not be generalizable to other settings . it has been found that sweden and denmark have greater gender equality in the division of household labor compared with greece or spain . possibly , men in northern eu countries depend less on their wives for regulating health behaviors than in the more traditional southern eu . further research should attempt to replicate this study in other populations where register data are available . this study shows no sex difference in the trajectories of medication and primary healthcare use within 1 year before and up to 4 years after spouse 's death . therefore , this danish study found no support for the hypothesis that reduced medication and primary healthcare use contribute to the explanation of more adverse health outcomes after conjugal loss in men compared with women in denmark .\noutput:\n" }, { "from": "agent", "value": "background . the study aimed to examine sex differences in healthcare use before and after widowhood to investigate whether reduced healthcare use among widowers compared with widows may partially explain excess mortality and more adverse health outcomes among men than women after spousal loss . methods . all individuals alive and aged at least 60 years in 1996 and who became widowed in the period from 1996 to 2003 were selected from the 5 % sample of the total danish population and all danish twins . the healthcare use was assessed as the average daily all - cause and major system - specific medication use and the average annual number of visits to general physicians ( gps ) . results . the average daily use of all - cause and major system - specific medications , as well as the number of gp visits increased over the period from 1 year before and up to 5 years after a spouse 's death , but there were no sex - specific patterns in the trajectories of medication use and number of gp visits after conjugal loss . conclusion . we found little support for the hypothesis that reduced healthcare use contributes to the explanation of more adverse health outcomes after conjugal loss in men compared with women in denmark ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: every patient with acute respiratory distress syndrome ( ards ) is hypoxemic by definition . in these patients , mechanical ventilation ( mv ) is often life - saving . repetitive cyclic stretch however , results in regional overdistension or / and derecruitment which is associated with a number of severe complications termed ventilator - induced / associated lung injury ( vi / ali ) . the attributable mortality of vi / ali has been estimated to be at least 9 % , and despite evidence that high concentrations of oxygen ( fractional inhaled concentrations of oxygen [ fio2 ] greater than 50 % ) , can lead to hyperoxic acute lung injury ( hali ) , oxygen therapy remains a cornerstone of management . little is known about \" permissive hypoxemia \" and for the most part , clinicians will optimize positive end expiratory pressure ( peep ) to enable reductions in fio2 , accepting oxygen saturations in the mid to high 80 's . in the first three icu days , most ards patients are ventilated with average fio259 % ( mean fio2 delivered on day 1 = 70 % ) , but it is not uncommon for the most severely ill to require much higher fio2 concentrations ( 100 % ) for prolonged periods or frequent intervals . in a previous issue of critical care , li and colleagues elucidate the potential mechanisms regulating interactions between injury cascades resulting from hyperoxia and high tidal volume ventilation . using gene - deficient models and specific inhibitors of intracellular signaling pathways , this author group demonstrate that the combination of hyperoxia and high tidal volume ventilation results in augmented lung injury , evidenced by indices of increased lung inflammation , microvascular permeability , and lung epithelial apoptotic cell death . the combined detrimental effect of oxygen and repetitive cyclic stretch was shown to result in the activation of specific intracellular signaling pathways . the paper by li and colleagues is part of a growing body of literature suggesting that the response of the mechanically ventilated lung to biochemical or biomolecular stimuli is profoundly altered by the coexistence of injurious stimuli that synergize at the cellular level as well as at the tissue level . more importantly , the findings suggest that interference or cooperation of signals may have critical physiological consequences such as activation of death pathways . studies on various model systems have shown that a relatively small number of transcription factors can set up strikingly complex spatial and temporal patterns of gene expression . this pattern creation is achieved mainly by means of combinatorial or differential gene regulation ; that is , regulation of a gene by two or more transcription factors simultaneously or under different conditions . li and colleagues offer insight into the specific molecular details of the mechanisms of combinatorial regulation of hyperoxia and high tidal volume . in their model , mitogen - activated protein kinase erk1 / 2 , c - jun nh2 - terminal kinases , and downstream binding of the transcription factor ap - 1 were responsible for orchestrating the molecular response and cellular physiological consequence of hali plus vi / ali whilst lung stretch alone is dependent on activation of the jnk pathway , high volume plus hyperoxia mediated its detrimental effect via jnk and erk 1/2 activation . despite a historical emphasis on nf - b - dependent inflammation - related genes as mediators of injury , li and colleagues ' paper suggests that the augmented response seen when high volume and hyperoxia coexist appears to be nf - b independent . the molecular implication from their paper is that individual stimuli exert intracellular effects via independent signaling pathways that may converge or diverge at specific molecular ' nodes ' or ' hubs ' critical control points and potential targets for therapy . moreover , molecules that were previously perceived as reflecting redundancy in the response represent a sophisticated system that probably depends on the ' message ' carried rather than the messenger . the clinical implications of deciphering injury specific intra - cellular signaling is that it provides novel insight into the potential for future molecular treatment of injury - specific stimuli . exposure to hyperoxia is a well - established model of lung injury characterized by the development of pulmonary edema and inflammation . the development of hyperoxic lung injury was until recently thought to require the generation of reactive oxygen species , which leads to alveolar epithelial and endothelial cell death by both apoptosis and necrosis . disturbance of cell - death pathways , either local ( pulmonary ) or distal ( kidney and intestines ) , has also been implicated in the pathogenesis of vi / ali and ensuing mof , and this disturbance is a key feature of the alveolar remodeling process during recovery from injury . in contrast to the literature on vi / ali , where increased expression of cytokines and chemokines has been thought to be related to increase epithelial cell apoptosis , in studies of hali , overexpression of cytokines or chemokines ( for example , tnf - , il - 1 , il - 6 , cxc - chemokine receptor 2 , and il - 11 ) , growth factors ( for example , insulin growth factor and keratinocyte growth factor [ kgf ] ) , or the subunit of the na , k - atpase have been shown to protect animals from hyperoxia by attenuating death signals . moreover , this effect appears to be independent of potential antioxidant effects , since antioxidants by themselves do not reverse or prevent all of the manifestations of hali and since the ability of certain cytokines to inhibit hyperoxia - induced cell death is independent of major alterations in lung antioxidants . this evidence raises crucial questions about how different injury signal components are integrated ; what are the morbidity and mortality defining manifestations of vi / ali and / or hali and which , where and when should \" outcome - defining \" pathways be blocked . fio2 = fractional inhaled concentration of oxygen ; hali = hyperoxic acute lung injury ; il = interleukin ; nf = nuclear factor ; tnf = tumor necrosis factor ; vi / ali = ventilator - induced / associated lung injury .\noutput:\n" }, { "from": "agent", "value": "in patients with acute respiratory distress syndrome ( ards ) , supportive therapy with mechanical ventilation and oxygen is often life saving . further acute lung injury however , is an unfortunate consequence of oxygen therapy as well as mechanical injury secondary to ventilator induced / associated lung injury ( vi / ali ) . in this issue of critical care , li et al . expand on the intra - cellular signaling pathways regulating interactions between injury cascades resulting from hyperoxia and high tidal volume ventilation . the findings , suggest that interference or cooperation of different signals may have critical consequences as evidenced by indices of increased lung inflammation , microvascular permeability , and lung epithelial apoptotic cell death ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this paper describes the clinical diagnosis of proteus syndrome ( ps ) in children referred for evaluation of asymmetric disproportionate overgrowth . retrospective , descriptive , cross - sectional study conducted from january 1998 to december 2010 . thirteen ( 0.65 % ) patients presented features suggestive of ps . these patients were formally evaluated based on the revised diagnostic criteria proposed by biesecker . other dysmorphic features were as follows : macrodactily ( 84.6 % ) ; linear epidermal nevus ( 41.6 % ) ; hemangioma ( 30.7 % ) ; and lipoma ( 23 % ) . the diagnostic rate of only 46.1 % of patients with ps confirms the diagnostic difficulties and the need for continuous monitoring and periodic review of these patients since the clinical manifestations of this syndrome become more evident with aging . molecular tests may help the differential diagnosis of proteus syndrome when they became commercially available . , rudolf wiedemann , a german pediatrician , named it proteus syndrome for a greek sea - god , who could change his shape at will assuming many forms to escape capture . this name was given to represent the variable clinical manifestations seen in the first patients identified with this syndrome and the morphological changes of its presentation and evolution . it is a hamartomatous syndrome , with clinical manifestations that vary greatly and predominance of malformations and overgrowth of multiple organs . it is an extremely rare syndrome with an estimated prevalence of approximately 1:1.000.000 , being more common among males at a ratio of 1:9:1 . this disease is characterized by a mosaic distribution , sporadic occurrence , and progressive course , hyperplasia of connective tissue , vascular malformations , epidermal nevus , and hyperostosis . clinical features may be present at birth but typically develop over time , starting between 1 and 18 months of age . bone , connective tissue , fat , central nervous system , eye , spleen , thymus , and colon are commonly involved tissues . ps is probably caused by a post - zygotic mutation resulting in mosaicism , which possibly explains the variability of manifestations and the monozygotic twins discordant for the syndrome . the association of ps with mutations in the pten suppressor gene is uncertain , being reported by zhou et al . and by smith et al . nevertheless , barker et al . andthiffault et al . did not find mutations in the pten gene among the patients with ps included in their studies . although there are reports of these mutations in ps , they are usually absent in the affected individuals . a recent study , with 29 ps patients , revealed that an activating somatic mutation of the akt1 oncogene kinase , an enzyme involved in cell proliferation , was present in 26 of these patients concluding that this mutation was the cause of ps . the rarity of the syndrome , the wide spectrum of presentation , the lack of an easily available diagnostic test , and the occurrence of syndromes with similar phenotypes contribute to the diagnostic challenge . due to the lack of commercially available genetic tests , knowledge of the multiple presentations and evolution of psalthough the use of diagnostic criteria has its flaws , the benefit of its use is justified because it classifies and defines , through specific criteria , a group of individuals who have similar clinical and prognostic features . given the present difficulty in diagnosing ps , this study describes a series of patients with such diagnosis , using the criteria proposed by biesecker et al . between january 1998 and december 2010 , 2011 new patients were seen at the genetics and pediatric endocrinology outpatient clinics of a university hospital . the records of all cases referred due to asymmetric overgrowth and clinical suspicion of proteus syndrome were identified and retrospectively analyzed a retrospective chart review . thirteen patients of the total number of patients seen in the study period ( 0.65 % ) had features compatible with the syndrome . the general criteria are mandatory and include mosaic distribution , sporadic occurrence , and progressive course . the specific criteria are classified into three subgroups named a , b , and c. one feature of subgroup a or two features of b , or else three features of c must be present to confirm the diagnosis [ table 1 ] . revised diagnostic criteria for proteus syndromeas the study involved review of medical records , patient informed consent was not required , with preservation of the confidentiality of data . this study included 13 patients with an initial diagnostic suggestive of ps that is asymmetric overgrowth . only when evaluated by the biesecker specific criteria , the distinction between ps and non - ps was possible . all patients had asymmetric overgrowth , 11 : macrodactily ( 84.6 % ) , 5 : epidermal nevus ( 41.6 % ) , 4 : hemangioma ( 30.7 % ) , 3 : lipoma ( 23 % ) , 5 : linear epidermal nevus ( 41.6 % ) and 3 : connective tissue nevus ( 23 % ) [ table 2 ] . of these 13 patients , the clinical diagnosis of ps was confirmed in 6 ( 46.1 % ) : 6 ( 100 % ) patients fulfilled criteria 2 b , 3 ( 50 % ) patients fulfilled criteria 1a , and none of them fulfilled criteria 3c [ table 2 ] . clinical findings in patients with a possible diagnosis of proteus syndrome in the group where ps was not confirmed ( 53.8 % ) : none of the patients met criteria 1a , all patients met criteria 1b ( 100 % ) , and 2 met criteria 1 c ( 28.5 % ) . linear epidermal nevus was present in all patients with a confirmed diagnosis of ps , whereas none of the patients in whom the diagnosis of ps was not confirmed had this clinical feature [ table 2 ] . the rarity of ps may be underestimated in some series , such as ours , due to young age of the patients and may be overestimated , in others series , due to the lack of stringent diagnostic criteria including other hamartomatous or hyperplastic disorders . in this study , due to the young age of the children ( 6.925.1 years ) , it is possible that greater number of cases of ps may be diagnosed in the future due to the progressive nature of the syndrome . in 1999 , biesecker et al . presented their recommendations for the diagnosis of ps in an attempt to reduce the number of false clinical diagnoses of the syndrome . since then , this is the criteria most frequently used in clinical practice for the diagnosis of ps . the linear epidermal nevus was present in all six patients who met the diagnostic criteria for ps . this abnormality is described in the literature as a specific finding though it has not been found in all cases according to turner et al . demonstrated that , in ps , this lesion tends to develop during childhood , affecting most commonly the sole of the feet , extending over the affected area or developing new lesions , and with a tendency to maintaining stable in adulthood . in addition to the difficulty in confirming the diagnosis of ps , it is important to stress that there are also unusual features such as the presence of lung cyst . this finding was observed in only one case reported in this study ( case 7 ) , whereas its prevalence , according to the literature , is approximately of 10 % . other important findings of ps include central nervous system manifestations ( 40 % ) , mental ( 30 % ) , ophthalmological disabilities ( 42 % ) , and urological abnormalities ( 9 % ) . the differential diagnosis of ps must be made with other hamartomatous disorders such as klippel - trenaunay - weber ( asymmetry in one limb and hemangioma ) , maffucci disease ( enchondromatosis and hemangioma ) , ollier 's disease ( enchondromatosis ) , neurofibromatosis type i ( macrocephaly , caf - au - lait spots , subcutaneous neurofibromas ) , bannayan - zonana syndrome ( macrocephaly , craniofacial abnormalities ) , hemihyperplasia and multiple lipomatosis syndrome ( hhml ) and other disorders that present with hemihyperplasia . the seven patients in this study who did not meet diagnostic criteria for ps did not fulfill criteria to be diagnosed with any of these disorders . the risk of tumor development appears to be higher in patients with ps than in the general population , so they should be assessed on a regular basis . most tumors associated with ps are benign ( e.g. , monomorphic adenomas , bilateral ovarian cystadenomas ) , but 19 % are malignant . although some authors believe that the progression of ps stops around 15 - 17 years , one reported case included a 23 - year - old man . patients are at increased risk of premature death , usually caused by deep vein thrombosis , pulmonary embolism , and pneumonia . premature death is more common among males ( 3.25:1 ) particularly boys aged less than 10 years . bone abnormalities and its accompanying asymmetries must be treated to preserve the functionality of the affected limb . although our paper has the limitation of being a retrospective study , the biesecker diagnostic criteria were applied consistently trough information obtained in structured medical charts . ps was diagnosed in 6 of 13 ( 41 % ) patients evaluated with this diagnostic suspicion and in 6 of 2011 patients ( 0.3 % ) seen in the study period . these data confirms the rarity of ps and the highlights the importance of studies validating the clinical diagnosis even when of retrospective nature . since molecular diagnosis of pswere just recently reported and are not yet commercially available , the authors emphasize the importance of using strict clinical diagnostic criteria . with the establishment of clinical diagnosis\noutput:\n" }, { "from": "agent", "value": "objectives : this paper describes the clinical diagnosis of proteus syndrome ( ps ) in children referred for evaluation of asymmetric disproportionate overgrowth.materials and methods : retrospective , descriptive , cross - sectional study conducted from january 1998 to december 2010 . results : during the study period , 2011 new patients were evaluated . thirteen ( 0.65 % ) patients presented features suggestive of ps . these patients were formally evaluated based on the revised diagnostic criteria proposed by biesecker . the mean age was 6.92 5.1 years . ten patients ( 76.9 % ) were females . all subjects had asymmetric disproportionate overgrowth . other dysmorphic features were as follows : macrodactily ( 84.6 % ) ; linear epidermal nevus ( 41.6 % ) ; hemangioma ( 30.7 % ) ; and lipoma ( 23 % ) . six patients fulfilled the diagnostic criteria for ps.conclusions : the diagnostic rate of only 46.1 % of patients with ps confirms the diagnostic difficulties and the need for continuous monitoring and periodic review of these patients since the clinical manifestations of this syndrome become more evident with aging . molecular tests may help the differential diagnosis of proteus syndrome when they became commercially available ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: compulsive gambling has been reported with treatment of parkinson 's disease but not with epilepsy . a 46 - year - old female , diagnosed with idiopathic generalized epilepsy at the age of 18 , was first seen in the clinic in 2000 , when she had nonconvulsive status epilepticus . she had trialed carbamazepine , valproate ( vpa ) , topiramate , gabapentin ( gpt ) , and lamotrigine ( ltg ) , prior to attending the clinic , to which had been added clobazam without seizure control . levetiracetam ( lev ) was introduced in 2001 , at which time she was on vpa and gpt . lamotrigine was reintroduced in 2006 , and both gpt and vpa were stopped in 2009 when her seizure activity was better controlled . she was known to have a tendency toward excessive behavior ( shopping , drinking , and exercising ) but this predated her epilepsy . he attempted suicide and was hospitalized , but there was no other premorbid psychiatric history within the family , and the patient was never diagnosed with a mental illness . following the reintroduction of ltg , she initially lost $ 4000 $ 5000 in gambling , which she could repay . she had , up to this time , successfully concealed her gambling , but with increased dosage of ltg she lost $ 50,000 of her family 's assets , thereby provoking serious consequences . at the time of discovery ( blood level : 31 mg / l , therapeutic ) and ltg 200 mg i mane and ii nocte ( blood level : 53.6 gsk ( glaxo smith kline ) and ucb ( united chemical belgium ) were contacted , and gsk reported intrusive repetitive behavior ( similar to punding ) associated with ltg but that there had been no reports of excessive gambling . ucb reported that lev is associated with depression and other emotional issues , but there are no known cases of gambling with lev . evidence of an association between lev and a genetic variation in dopaminergic activity and hence the risk for psychiatric complications has been previously reported . as it is presumed to be the dopaminergic effect of dopamine agonists that provoke the compulsive gambling in parkinson 's disease , this may offer a plausible explanation in this case . dopaminergic medications , in the form of madopar ( l - dopa combined with benserazide ) , have been trialed in 3 patients with intractable epilepsy , resulting in seizure reduction in 2 patients , thereby suggesting possible reinforcement of the hypothesis of a dopaminergic mechanism of seizure control in idiopathic generalized epilepsy , . there have been other reports of obsessive behavior with lev that dissipated upon stopping lev , which also indicates it to be a potential provocateur in this case . lamotrigine has also been associated with obsessive symptoms , which appeared dose - dependent in one case . in that case , it was hypothesized that ltg inhibited the presynaptic release of glutamate with altered striatal dopamine uptake , which again is relevant to the reputed cause of gambling associated with parkinson 's disease and dopaminergic therapy . others have also noted the emergence of obsessional behavior in association with ltg and questioned glutamatergic regulation . the hypothesis is that ltg may directly stimulate the postsynaptic striatal d2 and d1 dopamine receptors or indirectly release dopamine from the nigostriatal dopamine neurons . these reports , when seen in the context of this patient , raise serious concerns that this patient 's gambling behavior may well be aem - provoked and could be due to either the ltg or the lev or the combination of both . the emergence of compulsive gambling in parkinson 's disease is a relatively newly recognized phenomenon and has become a major focus of patient monitoring . this patient initially concealed her gambling , and without such behavior being recognized as a possible adverse event of aems , it might have remained ( and may remain ) unexplained . to our knowledge , this case represents the first report of possible compulsive gambling associated with the use of aems , either ltg or lev or their combination . it highlights a potential adverse effect of aems that may be more widespread if actively sought as this patient was able to initially conceal it until the problem became unmanageable . this research received no specific grant from any funding agency in the public , commercial , or not - for - profit sectors .\noutput:\n" }, { "from": "agent", "value": "compulsive gambling is recognized with parkinson 's disease treatment with dopamine agonists but has not been reported with antiepileptic medications ( aems ) in epilepsy . this is the first report regarding possible compulsive gambling , provoked by aems in a patient with idiopathic generalized epilepsy , who presented with nonconvulsive status epilepticus , having previously not achieved seizure control with carbamazepine , valproate , ( vpa ) , topiramate , gabapentin ( gpt ) , lamotrigine ( ltg ) , and clobazam . levetiracetam ( lev ) was added to vpa and gpt , which the patient was already taking and ltg subsequently retrialed . following the reintroduction of ltg , she lost $ 40005000 , which she concealed . with better seizure control , vpa and gpt were withdrawn , leaving her on lev and ltg . with increased ltg dosage , she lost $ 50,000 , prompting discovery of her gambling ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bevacizumab is thought to normalize tumor vasculature and restore the blood - brain barrier , decreasing contrast enhancement and peritumoral edema . antiangiogenic treatment targeting the vegf pathway using bevacizumab causes a rapid decrease in t1 contrast - enhancing tumor parts , with high radiographic response rates ranging between 3060 % . however , in one third of all patients , glioblastomas are more prone to progress as nonenhancing tumor after bevacizumab treatment . recently defined rano ( response assessment in neuro - oncology ) criteria for glioma progression recommend fluid - attenuated inversion recovery ( flair ) / t2 hyperintensity on mri as a surrogate for nonenhancing tumor ; however , nonenhancing tumor can be difficult to differentiate from other causes of flair / t2 hyperintensity ( e.g. , radiation - induced gliosis , peritumoral edema ) . positron emission tomography using the radiolabeled amino acid o - ( 2 - [ f ] fluoroethyl ) - l - tyrosine ( f - fet pet ) may offer an improvement of the detection oftrue , i.e. , metabolically active tumor extent of high - grade glioma over and above the information provided by contrast enhancement and flair hyperintensity on mri alone . a 58 - year - old patient suffered from aphasia and agitation 4 weeks prior to admission . initial mri revealed a contrast - enhancing , tumor - suspicious lesion in the left temporal lobe , and a biopsy was performed stereotactically . molecular analysis of prognostic factors revealed that the o6 - methylguanine methyltransferase promoter ( mgmt ) was not methylated and isocitrate dehydrogenases 1 and 2 ( idh1 / idh2 ) were not mutated . in order to achieve a macroscopically complete tumor resection , a fluorescence - guided resection using 5 - aminolevulinic acid ( 5 - ala ) after surgery , fractionated external radiation therapy was initiated . within 2 weeks after tumor resection , after stratification for molecular markers , the patient was treated with concomitant radiotherapy up to a dosage of 60 gy , and afterwards with adjuvant bevacizumab every 2 weeks over 8 months . due to a severe allergic reaction , the combination therapy with irinotecan had to be discontinued after the first application . during bevacizumab treatment , clinical controls and follow - up mris in 8 - after 8 months of single bevacizumab therapy , hemiparesis of the right side and deterioration of the aphasia occurred .1 b , encircled within black lines ) is significantly larger , suggesting signs of nonenhancing tumor progression during bevacizumab treatment . to further evaluate the mri results , f - fet pet ( fig . metabolically active tumor volume of f - fet pet uptake at a threshold = 1.6 and volume of the hyperintense flair signal were calculated ( fig .1 d , encircled within white lines ; e ) show that the volume of the flair hyperintensity is considerably larger than the metabolically active tumor volume .1 f ) , the volume of the flair hyperintensity ( grey ) shows no correspondence in size and spatial configuration to the f - fet pet metabolically active tumor volume . moreover , in comparison to the flair hyperintensity , f - fet uptake at a threshold = 1.6 ( red ) reveals additional subareas of metabolically active tumor ( fig .1 f ) in transaxial , coronal , and sagittal orientation . for treatment of tumor recurrence , chemotherapy with dose - intensified temozolomideclinically , chemotherapy response could not be observed ; during follow - up an exacerbation of the aphasia and hemiparesis occurred . due to a severe impairment of the patient 's clinical condition , palliative care was initiated 3 months after tumor recurrence . the differences in mri and f - fet pet might be explained by a complex morphologic heterogeneity of glioblastoma , leading to difficult interpretation of standard mri sequences . there are highly malignant tumor parts with and without contrast enhancement , and , furthermore , t2 - based signal hyperintensity is a combination of infiltrating tumor cells , necrotic areas , tumor edema , and treatment - related leukoencephalopathy , e.g. , due to radiotherapy . in contrast , f - fet pet shows metabolically active tumor independent of any anatomic or pathophysiologic changes and may therefore reflect tumor extension more accurately than mri . in this context , localization of the f - fet pet metabolically active tumor does not always match the pathological findings seen on mris . for example , in a small group of patients with recurrent high - grade glioma treated with bevacizumab and irinotecan , which partially responded according to rano criteria without response based on f - fet pet imaging findings , tumor progression could be detected earlier by f - fet pet . in summary , during bevacizumab treatment , f - fet pet in addition to contrast - enhanced and flair - / t2 - weighted mri might add important information for assessment of tumor recurrence , as compared with standard mri alone .\noutput:\n" }, { "from": "agent", "value": "antiangiogenic treatment using bevacizumab may cause difficulties in distinguishing between antivascular and true antitumor effects when using mri response criteria based on changes of contrast enhancement ( i.e. , macdonald criteria ) . furthermore , more precise tumor response assessment criteria ( i.e. , rano criteria ) , which incorporate nonenhancing t2 / flair sequences into macdonald criteria , may be influenced by other causes of t2 / flair hyperintensity ( e.g. , radiation - induced gliosis ) . the authors present discrepant mr and [ 18f ] fluoroethyl - l - tyrosine pet imaging findings in a patient with bevacizumab treatment failure ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: vertebral compression fracture ( vcf ) is a common injury in the elderly with an incidence of 700,000 per year in the united states alone .1 conservative treatment of painful vcfs has only modest short - term effectiveness and is associated with poor long - term outcomes .2 percutaneous balloon kyphoplasty ( bk ) is widely used to treat vcfs and has demonstrated clinically meaningful symptom improvement in most , but not all , studies .3 however , the effectiveness of bk is , in part , dependent on the handling characteristics , delivery methods , and curing properties of the injected polymethylmethacrylate ( pmma ) bone cement used to reduce and stabilize the fracture construct .47 adverse events related to pmma use are infrequent , but may be due to thermal necrosis , volumetric pmma shrinkage , and increased stiffness of the composite compared to normal bone .49 percutaneous introduction of low - viscosity pmma into the vertebral body , as with the traditional bk procedure , may not fully support the initial fracture reduction .8,9 vertebral expansion , cavity creation , and height restoration utilizing a bk balloon tamp crushes peripheral noninvolved intravertebral trabecular matrices prior to pmma filling , and may place the treated vertebra at risk for structural damage and refracture .810 while tamping of the crushed trabecular structures may prevent pmma extravasation ,11 it may have the untoward effect of hindering pmma interdigitation , creating a zone of necrotic bone surrounding the injected bone cement bolus .12 subsequent resorption of necrotic bone may cause pmma loosening , pmma mobility , adverse intravertebral stress , and an increased risk of fracture across the remaining trabecular bone .13 radiofrequency - targeted vertebral augmentation ( rf - tva ) is a percutaneous vertebral augmentation technique that was developed to address some of the limitations of bk . this technique involves the use of a navigational osteotome to create a targeted intravertebral cavity , thereby preserving the noninvolved and structurally sound native vertebral body trabeculae , followed by introduction of an ultrahigh - viscosity pmma with extended working time due to concurrent rf heating . continuous controlled distribution of ultrahigh - viscosity pmma increases the ability to stabilize the fracture and , subsequently , to mechanically interlock the pmma with the intact trabeculae . with further delivery under fluoroscopy , controlled vertebral height restorationcan be achieved .1416 the purpose of this ex vivo biomechanical pilot study was to compare rf - tva to traditional bk for restoration of vertebral height , cavity creation , and pmma delivery and interdigitation into the surrounding trabeculae . a cadaveric model protocol to approximate the vertebral body tissue encountered with in vivo conditions was used . fresh frozen human vertebral specimens were maintained at 20c until approximately 24 hours prior to testing . sixteen vertebral specimens ( eight per treatment group ) from six human spine specimens ( t9t12 ) were thawed to room temperature and all residual soft tissue was removed via careful manual dissection . all specimens were confirmed as osteoporotic , defined as a t - score less than 2.5 compared to age - matched norms . vertebral bodies were prepared by transecting the pedicles and removing all disc material from the endplates . the caudal and cephalad surfaces of each vertebral body were rigidly embedded in a urethane potting compound ( smooth - on , inc , easton , pa ) and each composite was positioned with the centroid located in the middle of the potting fixture . prepared vertebral bodies were mounted in individual custom semiconstrained fixtures and rigidly attached to a servohydraulic load frame ( 8521s ; instron , norwood , ma ) in order to create consistent vcfs . all specimens were tested in air and preconditioned for ten cycles loaded between 500 n and 200 n of compression at a test frequency of 1 hz . immediately following preconditioning , loads were applied at a displacement rate of 5 mm / minute with a data acquisition rate of 20 hz . monotonic testing was performed until the anterior height of the vertebral body was reduced by 30 % compared to the measured baseline height ( figure 1 ) . each procedure was performed in four vertebrae under a 150 n follower load and in four vertebrae under no load . a follower load was used to increase the clinical relevance of this model by applying a load to the vertebral body physiologically representative of a patient in the supine position .17 the follower load testing technique applies a compressive load along the path that approximates the tangent of the lumbar spine curvature and models resistance ( due to fracture consolidation that occurs within the early weeks postfracture ) that the force applied by the augmentation procedure to restore height must overcome . all procedures were performed using fluoroscopic guidance by the same fellowship - trained neurosurgeon with extensive experience in the performance of rf - tva and bk for treatment of vcfs . rf - tva was performed via a unipedicular approach with site - specific cavity creation followed by remotely controlled delivery of ultrahigh - viscosity cement ( stabilit er bone cement ; dfine , inc , san jose , ca ) using the stabilit vertebral augmentation system ( dfine ) ( figure 2 ) . after placement of a working cannula , an initial cavity was created by inserting a straight coring osteotome ( vertecor straightline osteotome ; dfine ) that permits biopsy . a navigational osteotome ( vertecor midline osteotome ; dfine ) was then inserted through the working cannula . the midline osteotome was navigated through the vertebral body by rotating the handle to articulate the distal beveled tip as the osteotome was advanced through the vertebral body to the anterior third and across the midline in a controlled fashion . the midline osteotome was then reoriented and additional passes made to create site - specific cavities ( figure 3 ) . this resulted in well - defined cavities with minimal disruption of adjacent trabeculae that served as preferential paths for cement delivery . the pmma , which has an extended working time compared to standard pmma , was then converted to an ultrahigh - viscosity pmma as it passed through the activation element ( where it was heated by application of radiofrequency ) immediately prior to entering the delivery cannula . the ultrahigh - viscosity pmma was delivered at a continuous rate of 1.3 cc / minute using a remote - controlled automated hydraulic delivery system . intermittently during pmma delivery , intravertebral filling was fluoroscopically monitored and terminated when the treating physician deemed that the fill was adequate . bipedicular bk was performed using standard techniques described previously ( kyphx osteo introducer system ; medtronic , inc , minneapolis , mn ) and included insertion of an inflatable bone tamp ( kyphx xpander inflatable bone tamp ; medtronic ) , balloon inflation for vertebral cavity creation , height restoration , and filling with pmma ( kyphx hv - r high - viscosity radiopaque bone cement ; medtronic ) .18 prior to preconditioning and immediately following the monotonic loading test , radiographs were acquired on all specimens for vertebral body height comparisons . following cavity creation and prior to cement delivery , two vertebrae in each treatment groupwere scanned using computed tomography ( slice thickness 0.625 mm ; lightspeed16 ; ge healthcare , little chalfont , united kingdom ) to evaluate location and shape of the cavity as well as adjacent trabecular morphology . following cement delivery , radiographic and computed tomography images were acquired and vertebral height was measured prior to serial sectioning . anterior vertebral height was measured using the technique described by mckiernan et al. 19 vertebral height was defined as the distance between points on the most anterior aspects of the superior endplate and the inferior endplate . all prefracture , postfracture , and postvertebral augmentation images for each vertebra were read by five independent reviewers with the average of the readings used for data analysis . height restored ( anterior measure posttreatment minus post fracture ) and height loss ( anterior measure intact vertebra minus postfracture ) were used to calculate percent height restoration ( height restored / height loss 100 ) . following sectioning , poor pmma interdigitation was identified by a solid pmma mass due to pmma lumping without interspersion . dissolution of pmma was performed by soaking the sectioned specimens in acetone prior to examination of the remaining trabecular structures . data were reported as mean standard deviation or median ( interquartile range ) , depending on normality assumptions . comparison of vertebral height restoration between groups was performed using the wilcoxon signed - rank test . a cadaveric model protocol to approximate the vertebral body tissue encountered with in vivo conditions was used . fresh frozen human vertebral specimens were maintained at 20c until approximately 24 hours prior to testing . sixteen vertebral specimens ( eight per treatment group ) from six human spine specimens ( t9t12 ) were thawed to room temperature and all residual soft tissue was removed via careful manual dissection . all specimens were confirmed as osteoporotic , defined as a t - score less than 2.5 compared to age - matched norms . vertebral bodies were prepared by transecting the pedicles and removing all disc material from the endplates . the caudal and cephalad surfaces of each vertebral body were rigidly embedded in a urethane potting compound ( smooth - on , inc , easton , pa ) and each composite was positioned with the centroid located in the middle of the potting fixture . prepared vertebral bodies were mounted in individual custom semiconstrained fixtures and rigidly attached to a servohydraulic load frame ( 8521s ; instron , norwood , ma ) in order to create consistent vcfs . all specimens were tested in air and preconditioned for ten cycles loaded between 500 n and 200 n of compression at a test frequency of 1 hz . immediately following preconditioning , loads were applied at a displacement rate of 5 mm / minute with a data acquisition rate of 20 hz . monotonic testing was performed until the anterior height of the vertebral body was reduced by 30 % compared to the measured baseline height ( figure 1 ) . each procedure was performed in four vertebrae under a 150 n follower load and in four vertebrae under no load . a follower load was used to increase the clinical relevance of this model by applying a load to the vertebral body physiologically representative of a patient in the supine position .17 the follower load testing technique applies a compressive load along the path that approximates the tangent of the lumbar spine curvature and models resistance ( due to fracture consolidation that occurs within the early weeks postfracture ) that the force applied by the augmentation procedure to restore height must overcome . all procedures were performed using fluoroscopic guidance by the same fellowship - trained neurosurgeon with extensive experience in the performance of rf - tva and bk for treatment of vcfs . rf - tva was performed via a unipedicular approach with site - specific cavity creation followed by remotely controlled delivery of ultrahigh - viscosity cement ( stabilit er bone cement ; dfine , inc , san jose , ca ) using the stabilit vertebral augmentation system ( dfine ) ( figure 2 ) . after placement of a working cannula , an initial cavity was created by inserting a straight coring osteotome ( vertecor straightline osteotome ; dfine ) that permits biopsy . a navigational osteotome ( vertecor midline osteotome ; dfine ) was then inserted through the working cannula . the midline osteotome was navigated through the vertebral body by rotating the handle to articulate the distal beveled tip as the osteotome was advanced through the vertebral body to the anterior third and across the midline in a controlled fashion . the midline osteotome was then reoriented and additional passes made to create site - specific cavities ( figure 3 ) . this resulted in well - defined cavities with minimal disruption of adjacent trabeculae that served as preferential paths for cement delivery . the pmma , which has an extended working time compared to standard pmma , was then converted to an ultrahigh - viscosity pmma as it passed through the activation element ( where it was heated by application of radiofrequency ) immediately prior to entering the delivery cannula . the ultrahigh - viscosity pmma was delivered at a continuous rate of 1.3 cc / minute using a remote - controlled automated hydraulic delivery system . intermittently during pmma delivery , intravertebral filling was fluoroscopically monitored and terminated when the treating physician deemed that the fill was adequate . bipedicular bk was performed using standard techniques described previously ( kyphx osteo introducer system ; medtronic , inc , minneapolis , mn ) and included insertion of an inflatable bone tamp ( kyphx xpander inflatable bone tamp ; medtronic ) , balloon inflation for vertebral cavity creation , height restoration , and filling with pmma ( kyphx hv - r high - viscosity radiopaque bone cement ; medtronic ) .18 prior to preconditioning and immediately following the monotonic loading test , radiographs were acquired on all specimens for vertebral body height comparisons . following cavity creation and prior to cement delivery , two vertebrae in each treatment groupwere scanned using computed tomography ( slice thickness 0.625 mm ; lightspeed16 ; ge healthcare , little chalfont , united kingdom ) to evaluate location and shape of the cavity as well as adjacent trabecular morphology . following cement delivery , radiographic and computed tomography images were acquired and vertebral height was measured prior to serial sectioning . anterior vertebral height was measured using the technique described by mckiernan et al. 19 vertebral height was defined as the distance between points on the most anterior aspects of the superior endplate and the inferior endplate . all prefracture , postfracture , and postvertebral augmentation images for each vertebra were read by five independent reviewers with the average of the readings used for data analysis . height restored ( anterior measure posttreatment minus post fracture ) and height loss ( anterior measure intact vertebra minus postfracture ) were used to calculate percent height restoration ( height restored / height loss 100 ) . poor pmma interdigitation was identified by a solid pmma mass due to pmma lumping without interspersion . dissolution of pmma was performed by soaking the sectioned specimens in acetone prior to examination of the remaining trabecular structures . data were reported as mean standard deviation or median ( interquartile range ) , depending on normality assumptions . comparison of vertebral height restoration between groups was performed using the wilcoxon signed - rank test . vertebral specimens had an average age at death of 869 years ( range : 7296 years ) . bone mineral density averaged 0.640.15 g / cm ( range : 0.390.76 g / cm ) , with all specimens meeting the criterion for osteoporosis . mean maximum failure load was similar ( p = 0.18 ) for rf - tva ( 1544526 n ) and bk ( 1979484 n ) . anterior height restoration was greater with rf - tva ( median : 84 % , interquartile range : 62 % 95 % ) compared to bk ( median : 69 % , interquartile range : 60 % 81 % ) , although the difference did not achieve statistical significance ( p = 0.16 ) . when analyzed according to loading condition , anterior height restoration was numerically greater with rf - tva under loaded ( median : 70 % versus 66 % ) and unloaded ( median : 94 % versus 77 % ) conditions , although the small sample precluded formal statistical analysis in this subgroup . inspection of computed tomography images revealed the creation of distinct cavities prior to cement delivery with both procedures . however , rf - tva resulted in more discrete cavities leading to less native trabecular destruction compared to the marked trabecular destruction observed with bk ( figure 4 ) . mean pmma volume was 6.61.1 cc for rf - tva and 6.51.1 cc for bk . following serial sectioning and prior to pmma dissolution , specimens subjected to rf - tva consistently showed a well - identified focal area of pmma with an extensive peripheral zone of pmma interdigitation and mechanical interlock into the adjacent trabecular matrix ( figure 5 ) . in contrast , specimens in the bk group demonstrated little evidence of pmma interdigitation beyond the boundaries created by the balloon tamp due to the peripheral crushed trabecular bone . following pmma dissolution , increased trabecular bone loss due to balloon inflation was confirmed in these specimens ( figure 6 ) . this ex vivo biomechanical pilot study showed that rf - tva achieves favorable vertebral height restoration with focused pmma delivery and less trabecular destruction compared to bk . the novel aspects of rf - tva include a unipedicular approach and use of an articulating navigational osteotome that , unlike bk , allows targeted creation of a site - specific , well - defined , minimally destructive intravertebral cavity as well as controlled delivery of an ultrahigh - viscosity cement resulting in optimal void filling and extensive interdigitation into the adjacent trabecular bone . this study found that a significant percentage of anterior vertebral height restoration can be achieved utilizing rf - tva and bk under clinically relevant loading conditions . despite less anterior vertebral height restoration in both groups underloaded versus unloaded conditions , there was greater height restoration with rf - tva with unloaded conditions . this phenomenon was likely caused by the targeted delivery and interdigitation of ultrahigh - viscosity rf - heated cement into the remaining trabeculae . under loaded conditions , which more realistically simulate in vivo conditions , targeted cavity creation was achieved with minimal sacrifice of the adjacent trabecular matrix ; however , cavities created using bipedicular bk sacrificed the trabecular matrix , were largely dictated by balloon geometry , and were often limited to the axial orientation of the working cannula through which the balloons were inserted . additionally , upon filling , pmma interdigitation and mechanical interlock of the pmma with the adjacent trabecular matrix was poor . tamped trabecular bone following pmma filling has been shown to be necrotic with the possibility of resorption and potential for pmma loosening and mobilization .12 using a finite element model , dabirrahmani et al reported that under these pmma bone interface parameters , and with normal load conditions , the pmma may become loose and dislocate from the original cavity position .13 the penetration of standard pmma into trabecular bone is dependent on the porosity of the available trabecular matrix , the viscosity of the introduced pmma , and the stability of the pmma during curing .5,7,13,2025 since pmma has no adhesive properties , its primary function is as a filler , which underscores the importance of trabecular interlock . penetration of pmma into surrounding intact trabecular matrices can have a significant effect on the mechanical integrity of the overall bonepmma construct including the dampening of increased stress within the vertebral body , minimization of stress shielding by better load distribution , and maintenance of intravertebral bone and bone density .4,2123,25 in benchtop studies of the bonepmma interface , graham et al reported that bone porosity was the leading factor in the fracture resistance of the bonepmma interface .21 peripheral interdigitation of pmma maintains mechanical integrity of the construct in compression resulting in a more uniform load transfer between the vertebral endplates and vertebral body .13 the pmma delivery in rf - tva may , therefore , aid in initially stabilizing the fracture and , upon bone - to - pmma mechanical interlock , minimizing the potential additive risks of bone necrosis and resorption , interface fibrous membrane formation , and pmma loosening and mobilization . the utility of an articulating cavity creation device to achieve remote access within the vertebral body and reproducible targeted cavity creation via a unipedicular approach is further underscored by chung et al , who reported that placement of a unipedicular bone tamp more centrally within the vertebral body violated the medial wall of the pedicle resulting in pmma leakage into the spinal canal .26 a limitation of the current study includes the use of prepared cadaveric vertebral bodies since ex vivo models can not reproduce the exact in vivo environment encountered during surgery . however , the use of osteoporotic bone specimens allowed the researchers to replicate and treat trabecular involvement similar to in vivo conditions following vcf . the application of a load during treatment of a subset of these specimens provided further clinical relevance to the study findings . a second limitation of this study was the small sample size , which limited the statistical power of anterior vertebral height restoration outcome comparisons . however , the sectioned histological review of pmma distribution showed superior cement interdigitation and mechanical interlock in all specimens treated with rf - tva . despite these limitations , these results provide mechanistic insight to outcomes of a human clinical trial that demonstrated shorter procedural time , reduced leakage rates , and equivalent height restoration with rf - tva compared to bk .16 in conclusion , unipedicular rf - tva and bipedicular bk achieve satisfactory vertebral height restoration in an ex vivo vcf model . however , rf - tva produces less trabecular destruction and superior pmma interdigitation compared to bk . rf - tva has potential clinical utility in the aging population with painful osteoporotic vcfs .\noutput:\n" }, { "from": "agent", "value": "purposetraditional balloon kyphoplasty ( bk ) is a common treatment for symptomatic vertebral compression fractures . the purpose of this study was to compare a novel vertebral augmentation technique , radiofrequency - targeted vertebral augmentation ( rf - tva ) , to bk for restoration of vertebral height , cavity creation , and polymethylmethacrylate ( pmma ) delivery and interdigitation into the surrounding trabeculae.methodsthis ex vivo biomechanical pilot study utilized 16 osteoporotic cadaveric vertebral bodies in a standardized fracture model to compare unipedicular rf - tva ( n = 8 ) to bipedicular bk ( n = 8 ) . four specimens from each group were tested in loaded and unloaded conditions . all specimens were imaged , assessed for height restoration , and sectioned to observe pmma distribution . a subset of specimens underwent computed tomography scanning to assess cavity creation and trabecular architecture prior to cement delivery.resultsanterior height restoration was greater with rf - tva ( median : 84 % , interquartile range : 62 % 95 % ) compared to bk ( median : 69 % , interquartile range : 60 % 81 % ) , although the difference did not achieve statistical significance ( p = 0.16 ) . anterior height restoration was numerically greater under loaded ( median : 70 % versus 66 % ) and unloaded ( median : 94 % versus 77 % ) conditions with rf - tva versus bk . rf - tva produced more discrete cavities and less native trabecular destruction compared to marked trabecular destruction observed with bk . rf - tva consistently showed a well - identified focal area of pmma with an extensive peripheral zone of pmma interdigitation , providing mechanical interlock into the adjacent intact trabecular matrix . in contrast , bk yielded little evidence of pmma interdigitation beyond the boundaries created by the balloon tamp due to the crushed trabecular bone peripherally.conclusionrf - tva achieves favorable vertebral height restoration with targeted pmma delivery and less trabecular destruction compared to bk . rf - tva has potential clinical utility in the aging population with painful osteoporotic vertebral fracture ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although conception is discouraged in woman with eisenmenger 's syndrome , as maternal mortality is 30 % - 50 % ; but in inevitable circumstances , meticulous planning of anesthesia can help the parturient survive the ordeal of a cesarean section . a 27 - year - old pregnant female , 50 kg ( gravida three para one ) was admitted to our hospital at 34 weeks of gestation with complaint of pain abdomen for 2 days . on examination , the patient was found to be cyanotic with clubbed fingers and raised jugular venous pressure ( jvp ) . her pulse rate was 98 per minute , blood pressure 130/90 mmhg , respiratory rate 18 per minute ; o2 saturation 64 % on air . on auscultation , a pansystolic murmur grade iii in fourth to sixth intercostals space , and bilateral basal crepitations were present . two years back , during her first pregnancy , she delivered a term still born baby at home , after which she became dyspnoeic , cyanotic , and was rushed to hospital . the patient was advised to have regular follow - up with the cardiologist but her visits were irregular . the second pregnancy was spontaneously terminated at 4 months and was uneventful . with regard for her health , she was told to have congenital heart disease in childhood , but because of poor socioeconomic status lost follow - up . during present pregnancy , she had dyspnea grade i in first trimester but increased to grade iii in third trimester . she was on irregular treatment with tablet sildenafil 25 mg twice a day since 4 months . two - dimensional echocardiography ( echo ) with color doppler showed large perimembranous vsd of 17 mm size , bidirectional shunt , severe pulmonary artery hypertension ( pah ) , severe tricuspid regurgitation , dilated right atrium , normal biventricular function with ejection fraction of 52 % . in the operating room , the patient was given oxygen by facemask ; electrocardiogram ( ecg ) and pulse - oximeter were attached for continuous monitoring . the baseline parameters were observed and recorded with heart rate of 99 per min , blood pressure140 / 98 mm hg , cvp 11 cm h2o and spo2 was 88 % on oxygen by facemask . meticulous attention was paid to avoid bubbles in lines and syringes because of the risk of paradoxical embolism . an 18 g tuohy needle was inserted in l2 - l3 interspace in sitting position and an epidural catheter was introduced 3 cm toward cephalad direction in epidural space . 3 cc test dose of lignocaine with adrenaline ( 1 in 2 lacs ) mixture was administered . no formal fluid preload was done , but a slow infusion of hydroxyethyl starch was commenced . incremental dose of lignocaine with adrenaline solution and bupivacaine ( 0.5 % ) were titrated against anesthetic and hemodynamics effects . over a period of 30 min , a total of 7cc of lignocaine with adrenaline solution and 8 cc of bupivacaine with 25 g of fentanyl produced a block height of t8 tested to touch with blunt forceps . postoperatively , epidural analgesia was maintained with 0.125 % bupivaicaine and 20 g of fentanyl every 8 hourly for 72 h. after surgery patient was shifted to intensive care unit ( icu ) for monitoring and was discharged on 10 day . pulmonary hypertension in pregnancy is associated with high mortality ( 30 % - 50 % ) ; hence , pregnancy is contraindicated . the cardiac output must be maintained and the systemic vascular resistance ( svr ) must not be allowed to fall ensuring minimal change in the amount of right to left shunt . general anesthesia poses risk as potential for increased catecholamine release after laryngoscopy , during anesthesia and in recovery given the relatively poor pain control leading to increased right to left shunt . also , general anesthesia might exacerbate her respiratory disease , thereby increasing postoperative hypoxia . epidural anesthesia has been used successfully in this condition and because of its slow onset ; reduces the chance of precipitous hemodynamic changes as seen in spinal anesthesia . spinnato et al . , and others have suggested that it is safe to administer epidural anesthesia to patient with eisenmenger 's syndrome . in our caseelective lscs was chosen and successfully conducted with epidural anesthesia with local anesthetic and fentanyl . as the postpartum period is the period in which many mortalities have been reported , continuous monitoring of pulse , ecg and spo2 was continued in icu , so that the postpartum hemodynamic alterations are recognized early and treated accordingly . in conclusion , our experience with this patient suggests that successful outcome is possible in patients with pulmonary hypertension with segmental epidural anesthesia ; however , patients need intensive monitoring in the intraoperative and postoperative period .\noutput:\n" }, { "from": "agent", "value": "we describe a case of a pregnant patient with a large ventricular septal defect ( vsd ) and pulmonary artery hypertension , presented to the hospital and underwent elective cesarean section under epidural anesthesia and postoperative analgesia . the procedure was uneventful till the patient was discharged on 10th day ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pocket ultrasound devices appear particularly attractive but is this technology ready for use in emergency settings or intensive care units ? echocardiography is frequently used for hemodynamic evaluation in patients with circulatory or respiratory failure as it is possible to use it to evaluate left and right ventricular function , preload , preload responsiveness , and pulmonary artery pressures . it allows not only the determination of the source of shock but also evaluation of filling pressures and volumes , and systolic and diastolic heart function . however , this approach may be time consuming and , more importantly , requires skills that can be achieved only after dedicated training and many supervised examinations . a focused approach to echocardiographythis approach allows the rapid evaluation of the main alterations contributing to hemodynamic instability and thus the orientation of therapy . focused echocardiography consists of eyeball evaluation of left ventricular systolic function and evaluation of right ventricular enlargement , evaluation of preload responsiveness , and detection of cardiac tamponade . this can be done semi - quantitatively by categorizing function or dilation as normal , moderately altered , or markedly altered . this simplified echocardiographic approach can be performed by many operators , as minimal skills are required . indeed , after a 3 hour training course and 5 hours of hands - on training , beginners can acquire enough skills to adequately estimate the different components of focused echocardiography and to identify most life - threatening hemodynamic alterations . this approach and skill requirement are now recognized by scientific societies and implemented in core ultrasound training . however , one piece was still missing from the puzzle of focused echocardiography : until recently , focused echocardiography was often performed with relatively large echo machines , which are not really suitable for focused echocardiography as they are heavy to mobilize , use a large part of the limited space available at the bedside , and , more importantly , often have a long setup time , which may be an issue when emergency evaluation is required . over the past years , several companies have developed portable ultrasound machines that have greatly improved the possibility of rapidly moving them for emergency assessment . additionally , pocket ultrasound devices have now been developed . these devices can be stored in a pocket but share only some technical features with the larger devices . two - dimensional imaging and color flow mode are available , with possible adjustments of global gain and depth . however , more advanced features , such as time - motion mode , and pulsed and continuous doppler , are not available . although pocket ultrasound devices provide excellent quality images in selected populations , the crucial question of whether these devices can be used in an unselected population in an emergency setting remained unanswered . in this issue , biais and colleagues evaluate whether the findings observed during focused echocardiography with a portable ultrasound device reliably reflect those that can be obtained with a classical echocardiography device . in this elegant trial , the authors investigated 151 patients requiring evaluation with focused echocardiography in an emergency department . in each casetwo intensivists independently , and blind to the other examination , conducted a focused echocardiographic assessment using either the pocket ultrasound device or a classical echocardiography device . parasternal , apical , and subcostal views were obtained to evaluate global cardiac systolic function , ventricular enlargement or hypertrophy , presence of a pericardial effusion and size and the respiratory changes of the inferior vena cava diameter . all measurements were qualitative except for ejection fraction , which was visually determined . in no casedid the pocket device technology fail to provide a definitive diagnosis ; when a diagnosis could not be obtained with one device it was also the case with the other device . with the portable ultrasound device it was possible to adequately evaluate the different items with good to excellent agreement . in addition , ejection fraction was correctly evaluated with no bias and narrow limits of agreement ( 13.5 % ) . the authors nicely show that this portable ultrasound device is perfectly suited for use in the emergency department . but would this kind of device also be useful in the intensive care unit ? obviously , image quality was sufficient for focused echocardiography , but this does not mean that image quality was similar between the two devices and acquisition of good images may be more difficult in critically ill patients , and in particular in mechanically ventilated patients . in addition , portable ultrasound devices may not be suitable for more advanced echocardiographic studies ; for example , measurements of cardiac output and filling pressures are not feasible in the absence of doppler technologies . first , one may guess that improvements in technologies will allow some of these limitations to be overcome in the future ; in particular , image acquisition is likely to improve . doppler techniques could also be implemented , allowing cardiac output monitoring , but this is not a high priority . in many patients , , of course , conventional high - tech ultrasound devices will still have a place for more precise assessment . in conclusion , pocket ultrasound devices are now ready for wide use in emergency department and ambulance settings for focused echocardiography .\noutput:\n" }, { "from": "agent", "value": "pocket ultrasound devices have recently been developed and may be particularly useful for emergency assessment . these devices can be stored in a pocket but share only some technical features with conventional echocardiographic machines . two - dimensional imaging and color flow mode are available , with possible adjustments of global gain and depth , but doppler features are lacking . these devices are particularly fitted for focused echocardiography . in this issue , a trial compares a pocket ultrasound device with a conventional echocardiographic machine for focused echocardiography in patients admitted to the emergency department . this commentary will put these findings into perspective ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pterygium is a common wing - shaped and oriented fibrovascular lesion coating the surface of the eye . according to the population - based studies , its prevalence rate varies from 0.7 % to 33 % . this abnormality arises from the conjunctiva and extends into the cornea and can result in remarkable cosmetic problems , visual impairment , recurrent inflammation , and mild irritation . surgery is needed for cases when lesion expands to the central part of the cornea ( figure 1 ) . there are countless theories regarding the causes of pterygium including uv light exposure , viruses , oxidative stress , dna methylation , apoptotic and oncogenic proteins , loss of heterozygosity , microsatellite instability , inflammatory mediators , extracellular matrix modulators , lymphangiogenesis , cell epithelial - mesenchymal transition , and alterations in cholesterol metabolism . therefore , we focused on lats1 and lats2 genes which are the common tumor suppressor genes in the uv - induced dna damage response ( ddr ) signaling pathways . lats ( large tumor suppressor ) gene , a ser / thr kinase , belongs to the ndr / lats subfamily of agc ( protein kinase a / pkg / pkc ) kinases originally isolated from drosophila melanogaster . two mammalian homologs of fly lats , lats1 and lats2 , are located in 6q25 .1 and 13q12 .11 chromosomes , respectively . one of the ddr signaling pathways , which facilitate apoptosis following high levels of uv - induced damage , is chk1 - lats2 - p21 axis . andchk1 - lats2 - ( 14 - 3 - 3 ) regulates the p - body formation as a unique signaling pathway in response to uv - induced dna damage . lats1 and lats2 are also engaged in the regulation of cell cycle through g2 - m arrest and g1 - s arrest , respectively . after dna damage the integrity of genome is warranted through rassf1a - lats1 / 2 - mdm2 - p53 signaling pathway . in addition , a large amount of literature has reported the function of these genes in morphogenesis , cell division , and apoptosis . epigenetic modifications such as dna methylation of cpg islands in promoter regions are the main cause of tumor suppressor gene silencing and can result in tumor development . some tumors such as breast cancer and astrocytoma have shown downregulation of lats1 and lats2 mrna expression through promoter methylation . to our knowledge for the first time , this study highlights the status of lats1 and lats2 promoter methylation and mrna expression profiles in pterygium . this case - control study was performed from 2010 to 2013 consisting of 70 primary pterygium tissues ( 35 males and 35 females with a mean age of 52.4420.611 ) and 70 normal conjunctiva tissues of the patients who had undergone cataract surgery ( 35 males and 35 females with a mean age of 50.6723.318 ) . all procedures in this study were approved by the ethical board at the zahedan university of medical sciences . then 1 - 2 g of isolated dna was diluted in 20 l of water and used for bisulfite treatment by wizard dna clean - up system ( promega ) kit which converts unmethylated cytosine to uracil and leaves methylated cytosine unaltered . according to the manufacturer 's instructions of promega , the treated dna should be diluted in 20 l of water and kept at 20c for using in the further experiments . to carry out the msp analysis , promoters of the genes were recognized through online data analysis ( http://www.ensembl.org ) and then the preferred sequences were used to design methylated and unmethylated primers by methprime online software . our selection for the site of methylated and unmethylated was consistent with the related literature . each pcr reaction contained 1 l of modified dna and 0.5 l of each primer which is dissolved in the lyophilized blue pellet of accupower hotstart pcr premix reached a final volume of 20 l with water . the msp amplification was set as follows : 95c for 5 min , followed by 40 cycles ( 95c for 40 s , the annealing temperature for lats1 : m = 53 , u = 57 ; lats2 : m = 55.5 , u = 55 for 40 s and extension at 72c for 40 s ) . pcr products were detected by electrophoresis in 2 % agarose gel , 80100 volts for an hour until being well separated ( figure 2 ) . total rna was extracted from pterygium and control tissues using the rnx - plus solution ( cat . number : k1621 ) was used to reverse - transcribe 1 mg of rna to cdna in a final volume of 20 l . real - time pcr was performed using sybr green in abi 5700 sequence detection system ( applied biosystems ) . pcr efficiencies ( e ) were calculated for all used primers from the given slopes of standard curves , generated from serial dilutions of positive controls , according to the following equation : e = 2 . the effect of lats1 and lats2 genes methylation on the risk of pterygium formation was detected by estimating odds ratios ( or ) and 95 % confidence intervals ( 95 % ci ) , using logistic regression . avoiding bias in estimating or , we calculated confidence intervals by three methods including exact , cornfield , and woolf . the stata se ( version 13.1 ) the methylation frequency of lats1 gene was 66 ( 94.28 % ) for cases and 54 ( 77.14 % ) for healthy controls . lats2 gene showed 98.57 % ( n = 69 ) methylation in cases and 82.86 % ( n = 58 ) in the controls group . comparison of methylated versus unmethylated indicated significant difference between cases and controls in last1 ( or = 4.9 ; 95 % ci : 1.54 to 15.48 , p = 0.003 ) and lats2 ( or = 7.1 ; 95 % ci : 1.53 to 33.19 , p = 0.004 ) ( table 3 ) . decreased expression in case group of both candidate genes ( 0.420.030 in case versus 0.570.068 for controls in lats1 and 0.440.028 in cases versus 0.570.061 controls in lats2 ) was detected . comparison of mean between cases and controls revealed a statistically significant difference in both genes ( p 0.05 ) ( table 4 ) . pterygium is a benign lesion that extends from conjunctiva to the cornea where it may interfere with vision . since the current treatment of pterygium is invasive , mainly based on surgery , studies for new markers should be conducted . environmental factors such as uv radiation play an important role in tumor promotion through the epigenetic dysregulation of the cell cycle genes . lats1 and lats2 as a part of ddr signaling pathways are putative serine / threonine kinase proteins that localize to the mitotic apparatus and constitute a complex with cell cycle control system . lats1 acts as a negative regulator of cdc2 / cyclina , which reduces h1 histone kinase activity of cdc2 and results in a g2 - mcell - cycle arrest . also , lats1 is activated by rassf1a ( ras association domain family 1 isoform a ) that stimulates response to dna damage . the activation of lats1 promotes genomic stability via stabilizing replication forks by restricting cdk2 - mediated phosphorylation of brca2 . this modulation not only has a fundamental role in error - free dna repair but also maintains nucleofilament formation at stalled replication forks . it interacts with the centrosomal proteins aurora - a and ajuba and also is required for the accumulation of gamma - tubulin and spindle formation at the onset of mitosis . it also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to the cytoskeleton damage . the lats2 - mdm2 - p53 axis thus constitutes an innovative checkpoint pathway critical for the maintenance of proper chromosome number . both lats1 and lats2 as tumor suppressors are part of hippo signaling pathway which has profound effects on normal cell fate and tumorigenesis . therefore , silencing of lats1 and lats2 putative tumor suppressor genes through promoter methylation may cause the development of pterygium . in addition , promoter hypermethylation mediates decreased expression of lats1 and lats2 in human astrocytoma . downregulation of lats1 and lats2 mrna expression by promoter hypermethylation has been reported in breast cancer . consistent with the abovementioned studies , our results confirmed the significant relationship between reduced expression of the lats1 and lats2 through methylation and the risk of pterygium formation . besides our data , the literature reviews showed the aberrant dna methylation and decreased expression of p16 , ecadherin , tgm 2 , mmp2 , and cd24 genes in pterygium . exploring pterygium methylation markers and their subsequent effects on mrna expression paves the road for better therapy such as discovering drugs with the regulation of methylation characteristic . further studies are required to identify the exact molecular function of lats1 / lats2 genes in pterygium in various and larger genetic populations using advanced molecular techniques .\noutput:\n" }, { "from": "agent", "value": "purpose . pterygium is a serious eye problem in countries with high exposure to uv . however , despite numerous studies , the molecular etiology of pterygium is unclear . recent studies have indicated that lats1 and lats2 genes are involved in ddr signaling pathways against continuous uv exposure . our aim was to evaluate the lats1 and lats2 promoter methylation with the risk of pterygium formation . methods . we evaluated the promoter methylation status of lats1 and lats2 using methylation - specific pcr technique . also , mrna expression of lats1 and lats2 was assessed in 14 cases of pterygium and 14 normal specimens by real - time pcr . results . promoter methylation of lats1 and lats2 was detected significantly between pterygium tissues and normal tissues [ lats1 ; or = 4.9 ; 95 % ci : 1.54 to 15.48 , p = 0.003 ; lats2 ; or = 7.1 ; 95 % ci : 1.53 to 33.19 , p = 0.004 ] . the gene expression analysis showed a statistically significant difference between pterygium tissues and healthy controls for both lats1 and lats2 ( p < 0.05 ) . conclusions . the data of this study is the first report regarding the effect of promoter methylation of the lats1 and lats2 in the pterygium . to confirm these data , doing further studies in various genetic populations with large sample sizes using advanced molecular techniques is proposed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: embryologically , this defect has been attributed to a malaligned ventricular and or atrial septum , defect of the atrioventricular canal as well as the excessive growth of the endocardial cushion . these include patent ductus arteriosus , coarctation of the aorta , transposition of the great arteries , pulmonary stenosis , shunt defects , cor triatriatum , chamber , and valvular anomalies . there have been few reports of mitral atresia including that of the first of a set of twin diagnosed with mitral atresia ; hypoplastic left ventricle , ventricular septal defect ( vsd ) , d - transposition of the great vessels , severe pulmonary stenosis , and hypoplastic pulmonary arteries at 33 weeks gestation . clinical presentation depends on the types and severity of the accompanying anomalies , however , most patients present with respiratory difficulty , cyanosis , failure to thrive , poor peripheral pulses , and congestive cardiac failure . although cardiac catheterization and cardiac angiography are the mainstay in the evaluation of these patients , ultrasonography remains an effective alternative in the evaluation of the mitral valve especially in resource - poor countries with limited facilities . some authors have proposed to classify mitral atresia based on the position of the great vessels , the size of the left ventricle and the presence or absence of a ventricular outflow obstruction . this report describes the presence of this rare anomaly in the presence of a hypoplastic left ventricle , large atrial septal defect ( asd ) , and vsd in a 5 - month - old infant . a 5 - month - old male infant was referred to the emergency paediatric unit of our facility from the ent unit . his complaints were recurrent breathlessness and cough since the first week of life and fever of 4 days before presentation . this was associated with a cough and darkened mucous membrane of the oral cavity , lips and the digits ; the parents also complained of feeding difficulties , but there was no history of body swelling . he was a product of term gestation , delivered to a 17 - year - old primipara ; the marriage was nonconsanguineous and the father was 27 years old . on examination , he was in respiratory distress , centrally cyanosed , well hydrated with no pedal edema . he had deranged anthropometry ; his weight was 3.8 kg , length was 50 cm while occipito frontal circumference was 38 cm . he was tachycardic with a pulse rate of 176 beats / min , the apex was displaced to fifth left intercostal space lateral to midclavicular line , he had first , second and third heart sounds with a grade three systolic murmur maximal at the left sternal margin . chest x - ray [ figure 1 ] revealed cardiomegaly and an elevated apex indicative of right ventricular hypertrophy , and there were prominent vascular markings in both lung fields . electrocardiography revealed sinus tachycardia with right ventricular hypertrophy ; and transthoracic echocardiography was done using sonoscape s8000 with 7.5 mhz probe ; studies included m - mode , doppler , color flow mapping which revealed an atretic mitral valve , large asd of 15 mm ( almost like a common atrium ) , inlet vsd of 10 mm with right to left shunting and hypoplastic left ventricle [ figure 2 ] . the great vessels were normally positioned and related [ figure 3 ] ; the aortic arch was left side [ figure 4 ] and there was no patent ductus arteriosus detected . he was managed with diuretics , vasopressors , antibiotics , and also maintained on oxygen . however , his condition further deteriorated , and he died on the third day of admission . chest x - ray showing cardiomegaly echocardiography showing mitral atresia , atrial septal defect , and ventricular septal defect normal relationship of the great arteries left sided aortic archaccording to the proposed classification of mitral atresia our patient who had a normally positioned great vessels , hypoplastic left ventricle and the absence of a ventricular outflow obstruction fits type i mitral atresia . the presence of a hypoplastic left ventricle in our patient is similar to the observation in previous reports and had often been referred to as the hypoplastic left heart syndrome . this is common and have been reported in about 75 % of cases of type i mitral atresia . had described the presence of a normally sized left ventricle , although their patient had an associated aortic atresia with an intact ventricular septum . the regurgitant flow from the atretic aortic valve maintains the size of the left ventricle . other less common findings are mitral atresia with an absent left ventricle or single ventricle . the normally sited and positioned great vessels in our patient was also in keeping with the autopsy cases reviewed by moreno et al . where up to 52 cases of mitral atresia were also found to have normally related great vessels . similarly , they reported asd and vsd in their series as was observed in our case . asplenia and polysplenia have been documented by some authors , however , our patient had a normal spleen . our patient presented within the first week of life , and this is in keeping with the natural history of this complex heart disease . similarly , majority of the cases reviewed by moreno et al . although , they observed more severe cyanosis in patients with right ventricular outflow tract obstruction , our patient had severe cyanosis with no observed pulmonary stenosis . in the absence of a pulmonary stenosis , the ensuing pulmonary venous congestion from our patient 's large asd in the presence of a mitral atresia may have contributed to severe pulmonary congestion explaining the cyanosis and heart failure . hypertrophy of the right chamber of the heart is usually a common finding because both systemic and pulmonary venous blood is propelled mostly by the right ventricle in the presence of a large asd . this is because blood flows from the lungs into the left atrium , crosses to the right side of the heart to mix with the systemic venous return and then from the right ventricle into the pulmonary artery and aorta through the vsd . prognosis and outcome of this patient may have been improved by the presence of a pulmonary stenosis as this may prevent the pulmonary venous congestion that ensues from the large amount of blood shunted to the right chamber through the large asd in the presence of a mitral atresia . mitral atresia is a rare disease with poor outcome , and very few cases have been reported in recent times . it could be associated with variable cardiac defects and absence of pulmonary stenosis , surgical intervention portends poor outcome as was witnessed in the index case .\noutput:\n" }, { "from": "agent", "value": "mitral atresia is a rare congenital heart defect when compared to atresia of other valves and it is often associated with other cardiac malformation such as patent ductus arteriosus , coarctation of the aorta , transposition of the great arteries , pulmonary stenosis , shunt defects , cor triatriatum , chamber , and valvular anomalies . there have been few reports of mitral atresia , therefore , the case of a 5 - month - old male child with complaint of difficulty with breathing and echocardiographic diagnosis of atretic mitral valves , atrial septal defect of 15 mms , ventricular septal defect ( vsd ) of 10 mms and hypoplastic left ventricle is reported ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: from july through september 2000 , patients in five european countries ( england , scotland , germany , the netherlands , and iceland ) were infected with a strain of salmonella enterica serotype typhimurium definitive phage type ( dt ) 204b ; the strain was resistant to ampicillin ( a ) , chloramphenicol ( c ) , gentamicin ( g ) , kanamycin ( k ) , streptomycin ( s ) , sulphonamides ( su ) , tetracyclines ( t ) , trimethoprim ( tm ) , and nalidixic acid ( nx ) . the strain also had decreased susceptibility to ciprofloxacin ( cpl ) , with an mic by e - test of 0.38 mg / l ( 1,2 ) . over 350 laboratory - confirmed cases were recognized . isolates from patients in iceland , the netherlands , and scotland were referred to the england and wales public health laboratory service ( phls ) laboratory of enteric pathogens for phage typing and antibiogram analysis . these isolates were compared with those from a concurrent outbreak of multiresistant s. typhimurium dt204b in northeastern england and from patients returning to england and wales after visiting other european countries . a panel of seven isolates from outbreaks in england , scotland , iceland , and the netherlands and from patients returning to the united kingdom after visiting greece , germany , and the netherlands were further characterized by a variety of molecular techniques , including plasmid profile typing , pulsed - field gel electrophoresis ( pfge ) , fluorescent amplified fragment - length polymorphism fingerprinting ( faflp ) , and integron typing ; specific resistance genes were characterized by polymerase chain reaction ( pcr ) and the mutation conferring decreased susceptibility to ciprofloxacin was identified by a lightcycler ( roche diagnostics ltd . , lewes , u.k . ) isolates from germany and scotland were typed independently with the same phenotypic methods as those used in the laboratory of enteric pathogens and also by plasmid profile typing and pfge . to facilitate epidemiologic investigations , pfge tagged image files ( tifs ) of banding patterns of isolates from england , scotland , and germany were exchanged electronically . conjugation experiments were performed at both 28c and 37c by using a rifampicin - resistant strain of escherichia coli ( strain 20r764 ) as the recipient . dna was extracted from transconjugants by using a dneasy tissue kit ( qiagen ltd . , crawley , u.k . ) . for plasmid profile analysis , plasmids were resolved by electrophoresis at 110 v for 3 hours in 0.8 % wt / vol agarose . ( milton keynes , u.k . ) were used to detect the antibiotic resistance genes aada2 , blacarb - 2 , blatem , sul1 , teta ( class a ) , teta ( class g ) , teta ( class b ) , and integrons in both wild - type strains and e. coli k12 transconjugants . the nucleotide sequence of these primers and the corresponding temperature profiles for amplification have been described ( 4 ) . gama , designed to detect three different gyra mutations , was performed in a lightcycler instrument under previously described reaction components and conditions ( 3 ) . for pfge ( 5 ) with 2 % chromosomal grade agarose ( bio - rad laboratories , hemel hempstead , u.k . ) replacing the 2 % type vii lgt agarose ( sigma chemical co. , poole , u.k . ) . samples were run through a 1 % pulsed - field certified agarose gel ( bio - rad ) at 180 v for 44 hours , with pulse times ramped from 6 to 72 seconds . for faflp , the selective primer combinations eco +0 mse + t , eco +0 mse + ta , and eco +0 mse + cg were used , and gel separation and fragment analyses were performed , all as described by scott et al . this rare phage type was reported in only 40 cases in england and wales in the 5 - year period 19962000 and had never been identified in iceland before this epidemic . with the exception of resistance to nalidixic acid and decreased susceptibility to ciprofloxacin , the complete resistance spectrum ( acgkssuttm ) was transferable to e. coli k12 rif as an intact linkage group . plasmid profile analysis demonstrated the presence of five plasmids of 120 , 65 , 4.0 , 3.0 , and 2.0 mda . most transconjugants with the resistance pattern acgkssuttm had a single incompatibility group h2 plasmid of 120 mda . a few transconjugants had both the 120 - mda plasmid and an additional plasmid of 65 mda . when pcr amplification was performed on dna from transconjugants harboring either the single 120 - mda plasmid or both the 120 - mda and 65 - mda plasmids , positive results for aada2 , blatem , sul1 , and teta ( class a ) were obtained ; blacarb - 2 , teta ( class g ) , and teta ( class b ) were negative . when studied by integron pcr , one discrete 1.6 - kb band was generated in transconjugants when either the 120 - mda plasmid or both the 120 - mda and the 65 - mda plasmids were present . whether both the 120 - mda plasmid and the 65 mda - plasmid have tetracycline resistance genes or whether tetracycline resistance is encoded by only the 120 - mda plasmid is unclear . when studied by gama , the gyra mutation was that of aspartate to glycine ( gac - ggc ) at codon 87 . to facilitate epidemiologic investigations , pfge and plasmid profile tifs of the banding patterns of these isolates and those of multiresistant s. typhimurium dt204b from scotland and germany were exchanged electronically . in all cases , pulsed - field gel electrophoresis profiles of xbai - digested genomic dna from isolates of salmonella enterica serotype typhimurium dt204b . these results confirm that the strains of s. typhimurium dt204b of r - type acgkssuttmnxcpl responsible for outbreaks of infection in five european countries in the summer of 2000 were indistinguishable by all phenotypic and molecular criteria used for their characterization . a key aspect of this investigation was the rapid exchange of molecular fingerprints between laboratories already using standardized phage typing and antimicrobial susceptibility testing . in the united states , the exchange of molecular data has been addressed by the establishment of pulsenet , a national molecular typing scheme based on a standard method for pfge ; a similar network is being set up for the major salmonella reference laboratories in europe with research funding from the european commission . developing compatible networks for the exchange of real - time molecular data for s. enterica on an intercontinental scale would be of major benefit for the global control of salmonellosis .\noutput:\n" }, { "from": "agent", "value": "from july through september 2000 , patients in five european countries were infected with a multidrug - resistant strain of salmonella typhimurium dt204b . epidemiologic investigations were facilitated by the transmission of electronic images ( tagged image files ) of pulsed - field gel electrophoresis profiles . this investigation highlights the importance of standardized protocols for molecular typing in international outbreaks of foodborne disease ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: protein folding occurs spontaneously , as the process lowers the free energy of the system upon formation of the folded state . during folding , however , the entropic loss can transiently outweigh the enthalpic gain , thus resulting in one or more free energy bottlenecks or transition states along a given folding pathway . because , for a given protein , identifying the structure of the folding transition state ( s ) is key to elucidating its folding mechanism , these high energy states have been the subject of many previous studies . due to the transient nature of these states , however , it is extremely difficult , if not impossible , to directly observe and study them experimentally . as such , only indirect methods have been used to yield structural information about folding transition states . for example , one such method , - value analysis , uses site - specific side chain mutations in conjunction with stability and kinetics measurements to infer if a certain side chain becomes native - like at the transition state . while these methods have proven invaluable in the study and understanding of how proteins fold , they can not be used to isolate the folding transition state of interest for further structural and dynamic investigations . thus , it would be very useful to devise a method that can convert a folding transition state to a thermodynamically stable and accessible state . herein , we propose , based on the transition state analog ( tsa ) methodology commonly used in mechanistic studies of enzymatic reactions , that it is possible , at least for small protein systems , to use cross - linking strategies to accomplish this goal . in enzymatic studies , the tsa represents a stable , nonreactive enzyme substrate complex that mimics the transition state of the reaction of interest . in such biochemical reactions , the transition state is an ensemble of high energy configurations near a saddle point along the free energy coordinate that is experimentally inaccessible . however , since the tsa is thermodynamically accessible and also captures strongly bound interactions that translate to a transition state - like complex , it allows for a more detailed structural characterization of the transition state , which is otherwise difficult to achieve . for protein folding , another advantage of being able to engineer tsas is that , besides what is mentioned above , it would enable us to measure folding dynamics that are otherwise inaccessible , i.e. , the conformational dynamics at the downhill side of the folding free energy barrier . for small and two - state folding proteins , the folding transition state often consists of a relatively small number of key side chain - side chain and backbone backbone hydrogen bond interactions . thus , a viable strategy that could be used to create a folding tsa is to cross - link some of these key interactions via covalent bonds , to lower the entropic cost of forming the transition state . to test the feasibility of this idea , herein we apply it to one of the simplest folding systems , the - hairpin . since the folded structure of - hairpins consists of a series of backbone backbone hydrogen bonds , some of which exist in the transition state , an ideal approach to create a folding tsa would be to covalently cross - link one or multiple of these hydrogen bonds . converting a backbonebackbone hydrogen bond to a chemical bond without introducing significant structural perturbations , however , is challenging . thus , instead we seek to use a side chain disulfide cross - linker to help , albeit in an indirect manner , restrain a particular native backbonea disulfide bond may introduce strain to these hydrogen bonded sites , however , experiments on a small model system have shown that the favorable enthalpic contribution of the cross - linker could compensate for this potential geometric distortion . while the strategy of cross - linking has been widely used to increase protein stability , trigger protein unfolding , and to interrogate , in the context of - value analysis , folding mechanisms , to the best of our knowledge it has not been used to create a thermodynamically stable conformation that structurally resembles the folding transition state . as many studies have shown , the major folding pathway of trpzip - hairpins involves a transition state wherein the turn structure is at least partially formed . thus , we propose , using trpzip4 as a testbed , to create a - hairpin folding tsa by forcing the formation of a backbone backbone hydrogen bond critical to the stability of the - turn between asp6 and thr11 ( table 1 ) . as indicated ( figure 1 ) , such a conformational constraint on a system that folds cooperatively , if effective , is expected to divide the unfolded state ensemble into two structurally distinguishable subpopulations : one with a native or native - like turn ( ua ) , whereas the other is completely unstructured ( ub ) . if ua behaves like a folding tsa , we expect that its folding rate will be significantly increased with respect to the wild - type . on the other hand , the folding kinetics of ub are expected to be similar to those of the wild - type because both pathways ( i.e. , ub f and ub ua f ) involve the formation of the turn , the rate limiting step in trpzip4 folding . indeed , consistent with this picture , our results show that the conformational relaxation kinetics of this cross - linked trpzip4 variant , induced by a rapid temperature - jump ( t - jump ) and measured via time - resolved infrared ( ir ) spectroscopy , are biphasic , with one phase having a relaxation rate that is almost identical to that of the wild - type and another relaxing an order of magnitude faster . further evidence supporting our hypothesis ( figure 1 ) is that t - jump measurements on another cross - linked trpzip variant , whose two ends are connected via a disulfide ( table 1 ) , only show single - exponential relaxation kinetics , as are observed for the wild - type , but with a slower relaxation rate , due mainly to a decrease in the unfolding rate . cartoon representation of the proposed folding mechanism wherein two distinguishable unfolded states , ua and ub , are populated , due to the disulfide cross - linker in the turn region . all peptides were synthesized using standard 9 - fluorenylmethoxy - carbonyl ( fmoc ) methods on a ps3 peptide synthesizer ( protein technologies , woburn , ma ) and purified by reverse - phase high - performance liquid chromatography ( hplc ) . maldi - tof mass spectrometry was used to characterize the identity of the synthesized peptides . disulfide formation was accomplished , using a published protocol , via dimethyl sulfoxide ( dmso ) . specifically , an appropriate amount of pure peptide solid was dissolved in a 20 % dmso solution in h2o , and the resulting mixture was stirred for 4 h at room temperature , allowing the oxidation reaction to complete . subsequently , a second round of hplc was carried out to purify the disulfide cross - linked peptide , and the identity was further verified by maldi - tof mass spectrometry . all peptide samples were prepared by directly dissolving the lyophilized peptide solid in d2o and the final ph of the peptide samples was approximately 3 . for the uncross - linked peptide samples , a reducing agent , tris ( 2 - carboxyethyl ) - phosphine hydrochloride ( tcep ) , was also added at a concentration of approximately 10 times that of the peptide , to ensure that disulfide bonds were completely removed . the peptide concentration was determined optically using the absorbance at 280 nm and 280 = 22125 cm m , and , for all peptide samples , residual trifluoroacetic acid ( tfa ) from peptide cleavage has been removed via deuterium chloride ( dcl ) exchange . the instruments and conditions used to collect the spectroscopic data , including static circular dichroism ( cd ) and infrared ( ir ) and time - resolved ir measurements , are identical to those used previously . for the ir measurements , the peptide concentration was approximately 2 mm , prepared in d2o ( ph 3 ) . the probing frequency in the t - jump experiment was 1626 cm , and the t - jump amplitude was in the range of 812 c . molecular dynamics ( md ) simulations were performed for wild - type and cross - linked trpzip4 using the amber 11 package . the peptides were modeled with the amber ff96 all - atom force field , and the solvent was modeled with the gb / sa implicit solvent model . the salt concentration was set to 0.2 m , and the default surface tension was 510 kcal / mol / . the shake algorithm with a relative geometric tolerance of 10 was used to constrain all chemical bonds . nonbonded cutoffs were not used in the simulations . for both wild - type and cross - linked trpzip4 ,10 independent trajectories were carried out for 200 ns ( 2 s in total ) . in each trajectory , the fully extended structure of the polypeptide was first subjected to 2500 steps of minimization , and then the temperature of the system was established by velocity rearrangement from a maxwell boltzmann distribution at 300 k. afterward , the system was maintained at 300 k using the weak - coupling algorithm with a coupling constant of 0.5 ps . the integrated tempering enhanced sampling ( its ) method was used in the production run of each trajectory . in the present study , 100 temperatures , evenly distributed in the range of 270470 k , were used in the its method to ensure the efficient sampling of the desired energy . we chose the trpzip4 - hairpin ( table 1 ) as our model system because of its small size and the large body of information on its folding mechanism . the major folding pathway , as suggested by previous studies , begins with turn formation , which is a thermodynamically unfavorable event and hence results in a folding free energy barrier , followed by the sequential creation of backbone backbone hydrogen bonds further away from the turn in a zipping out manner . thus , based on this picture as well as the nmr structure , which indicates that the first interstrand hydrogen bond is formed between the amides of asp6 and thr11 , we propose to use a disulfide to reduce the number of possible configurations available near these residues with the expectation that this restriction is sufficient to produce an unfolded species that has a native - like turn and , therefore , behaves like a folding tsa . to accomplish this , we first mutated asp6 and thr11 to cysteine , and then the resulting mutant was placed under oxidizing conditions to promote disulfide bond formation . in addition , we have studied another cross - linked variant of trpzip4 with a disulfide formed at the peptide ends that serves as a control . for convenience , the sequences and abbreviations of all the peptides studied are summarized in table 1 . as shown ( figure 2 ) , the far - uv cd spectra of both cross - linked and uncross - linked peptides are in line with that of the wild - type , exhibiting a positive band at 228 nm . since this cd feature signifies the * exciton - coupling of the paired trp residues in the folded state , these results suggest that the mutations and disulfide constraints used in this study do not significantly perturb the native fold of trpzip4 . in addition , the chemical shifts obtained from the 1d h nmr spectrum of tz4 - t - cl agree with previously published data , and are well dispersed , which indicates a well - folded secondary structure ( figure s1 , supporting information ) . as expected , cd thermal unfolding measurements indicate , for a given sequence , that cross - linking increases the thermal stability of the - hairpin , in comparison to that of the uncross - linked peptide ( figure 3 and table 2 ) . nevertheless , what is more interesting is that the tm ( 67 c ) of tz4 - t - cl is almost identical to that ( 70 c ) of the wild - type , indicating that the added disulfide constraint at this site does not significantly perturb - hairpin stability , presumably because the enthalpic stabilization gained from the cross - linking is mostly offset by the conformational entropic loss in the unfolded state . on the other hand , as observed in similar studies , cross - linking the two ends of the trpzip4 peptide results in a hyperstable - hairpin with a tm 100 c . this result is not surprising considering that the unfolding process , which , according to the zipping out folding mechanism , should unzip the backbonecd spectra of the cross - linked and uncross - linked trpzip4 variants , as indicated . normalized cd thermal unfolding curves of the cross - linked and uncross - linked trpzip4 variants , as indicated . the solid lines are global fits of these data to a two - state model ( supporting information ) and the resultant thermodynamics parameters are listed in table 2 . the conformational relaxation kinetics of these trpzip4 variants were measured by a laser - induced t - jump ir technique , as was used in the study of the trpzip4 wild - type peptide . as shown ( figure 4 ) , unlike what was observed for the wild - type , the conformational relaxation of tz4 - t - cl , probed at 1626 cm , proceeds with two distinct and well - separated kinetic phases , indicating that the disulfide cross - linking indeed , as proposed , changes the folding mechanism of trpzip4 , as the wild - type , in response to a t - jump , only shows single - exponential decays . interestingly , as shown ( figure 5 ) , the relaxation rate of the slow phase ( 2 ) is almost identical to that of the wild - type in the temperature range between 40 and 45 c , whereas the relaxation rate of the fast phase ( 1 ) is an order of magnitude faster . to confirm that the difference in the relaxation kinetics of tz4 - t - cl and the wild - type originates from the disulfide cross - linker , we also measured the relaxation kinetics of the uncross - linked variant of this peptide ( tz4 - t - ul ) . as shown ( figure 6 ) , the t - jump induced relaxation kinetics of tz4 - t - ul can well be described by a single - exponential function with a rate constant that is slower than that of the wild - type . further analysis of the relaxation rates , based on a two - state model , indicates that this slowing down predominantly arises from a decrease in the folding rate ( figure 6 ) . for example , at 40 c the folding and unfolding rate constants of tz4 - t - ul are determined to be ( 13.3 s ) and ( 66.0 s ) , respectively , compared to ( 6.6 s ) and ( 48.4 s ) of the wild - type . this result is in agreement with the notion that the turn is at least partially , if not completely , formed in the transition state as these cysteine mutations , as shown above ( figure 3 ) , destabilize the native fold . additionally , the relaxation rate of the slow phase in tz4 - t - cl is at least 2 times faster than that of tz4 - t - ul , thus ruling out the possibility that the double - exponential kinetics observed in tz4 - t - cl could be due to a mixture of oxidized and reduced disulfides . relaxation kinetics of tz4 - t - cl in response to a t - jump from 28.9 to 39.7 c . the smooth line represents the best fit of this curve to the following double exponential function : od ( t ) = a + b1exp ( t / 1 ) + b2exp ( t / 2 ) , with b1 = 1.7510 , 1 = 0.500.05 s and b2 = 1.5610 , 2 = 4.70.6 s . temperature dependence of the fast and slow relaxation rate constants of tz4 - t - cl , as indicated . the green circles represent the relaxation rate constants of the wild - type trpzip4 near 40 c , which are reproduced from ref ( 42 ) . temperature dependence of the relaxation ( green ) , folding ( red ) and unfolding ( blue ) rate constants of tz4 - t - ul . the black smooth line represents the relaxation rate constant of the wild - type trpzip4 , reproduced from ref ( 42 ) . shown in the inset is a representative relaxation curve ( green ) of tz4 - t - ul in response to a t - jump from 33.2 to 41.2 c , and the smooth line represents the best fit of this curve to a single - exponential function with a relaxation time constant of 13.61.4 s . to further confirm that the double - exponential relaxation behavior observed is unique to tz4 - t - cl , we have also studied a second disulfide trpzip4 variant , tz4 - e - cl , where the cross - linker is introduced at the termini of the - hairpin and , hence , is not directly involved with interstrand hydrogen bonding or key side chain interactions . as shown ( figure 7 ) , similar to those observed for the wild - type and tz4 - t - ul , the t - jump induced conformational relaxation kinetics , measured only at high temperatures because of the peptide s high stability ( table 2 ) , are single - exponential . thus , these results provide further evidence supporting the notion that the disulfide cross - linker in tz4 - t - cl is unique in that it alters the folding mechanism of trpzip4 . relaxation kinetics of tz4 - e - cl in response to a t - jump from 69.7 to 82.0 c . the smooth line represents the best fit of this curve to a single - exponential function with a time constant of 1.30.5 s . the fact that the conformational relaxation of tz4 - t - cl occurs in a distinctively different manner than that of trpzip4 wild - type suggests that the cross - linker acts to introduce either an additional folding pathway by forming two distinct unfolded conformational states , as indicated in figure 1 , or an on - pathway folding intermediate ( i.e. , i in a sequential folding mechanism u i f ) . distinguishing between these two possibilities is not easy , as both could give rise to double - exponential relaxation kinetics with two drastically different rate constants . however , md simulations provide evidence indicating the presence of two unfolded populations . as a result , we propose that the folding mechanism follows the cartoon shown in figure 1 , where there are two pathways to the folded state : one with a barrier ( i.e. , from ub ) similar to the wild - type , and one ( i.e. , from ua ) with a much smaller barrier or no barrier at all . the above results support the notion that the disulfide cross - linker in tz4 - t - cl modifies the mechanism of trpzip4 folding by creating a partially folded , thermodynamically accessible state , ua , which folds on an ultrafast time scale ( 500 ns at 40 c ) . in addition , a simple calculation , using the relaxation rate constants of ua and ub , suggests that the difference in their folding free energy barrier heights ( i.e. , g ) is about 2.4 kbt . considering that ub has roughly the same relaxation rates as the wild - type and that small proteins typically have a free energy barrier in the range of 24 kbt , these results suggest that the folding of ua ( figure 1 ) proceeds without encountering any significant free energy barriers . in other words , we believe that ua behaves like a tsa and its folding rate , approximately ( 500 ns ) , reports on the dynamics of a fundamental event in - hairpin folding , namely , the process taking the system from the transition state to the folded state . to provide further evidence supporting the proposed folding mechanism , we carried out free energy calculations on tz4 - t - cl . specifically , we generated the folding free energy landscape of tz4 - t - cl using md simulations at 313 k as a function of turn residues , which include asp7 - lys10 , and the residues outside the turn region that are also involved in interstrand hydrogen bonding ( referred to as residues ) . as shown ( figure 8 ) , the simulations clearly indicate that two major unfolded populations are present , with one having a folded turn structure ( figure s2 , supporting information ) and likely corresponding to the proposed ua state . in addition , there is no apparent barrier between this unfolded state and the folded state , indicative of a downhill folding pathway . the second unfolded population observed in the simulations corresponds to a fully unfolded structure ( figure s3 , supporting information ) with none of the turn and - strand residues being native - like and , thus , is consistent with the proposed ub state . unlike the partially unfolded state , folding from this fully unfolded state involves a free energy barrier of 3.0 kbt , which agrees well with the value of 2.4 kbt calculated from experiments . similarly , simulations indicate that converting the fully unfolded state to the partially unfolded state also involves a free barrier that amounts to 3.0 kbt . for comparison , we also computed the folding free energy landscape of trpzip4 wild - type . as shown ( figure 9 ) , the folding free energy barrier is 5.0 kbt , which is in close range to the barrier height observed for ub in tz4 - t - cl . however , if folding were assumed to begin from an unfolded state similar to ua , the free energy barrier is significantly higher , showing that the disulfide cross - linker can indeed play a key role in modulating the folding free energy landscape . simulated free energy landscape of tz4 - t - cl presented as function of - strand residues versus the number of turn residues at 313k . simulated free energy landscape of trpzip4 wild - type presented as a function - strand residues versus the number of turn residues at 313k . in addition , a recent study by dyer and co - workers showed that a designed mini -- hairpin , cln025 , a variant of chignolin , with a preformed turn in the unfolded state , has a folding rate of ( 100 ns ) at 40 c . they attribute this ultrafast rate to an early hydrophobic collapsed structure that results in a free energy landscape with a minimal folding barrier . as a consequence , the folding rate is limited only by local rearrangements required to accommodate native hydrogen bond formation . since hamm and co - workers have shown that the rate of hydrogen bond formation occurs on a picosecond time scale , then the difference in the folding rates of cln025 and tz4 - t - cl ( from ua ) most likely reflects the difference in the times required to bring the two chains to their native geometries in these two cases . in other words , the rate of - hairpin structural evolution , from the transition state , should be limited by the chain diffusion rate or the rate of loop closure and , as a result , the longer folding time of tz4 - t - cl ( from ua ) is due to its longer chain length . to provide further support of this notion , we analyzed how the folding rate depends on chain length , using the number of native hydrogen bonds as a proxy . assuming that the turn is preformed for both cln025 and tz4 - t - cl ( from state ua ) , folding then involves propagation of two or four hydrogen bonds , respectively . as shown ( figure 10 ) , the folding time shows a power law dependence on the number of native hydrogen bonds to be propagated and , perhaps more interestingly , the value of the exponent ( 2.3 ) is almost identical to that ( 2.4 ) determined by makarov and co - workers for end - to - end loop closure time with respect to length for unstructured polymer chains . not only does this finding provide further evidence indicating that the folding of tz4 - t - cl , when it starts from state ua , encounters a small , if any , free energy barrier , but it also suggests that the time it takes to form native contacts in a peptide chain in a downhill folding scenario can be estimated by the rate of loop closure . finally , another line of evidence supporting the aforementioned power law relationship is that the rate of adding an extra - strand onto a folded three - stranded - sheet protein , which involves formation of four interstrand hydrogen bonds in a barrierless manner , was also found to be approximately ( 500 ns ) at 40 c . dependence of the folding time ( ) on the number of native hydrogen bonds ( nh ) . the smooth line represents the best fit of these points to the following equation : = 0nh , with 0 = 20 ns and = 2.3 . the transition state is the hallmark of protein folding dynamics . however , due to its transient nature , taking a snapshot of the folding transition state with sufficient structural resolution is inaccessible by current experimental techniques . thus , it would be helpful to devise a method that could create stable structural analogues of the transition state . here , we propose that it is possible to utilize a side chain cross - linker to restrict a particular backbonebackbone hydrogen bond site , thus allowing for the creation of a thermodynamically stable state analogous to the transition state . in a proof - of - principle study , we apply this idea to a small - hairpin model , trpzip4 , the transition state of which has been shown to involve turn formation . by strategically introducing a disulfide constraint in the turn regionthat , we believe , would facilitate native turn formation even in the unfolded state , we find that the conformational relaxation kinetics of the disulfide - bond - containing trpzip4 has two phases , indeed indicative of the presence of an additional state . further evidence supporting the notion that this cross - linked trpzip4 has an unfolded state that mimics the folding transition state of the wild - type is that the folding rate of this state , about ( 500 ns ) at 40 c , is approximately an order of magnitude faster than the wild - type . in addition , a simple analysis of the folding rate obtained from these results reveals that cross - linking the turn induces a free energy barrier decrease of 2.4 kbt . furthermore , md simulations performed on the cross - linked trpzip4 variant also corroborate the notion that two distinct unfolded populations are present : one with a preformed turn that folds via a barrierless pathway , and a second fully unfolded state that encounters a folding free energy barrier similar to that of the wild - type . more interestingly , we find that the time required to propagate a number of native hydrogen bond contacts after the major folding barrier follows a similar length dependence as observed in loop closure kinetics .\noutput:\n" }, { "from": "agent", "value": "understanding the structural nature of the free energy bottleneck ( s ) encountered in protein folding is essential to elucidating the underlying dynamics and mechanism . for this reason , several techniques , including - value analysis , have previously been developed to infer the structural characteristics of such high free - energy or transition states . herein we propose that one ( or few ) appropriately placed backbone and / or side chain cross - linkers , such as disulfides , could be used to populate a thermodynamically accessible conformational state that mimics the folding transition state . specifically , we test this hypothesis on a model - hairpin , trpzip4 , as its folding mechanism has been extensively studied and is well understood . our results show that cross - linking the two - strands near the turn region increases the folding rate by an order of magnitude , to about ( 500 ns ) 1 , whereas cross - linking the termini results in a hyperstable - hairpin that has essentially the same folding rate as the uncross - linked peptide . taken together , these findings suggest that cross - linking is not only a useful strategy to manipulate folding free energy barriers , as shown in other studies , but also , in some cases , it can be used to stabilize a folding transition state analogue and allow for direct assessment of the folding process on the downhill side of the free energy barrier . the calculated free energy landscape of the cross - linked trpzip4 also supports this picture . an empirical analysis further suggests , when folding of - hairpins does not involve a significant free energy barrier , the folding time ( ) follows a power law dependence on the number of hydrogen bonds to be formed ( nh ) , namely , = 0nh , with 0 = 20 ns and = 2.3 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: risk factors for developing this condition include light skin color , sun exposure , and old age . pressure applied to the adjacent helical rim results not only in accentuation , but also blanching of the nodules . weathering nodules are a benign , asymptomatic condition with a characteristic clinical appearance of skin colored to white papules or nodules . they are most often found on the helix of the ear , may be bilateral or unilateral , multiple or single , and usually measure 23 mm in width and 12 mm in height . we describe 10 patients who presented with weathering nodules and summarize the possible risk factors that predisposed them to develop this condition . over a 9 - month period , a clinical diagnosis of weathering nodules was made in 10 patients who presented to our clinic . characteristics recorded for these patients including age , gender , race , history of sun exposure , location and number of weathering nodules , as well as previous diagnoses of actinic keratosis and / or nonmelanoma skin cancer were collected and are summarized below [ table 1 ] . clinical characteristics of 10 patients with weathering nodules the patients with weathering nodules , diagnosed by clinical presentation , included 9 men , aging 38 - 70 years old ( median age was 56 ) and one woman who was 70 years old . the lesions were slightly whiter than the skin surrounding them [ figure 1 ] , had a smooth surface with occasional scaling , and blanched with pressure applied to the adjacent helix [ figures 2 and 3 ] . the majority of nodules measured approximately 23 mm in width and 12 mm in height , were present along the helix in all patients and along the antihelix as well in three patients ( cases 3 , 6 , and 8 ) [ figure 1 ] . one patient had a single lesion on the helix of his right ear ( case 3 ) ; the other patients displayed nodules that were multiple ( case 10 ) and grouped ( case 9 ) [ figure 4 ] , occasionally forming a scalloped appearance ( case 8 ) [ figure 1 ] . the female patient ( case 10 ) had multiple lesions on the right ear and a single lesion , as well as darwin 's tubercle , on the other ear . one of the men also had a darwin 's tubercle on his right ear ( case 1 ) [ figure 3 ] . weathering nodules on the helix and antihelix of the right ear are whiter than the surrounding skin of a man who had been exposed to ionizing radiation at 4 years old , and is also an avid surfer ( case 8 ) the right ear weathering nodules of a man with a history of poikiloderma of civatte ( case 4 ) are prominently seen when pressure is applied to the ear , which also caused the lesions blanch ( a and b ) a 38 - year - old man , with excessive sun exposure since childhood , who surfs ( case 1 ) . in addition to darwin 's tubercle ( a congenital variant of normal ear morphology where there is a thickening of the helix ) , subtle appearing weathering nodules on both the helix and the antihelix of the right ear are observed ( a ) . however , after pressure on the helix , the weathering nodules become more apparent ( b ) a man with grouped weathering nodules on the left ear helical rim and a history of excessive sun exposure since childhood ( case 9 ) these lesions were all incidental findings on examination . in all patients , pressure was placed on the helical rim and the lesions were noted to blanch ( positive blanch sign ) which clinically confirmed the diagnosis . all the patients confirmed greater than normal sun exposure , including outdoor activities or professions and lack of sunscreen use since childhood . eight patients ( cases 1 and 410 ) had concurrent actinic keratosis and three ( cases 6 , 8 , and 9 ) had actinically - induced malignancy . one patient ( case 8 ) had a history of bilateral auricular radiation therapy to cure his conductive deafness when he was 4 years old ; he reports that his weathering nodules have been present since he was 8 years old , implying that nonsolar radiation may play a role in the pathogenesis of weathering nodules . one patient ( case 5 ) was receiving prednisone and subsequently azathioprine for ulcerative colitis for at least 2 years ; hence , it is possible that systemic immune suppression , in addition to his sun exposure , may have contributed to the development of his weathering nodules . two patients ( cases 1 and 10 ) had darwin 's tubercle which correlates with the incidence of this congenital variant of ear morphology in the general population . weathering nodules are a benign condition with a characteristic clinical appearance of white to skin - colored papules about the ear , usually on the helix ; pressure on the adjacent helical rim not only enhances their presentation , but also results in blanching of the lesions : a positive blanch sign . weathering nodules were not recognized as a distinct condition until kavanagh et al . before this time , there were other case reports that likely described weathering nodules , but did not have a distinct medical diagnosis for them . increased age is likely a risk factor for developing weathering nodules , as reflected by the advanced age of the patients reported to have this condition ( median of 56 years old in this study ) ; however , this study presents the first two pediatric cases of weathering nodules in the literature , as one man ( case 8 ) claims to have had weathering nodules present from 8 years ; yet he also had a history of radiotherapy to his ears 4 years earlier , and the woman ( case 10 ) confirmed that nodules were present since she was 9 years old . thus , advanced age is likely a strong risk factor for developing these nodules , but it may not be integral to the pathogenesis of the condition . a predilection for weathering nodules to occur in men is anecdotally supported by the nine men and one woman in this study . indeed , individual reports that describe women with this condition are rare . the first woman in whom weathering nodules were reported was 35 years old , had bilateral lesions , and a 20 year history of increased time spent on outdoors . however , a more recent epidemiologic study of 400 patients performed on a tropical population ( brazil ) found an increased incidence of weathering nodules in women . they observed weathering nodules in 81 of 230 women as compared to 74 of 170 men . it has been proposed that women 's ears are normally protected from the sun by their long hair , protecting them from sun - induced ear damage . weathering nodules were also found to be more common within the tropical population studied ( 38.8 % , 155/400 ) when compared to a nontropical population ( 4 % , 4/100 ) . these data support the hypothesis that sun exposure has a significant role in the pathogenesis of these lesions . in addition , weathering nodules were previously thought to be found exclusively in white - or light - skinned populations ; indeed , they had previously been described asa condition found on caucasian men who have a history of significant cumulative sun exposure . although this claim was substantiated by earlier individual case reports , an epidemiologic study recently described five patients ( 17 % , 5/29 ) with fitzpatrick skin phototype v who had weathering nodules . however , to the best of our knowledge , no fitzpatrick phototype vi patients with weathering nodules have been reported . the morphology of these lesions is distinctive ; they typically present on the helix of the ear as multiple , nontender , white nodules with smooth surfaces measuring 23 mm in diameter and 12 mm in height . occasionally , they present with a gritty , scaling texture , which is suggestive of underlying cartilage . various other conditions may mimic weathering nodules , such as basal cell carcinoma , calcinosis cutis , chondrodermatitis nodularis helicis , elastotic nodules , follicular neoplasm ( including trichilemmomas ) , keratoacanthoma , sarcoidosis , squamous cell carcinoma , and tophi . chondrodermatitis nodularis helicis lesions are typically painful , pink or gray , often with a central crust - like scale or ulceration . elastotic nodules can be recognized as bilateral , pale , semi - translucent aggregates of pink - white material , with an orange - peel - like surface and associated pain . although the precise pathogenesis is unknown , consistent history of sun exposure andthis is supported by the epidermal atrophy , solar elastosis , and telangiectasias , which have been found to occur over the nodules and are known the consequences of solar damage . the majority of our patients who presented with these nodules ( 8 out of 10 ) had concurrent actinically - induced cutaneous malignancy , premalignancy , or both . increased sun exposure was also noted in all of our patients and is likely involved in the pathogenesis of these lesions . one of our patients developed weathering nodules at 8 years of age , 4 years after receiving bilateral auricular radiation therapy for hearing loss . although this treatment has been associated with many side effects , weathering nodules have not been described . this individual is unique ; aside from being the first case of pediatric weathering nodules , his clinical history suggests that the pathogenesis of weathering nodules may not only be caused by solar exposure , but may also result from other types of radiation exposure . histologically , the weathering nodules are made up of a spur of fibrous tissue with a focus of cartilage metaplasia . in contrast , elastotic nodules have disorganized thick collagen fibers replacing much of the dermis . weathering nodules are benign and asymptomatic . however , cryotherapy has been used with good results in two patients who had no recurrence of the lesions . however , the prognosis is favorable since there are no reports of skin cancer developing from the lesions . weathering nodules are benign lesions that have an easily recognizable clinical appearance : asymptomatic , white to flesh - colored papules on the helices of the ear . the lesions characteristically become more prominent and blanch when pressure is applied to the adjacent helical rim ; we introduce the descriptive terminology of a positive blanch sign when this pathognomonic feature of weathering nodules is clinically confirmed . all the patients in this report had lesions with morphology consistent with weathering nodules and a positive blanch sign ; in addition , they had a history of excess sun exposure or evidence of actinic damage . one of the patients had a pediatric onset of the condition following radiotherapy to the ears , raising the possibility that other forms of ionizing radiation , in addition to ultraviolet light , may have a potential role in the pathogenesis of this condition . weathering nodules are rarely mentioned in textbooks or in the literature and may be confused with other cutaneous conditions . therefore , it is paramount for clinicians to become familiar with the clinical presentation , epidemiology , and pathogenesis of these lesions to include them in the differential diagnosis of ear nodules . this will help avoid unnecessary biopsies as well as providing assurance of their benign behavior to patients . weathering nodules characteristically become more prominent and blanch when pressure is applied to the adjacent helical rim ; we introduce the descriptive terminology of a positive blanch sign when this pathognomonic feature of weathering nodules is clinically confirmed . actinic damage was previously thought to be fundamental in the development of these lesions ; however , we report a patient with pediatric onset of the condition following radiotherapy to the ears . this anecdotally supports the hypothesis that other forms of ionizing radiation , in addition to ultraviolet light , may have a potential role in the pathogenesis of these lesions . weathering nodules characteristically become more prominent and blanch when pressure is applied to the adjacent helical rim ; we introduce the descriptive terminology of a positive blanch sign when this pathognomonic feature of weathering nodules is clinically confirmed . actinic damage was previously thought to be fundamental in the development of these lesions ; however , we report a patient with pediatric onset of the condition following radiotherapy to the ears . this anecdotally supports the hypothesis that other forms of ionizing radiation , in addition to ultraviolet light , may have a potential role in the pathogenesis of these lesions . weathering nodules characteristically become more prominent and blanch when pressure is applied to the adjacent helical rim ; we introduce the descriptive terminology of a positive blanch sign when this pathognomonic feature of weathering nodules is clinically confirmed . actinic damage was previously thought to be fundamental in the development of these lesions ; however , we report a patient with pediatric onset of the condition following radiotherapy to the ears . this anecdotally supports the hypothesis that other forms of ionizing radiation , in addition to ultraviolet light , may have a potential role in the pathogenesis of these lesions .\noutput:\n" }, { "from": "agent", "value": "weathering nodules are a benign skin condition that usually present as papules on the helices of patients with significant prior sun exposure . they are easily recognized clinically and blanch upon application of pressure to the adjacent helical rim : a positive blanch sign . we describe the clinical presentation of weathering nodules in 10 patients , nine men and one woman , aging from 38 to 70 ( median 59 ) , and their associated risk factors . eight patients had a history of actinic keratosis , three had a history of nonmelanoma skin cancer , and all patients had increased sun exposure through outdoor activities . weathering nodules are rarely mentioned in the literature and may be confused with other cutaneous disorders . therefore , it is paramount for clinicians to become familiar with weathering nodules and include them in the differential diagnosis of ear nodules . appropriate diagnosis will help avoid unnecessary biopsies while reassuring the patient that the lesions are benign ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this regulation ensures that needed proteins are produced , while those whose function is not compatible with current needs are not . it may also serve to minimize the cost of protein production ; indeed , making proteins consumes cellular resources by using energy and nutrients as building blocks and also by occupying common cellular machineries such as ribosomes , polymerases , or chaperones , whose abundance may be limiting . definingthe cost of protein production , and the molecular processes limiting this production , is a central challenge in cellular physiology , which is relevant in particular for understanding the interplays among cell growth , cell division , and cell size . the cost of protein production is commonly attributed to protein translation ( andrews and hegeman , 1976 , emilsson and kurland , 1990 , kurland , 1992 , marr , 1991 , molin et al . , 1974 , scott and hwa , 2011 , scott et al . , 2010 , a major fraction of the cellular gtp pool is used for amino acid polymerization , while significantly lower quantities are invested in other processes including gene transcription and protein folding ( russell and cook , 1995 , schimmel , 1993 ) . ribosomes were implicated as the major factor limiting growth of rapidly growing cells ( dennis et al . , 2004 , emilsson and kurland , 1990 , klumpp et al . , 2013 , maale and kjeldgaard , 1966 , marr , 1991 , russell and cook , 1995 , scott et al . , 2010 , scott et al . , 2014 ,1993 ) , following the discovery that most of the cellular biosynthetic activity is devoted to making ribosomes ( bremer and dennis , 1996 ) and the observation that ribosome content is tightly coordinated with cell growth rate ( bremer and dennis , 1996 , schaechter et al . , 1958 , warner , 1999 ) . however , there is still a need for experimental data that directly map the molecular mechanisms limiting protein expression . the cost of protein production was extensively studied in e. coli . forced overexpression of the lac operon in medium lacking lactose leads to reduced cell growth and arrested the cell cycle when reaching 30 % of total proteome ( dong et al . , 1995 , horiuchi et al . , 1962 , nguyen et al . , 1989 , novick and weiner , 1957 , scott et al . , 2010 ) . this reduced growth was broadly interpreted as the cost of protein production ( dong et al . , 1995 , klumpp et al . , 2013 , scott et al . , 2010 , , 2008 , zamenhof and eichhorn , 1967 ) , although a recent study provided an alternative interpretation ( eames and kortemme , 2012 ) . only limited data are available describing protein burden in eukaryotic cells ( hauf et al . , 2000 , lang et al . , 2009 , maclean , 2007 ) , andit is not clear whether results inferred from one cell type , or from specific conditions , can be generalized to other organisms and environments . in this paper , we examined the relative contributions of gene transcription and protein translation to the cost of protein production in budding yeast , s. cerevisiae , and mapped the limitation to the initiation versus elongation steps of each process . we found that transcription and translation can both be limiting , depending on the growth conditions . in particular , our data challenge the hypothesis that ribosome content is a universal limiting factor defining growth rate of rapidly growing cells , as only slow - growing cells appeared to be limited in ribosome content . notably , endogenous protein expression was increased , rather than decreased , upon forced production of inert proteins , suggesting that the protein production capacity can readily adapt to increasing demands . we discuss the implications of our data for describing the interplay between protein production and cell growth . we therefore analyzed the impact of enforcing protein production on cell growth rate . expressing mcherry fluorescent protein using one of the strongest yeast promoters ( ptdh3 , glyceraldehyde -3-phosphate dehydrogenase enzyme ) resulted in a change in growth rate that was below our experimental resolution ( 2 % ) . to enforce higher expression levels , we cloned the ptdh3 - driven mcherry construct into a plasmid that integrates into the genome in multiple copies and generated a library of strains expressing one up to 20 copies of this construct ( figures 1a , 1b , and s1a ) , as measured by mcherry fluorescence and verified by qpcr of genomic dna ( figure 1c ) . proportionality between fluorescence levels and dna copy numbers was maintained for the full range of integrations and was compatible with protein abundances measured by western blots ( figures 1d and s1b ) . a comparable library was generated also using gfp , giving consistent results ( figure s3b ) . we calibrated the measured fluorescence levels using 15 gfp - fused proteins and available abundances data ( figures 1e and s1c ; table s3 ; supplemental experimental procedures ) . by thisfirst , we used direct comparison of growth curves of strain expressing a single copy or 18 integrations of ptdh3 - mcherry . the strain with 18 copies grew 18 % slower than the stain expressing a single copy ( figure 1f ) . second , relative growth rates were quantified for the full library using a sensitive competition assay ( figure 1 g ) . strains containing different integration number of ptdh3 - mcherry were co - incubated with gfp - labeled wild - type cells , and their relative abundance in the population of growing cells was quantified at subsequent times using a flow cytometer . when cells were grown in rich media ( ypd ) and maintained in log phase by serial dilutions , the relative growth rate decreased linearly with increasing mcherry fluorescence ( figure 1h ) . also by this estimate , each additional copy of the construct reduces the growth rate by 1 % ( figure s1d ) . to examinewhether protein burden depends on growth conditions , we repeated our measurements when growing cells in different media , this time allowing cells to enter and exit stationary phase . in all conditions tested , growth rate decreased linearly with increasing mcherry expression , although to different extents ( figures 2a , 2c , and s2 ) . notably , cells growing in low - phosphate conditions appeared less sensitive to the introduced burden compared to cells growing in standard media , possibly reflecting their somewhat lower division rate . exit from prolonged starvation was also delayed ( figure 2b ) , as was reported for e. coli ( shachrai et al . , 2010 ) . finally , when growing cells in continuous cultures , burdened cells reached a lower steady - state density ( figure 2d ) , indicating that they require a higher influx of the limiting nutrient for maintaining the same imposed growth rate . repeating our experiment using an additional library of lower - expression - capacity strains did not show measurable growth defects , verifying that the reduced fitness is not due to the multiple genomic integrations ( figures 3a , s3c , and s3d ) . in contrast , replacing wild - type gfp by its 20-fold less stable variant ( mateus and avery , 2000 ) had the same effect on fitness , confirming that growth is not impaired by accumulating gfp ( figures 3b and s3a ) . consistent with this , neither the mcherry nor the gfp proteins formed detectable aggregates ( figures 1b and s3f s3h ; supplemental information ) . because tdh3p is a key enzyme in glycolysis ( mcalister and holland , 1985 ) , the reduced growth rate of our strain could reflect impaired glycolysis resulting from competition with endogenous tdh3 expression . fluorescence levels in our library , however , increased linearly with the dna copy number ( figure 1c ) , suggesting limited competition between copies . furthermore , two additional libraries , in which mcherry was driven by different promoters ( ppdc1 and ppgk1 ) , showed practically the same fitness cost when normalized by expression levels ( figure 3c ) . more directly , we verified that the expression of tdh3 - gfp - fused protein was not lower in burdened cells in any of the conditions tested ( figure s3i ) . therefore , we can conclude that the reduced fitness of our library strains does not result from the multiple genomic integrations , protein toxicity , or impaired glycolysis , suggesting that it is the result of a limitation in the protein production process itself . we next wished to examine the relative contribution of protein translation and gene transcription to the cost of protein production . to this end , we generated an additional library in which mcherry was expressed from a destabilized mrna ( damp [ decreased abundance by mrna perturbation ] ; figure 4a ) ( muhlrad and parker , 1999 , schuldiner et al . , 2005 ) , thereby reducing the translation load while maintaining the same transcription burden . indeed , when expressed using the same tdh3 promoter , the damp strain produced 10-fold lower mcherry fluorescence ( figure s4a ) and 30-fold less mrna as measured by qpcr ( not shown ) . the burden on the translation machinery was thus reduced by 10-fold . by comparing fitness cost in these two libraries , we could therefore distinguish the cost coming from transcription from that coming from the translation process ; a cost that results from burdened translation depends only on the amount of mcherry produced , independently of whether it was transcribed from wild - type or destabilized mrna . in contrast , the cost originating from limiting transcription will depend on the genomic copy number ( transcribed genes ) , irrespective of how many proteins were eventually produced ( figure s4b ) . we applied this approach to cells growing at three different conditions : low phosphate , low nitrogen , and standard media ( sc ) . the relative contribution of transcription versus translation to the measured burden varied depending on growth conditions . in mediumlow in phosphate , the cost scaled with the genomic copy number , indicating that transcription is limiting . in contrast , in medium low in nitrogen , the cost scaled more with mcherry fluorescence , indicating that translation is limiting . in standard media ( sc ) , both transcription and translation contributed about equally to the fitness cost ( figures 4b4d , s4c , and s4d ) . cells growing in low phosphate are therefore limited in their transcription capacity , while cells growing in low nitrogen are limited in their translation capacity . to further verify that , we examined whether these different conditions inflict differential sensitivity to drugs that inhibit protein translation or gene transcription . indeed , cells growing in low nitrogen were more sensitive to the translation - inhibiting drug hygromycin b , while cells growing in low phosphate were more sensitive to the transcription - inhibiting drug phenanthroline ( figures s4e s4i ; supplemental information ) . we next wished to map the measured limitations to the initiation or the elongation steps of the respective transcription / translation processes . to this end , we generated an additional library , in which mcherry orf ( open reading frame ) was fused to gfp orf . the two orfs were separated by a linker , and were transcribed as a single unit using the tdh3 promoter ( figure 5a ) . mcherry fluorescence levels were invariant to the addition of gfp ( figure s5b ) . comparing the fitness of the new libraryto the original mcherry library enabled us to distinguish the relative contribution of initiation and elongation to protein burden . in standard media ( sc ) , the fitness cost scaled with mcherry fluorescence , irrespectively of gfp production , indicating that initiation is limiting . in contrast , in medium low in nitrogen , the cost scaled with the total length of the transcribed proteins , indicating that elongation is limiting ( figures 5b and s5d ) . introducing a stop codon between the mcherry and gfp , reduced mcherry levels , likely reflecting nonsense - mediated mrna decay ( hentze and kulozik , 1999 ; figures 5c , s5b , and s5c ) . fitness cost of expressing this construct in low - nitrogen medium still scaled with the total length of the translated proteins ( mcherry only ) ( figure 5d , left ) . in contrast , when growing this library in low phosphate , fitness cost scaled primarily with the genomic copy number and not with protein fluorescence , consistent with transcription initiation being the main limiting factor ( figure 5d , right ) . fitness cost here was still somewhat lower than that of the fused cherry - gfp , suggesting a minor contribution of translation elongation . ribosome content and energy are critical resources for protein translation and are often implicated in limiting protein production ( andrews and hegeman , 1976 , emilsson and kurland , 1990 , klumpp et al . , 2013 , maale and kjeldgaard , 1966 , marr , 1991 , scott et al . , 2010 , scott et al . , 2014 , we were therefore surprised that translation did not emerge as the universal , or major , factor limiting growth of our rapidly proliferating cells . furthermore , even in the one case where limitation was mapped exclusively to translation elongation ( low - nitrogen medium ) , it is more likely due to shortage of amino acids previously reported under these conditions ( boer et al . , 2010 ) . we reasoned that this might reflect the unconstrained availability of energy expected from fermenting cells , which direct the vast majority of their carbon molecules to produce ethanol ( figure 6a ) . indeed , each glucose molecule generates two atp molecules when fermented , but it can generate 36 atps if respired , so that a minor re - direction of the carbon flux toward respiration could provide all additional energy required when the translation capacity is forced to increase . as a result , we predicted that energy , and subsequently translation , would become limiting when growing cells on a suboptimal carbon source that can not be fermented . to test this possibilitycells division time was 6 hr ( figure s6a ) , compared to 1.5 hr for cells grown on glucose - supported media . as predicted , limitation was mapped exclusively to translation ; the reduced fitness of the damp and wild - type strains scaled with the amount of produced proteins , irrespective of mrna stability ( figures 6b and s6b ) . energy limitation could directly impact on translation elongation and perhaps indirectly impact ribosomal machinery , as producing ribosomes is the major biosynthetic activity of the cell ( bremer and dennis , 1996 , russell and cook , 1995 ) . we found that the cost of expressing the fused mcherry - gfp protein was the same as that of expressing mcherry alone , indicating that the limitation is due to translation initiation ( figures 6c , 6d , and s6c ) . while ribosome content could limit either initiation or elongation , a recent theoretical analysis concluded that initiation is the rate - limiting step in ribosome function ( shah et al . , 2013 ) . together , our results suggest that during this slow growth on a non - fermentable carbon source , protein production is limited by ribosome content . it is often assumed that microbes are optimized for rapid growth ( schaechter et al . , 1958 ) . accordingly , it is expected that cells grow at their maximal possible capacity and can not further increase their overall biosynthesis . in this framework , enforcing expression of unneeded proteins would necessarily come at the expense of producing other proteins ( klumpp et al . , 2013 , scott et al . , 2010 , our finding that ribosome content is not limiting under conditions of rapid growth , prompted us to re - visit this assumption . if protein production is not constrained , cells might grow larger when forced to express excessive amounts of proteins . we therefore examined whether cell size increased in our library strains using a coulter counter . indeed , cell volume increased in proportion to the produced mcherry proteins , with cells becoming up to 40 % bigger . this increase is consistent with the estimated fraction of added proteins and may therefore be at least partially explained by the extra proteins being produced ( figures 7a and 7b ) . note that as a consequence of the increased cell size , cell volume in our library is negatively correlated with the cell growth rate ( figure 7c ) . this negative correlation contrasts the typical positive correlation between size and division observed upon changing conditions ( schaechter et al . , 1958 ) but resembles the relationship observed when the influx of glucose does not match the levels predicted by sensing the environment ( schmidt - glenewinkel and barkai , 2014 ) . we next asked whether expression of the enforced mcherry protein comes at the expense of endogenous protein expression . to examine that , we selected a group of 90 gfp - fused proteins that span a broad range of expression levels ( figure s7a ; table s4 ) and used the synthetic genetic array ( sga ) technique ( cohen and schuldiner , 2011 , tong et al . , in short , the sga technique consists of mating an haploid cell expressing a given gfp - fused protein with a haploid cell expressing either high or low mcherry levels , subjecting the resulting diploid to meiosis and sporulation , germinating the spores , and selecting for haploids that contain both markers . we found variable levels of mcherry expression following sga using the high burden strain , indicating instability of the long tandem integrations during meiosis ( not shown ) . we next mixed together haploids containing the same gfp - fused proteins but either high or low mcherry proteins , grew them to log phase , and measured their fluorescence using flow cytometry . this provided direct comparison of the endogenous gfp - fused protein in high - and low - burden cells grown under the same precise conditions ( figure 7d ) . notably , expression of endogenous proteins increased , rather than decreased , when enforcing high expression of mcherry proteins . furthermore , on average , the increase in expression was proportional to the amount of enforced mcherry production and was dependent on the growth condition . the strongest effect was observed for cells grown in standard media ( sc ) , where we observed an averaged 20 % increase in endogenous protein expression in cells expressing 18 copies of the ptdh3 - mcherry construct . cells growing in low phosphate or low nitrogen also increased their endogenous protein expression in proportion to the enforced mcherry production , but to a significantly lower amount . in none of the cases did we observe an overall decreased average expression of the endogenous proteins below the low - burden gfp amounts ( figures 7e and s7b s7d ) . common notion holds that microorganisms , including bacteria and yeast , are optimized for rapid growth , making the most efficient use of nutrients once these become available in order to outgrow other microorganisms that share the same habitat . proteins are the growth driving force , but their production is a major consumer of energy and nutrients . what are the fundamental limits on cell growth rate ? what cellular resources are limiting , andour study touches on these questions by systematically interrogating the origins and consequences of protein burden : the reduced growth rate of cells that are forced to express increasingly high amounts of inert proteins . first , we demonstrate that forcing cells to either transcribe or translate inert proteins reduces cell growth in proportion to the introduced burden , and we map the relative contributions of these processes in different conditions . second , we find that the capacity of the cells to tolerate increased demand for transcription or translation differs between growth conditions , even when the growth rates themselves remain largely similar . finally , we show that cells adapt to the enforced burden by increasing their size and increasing the abundances of endogenous proteins , suggesting a general adaptation of the protein production machinery and a limited competition for common resources . our results call for revisiting some common notions invoked for describing the physiology of cell growth . the first is the question of whether maximal growth rate is set by optimal allocation of ribosomes , dedicating the maximal possible fraction of ribosomes to the task of producing new ribosomes . this notion comes largely from the realization that cell growth is fundamentally limited by ribosome translation . for example , if 50 % of the ribosomes are occupied in making new ribosomes , each one of those ribosomes will need to translate two ribosomes within each cell cycle . in e.coli , ribosome translation requires 610 min , in agreement with their 20 - min minimal division time ( scott et al . , 2010 ) . our results imply that budding yeast does not work in this limit , consistent with the larger difference between cell - cycle time ( 90 min ) and the time it takes to translate a eukaryotic ribosome ( 24 min ; planta and mager , 1998 , waldron et al . , 1977 ; supplemental information ) . thus , ribosome content was not universally limiting in the rapid growth conditions we tested . when we grew cells in medium containing low levels of phosphate ( while maintaining rapid growth ; figure 2c ) , limitation was mapped to transcription initiation . cells growing in sc were equally limited by transcription and translation initiation , whereas in yeast growing in low - nitrogen conditions , limitation was mapped to translation elongation ( figure 6d ) . this may be attributed to a shortage of ribosomes , but we find it more likely to result from the shortage of amino acids that has been described for this medium ( boer et al . , 2010 ) . therefore , ribosome activity readily adapts to the increasing translation demands , at least in some conditions . a likely implication of our results is therefore that rapidly growing cells do not produce proteins at their maximal possible capacity . this , again , calls for revisiting the common assumption that protein production is set by maximizing the use of some limiting resource , be it the ribosome , nutrient , or any other factor . indeed , we show that cells readily adapt to the increased protein production by increasing in size and the amount of endogenous proteins . if ribosomes , or other factors , are not limiting protein production and cell growth , what defines a cell s growth rate , and how does it depend on the number of proteins produced ? our data suggest that growth control involves the coordination of a variety of processes that function in parallel , with different growth conditions altering the relative importance of these processes . proposed cell physiological models ( bremer and dennis , 1996 , keren et al . , 2013 , klumpp et al . , 2013 , scott et al . , 2010 , zaslaver et al . , 2009 ) provide the necessary rigorous framework for formulating such limitations and testing possible hypotheses about their consequences . still , the space of possible models is too broad considering the scarcity of available experimental data . the experimental setup we have described provides data essential for restricting and refining the resource allocation models toward the goal of understanding cell physiology and , in particular , the interplay among protein production , cell size , and cell growth . by contrast , in higher eukaryotes , most cells grow slower . further , while budding yeast metabolize glucose by fermentation , respiration is predominant in most cells predominantly . by these criteria , these cells would be more similar to our glycerol - grown cells , in which ribosomes appear to be limitingall of the budding yeast ( s. cerevisiae ) strains in this study were based on by4741 , by4742 ( brachmann et al . ,1998 ) , or y8205 ( tong and boone , 2007 ) laboratory strains . manipulations were performed using a standard peg ; liac ; ssdna protocol ( gietz and woods , 2002 ) . for strains and plasmids used in this research , see supplemental experimental procedures and table s1 ; for strain stability , see supplemental information . strains were grown in ypd medium , ypeg medium , sc medium , or sc medium depleted of a specific nutrient , as described in the main text . were grown to stationery phase in sc medium overnight ( optical density [ od ] 10 ) and were left without shaking at 30c for 1 week . gfp and mcherry strains were then co - incubated in the specified media at 30c . the cells were diluted once a day and may have reached stationary phase ( except for the ypd log experiment , in which cells were diluted every 9 hr ) . forcells were harvested and frozen immediately in liquid nitrogen ; dna and rna were extracted using masterpure complete dna and rna purification kit ( epicenter , mc85200 ) , respectively . next , rna was reverse - transcribed to cdna using m - mlv reverse transcriptase kit ( promega , m1701 ) . cdna and dna levels were compared to the wild - type ( wt ) using act1 gene as reference ( lightcycler 480 , roche ) . following starvation , cells were returned to fresh sc medium and their od600 was measured every 10 min using an absorbance reader ( sunrise , tecan ) . lag time was defined as the time it took the cells to increase their od600 by 1.5-fold . cells were grown overnight in the different media , then diluted to od6000 .1 into shake flasks . ods were measured ( novaspec plus , amersham biosciences ) every 90/40 min ( low - nitrogen medium / other media , respectively ) for 12 hr and a final od600 measurement afternext , growth curves were plotted : log2 ( od ) as a function of time in hours . the generation time was calculated as 1 / s , where s is the slope s linear part in the growth curve . post - alkaline naoh protein extraction protocol was performed followed by standard quantitative western blot . soluble , insoluble , and total protein isolation and relative quantification were performed as previously described ( geiler - samerotte et al . , 2011 ) . cells were grown overnight to stationary phase , then diluted to a final od of 0.5 . the photos were taken by a delta vision 1 microscope ( applied precision ) with the following optics objective : olympus 60/1 .42 , plan apo n. all the strains were diluted after overnight growth and left growing to od6000 .3 . next the cultures were diluted 1:40 with 0.5 m nacl and immediately measured in a multisizer4 coulter counter ( beckman coulter ) ( coulter , 1953 ) . haploids from the sga selection , which possessed both the gfp - tagged protein and the different copies of mcherry , were grown overnight in the relevant media . the following day , cells from each plate were diluted 20 and mixed 1:1.5 ( low : high burden ) and were left to grow with shaking at 30c for 5 hr ( 6 hr for low - nitrogen medium ) before analysis in the flow cytometer ( 80,000 cells per well ) . for protein cost origin analysis and modeling and gfp haploid libraries analysis , see supplemental experimental procedures . e.m . - r . designed experiments , performed research , interpreted data and wrote the manuscript . g.j . designed chemostat experiments and performed research . n.b . designed and supervised research , interpreted data , and wrote the manuscript .\noutput:\n" }, { "from": "agent", "value": "summarythe economy of protein production is central to cell physiology , being intimately linked with cell division rate and cell size . attempts to model cellular physiology are limited by the scarcity of experimental data defining the molecular processes limiting protein expression . here , we distinguish the relative contribution of gene transcription and protein translation to the slower proliferation of budding yeast producing excess levels of unneeded proteins . in contrast to widely held assumptions , rapidly growing cells are not universally limited by ribosome content . rather , transcription dominates cost under some conditions ( e.g. , low phosphate ) , translation in others ( e.g. , low nitrogen ) , and both in other conditions ( e.g. , rich media ) . furthermore , cells adapted to enforced protein production by becoming larger and increasing their endogenous protein levels , suggesting limited competition for common resources . we propose that rapidly growing cells do not exhaust their resources to maximize growth but maintain sufficient reserves to accommodate changing requirements ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: nmr spectra were acquired on jeol eclipse 400 mhz and bruker avance 600 mhz spectrometers and referenced to residual solvent h and c signals ( h 7.26 , c 77.0 for cdcl3 ; and h 2.50 , c 39.5 for dmso - d6 ) . low - resolution esims spectra were acquired on jeol lc - mate mass spectrometer , while high - accuracy mass measurements were obtained on agilent 6230 mass spectrometer . the purification of the compounds was carried out on agilent 1200 hplc system equipped with a quaternary pump , a diode array detector , and a normal phase silica gel column ( phenomenex sphereclone , 4.6 mm 100 mm , 5 m ) at a flow rate of 1 ml / min . the octocoral l. alba was hand collected using scuba at 10 m near otoque island , located on the pacific ocean side off the coast of panama in august 2009 . a piece of the coral was rinsed with autoclaved seawater to remove loosely attached bacteria , and a small portion ( 0.5 ml ) of the coral mucus was inoculated directly on agar plates with the seawater - based nutrient medium ( 8 g of noble agar , 500 mg of mannitol , 100 mg of peptone , rifampicin [ 5 g / ml ] in 1 l of natural sea water ) . agar plates were taken to the laboratory and observed for bacterial isolation , at room temperature over a period of 1 month . strain gl0033 was further isolated from the collection plate and successively replated until a pure strain was obtained . the coral specimen was identified as l. alba based on its morphology and sem micrographs of the coral sclerites following breedy and guzman . the taxonomic identification of bacterial strain gl0033 was carried out using pcr amplification and 16 s rrna gene sequencing . the ncbi blast search for the gl0033 sequence indicated that this strain was 100 % similar to bacillus sp . reference specimens of the coral ( glot - 120209 - 02 ) and the bacterial strain ( gl0033 ) are deposited at indicasat 's cedd . bacterium gl0033 was inoculated in six 2 l erlenmeyer flasks , each containing 1 l of the culture broth ( 4 g of peptone , 2 g of the yeast extract , and 2 ml of glycerol in 1 l of natural seawater ) . twenty grams of sterile amberlite xad - 16 resin was added to each erlenmeyer flask with the culture medium . after 10 days of cultivation at room temperature ( 20c ) at 172 rpm , the resin was filtered , washed with deionized water , and eluted with methanol . the culture medium ( 6 l ) the organic extracts were combined and the solvents were removed under reduced pressure to yield 3.4 g of the crude extract . the crude extract ( 3.0 g ) was fractionated using reverse phase c - 18 solid phase extraction ( spe ) cartridges , eluted with a step gradient of 20 % , 40 % , 60 % , 80 % , and 100 % meoh in water . the meoh / water 60:40 spe fraction showed 84 % growth inhibition of the p. falciparum . the fraction was then subjected to hplc purification on a normal phase silica gel column ( phenomenex sphereclone , 2504.5 mm , 1 ml / min ) using the isocratic elution of 7:3 etoac / hexanes , over 70 mins to yield 0.8 mg of bacilosarcin a ( 1 ) , 0.7 mg of ai77 - f ( 2 ) , and 0.8 mg of ai77 - h ( 3 ) . bacilosarcin a ( 1 ) : white amorphous powder , 24.5 ( c 0.5 , chcl3 ) ; h nmr ( 400 mhz , cdcl3 ) 10.68 ( 1h , bs , oh ) , 7.42 ( 1h , dd , j = 8.2 , 7.5 hz , h - 6 ) , 6.94 ( 1h , d , j = 9.9 hz , h - 6 ) , 6.89 ( 1h , d , j = 8.2 hz , h - 7 ) , 6.70 ( 1h , d , j = 7.5 hz , h - 5 ) , 6.41 ( 1h , bs , nh ) , 4.59 ( 1h , dt , j = 13.1 , 2.7 hz , h - 3 ) , 4.39 ( 1h , m , h - 5 ) , 4.09 ( 1h , dd , j = 9.9 , 2.6 hz , h - 9 ) , 3.93 ( 1h , d , j = 9.9 hz , h - 8 ) , 3.50 ( 1h , dd , j = 7.0 , 2.6 hz , h - 10 ) , 3.08 ( 1h , dd , j = 16.1 , 13.1 hz , h - 4a ) , 2.84 ( 1h , dd , j = 16.1 , 2.7 hz , h - 4b ) , 2.63 ( 1h , d , j = 17.9 hz , h - 11a ) , 2.46 ( 1h , dd , j = 17.9 , 7.0 hz , h - 11b ) , 1.76 ( 1h , ddd , j = 13.8 , 9.9 , 4.9 hz , h - 4a ) , 1.66 ( 1h , m , h - 3 ) , 1.44 ( ddd , j = 13.8 , 9.1 , 4.8 hz , h - 4b ) , 1.34 ( 3h , s , h - 13 ) , 1.30 ( 3h , s , h - 16 ) , 0.97 ( 3h , d , j = 6.4 hz , h - 2 ) , 0.95 ( 3h , d , j = 6.3 hz , h - 1 ) ; c nmr ( 100 mhz , cdcl3 ) ppm 172.3 ( c , c - 7 ) , 171.3 ( c , c - 12 ) , 169.7 ( c , c - 1 ) , 162.1 ( c , c - 8 ) , 139.3 ( c , c - 10 ) , 136.6 ( ch , c - 6 ) , 118.2 ( ch , c - 5 ) , 116.3 ( ch , c - 7 ) , 108.1 ( c , c - 9 ) , 98.0 ( c , c - 15 ) , 81.2 ( ch , c - 3 ) , 72.5 ( ch , c - 9 ) , 69.7 , ( c , c - 14 ) , 68.2 ( ch , c - 8 ) , 49.6 ( ch , c - 5 ) , 47.9 ( ch , c - 10 ) , 41.0 ( ch2 , c - 4 ) , 30.5 ( ch2 , c - 4 ) , 30.3 ( ch2 , c - 11 ) , 24.7 ( ch , c - 3 ) , 23.8 ( ch3 , c - 16 ) , 23.1 ( ch3 , c - 2 ) , 21.8 ( ch3 , c - 1 ) , 21.3 ( ch3 , c - 13 ) ; hresitof - ms m / z 492.2338 [ m + h ] ( calculated for c24h34n3o8 , 492.2340 ) . ai77 - f ( 2 ) : white amorphous powder , 106.4 ( c 0.2 , chcl3 ) ; h nmr ( 400 mhz , dmso - d6 ) ppm 10.81 ( 1h , s , c8 - oh ) , 7.83 ( 1h , d , j = 10.0 , h - 6 ) , 7.52 ( 1h , dd , j = 5.7 , 1.1 , h - 10 ) , 7.50 ( 1h , t , j = 8.0 hz , h - 6 ) , 6.86 ( 1h , d , j = 8.0 , h - 7 ) , 6.84 ( 1h , d , j = 6.1 hz , h - 5 ) , 6.28 ( 1h , dd , j = 5.7 , 2.0 , h - 11 ) , 6.21 ( 1h , d , j = 6.0 , c8 - oh ) , 5.36 ( 1h , dt , j = 3.8 , 1.1 , h - 9 ) , 4.69 ( 1h , ddd , j = 8.9 , 6.0 , 4.2 , h - 3 ) , 4.41 ( 1h , dd , j = 6.6 , 3.8 , h - 8 ) , 4.17 ( 1h , ddd , j = 13.5 , 10.0 , 4.2 , h - 5 ) , 2.97 ( 2h , m , h - 4 ) , 1.69 ( 1h , m , h -4-a ) , 1.58 ( 1h , m , h - 3 ) , 1.31 ( 1h , ddd , j = 13.5 , 10.0 , 3.8 , h -4-b ) , 0.91 ( 3h , d , 6.6 , h - 2 ) , 0.84 ( 3h , d , 6.4 , h - 1 ) ; c nmr ( 100 mhz , dmso - d6 ) ppm 172.7 ( c , c - 12 ) , 169.7 ( c , c - 1 ) , 168.8 ( c , c - 7 ) , 160.81 ( c , c - 8 ) , 154.5 ( ch , c - 10 ) , 140.2 ( c , c - 10 ) , 136.3 ( ch , c - 6 ) , 121.7 ( ch , c - 11 ) , 118.5 ( ch , c - 5 ) , 115.3 ( ch , c - 7 ) , 108.4 ( c , c - 9 ) , 84.1 ( ch , c - 9 ) , 80.8 ( ch , c - 3 ) , 70.6 ( ch , c - 8 ) , 48.3 ( ch , c - 5 ) , 38.8 ( ch2 , c - 4 ) , 29.1 ( ch2 , c - 4 ) , 24.05 ( ch , c - 3 ) , 23.3 ( ch3 , c2 ) , 21.3 ( ch3 , c - 1 ) ; hresift - ms [ m + na ] + m / z 412.1365 ( calculated for c20h23no7na , 412.1367 ) . ai77 - h ( 3 ) : white amorphous powder , - 33 ( c 0.2 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) ppm 10.76 ( 1h , s , c8 - oh ) , 7.66 ( 1h , d , j = 5.1 hz , h - 10 ) , 7.41 ( 1h , t , j = 7.9 hz , h - 6 ) , 6.88 ( 1h , m , h - 7 ) , 6.87 ( 1h , m , h - 6 ) , 6.69 ( d , j = 7.9 hz , h - 5 ) , 6.19 ( 1h , d , j = 5.1 hz , h - 11 ) , 5.30 ( 1h , d , j = 5.1 hz , h - 9 ) , 4.60 ( 1h , d , j = 13.6 hz , h - 3 ) , 4.37 ( 1h , m , h - 5 ) , 4.30 ( 1h , d , j = 5.2 hz , h - 8 ) , 3.02 ( 1h , dd , j = 16.1 , 13.6 hz , h - 4a ) , 2.84 ( 1h , dd , j = 16.1 , 2.6 hz , h - 4b ) , 1.83 ( 1h , m , h - 4a ) , 1.69 ( 1h , m , h - 3 ) , 1.47 ( 1h , ddd , j = 13.8 , 9.2 , 4.6 hz , h - 4b ) , 0.97 ( 3h , d , j = 6.6 hz , h - 2 ) , 0.95 ( 3h , d , j = 6.1 hz , h - 1 ) ; c nmr ( 100 mhz , cdcl3 ) ppm 171.9 ( c , c - 12 ) , 169.4 ( c , c - 1 ) , 168.9 ( c , c - 7 ) , 162.2 ( c , c - 8 ) , 153.4 ( ch , c - 10 ) , 139.1 ( c , c - 10 ) , 136.5 ( ch , c - 6 ) , 122.9 ( ch , c - 11 ) , 118.2 ( ch , c - 5 ) , 116.3 ( ch , c - 7 ) , 108.0 ( c , c - 9 ) , 83.3 ( ch , c - 9 ) , 80.8 ( ch , c - 3 ) , 72.0 ( ch , c - 8 ) , 49.4 ( ch , c - 5 ) , 40.5 ( ch2 , c - 4 ) , 30.3 ( ch2 , c - 4 ) , 24.7 ( ch , c - 3 ) , 23.0 ( ch3,c - 2 ) , 21.8 ( ch3,c - 1 ) ; hresims [ m + na ] + m / z 412.1369 ( calculated for c20h23no7na , 412.1367 ) . the antiplasmodial activity was determined in a chloroquine - resistant p. falciparum strain ( w2 ) utilizing a microfluorimetric assay to measure the inhibition of the parasite growth based on the detection of the parasitic dna by intercalation with picogreen . the parasites were maintained in a 2 % hematocrit on flat - bottomed flasks ( 75 ml ) with the rpmi 1640 medium ( gibco - brl ) supplemented with 10 % human serum . cytotoxicity was measured in mcf - 7 human breast cancer cells with the cell viability being determined by mtt reduction . cells were seeded in 96 - well plates at a rate of 6000 cells / well in 180 l of the medium . after 24 h , the test chemicals were dissolved in dmso and diluted in the medium without fetal bovine serum and then added to the plate at a rate of 20 g / well . the octocoral l. alba was hand collected using scuba at 10 m near otoque island , located on the pacific ocean side off the coast of panama in august 2009 . a piece of the coral was rinsed with autoclaved seawater to remove loosely attached bacteria , and a small portion ( 0.5 ml ) of the coral mucus was inoculated directly on agar plates with the seawater - based nutrient medium ( 8 g of noble agar , 500 mg of mannitol , 100 mg of peptone , rifampicin [ 5 g / ml ] in 1 l of natural sea water ) . agar plates were taken to the laboratory and observed for bacterial isolation , at room temperature over a period of 1 month . strain gl0033 was further isolated from the collection plate and successively replated until a pure strain was obtained . the coral specimen was identified as l. alba based on its morphology and sem micrographs of the coral sclerites following breedy and guzman . the taxonomic identification of bacterial strain gl0033 was carried out using pcr amplification and 16 s rrna gene sequencing . the ncbi blast search for the gl0033 sequence indicated that this strain was 100 % similar to bacillus sp . reference specimens of the coral ( glot - 120209 - 02 ) and the bacterial strain ( gl0033 ) are deposited at indicasat 's cedd . bacterium gl0033 was inoculated in six 2 l erlenmeyer flasks , each containing 1 l of the culture broth ( 4 g of peptone , 2 g of the yeast extract , and 2 ml of glycerol in 1 l of natural seawater ) . twenty grams of sterile amberlite xad - 16 resin was added to each erlenmeyer flask with the culture medium . after 10 days of cultivation at room temperature ( 20c ) at 172 rpm , the resin was filtered , washed with deionized water , and eluted with methanol . the culture medium ( 6 l ) the organic extracts were combined and the solvents were removed under reduced pressure to yield 3.4 g of the crude extract . the crude extract ( 3.0 g ) was fractionated using reverse phase c - 18 solid phase extraction ( spe ) cartridges , eluted with a step gradient of 20 % , 40 % , 60 % , 80 % , and 100 % meoh in water . the meoh / water 60:40 spe fraction showed 84 % growth inhibition of the p. falciparum . the fraction was then subjected to hplc purification on a normal phase silica gel column ( phenomenex sphereclone , 2504.5 mm , 1 ml / min ) using the isocratic elution of 7:3 etoac / hexanes , over 70 mins to yield 0.8 mg of bacilosarcin a ( 1 ) , 0.7 mg of ai77 - f ( 2 ) , and 0.8 mg of ai77 - h ( 3 ) . bacilosarcin a ( 1 ) : white amorphous powder , 24.5 ( c 0.5 , chcl3 ) ; h nmr ( 400 mhz , cdcl3 ) 10.68 ( 1h , bs , oh ) , 7.42 ( 1h , dd , j = 8.2 , 7.5 hz , h - 6 ) , 6.94 ( 1h , d , j = 9.9 hz , h - 6 ) , 6.89 ( 1h , d , j = 8.2 hz , h - 7 ) , 6.70 ( 1h , d , j = 7.5 hz , h - 5 ) , 6.41 ( 1h , bs , nh ) , 4.59 ( 1h , dt , j = 13.1 , 2.7 hz , h - 3 ) , 4.39 ( 1h , m , h - 5 ) , 4.09 ( 1h , dd , j = 9.9 , 2.6 hz , h - 9 ) , 3.93 ( 1h , d , j = 9.9 hz , h - 8 ) , 3.50 ( 1h , dd , j = 7.0 , 2.6 hz , h - 10 ) , 3.08 ( 1h , dd , j = 16.1 , 13.1 hz , h - 4a ) , 2.84 ( 1h , dd , j = 16.1 , 2.7 hz , h - 4b ) , 2.63 ( 1h , d , j = 17.9 hz , h - 11a ) , 2.46 ( 1h , dd , j = 17.9 , 7.0 hz , h - 11b ) , 1.76 ( 1h , ddd , j = 13.8 , 9.9 , 4.9 hz , h - 4a ) , 1.66 ( 1h , m , h - 3 ) , 1.44 ( ddd , j = 13.8 , 9.1 , 4.8 hz , h - 4b ) , 1.34 ( 3h , s , h - 13 ) , 1.30 ( 3h , s , h - 16 ) , 0.97 ( 3h , d , j = 6.4 hz , h - 2 ) , 0.95 ( 3h , d , j = 6.3 hz , h - 1 ) ; c nmr ( 100 mhz , cdcl3 ) ppm 172.3 ( c , c - 7 ) , 171.3 ( c , c - 12 ) , 169.7 ( c , c - 1 ) , 162.1 ( c , c - 8 ) , 139.3 ( c , c - 10 ) , 136.6 ( ch , c - 6 ) , 118.2 ( ch , c - 5 ) , 116.3 ( ch , c - 7 ) , 108.1 ( c , c - 9 ) , 98.0 ( c , c - 15 ) , 81.2 ( ch , c - 3 ) , 72.5 ( ch , c - 9 ) , 69.7 , ( c , c - 14 ) , 68.2 ( ch , c - 8 ) , 49.6 ( ch , c - 5 ) , 47.9 ( ch , c - 10 ) , 41.0 ( ch2 , c - 4 ) , 30.5 ( ch2 , c - 4 ) , 30.3 ( ch2 , c - 11 ) , 24.7 ( ch , c - 3 ) , 23.8 ( ch3 , c - 16 ) , 23.1 ( ch3 , c - 2 ) , 21.8 ( ch3 , c - 1 ) , 21.3 ( ch3 , c - 13 ) ; hresitof - ms m / z 492.2338 [ m + h ] ( calculated for c24h34n3o8 , 492.2340 ) . ai77 - f ( 2 ) : white amorphous powder , 106.4 ( c 0.2 , chcl3 ) ; h nmr ( 400 mhz , dmso - d6 ) ppm 10.81 ( 1h , s , c8 - oh ) , 7.83 ( 1h , d , j = 10.0 , h - 6 ) , 7.52 ( 1h , dd , j = 5.7 , 1.1 , h - 10 ) , 7.50 ( 1h , t , j = 8.0 hz , h - 6 ) , 6.86 ( 1h , d , j = 8.0 , h - 7 ) , 6.84 ( 1h , d , j = 6.1 hz , h - 5 ) , 6.28 ( 1h , dd , j = 5.7 , 2.0 , h - 11 ) , 6.21 ( 1h , d , j = 6.0 , c8 - oh ) , 5.36 ( 1h , dt , j = 3.8 , 1.1 , h - 9 ) , 4.69 ( 1h , ddd , j = 8.9 , 6.0 , 4.2 , h - 3 ) , 4.41 ( 1h , dd , j = 6.6 , 3.8 , h - 8 ) , 4.17 ( 1h , ddd , j = 13.5 , 10.0 , 4.2 , h - 5 ) , 2.97 ( 2h , m , h - 4 ) , 1.69 ( 1h , m , h -4-a ) , 1.58 ( 1h , m , h - 3 ) , 1.31 ( 1h , ddd , j = 13.5 , 10.0 , 3.8 , h -4-b ) , 0.91 ( 3h , d , 6.6 , h - 2 ) , 0.84 ( 3h , d , 6.4 , h - 1 ) ; c nmr ( 100 mhz , dmso - d6 ) ppm 172.7 ( c , c - 12 ) , 169.7 ( c , c - 1 ) , 168.8 ( c , c - 7 ) , 160.81 ( c , c - 8 ) , 154.5 ( ch , c - 10 ) , 140.2 ( c , c - 10 ) , 136.3 ( ch , c - 6 ) , 121.7 ( ch , c - 11 ) , 118.5 ( ch , c - 5 ) , 115.3 ( ch , c - 7 ) , 108.4 ( c , c - 9 ) , 84.1 ( ch , c - 9 ) , 80.8 ( ch , c - 3 ) , 70.6 ( ch , c - 8 ) , 48.3 ( ch , c - 5 ) , 38.8 ( ch2 , c - 4 ) , 29.1 ( ch2 , c - 4 ) , 24.05 ( ch , c - 3 ) , 23.3 ( ch3 , c2 ) , 21.3 ( ch3 , c - 1 ) ; hresift - ms [ m + na ] + m / z 412.1365 ( calculated for c20h23no7na , 412.1367 ) . ai77 - h ( 3 ) : white amorphous powder , - 33 ( c 0.2 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) ppm 10.76 ( 1h , s , c8 - oh ) , 7.66 ( 1h , d , j = 5.1 hz , h - 10 ) , 7.41 ( 1h , t , j = 7.9 hz , h - 6 ) , 6.88 ( 1h , m , h - 7 ) , 6.87 ( 1h , m , h - 6 ) , 6.69 ( d , j = 7.9 hz , h - 5 ) , 6.19 ( 1h , d , j = 5.1 hz , h - 11 ) , 5.30 ( 1h , d , j = 5.1 hz , h - 9 ) , 4.60 ( 1h , d , j = 13.6 hz , h - 3 ) , 4.37 ( 1h , m , h - 5 ) , 4.30 ( 1h , d , j = 5.2 hz , h - 8 ) , 3.02 ( 1h , dd , j = 16.1 , 13.6 hz , h - 4a ) , 2.84 ( 1h , dd , j = 16.1 , 2.6 hz , h - 4b ) , 1.83 ( 1h , m , h - 4a ) , 1.69 ( 1h , m , h - 3 ) , 1.47 ( 1h , ddd , j = 13.8 , 9.2 , 4.6 hz , h - 4b ) , 0.97 ( 3h , d , j = 6.6 hz , h - 2 ) , 0.95 ( 3h , d , j = 6.1 hz , h - 1 ) ; c nmr ( 100 mhz , cdcl3 ) ppm 171.9 ( c , c - 12 ) , 169.4 ( c , c - 1 ) , 168.9 ( c , c - 7 ) , 162.2 ( c , c - 8 ) , 153.4 ( ch , c - 10 ) , 139.1 ( c , c - 10 ) , 136.5 ( ch , c - 6 ) , 122.9 ( ch , c - 11 ) , 118.2 ( ch , c - 5 ) , 116.3 ( ch , c - 7 ) , 108.0 ( c , c - 9 ) , 83.3 ( ch , c - 9 ) , 80.8 ( ch , c - 3 ) , 72.0 ( ch , c - 8 ) , 49.4 ( ch , c - 5 ) , 40.5 ( ch2 , c - 4 ) , 30.3 ( ch2 , c - 4 ) , 24.7 ( ch , c - 3 ) , 23.0 ( ch3,c - 2 ) , 21.8 ( ch3,c - 1 ) ; hresims [ m + na ] + the antiplasmodial activity was determined in a chloroquine - resistant p. falciparum strain ( w2 ) utilizing a microfluorimetric assay to measure the inhibition of the parasite growth based on the detection of the parasitic dna by intercalation with picogreen . the parasites were maintained in a 2 % hematocrit on flat - bottomed flasks ( 75 ml ) with the rpmi 1640 medium ( gibco - brl ) supplemented with 10 % human serum . cytotoxicity was measured in mcf - 7 human breast cancer cells with the cell viability being determined by mtt reduction . cells were seeded in 96 - well plates at a rate of 6000 cells / well in 180 l of the medium . after 24 h , the test chemicals were dissolved in dmso and diluted in the medium without fetal bovine serum and then added to the plate at a rate of 20 g / well . the bacterial strain gl0033 was isolated from the octocoral l. alba collected near otoque island , gulf of panama , pacific panama . the organic crude extract of strain gl0033 obtained from the culture broth showed a strong inhibition on the growing of chloroquine - resistant plasmodium falciparum . the bioassay - guided fractionation of the extract using spe fractionation followed by hplc purification yielded compounds 13 [ figure 1 ] . structures of 13 were identified as bacilosarcin a ( 1 ) , ai77 - f ( 2 ) , and ai77 - h ( 3 ) , on the basis of their spectroscopic data ( h - nmr , c - nmr , hresitof - ms , and optical rotations ) and their comparison with spectroscopic data from the literature . structures of compounds 1 - 3 isolated from bacillus sp compounds 13 where evaluated for their activity against chloroquine - resistant p. falciparum [ table 1 ] . bacilosarcin a ( 1 ) showed an ic50 value of 2.2 m in the antiplasmodial assay , whereas compounds 12 did not show any activity [ table 1 ] . biological activity of compounds 13 against plasmodium falciparum and mcf - 7 breast cancer cell lines compounds 13 possess the same 3,4 - dihydro -8-hydroxy - isocoumarin moiety ; however , bacilosarcin a ( 1 ) includes a 3 - oxa -6,9-diazabicyclo [ 3.3.1 ] nonane ring system attached to carbon c - 8 , instead of the -- unsaturated butenolide ring present in compounds 2 and 3 . from these structural features , we can infer that the heterobicyclic ring system attached to c - 8 in bacilosarcin a is required for its antimalarial activity . compounds 13 were also evaluated for their cytotoxicity using mcf - 7 human breast cancer cell lines and showed no significant cytotoxic effect in this assay [ table 1 ] . one of the more remarkable structural features of bacilosarcin a ( 1 ) is its unprecedented 3 - oxa -6,9-diazabicyclo [ 3.3.1 ] nonane ring system which brought the attention of synthetic organic chemists resulting in the total synthesis of compound 1 . this is the first report of the antiplasmodial activity of bacilosarcin a ( 1 ) , which constitutes a new addition to the few existing antiplasmodial metabolites isolated from heterotrophic bacteria associated with corals . this finding confirms that bacteria associated with marine invertebrates represent a promising resource for antimalarial research .\noutput:\n" }, { "from": "agent", "value": "aim : this study was designed for isolating and characterizing antiplasmodial compounds from marine octocoral - associated bacteria.materials and methods : the organic extract of the bacillus sp . was subjected to purification using several chromatography techniques guided by bioassays to yield three isocoumarin derivatives ( 13 ) . chemical structures of the compounds were elucidated on the basis of hrms spectra and nmr spectroscopy . the antiplasmodial activity of the isolated compounds was evaluated in vitro against the chloroquine - resistant plasmodium falciparum strain w2.results : isolated compounds were identified as bacilosarcin a ( 1 ) , ai77 - f ( 2 ) , and ai77 - h ( 3 ) . bacilosarcin a ( 1 ) displayed a low micromolar activity ( ic50 = 2.2 m ) against p. falciparum while compounds 2 and 3 showed no activity.conclusions : bacilosarcin a was found to be responsible for the antiplasmodial activity observed in the crude extract obtained from the bacillus sp ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the main treatment for renal cell carcinoma ( rcc ) is radical nephrectomy ( rn ) , and rn has been the gold standard treatment for rcc during the last 2 decades . however , the risk of deteriorated renal function after rn has now been well documented . the incidental detection of renal masses has dramatically increased the number of patients presenting with locally confined rcc , and this calls for multiple options for the surgical therapy . consequently , there has been a continuous development of partial nephrectomy ( pn ) to avoid unnecessary destruction of nephrons . the benefits of pn include a decreased risk of long - term renal insufficiency and a positive impact on the quality of life [ 5 - 7 ] . thus , according to the current guidelines , pn is now indicated for rcc less than 4 cm . although earlier studies suggested that 4 cm be established as the maximum size for pn , recent data suggest that it might be possible to extend the success and benefits of pn to treating tumors 4 cm in size . thus , we retrospectively evaluated and compared the oncologic and functional outcomes of patients treated with pn and rn for pt1b stage rcc . a total of 70 patients who were diagnosed with pt1bn0m0 rcc between january 1995 and december 2004 were included in this study . all of the patients underwent pn ( n = 18 , 25.7 % ) or rn ( n = 52 , 74.3 % ) by an experienced surgeon , and standard techniques were used for both pn ( under the cold ischemic condition ) and rn . the preoperative clinical tumor staging workup included computed tomography ( ct ) or magnetic resonance imaging ( mri ) of the abdomen and pelvis and chest radiography . the patients ' age , gender , past medical history ( diabetes mellitus , hypertension ) , charlson comorbidity index score , follow - up duration , body mass index ( bmi ) , preoperative symptoms , and pathologic factors ( tumor size , location , histologic type , and fuhrman 's nuclear grade ) were investigated . to identify the oncologic outcome , the 5 - year overall survival ( os ) , 5 - year recurrence - free survival ( rfs ) , and 5 - year cancer - specific survival ( css ) were compared between each group . to evaluate renal function , the preoperative and postoperative ( immediate and 1 year after nephrectomy ) serum creatinine level and estimated glomerular filtration rate ( gfr ) were analyzed . the estimated gfr was calculated by using the modification of diet in renal disease ( mdrd ) equation . all the patients received a follow - up visit at 1 to 2 weeks after discharge for assessing their general health status . after the first visit , the patients received follow - up evaluations every 3 or 6 months until the first year , and then annually . at these times , they were evaluated for newly developed symptoms and they underwent careful physical examinations , laboratory tests , and radiologic tests ( chest x - ray , ultrasonography [ usg ] , ct ) . the usg , ct , and / or mri were checked to evaluate for local recurrence or distant metastasis . decreased renal function was evaluated according to the national kidney foundation dialysis outcomes quality initiative clinical practice guidelines . the 5 - year os , rfs , and css were estimated by using the kaplan - meier method . the effect of surgery on renal function , according to the serum creatinine levels and estimated gfr , was analyzed by using the mann - whitney u test . a 5 % level of significance was used for all statistical testing , and all statistical tests were two - sided . the analysis was performed by using the statistical software spss ( 17.0 ko for windows , release 14.0.2 ) . a total of 70 patients who were diagnosed with pt1bn0m0 rcc between january 1995 and december 2004 were included in this study . all of the patients underwent pn ( n = 18 , 25.7 % ) or rn ( n = 52 , 74.3 % ) by an experienced surgeon , and standard techniques were used for both pn ( under the cold ischemic condition ) and rn . the preoperative clinical tumor staging workup included computed tomography ( ct ) or magnetic resonance imaging ( mri ) of the abdomen and pelvis and chest radiography . the patients ' age , gender , past medical history ( diabetes mellitus , hypertension ) , charlson comorbidity index score , follow - up duration , body mass index ( bmi ) , preoperative symptoms , and pathologic factors ( tumor size , location , histologic type , and fuhrman 's nuclear grade ) were investigated . to identify the oncologic outcome , the 5 - year overall survival ( os ) , 5 - year recurrence - free survival ( rfs ) , and 5 - year cancer - specific survival ( css ) were compared between each group . to evaluate renal function , the preoperative and postoperative ( immediate and 1 year after nephrectomy ) serum creatinine level and estimated glomerular filtration rate ( gfr ) were analyzed . the estimated gfr was calculated by using the modification of diet in renal disease ( mdrd ) equation . all the patients received a follow - up visit at 1 to 2 weeks after discharge for assessing their general health status . after the first visit , the patients received follow - up evaluations every 3 or 6 months until the first year , and then annually . at these times , they were evaluated for newly developed symptoms and they underwent careful physical examinations , laboratory tests , and radiologic tests ( chest x - ray , ultrasonography [ usg ] , ct ) . the usg , ct , and / or mri were checked to evaluate for local recurrence or distant metastasis . the stage was reassessed according to the 2002 tnm classification system . decreased renal function was evaluated according to the national kidney foundation dialysis outcomes quality initiative clinical practice guidelines . the 5 - year os , rfs , and css were estimated by using the kaplan - meier method . the effect of surgery on renal function , according to the serum creatinine levels and estimated gfr , was analyzed by using the mann - whitney u test . a 5 % level of significance was used for all statistical testing , and all statistical tests were two - sided . the analysis was performed by using the statistical software spss ( 17.0 ko for windows , release 14.0.2 ) . the mean ages of the patients were 47.39.8 years and 57.310.7 years for the pn and rn groups , respectively . the mean follow - up durations of the patients treated with pn and rn were 78.244.1 months and 66.543.6 months , respectively . the characteristics of the 70 patients with pt1b rcc are shown in table 1 . the 5 - year os rate ( 92.3 % vs. 87.8 % , p = 0.501 ) , the 5 - year rfs rate ( 92.3 % vs. 77.8 % , p = 0.175 ) , and the 5 - year css rate ( 92.3 % vs. 94.5 % , p = 0.936 ) for the pn and rn groups showed no significant difference ( fig . 1 - 3 ) . one patient ( 5.5 % ) and 9 patients ( 17.3 % ) showed distant metastasis in the pn and rn groups , respectively . details of distant metastasis are summarized in table 2 . when comparing the renal function of the pn and rn groups , the proportion of patients with decreased renal function in the rn group was higher than that in the pn group ( pn = 0 % vs. rn = 11.5 % ) . the postoperative change ( 1 year after nephrectomy ) in the serum creatinine level was greater in the rn group than in the pn group ( pn = 0.20.2 mg / dl vs. rn = 0.30.5 mg / dl , p = 0.150 ) . the postoperative change ( 1 year after nephrectomy ) in the estimated gfr was also greater in the rn group than in the pn group ( pn = 12.19.1 ml / min / 1.73 m vs. rn = 18.112.5 ml / min / 1.73 m , p = 0.162 ) , but the difference was statistically insignificant ( table 3 ) . rn has generally remained the standard treatment for localized rcc for many decades because of concern about incomplete tumor excision , local recurrence , microscopic satellite tumors , and multifocality . initially , pn was accepted as the standard treatment of only localized rcc with imperative or absolute indications ( patients with a solitary kidney or bilateral rcc ) . the relative indications are a functioning contralateral kidney that is affected by comorbidities that might impair future renal function , such as diabetes , arterial hypertension , and arteriosclerosis , including the hereditary forms of rcc . elective indications are those for a perfectly normal contralateral kidney . with the widespread use of advanced diagnostic imaging techniques such usg , ct , and mri , a large number of renal masses are being incidentally found before they produce symptoms . several studies have suggested that rn is a significant risk factor for the development of chronic kidney disease . huang et al reported that the risk of new onset of chronic kidney disease is significantly greater in patients undergoing rn than in those undergoing pn . pn provides multiple options for surgically treating renal tumors , and during the last decade the urological community has come to accept pn as a safe , effective alternative to rn in elective situations . according to the 2007 rcc guidelines of the european association of urology , pn is the standard treatment for patients with clinically localized rcc 4 cm ( t1a tumors ) . just as pn for t1a tumorshas become well accepted , physicians are now raising the issue of expanding the indications for elective pn to include larger tumors . several studies have suggested that the indications for pn can be safely expanded to include patients with rcc up to 7 cm ( t1b tumors ) [ 16 - 18 ] . leibovich et al have reported 5 - year css rates of 95 % and 98 % for patients with tumors measuring 4 to 7 cm and who underwent pn and rn , respectively . patard et al reported 3 - year css rates of 98 % and 97 % for patients who underwent pn for tumors 4 and 4 cm , respectively . these data justify the use of nephron - sparing surgery for larger , anatomically amenable tumors . another advantage of pn includes preservation of the maximum renal parenchyma , which help to avoid end - stage renal disease and positively impacts the quality of life . chronic renal failure and dialysis are associated with significant cardiovascular morbidity and mortality , and it has been suggested that rn may impact long - term survival compared with pn for renal tumors . weight et al have reported that the average excess loss of renal function observed with rn was associated with a 25 % increased risk of cardiac death and 17 % increased risk of death from any cause in a multivariate analysis . thompson et al reported that pn decreases the risk of chronic renal failure and complications including hip fractures and cardiovascular morbidity . lesage et al recently compared open pn and rn for renal tumors , and they concluded that the former resulted in a better quality of life due to the preservation of renal function . dash et al compared the outcomes of elective pn vs. rn for clear cell rcc 4 to 7 cm in size . they showed that renal function was better preserved after pn and that there was no clear evidence that pn was associated with an inferior oncological outcome . furthermore , the results of a recent retrospective study have shown that in selected patients with stage t1b - t3n0m0 rcc 4 cm in size , laparoscopic pn provides intermediate - term oncological efficacy equivalent to that of laparoscopic rn and the renal function outcomes are superior to that of laparoscopic rn . in this study , pn and rn showed similar results for os ( 92.3 % vs. 87.8 % , p = 0.501 ) , rfs ( 92.3 % vs. 77.8 % , p = 0.175 ) , and css ( 92.3 % vs. 94.5 % , p = 0.936 ) , respectively . furthermore , the proportion of patients with decreased renal function ( pn = 0 % vs. rn = 11.5 % ) and postoperative changes in the serum creatinine level 1 year after nephrectomy ( 0.20.2 mg / dl vs. 0.30.5 mg / dl , p = 0.150 ) was better in the pn group than in the rn group . thus , our results showed that pn is a safe and effective method for treating pt1b rcc and the oncologic and functional outcomes are good . the limitations of this study included the retrospective nature of the analysis , the smaller number of patients in the pn group ( n = 18 ) , the small numbers of oncologic events in both groups , that it was a single - surgeon experience , and the intermediate duration of follow - up . because this was a retrospective study , the patients were not randomly assigned to a surgical procedure , which meant that the choice of surgery might have been biased by the surgeons ' preference according to the preoperative condition of the patient . with time , increased patient numbers , prolonged follow - up duration , and increased numbers of events will be available for study . previous studies have demonstrated that for rcc 4 cm , pn has excellent survival and recurrence rates . although pn is a controversial choice for larger tumors , we demonstrated that pt1b patients can also be treated safely and they can expect an optimal long - term oncologic efficacy with pn . therefore , pn is effective for patients with pt1b rcc and it provides long - term tumor control while preserving renal function . in this study , pn for patients with pt1b rcc had no statistically significant difference in prognosis compared with that of rn , and the renal function of the patients who underwent pn was better .\noutput:\n" }, { "from": "agent", "value": "purposepartial nephrectomy ( pn ) for patients with t1a renal cell carcinoma ( rcc ) has increasingly become accepted , although its role for patients with t1b rcc remains controversial . we retrospectively evaluated and then compared the oncologic and functional outcomes of patients with pt1b rcc who were treated with pn or radical nephrectomy ( rn ) . materials and methodsa total of 70 patients who were diagnosed with pt1bn0m0 rcc between january 1995 and december 2004 were included . the 5 - year overall survival ( os ) , the 5 - year recurrence - free survival ( rfs ) , and the 5 - year cancer - specific survival ( css ) were compared between the groups . preoperative and postoperative serum creatinine and estimated glomerular filtration rate ( gfr ) levels were analyzed to assess renal function.resultsthe 5 - year os ( 92.3 % vs. 87.8 % , p = 0.501 ) , rfs ( 92.3 % vs. 77.8 % , p = 0.175 ) , and css ( 92.3 % vs. 94.5 % , p = 0.936 ) of the pn and rn groups were not statistically different . the proportion of patients with decreased renal function was lower in the pn group than in the rn group ( pn = 0 % vs. rn = 11.5 % ) . the postoperative change in serum creatinine and the gfr 1 year after nephrectomy was higher in the rn group than in the pn group ( pn = 0.20.2 , 12.19.1 vs. rn = 0.30.5 , 18.112.5 ) , but there was no statistical difference.conclusionsthere were no statistically significant differences in prognosis or renal function between patients treated with pn and those treated with rn for pt1b rcc . pn may be a useful treatment modality for patients with pt1b rcc ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: haloterrigena turkmenica ( zvyagintseva and tarasov 1987 ) ventosa et al . 1999 , comb . it is of phylogenetic interest because of the yet unclear position of the genera haloterrigena and natrinema within the halobacteriaceae , which created some taxonomic problems historically . we describe the features of this organism , together with the complete genome sequence , and annotation . h. turkmenica wanu15 strain was isolated on a complex medium described by wallace ( 2008 ) ( horikoshi medium ) containing ( gm / l ) glucose ( 10 g ) , peptone ( 5 g ) , yeast extract ( 5 g ) , k2hpo4 ( 1 g ) , mgso47h2o ( 0.2 g ) , naco3 ( 15 g ) and nacl ( 200 g ) . solid medium was prepared by adding 2.0 ( w / v ) bacto - agar ( difco ) . phenotypic tests were performed in accordance with the proposed minimal standards for the description of new taxa in the order halobacteriales . gram staining was performed as described by dussault ( 1955 ) and motility was examined on semi - solid agar . ( 1980 ) , containing 030 % ( w / v ) nacl , and the ph range for growth was assayed with ph values of 5 , 6 , 7 , 8 , 8.5 , 9 , 9.5 , 10 , 11 and 12 , and at different temperatures ( 4 , 10 , 20 , 30 , 40 , 45 , 50 , 55 and 60 c ) . haloalkaliphilic minimal medium was used for all biochemical tests ; this medium was developed by mwatha and grant ( 1993 ) , with the following composition , yeast extract , 1 g ; kno31 g ; kh2po4 , 1 g ; mgso47h2o , 0.2 g ; nacl , 150 g ; na2co3 , 18 g ; ph was adjusted to 9 . hydrolysis of starch , casein , gelatin , tween 80 ; cellulose , nitrate reduction ; production of indole and h2s ; catalase and oxidase activities ; and utilization of sugars were evaluated . genomic dna was extracted from pure culture of archaeal strain and subsequently sequenced using roche 454 gs ( flx titanium ) pyrosequencing . h. turkmenica wanu15 is gram - negative , coccobacilli or oval ( 1.52.0 mm in diameter ) and non - motile . colonies on complex agar medium with 3.4 m nacl are red , elevated and circular . growth occurs at nacl concentrations of 24.5 m , with an optimum at 3.4 m , and ph values in the range 8.511 , with an optimum at 9 , and at temperatures of 3060 c , with an optimum at 40 c . the following substrates are utilized for growth : glycerol , sodium acetate , propionate and citrate . acid is produced from glucose , mannose , fructose , sucrose , ribose and xylose . other phenotypic characteristics that distinguish strain wnu15 from different species of the genus haloterrigena are shown in table 1 . all of the reads were assembled using gs de novo assembler version 2.9 ( 454 life science ) , which generated 574 contigs with n5020 ,520 bp . the genome contains 49 rna genes predicted by rapid annotation using the subsystems technology ( rast ) server . a total of 2959 protein coding sequences in 193 subsystems were functionally annotated by rast ( fig . genome analysis revealed that the genome of h. turkmenica wanu15 contains various gene clusters for biosynthesis of secondary metabolites and peptides . functional comparison of genome sequences in the rast server revealed the closest neighbors of halogeometricum borinquense dsm 11551 ( score 515 ) followed by haloarcula marismortui atcc 43049 ( score 506 ) , halomicrobium mukohataei dsm 12286 ( score 501 ) , halorhabdus utahensis dsm 12940 ( score 497 ) and haloquadratum walsbyi dsm 16790 ( score 488 ) . on the other hand , analysis of the complete 16s rrna sequence in eztaxonserver ( http://www.ezbiocloud.net/eztaxon ; ) under default settings ( with matches only against cultured strains ) identified h. turkmenica . overall the various in silico results confirmed that the present environmental isolate is a member of the genus haloterrigena , though further characterization work is required to determine its species . the h. turkmenica wanu15 whole genome shotgun project has been deposited in ddbj / embl / genbank under the accession no lkcv00000000 . h. turkmenica wanu15 strain was isolated on a complex medium described by wallace ( 2008 ) ( horikoshi medium ) containing ( gm / l ) glucose ( 10 g ) , peptone ( 5 g ) , yeast extract ( 5 g ) , k2hpo4 ( 1 g ) , mgso47h2o ( 0.2 g ) , naco3 ( 15 g ) and nacl ( 200 g ) . solid medium was prepared by adding 2.0 ( w / v ) bacto - agar ( difco ) . phenotypic tests were performed in accordance with the proposed minimal standards for the description of new taxa in the order halobacteriales . gram staining was performed as described by dussault ( 1955 ) and motility was examined on semi - solid agar . ( 1980 ) , containing 030 % ( w / v ) nacl , and the ph range for growth was assayed with ph values of 5 , 6 , 7 , 8 , 8.5 , 9 , 9.5 , 10 , 11 and 12 , and at different temperatures ( 4 , 10 , 20 , 30 , 40 , 45 , 50 , 55 and 60 c ) . haloalkaliphilic minimal medium was used for all biochemical tests ; this medium was developed by mwatha and grant ( 1993 ) , with the following composition , yeast extract , 1 g ; kno31 g ; kh2po4 , 1 g ; mgso47h2o , 0.2 g ; nacl , 150 g ; na2co3 , 18 g ; ph was adjusted to 9 . hydrolysis of starch , casein , gelatin , tween 80 ; cellulose , nitrate reduction ; production of indole and h2s ; catalase and oxidase activities ; and utilization of sugars were evaluated . genomic dna was extracted from pure culture of archaeal strain and subsequently sequenced using roche 454 gs ( flx titanium ) pyrosequencing . h. turkmenica wanu15 is gram - negative , coccobacilli or oval ( 1.52.0 mm in diameter ) and non - motile . colonies on complex agar medium with 3.4 m nacl are red , elevated and circular . growth occurs at nacl concentrations of 24.5 m , with an optimum at 3.4 m , and ph values in the range 8.511 , with an optimum at 9 , and at temperatures of 3060 c , with an optimum at 40 c . the following substrates are utilized for growth : glycerol , sodium acetate , propionate and citrate . acid is produced from glucose , mannose , fructose , sucrose , ribose and xylose . other phenotypic characteristics that distinguish strain wnu15 from different species of the genus haloterrigena are shown in table 1 . all of the reads were assembled using gs de novo assembler version 2.9 ( 454 life science ) , which generated 574 contigs with n5020 ,520 bp . the g + c content was calculated using the draft genome sequence . the g + c content for the draft genome is 64 % . the genome contains 49 rna genes predicted by rapid annotation using the subsystems technology ( rast ) server . a total of 2959 protein coding sequences in 193 subsystems were functionally annotated by rast ( fig . genome analysis revealed that the genome of h. turkmenica wanu15 contains various gene clusters for biosynthesis of secondary metabolites and peptides . functional comparison of genome sequences in the rast server revealed the closest neighbors of halogeometricum borinquense dsm 11551 ( score 515 ) followed by haloarcula marismortui atcc 43049 ( score 506 ) , halomicrobium mukohataei dsm 12286 ( score 501 ) , halorhabdus utahensis dsm 12940 ( score 497 ) and haloquadratum walsbyi dsm 16790 ( score 488 ) . on the other hand , analysis of the complete 16s rrna sequence in eztaxonserver ( http://www.ezbiocloud.net/eztaxon ; ) under default settings ( with matches only against cultured strains ) identified h. turkmenica . overall the various in silico results confirmed that the present environmental isolate is a member of the genus haloterrigena , though further characterization work is required to determine its species . the h. turkmenica wanu15 whole genome shotgun project has been deposited in ddbj / embl / genbank under the accession no lkcv00000000 . the authors declare that there is no conflict of interests on the work published in this paper .\noutput:\n" }, { "from": "agent", "value": "we report draft genome sequence of haloterrigena turkmenica strain wanu15 , isolated from soda lake . the draft genome size is 2,950,899 bp with a g + c content of 64 % and contains 49 rna sequence . the genome sequence can be accessed at ddbj / embl / genbank under the accession no . lkcv00000000 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 65 - year - old man with a medical history of stage iii nasopharyngeal cancer , end - stage renal disease treated with dialysis , hyperthyroidism , type 2 diabetes mellitus , hypertension , atrial fibrillation , and secondary hyperparathyroidism presented at the oral medicine clinic of the college of dentistry , university of florida for dental evaluation prior to the start of radiotherapy . intraoral radiographs were taken using a cs2000 intraoral x - ray system ( carestream dental llc , atlanta , ga , usa ) with # 2 soredex optime ( soredex , charlotte , nc , usa ) photo - stimulable phosphor ( psp ) sensors at 70 kvp , 7 ma , and a 0.142 - second exposure time , using a standard bitewing technique . a panoramic image was obtained using an orthopantomograph op100 d digital panoramic x - ray unit ( instrumentarium dental , tuusula , finland ) with exposure factors of 70 kvp with 12 ma for 17.6 seconds . the panoramic and bitewing radiographs revealed multiple tortuous vascular calcifications in the soft tissue of the neck and cheek bilaterally , with a dense \" rail track \" pattern of linear calcifications within the facial artery . based upon the radiographic presentation and the patient 's known medical history , multiple radiopaque entities were also noted in the soft tissue of the neck , more on the left than on the right , consistent with a diagnosis of carotid atherosclerosis ( figs . 1 and 2 ) . positron emission tomography / computed tomography ( pet / ct ) scans were performed using a philips gemini gxl 16 pet / ct system with 5 mm thickness . the acquired data were reviewed by a medical radiologist , and \" pipe - stem \" calcifications were observed in the bilateral , lingual , and facial arteries ( fig . calcifications may occur in several locations in the cardiovascular system , including the intima and media of vessels . intimal arterial calcification is associated with atherosclerosis , and vascular plaques form within the intima of the involved vessel .3 however , in mnckeberg arteriosclerosis , the calcific deposits are located entirely within the medial layer of the arterial wall and both the internal and external elastic membranes are spared .712 in a recent study , the prevalence of mnckeberg arteriosclerosis in the population was found to be 13.3 % for males and6 .9 % for females , and it is a well - recognized age - related phenomenon .1112 medial artery calcification can lead to vascular stiffness , resulting in increased vascular resistance , reduced compliance of the artery , and an inability to properly vasodilate in the setting of increased stress .13 medial calcinosis contributes to significant adverse cardiovascular outcomes in patients with chronic kidney disease and diabetes , where higher levels of medial artery calcification are a risk factor for amputation .14 the affected artery may not demonstrate evidence of a pulse . the exact pathogenic mechanism of medial calcinosis is not well understood . however , degenerative processes leading to the apoptosis or necrosis of medial smooth muscle cells and osteogenic processes leading to formation of bone - like structures are two distinct pathologic mechanisms that have been suggested for mnckeberg arteriosclerosis .15 meema et al. 8 have suggested the possibility that two clinically and histologically different types of medial calcifications may exist . the first type is a benign , slowly progressive , essentially asymptomatic form with thin medial calcifications and little or no narrowing of the arterial lumen . in contrast , the second type is defined as a malignant , rapidly progressive form , in which massive and extensive medial calcifications may displace the internal elastica toward the lumen , causing luminal narrowing .78 mnckeberg initially described medial calcinosis as primarily affecting the arteries of the lower limbs , and occasionally affecting the peripheral arteries of the upper extremities . however , the process rarely affects the intraabdominal arteries , with the exception of the renal and splenic arteries .7 some reports in the literature have described mnckeberg arteriosclerosis . in 1977 , lachman et al. 7 described the involvement of coronary , peripheral , and visceral arteries with mnckeberg calcification . a case of mnckeberg arteriosclerosis involving the aorta , pelvic , and lower limb arteries was reported by lanzer in 1998.16 the nonvascular involvement of soft tissue ( pharynx and larynx ) with mnckeberg sclerosis was reported by couri et al. 6 in this report , we described a diabetic patient with end - stage renal disease on dialysis , who had advanced and previously undiagnosed mnckeberg medial calcinosis of the facial and lingual arteries . knowledge of the radiographic appearance of this calcification is clinically useful in developing a differential diagnosis . the proper interpretation of radiographic images presupposes a thorough knowledge of the anatomy , distribution , number , size , and shape of the calcifications . the calcified vessel appears as a parallel pair of thin , radiopaque lines that may have a straight course or a tortuous path , showing a pattern of blood vessels that looks like railroad tracks .511 carotid artery calcifications and phleboliths are calcifications that can be seen in the same location on a panoramic radiograph . carotid artery calcifications radiographically appear as curvilinear irregular parallel radiopacities in the soft tissues of the neck at or below the third and fourth cervical vertebrae , and inferior and lateral to the hyoid bone .1718 phleboliths can be seen on a panoramic radiograph as round or oval in shape with a homogeneously radiopaque center , giving phleboliths a \" target \" appearance .19 mnckeberg sclerosis is listed among the primary diseases of vessels that can be visualized on panoramic radiographs . to the best of our knowledge , our report describes the first known case of medial calcification in the facial artery on the panoramic radiograph of a diabetic patient with end - stage renal disease . soft tissue calcifications in the maxillofacial area are relatively common and can occur as the result of physiologic or pathologic mineralization , and generally correspond to radiographic findings in routine examinations , such as panoramic radiographs . a comprehensive review and thorough interpretation of all conventional and routine dental radiographs , especially beyond the region of interest , is necessary , and dental practitioners should be aware of the various calcified structures seen on panoramic radiographs , especially those associated with systemic diseases . a proper knowledge of radiographic features , however subtle they may be , assists the clinician in following up and further managing the patient , including appropriate referrals .\noutput:\n" }, { "from": "agent", "value": "mnckeberg sclerosis is a disease of unknown etiology , characterized by dystrophic calcification within the arterial tunica media of the lower extremities leading to reduced arterial compliance . medial calcinosis does not obstruct the lumina of the arteries , and therefore does not lead to symptoms or signs of limb or organ ischemia . mnckeberg sclerosis most commonly occurs in aged and diabetic individuals and in patients on dialysis . mnckeberg arteriosclerosis is frequently observed in the visceral arteries , and it can occur in the head and neck region as well . this report describes a remarkable case of mnckeberg arteriosclerosis in the head and neck region as detected on dental imaging studies . to the best of our knowledge , this is the first case that has been reported in which this condition presented in the facial vasculature . the aim of this report was to define the radiographic characteristics of mnckeberg arteriosclerosis in an effort to assist health care providers in diagnosing and managing this condition ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: established in 1995 , wame ( pronounced whammy ) is a nonprofit voluntary association of editors of peer - reviewed medical journals from countries throughout the world who seek to foster international cooperation amoung the education of medical journal editors . membership in wame is free and all decision - making editors of peer - reviewed medical journals are eligible to join . membership is also available to selected scholors in journal editorial policy and peer review . as of august 25 , 2013 , wame has more than 1915 members representing more than 1000 journals from 92 countries . wame has the following goals : to facilitate worldwide cooperation and communication amoung editors of peer - reviewed medical journals ; to improve editorial standards , to promote professionalism in medical editing through education , self - criticism and self - regulation ; andto encourage research on the principles and practice of medical editing . to facilitate worldwide cooperation and communication amoung editors of peer - reviewed medical journals ; to improve editorial standards , to promote professionalism in medical editing through education , self - criticism and self - regulation ; and to encourage research on the principles and practice of medical editing . for more information about wameestablished in 1995 , wame ( pronounced whammy ) is a nonprofit voluntary association of editors of peer - reviewed medical journals from countries throughout the world who seek to foster international cooperation amoung the education of medical journal editors . membership in wame is free and all decision - making editors of peer - reviewed medical journals are eligible to join . membership is also available to selected scholors in journal editorial policy and peer review . as of august 25 , 2013 , wame has more than 1915 members representing more than 1000 journals from 92 countries . wame has the following goals : to facilitate worldwide cooperation and communication amoung editors of peer - reviewed medical journals ; to improve editorial standards , to promote professionalism in medical editing through education , self - criticism and self - regulation ; andto encourage research on the principles and practice of medical editing . to facilitate worldwide cooperation and communication amoung editors of peer - reviewed medical journals ; to improve editorial standards , to promote professionalism in medical editing through education , self - criticism and self - regulation ; and to encourage research on the principles and practice of medical editing . for more information about wame\noutput:\n" }, { "from": "agent", "value": "the editor - in - chief of the international journal of mch and aids ( ijma ) is a member of the world association of medical editors ( wame ) . the editorial board of ijma believes it is important that the statement on promoting global health and this accompanying editorial is brought to the attention of our readers . medical journal editors have a social responsibility to promote global health by publishing , whenever possible , research that furthers health worldwide ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 31 - year - old male presented with loss of consciousness of abrupt onset after several days of headache . initial pre - contrast ct showed swollen hypodense area , ichs and linear hyperdensity in the left frontal lobe ( fig . ct angiography with 3 - dimensional post processing revealed dilated medullary veins with caput medusa appearance , but no venous drainage from the left frontal dva ) ( fig . multiplanar source images of ct angiography demonstrated the filling defect in the anterior superior sagittal venous sinus and suggested the thrombosis in the draining vein ( fig . ct angiograms ten days ( not shown in this report ) and two months later ( fig .2 b , c ) , thrombosed draining vein was progressively recanalized and detected were findings of venous infarction with multifocal parenchymal hemorrhages in the left frontal lobe .2 d ) clearly showed the presence of resolving venous thrombosis at a month ( fig . no underlying cause such as connective tissue disease , coagulopathy , history of steroid administration , dehydration and so on was identified for the spontaneous thrombosis in the venous drainage from dva . the patient was treated conservatively , became conscious five days later and eventually recovered without localized neurological deficit . he developed generalized seizure , but had been under control with anti - epileptic medications . in this case , interpretation of ct and ct angiography findings at the time of initial clinical presentation was complicated because spontaneous ichs abruptly occurred in a young , healthy male and there was no underlying vascular pathology found such as avm in the left frontal lobe or dural avm and the hemorrhages appeared not to be related to neoplasms . hypodense area in the left lobe involved both cortical gray matter and white matter as in the case of cerebral infarction , did not coincide with the territory of left anterior cerebral artery . source images from ct angiography showed multiple dilated linear enhancements with parenchymal staining in the left frontal lobe . possible venous infarction due to thrombosis in the venous drainage was suspected but dva with thrombosis was not included in the initial differential diagnosis because venous collector was not recognizable . early correct recognition of thrombosed typical dva as the underlying cause for the ich and venous infarction of sudden onset could lead to the proper anticoagulation treatment . cases of spontaneous ich related to dva were reported and associated with either high flow arteriovenous shunts or cavernous venous malformations [ 1 - 4 ] . however , very small number of typical dvas were reported , which presented ich as the initial manifestation . analyzed previously reported 13 cases and their one case of typical dva complicated by thrombosis of the draining vein . among those 14 cases , they include one case of venous infarction without ich by mistake , thus four had ichs . eight cases of venous infarction including their own two were analyzed by masson et al . a case of childhood dva complicated by spontaneous thrombosis was reported elsewhere and should be included in the list of venous infarction . among those nine , two were categorized as \" hemorrhagic \" and we reviewed the case reports . authors of the two case reports related ichs to thrombosis in the draining veins , and their case figures did not show venous infarction initially . among 21 cases of dvas with venous thrombosis in the previous literatures , one was reported in french and another one in spanish .19 cases reported in english were reviewed [ 6 , 9 , 15 - 18 ] and we summarized their demographics , location of dva , presence of parenchymal hemorrhage at the initial diagnosis including our case ( table 1 ) . among those 20 , three had cerebellar dvas , and one case presented with only with subarachnoid hemorrhage and no infarction . two cases had ich only and f i ve cases showed findings of ich and venous infarction on the initial brain images . most of them presented only ct , mri or angiographic images at the initial diagnosis or at certain time points . only four cases had follow - up images of any sort , but they did not show sequential changes of the thrombosed vein and dva , neighboring brain tissue . as described elsewhere , thrombotic obstruction of dva and draining vein resulting venous congestion should be the pathologic mechanism for the initial parenchymal hemorrhages and venous infarction . in the present case , sequential ct , ct angiography and digital subtraction angiography demonstrated initial thrombotic obstruction of the venous drainage from dva , its recanalization and temporal changes occurring in the affected brain parenchyma .\noutput:\n" }, { "from": "agent", "value": "we report a rare case of thrombosed developmental venous anomaly ( dva ) in a 31 - year old male with hemorrhagic cerebral venous infarction at the initial clinical presentation . in this case , sequential ct , ct angiography and digital subtraction angiography demonstrated thrombotic obstruction of the venous drainage from dva , its progressive recanalization and temporal evolution of the affected brain parenchyma . the relevant previous literatures were reviewed and summarized ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: periodontal disease is characterized by gram - negative bacteria in the oral cavity , along with chronic inflammation , which could consequently lead to the destruction of the soft tissue and resorption of the periodontal bone . it was suggested that the alteration or progression of the disease may be associated with the host immune response to these bacteria , and that inflammatory cells in diseased periodontal tissues are related to the disease progression . recruitment and retention of these cells are determined by cell adhesion molecules , which are suggested to be involved in the pathogenesis of inflammatory diseases . evidence shows that cell adhesion molecules can be up - regulated as a result of stimulation from certain pro - inflammatory cytokines , and can act as co - stimulatory receptors in the activation of inflammatory cells . cellular adhesion molecule ( cam ) , an adhesion protein on the surface of the gums , epithelium of gingival sulcus , and junctional epithelium , is an important component of the adhesion between cells and their extracellular matrix . cam is involved in the occurrence and development of periodontitis , mainly through the participation of cell information transmission , inflammation , and immune response . with the assistance of the specificity of cam on the junctional epithelium , polymorphonuclear leukocyte ( pmn ) intercellular adhesion molecule 1 ( icam - 1 ) and vascular cell adhesion molecule 1 ( vcam - 1 ) belong to the ig superfamily . icam - 1 is widely expressed on leucocytes , endothelial cells , monocytes , synovial cells , fibroblasts , and epithelial cells . in immunological and inflammatory reactions , these abilities of icam - 1 and vcam - 1 were found to be involved in rheumatoid arthritis . in confirmation of this information , a study also showed that the plasma and synovial fluid levels of icam - 1 and vcam - 1 were significantly higher in rheumatoid arthritis patients in comparison with normal healthy controls . the icam1 gene is located on locus 19p13.3 - p13 .2 . as an indispensable participant in the initiation of the immunological response , icam - 1 mediates adhesion of leukocytes against the blood vessel wall , enabling them to enter the tissues by transendothelial migration . the vcam1 gene is located on locus 1p31 - 32 . as an endothelial receptor for vla - 4 and integrin 47the polymorphisms of icam1 and vcam1 genes may affect the function of the immune response . several studies have indicated that polymorphisms of rs5498 t c in exon 6 of the icam1 gene and rs1041163 t c in the vcam1 gene promoter are associated with various diseases , such as coronary artery disease , stenosis , myocardial infarction , and arthrosclerosis . because the pathophysiology of periodontitis is similar to that of these diseases , which is inflammatory in nature , andno case - control study has been conducted on the associations between icam - 1 and vcam - 1gene polymorphisms and chronic periodontitis , we evaluated their roles in the susceptibility to periodontal diseases and investigated the potential associations between the polymorphisms and chronic periodontitis in the heilongjiang chinese population . previous studies indicated that icam - 1 rs5498 and vcam - 1 rs1041163 gene polymorphisms are associated with various diseases , including coronary artery disease , stenosis , and arthrosclerosis . since the pathophysiology of these diseases is inflammation , similar to that of periodontitis , and because icam - 1 and vcam - 1 are known to be involved in the occurrence and development of periodontitis , we hypothesized that the polymorphisms were also associated with periodontitis . icam - 1 rs5498 and vcam - 1 rs1041163 polymorphisms contribute to chronic periodontitis , and icam - 1 rs5498 and vcam - 1 rs1041163 gene polymorphisms might be associated with periodontitis severity in the heilongjiang chinese population . our study is the first to investigate the relationships between icam - 1 and vcam - 1 polymorphisms and periodontitis . previous studies indicated that icam - 1 rs5498 and vcam - 1 rs1041163 gene polymorphisms are associated with various diseases , including coronary artery disease , stenosis , and arthrosclerosis . since the pathophysiology of these diseases is inflammation , similar to that of periodontitis , and because icam - 1 and vcam - 1 are known to be involved in the occurrence and development of periodontitis , we hypothesized that the polymorphisms were also associated with periodontitis . icam - 1 rs5498 and vcam - 1 rs1041163 polymorphisms contribute to chronic periodontitis , and icam - 1 rs5498 and vcam - 1 rs1041163 gene polymorphisms might be associated with periodontitis severity in the heilongjiang chinese population . our study is the first to investigate the relationships between icam - 1 and vcam - 1 polymorphisms and periodontitis . this study was approved by the ethics committee of the first affiliated hospital of harbin medical university and each subject signed informed consent prior to enrollment in the current study . all procedures in this study were in accordance with the declaration of helsinki . in this study , 766 nonsmoking subjects , who were admitted to the first affiliated hospital of harbin medical university between september 2012 and december 2014 , there were 584 patients with periodontitis ( 284 females and 300 males ; age range : 2050 years ) among whom 228 had mild , 212 had moderate , and 144 had severe chronic periodontitis . we recruited another 182 subjects as healthy controls ( 98 females and 84 males ; age range : 2050 years ) . periodontitis was diagnosed based on probing depth ( pd ) , clinical attachment loss ( cal ) , and bleeding on probing index ( bpi ) , in addition to radiographic findings . the exclusion criteria were : history or current manifestations of systemic diseases ; patients with diabetes mellitus , immunological disorders , hepatitis , hiv infection , or cardiovascular events ; patients using orthodontic appliances ; patients needing pre - medication for dental treatment ; patients using anti - inflammatory drugs on a regular basis ; patients with acute necrotizing ulcerative gingivitis ; and pregnant or lactating women . the diagnostic criteria of chronic periodontitis were : ( 1 ) presence of local factors such as plaque and calculus ; ( 2 ) more than 2 sites had a pd 5 mm , and cal was 1 mm in every quadrant , and the number of the teeth with alveolar bone absorption more than 2/3 the root length was 8 . the severity of chronic periodontitis was categorized as : ( 1 ) the mild group : pd 4 mm , cal : 12 mm , and the alveolar bone absorption is less than 1/3 the root length ; ( 2 ) the moderate group : pd 6 mm , cal : 35 mm , and the alveolar bone absorption is 1/3 to 1/2 the root length ; and ( 3 ) the severe group : pd 6 mm , cal 5 mm , and the alveolar bone absorption is more than 1/2 the root length . healthy subjects ( 182 ) without periodontal disease , systemic inflammatory disease , or surgical treatment within 4 weeks were enrolled as controls . patients with absence of periodontitis were diagnosed based on : ( 1 ) at least 22 teeth in situ ; ( 2 ) no site with pd 3 mm ; and ( 3 ) no presence of cal . no pathogenic tooth mobility was found in healthy controls and none had a history of periodontitis or tooth loss . furthermore , no bleeding on probing or radiographic evidence of bone loss was observed among these subjects . the buccal swabs were naturally dried at room temperature and their surfaces were stripped and transferred to eppendorf tubes . genomic dna was extracted by the swab gen dna kit and stored at 20c for later genotyping . we analyzed 2 single - nucleotide polymorphisms ( snps ) with the multiplex snapshot kit for rs5498 t c in exon 6 of the icam1 gene and rs1041163 t c in the vcam1 gene . the primers for icam - 1 rs5498 were : forward : 5 - gtaaaggacctctgggttact - 3 reverse : 5 - aggcttctggatctcctctt - 3 . the primers for vcam - 1 rs1041163 were : forward : 5 - actcacagagcacattcacg - 3 reverse : 5 - agatcttgagggcacctac - 3 . the pcr protocol was : initial denaturation at 94c for 5 min , 33 cycles of amplification at 94c for 30 s , annealing at 55c for 30 s , and extension for 30 s at 72c , followed by a final extension for 5 min at 72c . pcr products were purified with shrimp alkaline phosphatase ( sap ) and preserved at 4c . the primers and sequences of the snapshot extension reaction were : rs5498 - r - r - 60 : 5 - tttttttttttttttttttttttttttttttttttttttttagcacattcacggtcacct - 3 . rs1041163 - y - f - 34 : 5 - tttttttttttgctagtatttcctgaatcaattt - 3 . the reaction protocol was : 25 cycles of extension at 96c for 10 s , at 51c for 5 s , and at 60c for 30s , followed by 1 cycle at 4c . the products were purified with 0.3 l sap and 1.7 l ddh2o and stored at 4c . analysis using abi 3730xl sequencer was : 1 l product , 0.2 l genescan - 120liz size standard and 8.8 l deionized formamide were mixed in a 96 - well - plate , denatured at 95c for 5 min , and directly analyzed by use of an abi 3730xl sequencer . contingency data were used with chi - square tests for the comparisons between observed genotype frequencies and those expected under hardy - weinberg equilibrium . chi - square tests were conducted to compare the genotypes distributions of the groups with spss version 18 software . the odds ratios ( or ) were calculated with their 95 % confidence intervals ( ci ) . this study was approved by the ethics committee of the first affiliated hospital of harbin medical university and each subject signed informed consent prior to enrollment in the current study . in this study , 766 nonsmoking subjects , who were admitted to the first affiliated hospital of harbin medical university between september 2012 and december 2014 , were recruited . there were 584 patients with periodontitis ( 284 females and 300 males ; age range : 2050 years ) among whom 228 had mild , 212 had moderate , and 144 had severe chronic periodontitis . we recruited another 182 subjects as healthy controls ( 98 females and 84 males ; age range : 2050 years ) . periodontitis was diagnosed based on probing depth ( pd ) , clinical attachment loss ( cal ) , and bleeding on probing index ( bpi ) , in addition to radiographic findings . the exclusion criteria were : history or current manifestations of systemic diseases ; patients with diabetes mellitus , immunological disorders , hepatitis , hiv infection , or cardiovascular events ; patients using orthodontic appliances ; patients needing pre - medication for dental treatment ; patients using anti - inflammatory drugs on a regular basis ; patients with acute necrotizing ulcerative gingivitis ; and pregnant or lactating women . the diagnostic criteria of chronic periodontitis were : ( 1 ) presence of local factors such as plaque and calculus ; ( 2 ) more than 2 sites had a pd 5 mm , and cal was 1 mm in every quadrant , and the number of the teeth with alveolar bone absorption more than 2/3 the root length was 8 . the severity of chronic periodontitis was categorized as : ( 1 ) the mild group : pd 4 mm , cal : 12 mm , and the alveolar bone absorption is less than 1/3 the root length ; ( 2 ) the moderate group : pd 6 mm , cal : 35 mm , and the alveolar bone absorption is 1/3 to 1/2 the root length ; and ( 3 ) the severe group : pd 6 mm , cal 5 mm , and the alveolar bone absorption is more than 1/2 the root length . healthy subjects ( 182 ) without periodontal disease , systemic inflammatory disease , or surgical treatment within 4 weeks were enrolled as controls . patients with absence of periodontitis were diagnosed based on : ( 1 ) at least 22 teeth in situ ; ( 2 ) no site with pd 3 mm ; and ( 3 ) no presence of cal . no pathogenic tooth mobility was found in healthy controls and none had a history of periodontitis or tooth loss . furthermore , no bleeding on probing or radiographic evidence of bone loss was observed among these subjects . all subjects signed informed consent forms prior to enrollment in the current study . the buccal swabs were naturally dried at room temperature and their surfaces were stripped and transferred to eppendorf tubes . genomic dna was extracted by the swab gen dna kit and stored at 20c for later genotyping . we analyzed 2 single - nucleotide polymorphisms ( snps ) with the multiplex snapshot kit for rs5498 t c in exon 6 of the icam1 gene and rs1041163 t c in the vcam1 gene . the primers for icam - 1 rs5498 were : forward : 5 - gtaaaggacctctgggttact - 3 reverse : 5 - aggcttctggatctcctctt - 3 . the primers for vcam - 1 rs1041163 were : forward : 5 - actcacagagcacattcacg - 3 reverse : 5 - agatcttgagggcacctac - 3 . the pcr protocol was : initial denaturation at 94c for 5 min , 33 cycles of amplification at 94c for 30 s , annealing at 55c for 30 s , and extension for 30 s at 72c , followed by a final extension for 5 min at 72c . pcr products were purified with shrimp alkaline phosphatase ( sap ) and preserved at 4c . the primers and sequences of the snapshot extension reaction were : rs5498 - r - r - 60 : 5 - tttttttttttttttttttttttttttttttttttttttttagcacattcacggtcacct - 3 . rs1041163 - y - f - 34 : 5 - tttttttttttgctagtatttcctgaatcaattt - 3 . the reaction protocol was : 25 cycles of extension at 96c for 10 s , at 51c for 5 s , and at 60c for 30s , followed by 1 cycle at 4c . the products were purified with 0.3 l sap and 1.7 l ddh2o and stored at 4c . analysis using abi 3730xl sequencer was : 1 l product , 0.2 l genescan - 120liz size standard and 8.8 l deionized formamide were mixed in a 96 - well - plate , denatured at 95c for 5 min , and directly analyzed by use of an abi 3730xl sequencer . contingency data were used with chi - square tests for the comparisons between observed genotype frequencies and those expected under hardy - weinberg equilibrium . chi - square tests were conducted to compare the genotypes distributions of the groups with spss version 18 software . the odds ratios ( or ) were calculated with their 95 % confidence intervals ( ci ) . the distributions of the icam - 1genotypes are shown in table 1 . at the snp level , a trend in genotype distribution was observed for rs5498 ( cc vs. ct vs. tt , p = 0.007 ) . c allele in the patients with chronic periodontitis compared to the controls , the trend did not achieve statistical significance ( p = 0.472 ) . as shown in table 2 , the genotype distributions of vcam - 1 were different between the patients and the controls , with a trend in genotype distribution observed for rs1041163 ( cc vs. ct vs. tt , p = 0.029 ) . t alleles was observed in the periodontal patients than in the controls ( p = 0.009 ) . the odds of having chronic periodontitis among subjects with t / c at icam - 1 rs5498 was 1.666 times the odds of having the disease among subjects with t / t at icam - 1 rs5498 , with 95 % confidence interval ( 1.154 and 2.404 ) . the distributions of rs5498 genotypes were significantly different across the 3 severity groups of periodontitis patients ( cc vs. ct vs. tt , p = 0.021 ; cc vs. ct + tt , p = 0.029 ; table 3 ) . as shown in table 4 , similar results were obtained for rs1041163 ( cc vs. ct vs. tt , p = 0.049 ) . it has been proven that periodontitis , a complex multifactorial disease , is determined by both environmental and genetic factors . in addition to the pathogenic bacteria and other environmental factors ( e.g. , smoking and stress ) involved in the pathogenesis of periodontitis , there is also evidence suggesting that genetic factors might participate in the etiology of periodontitis . recently , growing interest has been focused on identifying allelic variants of genes that can be used to assess the risk of periodontal diseases . icam - 1 andvcam - 1 polymorphisms are currently being investigated and have been found to be associated with several diseases , including stenosis , coronary artery disease , and arthrosclerosis . to the best of our knowledge , however , our study is the first to investigate the association between these polymorphisms and periodontitis . there was a significant difference in the rs5498 polymorphism of the icam - 1 gene between the chronic periodontal patients and the controls . the genotype distribution of vcam - 1 rs1041163 was also significantly different between the patients and the controls . these results suggest that rs5498 and rs1041163 polymorphisms may contribute to chronic periodontitis . among the mild , moderate , and severe cases of periodontitis , the genotypes of rs5498 were found to have different distributions ; similar results were obtained for the genotypes of rs1041163 , suggesting that both rs5498 and rs1041163 may affect periodontitis severity . both icam - 1 and vcam - 1 mrnas are expressed by non - stimulated hepatocyte growth factor ( hgf ) . in addition , icam - 1 is induced by pro - inflammatory cytokines , such as il - 1 , tnf - , ifn - , and il - 2 . escherichia coli lps and vcam - 1 are induced by il - 1 . icam - 1 mediates the middle screw rotary body into the process of human gingival epithelium as an adhesion receptor on leukocytes and endothelial cells . a previous study suggested the icam - 1 plays an important role in the early stage and progression of chronic periodontitis . vcam - 1 , combined with monocytes and lymphocytes , can activate vascular endothelial cells to express vascular adhesion molecules . animal studies have shown that suppressing the expression of vcam - 1 can significantly inhibit the inflammatory responses . in order to control the inflammatory responses , it is critical to effectively suppress the expression of vcam - 1 . these results indicate that snps of icam - 1 and vcam - 1 may cause susceptibility to periodontitis , and that different distributions may result in different severities of periodontitis . it is thus possible to intervene in and control the progression of periodontitis and to treat periodontitis on the snp level by identifying the polymorphisms of icam - 1 and vcam - 1 . the pathophysiology of periodontitis , similar to that of some other complex diseases , is characterized by various biological pathways , which ultimately lead to the same clinical manifestation . it is important to note that the number and type of genes involved in the same disease may not be the same in different ethnic populations . accordingly , a functional snp may be in linkage disequilibrium with distinct markers in different ethnic groups . therefore , we can not deny the possibility that functional rs5498 and rs1041163 , together with the other uncovered functional variants in linkage disequilibrium , might synergistically influence diseases . taken together , our study shows that icam - 1 rs5498 and vcam - 1 rs1041163 gene regions may affect the susceptibility to chronic periodontitis in the heilongjiang chinese population . our work provides the first evidence of the involvement of human icam - 1 and vcam - 1genes in chronic periodontitis . however , the basic functions of icam - 1 and vcam - 1gene mutations remain to be further elucidated . our findings indicate that icam - 1 rs5498 and vcam - 1 rs1041163 polymorphisms participate in the pathogenesis of chronic periodontitis , and that the gene polymorphisms at both icam - 1 rs5498 and vcam - 1 rs1041163 might be associated with periodontitis severity in the heilongjiang chinese population . future studies should focus on the application of these polymorphisms in the diagnosis and treatment of periodontitis as biomarkers .\noutput:\n" }, { "from": "agent", "value": "backgroundwe aimed to investigate the potential genetic relationships between the polymorphisms of gene rs5498 icam - 1 and rs1041163 vcam - 1 and chronic periodontitis in a chinese population within heilongjiang.material / methodsgenomic dna was extracted from oral mucosa cells of 584 periodontal patients and 182 healthy individuals . genotyping of the rs5498 icam - 1 and rs1041163 vcam - 1 gene polymorphisms was performed with the multiplex snapshot technique.resultsstatistically significant associations were identified between the chronic periodontal patients and the controls in the gene polymorphisms of rs5498 icam - 1 ( p = 0.007 ) and rs1041163 vcam - 1 ( p = 0.029 ) . the distribution of rs5498 ( p = 0.029 ) and rs1041163 ( p = 0.049 ) differed significantly across the mild , moderate , and severe groups of periodontitis.conclusionsour findings indicate that icam - 1 rs5498 and vcam - 1 rs1041163 polymorphisms contribute to chronic periodontitis , and icam - 1 rs5498 and vcam - 1 rs1041163 gene polymorphisms might be associated with periodontitis severity in the heilongjiang chinese population . further studies should be conducted to determine whether these polymorphisms could be used as biomarkers of periodontitis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tracheal agenesis is a rare and lethal congenital anomaly , where a complete interruption or absence of the trachea is present . since it was initially described in 1900 , few cases have been published worldwide ( 1 ) . the prevalence of tracheal agenesis is less than 1:50,000 with a male to female ratio of 2:1 . in general ,52 % of cases are associated with premature delivery and approximately half of the cases are associated with polyhydramnios ( 2 ) . type i is characterized by agenesis of the proximal trachea and by the presence of a distal tracheoesophageal fistula , whereas type ii is defined by a complete absence of the trachea and by the presence of normal bifurcating bronchi . in type iii , isolated type ii tracheal agenesis with fistula is rare , and up to 94 % of cases are associated with other congenital abnormalities . newborns with type ii tracheal agenesis usually present with polyhydramnios , respiratory distress , aphonia , cyanosis , and an inability to undergo endotracheal intubation . currently , type ii tracheal agenesis accounts for approximately 50 - 60 % of all cases . at present , the etiology of type ii tracheal agenesis is unknown and no significant karyotype exists ( 4 ) . in general , prenatal diagnosesthis case report depicts an unusual situation where type ii tracheal agenesis with esophageal fistula was diagnosed independently of any other congenital anomalies . our patient was born to a 31 - year - old g2p1a0 mother and a non - consanguineous father . prenatal ultrasound at 25 , 29 , and 32 weeks showed polyhydramnios and suspected esophageal atresia . amniocentesis reductions were performed three times during the pregnancy to reduce the volume of amniotic fluid . aside from these findings , the patient was delivered at 351/7 weeks gestation by caesarean section owing to fetal bradycardia and the suspected diagnosis of esophageal atresia . its birth weight was 1850gm , indicative of intrauterine growth restriction ( iugr ) . respiratory distress developed immediately following birth and attempts at intubation with a 2.5 mm endo - tracheal tube ( ett ) failed due to the blockage below the vocal folds . examination showed a hypoxic newborn with a po2 of 63 , with a blood ph of 6.8 and a pco2 of 135 . mask ventilation was also difficult , but an o2 saturation of 95 % was achieved following administration of 75 % fio2 . once stabilized , the perinatal patient was immediately transferred to the operating room of a tertiary pediatric medical center . a second intubation using a 2.5 mm ett failed due to subglottic obstruction . rigid bronchoscopy was performed and revealed a blind pouch below the vocal folds ( fig .1 ) . notice the scope in the subglottic segment demonstrating absent cervical and thoracic trachea . tracheostomy was attempted but was unsuccessful as no cervical trachea was palpable below the cricoid cartilage . intraoperative fluoroscopy of the trachea also confirmed the subglottic stenosis and absence of the lower cervical and thoracic trachea . the presence of a bronchoesophageal fistula was identified with both bronchi originating from a flattened carina . the bronchi and carina exhibited unusual horizontal orientation and the carina demonstrated a straight continuous roof with no tracheal remnants ( fig .2 ) . note the unusual horizontal orientation of r / l main bronchi and carina ( with contrast in the esophagus and bronchial tree ) visualized using fluoroscopy . based on these imaging studies , isolated type ii tracheal agenesis with bronchioesophageal fistula was diagnosed . a post - mortem ct scan revealed a 7 mm remnant segment of cervical trachea ( with no lumen ) running in the craniocaudal plane and confirmed the complete absence of the lower cervical and thoracic trachea . the carina originated from the esophagus and joined to the right and left main bronchi . floyd et al . defined type ii tracheal agenesis as complete absence of the trachea with the presence of normal bifurcating main bronchi ( 3 ) .94 % of cases are associated with other congenital defects including congenital cardiac , genitourinary , gastro - intestinal , pulmonary , cns , and musculoskeletal anomalies ( 3,6,7 ) . while the embryological mechanisms behind type ii tracheal agenesis remain controversial , it has been suggested that tracheal agenesis is a result of the abortion of the lung bud outgrowth and delayed formation of the bronchi and lungs via remnant primordial mesenchyme which often attaches to the esophagus ( 7 ) . also , while no significant genetic karyotype has been found to correlate with tracheal agenesis , homozygous shhnull mutant mice show foregut defects similar to those seen in tracheal agenesis ( 8 ) . tracheal agenesis should be included in the differential diagnosis when the following clinical signs are manifested : neonate with a history of polyhydramnios , absence of an audible cry at birth , failure to intubate beyond the vocal folds , and respiratory distress ( 9 ) . in patients with tracheal agenesis , surgical correction has been proposed as a corrective measure ( 6 ) . to date , only one patient with type ii tracheal agenesis has survived beyond the neonatal period . however , that surviving patient had a proximal tracheoesophageal fistula in addition to a bronchoesophageal fistula , which allowed the successful establishment of a permanent airway by performing a tracheotomy and inserting a long t tube to create a patent airway ( 10 ) . while temporary management can include the insertion of an esophageal tube , depending on the extent of the fistula , infants with a complete absence of the trachea tend to die within hours of birth , as a permanent airway can not be created . however , there is no established medical protocol for life conservation in isolated type ii complete tracheal agenesis . currently , this anomaly is incompatible with life and future hopes for survival will depend on surgical developments .\noutput:\n" }, { "from": "agent", "value": "in this report we describe a newborn with a rare case of type ii tracheal agenesis and bronchoesophageal fistula . polyhydramnios and suspected esophageal atresia were identified during routine pre - natal ultrasound screening . upon delivery , rigid bronchoscopy , esophagoscopy , and intraoperative fluoroscopy were performed , where both bronchi and the carina showed unusual horizontal orientation making it difficult to identify the fistula . however , a post mortem ct confirmed the diagnosis of an isolated type ii tracheal agenesis with bronchoesophageal fistula ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: when infants ( or other people ) explore a visual scene , they do so through a series of saccadic eye movements that bring the limited area of sharp foveal vision to specific regions of the scene . according to the prevailing models of visual attention 7 , eye movements during free viewing are directed primarily toward physically salient areas in the scene ( e.g. , areas with high contrast in color , intensity , or orientation ) , so the first gaze shift is always directed toward the most salient location . after this location has been explored , it is suppressed and gaze shifts to the second most salient location , followed by other locations in order of saliency . hence , the observer 's first look is directed to a face if the face pops out from the surrounding objects because of salient cues ( e.g. , the contrast of the sclera and iris in the eyes 8 , or teeth and upturned mouth corners 9 ) , or because the human visual system is sensitive to the basic geometry of the face and prioritizes this combination of features over other cues 10 . sensitivity to the basic geometry of faces is thought to exist at birth 2 , but it has been unclear whether this sensitivity is robust enough to lead infants to select faces as the targets of their first gaze shift over other visual objects that are present in complex scenes . to test this possibility , several recent studies have examined whether infants ' first gaze shifts are directed toward faces when viewing stimulus arrays consisting of a face and three to five other objects , or whether first gaze shifts are unbiasedso faces are selected as targets of first gaze shifts as often as other visual objects 5 , 8 , 11 . in two studies of 6montholds , infants ' initial gazes were biased : their first looks were directed toward faces about 50 % of the time ( the predicted level based on unbiased visual orienting was 17 % ; 5 , 8 ) . moreover , they were biased in favor of faces even when faces were not the most salient targets in the scene in terms of their color , luminance , or contour 8 . while these results are consistent with an attention bias toward faces in infants , other results suggest that the bias can not be interpreted as a specific tuning of the infants ' visual system to the basic geometry of faces . in essence , the bias was also found for inverted faces 5 and , to some extent , for pictures of body parts and animals 8 . furthermore , at 6 months , the mechanisms biasing attention to faces may still depend disproportionally on the presence of specific cues , such as color ; a study of 3 to 6montholds did not reveal this bias when faces were presented as shades of gray 11 . while biased orienting to faces appears rudimentary at 6 months , this bias becomes more robust with development . in a study that failed to find evidence for biased orienting to faces in 3 and 6montholds 11 , similarly , in a study of observers of a range of ages , the proportion of trials in which infants fixated on the face during the first second of viewing the scene increased from 15 % at 4 months to 50 % by 12 months , and then to almost 90 % by 24 years 12 . these agerelated changes in attentional bias for faces may reflect specific developmental changes in sensitivity to faces , such as strengthening of the perceptual template for the basic geometry of faces 6 , or gradual increases in the motivation to look at faces as a source of social information 13 . however , the agerelated changes in the localization of faces may also reflect more general developmental changes in visual function and attentional abilities 12 , 13 . these changes relate to increased sensitivity to visual features , such as color , orientation , and intensity , and increased use of these cues in the guidance of eye movements toward salient visual objects 12 , as well as agefunctional maturation of frontoparietal attention networks 14 , important for the capacity to selectively attend to specific visual targets while suppressing other , interfering inputs 12 , 15 . in a study that supports the role of developmental changes in visual abilities in the attention bias for faces , infants were less likely to benefit from color , intensity , and orientation contrasts in localizing faces than older children and adults 12 . also , the correspondence between infants ' gaze patterns for a given scene ( i.e. , eye position in xy coordinates ) and the physical salience values for the same scene ( i.e. , intensity , color , and orientation values for each xy coordinate ) increased with age 12 , suggesting developmental changes in sensitivity to visual features . support for agerelated changes in attention networks , in turn , comes from results showing that the average duration of visual fixations , which is a proxy of the ability to keep attention in a stationary position 16 , correlates positively with the attentional bias toward faces 12 . similarly , agerelated improvements in the general abilities to localize visual targets among other objects ( e.g. , a discrepantly oriented bar or a moving bar in an array of similar bars ) mediate agerelated increases in total looking time toward faces in complex dynamic scenes ( 15 ; figure 1 ) . upper left : a paradigm testing infants ' orientation to faces in cluttered scenes where faces were either the most salient or not the most salient . upper right : agerelated increase in orientation to faces ( especially when faces were the most salient elements of the scene ) , as shown by increased proportions of trials in which the observer fixated the face at least once during the first second of the image viewing . participants fixating a face stimulus in the center of the screen were presented with a lateral distractor to the left or to the right . middle : a trial with a rapid gaze shift from the stimulus in the center to the lateral distractor ( the gaze shift is seen as an abrupt change in x coordinates of the gaze ) . lower right : an example of a trial in which the gaze holds in the central stimulus , and the saccade to the lateral stimulus is suppressed . after infants fixate on an object , they sometimes look at it for a long period , inspecting its distinguishing characteristics carefully . how long they look is thought to depend on the complexity of the object 3 , and may directly reflect the time it takes to construct an internal representation or trace of the external stimulus 17 . instead of a single fixation , prolonged holding of attention on an object is likely to consist of many separate fixations that span different subregions of the object . eyetracking research can produce a detailed characterization of the spatial distribution of these fixations 18 , but such analyses are not typically performed in studies of infants because of the limits of the spatial resolution of eyetracking technologies when used with participants who do not sit still 15 . attention holding in infants can be quantified by calculating the cumulative duration of individual looks at the target area . this duration of total looks is not reliably longer for faces than for other visual objects in 3montholds , but most studies using this measure have shown reliable bias for faces in 6montholds and older infants 4 , 5 , 8 . in an extension of the work examining infants ' attention to faces displayed on computer screens , infants ' gaze behavior was recorded by headmounted eye trackers while infants were carried in an office hallway 19 . infants maintained gaze on people 45 % of the time people were in view ; adults ( i.e. , the mothers carrying the infants ) maintained gaze 18 % of the time . when infants are fixating on a face , they may actively maintain their attention on this stimulus by filtering out other , competing inputs . we see this phenomenon in studies showing that attention to a face in the center of a visual display momentarily suppresses reflexive saccades to other competing stimuli in the visual periphery 20 , 21 . present at 3 months 22 , the phenomenon was interpreted initially as difficulty disengaging from a stimulus with social or emotional signal value instead of active attention 23 . in young infants , it is challenging to distinguish obligatory looking resulting from a difficulty to disengage from more active prioritization of attention . but because obligatory fixations are typically observed at around 1 and 2 months , and the capacity to disengage and shift spatial attention from one stimulus to another is well developed by 6 months 24 , the most likely interpretation of maintaining attention on faces , especially in older infants , is that this bias involves active suppression of responses to other distracting stimuli . a similar interpretation has been proposed for increases in sustained attention to patterned stimuli in infants between 6 and 12 months 17 . the tendency to actively maintain gaze on faces strengthens during the second half of the 1st year . at this age , infants viewing complex scenes begin to fixate longer on faces than on salient competing stimuli 13 . similarly , the tendency to hold attention on faces upon presentation of distracting stimuli increases significantly between 5 and 7 months , but does not change further between 7 and 11 months 20 . in addition to becoming stronger , the bias to hold attention on faces may also become more selective over development , leading to increased prioritization of attention to faces that are more complex , novel , and informative . for example , 5montholds hold attention no differently for neutral and emotional faces , or the differences between these conditions are smaller than in 7montholds , who hold attention more selectively for faces displaying salient emotions such as fear 17 , 20 . the strengthening of the attentional hold for faces during the second half of the 1st year may relate to emerging functionality of prefrontal systems involved in active control of attention . in studies of nonhuman primates and human adults , facesensitive areas in the occipital temporal cortex feed forward to prefrontal areas 25 , and the activation of a distinct population of fixation neurons in the frontal eye fields and superior colliculus is important for maintaining fixation on a stimulus and inhibiting generation of saccades 26 . prefrontal control networks may also maintain stationary attentional focus through topdown modulation of visual excitability , resulting in selective enhancement of responses to the target stimulus and reducing responses to competing stimuli 27 . the possibility that these systems change during the second half of the 1st year is supported by brain imaging studies showing increased metabolic activity in prefrontal areas at this age 28 and changes in infants ' behavior that suggest reduced responsiveness to visual distraction . infants may hold attention on faces , especially faces making eye contact , to derive communicative cues , such as facial expressions or shifts of gaze that cue attention to an object in the environment 29 . to use these cues effectively , infants must not just orient to the source of the communicative act ( i.e. , the face ) , but also look away from the face to the cued object . the tendency to hold attention on faces might interfere with the gaze disengagement and , consequently , prevent optimal use of communicative cues . however , this does not seem to be the case because 6montholds can release attention holding and disengage from an adult 's face when the adult uses her gaze to signal the infant to look at an object 30 . this result further supports the hypothesis that in infants , holding attention on faces is voluntary rather than obligatory , because infants apparently can terminate fixating on the face when a relevant signal is given . new eyetracking technologies have led to renewed interest in infants ' attentional bias for faces , enabling researchers to obtain increasingly detailed spatial and temporal information about this bias . the evidence i reviewed in this article shows that biased orienting to faces in complex scenes is absent or weak in 3montholds , but becomes more reliable during the second half of the 1st year . biased holding of attention on faces is present at 3 months , but this tendency may be mediated initially by immaturity of the mechanisms involved in gaze disengagement , and more active prioritization of faces may not emerge before 6 months . hence , a clear shift in both abilities apparently occurs during the second half of the 1st year , when infants begin to localize faces reliably and look at faces longer than at other salient aspects of scenes , and when attention to faces becomes more resistant to distraction . this developmental shift may relate to more general improvements in attention skills at this age , originating from functional development of those frontoparietal networks that underlie control of eye movement and voluntary prioritization of attention to sensory inputs . first , as highly reproducible and tractable aspect of infants ' behavior , the bias for faces may be stable enough to lend itself to a detailed analysis of neural correlates , and may provide insights into the mechanisms that mediate attention orienting , maintenance , and termination in the developing brain . second , infants ' biases for faces may inform translational research aimed at developing novel markers of early childhood development . the bias to orient to faces is regarded as a cognitive adaptation that is functionally significant for early neurodevelopment and social behavior 2 . a lack of this bias in infants may predict increased risk for autism 18 , and tests are being developed to detect the absence of agetypical attentional biases in infants in pediatric practice 31 . an important and potentially realizable prerequisite for developing such technologies is to characterize the typical developmental course of face perception in a sufficiently large number of infants , and to demonstrate that the strength of the attentional bias for faces can be tested reliably in individual infants .\noutput:\n" }, { "from": "agent", "value": "abstractinfants have a natural tendency to look at adults ' faces , possibly to help initiate vital interactions with caregivers during sensitive periods of development . recent studies using eyetracking technologies have identified the mechanisms that underlie infants ' capacity to orient and hold attention on faces . these studies have shown that the bias for faces is weak in young infants , but becomes more robust and resistant to distraction during the second half of the 1st year . this development is apparently related to more general changes in infants ' attention and control of eye movement . as a tractable and reproducible aspect of infant behavior , the attention bias for faces can be used to examine the neural correlates of attention and may be a way to monitor early neurodevelopment in infants ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: topical corticosteroids have made a dramatic contribution to dermatology since the introduction of compound f or hydrocortisone in 1952 and have become the mainstay of dermatologic treatment of a wide range of inflammatory and non - infectious conditions . the clinical effects are mediated by their anti - inflammatory , vasoconstrictive , anti - proliferative and immunosuppressive properties . as potent topical corticosteroids are easily available over - the - counter at a low price , misuse has been noticed among the general population , producing many adverse effects . in spite of being a common problem , this study was conducted among the people living in the state of chhattisgarh , india to assess the frequency of topical corticosteroids misuse , the reasons behind it and the most common adverse effects resulting from it . patients were recruited for the study from the dermatology out - patient department during the period from november 2010 to october 2011 . the patients studied were those who had used topical corticosteroids incorrectly ( i.e. for conditions where topical corticosteroids were either not indicated or if indicated , the dose , frequency of application and / or the duration of application was not appropriate ) and presented with at least one of the following adverse effects as chief complaint : acne , facial hypertrichosis , plethoric face and telangiectasia , cutaneous atrophy , stretch marks , hyper / hypo pigmentation , tinea incognito , perioral dermatitis , infantile gluteal granuloma and pyoderma . patients were interviewed using a self - prepared questionnaire covering their personal details such as age , gender , employment , marital status , education level , duration and frequency of application of topical corticosteroid and the reasons for using the drug , awareness of proper dosing and adverse effects . patients were also asked about who had prescribed / recommended the remedy . a full skin examination was performed to detect any condition related to abuse of topical corticosteroids . most of the diagnoses were exclusively clinical , and were based on the typical , classical features . out of the 6723 new patients seen during the study period , 379 ( 5.63 % ) presented with adverse effects of topical corticosteroids resulting from the misuse of these drugs , of whom 78.89 % were females . more than 65 % of the patients were in the age group of 10 - 29 years . the mean duration of use was 7.4 months ( range : 1 - 60 months ) . most of the patients ( 96.57 % ) had not read the leaflet ( package insert ) , either because they were illiterate or because the drug provider had not given any information about the adverse effects , or the drug was supplied without a leaflet . none of the patients knew the dosage , i.e. how much of the drug should be used per body area . the number of applications varied from once daily to 3 - 4 times a day . demographic status of patients ( n = 379 ) the various topical corticosteroids used are summarized in table 2 . potent and very potent preparations were used by 88.92 % patients , including those who used topical combination preparations of corticosteroid , antibiotic and / or antifungal . corticosteroids not misused by patients in this study were halobetasol , clobetasol , triamcinolone , desonide and hydrocortisone . this may be because of the limited availability of these products in the area and also because of restricted use , by dermatologists only . topical corticosteroid formulation misused most of the patients were using topical corticosteroids on advice of pharmacists or paramedical personnel ; others were advised by friends and relatives . only in a few patients were topical corticosteroids prescribed by a physician or a dermatologist . lightening of skin colour was the main reason for using topical corticosteroids in 50.39 % patients in the absence of any primary dermatosis . other reasons for use were acne , dermatophytosis , facial dryness , pyodermas , scabies and pediculosis pubis [ table 3 ] . sources and reasons for using topical corticosteroids ( n = 379 ) the dermatological adverse effects seen after application of topical corticosteroids are listed in table 4 . acne and plethoric , puffy face with telangiectasia ( steroid face ) were the most common adverse effects noted . patients who presented with acneiform eruptions had sudden onset of lesions at the sites of application with predominance of papulopustular lesions . other adverse effects were facial hypertrichosis , pigmentation disorders , pyodermas , tinea incognito , cutaneous atrophy and perioral dermatitis . dermatological adverse effects seen ( n = 379 ) steroid acne presenting as small , firm , monomorphic , follicular papules over the forehead steroid acne on the face characterized by pustules and erythema generalized facial erythema due to of telangiectasia , after inappropriate use of high - potency corticosteroids for long term steroid induced hypertrichosis : the patient had continued treatment with topical corticosteroids for 10 months hypopigmentation caused by long term use of topical corticosteroids tinea incognito : the patient had applied topical corticosteroids that masked a diagnosis of tinea cutaneous atrophy , a sign of topical corticosteroid abuse , over the left axillary region of a 23 - year - old male perioral dermatitis in 23 - year - old girl showing multiple small erythematous papules that are localised to the perioral skin and nasolabial foldsmisuse of topical corticosteroids appears to be a common problem in india , as indicated by the proportion of patients visiting the department of dermatology with adverse effects of these drugs . the real problem is probably even greater , as , at the time of the study , many people who had used these drugs may not have presented to the dermatologist or adverse effects had still not appeared . topical corticosteroids are used as skin lighteners due to their potent bleaching action , and also their anti - inflammatory activity , which can reduce the risk of dermatitis when used along with other irritating skin lightening agents . people of various age groups , socio - economic status , employment and marital status were also found to be using topical corticosteroids as self - medication for conditions where their use is actually not indicated . the adverse effects are directly related to the potency of topical corticosteroids and have become more prevalent with the introduction of high potency topical corticosteroids . these include effects on the epidermis and the dermis in addition to those resulting from their systemic absorption . with the increasing use of topical corticosteroids , a number of adverse effects related to its misuse such as perioral dermatitis , tinea incognito , impetigo incognito and infantile gluteal granuloma have been detected apart from other complications such as cellulitis , bacterial and fungal infections , acne , skin atrophy and pigmentation disorders . recently a new term topical steroid - dependent face has been coined by saraswat et al . for the condition where , after prolonged use of topical corticosteroid on the face , there is severe rebound erythema , burning and scaling on any attempted cessation of the application . unfortunately , we found that most of the topical corticosteroids used were classed as potent or very potent . in spite of the fact that these drugs can cause such serious adverse effects , they are sold without medical prescription or control and there is little awareness about the adverse effects among the general public . in this study , the main responsibility for the misuse of topical corticosteroids could be attributed to pharmacists , paramedical personnel , the patient , friends or family . responsibility could also attributed be to general physicians and even some dermatologists to the extent that they did not emphasize the adverse effects and proper dosing of topical corticosteroids to the patients . this may also bring into focus the insufficient knowledge among medical / paramedical personnel about the proper use of topical corticosteroids . it may reflect the shortcomings of the continuing medical education program with regard to this problem . there were few a shortcomings in this study ; first , the diagnoses were mainly clinical and not confirmed by any further investigation . however the features that were observed were typical rather than atypical , making the diagnosis easiersecond , it is difficult for patients using topical corticosteroids over a long time to recollect the exact duration of their use . third , it was difficult for many patients to understand what corticosteroid was until they were shown samples of these drugs . moreover , flooding of the market with innumerable brands containing corticosteroids makes it more difficult to show a sample of each and every brand for the patient to recognize . this could have led to under - estimation of the frequency of the practice in our evaluation . despite all these limitations , this study provides data confirming the extensive and uncontrolled use of topical corticosteroids in the study setting . the misuse of topical corticosteroids has a huge impact on dermatological practice as it is responsible for a significant proportion of visits to dermatology clinics . it is a hydra - headed problem that needs multi - dimensional interventions , involving educational , legal and managerial approaches to overcome it . education of the general public through media programs and introduction of continuing medical education programs for medical , paramedical personnel and pharmacists are probably the most important steps to be taken to create awareness about the hazards of misuse of topical corticosteroids . secondly , legal approaches should include the enforcement of the existing legislation that potent topical corticosteroids can not be sold over - the - counter and without the prescription of a qualified doctor .\noutput:\n" }, { "from": "agent", "value": "background : misuse of topical corticosteroids is a widespread phenomenon among young people in india , especially women . the practice is associated with significant adverse effects and poor awareness of these effects among the general public.aim : this study was conducted to examine the misuse and adverse effects of topical corticosteroids among the people in bastar region in chhattisgarh state of india.materials and methods : data collected from patients presenting with at least one of the adverse effects of topical corticosteroids as the chief complaint , from november 2010 to october 2011 . results : out of the 6723 new patients , 379 ( 5.63 % ) had presented with misuse and adverse effects of topical corticosteroids , of whom 78.89 % were females . more than 65 % of the patients were in the age group 10 - 29 years . the main reason for using the topical corticosteroids was to lighten skin colour and treat melasma and suntan . acne ( 37.99 % ) and telangiectasia ( 18.99 % ) were the most common adverse effects noted.conclusions : misuse of topical corticosteroids has a huge impact on dermatological practice , leading to a significant proportion of visits to the dermatologist . this hydra - headed problem needs multi - dimensional interventions , involving educational , legal and managerial approaches with cooperation from different sectors of society ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: alzheimer 's disease ( ad ) and parkinson 's disease ( pd ) are progressive neurodegenerative disorders for which we do not have a cure . the current drug treatments are more designed to keep the symptoms at bay , but do not repair or prevent further degeneration . there is a clear need for novel treatments , and the industry has invested billions of dollars in finding new drug treatments . however , in particular in ad , the efforts have been in vain , and a string of clinical trials that did not find any improvements have discouraged some drug companies from investing into further research . the immune response strategy to remove beta - amyloid by activating the patient 's immune system or with the help of specific antibodies directed against amyloid had a string of failures , with the most recent one the antibody crenezumab developed by eli lilly ( cummings et al . , the failure to ameliorate memory impairment with this strategy has led to discussion about the sensibility of this approach ( fuller et al . , 2014 ) . the second strategy to reduce the activity of the beta - and gamma - secretases that produce amyloid also has suffered a series of setbacks : avagacestat , ( by bristol - myers squibb ) , tarenflurbil ( flurizan , myriad genetics ) , ly2886721 and semagacestat ( eli lilly and company ) ( extance , 2010 ; brooks , 2013 ; groves , 2013 ) . this led to a discussion about the validity of the ad biomarker beta - amyloid ( armstrong , 2014 ) . while these two main strategies have not been successful , another strategy has shown promising results for a fairly long time now . instead of focusing solely on amyloid levels as a biomarker , the idea of supporting cellular repair by the use of growth factors has shown promising results . growth factor signaling de - sensitization has been shown in the brains of people with alzheimer 's or parkinson 's disease ( holscher , 2014b ) . the reason for this is not entirely understood , but it may well be caused by the chronic inflammation that develops in these neurodegenerative disorders . cytokines such as tumor necrosis factor - ( tnf - ) released in the inflammation response down - regulate growth factor signaling ( chertoff et al . , 2011 ; clark et al . , 2012 ; najem et al . , a wide range of growth factors have been tested in preclinical studies and have shown a range of protective effects . one of the first growth factors that show extensive neuroprotective properties in a mouse model of ad is nerve growth factor ( ngf ) . ngf was found to protect synapses , synaptic plasticity , and learning abilities in ad mouse models or in nonprimate monkeys ( clarris et al . , 1994 ; kordower et al . , 1997 ; covaceuszach et al . , however , ngf does not cross the blood - brain barrier ( bbb ) , which severely limits the potential use of this growth factor to protect the brain ( bradbury , 2005 ; heese et al . brain derived neurotrophic factor ( bdnf ) also has been shown good effects in mouse models of ad . injecting bdnf intracerebroventricular improved memory formation , reduced the impairments of synaptic plasticity in the hippocampus , and increased synaptic numbers ( blurton - jones et al . , 2009 ) . enhancing the bdnf levels in the brain by gene delivery vectorsthe elevation of bdnf levels reverses synapse loss , improves synaptic plasticity and restores learning abilities of a mouse model of ad ( nagahara et al . however , bdnf does not cross the bbb and therefore it would need to be injected into the brain in order to be effective ( schulte - herbruggen et al . , 2007 ; zuccato and cattaneo , 2009 ) . other growth factors that do cross the bbb are leptin and ghrelin , which also have shown protective effects on synapses and memory formation and protect against oxidative stress ( perez - gonzalez et al . , 2011 ; tan and bloom , 2013 ; gomes et al . , 2014 ; sharma and hlscher , 2014 ) . in pd , glia - derived neurotrophic factor ( gdnf ) has shown good effects and is under intense research to develop a new treatment ( broome et al . , 1999 ; drinkut et al . does not cross the bbb either , new strategies such as nasal application are being tested ( migliore et al . , 2014 ) . the growth factors insulin and insulin - like growth factor 1 ( igf - 1 ) also have shown good effects in protecting synapses and synaptic function and memory formation . in a mouse model of ad , a systemic slow - release formulation of igf - 1 enhanced cognitive performance , decreased amyloid levels , protected synapses and reduced inflammation ( carro et al . , 2006 ) . in mouse models of ad , insulin and igf signaling was found to be impaired , and a reversal of this is neuroprotective ( bomfim et al . based on this observation , drugs initially developed to treat diabetes have been tested in animal models of ad and pd . the growth factors glucagon - like peptide - 1 ( glp - 1 ) and glucose - dependent insulinotropic polypeptide ( gip ) show good effects in animal models of diabetes and have shown good effects in several mouse models of ad ( holscher , 2014a ) . three glp - 1 mimetics have been licenced and are very effective in treating type 2 diabetes ( campbell and drucker , 2013 ) . they cross the bbb ( hunter and holscher , 2012 ) and have shown good effects in animal models of ad and pd ( holscher , 2013 , 2014b ) . based on the encouraging preclinical results , several clinical trials are ongoing to test insulin of glp - 1 mimetics in ad and pd patients . considering that a long list of drugs that initially showed effects in preclinical tests had shown disappointing results in subsequent clinical trials , it is noteworthy that initial data has been published that demonstrate positive clinical effects of growth factor analogues in ad and pd . biochemical tests of brain tissue demonstrate that insulin signaling in the brain is de - sensitized in ad patients , and the brain tissue shows key biochemical markers of insulin signaling failure ( moloney et al . , 2010 ; talbot et al . , 2012 ) . a study showed that in brain tissue of ad patients , igf - 1 and insulin signaling was strongly de - sensitized . phosphorylation of the insulin receptor chain was reduced at positions ir py1150 / 1151 and ir py960 , while the insulin receptor substrate 1 ( irs - 1 ) was hyperphosphorylated at positions irs - 1 ps616 and irs - 1 ps636 . furthermore , when incubating ad brain tissue with insulin , it revealed a reduced downstream second messenger cascade ( talbot et al . , 2012 ) . incubating the brain tissue with the glp - 1 mimetic liraglutide also reversed some of the insulin signaling impairments ( talbot et al . , 2011 ) . currently , it is believed that the insulin receptor desensitization is triggered by amyloid - oligomers . in vitro cell culture experiments showed that oligomers bind to and activate receptors which are then taken up into the cell ( zhao et al . infusion of oligomers into the brains of monkeys also show these effects and trigger local inflammatory response ( lourenco et al . , 2013 ) . interestingly , glp - 1 analogues that prevent the insulin desensitization can prevent this oligomer - induced effect ( bomfim et al . building on the observation that insulin signaling is impaired , nasal application of insulin has been tested in patients with mild cognitive impairment ( mci ) , which develops further to ad in the majority of cases . a pilot study testing nasal application of insulin in mci / ad patients included 26 memory - impaired subjects ( 13 diagnosed with early ad and 13 with mci ) and 35 controls randomly allocated to groups with a double - blind design . they received three intranasal treatments consisting of placebo or insulin ( 20 or 40 iu ) . insulin facilitated recall on two measures of verbal memory in memory - impaired apolipoprotein e epsilon4 ( apoee4 ) carriers . these effects were stronger for memory - impaired non - apoee4 carriers than for memory - impaired apoee4 carriers and control subjects . these findings are a proof of concept and demonstrate that insulin can indeed improve memory impairments in ad / mci patients ( reger et al . , 2006 ) . a follow - up pilot study with 24 ad / mci patients confirmed these effects of insulin ( reger et al . , 2008b ) . in a follow up study , 33 ad / mci patients and 59 control subjects received intranasal treatments of insulin or placebo . interestingly , insulin also affected plasma amyloid - beta levels in memory - impaired subjects and controls ( reger et al . , 2008a ) . following this , a randomized , double - blind , placebo - controlled clinical pilot trial was conducted .104 patients with either mci ( n = 64 ) or mild to moderate ad ( n = 40 ) were tested . treatment with 20 iu of insulin improved memory , and both doses of insulin ( 20 and 40 iu ) preserved caregiver - rated functional ability . both insulin doses also preserved general cognition as assessed by the alzheimer 's disease assessment scale - cognitive ( adas - cog ) score for younger participants , and functional abilities as assessed by the alzheimer 's disease cooperative study activities of daily living ( adcs - adl ) scale for adults with ad . placebo - assigned participants showed decreased 18 - fluoro -2-deoxyglucose with positron emission tomography ( fdg - pet ) uptake in the brain , demonstrating that neuronal metabolism was deteriorating . importantly , the improvements in episodic memory were still present two months after cessation of treatment ( craft et al . , 2012 ) . in a recent clinical trial , ad / mci patients received insulin analogue detemir ( 40 iu / d levemir ) and showed improvements in memory if they had high levels of insulin resistance at baseline ( craft , 2013 ) . this series of studies demonstrate that improving insulin signaling in the brains of ad patients has indeed positive effects on key disease parameters and biomarkers . this is a welcome change from previous experience , where encouraging effects with novel drugs in preclinical studies could not be repeated in clinical studies . the treatment of patients with insulin is unlikely to be the best strategy , as it may well enhance insulin de - sensitization if taken over longer time periods . in diabetes , the problem of progressing insulin de - sensitization by treatment with insulin is well described ( inoue et al . , the glp - 1 treatment had been developed which uses a different receptor pathway ( lovshin and drucker , 2009 ) . the positive preclinical results of glp - 1 in animal models of ad and pd motivated several clinical trials . this proof of concept study tested the effects of exendin - 4 in a randomized open label trial . drug treated patients showed improvement at 12 months in motor tasks , compared with control patients . most interestingly , exendin - 4 showed a clear improvement in the mattis drs - 2 cognitive score , suggesting that exendin - 4 has beneficial effects on cognition ( aviles - olmos et al . impressively , this effect was still visible 12 months after the clinical trial ( aviles - olmos et al . , 2014 ) . this result demonstrates the potential of these drugs , and confirms that the results from animal studies can be found in humans as well . the long lasting drug effect suggests that the effect is due to the normalization of growth factor signaling and the growth of new synapses and increased dopamine synthesis and release , rather than based on a short - term drug effect on synaptic release ( bertilsson et al . , a larger study has started which has a larger number of patients and a double - blind placebo controlled study design ( clinical trial identifier nct01971242 ) . to test the effects of these drugs in ad , a randomized , double - blind clinical trial of exendin - 4 treatment in mci patients / early phase ad by the nih / niafurthermore , a phase ii clinical trial of the effects of the glp - 1 analogue liraglutide in mci / ad patients has started ( clinical trial identifier nct01843075 ) . based on the encouraging preclinical results , several clinical trials are ongoing to test insulin of glp - 1 mimetics in ad and pd patients . considering that a long list of drugs that initially showed effects in preclinical tests had shown disappointing results in subsequent clinical trials , it is noteworthy that initial data has been published that demonstrate positive clinical effects of growth factor analogues in ad and pd . biochemical tests of brain tissue demonstrate that insulin signaling in the brain is de - sensitized in ad patients , and the brain tissue shows key biochemical markers of insulin signaling failure ( moloney et al . , 2010 ; talbot et al . , 2012 ) . a study showed that in brain tissue of ad patients , igf - 1 and insulin signaling was strongly de - sensitized . phosphorylation of the insulin receptor chain was reduced at positions ir py1150 / 1151 and ir py960 , while the insulin receptor substrate 1 ( irs - 1 ) was hyperphosphorylated at positions irs - 1 ps616 and irs - 1 ps636 . furthermore , when incubating ad brain tissue with insulin , it revealed a reduced downstream second messenger cascade ( talbot et al . , 2012 ) . incubating the brain tissue with the glp - 1 mimetic liraglutide also reversed some of the insulin signaling impairments ( talbot et al . , 2011 ) . currently , it is believed that the insulin receptor desensitization is triggered by amyloid - oligomers . in vitro cell culture experiments showed that oligomers bind to and activate receptors which are then taken up into the cell ( zhao et al . infusion of oligomers into the brains of monkeys also show these effects and trigger local inflammatory response ( lourenco et al . , 2013 ) . interestingly , glp - 1 analogues that prevent the insulin desensitization can prevent this oligomer - induced effect ( bomfim et al . building on the observation that insulin signaling is impaired , nasal application of insulin has been tested in patients with mild cognitive impairment ( mci ) , which develops further to ad in the majority of cases . a pilot study testing nasal application of insulin in mci / ad patients included 26 memory - impaired subjects ( 13 diagnosed with early ad and 13 with mci ) and 35 controls randomly allocated to groups with a double - blind design . they received three intranasal treatments consisting of placebo or insulin ( 20 or 40 iu ) . insulin facilitated recall on two measures of verbal memory in memory - impaired apolipoprotein e epsilon4 ( apoee4 ) carriers . these effects were stronger for memory - impaired non - apoee4 carriers than for memory - impaired apoee4 carriers and control subjects . these findings are a proof of concept and demonstrate that insulin can indeed improve memory impairments in ad / mci patients ( reger et al . , 2006 ) . a follow - up pilot study with 24 ad / mci patients confirmed these effects of insulin ( reger et al . , 2008b ) . in a follow up study , 33 ad / mci patients and 59 control subjects received intranasal treatments of insulin or placebo . interestingly , insulin also affected plasma amyloid - beta levels in memory - impaired subjects and controls ( reger et al . , 2008a ) . following this , a randomized , double - blind , placebo - controlled clinical pilot trial was conducted .104 patients with either mci ( n = 64 ) or mild to moderate ad ( n = 40 ) were tested . treatment with 20 iu of insulin improved memory , and both doses of insulin ( 20 and 40 iu ) preserved caregiver - rated functional ability . both insulin doses also preserved general cognition as assessed by the alzheimer 's disease assessment scale - cognitive ( adas - cog ) score for younger participants , and functional abilities as assessed by the alzheimer 's disease cooperative study activities of daily living ( adcs - adl ) scale for adults with ad . placebo - assigned participants showed decreased 18 - fluoro -2-deoxyglucose with positron emission tomography ( fdg - pet ) uptake in the brain , demonstrating that neuronal metabolism was deteriorating . importantly , the improvements in episodic memory were still present two months after cessation of treatment ( craft et al . , 2012 ) . in a recent clinical trial , ad / mci patients received insulin analogue detemir ( 40 iu / d levemir ) and showed improvements in memory if they had high levels of insulin resistance at baseline ( craft , 2013 ) . this series of studies demonstrate that improving insulin signaling in the brains of ad patients has indeed positive effects on key disease parameters and biomarkers . this is a welcome change from previous experience , where encouraging effects with novel drugs in preclinical studies could not be repeated in clinical studies . the treatment of patients with insulin is unlikely to be the best strategy , as it may well enhance insulin de - sensitization if taken over longer time periods . in diabetes , the problem of progressing insulin de - sensitization by treatment with insulin is well described ( inoue et al . , 1996 ) . in order to prevent this in diabetic patients , the glp - 1 treatment had been developed which uses a different receptor pathway ( lovshin and drucker , 2009 ) . the positive preclinical results of glp - 1 in animal models of ad and pd motivated several clinical trials . this proof of concept study tested the effects of exendin - 4 in a randomized open label trial . drug treated patients showed improvement at 12 months in motor tasks , compared with control patients . most interestingly , exendin - 4 showed a clear improvement in the mattis drs - 2 cognitive score , suggesting that exendin - 4 has beneficial effects on cognition ( aviles - olmos et al . , 2013 ) . impressively , this effect was still visible 12 months after the clinical trial ( aviles - olmos et al . , 2014 ) . this result demonstrates the potential of these drugs , and confirms that the results from animal studies can be found in humans as well . the long lasting drug effect suggests that the effect is due to the normalization of growth factor signaling and the growth of new synapses and increased dopamine synthesis and release , rather than based on a short - term drug effect on synaptic release ( bertilsson et al . , a larger study has started which has a larger number of patients and a double - blind placebo controlled study design ( clinical trial identifier nct01971242 ) . to test the effects of these drugs in ad , a randomized , double - blind clinical trial of exendin - 4 treatment in mci patients / early phase ad by the nih / nia is on the way ( clinical trial identifier nct01255163 ) . furthermore , a phase ii clinical trial of the effects of the glp - 1 analogue liraglutide in mci / ad patients has started ( clinical trial identifier nct01843075 ) . in contrast to current drug treatment strategies supported by the drug industry which have not produced any protective effects in clinical trials in twenty years , the strategy of using growth factor analogues that can cross the bbb has shown first effects in humans and appears to be superior and worth investing into . currently , the drug trials of insulin and glp - 1 analogues are funded by non - profit and government agencies only . the lack of funding has hampered the tests of new treatments , and there is a clear need to rethink current research strategies and a shift of research targets . the development of new growth factor analogues is currently the strategy with the greatest promise of success .\noutput:\n" }, { "from": "agent", "value": "type 2 diabetes is a risk factor for alzheimer 's disease and parkinson 's disease . insulin signaling in the brains of people with alzheimer 's disease or parkinson 's disease is impaired . preclinical studies of growth factors showed impressive neuroprotective effects . in animal models of alzheimer 's disease and parkinson 's disease , insulin , glia - derived neurotrophic factor , or analogues of the incretin glucagon - like peptide - 1 prevented neurodegenerative processes and improved neuronal and synaptic functionality in alzheimer 's disease and parkinson 's disease . on the basis of these promising findings , several clinical trials are ongoing with the first encouraging clinical results published . this gives hope for developing effective treatments for alzheimer 's disease and parkinson 's disease that are currently unavailable ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the health information technology for economic and clinical health act enables providers to receive incentive payments for transitioning to electronic medical records . allowing patient access to medical recordsfor example , electronic portals enable patients to securely communicate with their physician , request medication refills , and view lab results . electronic resources such as patient portals may even assist patients in disease self - management by tracking refill history and changes in health status . although growing in popularity , only 7 % of americans utilize patient portals . however , internet use among older adults is increasing . in 2005 , approximately 30 % of adults aged 65 and older reported ever using internet or e - mail , and only 46 % of those who used the internet reported daily internet use . more recent estimates suggest that 53 % of american adults aged 65 and older report internet or e - mail use and that 70 % of those regularly use the internet . as internet use increases , older adults will be better suited to take advantage of electronic resources for healthcare purposes . however , previous estimates of internet use in older adults have not focused on individuals with chronic diseases such as heart failure . as patient portals increase in popularity , patients with chronic conditions requiring considerable symptom monitoring , such as heart failure , may be more likely to access electronic resources for disease self - care . these electronic resources may provide the tools needed to reduce the burden of extensive self - management . the prevalence of internet and email use among patients with heart failure is not currently known , and heart failure patients may have barriers limiting their ability to successfully navigate electronic resources and apply information . barriers known to be prevalent in heart failure patients include low health literacy , poor heart failure self - management knowledge , and cognitive impairment . these barriers are associated with decreased compliance , increased rehospitalization , and increased mortality . low health literacy is associated with poorer condition - related knowledge including worse heart failure knowledge . adults with limited health literacy struggle to search for pertinent health information on the internet . although cognitive impairment is prevalent in heart failure , no studies have explored whether cognitive impairment impacts electronic resource use and electronic communication in heart failure patients . finally , whether patients who use the internet and e - mail have used these resources to gain disease - specific knowledge has not been investigated . despite increasing internet use among older adults , it is unclear whether internet and e - mail use among heart failure patients are influenced by health literacy or cognitive impairment and whether internet use relates to increased heart failure knowledge . the current study sought to investigate patterns of electronic resource use among older adults with heart failure and whether heart failure patients who report internet and e - mail use have higher health literacy and less cognitive impairment than heart failure patients who do not use internet or e - mail . additionally , the present study explored whether heart failure patients who use the internet demonstrate more heart failure - related knowledge than individuals who do not use the internet . the sample consisted of 119 english - speaking older adults with systolic heart failure who were participating in an nih - funded study examining cognitive function and self - management in older adults with heart failure . participants were 50 to 85 years of age diagnosed as new york heart association ( nyha ) heart failure class ii or iii with documented left ventricular ejection fraction less than 40 % confirmed by a medical chart review . participants were excluded if they had untreated sleep apnea , renal failure requiring dialysis , developmental disability impacting functions of daily living , history of substance abuse , neurological disorder ( e.g. , dementia , stroke ) , psychotic disorder ( e.g. , schizophrenia ) , terminal illness , cabg surgery within the previous 3 months , or head injury with greater than 10 minutes loss of consciousness according to their self - report . a brief neuropsychological battery was administered to assess multiple domains of cognitive functioning , including tests of global cognitive function , executive function , attention , and memory . the heart failure connectivity questionnaire was created for this study to measure computer and internet use and patterns . this questionnaire was developed by adapting questions from a survey in the kaiser family foundation 2005 report e - health and the elderly : how seniors use the internet for health information . fifteen questions were taken from the survey and altered to apply to heart failure patients . the questions assessed the following : internet access and use , e - mail use , internet - related communication with healthcare professionals , reasons for not using a computer or internet , and heart - failure - related internet use . meter . the meter demonstrates high internal consistency ( i.e. , cronbach 's alpha = 0.93 ) . the dutch heart failure knowledge scale was used to assess general heart failure knowledge as well as knowledge related to symptoms , symptom recognition , and treatment ( e.g. , diet and fluid restriction ) . scores range from 0 to 15 , with higher scores indicating more heart failure knowledge . the modified minimental state examination is a short screening measure of global cognitive function , tapping aspects of memory , spatial abilities , and attention . the 3ms includes a variety of short tasks such as letter sequencing , animal naming , mental reversal , and temporal orientation . this test takes approximately 7 minutes to complete and is sensitive to a range of cognitive impairments including alzheimer 's disease and other forms of dementia . participant e - mail and internet use were described using descriptive statistics ( % ) . logistic regression was conducted to examine the relationship between health literacy and cognitive function and the dichotomous variables of internet use ( 0 = no internet use ; 1 = internet use ) and e - mail use ( 0 = no e - mail use ; 1 = e - mail use ) . analysis of covariance ( ancova ) was used to determine whether heart failure knowledge differed between internet users and nonusers . most participants reported internet access at home or work ( 82.4 % ) , using the internet ( 78.2 % ) and using e - mail ( 71.4 % ) . forty - five percent of the sample reported looking up heart failure on the internet ( see table 2 ) . most participants demonstrated functional health literacy ( see table 3 ) . with regard to the dutch heart failure knowledge scale , 79.8 % of the patients had scores in the 1115 range , and 20.2 % of the patients had lower to marginal scores in the 710 range . two separate logistic regression analyses were conducted to investigate whether meter scores predicted internet use and e - mail use after controlling for age and education . the results of the logistic regression for internet and e - mail use are presented in tables 4 and 5 , respectively . results of the analysis of e - mail use indicated that individuals with higher health literacy were more likely to report e - mail use ( b = .08 , p .05 ) . controlling for age and education , logistic regression indicated that individuals with higher 3ms scores were more likely to report e - mail use ( b = .09 , p .05 ) . ancova between internet use and heart failure knowledge , controlling for age and education , revealed no effect of internet use on the dutch heart failure knowledge survey , f ( 1,116 ) = .089 , p = .77 . scores were similar in participants who reported internet use ( m = 12.24 , sd = 1.89 ) and those who reported no internet use ( m = 11.92 , sd = 2.40 ) . here we report that the majority of heart failure patients surveyed have internet access and use both the internet and e - mail . however , higher health literacy and better cognitive function predicted e - mail use but not internet use . eventually , internet use may become ubiquitous among heart failure patients , which would limit the ability of patient characteristics to predict useof course , our patients were not randomly selected and may not be representative of all patients with heart failure . however , they were recruited from two large medical centers in the midwest and were typically over 65 years of age . what was striking was the contrast between access and use of the internet and e - mail for heart failure - related purposes ; few patients reported having discussed the use of these resources with their physicians , and less than half reported using the internet to find information on heart failure . although there is little literature on use of the internet and e - mail by patients with heart failure , use of these resources will only increase and may hold promise for educating patients regarding heart failure and facilitating communication with healthcare providers . for example , a randomized trial of providing an online medical record to patients with heart failure reported that patients were able to use the system and that self - reported adherence to medications improved . furthermore , the american college of cardiology has created a website ( https://www.cardiosmart.org/ ) for patient education that includes many conditions including heart failure . thus , thought leaders are anticipating a need for internet - based resources for patient use . supporting effective use of available resources is important given that patients are expected to appropriately manage their health and respond to changes in symptoms . in this sample , heart failure knowledge did not differ between internet users and individuals who do not use the internet . many medical websites exist to provide heart failure - related information , but less than half ( 45.4 % ) of the sample reported having looked up heart failure on the internet . whether information obtained on the internet can help to address poor self - care requires further study . toward that end , a review of information regarding heart failure on the internet suggested that many websites provide primarily biomedical information as opposed to information designed to be useful to patients and recommended that healthcare providers carefully consider the content of websites prior to recommending them to patients . we are unaware of any trials of internet - delivered patient education for heart failure . however , there are many cases where the patients themselves are not solely in charge of their medical needs . it may be a family member , friend , or even a nurse who is in charge of making sure they take their medication or even bathing them . the internet could be a reliable tool for these caregivers if they have questions about the patient 's medications or notice some unusual symptoms . in fact , fox and brenner of the pew research center stated that eight in ten caregivers ( 79 % ) have access to the internet . they also found that some of searches that these caregivers made on the internet were for reviews of drugs , treatments , doctor , and even hospital facility ratings . this pew report reflects that the internet can be a reliable tool for health information , even if it is not the patients themselves directly going online . convenience sampling may limit the generalizability of these findings , and we did not intend for this to be an epidemiological investigation of rates of internet and e - mail use . rates of use of electronic resources change rapidly , and we suspect that increasing numbers of patients with heart failure will be using the internet and e - mail . although the heart failure connectivity questionnaire was a simple survey , the reliability is admittedly not known and the questions do not lend themselves to evaluation of internal consistency as they do not total up to create a score . in sum , the current findings suggest that many heart failure patients can access and use the internet and that higher health literacy and cognitive functioning predict e - mail use , although this sample generally had functional health literacy and dementia was an exclusion criteria . finally , less than half of the participants used the internet to obtain heart failure knowledge and use of the internetwas not related to more heart failure knowledge when compared with individuals who did not report internet use . electronic health educational resources , including patient portals and medical websites , may represent an untapped resource for bridging the gap between the healthcare team and patient self - management . interventions using the internet should capture usage statistics to demonstrate an adequate dose , as mere access and availability does not ensure use and patient learning . future studies are needed to investigate the use of health care portal use among heart failure patients and methods to enhance their use .\noutput:\n" }, { "from": "agent", "value": "background . the internet offers a potential for improving patient knowledge , and e - mail may be used in patient communication with providers . however , barriers to internet and e - mail use , such as low health literacy and cognitive impairment , may prevent patients from using technological resources . purpose . we investigated whether health literacy , heart failure knowledge , and cognitive function were related to internet and e - mail use in older adults with heart failure ( hf ) . methods . older adults ( n = 119 ) with heart failure ( 69.84 9.09 years ) completed measures of health literacy , heart failure knowledge , cognitive functioning , and internet use in a cross - sectional study . results . internet and e - mail use were reported in 78.2 % and 71.4 % of this sample of patients with hf , respectively . controlling for age and education , logistic regression analyses indicated that higher health literacy predicted e - mail ( p < .05 ) but not internet use . global cognitive function predicted e - mail ( p < .05 ) but not internet use . only 45 % used the internet to obtain information on hf and internet use was not associated with greater hf knowledge . conclusions . the majority of hf patients use the internet and e - mail , but poor health literacy and cognitive impairment may prevent some patients from accessing these resources . future studies that examine specific internet and email interventions to increase hf knowledge are needed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: biologicalresponse oftissue toionizing radiationdepends onthephysical characteristic ( type , energy , and dose rate ) of ionizing radiation . whentissues are exposed to ionizing radiation , environmental conditions such as the existence of radio sensitizers and radio protectors could considerably change the amount of tissue damage . in a study , alsbeih et al . showed that the presence of oxygen as a radio sensitizer could significantly increase biological damage to ionizing radiation . mn products from whole chromosomes or centric chromosome fragments did not participate in cell division during anaphase . mn formation could be considered as an appropriate biomarker of exposure to clastogenic and aneugenic hazard . studies revealed that , in the case of acute radiation exposure in human , mn is a suitable biomarker for biological dosimetry . fenech showed an increased mn frequency in human lymphocytes after exposure to 50 - 500 msv range of ionizing radiation . mn assay had been utilized to evaluate the biological damage in populations living in areas with high levels of radioactivity and in people who are occupationally exposed to ionization radiation . arbutin is a glycosylated hydroquinone found in large amounts in many plants , including those from the families of rosaceous , ericaceous , etc . its molecular weight is 272.25 g / mol and it absorbs maximum uv light at 286 mm . arbutin content in the leaves of some pyrusplants varies slightly from flower initiation to the time when leaves fall . the best time for obtaining greater amounts of arbutin from young and green leaves of the pyrus plants is spring . in this study , we investigated the effects of arbutin administration in modulating the genetic damage induced by gamma irradiationin the mouse erythropoietin system by determining the frequency of micronuclei in immature erythrocytes of bone marrow . male nmri mice ( 6 to 7 weeks old , 255 gr , number of groups = 10 , number of mice in each group = 5 , total mice = 50 ) were used in this study . the mice were kept at standard ambient conditions , including appropriate temperature ( 221c ) , humidity , and light regime ( 12:12 hour light - dark cycle ) . pure ( 98 % ) arbutin powder ( sigma ) ( 50 , 100 , and 200 mg / kg ) were dissolved in distilled water and injected into mice intraperitoneally , 2 - h before irradiation . whole - body irradiation performed with a linear particle accelerator ( linac ) source ( elekta ) . mice were placed in a ventilated plexiglas cage and irradiated in groups of five mice simultaneously . the source - to - skin distance of 100 cm with a dose rate of 200 cgy / min at room temperature ( 232c ) was used in all experiments . bone marrow obtained from the mice was tested using schmidt s method for micronucleus test . the radiation groups received 2 and 4 gy gamma radiations and other groups received 50 , 100 , 200 mg / kg arbutin ( ip ) , 2 hours before irradiation .24 hours after irradiation , the mice were slaughtered using cervical dislocation . for each mouse , the test tubes containing bone marrow and fcs were centrifuged at 1000 rpm for 7 minutes . then , the solution over the deposited substances in each tube was discharged and about 100 l of the serum remained in the tube . next , 20 l of the solution was placed on a slide , previously prepared for this purpose , and the other slide was used to uniformly spread the solution drop . the second slide was placed on the drop at 45 in order to spread the drop widthwise and the drop was then uniformly spread by rapid movements of the slide to the other side . the slides were kept for 24 hours at room temperature in the laboratory and then fixated using methanol before staining . may - grunewald stain differentiates between pce and nce . although gyms stain is effective in this distinction , but its major role is in staining micronuclei . to achieve optimum staining conditions , different conditions were examined to obtain the following specifications : 5 min : thick may - grunewald stain 3 min : diluted may - grunewald stain ( 1:1 stain - to - distilled water ratio ) cleansing by distilled water for two times 20 min : gyms stain 5 % final cleansing using distilled water . the slides were dried at room temperature after staining . in a proper staining , nuclei of the nucleated cells become dark blue . micronucleus test was used to assess cytogenetic effects of gamma radiation and the radio protective effects of arbutin . once the slides were prepared , for each sample 1,000 pces and nces were counted along with nucleated pces and nces . the cells were counted using immersion oil and an y100 nikon microscope with 100 objective lens . a total of 1000pces was scored for the presence of micronuclei for each sample . in order to study the cytotoxic effects of gamma rays on the proliferation of the bone marrow cellsgreater ratios , on the other hand , shows an increase in cell multiplication as a result of the agent administered to the mice . statistical analysis using one - way anova , tukey hsd test and t - test were used to show the significance of any intergroup differences in the number of micronucleated pces and the ratio of pces / pces + nces . male nmri mice ( 6 to 7 weeks old , 255 gr , number of groups = 10 , number of mice in each group = 5 , total mice = 50 ) were used in this study . the mice were kept at standard ambient conditions , including appropriate temperature ( 221c ) , humidity , and light regime ( 12:12 hour light - dark cycle ) . pure ( 98 % ) arbutin powder ( sigma ) ( 50 , 100 , and 200 mg / kg ) were dissolved in distilled water and injected into mice intraperitoneally , 2 - h before irradiation . whole - body irradiation performed with a linear particle accelerator ( linac ) source ( elekta ) . mice were placed in a ventilated plexiglas cage and irradiated in groups of five mice simultaneously . the source - to - skin distance of 100 cm with a dose rate of 200 cgy / min at room temperature ( 232c ) was used in all experiments . bone marrow obtained from the mice was tested using schmidt s method for micronucleus test . the radiation groups received 2 and 4 gy gamma radiations and other groups received 50 , 100 , 200 mg / kg arbutin ( ip ) , 2 hours before irradiation .24 hours after irradiation , the mice were slaughtered using cervical dislocation . for each mouse , the test tubes containing bone marrow and fcs were centrifuged at 1000 rpm for 7 minutes . then , the solution over the deposited substances in each tube was discharged and about 100 l of the serum remained in the tube . next , 20 l of the solution was placed on a slide , previously prepared for this purpose , and the other slide was used to uniformly spread the solution drop . the second slide was placed on the drop at 45 in order to spread the drop widthwise and the drop was then uniformly spread by rapid movements of the slide to the other side . the slides were kept for 24 hours at room temperature in the laboratory and then fixated using methanol before staining . may - grunewald stain differentiates between pce and nce . although gyms stain is effective in this distinction , but its major role is in staining micronuclei . to achieve optimum staining conditions , different conditions were examined to obtain the following specifications : 5 min : thick may - grunewald stain 3 min : diluted may - grunewald stain ( 1:1 stain - to - distilled water ratio ) cleansing by distilled water for two times 20 min : gyms stain 5 % final cleansing using distilled water . the slides were dried at room temperature after staining . in a proper staining , nuclei of the nucleated cells become dark blue . micronucleus test was used to assess cytogenetic effects of gamma radiation and the radio protective effects of arbutin . once the slides were prepared , for each sample 1,000 pces and nces were counted along with nucleated pces and nces . the cells were counted using immersion oil and an y100 nikon microscope with 100 objective lens . a total of 1000pces was scored for the presence of micronuclei for each sample . in order to study the cytotoxic effects of gamma rays on the proliferation of the bone marrow cells , greater ratios , on the other hand , shows an increase in cell multiplication as a result of the agent administered to the mice . statistical analysis using one - way anova , tukey hsd test and t - test were used to show the significance of any intergroup differences in the number of micronucleated pces and the ratio of pces / pces + nces . statistical analysis showed that the groups that had received maximum doses of arbutin ( 200 mg / kg ) , displayed no significant differences in mnpces and cell proliferation ratio in comparison with the control group ( p = 0.5 ) . average frequencies of mnpce and mnnce and pce / pce + nce ( meanse ) in the mice of the control group , 2 and 4 gy radiation groups , and groups that received radiation and arbutin data are meanse of 5 mice in each group ; arbutin dosage is in mg / kg and arb denotes arbutin ; p value compared to the control group therefore , lower doses of arbutin have not any clastogenic or cytotoxic effects . as shown in table 1 , the gamma radiation 2 and 4 gy caused a significant increase in the frequency of mnpces and decrease pce / pce + nce in comparison with the control group ( p 0.001 ) . the frequency of mnpce found in the arbutin treated groups was significantly lower than the treated group with radiation alone ( p 0.001 ) . in arbutin plus 2gy groups , there were no significant difference in mnpce and mnnce between 50 , 100 and 200 mg / kg ( p = 0.5 ) . in addition , no significant difference was found in pce / pce + nce between the 100 mg / kg and 200 mg / kg groups ( p = 0.5 ) . however , pce / pce + nce in the group that received 50 mg / kg arbutin was significantly different from the corresponding ratio in the groups that were given 100 and 200 mg / kg arbutin ( p 0.01 ) . in arbutin plus 4gy groups , there was no significant difference in the frequency of mnpces and the ratio of pce / pce + nce between 50 , 100 and 200 mg / kg ( p = 0.5 ) , thus the dose of 50 mg / kg could be considered as an optimal dose . table 2 shows the dose reduction factor ( drf ) , the ratio of mnpce in the treatment groups to the mnpce in the radiation - only groups , for different doses of arbutin at 2 and 4 gy gamma radiations . the cytokinesis - block micronucleus ( cbmn ) assay is a biological dose estimates for unknown radiological exposures that evaluate the human population micronuclei . it is a cytogenetic method for assessing cytotoxic effects such as ionizing radiation , chemical materials in mammalian system as well . the data clearly indicate that the mean frequency of mn in groups exposed to 2 and 4 gy gamma radiations is remarkably higher than the control groups . previous cytogenetic research done by maffie et al . , thierens , and khosravifarsani et al . confirmed our data . in addition , the 2gy group is significantly different from the 4 gy group regarding the frequency of mnpce ( p 0.05 ) , the frequency of mnnce , and pce / pce + nce ( p 0.001 ) . the 4gy group increase mnpce and mnnce while reducing pce / pce + nce ( p 0.001 ) compared to the 2gy group . previous studies by hosseinimehr and nemati , shahidi and mozdarani , and shokrzadeh et al . confirmed our data . arbutin has diverse functions , including being an anti - oxidant and a depigmenting agent . in erythrocytes , arbutin shows long - lasting radical scavenging properties and protects a membrane lipid from oxidative stress in human skin fibroblasts . it has antioxidant properties , protects skin against sunburn , is used as whitening agent , and for protection against extreme uv radiation in pharmacological formulations . , demonstrated the pyrus boissierianabuhse leaves extract has antioxidant activity serum , liver , kidney and pancreas in normal rats . previous study by ismail shahaboddin et al . demonstrated the pyrus boissieriana buhse leaves extract with 66 % arbutin has antioxidant , antihyperlipidemic and antihyperglycaemic activity . a similar decrease in mnpce induced by gamma irradiation has been described by other antioxidants such as amifostine , glutathione , and cimetidine . treatment with arbutin at doses of 50 , 100 , 200 mg / kg before exposure to 2 and 4 gy radiations reduced the frequency of mnpceby almost 2.22 fold . among radioprotective agents , amifostine has been evaluated as a powerful radio protector , but this drug is only effective at high doses , which is close to the toxic level ( i.e. , two - thirds of the ld50 value ) and induce side effects.in this study , we showed arbutin protected mice bone marrow at the relatively low dose of 50 mg / kg . arbutin is widely used as cosmetic preparation , but the role of arbutin in the gene expression of human malignant melanoma cells is rarely studied.the genotoxic effect of arbutin and its side effects in cancer progression and melanocytic tumorigenis is reported . the effects of arbutin on clastogenic and cytotoxic conditions caused by gamma ray injection of arbutin at 200 mg / kg ( the maximum dosage studied here ) in the absence of radiation , does not significantly change frequencies of mnpce , mnnce and pce / pce + nce compared to the control group ( table 1 ) . this means that the maximum dosage of arbutin examined here , does not have any clastogenic and cytotoxic effect . this also applies to smaller doses , i.e. , 50 and 100 mg / kg . administration of arbutin prior to gamma radiation resulted in extreme reduction in the frequency of micronuclei . at 2 and 4 gy gamma radiations , arbutin given at 50 , 100 , 200 mg / kg reduced mnpce frequencies from 97.55 , 98.22 , and 98.65 to 46.30 , 50 , and 51.53 , respectively , for 2 gy and for 4 gy groups from 116.40 , 114.53 , and 117.20 to 52.3 , 52 , and 52 , respectively . however , no significant difference was found between the three doses in terms of mnpce reduction ( p = 0.5 ) . in addition , injection of arbutin at 50 , 100 , 200 mg / kg prior to radiation increased pce / pce + nce from 0.29 , 0.32 , 0.31 in the 2 gy group to 0.43 , 0.41 , 0.41 , respectively , and for 4 gy from 0.21 , 0.23 , 0.22 to 0.39 , 0.39 , 0.39 , respectively ( table 1 ) . therefore , no significant difference was observed between the groups that received 100 and 200 mg / kg of arbutin with 2 gy , while the 50 mg / kg group showed significantly different results from the other two groups ( p 0.01 ) . however , no significant difference was observed between the three doses arbutinplus4 gy in terms of pce / pce + nce . in summary , based on the discussion above , it can be concluded that arbutin at different doses had radio protective properties and mitigated clastogenic effects of gamma ray . at both radiation levelsas seen in the results , at 4 gy gamma radiation , like 2 gy radiation , arbutin reduced micronuclei count and can therefore show radio protective properties in case of more severe radiation - related complications that occur at higher doses . arbutin has effectively mitigated cytotoxic effects of gamma radiation and increased cell multiplication ratio at both radiation doses to the normal level observed in the control group . a good radio protector used in radiotherapy patients should have the following properties : ( i ) offer a good protection against acute and chronic radiation damage ( drf 1.5 ) , ( ii ) have the ability to be rapidly absorbed and distributed throughout the body , ( iii ) have no significant toxicity or side effects in the body , ( iv ) be chemically stable , and ( v ) be widely available and cost - effective . one of the benefits of this study is to introduce arbutin for the first time as radio protector , but since this study was conducted on mice , generalization to humans is difficult . our results demonstrate that arbutin gives significant protection to mice bone against the clastogenic effects of gamma irradiation . these features make them suitable for use as chemical radio protectors for different exposure situations , where there is a risk of damage to bone marrow .\noutput:\n" }, { "from": "agent", "value": "background : interactions of free radicals from ionizing radiation with dna can induce dna damage and lead to mutagenesis and carsinogenesis . with respect to radiation damage to human , it is important to protect humans from side effects induced by ionizing radiation . in the present study , the effects of arbutin were investigated by using the micronucleus test for anti - clastogenic activity , to calculate the ratio of polychromatic erythrocyte to polychromatic erythrocyte plus normochromatic erythrocyte ( pce / pce + nce ) in order to show cell proliferation activity.methods : arbutin ( 50 , 100 , and 200 mg / kg ) was intraperitoneally ( ip ) administered to nmri mice two hours before gamma radiation at 2 and 4 gray ( gy ) . the frequency of micronuclei in 1000 pces ( mnpces ) and the ratio of pce / pce + nce were calculated for each sample . data were statistically evaluated using one - way anova , tukey hsd test , and t - test.results : the findings indicated that gamma radiation at 2 and 4 gy extremely increased the frequencies of mnpce ( p < 0.001 ) while reducing pce / pce + nce ( p < 0.001 ) compared to the control group . all three doses of arbutin before irradiation significantly reduced the frequencies of mnpces and increased the ratio of pce / pce + nce in mice bone marrow compared to the non - drug - treated irradiated control ( p < 0.001 ) . all three doses of arbutin had no toxicity effect on bone marrow cells . the calculated dose reduction factor ( drf ) showed drf = 1.93 for 2gy and drf = 2.22 for 4 gy.conclusion : our results demonstrated that arbutin gives significant protection to rat bone against the clastogenic and cytotoxic effects of gamma irradiation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: natural orifice transluminal endoscopic surgery ( notes ) is a new minimally invasive surgery that accesses the peritoneal or thoracic spaces through a transvisceral incision instead of a skin incision . to overcomethe technical limitations of notes , a hybrid notes technique , which combines a transcutaneous rigid laparoscopic approach with pure notes , can be used . possible transvisceral routes for hybrid notes include transesophageal , transgastric , transcolonic , and transvaginal routes . in theory , notes could reduce postoperative pain , wound complications , and the need for anesthesia , improve cosmetic results , and accelerate patient recovery and return to normal function , although these benefits have not been fully proven .1 the current upper gastrointestinal tract - related notes procedures have been performed in humans for transgastric organ resection ( i.e. , cholecystectomy , appendectomy ) , transgastric peritoneoscopy , transesophageal procedures ( peroral endoscopic myotomy , poem ) , and endoscopic full - thickness resection ( eftr ) . notes was first performed for transgastric peritoneoscopy in pigs .2 the peritoneal cavity was entered by direct incision of the anterior gastric wall with a needle knife , followed by dilation of the tract with a balloon dilator . after this first report , various notes procedures were tested in animal models , and the transgastric route was preferred in the beginning of notes because gastroscopy was familiar with gastroenterologist procedures .3 current transgastric intraperitoneal notes procedures using direct incision have been used in humans for peritoneoscopy , cholecystectomy , and appendectomy . the first notes peritoneoscopy performed in humans was reported in 2008.4 ten patients underwent diagnostic laparoscopy followed by transgastric access and endoscopic peritoneoscopy . transgastric notes peritoneoscopy was reported to be safe in all patients , and the mean duration of the procedure was 24.8 minutes . the largest study of transgastric cholecystectomy in humans was reported in 2010.5 a total of 27 transgastric cholecystectomies were performed by hybrid notes , and the rate of complications such as gastric hematoma , abdominal sepsis , and esophageal perforations was 18 % . a recent study including 14 consecutive transgastric appendectomies6 showed that two patients with purulent peritonitis required laparoscopic lavage several days after the procedure , although no leaks were detected at the appendiceal stump or stomach . all of these transgastric intraperitoneal notes procedures were successful in humans , but are not widely applied in clinic practice . in a recent randomized study in a porcine model , standard laparoscopy provided significantly better lesion detection ( 78.5 % vs. 38.9 % ) , organ visualization ( 7.15 vs. 4.35 ) , and biopsy capability ( 87 % vs. 65 % ) than transgastric notes .7 additional studies on transgastric cholecystectomy and appendectomy are required to demonstrate their role in clinical practice . submucosal tunneling was developed to guarantee safe peritoneal access , secure gastric closure , and accelerate healing of the incision site . after submucosal injection of 5 to 15 ml of normal saline , a 2 - cm incision was made in the mucosa using esd knives . a 4 to 5 cm tunnel was adequate for subepithelial tumor dissection , but a 10 - cm tunnel was used for poem . after the notes procedure , closure of the mucosal incision was performed using several endoscopic clips .8,9 submucosal tunneling has the advantage8 ,9 of the seromuscular incision site being situated far from the mucosal incision site , which allows minimization of any intraperitoneal leakage of gastric content and air by the narrow , long submucosal tract during the procedure . maintaining gastric distensioneven after seromuscular incision allows better endoscopic view and working space , thus allowing easy placement of the clips for closure of the incision . submucosal tunneling can be used for transgastric intraperitoneal procedures , dissection of subepithelial tumors , and poem . the initial submucosal tunneling procedure was access peritoneum via stomach .8 diagnostic transgastric peritoneoscopy using submucosal tunneling was successful with the patient under conscious sedation .10 however , in a recent randomized trial in an animal model , submucosal tunneling was found to permit lower visualization than direct incision .11 laparoscopic resection is not easy for subepithelial tumors that are located in the esophagus or gastric cardia . for these locations , dissection of subepithelial tumors using the submucosal tunneling technique is a possible alternative intervention . several recent retrospective studies have shown a 78 % to 100 % rate of successful subepithelial tumor resection using submucosal tunneling ( table 1 ) .12 - 17 frequent complications seen were pneumothorax and subcutaneous emphysema , which improved in most cases with conservative management , although a few patients required chest tube insertion or subcutaneous puncture .16,17 further studies are required to demonstrate the efficiency of this technique for subepithelial tumors ( particularly gastrointestinal stromal tumors ) with regard to its safety and ability to achieve complete resection with an intact capsule . the long - term follow - up data after resection is also required . achalasia is the primary esophageal motility dysfunction disorder . the loss of inhibitory neurons of the myenteric plexus results in failure of the lower esophageal sphincter to relax in response to swallowing . traditional treatments include pharmacological management , endoscopic intervention ( botulinum toxin injection , pneumatic dilation ) , and surgical treatment ( laparoscopic heller myotomy , lhm ) . the overall success rate of lhm was 77.0 % to 97.2 % .18 poem is a new endoscopic treatment modality for achalasia . endoscopic myotomy was first used in achalasia patients 30 years ago with the needle knife used for direct incision of muscle at the esophagogastric junction ( egj ) .19 pasricha et al. 20 first described the current method using submucosal tunneling and an insulated - tip knife in a pig model , which was then performed by inoue et al. 21 in humans .1 ) after submucosal injection , a 2 - cm long mucosal incision is made at approximately 10 to 13 cm proximal to the egj .2 ) a long submucosal tunnel is created 2 to 3 cm distal to the egj .3 ) endoscopic myotomy is performed 3 to 5 cm distal from the mucosal incision site in a proximal to distal direction . long endoscopic myotomy of the inner circular muscle bundles is performed using an insulated - tip knife , leaving the outer longitudinal muscle layer intact . the learning curve for poem plateaus at approximately 20 cases for experienced endoscopists .22 over 10 reports of poem use for achalasia have been published , and these indicate good short - term results without serious complications . in a recent international prospective multicenter study on poem of 70 patients at five centers in the europe and north america , the endoscopist had to perform at least two procedures under the direct guidance of an endoscopist with good experience in performing poem , prior to performing poem independently .23 all procedures were successful , and no conversions to laparoscopic or open surgery were required . the percentage of patients in symptom remission at 3 , 6 , and 12 months was 97 % , 89 % , and 82 % , respectively . poem has several theoretical advantages over lhm because it is less invasive and can allow myotomy to be performed in the proximal esophagus . extending the distance to allow lhm to be performed in the thoracic esophagus is difficult in patients with advanced disease , and the risk of injury to the vagus nerve is lower with poem because myotomy is performed from inside the esophageal lumen . because the target area for poem is the lateral side of the esophagus and that for lhm is the anterior side , a subsequent lhm is a feasible second - line treatment if poem fails .23 acid reflux is a major complication after successful lhm and poem . addition of an anti - reflux procedure to lhm can substantially reduce the incidence and severity of acid reflux .24,25 the incidence of reflux after lhm , with or without an anti - reflux procedure is 3 % to 34 % according to the literature .18 in a multicenter study , the rate of acidic reflux was 42 % at 3 months after poem .23 although the rate of reflux after poem appears to be higher than that after lhm , the severity of esophagitis was minor ( grade a or b ) and only 12 % of patients required daily proton pump inhibitor therapy .23 currently , no randomized trial has compared lhm with poem . outcomes of poem were comparable with those of lhm in short - term retrospective studies and long - term prospective randomized trials are required .26 - 28conventional endoscopic submucosal dissection techniques are not used for subepithelial tumors originating from , or infiltrating into , the muscularis propria layer because of the increased risk of incomplete resection and perforation . laparoscopic wedge resection is a minimally invasive treatment that is effective for most subepithelial tumors , and is usually performed from outside the stomach using a linear stapler . the exogastric approach with a linear stapler can lead to excessive resection of healthy tissue of the gastric wall resulting in deformity or stenosis . eftr can be used for tumor resection by direct visualization of the tumor from inside the stomach lumen leading to a free surgical margin with little resection of healthy tissue . eftr can be performed using pure notes that involves only endoscopy without laparoscopy ( table 2 ) .29 - 31 in a simple method of eftr , gastric tumors can be grasped and lifted by the tissue anchor and then resected with a snare .29 in other procedures , the tumors are separated from the muscularis layer using an insulated - tip knife under direct vision until less than one - fifth of the lesion remains , and then a snare used .30 in the most detailed procedure , a circumferential incision is made as deep as the muscularis propria around the lesion , and incision of the serosal layer is performed with a hook knife or insulated - tip knife . finally , the tumor is removed with a snare .31 en bloc resection rates were 100 % and no patient had severe complications , although 2 of the 20 patients needed ultrasound - guided percutaneous puncture for drainage of the abdominal cavity effusion in a retrospective study .30 the most important step of eftr with pure notes is the successful closure of the gastric wall opening after resection . multiple metallic clips and endoloop and over - the - scope clips have been used for successful closure .29 - 31 these studies showed the possibility of performing endoscopic resection without the need for laparoscopy . however , appropriate indication ( i.e. , location and size of the subepithelial tumor ) , details of procedures ( i.e. , resection and closure methods ) , and other management requirements for patients ( i.e. , pre - and post - management ) should be studied before widely using pure notes for subepithelial tumors . hybrid notes ( combining notes with laparoscopic approach ) is more acceptable than pure notes . hybrid notes has been applied for gastric subepithelial tumors and early gastric cancer ( egc ) . hiki et al. 32 developed a hybrid notes procedure called laparoscopic and endoscopic cooperative surgery .33 the gastric wall was perforated using a needle knife from inside the stomach lumen after circumferential submucosal dissection . seromuscular dissection and closure of the opening were performed using a laparoscopic procedure at the peritoneum . two recent studies showed that laparoscopic and endoscopic cooperative surgeries for gastric subepithelial tumors ( n = 7 and n = 20 ) were successful without complications .32,33 endoscopic seromuscular incision ( eftr ) was performed by abe et al. 34,35 after circumferential submucosal dissection , endoscopic full - thickness ( from the muscle layer to the serosal layer ) cut around three - fourths of the circumference of the above - mentioned submucosal incision was made under laparoscopic supervision . complete resection and closure of the wall defect were performed by the laparoscopic approach from the peritoneal cavity . abe et al. 35 presented four cases of sub - endothelial tumors that were successfully resected using eftr with laparoscopic assistance with no complications and minimal resection of healthy tissue . the mean size of the resected specimens and tumors was 37 mm and 30 mm , respectively . in this study , the advantage of eftr over conventional laparoscopic wedge resection was the minimal resection of healthy tissue . theoretically , eftr with laparoscopic assistance can be used for lesions located near the egj or the pyloric ring because conventional laparoscopic wedge resection for these lesions is technically complex . abe et al. 34 first reported eftr with laparoscopic assistance for egc , followed by a prospective pilot study by cho et al. 36 lymph node dissection including sentinel lymph node navigation was performed before eftr . eftr needed to be converted to subtotal gastrectomy in 5 of 14 egcs because of issues with reconstruction , insufficient vascular flow after gastric wall closure , and leakage at the suture site . although this study showed that eftr was technically successful , two important barriers hinder its wide application for egcs . a recent multicenter , single - arm phase ii study showed promising outcomes for sentinel lymph node biopsy in gastric cancer .37 confirmation using randomized phase iii studies is needed . another barrier is the current eftr technique because the gastric mucosa is exposed to the peritoneum , which could cause flow of gastric juice into the peritoneal cavity . the mucosal cancer is exposed and manipulated in the peritoneum from the open gastric wall incision . therefore , it is difficult to completely prevent viable cancer cell seeding into the peritoneal cavity . developing a nonexposure technique is a possible solution . after laparoscopic circumferential seromuscular dissection from the peritoneal cavity , the tumor was resected endoscopically or using a stapler . the opening was sutured using a linear stapler or was hand - sewn .38,39 however , laparoscopic seromuscular hand - sewn suture and laparoscopic circumferential seromuscular dissection without perforation may not be easy . intraoperative perforations occurred in 2 of 6 cases , and the mean operation time was 349 minutes in the first 3 cases and 198 minutes in the remaining 3 cases .39 easier , safer , and more effective techniques may be needed . contamination of the peritoneal cavity is a big concern during notes procedures because an endoscope is passed through the unsterile upper gastrointestinal tract into the usually sterile peritoneal cavity . notes peritoneoscopy and intraperitoneal procedures ( i.e. , biopsy or organ extraction ) need intraperitoneal navigation of the endoscope , and sterile methods may be needed for these procedures . in a randomized controlled study in a live porcine model , all non - sterile pigs ( n = 8 ) showed gross infection in the peritoneal cavity , including fibrinopurulent exudates , pus , and abscesses .40 the pigs in the non - sterile group underwent the procedure with non - sterile endoscopes and accessories , no antiseptic lavage of the gastric and oral cavities , and no antibiotics . on the other hand , all pigs in the sterile group demonstrated no gross evidence of intraperitoneal infection and negative cultures when samples were obtained from the peritoneal cavity .40 in another randomized study in a porcine model , the use of intravenous antibiotics with topical antimicrobial lavage of the mouth and stomach decreased the peritoneal bacterial load to almost zero , and this was associated with a significantly lower peritoneal infection rate than that with saline lavage .41 however , the extent of sterile methods needed is unclear . aggressive maximal sterile techniques include disinfection of the stomach and oral cavity , and use of intravenous antibiotics , sterile endoscopes with sterile overtubes , and sterile gowns , gloves , and face masks .40 in a randomized study in pigs , excluding disinfection of the stomach and oral cavity , these techniques were not associated with postoperative clinically relevant infections , although bacterial contamination could occur .42 moreover , excluding the sterilization of the oroesophageal overtube and decontamination of the stomach , these techniques were not associated with infectious complications in human trials , although these studies had a small number of participants ( n = 8 or n = 10 ) .43,44 whether proton pump inhibitors ( ppis ) , which raise the gastric ph resulting in increased bacterial colonization of the stomach , increase the risk of peritoneal infection was not determined . in a rat model , pretreatment with a ppi resulted in a higher rate of peritoneal bacterial contamination ( ppi vs. control ; 60 % vs. 20 % ) and abscess formation ( 33 % vs. 13 % ) .45 on the other hand , leakage of gastric juice into the peritoneum leads to chemical peritonitis . in a pig model , an aggressive sterile technique using ppi demonstrated no gross or bacteriological evidence of infection .40 the infection risk with poem and eftr seems to be lower than that with notes peritoneoscopy because the endoscope does not navigate the sterile peritoneum or mediastinum in poem and eftr . no penetration of endoscope occurs during procedure , with only the insulated - tip knife penetrating the gastric and esophageal walls . in addition , the insulated tip knife does not make contact with the peritoneal or mediastinal organs . in fact , the clinical outcomes of recent poem and eftr studies have shown no significant infection , although antibiotics may be needed in the pre - or post - procedures .12 - 17,29 - 31 therefore , i assume that infection is not an obstacle to the use of notes in the upper gastrointestinal tract if appropriate disinfection is performed for each procedure . various transgastric notes procedures such as periotoneoscopy , cholecystectomy , and appendectomy have been investigated in humans . however , transgastric notes procedures have not been used widely because of its obscure benefits and roles . on the other hand , poem has several advantages , and recent studies on poem show good outcomes without serious complications . eftr is a developing technology , and previous data on its use with pure or hybrid notes techniques indicate that it may be a feasible treatment method for subepithelial tumors . favorable outcomes for eftr are anticipated in the future .\noutput:\n" }, { "from": "agent", "value": "since the first transgastric natural orifice transluminal endoscopic surgery was described , various applications and modified procedures have been investigated . transgastric natural orifice transluminal endoscopic surgery for periotoneoscopy , cholecystectomy , and appendectomy all seem viable in humans , but additional studies are required to demonstrate their benefits and roles in clinical practice . the submucosal tunneling method enhances the safety of peritoneal access and gastric closure and minimizes the risk of intraperitoneal leakage of gastric air and juice . submucosal tunneling involves submucosal tumor resection and peroral endoscopic myotomy . peroral endoscopic myotomy is a safe and effective treatment option for achalasia , and the most promising natural orifice transluminal endoscopic surgery procedure . endoscopic full - thickness resection is a rapidly developing natural orifice transluminal endoscopic surgery procedure for the upper gastrointestinal tract and can be performed with a hybrid natural orifice transluminal endoscopic surgery technique ( combining a laparoscopic approach ) to overcome some limitations of pure natural orifice transluminal endoscopic surgery . studies to identify the most appropriate role of endoscopic full - thickness resection are anticipated . in this article , i review the procedures of natural orifice transluminal endoscopic surgery associated with the upper gastrointestinal tract ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: intraoperative autologous blood transfusion ( iabt ) is the technique of salvaging and subsequently reinfusing blood spilled into the operative field . it is already used for ectopic pregnancies or ovarian bleeding with hemoperitoneum instead of a homologous blood transfusion , although the previous experience has been limited to laparoscopic surgery for patients in good condition or undergoing an open laparotomy . herein , we report retrospectively the efficacy and safety of the iabt technique during laparoscopic surgery for large hemoperitoneum caused by benign gynecologic disease . the subjects were 18 patients with suspected large hemoperitoneum resulting from ectopic pregnancies or ovarian bleeding , who underwent urgent laparoscopic surgery with a carbon dioxide pneumoperitoneum at the department of obstetrics and gynecology of our hospital during a 31 - month period . all patients provided informed consent for the procedure . for the patients with hypovolemic shock , their general condition was improved by acute liquid transfusion before surgery . with the patient under general anesthesia and in the lithotomy position , an approximately 12 - mm incision was made below the umbilicus , and a primary 12 - mm blunt cannula was inserted with the open technique . after confirmation through a laparoscope , carbon dioxide pneumoperitoneum was made in the high pelvic position . a 5 - mm trocar was inserted into the right or left lower abdomen , followed by the suctioning of accumulated blood ( figure 1 ) . after diagnostic laparoscopy , laparoscopic surgery was performed with an additional trocar . before the end of the surgery , the peritoneal cavity was irrigated andphotograph of the suctioning of accumulated blood through a 5 - mm trocar , which was inserted into the left lower abdomen . the cell saver , haemo lite 2 ( haemonetics corporation , braintree , massachusetts ) ( figure 2 ) , was used for iabt . the accumulated blood in the peritoneal cavity was suctioned by adding heparinized saline solution via a double - lumen tube into a reservoir containing a 140 - m filter , which removed gross debris . the filtered blood was then transferred into a centrifuge and washed with 1000 ml of saline solution . following the removal of plasma , heparin , free hemoglobin , and cellular debris , 200 to 250 ml of 60 % hematocrit of processed blood was obtained and packed for reinfusion for 10 to 15 minutes per cycle . from centrifugation , irrigation and packingwere automated , the procedure was simply repeated when the accumulated blood increased during surgery . after the diagnosis was established , the processed blood was immediately reinfused through a leukocyte reduction filter ( blood transfusion filter : nihon pall , tokyo , japan ) in all of the patients . antibiotics were administered intravenously for 3 days . the efficacy and the adverse reactions to autologous blood transfusionthe 11 patients who had positive urine pregnancy tests ( human chorionic gonadotropin : hcg 25 miu / ml ) were diagnosed with ectopic pregnancies , and the 7 patients with negative urine pregnancy tests were diagnosed with ovarian bleeding . cases of ectopic pregnancy ( n = 11 ) pre = preoperative ; post = postoperative ; hb = hemoglobin ; tp = total protein . cases of ovarian bleeding ( n = 7 ) pre = preoperative ; post = postoperative ; hb = hemoglobin ; tp = total protein . none of the patients required homologous blood transfusions . the patients with more than 1000 ml of blood loss were administered heat - processed albumin during surgery or postoperatively . adverse reactions to autologous blood transfusion , such as allergic reactions , infection , bleeding tendencies , or embolisms , were not found in any of the patients who received reinfusion . all of the patients were able to walk the day after surgery and were discharged within 7 days of receiving therapy for anemia . ectopic pregnancy and ovarian bleeding can now be detected at earlier stages because of improvements in pregnancy tests and transvaginal echography . therefore , laparoscopic surgery is usually performed for patients in good general condition , and without severe anemia or hypovolemic shock . however , some patients still experience a lot of bleeding into the peritoneal cavity and sometimes need blood transfusions . autologous blood transfusion has become increasingly used to avoid the side effects of homologous blood transfusions including allergic reactions or infections . three types of autologous blood transfusion exist : hemodilution , predeposit , and salvage types . the hemodilution and predeposit types could not be used for hemoperitoneum patients , though the salvage type iabt was very suitable for such patients . iabt is already used for ectopic pregnancies or ovarian bleeding with hemoperitoneum instead of homologous blood transfusion , but previous experience has been limited to laparoscopic surgery for patients in good condition or having open laparotomy . recently , the use of iabt has been reported in laparoscopic surgery for spleen trauma . we applied iabt in cases of large hemoperitoneum caused by benign gynecologic diseases like ectopic pregnancy and ovarian bleeding . the advantages of iabt compared with those of homologous transfusions include immediate preparation without cross - match testing as well as cost - effectiveness . most of the accumulated blood in the peritoneal cavity was unclotted and at least half of this blood could be reinfused . the survival time of red cells processed by the cell saver was no different from that of normal red cells . the color of the processed blood is bright red like arterial blood because oxygen saturation increases during processing , such as centrifuging and irrigation . the disadvantage of iabt is that it decreases blood protein in proportion to the volume of blood loss . to prevent pulmonary edema from arising from hypoproteinemia , heat - processed albumin was used for patients whose blood loss exceeded 1000 ml . antibiotics were administered to cover the risks of contamination , such as bacteria in the processed blood . despite this precaution , the frequency of bacterial contamination in laparoscopic surgery was theoretically lower than that in laparotomy . coagulation factors are not generally decreased in the case of hemoperitoneum compared with external bleeding . iabt enabled the performance of laparoscopic surgery for patients with large hemoperitoneum caused by ectopic pregnancies or ovarian bleeding without a homologous blood transfusion . homologous blood transfusion and the side effects from autologous blood transfusions were not considered proof of the efficacy and safety of iabt .\noutput:\n" }, { "from": "agent", "value": "objective : our purpose was to evaluate the efficacy and safety of intraoperative autologous blood transfusion during laparoscopic surgery for hemoperitoneum in benign gynecologic disease.methods : the cell saver , haemo lite 2 , an intraoperative autologous blood salvage device , was used in laparoscopic surgery on 18 patients with ectopic pregnancies or ovarian bleeding who had a large hemoperitoneum with / without severe anemia and hypovolemic shock.results : the blood loss was 1186789 ml , and the volume of reinfused processed blood was 661405 ml in ectopic pregnancy cases . the blood loss was 716219 ml , and the volume of reinfused processed blood was 496138 ml in ovarian bleeding . laparoscopic surgery was performed and homologous blood transfusion was not required in any patient . no adverse reactions or procedural difficulties associated with the autologous blood transfusions occurred.conclusions : intraoperative autologous blood transfusion enabled the performance of laparoscopic surgery for large hemoperitoneum caused by ectopic pregnancies or ovarian bleeding without a homologous blood transfusion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the use of recombinant proteins as biological drugs has been known for the past three decades ; however , this field is continuously emerging and in the last decade an increasing number of new biologic entities ( biologics ) in the area of cytokines were developed . biologics can be an antibody which neutralizes an inflammatory cytokine or blocks its receptors , decoy receptors targeting the cytokine , or a recombinant protein , which can either be receptor agonist or , alternatively , an antagonist that occupies and prevents receptor binding . the benefits of cytokines as therapeutic targets are as follows : ( i ) unlike in chemical drugs , specific protein which mediate the inflammatory process can be inhibited ; ( ii ) cytokines are well studied in animal models using neutralizing antibodies or genetic models like knockout mice ; thus the process in which these cytokines are involved can be thoroughly researched ; ( iii ) with the advancement of biotechnology techniques , the expression and isolation of highly purified recombinant proteins becomes a relatively easier and cheaper process than in the past years . the drawbacks of cytokine therapy come due to the basic properties of cytokines : ( i ) cytokines are pleiotropic , meaning that they affect several processes in parallel ; ( ii ) cytokines are also known to have redundancy , meaning that the effects achieved by blocking one specific cytokine activity can be compensated by others ( although this can be also beneficial , since a biological agent can be replaced to different cytokine blocker when incomplete remission or in case of intolerance ) ; ( iii ) the cytokine network is a regulated and balanced system and its alteration may lead to impaired immune response . for example , inhibiting proinflammatory cytokines can result in compromised host defense against infections . on the other hand , inhibition of regulatory cytokines can result in autoimmunity or tissue damage ; ( iv ) the production and manufacturing of biologics is still an expensive process , since their production requires sterile conditions ( i.e. , gmp conditions ) and multiple stages of purification ; ( v ) compared to chemical drugs , recombinant cytokines and antibodies have limited shelf half - life , require special / controlled storage conditions , and are typically administrated by a physician . in this reviewwe discuss some of the key approaches of anticytokine blockers focusing on approved anti - inflammatory biologics . in particular , we highlight their beneficial effects and present their possible side effects and risk factors . most importantly , we suggest several potential solutions for the anticytokine adverse effects and propose new approaches to this emerging field . cytokine therapy emerged from the need to increase immunity against tumors using the lymphocyte activator and proliferative factor , interleukin - 2 ( il - 2 ) . based on its remarked efficacy in mice , cancer patients bearing renal cell carcinoma ( rcc ) and melanomawere administered high doses of il - 2 in order to increase antitumor immunity . unfortunately , systemic administration of il - 2 has been related to severe toxicity , mainly capillary leak syndrome , associated with edema and hypotension , damage to the kidneys , heart , and brain ( as well as tachycardia , atrial fibrillation , fever and chills , muscle and joint pain , and catheter related urinary tract infections ) . in spite of numerous restrictions and warnings , a recombinant modified version of il - 2 ( aldesleukin ) was approved in 1992 for metastatic rcc and in 1998 for metastatic melanoma patients . as early as the 1990s , several years following the discovery of il - 1 by auron et al . , il - 1 was used to treat cancer patients undergoing chemotherapy or patients suffering from anemia . it was assumed that since il - 1 has neutrophilic effects , it could restore neutrophil counts back to normal numbers in neutropenic patients . however , il - 1 is a potent proinflammatory cytokine ; thus the treatment resulted in toxicity with side effects such as fever , rigors , fatigue , joint aches , headache , and nausea . ifn in a pegylated form is given in order to increase antiviral immunity by elevated cd8 + cell response in cases of chronic hepatitis - b virus ( hbv ) and hepatitis - c virus ( hcv ) or in the case of immediate treatment for acute hcv . the ifn can be given alone or together with the nucleoside analog , ribavirin . this treatment facilitates the clearance of the hcv virus and can prevent the chronic disease which can result in cirrhosis and hepatocellular carcinoma . however , this type i ifn cytokine can cause serious adverse effects that can result in limitation of the doses given or even in discontinuation of the treatment . among these adverse effectsare decreased granulocytes and thrombocytes production in the bone - marrow , flu - like symptoms , neuropsychiatric disorders , and autoimmunity syndromes , mainly thyroiditis . tnf - is a proinflammatory cytokine ; it appears early during the response to trauma or bacterial infections and was first cloned in 1985 by several groups . initially it was described as a soluble factor with two important abilities , inducing hemorrhagic necrosis of tumors in vivo , combined with the ability to kill tumor cells in vitro . tnf - is a central alarm cytokine , which is mainly secreted from activated macrophages or dendritic cells in response to ligation of pattern - recognition receptors . both tnf and il - 1 are attractive therapeutic targets , since they are the upstream factors of the inflammatory cascade . the role of tnf receptor signaling has been correlated with several diseases including rheumatoid arthritis ( ra ) , crohn 's disease , atherosclerosis , psoriasis , sepsis , diabetes , and obesity . tnf - is expressed as a precursor , anchored to the cell membrane and further cleaved to its soluble form . tnf - binds the inflammatory tnfr1 and regulatory tnfr2 and in addition to the inflammatory cascade affects cell death , proliferation , and differentiation . the tnf - inhibitor etanercept was the first biologic on the market for the treatment of ra . etanercept is a fc fused recombinant form of a natural tnf inhibitor that was first described in 1988 and later was found to be a soluble tnf receptor . infliximab is a monoclonal chimeric human - mouse anti - tnf antibody and was approved by the fda together with etanercept in 1998 . later on , by 2002 , a fully human monoclonal antibody against tnf - ( adalimumab ) was approved as well . while infliximab binds both monomeric and trimeric forms of tnf ( the inactive and active forms ) , etanercept binds mainly the active trimeric form in a less stable manner , as well as binding tnf - . the anti - tnf antibodies are capable of lysing cells they bind by recruiting the complement system . these differences appear in the molecules effectiveness against different inflammatory diseases and might be related to the antibodies binding to membranal tnf - on t cells . infliximab was first approved for the treatment of severe crohn 's disease and later also for ra , where etanercept was first approved only for the treatment of ra . infliximab was further approved for ulcerative colitis , psoriatic arthritis , ankylosing spondylitis , and chronic plaque psoriasis , and etanercept was further approved for psoriatic arthritis , ankylosing spondylitis , chronic plaque psoriasis , and juvenile idiopathic arthritis in children . adalimumab is approved for rheumatoid arthritis , psoriatic arthritis , ankylosing spondylitis , crohn 's disease , ulcerative colitis , moderate - to - severe chronic psoriasis , moderate - to - severe hidradenitis suppurativa , juvenile idiopathic arthritis , and noninfectious uveitis . these days , certolizumab and golimumab are the newer , less studied anti - tnf - antibodies most recently approved by the fda for the treatment of ra , psoriatic arthritis , ankylosing spondylitis , crohn 's disease unresponsive to regular medications ( certolizumab ) , and ulcerative colitis ( golimumab ) . although the tnf inhibitors were shown effective for the treatment of skin and joint inflammation , they carry the risk of several adverse effects , mainly concerning infections . tnf - is a fundamental factor for fighting intracellular bacteria and is therefore not surprising that tnf - inhibition was shown to increase the risk for reactivation of tuberculosis . in a 3 - year french study of 69 newly diagnosed tuberculosis patients undergoing anti - tnf therapy , it was concluded that anti - tnf antibodies ( infliximab and adalimumab ) have a high risk for tuberculosis . etanercept , the soluble tnf receptor , also carries such a risk but at a lower level . it can be assumed that the differences in the anti - tnf strategies , which allow antibodies to be more effective against ibd , affect also the ability to inhibit the immune system to fight tuberculosis . similarly , reactivation of hbv is higher during tnf inhibition . additionally , ra patients who were treated with anti - tnf antibodies experienced a higher rate of outbreaks of herpes zoster virus ( hzv ) compared to etanercept or disease - modifying antirheumatic drug ( dmard ) treatments . blocking tnf plays an opposing role regarding the development of malignancies . on the one hand , tnf is an inflammatory mediator and the inflammatory process itself can lead to cancerous diseases ; hence , inhibiting tnf , like other proinflammatory molecules , can be beneficial in the aspect of cancer initiation and progression . on the other hand , tnf plays a role in cell proliferation , differentiation , and apoptosis , and , therefore , its inhibition can be a result and indeed was correlated with hematological malignancies , like increased hepatosplenic t cell lymphoma in young ibd patients treated with infliximab . in addition , since tnf inhibitors are immunosuppressive drugs , they carry the risk for development of malignancies . indeed , tnf inhibitors carry warnings for increased risk of hematological malignancies in children , adolescents , and young adults , primarily treated for ulcerative colitis or crohn 's disease also treated with immunosuppressant ( azathioprine and / or mercaptopurine ) . the fact that tnf inhibitors are often combined with methotrexate which also increases the risk for malignancy and , in addition , the association of diseases treated with tnf inhibitors , for example , ibd or ra , with increased risk for cancer is making the direct link between tnf inhibitors and malignancies harder to determine . tnf inhibition , using infliximab or etanercept , was trialed for the treatment of congestive heart disease and not only were they shown to be inefficient but also increased the chance of hospitalization or death due to heart failure . patients treated with anti - tnf therapy were also reported for increased risk for demyelinating disorders , like multiple sclerosis , optic neuritis , and acute transverse myelitis ; paradoxical psoriasis consisting of severe skin lesions was observed in ibd patients treated with anti - tnf agents . in addition , unlike anti - tnf antibodies , etanercept , which is not effective for the treatment of ibd , was correlated with the development of newly diagnosed ulcerative colitis and crohn 's disease in treated patients . following the failure to use il - 1 as a therapeutic agent in order to treat neutropenic patients and the increasing data demonstrating the potency of this cytokine to induce inflammationfollowing inflammatory stimuli , like bacterial products , the proinflammatory cytokines , il - 1 and il - 1 , are elevated . however , an additional inhibitory protein that reduces these il - 1 molecules is secreted . the anti - inflammatory mediator was isolated in 1990 , and the sequence of the il - 1 receptor antagonist ( il - 1ra ) was published . it is a cytokine , which belongs to the il - 1 family with about 40 % similarity to il - 1 that binds the same il - 1 receptor type 1 ( il - 1r1 ) albeit occupying it without inducing the signal transduction . the significance of the il - 1ra as a natural anti - inflammatory cytokine is demonstrated by the genetic loss of function of the il1rn gene . this results in a lethal systemic inflammatory disease with severe skin and bone involvement , termed deficiency of interleukin - 1 receptor antagonist ( dira ) . anakinra is a recombinant nonglycosylated form of il - 1ra that was approved in 2001 for the treatment of ra in adult patients that did not respond to other antirheumatoid drugs , like dmard . anakinra was shown beneficial for the treatment of ra by reducing symptoms and joint damage ; however it is recommended to use when other biologics , like anti - il - 6 or anti - tnf therapies which are preferable , are refractory or contraindicated . mutations in the inflammasome related genes can result in autoinflammatory syndromes due to excess il - 1 . anakinra is therefore approved for the treatment of patients suffering from a form of cryopyrin - associated periodic syndromes ( caps ) called neonatal - onset multisystem inflammatory disease ( nomid ) . caps is a common name for three autoinflammatory syndromes ( familial cold autoinflammatory syndrome , muckle - wells syndrome , and nomid ) , in which dysregulated inflammasome results in il - 1 activation and secretion and a broad inflammation occurs . since il - 1 is the major mediator of these autoinflammatory diseases , it is obvious why anakinra , which blocks il - 1 activity , is preferable for therapy . familial mediterranean fever ( fmf ) is a hereditary chronic inflammatory disease which il - 1 plays a major role in , and blocking il - 1 reduces the symptoms . anakinra was also shown to be effective in the case of nonhereditary chronic systemic inflammatory diseases like the adult - onset still disease , which involves arthritis , fever , and systemic inflammation or the childhood versionin addition , there are more common inflammatory diseases like gout , hemodialysis patients , postmyocardial infarction cardiac remodeling , and type 2 diabetes , in which the glycaemia and beta - cell secretory function are improved , in addition to vast types of other inflammatory disorders responding to anakinra ( reviewed n ) . anakinra has a short half - life of about 6 h ; treatment therefore requires frequent subcutaneous injections and the most common side effect of anakinra is injection site reaction . the short half - life of anakinra allows immediate withdrawal of the treatment if needed . during the administration of anakinra , the immune systems ability to fight infections is reduced . meta - analysis of four ra trials using anakinra showed increased risk of infections , mainly pneumonia but also osteomyelitis , cellulitis , bursitis , herpes zoster , infected bunion , and gangrene . gouty arthritis patients treated with anakinra were also in increased risk for infections , mostly by s. aureus . since il - 1 is a neutrophil attractant and growth factor , the risk for neutropenia in patients treated with anakinra increased as well , and during administration of anakinra neutrophil numbers must be followed . the combination of anakinra together with corticosteroids or other immunosuppressive drugs increases the risk of infections . combining anakinra with prednisolonewas shown to risk ra patient with serious infections of s. aureus , hemolytic streptococci , and e. coli . patients with a history of tuberculosis are not recommended for anakinra treatment or for those participating in clinical trials , since the chance for reactivation of tuberculosis during administration of anakinra is high . rilonacept ( also termed il - 1 trap ) , a dimer of il - 1r and il - 1r accessory protein ( il - 1racp ) extracellular chains fused to the fc fragments of igg , was trialed and found effective for the treatment of caps . rilonacept was approved as biological drug in 2008 , and canakinumab , a monoclonal anti - il - 1 antibody that was also shown beneficial for the treatment of caps , was approved in 2009 . like anakinra , both were shown to reduce symptoms in additional inflammatory diseases , such as gout , and canakinumab was also shown to be effective for sjia . side effects associated with canakinumab resemble those of anakinra , such as increased risk of infections , neutropenia , and low platelet count ; therefore it is not recommended for patients with a high risk for infections . canakinumab is administered once every four to eight weeks , dependent on disease severity , due to its extended half - life . nonetheless , withdrawal will not terminate the effects of the drug immediately , like in the case of anakinra . hyper - igd syndrome ( hids ) is a genetic autoinflammatory syndrome associated with high igd blood levels , caused by a mutation in the gene encoding mevalonate kinase ( mk ) . tnfr1 - associated periodic syndrome ( traps ) is caused by intracellular accumulation of misfolded mutated tnfr1 and an elevated il - 1 production . canakinumab is currently tested in a phase iii trial in colchicine resistant fmf , hids / mk deficiency , and traps patients ( clinicaltrials.gov identifier : nct02059291 ) . in addition , the effect of canakinumab on cardiovascular events and type 2 diabetes is currently held by the canakinumab anti - inflammatory thrombosis outcome study ( cantos ) trial . il - 6 is the ligand for il - 6 receptor ( il - 6r ) . following its binding , gp130 , a transmembranal glycoprotein forms a homodimer and transmits the signaling . unlike il - 1r1 or tnfr1 , which are ubiquitousanother difference from the il - 1 and tnf cytokines is that the soluble form of il - 6r facilitates and induces the signal rather than serving as an inhibitor . soluble il - 6r binds il - 6 and this complex further binds membranal gp130 , which , unlike il - 6r , is expressed in all cell types . this kind of signaling is termed trans - signaling , a process which allows il - 6 to mediate its response on cells that lack il - 6r ; among these are embryonic stem cells , endothelial cells , hematopoietic progenitor cells , osteoclasts , and neuronal cells . the proinflammatory cytokines , il - 1 and tnf - , were assumed to be responsible for the acute phase response of liver cells in vivo . nevertheless , when hepatocytes response to stimulation by crude macrophage cytokines was compared to isolated cytokines il - 6 , il - 1 , and tnf , only il - 6 could induce fully comparable response . among the many il - 6 effectsil - 6 can alter the t helper cell phenotype programming ; it can stimulate b cells , nk cells , osteoclasts , and cancer cells and is secreted by a variety of cells ; among these are lymphocytes , macrophages , endothelial cells , epithelial cells , and fibroblasts ; these then play a major role in autoimmune diseases , especially ra , in which increased levels of il - 6 are found in synovial fluid . the myeloma receptor antibody ( mra ) , a humanized antibody against il - 6r , was first trialed in 2003it was then demonstrated to decrease serum acute phase protein in ra patients , which were not responsive to dmard or other immunosuppressive drugs . the mra antibody was renamed tocilizumab and its efficiency for ra was demonstrated in a large trial consisting of 633 patients . the trial showed reduced disease activity and the fda approved tocilizumab in 2010 for the treatment of ra patients refractory to tnf inhibitors ; additionally it was also shown efficient in another trial for the treatment of sjia where in 2011 the fda expanded the use of the antibody to include the treatment of sjia patients . data pooled from five clinical trials , two ongoing extension trials , and one clinical pharmacology study summarized the following adverse effects among trial participants : serious infections mainly pneumonia , gastroenteritis , and urinary tract infections , opportunistic infections ( such as tuberculosis , candidiasis ) , gastrointestinal perforation , and anaphylactic reactions . other side effects were neutropenia and increased lipid levels , which are assumed to induce cardiovascular events . since il - 6 elevates crp levels , its inhibition by tocilizumab results in milder elevation of crp during infections . this can put the patients at risk since it is harder to diagnose an infection in patients undergoing treatment . one of sjia complications is macrophage - activating syndrome ( mas ) , a life threatening disease , associated with impaired bone - marrow and liver functions . tocilizumab treatment does not prevent or worsen mas ; however , it does mask the clinical symptoms , again by reducing the crp levels , which allow diagnosing the outbreak of this syndrome . blocking il - 1 with anakinra , on the other hand , was shown to reduce mas severity in sjia patients . siltuximab is a human - mouse chimeric anti - il - 6 antibody approved in 2014 for hiv - negative and herpes virus - 8 negative patients for the treatment of multicentric castleman 's disease , a lymphoproliferative disorder associated with increased il - 6 in the enlarged hyperplastic lymph nodes . siltuximab was further studied for its beneficial anti - il - 6 effects in other malignancies , like multiple myeloma , myelodysplastic syndrome , prostate cancer , ovarian cancer and lung cancer , and cancer - associated cachexia and anorexia . however , the treatment with siltuximab increases the risk of upper respiratory tract infections and other adverse effects including nausea , fatigue pruritus , increased weight gain , rash , hyperuricemia , thrombocytopenia , dyspnea , leukopenia , and neutropenia . ustekinumab is a human monoclonal antibody against il - 12 and il - 23 , which share the same il - 12p40 subunit . the antibody recognition of this cytokine reduces the differentiation of nave cd4 + t helper cells into effector t cells , th1 , and th17 . th17 cells were named after il - 17 cytokine ( which they produce ) and are correlated with autoimmunity disorders including ra , lupus , colitis , and eae . il - 12 and il - 23 and their associated t helper cells are correlated to psoriasis which is an immune - mediated chronic inflammatory skin disease , and psoriasis patients have an increased risk to develop psoriatic arthritis . ustekinumab was shown to be more effective compared to etanercept and was approved in 2009 for plaque psoriasis and in 2013 for psoriatic arthritis . however , ustekinumab treated patients are recommended to receive prophylactic treatment due to increased risk of tuberculosis reactivation , as well as the issue of reduced cd4 + lymphocytes during this treatment , that should be taken into account . secukinumab is a human anti - il - 17a antibody that was trialed and shown ineffective in clinical trials for the treatment of crohn 's disease , as the treatment aggravated the disease severity in addition to increased adverse effects , like upper respiratory tract infections and local fungal infections . however , much like ustekinumab , il - 17 inhibition using secukinumab reduced symptoms and improved physiological functioning compared to placebo or etanercept in plaque psoriasis and was approved by the fda in 2015 . secukinumab was also reported for its efficiency for psoriatic arthritis and ankylosing spondylitis and was approved for these indications . in march 2016 an additional monoclonal anti - il - 17 antibodylong - term data from experiences of these antibodies targeting effector helper t cells cytokines is required for further evaluation of the adverse effects and safety of these biologics . anticytokine therapy is a powerful tool to fight autoimmune and autoinflammatory diseases in addition to many other diseases in which the inflammatory process enhances the disease activity . il - 1ra , anakinra , was shown beneficial in vast types of diseases , among which are autoimmune ra , autoinflammatory diseases like caps , hereditary inflammatory fmf , improved beta cells function in type 2 diabetes , remodeling following myocardial infarction , smoldering myeloma , and a variety of other disorders . other inflammatory mediators like tnf - and il - 6 have also great potential as targets in anti - inflammatory treatment . however , there is always a major cause for concern when systemically reducing inflammation by biologics that can compromise the patient ability to overcome infections . for example , the ability to reduce the rheumatoid process in patient 's joints without inhibiting the neutrophils migration into the lungs in order to fight pneumonia is the objective for new biologics . one strategy to do so is to inject the patient with inactive biologic that would be activated whenever it meets the inflammatory site ; the chimeric - il - 1ra recently published carries such an approach . this molecule is composed of the n - terminal peptide of il - 1 fused to il - 1ra in its c - terminal side that mimics the structure of the precursor of il - 1 ; thus it is expressed as an inactive procytokine . in the inflammatory sites , increased levels of neutrophil serine proteases ( like elastase , cathepsin g , or chymotrypsin ) , macrophages - derived pr3 and caspase - 1 , or granzymes from nk cells are released from activated or dying cells and these enzymes cleave the n - terminal peptide of il - 1 and release the active free c - terminal cytokine part ( figure 1 ) . for example in the inflamed joint of gouty arthritis patients , il - 1 is active due to the increased activity of neutrophils where the short - lived neutrophils are rich in serine proteases and are released to the site of inflammation . as for the chimeric - il - 1ra , the active il - 1ra part is released in the same manner as il - 1 ( i.e. , an inactive precursor that transforms into an active cytokine due to the inflamed environment ) . at the same time , the patient 's unaffected tissues are spared from the excessive systemic il - 1r1 blockade . chronic inflammation in the microenvironment of tumors facilitates the tumors mechanisms of invasion and growth . the tumor is surrounded with myeloid cells , rich with inflammatory enzymes and cytokines when il - 1 facilitates tumor growth , angiogenesis , and metastases . it was shown that the inflammatory tumorigenic microenvironment is derived from il - 1 secreted from the myeloid cells around the tumor , and the il - 1 secreted from the tumor cells accompanied with hypoxia , necrosis , or dna damage . it was therefore why anti - il - 1 therapy was suggested for trials in cancer patients . recently , it was shown that il - 1 neutralization using a monoclonal antibody would be beneficial in cancer patients in prolonging their survival . cancer patients are often treated with immunosuppressive and bone - marrow suppressing drugs ; therefore , they are exposed to increased risk of infections . thus , biologics like the chimeric - il - 1ra that might reduce the inflammatory process in the tumor site without reducing the patient 's ability to fight infection is a desirable approach . in order to inhibit cell surface tnf , in a cell - type restricted manner , efimov et al . constructed bispecific antibody that recognizes both the f4 / 80 macrophage marker and the membranal tnf - . in this manner , the antibody favors binding of tnf - on myeloid cells rather than free tnf - or t lymphocytes derived tnf - . the aim was to reduce anti - tnf side effects by blocking macrophage - derived inflammation , while maintaining t cell activity . the authors claim that this antibody can prevent reactivation of latent tuberculosis and reduce anti - tnf liver toxicity . unregulated levels of cytokines are central mediators of many inflammatory diseases . targeting these cytokines using recombinant anti - inflammatory cytokines , recombinant soluble receptors , or antibodies against cytokineshas demonstrated preferable clinical outcomes in patients with autoimmune diseases , which are refractory to glucocorticoids treatments . however , systemic cytokine blocking suffers from a number of serious limitations . for one , the lack of danger signals , which is crucial for adequate immune cell activation as well as hematopoiesis alterations , common features in all biologics , expose the host to increased risks of infections . in addition , the pleiotropic nature of most cytokines and their necessity to the function of multiple cell types across different organs make it almost impossible to inhibit their signaling cascade in a long - term therapy without severe complications . therefore , new approaches based on site - restricted biologics , which maintain the cytokine activity in other sites , are highly advised .\noutput:\n" }, { "from": "agent", "value": "proinflammatory cytokines are potent mediators of numerous biological processes and are tightly regulated in the body . chronic uncontrolled levels of such cytokines can initiate and derive many pathologies , including incidences of autoimmunity and cancer . therefore , therapies that regulate the activity of inflammatory cytokines , either by supplementation of anti - inflammatory recombinant cytokines or by neutralizing them by using blocking antibodies , have been extensively used over the past decades . over the past few years , new innovative biological agents for blocking and regulating cytokine activities have emerged . here , we review some of the most recent approaches of cytokine targeting , focusing on anti - tnf antibodies or recombinant tnf decoy receptor , recombinant il - 1 receptor antagonist ( il - 1ra ) and anti - il - 1 antibodies , anti - il - 6 receptor antibodies , and th17 targeting antibodies . we discuss their effects as biologic drugs , as evaluated in numerous clinical trials , and highlight their therapeutic potential as well as emphasize their inherent limitations and clinical risks . we suggest that while systemic blocking of proinflammatory cytokines using biological agents can ameliorate disease pathogenesis and progression , it may also abrogate the hosts defense against infections . moreover , we outline the rational need to develop new therapies , which block inflammatory cytokines only at sites of inflammation , while enabling their function systemically ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: uveal melanoma ( um ) is the most common intraocular malignancy in adults , with an incidence of 56 cases per million per year .1,2 the incidence rate in nonwhites is extremely low ; in the united states , it is less than one - eighth of the rate for whites .2 it is usually diagnosed in the sixth decade of life , with a slight predominance of males .2 among all melanoma cases reported in the united states , approximately 5 % arise from the ocular and adnexal structures ; of these , 85 % correspond to um .3 it is the most common noncutaneous form of melanoma .1,2 most patients with um have no known family history of the disease , even though there are a few reports of sporadic familiar cases .2 although heredity may not play a role in most cases , cytogenetic analyses of um tissue have revealed that alterations in chromosomes 3 and 8 may be associated with increased metastasis - related mortality .2 the collaborative ocular melanoma study found that eyes treated with 125 - iodine ( i - 125 ) brachytherapy compared to enucleation had no difference in mortality ( 43 % and 41 % , respectively ) , or in the development of metastasis ( 21 % and 17 % , respectively ) at 12 years of follow - up .3 consequences of radiation on the sensitive ocular structures involves apoptosis , cell migration , clotting cascades , increased vascular endothelial permeability , aneurysm formation , telangiectasia , and neovascularization .3,4 as a result , radiation - related complications include retinal detachment , cataract formation , radiation optic neuropathy , severe visual loss , neovascular glaucoma , nerve - fiber layer infarcts , retinal hemorrhages , and vitreous hemorrhage .3,4 posterior um is commonly associated with retinal detachment .5,6 exudative retinal detachments have an incidence of 50 % to 100 % prior to treatment .7 they tend to improve after treatment with brachytherapy , but may recur . furthermore , secondary vitreous fibrosis and epiretinal membranes add a tractional component along the peripheral edges of treated tumors . observation of chronic detachments leads to irreversible visual loss due to photoreceptor damage .5,6 different approaches have been proposed , including surgical drainage , endolaser , cryotherapy , and antivascular endothelial growth factor .6 the aim of this study is to describe the microincisional surgical management of retinal detachment secondary to radiation - related complications , and to determine safety , visual function , and anatomic outcomes of eyes previously treated with i - 125 brachytherapy for um . after obtaining approval by the university of miami institutional review board , we reviewed the charts of 102 patients with history of malignant um previously treated with i - 125 brachytherapy within the ocular oncology service at the bascom palmer eye institute that underwent 23/25 gauge microincisional pars plana vitrectomy ( mivs ) between march 2005 and july 2011 by an ocular oncologist ( tgm ) and his vitreoretinal surgical fellows . inclusion criteria included the presence of radiation - related retinal detachment , and minimum follow - up of 6 months after vitrectomy . indications for surgery included retinal detachment , radiation retinopathy , and visually significant cataract . recorded data included patient age , sex , involved eye , systemic disease , dates of plaque therapy , pars plana vitrectomy ( ppv ) , tumor location , best - corrected visual acuity ( bcva ) , and tumor dimensions . additional information included intraocular pressure ( iop ) , ocular comorbidity , radiation complications at the time of the ppv , ppv complications , systemic complications after ppv , presence of malignancy on vitreous cytology , intra - and extraocular metastasis , and need for further surgery . data were recorded at 1 week , at 1 , 3 , 6 , and 12 months , and at 2 , 3 , 4 , and 5 years . betadine preparation and sterile draping was performed , and the 23/25 gauge trochars were inserted in a beveled fashion 3.5 mm posterior to the limbus , then directed perpendicularly towards the optic nerve . the infusion cannula was secured into place , confirmed to be in the correct intraocular location by direct visualization , and turned on .130 wide - field viewing system ( advanced visual instruments , new york , ny , usa ) . in some patients , vitrectomy was combined with other procedures , including phacoemulsification and intraocular lens ( iol ) insertion , air fluid exchange , release of vitreoretinal traction , membrane peel , epiretinal membrane / internal limiting membrane removal , laser tumor ablation , sectoral panretinal photocoagulation , retinotomy , use of internal tamponade with c3f8 gas or silicone oil , synechiolysis , and conjunctival cyst or lid lesions removal . these cells were then evaluated by a highly experienced ocular pathologist for evidence of viable melanoma cells . intravitreal triamcinolone acetonide 4 mg / 0.1 ml ( triesence , alcon , fort worth , tx , usa ) or bevacizumab 2.5 mg / 0.1 ml ( avastin , genentech , san francisco , ca , usa ) was injected into any eye not receiving tamponade following removal of the last cannula . gentamicin 20 mg and dexamethasone 4 mg were administered away from the sclerotomies in the inferior subconjunctival space at the conclusion of the procedure in all eyes . patients were observed after radioactive plaque treatment with serial fundoscopic examinations and ultrasonography to confirm tumor control before proceeding for surgery for visual rehabilitation . postoperatively , patients were evaluated at 1 day , at 1 week , at 1 , 3 , 6 , and 12 months , and then every 6 weeks to 6 months according to their condition . acuities unable to be assessed with snellen charts were converted using the following convention : count fingers ( cf ) 20/2000 ; hand motions ( hm ) 20/20 ,000 ; and light perception ( lp ) 20/200 ,000 . logmar acuities were compared with baseline values using the paired t test to preoperative versus postoperative differences . after obtaining approval by the university of miami institutional review board , we reviewed the charts of 102 patients with history of malignant um previously treated with i - 125 brachytherapy within the ocular oncology service at the bascom palmer eye institute that underwent 23/25 gauge microincisional pars plana vitrectomy ( mivs ) between march 2005 and july 2011 by an ocular oncologist ( tgm ) and his vitreoretinal surgical fellows . inclusion criteria included the presence of radiation - related retinal detachment , and minimum follow - up of 6 months after vitrectomy . indications for surgery included retinal detachment , radiation retinopathy , and visually significant cataract . recorded data included patient age , sex , involved eye , systemic disease , dates of plaque therapy , pars plana vitrectomy ( ppv ) , tumor location , best - corrected visual acuity ( bcva ) , and tumor dimensions . additional information included intraocular pressure ( iop ) , ocular comorbidity , radiation complications at the time of the ppv , ppv complications , systemic complications after ppv , presence of malignancy on vitreous cytology , intra - and extraocular metastasis , and need for further surgery . data were recorded at 1 week , at 1 , 3 , 6 , and 12 months , and at 2 , 3 , 4 , and 5 years . betadine preparation and sterile draping was performed , and the 23/25 gauge trochars were inserted in a beveled fashion 3.5 mm posterior to the limbus , then directed perpendicularly towards the optic nerve . the infusion cannula was secured into place , confirmed to be in the correct intraocular location by direct visualization , and turned on .130 wide - field viewing system ( advanced visual instruments , new york , ny , usa ) . in some patients , vitrectomy was combined with other procedures , including phacoemulsification and intraocular lens ( iol ) insertion , air fluid exchange , release of vitreoretinal traction , membrane peel , epiretinal membrane / internal limiting membrane removal , laser tumor ablation , sectoral panretinal photocoagulation , retinotomy , use of internal tamponade with c3f8 gas or silicone oil , synechiolysis , and conjunctival cyst or lid lesions removal . these cells were then evaluated by a highly experienced ocular pathologist for evidence of viable melanoma cells . intravitreal triamcinolone acetonide 4 mg / 0.1 ml ( triesence , alcon , fort worth , tx , usa ) or bevacizumab 2.5 mg / 0.1 ml ( avastin , genentech , san francisco , ca , usa ) was injected into any eye not receiving tamponade following removal of the last cannula . gentamicin 20 mg and dexamethasone 4 mg were administered away from the sclerotomies in the inferior subconjunctival space at the conclusion of the procedure in all eyes . patients were observed after radioactive plaque treatment with serial fundoscopic examinations and ultrasonography to confirm tumor control before proceeding for surgery for visual rehabilitation . postoperatively , patients were evaluated at 1 day , at 1 week , at 1 , 3 , 6 , and 12 months , and then every 6 weeks to 6 months according to their condition . acuities unable to be assessed with snellen charts were converted using the following convention : count fingers ( cf ) 20/2000 ; hand motions ( hm ) 20/20 ,000 ; and light perception ( lp ) 20/200 ,000 . logmar acuities were compared with baseline values using the paired t test to preoperative versus postoperative differences . a total of 102 eyes ( 50 right eyes and 52 left eyes ) of 102 patients were evaluated . sixty - three patients were female ( 63/102 , 61.7 % ) and thirty - nine patients were male ( 39/102 , 38.2 % ) . average follow - up after vitrectomy was 19.5 months ( range 6.154.6 ) , and total follow - up from plaque removal to last follow - up appointment was 57.7 months ( range 12.0219.9 ) . fifty - nine patients ( 57.8 % ) had a choroidal melanoma , 37 patients ( 36.2 % ) had ciliochoroidal detachment , and six patients ( 5.8 % ) had a ciliary body tumor with posterior / anterior extension . all patients had radiation - related complications , including retinal detachment at the time of surgery in all eyes ( 100 % ) , vasculopathy in 91 eyes ( 89.2 % ) , optic neuropathy in 32 eyes ( 31.3 % ) , and vitreous hemorrhage in eight eyes ( 7.8 % ) ( table 1 ) . the mean baseline bcva in the affected eye was 20/258 . at 1 - week follow - up , bcva improved to 20/157 , at 1 month to 20/101 , at 3 months to 20/110 , at 6 months to 20/116 , and at 12 months to 20/113 . improvements in visual acuity ( va ) were statistically significant from baseline to all follow - up intervals ( p 0.05 ) ( figure 1 ) . at 3 months ,37.6 % gained two or more lines of vision compared with baseline while 8.6 % lost two or more lines ( figure 2 ) . at 6 months ,32.5 % gained two or more lines of vision compared with baseline while 8.9 % lost two or more lines ( figure 3 ) . at 12 months ,36.7 % gained two or more lines of vision compared with baseline while 19.1 % lost two or more lines ( figure 4 ) . final bcva was better than 20/50 in 37 patients ( 36.2 % ) , between 20/50 and 20/400 in 36 patients ( 35.2 % ) , and between 20/400 and 5/200 in 19 patients ( 18.6 % ) . only 10 patients ( 9.8 % ) had a nonambulatory final va ( worse than 5/200 ) ( table 2 ) . from the group of patients with final va 20/50 ( 37/102 ) , 37.8 % ( 14/37 ) had a final bcva of 20/25 , 21.6 % ( 8/37 ) of 20/40 , 13.5 % ( 5/37 ) of 20/20 , 13.5 % ( 5/37 ) of 20/30 , and 13.5 % ( 5/37 ) of 20/50 ( figure 5 ) . the mean bcva prior to surgery for this group of patients was 20/73 , with a statistically significant improvement after the surgical procedure ( p 0.05 ) ( table 2 ) . the current study did not find an increased incidence of complications related to the vitrectomy . no eyes required enucleation , but one patient died from metastatic disease ( 0.9 % ) . mean iop did not present a statistically significant increase after the procedure ( 13 mmhg at baseline and 14 mmhg at the last follow - up ; p 0.05 ) ( table 1 ) . there was no intra - or extraocular tumor dissemination , and no cases of tumor recurrence . average tumor size ( length width height ) showed a statistically significant decrease after i - 125 plaque brachytherapy treatment ( 13.8311.434.23 mm before brachytherapy versus 11.5010.092.66 mm after brachytherapy ) , and , again , after mivs ( 10.709.361.96 mm ) , with a p value 0.05 ( figure 6 ) . seven patients required surgical reintervention ( 6.86 % ) , and three patients had persistence of exudative retinal detachment at the last follow - up ( 2.94 % ) . a 59 year - old male with history of posterior um in the left eye , macula located , measuring 128.52.6 mm , was treated with i - 125 brachytherapy in august 2004 . he presented for follow - up appointment 88 months after treatment with a decrease in va in the left eye . on ocular examination , bcva was 20/25 od and 20/60 os , iop 12 and 14 , the iris was flat , without rubeosis or mass . comprehensive ophthalmoscopy showed a small nevus in the right eye with no malignant transformation or vascular activity . evaluation of the left eye showed a small cup - to - disc ratio , good rim coloration and perfusion , increasing vascular activity with radiation retinopathy , and a dome - shaped lesion with involution to a size of 98.51 mm , with focal exudative retinal detachment just superior to macula ( figure 7a ) . after the risks , benefits and alternatives were discussed , informed consent was obtained and the patient underwent 23 g mivs combined with phacoemulsification , iol implantation , membrane peeling , endolaser tumor ablation , vitreous biopsy , and intravitreal triamcinolone acetonide injection to the left eye ( figure 8 ) . at 1 month , postoperative va improved to 20/50 with improvement , but persistence of vascular activity secondary to radiation maculopathy . the tumor was stable , and the retina was attached with no proliferative vitreoretinopathy formation . bcva improved to 20/25 , iop was 13 , and the primary tumor was stable , with laser ablation and intratumoral focal hemorrhage ( figure 7b ) . the mean baseline bcva in the affected eye was 20/258 . at 1 - week follow - up , bcva improved to 20/157 , at 1 month to 20/101 , at 3 months to 20/110 , at 6 months to 20/116 , and at 12 months to 20/113 . improvements in visual acuity ( va ) were statistically significant from baseline to all follow - up intervals ( p 0.05 ) ( figure 1 ) . at 3 months ,37.6 % gained two or more lines of vision compared with baseline while 8.6 % lost two or more lines ( figure 2 ) . at 6 months ,32.5 % gained two or more lines of vision compared with baseline while 8.9 % lost two or more lines ( figure 3 ) . at 12 months , 36.7 % gained two or more lines of vision compared with baseline while 19.1 % lost two or more lines ( figure 4 ) . final bcva was better than 20/50 in 37 patients ( 36.2 % ) , between 20/50 and 20/400 in 36 patients ( 35.2 % ) , and between 20/400 and 5/200 in 19 patients ( 18.6 % ) . only 10 patients ( 9.8 % ) had a nonambulatory final va ( worse than 5/200 ) ( table 2 ) . from the group of patients with final va 20/50 ( 37/102 ) , 37.8 % ( 14/37 ) had a final bcva of 20/25 , 21.6 % ( 8/37 ) of 20/40 , 13.5 % ( 5/37 ) of 20/20 , 13.5 % ( 5/37 ) of 20/30 , and 13.5 % ( 5/37 ) of 20/50 ( figure 5 ) . the mean bcva prior to surgery for this group of patients was 20/73 , with a statistically significant improvement after the surgical procedure ( p 0.05 ) ( table 2 ) . the current study did not find an increased incidence of complications related to the vitrectomy . there were no cases of endophthalmitis or suprachoroidal hemorrhage . no eyes required enucleation , but one patient died from metastatic disease ( 0.9 % ) . mean iop did not present a statistically significant increase after the procedure ( 13 mmhg at baseline and 14 mmhg at the last follow - up ; p 0.05 ) ( table 1 ) . there was no intra - or extraocular tumor dissemination , and no cases of tumor recurrence . average tumor size ( length width height ) showed a statistically significant decrease after i - 125 plaque brachytherapy treatment ( 13.8311.434.23 mm before brachytherapy versus 11.5010.092.66 mm after brachytherapy ) , and , again , after mivs ( 10.709.361.96 mm ) , with a p value 0.05 ( figure 6 ) . seven patients required surgical reintervention ( 6.86 % ) , and three patients had persistence of exudative retinal detachment at the last follow - up ( 2.94 % ) . a 59 year - old male with history of posterior um in the left eye , macula located , measuring 128.52.6 mm , was treated with i - 125 brachytherapy in august 2004 . he presented for follow - up appointment 88 months after treatment with a decrease in va in the left eye . on ocular examination , bcva was 20/25 od and 20/60 os , iop 12 and 14 , the iris was flat , without rubeosis or mass . comprehensive ophthalmoscopy showed a small nevus in the right eye with no malignant transformation or vascular activity . evaluation of the left eye showed a small cup - to - disc ratio , good rim coloration and perfusion , increasing vascular activity with radiation retinopathy , and a dome - shaped lesion with involution to a size of 98.51 mm , with focal exudative retinal detachment just superior to macula ( figure 7a ) . after the risks , benefits and alternatives were discussed , informed consent was obtained and the patient underwent 23 g mivs combined with phacoemulsification , iol implantation , membrane peeling , endolaser tumor ablation , vitreous biopsy , and intravitreal triamcinolone acetonide injection to the left eye ( figure 8 ) . at 1 month , postoperative va improved to 20/50 with improvement , but persistence of vascular activity secondary to radiation maculopathy . the tumor was stable , and the retina was attached with no proliferative vitreoretinopathy formation . bcva improved to 20/25 , iop was 13 , and the primary tumor was stable , with laser ablation and intratumoral focal hemorrhage ( figure 7b ) . retinal detachment is a common complication in patients with a history of posterior uveal melanoma ( um ) , which may lead to permanent photoreceptor damage and visual loss .5,7 detachments can be either exudative , tractional , rhegmatogenous , or combined . initially , retinal detachment is related to intrinsic tumor vascular activity , but after brachytherapy treatment , it can be a consequence of radiation vasculopathy .5 in addition , following plaque brachytherapy , we have observed significant vitreoretinal interface changes along the peripheral tumor edges . with these vitreoretinal adhesions causing tractional changes , tractional or rhegmatogenous detachments may result . when fluid poses a threat to the macula , retinal detachment management may prevent long - term visual loss .7 vitrectomy has undergone continuous advancements in instrumentation , design , and utility .7 indications for patients with a history of treated um vary from tumor - related complications , such as exudative detachments , to radiation - related complications including radiation retinopathy , vitreous hemorrhage , tractional , and rhegmatogenous retinal detachments .7 before proceeding with surgery , observation is essential in order to rule out tumor activity , which is determined by a decrease in the tumor vascularity , volume , and exudative retinal detachment . some ocular oncologists suggest at least 6 months of observation following tumor treatment to ensure tumor stability .7 several studies have established the safety of ppv in eyes containing a treated melanoma . foster et al8 conducted a retrospective study of nine patients treated with i - 125 brachytherapy or transpupillary thermotherapy . one patient with vitreous hemorrhage established before tumor treatment , developed intraocular tumor dissemination 56 months after vitrectomy . one of them had a positive vitreous biopsy , and none developed intra - or extraocular tumor dissemination . one of our previous studies9 retrospectively evaluated 114 eyes of 111 patients who underwent combined phacoemulsification and 23 - gauge vitrectomy for retinal pathology ; 31 eyes had primary malignant um . patients were observed for a minimum of 6 months with serial exams documenting tumor stability . following ppv , adverse effects such as intraocular tumor dissemination , endophthalmitis , and hypotony have been described .5,915 in the current study , there were no cases of intra - or extraocular dissemination , tumor recurrence , endophthalmitis , or suprachoroidal hemorrhage . an interventional study by gibran and kapoor5 evaluated six patients with exudative retinal detachment associated with um . treatment included proton - beam radiation or brachytherapy , tumor biopsy , and surgical treatment of exudative retinal detachment , including vitrectomy and drainage of subretinal fluid at the time of irradiation . the patients had significant restoration of vision , regression of tumor thickness , no extrascleral extension or metastasis , and no recurrence of exudative retinal detachment . exudative retinal detachments prior to radiation treatment are present in 50 % to 100 % of the cases .7,12,1518 they tend to improve over time , with a mean of 5.6 months and 90 % resolution at 1 year .7,1921 even though early management of exudative retinal detachment may prevent photoreceptor damage , we consider that tumors should be inactive before proceeding with intraocular surgery to avoid tumor dissemination . additionally , in the present study we obtained a statistically significant improvement of va after microincisional vitrectomy , indicating that visual function can be enhanced in these patients . microincisional pars plana vitrectomy was safe and effective in improving visual function and anatomy in patients with complex radiation - related retinal detachment after i - 125 brachytherapy treatment for um . direct endolaser tumor ablation , and intravitreal triamcinolone acetonide or bevacizumab injection at the time of surgery may reduce rates of ongoing radiation - related complications including radiation vasculopathy . this procedure approach addresses the modifiable causes of visual loss in patients with previously treated malignant um and has the potential to improve visual function for this complex patient series .\noutput:\n" }, { "from": "agent", "value": "purposeto analyze functional and anatomical outcomes following 23/25 + gauge microincisional pars plana vitrectomy surgery ( mivs ) in patients with radiation - related retinal detachment after successful 125 - iodine ( i - 125 ) brachytherapy treatment for malignant uveal melanoma.patients and methodsretrospective case series of 102 consecutive eyes of 102 patients with history of uveal melanoma treated with i - 125 brachytherapy that underwent mivs at the bascom palmer eye institute . all cases were evaluated for surgical complications and local tumor control . extended follow - up included snellen s best - corrected visual acuity , intraocular pressure evaluation , quantitative echography , indirect ophthalmoscopy , and fundus imaging with optical coherence tomography / wide - field photography.resultsall patients had radiation - related complications , including retinal detachment ( 102 eyes ) , vasculopathy ( 91 eyes ) , optic neuropathy ( 32 eyes ) , and / or vitreous hemorrhage ( 8 eyes ) . sixty - seven patients had vitreoretinal traction . average follow - up after mivs was 19.5 months , and from plaque removal was 57.7 months . interval from plaque to mivs was 38.1 months . initial visual acuity was 20/258 , which improved to 20/101 at 1 month , 20/110 at 3 months , 20/116 at 6 months , and 20/113 at 12 months ( p < 0.05 ) . no eyes required enucleation . melanoma - related mortality was 0.9 % ( 1/102 ) . there was no intra - or extraocular tumor dissemination , and no tumor recurrence.conclusionmivs was effective in improving visual function and anatomy in patients with radiation - related retinal detachment . tumors decreased in size and there was no evidence of recurrence or tumor dissemination . this combined procedure addresses the modifiable causes of visual loss in patients with previously treated malignant uveal melanoma and has the potential to enhance their visual function ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: emergency department overcrowding is a common international concern .12 nationally there is a mixed opinion on whether this has a positive or negative effect on the rates of admission . one opinion is that if the emergency department is overcrowded then disproportionately more referrals are made in order to divert some of the workload to inhospital specialties and thus possibly cause more admissions . the other opinion is that a greater attempt is being made at admission avoidance measures by the emergency medicine staff in order to alleviate the problem of overcrowding . the objective of this retrospective review of patient data was to assess if there was any alteration in the rates of admission based on the levels of overcrowding in the emergency department . a retrospective review was performed of all attendances in this emergency department from january 2010 to december 2011 . this hospital sees approximately 60000 emergency medicine patients per annum and has a total of 512 inpatient beds across all specialties . there is a total of four consultants , one staff grade , six registrars , nine senior house officers and one intern whole time equivalent posts working as emergency physicians for this patient load . all patient attendances to our emergency department are tracked by an electronic patient information system irish medical systems ( ims ) maxims . this allows the percentage and absolute number of patients who were admitted on each particular day to be ascertained . a logbook is kept in the emergency department and updated every day at 08:00 documenting the number of extra admitted inpatients in the emergency department . the authors opinion is that this figure would be representative of the degree of overcrowding on that particular day . the authors compared these two variables between january 2010 and december 2011 to demonstrate their relationship . complete data were available from 1 january 2010 to 23 december 2010 and 2 january 2011 to 22 december 2011 . the results are illustrated graphically on a scatter gram and include a linear trend line inserted with standard microsoft excel software ( figures 1 and 2 ) . there were a total of 114836 attendances during the study period of 712 days . there was no significant change in the rate of admission in our emergency department based on the level of overcrowding during this period . the slope of the graph in figure 1 representing this was 0.0006 and had an r value of 0.88 % . similarly , the actual number of admissions did not change significantly based on the level of overcrowding in the emergency department . this is represented by the graph in figure 2 which has a slope of 0.159 and an r value of 1.7 % . no other variable such as the actual number of presentations per day or their severity of illness on these particular days was considered in these data . the data are also dependent on the reliability of the staff in updating the electronic patient information system . it would be difficult to assess the effect of these variables based on our available data . an assumption that the number of inpatients at 08:00 is representative of the level of overcrowding is made which may not be representative of overcrowding for that entire day . in this emergency department , admitted patients fall outside the governance and clinical care of emergency medicine even if the patient is boarded in the emergency department . this ensures that emergency medical staff resources are optimised only for the care of emergency medicine patients . the data show that emergency department overcrowding does not have any significant effect on the rates of admission from this emergency department . this helps in dismissing the belief that by overcrowding an emergency department less admissions are made to the hospital , which can have financial implications to the hospital . in ireland , patients admitted via the emergency department tend not to generate the same amount of financial revenue for the hospital as it impacts on elective private cases being performed . emergency department overcrowding does not significantly affect the absolute rate or number of admissions through this emergency department .\noutput:\n" }, { "from": "agent", "value": "emergency department overcrowding with admitted inpatients is a common international occurrence . we undertook a retrospective review to compare patient admission rates from patients presenting to our emergency department with the level of overcrowding with admitted inpatients on that particular day in the emergency department . over the 2 - year study period there was no change in the rate or absolute number of admissions per day compared with the level of inpatient overcrowding ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: obesity is associated with infertility and an increased risk of preterm birth in pregnant women . women who are unable to achieve this weight loss with conservative therapies can decide to undergo bariatric surgery , which has shown to improve fertility up to 58 % and to reduce adverse maternal and neonatal outcomes . bariatric surgery - related complications requiring acute abdominal surgery such as internal herniation after gastric bypass surgery might occur during pregnancy . additionally , cases of slippage of laparoscopic adjustable gastric banding ( lagb ) are described in the literature . banded laparoscopic roux - en - y gastric bypass ( b - lrygb ) is a relatively new technique and is believed to provide additional weight loss when compared with non - banded lrygb . however , no articles have been published regarding b - lrygb - related complications during pregnancy . we report a case of a 30 - year - old woman who succeeded to become pregnant after weight loss due to b - lrygb , but presented with acute abdominal pain in week 33 of her pregnancy . a 30 - year - old woman with a history of polycystic ovary syndrome ( pcos ) visited the obesity center amsterdam to opt for weight loss surgery . due to her body mass index ( bmi ) of 41four years later , she visited our hospital with complaints of weight regain and persistent irregular menstruation , and a still unfulfilled pregnancy wish . she claimed that her eating pattern had not changed , she was no sweetener and she exercised by cycling 40 km / week . no abnormalities were found during esophagogastroduodenoscopy . during a multidisciplinary meeting , it was decided to revise the dilated pouch and apply a minimizer ring ( bariatric solutions , stein an rhein , switzerland ) around the gastric pouch . during surgery , the gastric pouch appeared not dilated , after which was decided not to revise the pouch and solely apply a minimizer ring ( bariatric solutions , stein an rhein , switzerland ) 2 cm above the gastrojejunostomy . the minimizer ring was locked at the first hole ( 8 cm ; diameter 2.55 cm ) and fixated at the pouch with vicryl ( ethicon inc . her excess weight loss was 28.1 % ; total bmi loss was 4.5 points and total body weight loss 14 kg . in the third week of pregnancy , patient visited our emergency room with epigastric pain with radiation to her back since 2 days . laboratory tests showed a c - reactive protein 36 mg / l , leucocytes 9.1109 / l and hemoglobin 6.1 computed tomography ( ct ) of the abdomen suggested dislocation of the minimizer ring possible internal intestinal herniation and dilation of the intestines ( fig . figure 1 : ct - scan of the abdomen showing an ileus caused by a migrated minimizer ring . ct - scan of the abdomen showing an ileus caused by a migrated minimizer ring . therefore , patient received a nasogastric tube and was transferred to the operating room for emergency surgery . the fetus was monitored by a gynecologist with cardiotocography and the pediatrician was informed about the situation . inspection along the alimentary limb resulted in locating the minimizer ring at the transition of alimentary limb and common channel . after removal of this ring , the biliopancreatic limb and common channel were visible again ( fig . since gastric retention was no longer present , the nasogastric tube was removed several hours post - surgery . no complications occurred . as patient desired a new minimizer , it was advised to discuss this when no further pregnancies were planned and only in case of weight regain . a recent systematic review and meta - analysis reported improved pregnancy outcomes such as less preeclampsia and less gestational diabetes mellitus after bariatric surgery . although the authors conclude that more research is needed comparing pregnancy outcomes between several bariatric procedures , they recommend lagb in women planning to become pregnant . in the netherlands , it is recommended to perform a laparoscopic sleeve gastrectomy in young women who want to become pregnant in future . this avoids the occurrence of gastric bypass - related complications such as internal herniation and band - related complications such as slippage . however , when a young woman is scheduled for b - lrygb , surgical precautions must be taken . during b - lrygb surgery , the usage of insoluble suture material such as mersilene instead of vicryl should be considered in order to decrease the risk of band migration due to increased abdominal pressure during pregnancy . in order to increase as much as perioperative safety as possible in pregnant women , several precautions could be taken : careful open introduction in the left upper quadrant , as high as possible , subcostal ; usage of three trocars ; left lateral lift to reduce vena cava pressure and increase venous backflow and perioperative cardiotocography . although the optimal time for pregnancy after bariatric surgery is unknown , it is recommended to delay pregnancy until the first postoperative year . furthermore , women who remain overweight or obese due to insufficient weight loss following bariatric surgery are still at increased risk of adverse maternal and neonatal outcomes and should be regarded as a risk group . nevertheless , bariatric surgery has shown to be successful in the improvement of fertility and should be considered in morbidly obese women with a pregnancy wish , but fail to conceive due to their obesity .\noutput:\n" }, { "from": "agent", "value": "women desiring pregnancy might fail to conceive due to their obesity . bariatric surgery has shown to reduce this infertility up to 58 % and is therefore considered a successful strategy for morbidly obese infertile women . nevertheless , when pregnancy has succeeded , surgery - related complications might occur.banded laparoscopic roux - en - y gastric bypass ( b - lrygb ) is a relatively new technique in which a band is placed around the small gastric pouch . we report a case of a 30 - year - old woman who succeeded to become pregnant after weight loss due to b - lrygb , but presented with acute abdominal pain in week 33 of her pregnancy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it involves placement of mesh in pre - peritoneal space . however , mesh is a foreign body which can migrate as well as erode into surrounding visceral organs including urinary bladder and bowel . such an occurrence is rare with only few cases been reported in english literature following laparoscopic mesh hernioplasty . we report the first case of complete laparoscopic management of mesh erosion into small bowel and urinary bladder in a patient who had undergone total extra - peritoneal repair ( tep ) of left inguinal hernia earlier . a 62 - year - male underwent laparoscopic tep repair of left inguinal hernia in april 2012 at another centre . ten months after the surgery he reported symptoms of burning micturition , increased frequency , pyuria and persistent left groin pain . urine microscopy showed plenty of pus cells and culture grew escherichia coli sensitive to multiple drugs . however , the patient did not respond to antibiotics and continued to grow e. coli with similar sensitivity pattern in subsequent urine cultures . an abdominal ultrasonography showed abscess at hernioplasty site in continuity with the thickened left antero - lateral bladder wall . computed tomography ( ct ) scan revealed inflammatory changes in the left inguinal region with abscess , mural thickening of antero - lateral wall of urinary bladder , small air foci in urinary bladder and adherence of a thickened bowel loop to area of inflammation [ figure 1 ] . flexible cystoscopy revealed a small polypoidal lesion with surrounding bullous oedema and inflammation in left antero - lateral bladder wall . contrast - enhanced computed tomography scan showing thickening of antero - lateral wall of urinary bladder with air foci in urinary bladder and adherence of a thickened bowel loop to area of inflammation laparoscopic assessment was planned in view of suspected intra - peritoneal mesh migration . a three - way urinary catheter was inserted after the induction of general anaesthesia . at laparoscopyin addition , a bulge was seen in the region of left antero - lateral wall of urinary bladder [ figure 2 ] . during adhesiolysis of the bowel loop , it became apparent that the mesh was eroding into small bowel at one end and through the pre - peritoneal space into the bladder at another end . the entire mesh was pulled out into abdomen from pre - peritoneal space by applying gentle traction using graspers . the involved small bowel was resected using 60 mm endo gia stapler ( echelon 60 , ethicon endosurg inc . ) . bladder was filled with about 400 ml of methylene blue - saline to check for leak , which was absent . the resected small bowel segment along with eroded mesh [ figure 3 ] was retrieved in a custom made plastic bag . laparoscopic view of left inguinal region showing adhered small bowel along with a bulge in wall of urinary bladder resected bowel with the eroded mesh post - operative course was uneventful . the patient was discharged with urinary catheter in situ , which was subsequently removed 2 weeks later in the outpatient clinic . oral nitrofurantoin was continued for 6 weeks . at 12 months of follow - up , these include trocar site bleeding , injury to urinary bladder and bowel , mesh migration and erosion . mesh erosion into bowel and / or urinary bladder following laparoscopic inguinal hernia repair is a rare complication . in english literature , erosion has been reported in urinary bladder in nine cases , in colon in four cases and both colon and bladder in remaining two cases . majority of the cases have occurred following trans - abdominal pre - peritoneal ( tapp ) repair . the mode of presentation and their management has been summarised in table 1 . in cases involving urinary bladder , recurrent uti was the most common presentation . in some casessome published reports of mesh erosion following laparoscopic inguinal hernioplasty in one case involving bladder and bowel , no intervention was required for the bladder . similarly , in present case in which the mesh was eroding into both bowel and bladder , we did not require any intervention for the bladder except for leaving the urinary catheter for 2 weeks . it is well - known that erosion is a slow process leading to dense adhesions and fibrosis in the surrounding region . management of colonic erosion generally requires laparotomy with resection of the involved bowel or colonoscopic removal ion case of complete erosion . mesh erosion / migration should be suspected in a patient presenting with regional pain , urinary or bowel symptoms after a laparoscopic inguinal hernia repair . ct would define involved organs and extent of disease such as perforation , fistulae , and abscess . cystoscopy is indicated in cases with bladder involvement , where it can be diagnostic and even therapeutic . a peritoneal defect leads to direct contact between mesh and intra - abdominal organs resulting in adhesions , mechanical bowel obstruction , and fistula formation . this may also explain the higher number of cases being reported after tapp than tep . agrawal and avill have postulated that primary mesh migration occurs along the paths of low resistance either due to inadequate fixation or external displacing forces . failure to fix the mesh may result in mesh displacement although fixation increases possibility of adhesions and nerve injury . similarly , strenuous activity including bending and hip flexion in the immediate post - operative period ( during which mesh and staples have the greatest likelihood of dislodging ) may be a causative factor . on the other hand , secondary migration occurs as a consequence of foreign body reaction leading to erosion through the anatomic planes . weakening of wall and erosion of viscus can also occur due to sharp cut edges of mesh leading to inflammatory reaction . mesh erosion / migration should be suspected in any patient presenting with regional pain , urinary or bowel symptoms following laparoscopic mesh hernia repair in the past . laparoscopic approach is feasible in such patients as plane of placement of mesh is closer to visceral organs . further , it gives an opportunity to assess the extent and nature of involvement of organs and in the presence of expertise , successful surgical management can be accomplished using minimally invasive approach .\noutput:\n" }, { "from": "agent", "value": "mesh erosion into visceral organs is a rare complication following laparoscopic mesh repair for inguinal hernia with only 15 cases reported in english literature . we report the first case of complete laparoscopic management of mesh erosion into small bowel and urinary bladder . a 62 - year - male underwent laparoscopic total extra - peritoneal repair of left inguinal hernia at another centre in april 2012 . he presented to our centre 21 months later with persistent lower urinary tract infection ( uti ) . on evaluation mesh erosion into bowel and urinary bladder was suspected . at laparoscopy , a small bowel loop was adhered to the area of inflammation in the left lower abdomen . after adhesiolysis , mesh was seen to be eroding into small bowel . the entire infected mesh was pulled out from the pre - peritoneal space and urinary bladder wall using gentle traction . the involved small bowel segment was resected , and bowel continuity restored using endoscopic linear cutter . the resected bowel along with the mesh was extracted in a plastic bag . intra - operative test for leak from urinary bladder was found to be negative . the patient recovered uneventfully and is doing well at 12 months follow - up with resolution of uti . laparoscopic approach to mesh erosion is feasible as the plane of mesh placement during laparoscopic hernia repair is closer to peritoneum than during open hernia repair ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: molecular dynamics ( md ) is one of the most prominent techniques used to study the dynamics and equilibrium properties of biomolecules . it solves newton s equations of motion for all atoms , using force fields that account for bonded and nonbonded atomic interactions . these force fields have been parametrized to agree with quantum mechanical simulations and experiments . ever since the seminal first protein md simulation of bovine pancreatic trypsin inhibitor ( bpti ) , tremendous progress has been made both in terms of accuracy and sampling efficiency . even larger macromolecular systems can now be simulated on the order of microseconds . however , many important biological processes occur on time scales far beyond this regime posing the need for millisecond or longer simulations . the development of the anton supercomputer certainly marked a large step in the right direction ; however , that kind of computational fire power is not readily available to the average researcher . one of the most significant speed improvements of the last years was the utilization of graphics processing units ( gpus ) for molecular dynamics . nonetheless , it will take many years before nonspecialized computer hardware can routinely simulate large molecular systems on the time scales of their slowest motions , which is needed to fully characterize their free energy landscapes . in the meantime , enhanced sampling methods are one solution to this problem . a plethora of methods exist that perturb the underlying potential energy landscape to increase the chance of transitions between low energy states . three notable examples are the adaptive biasing force ( abf ) , metadynamics and driven adiabatic dynamics methods . in addition to these methods , accelerated md ( amd ) is a promising technique that directly modifies regions of the potential energy landscape that are below a certain cutoff energy . by energetically raising these regions and thus lowering barriers between energy wells , this results in an enhanced sampling of the conformational space accessible to the simulation . amd has been previously implemented for classical ( nonpolarizable ) simulations in amber and namd , and for ab initio md in cpmd . in addition to improvements in sampling ( the precision problem ) , the force fields used to propagate atoms may also need to be improved ( the accuracy problem ) . moreover , sampling and force field accuracy are related challenges , since better sampling allows for more precise calculations of experimental quantities that in turn can lead to the detection of smaller force field deficiencies . although the functional form of biomolecular force fields has remained largely unchanged since the first md simulation of a protein conducted more than 35 years ago , recent studies highlight certain shortcomings present in all current force fields that are unlikely to be solved simply by tuning their parametrization . for example , none of the current methods seem to be able to accurately capture the temperature dependency of proteins secondary structure propensities . in addition , polarizability may be essential to accurately simulate highly charged systems , such as nucleic acids in dna and rna . for this reason , substantial efforts are under way to develop force fields with more sophisticated functional forms , including polarizable force fields that can capture the redistribution of electrons around each atom in response to changes in the environment . this approach may eventually replace conventional force fields in several key areas ( e.g. , the modeling of protein folding , computer - aided drug design , the calculation of ion channel properties , or the description of allostery ) . the amoeba ( atomic multipole optimized energetics for biomolecular applications ) polarizable force field was developed by ponder and co - workers with the aim to move away from the well - established fixed point charge models and toward more expensive models that should allow a more accurate description of molecular properties . amoeba is one of the most widely used polarizable force fields to date , and it has been demonstrated to perform better than nonpolarizable force fields for describing solvation free energies of drug - like small molecules , and dynamical properties away from ambient condition . however , despite the impressive acceleration provided by gpu computing , the time performance of amoeba remains a significant limitation to its wider use to simulate large - scale biomolecular systems , since such simulations remain about 12 orders of magnitude more expensive than their nonpolarizable equivalents . for this reason , practical usage of amoeba has been limited , especially when target events are in micro - to millisecond time scales . orthogonal space random walk ( osrw ) to achieve ab initio prediction of organic crystal structures and thermodynamics . similarly , combining amoeba with the enhanced sampling capabilities of amd represents an attractive prospect . openmm is the perfect platform to implement the amd method , as it already allows a wide user base to take advantage of gpu - accelerated md simulations . in this paper , we show that the amd method and the amoeba force field can be synergistically combined in a way that conserves the accuracy of the polarizable force field , while significantly enhancing sampling . using three examples , we show that ( 1 ) with larger energy boost levels , the ameoba - based amd simulations can maintain structural stability , ( 2 ) the choice of amd parameters is the same for amoeba and for nonpolarizable force fields , and ( 3 ) the amoeba - based amd simulations allow metalloenzyme reactive sites to be better simulated . over the years , different variants of the amd algorithm have been proposed . in the original implementation , amd was used to only boost the dihedral potential since many protein conformational changes are governed by changes in the torsional degrees of freedom . subsequent work introduced an amd version that boosted the total potential . in a more recent implementation , amd uses a dual boosting approach that applies one boost potential only to the torsional terms and another separate boost potential to the total potential . here , we present the implementation of all three flavors of amd into openmm using the customintegrator , an integrator used to implement arbitrary , user defined integration algorithms . a detailed summary of the theory of amd can be found in refs ( 8a and 22 ) , so that we will only list the most important equations that were used for the implementation . in amd , whenever the system s potential energy , v ( r ) , falls below a threshold energy , e , a boost potential , v ( r ) , is added to yield the biased potential v * ( r ) . introducing the following abbreviationsthe total force on the system is calculated as a sum of constitutive forces , each obtained from the different components ( comp ) of the potential energy ( e.g. , dihedrals ) . a general expression can be derived for the amd forces that is valid irrespectively of the choice made for the boosted components , asthe overall force in the boosted system f * is then obtained aswhere f is the total force of the unaccelerated system and fcomp is the unaccelerated force of the component that is accelerated ( e.g. , dihedrals ) . the forces for the three flavors of amd then becomedihedral boost : total energy boost : dual boost : note that , in the dual boost implementation , the dihedral force is only boosted once . the custom integrator allows convenient implementation of amd , by scaling the forces at every simulation step according to the boost . for this , the energy and forces associated with the component to be boosted have to be retrieved . then , the total force is scaled depending on whether the system is above or below the threshold energy . three different systems were studied : the alanine dipeptide ( n - acetyl - n - methyl - alaninamide ) , bpti , and endonuclease iv . alanine dipeptide was solvated with a water box containing a buffer region of 10 . to eliminate any steric clashes , 100 steps of conjugate gradient minimizationa short 50 ps npt simulation was used to heat up the system to a temperature of 300 k. bpti and endonuclease iv were prepared based on pdb entries 5pti ( 24 ) and 1qtw , respectively . tleap was used to neutralize the systems by adding 6 cl and 6 na counterions respectively and solvate them with a water box . the fully solvated system contained 17155 and 52011 atoms , respectively . minimization using sander was carried out in two stages : an initial minimization of 1000 steps for the solvent and ions with the protein restrained by a force constant of 500 kcal / mol / , followed by a 2500 step minimization of the entire system . a short initial 20 ps md simulation with weak restraints ( 10 kcal / mol / ) on the protein residues was used to heat the system to a temperature of 300 k. all production md simulations for the alanine dipeptide , bpti , and endonuclease iv were conducted in the npt ensemble at 300 k , using the openmm python - based application layer . periodic boundary conditions were used , along with a nonbonded interaction cutoff of 10 . nonpolarizable simulations were performed using the amber ff99sbildn force field while polarizable simulations were performed using the amoeba force field . for the amber simulations , bonds involving hydrogen atomswere constrained using the shake algorithm , allowing for a time step of 2 fs . a time step of 1 fs was used for the amoeba simulations , while no constraints were used . energy conservation was monitored and none of the simulations showed energy drift . the acceleration level for the amd methodis defined in terms of e and , where e is the threshold boost energy and is a tuning parameter that determines the shape of the accelerated potential . to define the acceleration parameters , equilibrium md simulations were first conducted , with the amber ff99sbildn and amoeba force fields , to calculate the average potential and dihedral energies . for the total potential / torsional energy term , the boost energy was defined as the average total / dihedral angle energy plus 3.5 times the number of residues in the solute , and was defined as 20 % of e. from previous experience , this empirical formula produces marked enhancement in the sampling , while allowing for the accurate reconstruction of the thermodynamic ensemble . despite the explicit inclusion of polarization and anharmonic corrections in the amoeba force field , we have found that similar parameters can be used to enhance the sampling in amber ff99sbildn and amoeba amd simulations . our results are presented as follows ; first we use the workhorse of molecular simulations , the alanine dipeptide , to ensure that the amd implementation does indeed significantly enhance the conformational space sampling . we then use bpti to show that even at very high acceleration levels , amoeba - amd simulations are stable , as indicated by low root - mean - square deviations ( rmsd ) with respect to the bpti crystal structure . finally , we study the enzyme endonuclease iv to showcase a large protein system , for which nonpolarizable simulations fail to accurately describe structural details . to test our amd implementation , four different types of simulations were performed for alanine dipeptide : 500 ns of conventional md ( cmd ) , 100 ns of dihedral boost amd , 100 ns of total energy boost amd , and 100 ns of dual boost amd . the conformational space sampling is evaluated by deriving a free energy profile from occupancy of states in the dihedral backbone angle space . pioneering theoretical work in the late 1980s and early 1990s established the four free energy minima accessible to alanine dipeptide in the conformational space : the region ( 0 and 120180 , corresponding to a - strand conformation ) , the r region ( 0 and 6060 , corresponding to a right - handed - helical conformation ) , the l region ( 60 and 60 , corresponding to a left - handed - helical conformation ) and the c7 region ( 60 and 80 ) . for an excellent graphical representation of the free energy surface please refer to ref ( 32 ) . figure 1 shows the free energy maps calculated from the cmd simulation and different simulation times . despite the simplicity of the alanine dipeptide system , conventional md can not sample the entire dihedral backbone angle space . within the first 50 ns , only the two deepest energy minima ( and r ) are sampled . no sampling of the c7 region is seen within 500 ns of cmd simulation . free energy maps ( in kcal / mol ) for alanine dipeptide calculated from cmd simulations of length ( a ) 50 ns , ( b ) 100 ns , ( c ) 300 ns , and ( d ) 500 ns . in contrast , dual boost amd samples the conformational space much more efficiently . figure 2 shows the free energy maps for different simulation times of the dual boost amd simulation . even within 25 ns , all four regions ( including the c7 region ) after 100 ns of dual boost amd the reweighted energy profile clearly matches previously reported profile generated by umbrella sampling . this demonstrates the power of the amd method to enhance sampling by orders of magnitude and its correct implementation in openmm . it is worth noting that an explicit boost of the dihedral energy is often beneficial for peptide and protein simulations . for instance , in this test , only boosting the total energy was not sufficient to sample the l and c7 regions within 100 ns ( supporting information figure 1 ) , while the dihedral boost amd samples the conformational space similar to the dual boost amd ( supporting information figure 2 ) . reweighted free energy maps ( in kcal / mol ) for alanine dipeptide calculated from dual boost amd simulations of length ( a ) 25 ns , ( b ) 50 ns , ( c ) 75 ns , and ( d ) 100 ns . the bpti protein is often used to test new methods . in particular , it was used to test a previous implementation of amd for the amber code , based on nonpolarizable amber force fields . it was shown that , at high acceleration levels , amd simulations of 500 ns can replicate all the energy minima of bpti that were observed by shaw and co - workers using millisecond simulations , thus leading to an acceleration in the sampling of 34 orders of magnitude . here , we were interested to show that bpti is stable at similar high acceleration levels in our amd openmm implementation , with both the amber ff99sbildn , and the amoeba force fields . for each force field , a total of four different simulations were performed : cmd , dihedral boost amd , total energy boost amd and dual boost amd . the simulations were run for 100 ns , and 3 ns , for the amber ff99sbildn and amoeba force fields , respectively . simulation speeds of 30 ns / day for amber and 300 ps / day for amoeba were observed . to allow for a fair comparison , we also performed a short 1 ns benchmark amoeba simulation using the respa integrator ( allowing for a 2 fs time step for the multipole force evaluation , while maintaining a 1 fs time step for all other forces ) . thus , depending on the parameters , amoeba simulations are about 12 orders of magnitude slower than cmd ; however , enhanced sampling with amd has been previously shown for bpti to enhance sampling by several orders of magnitude and therefore should be able to bridge this gap . potential unfolding events or instabilities due to excessive boosting would show up as an increase in the rmsd . figure 3 summarizes the rmsds for the simulations and shows that none of the amd simulations exceeds 3 in the rmsd , which is similar to the unaccelerated simulations . rmsd values over the course of the simulations are shown for eight different bpti simulations : md amber ff99sbildn , total energy boost amd amber ff99sbildn , dual boost amd amber ff99sbildn , dihedral boost amd amber ff99sbildn , md amoeba , total energy boost amd amoeba , dual boost amd amoeba , and dihedral boost amd amoeba . next , we demonstrate that amoeba can achieve more accurate results than nonpolarizable force field simulations . for this , we chose to simulate the endonuclease iv metallo - enzyme . the enzyme has been determined at a very high resolution ( 1.02 ) using x - ray crystallography . it contains a stable three zinc cluster coordinated by histidine , aspartate , and glutamate residues . the zinc ions form a structure reminiscent of a right triangle with distinct relative distances . the trinuclear cluster has been previously studied with hybrid quantum mechanics / molecular mechanics ( qm / mm ) simulations and was found to be stable . however , qm / mm simulations are typically time - consuming and can often probe only the picosecond time scale . our initial hypothesis was that amoeba simulations should be able to more accurately describe the zinc cluster geometry than nonpolarizable amber simulations . to show this , we ran nonpolarizable and polarizable simulations on the protein and monitored the relative zinc distances . again , depending on the simulation parameters , we observed about 12 orders of magnitude faster sampling for nonpolarizable force field simulations ( 9 ns / day , for amber , versus 90 ps / day , for amoeba without respa ) . zn distances over the course of the simulations . in all three independent amber ff99sbildn simulations , the relative positions of the zinc cluster were perturbed within 3 ns , demonstrating a failure of the nonpolarizable force field to correctly capture the coordination structure around these charged ions . in contrast , the amoeba force field maintained the zinc geometry over the course of the 3 ns simulation . figure 4c , d summarizes the active site residues and zinc positions after 3 ns of simulation , superimposed with the crystal structure . the most pronounced perturbation in the nonpolarizable simulations is the displacement of zn2 away from the active site , facilitated by the displacement of the coordinating side chain asp 229 , and transferring the coordination of zn2 from his 182 to gln 150 . ( a ) ribbon representation of entire protein with its zinc cluster in the center . ( b ) close - up view of the endonuclease iv active site in the high resolution crystal structure ( 1qtw , 1.02 resolution ) . the zinc ions are forming a right triangle geometry coordinated by histidine , aspartate , and glutamate residues . ( c ) superposition of the crystal structure active site and the active site after 3 ns of amber ff99sbildn simulation . crystal structure zinc is shown in gray , while the simulated zinc is shown in green . ( d ) superposition of the crystal structure active site and the active site after 3 ns of amoeba simulation . crystal structure zinc is shown in gray , while the simulated zinc is shown in red . endonuclease iv contains a three zinc cluster ( zn 286 , 287 , and 288 ) . distances between 286 and 287 ( red ) , 286288 ( green ) , and 287288 ( blue ) are shown . horizontal dotted colored lines indicate the distance between the respective ion pair in the high - resolution crystal structure . three independent md simulations with the amber ff99sbildn force field are shown on top . in this paper , we presented the synergistic combination of the enhanced sampling method amd with the polarizable force field amoeba . the implementation of the amd sampling method into openmm should provide a fast and simple avenue for studying biomolecular systems that require extensive sampling ( e.g. , micro - to milliseconds ) , in addition to a polarizable force field . the tests presented here suggest that it is possible to maintain the accuracy of the amoeba polarizable force field while significantly improving the simulation sampling efficiency . at the acceleration levels used , the sampling efficiency for medium size protein simulations is typically increased by 23 orders in magnitude . finally , the superior performance of amoeba was demonstrated for describing the active - site of a zinc metalloenzyme , which is consistent with previous studies . the amoeba - amd implementation takes full advantage of gpu computing and is publicly available in openmm ( https://simtk.org/home/openmm ) .\noutput:\n" }, { "from": "agent", "value": "the accelerated molecular dynamics ( amd ) method has recently been shown to enhance the sampling of biomolecules in molecular dynamics ( md ) simulations , often by several orders of magnitude . here , we describe an implementation of the amd method for the openmm application layer that takes full advantage of graphics processing units ( gpus ) computing . the amd method is shown to work in combination with the amoeba polarizable force field ( amoeba - amd ) , allowing the simulation of long time - scale events with a polarizable force field . benchmarks are provided to show that the amoeba - amd method is efficiently implemented and produces accurate results in its standard parametrization . for the bpti protein , we demonstrate that the protein structure described with amoeba remains stable even on the extended time scales accessed at high levels of accelerations . for the dna repair metalloenzyme endonuclease iv , we show that the use of the amoeba force field is a significant improvement over fixed charged models for describing the enzyme active - site . the new amoeba - amd method is publicly available ( http://wiki.simtk.org/openmm/virtualrepository ) and promises to be interesting for studying complex systems that can benefit from both the use of a polarizable force field and enhanced sampling ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: au - rich elements ( ares ) are distinct sequence elements in the 3 - untranslated region ( utr ) of mrnas often consisting of one or several auuua pentamers located in an adenosine and uridine rich region ( 1 ) . the importance of these sequence motifs has been highlighted recently by a multitude of studies pointing out that the loss of are - mediated mrna control leads to severe pathologies as ares affect gene expression on a global scale ( 27 ) . ares have been studied bioinformatically early on ( 8 ) and today s estimate is that 7 % of the human protein - coding genes contain ares ( 9 ) . however , the presence of an are consensus motif alone is not enough to qualify a gene as a true in vivo target of are - binding proteins . recent computational and experimental evidence ( 1013 ) and the fact that are - targeting proteins bind to rna in single - stranded conformation ( 14 ) emphasize the need to analyze the structural context these motifs are embedded in . furthermore , the mounting comparative genomics data available can be harnessed to identify evolutionarily conserved motif sites . aresite is the first database that combines sequence annotation of ares with the prediction of the accessibility and evolutionary conservation of the motif site . in addition to these features , we incorporated information from extensive expert literature search and list experimentally validated targets of the are - binding proteins ttp , hur and auf1 . in its current version aresite uses ensembl release 56 as data basis . for human and mouse , any protein - coding gene that hasat least one transcript with a 3 - utr sequence has been added to the collection . to account for the various definitions of ares found in literature we decided not to restrict the database to a single motif , but offer the user the possibility to screen for a total of eight different consensus motifs , starting with the plain auuua pentamer to the wwwwauuuawwww 13 - mer , which resembles the core motif embedded in a stretch of a / u residues . by default , only the representative transcript of the selected gene , which we define as the transcript with the most auuua counts in its 3 - utr sequence , is analyzed in detail . for each transcript we list sequence statistics and calculate the fold enrichment based on an order - 0 and an order - 1 markov model for each motif . beside plain sequence annotation of are motifs in transcripts aresite also offers the researcher to study sequence conservation of motifs on both transcript and genomic level . for each motif sitefinally , an overview figure in form of a phylogenetic tree depicts the conservation pattern of all detected motif sites . motif site accessibility in terms of opening energies and probabilities of being unpaired are calculated using rnaplfold ( 16,17 ) . furthermore , results are visualized in an interactive svg plot that allows the user to explore different parameter settings ( figure 1 ) . figure 1 . screenshot of the interactive svg plot showing an are motif site of the human tnf - alpha gene . its are target site consists of several consecutive attta ( auuua ) motifs which favors the site s accessibility . when using a svg ready web browser the user can explore the target site and flanking nucleotides with different parameter settings . with default settings ( u = 5 ) , the plot shows for each nucleotide i the energy that is needed to open local secondary structure for a stretch of five nucleotides ( 53 ) ending at position i. screenshot of the interactive svg plot showing an are motif site of the human tnf - alpha gene . its are target site consists of several consecutive attta ( auuua ) motifs which favors the site s accessibility . when using a svg ready web browser the user can explore the target site and flanking nucleotides with different parameter settings . with default settings ( u = 5 ) , the plot shows for each nucleotide i the energy that is needed to open local secondary structure for a stretch of five nucleotides ( 53 ) ending at position i. for the three best studied are - binding proteins ttp , hur and auf1 , literature was screened for putative or confirmed mrna targets . we classified the type of evidence for an mrna being targeted by one of the three proteins by five criteria : ( i ) direct binding of the protein to the mrna or its 3 - utr ( e.g. using rna immunoprecipitation or electrophoretic mobility shift assays ) ; ( ii ) an independent reporter assay confirming the functionality of the putative binding site ; ( iii ) the loss or overexpression of the are - binding protein affects mrna and / or ( iv ) the protein level of the target mrna ; ( v ) the stability of the target mrna is affected by the lack or excess of the are - binding protein as shown by actinomycin d chase experiments or cell - free decay assays . if the user aims for permanent storage of the search results , annotated genbank files can be downloaded for each analyzed transcript . ( b ) experimental evidence collected for this gene . for each of the are - binding proteins ttp , hur andthe user can choose to see the supporting publications which are directly linked to pubmed . ( c ) overview figure that shows all know transcripts of the selected gene and highlights detected are motifs in the 3 - utrs . ( d ) detailed summary of the analysis results for the representative transcript . for each motif sitethe user can choose to display accessibility plots , genomic and transcript alignments together with sequence logos . black circles ( genomic alignments ) and boxes ( transcript alignments ) indicate that the corresponding are motif was also detected in the sequence of the corresponding species . for each of the are - binding proteins ttp , hur and auf1 we list the type of evidence . the user can choose to see the supporting publications which are directly linked to pubmed . ( c ) overview figure that shows all know transcripts of the selected gene and highlights detected are motifs in the 3 - utrs . ( d ) detailed summary of the analysis results for the representative transcript . for each motif sitethe user can choose to display accessibility plots , genomic and transcript alignments together with sequence logos . black circles ( genomic alignments ) and boxes ( transcript alignments ) indicate that the corresponding are motif was also detected in the sequence of the corresponding species . for each gene database entry we first collected all orthologous genes from other species that have a strict one to one relation . next we screened for transcripts that have an annotated 3 - utr and among those we selected the one that showed the best coverage ( at least 75 % ) of the reference species 3 - utr . multiple species whole transcript alignments were then generated with clustal w. to investigate the sequence conservation of the motif site we finally extract the region containing the motif site plus five flanking nucleotides on each side from the alignments . each alignment sequence is then searched with the corresponding consensus are motif . finally , detected motifs are used as sequence anchors and sequences are realigned using dialign ( 18 ) . the same procedure was also applied to the processed and filtered genomic alignments . since comparative data at the level of transcripts is still limited , we decided to also incorporate data from genome - wide alignments to get a more refined picture of the conservation pattern of motifs . interpretation of these data though has to be done with caution since there is no guarantee that the aligned sequences from other species really belong to the gene of interest . we apply , however , filtering strategies that ensure that aligned sequences are homologous over a longer stretch of nucleotides than simply the motif site . genomic alignments in maf format were obtained for each utr sequence from multiz generated alignments available at the ucsc genome browser ( 19 ) . for human , corresponding alignments were extracted from 46 species multiple alignments based on the human genome assembly hg19 , and for mouse from 30 species multiple alignments based on the assembly mm9 . the obtained alignment blocks were often too short for any practical use and so we developed a maf processing and filtering pipeline , that first merges adjacent maf blocks to longer ones and then returns alignment windows of 120 nt and a step size of 30 nt . finally , these windowed alignments were realigned with clustal w and were filtered to contain only sequences that have a length of at least 50 % of the sequence length of the reference species . for the calculation of the motif site accessibility in terms of opening energies and probabilities of being unpaired we used rnaplfold ( 16 ) with different parameter settings . rnaplfold is a thermodynamic rna folding program that calculates local base - pairing probabilities , as well as the probability that a stretch of u consecutive nucleotides is unpaired ( 17 ) . these probabilities are directly related to the energy needed to open all secondary structures in the respective stretch of nucleotides . the parameter set w = 80 , l = 40 models the effects of cotranscriptional folding and has been previously used to predict sirna binding ( 20 ) . aresite features also a different parameter setting ( w = 240 , l = 120 ) , which considers longer base pair spans and shows improved results on sirna binding as well as on rna rna interaction ( h. tafer , personal communication ) . for each detected motif sitewe list the accessibility values ( u = 5 ) for the core auuua pentamer for both parameter settings ( short range , mid range ) . alignments of orthologous transcripts were generated using data from the ensembl gene orthology pipeline . for each gene database entrywe first collected all orthologous genes from other species that have a strict one to one relation . next we screened for transcripts that have an annotated 3 - utr and among those we selected the one that showed the best coverage ( at least 75 % ) of the reference species 3 - utr . multiple species whole transcript alignments were then generated with clustal w. to investigate the sequence conservation of the motif site we finally extract the region containing the motif site plus five flanking nucleotides on each side from the alignments . each alignment sequence is then searched with the corresponding consensus are motif . finally , detected motifs are used as sequence anchors and sequences are realigned using dialign ( 18 ) . since comparative data at the level of transcripts is still limited , we decided to also incorporate data from genome - wide alignments to get a more refined picture of the conservation pattern of motifs . interpretation of these data though has to be done with caution since there is no guarantee that the aligned sequences from other species really belong to the gene of interest . we apply , however , filtering strategies that ensure that aligned sequences are homologous over a longer stretch of nucleotides than simply the motif site . genomic alignments in maf format were obtained for each utr sequence from multiz generated alignments available at the ucsc genome browser ( 19 ) . for human , corresponding alignments were extracted from 46 species multiple alignments based on the human genome assembly hg19 , and for mouse from 30 species multiple alignments based on the assembly mm9 . the obtained alignment blocks were often too short for any practical use and so we developed a maf processing and filtering pipeline , that first merges adjacent maf blocks to longer ones and then returns alignment windows of 120 nt and a step size of 30 nt . finally , these windowed alignments were realigned with clustal w and were filtered to contain only sequences that have a length of at least 50 % of the sequence length of the reference species . for the calculation of the motif site accessibility in terms of opening energies and probabilities of being unpaired we used rnaplfold ( 16 ) with different parameter settings . rnaplfold is a thermodynamic rna folding program that calculates local base - pairing probabilities , as well as the probability that a stretch of u consecutive nucleotides is unpaired ( 17 ) . these probabilities are directly related to the energy needed to open all secondary structures in the respective stretch of nucleotides . the parameter set w = 80 , l = 40 models the effects of cotranscriptional folding and has been previously used to predict sirna binding ( 20 ) . aresite features also a different parameter setting ( w = 240 , l = 120 ) , which considers longer base pair spans and shows improved results on sirna binding as well as on rna rna interaction ( h. tafer , personal communication ) . for each detected motif sitewe list the accessibility values ( u = 5 ) for the core auuua pentamer for both parameter settings ( short range , mid range ) . in this contribution we have introduced aresite , a database for the detailed investigation of are motifs in terms of motif site accessibility and evolutionary conservation . in its current state aresitereports 3275 human protein coding genes which have at least one occurrence of the consensus motif wuauuuauw in their 3 - utr sequences . this corresponds to 16 % of the human protein coding genes . for 711 of those genesthe requirements which are needed to qualify a gene as an in vivo target of are - binding proteins are still poorly understood . aresite with its features of conservation pattern analysis and accessibility prediction can help researchers to unravel the underlying mechanism . recent studies ( 11,13 ) demonstrate the great value of combining computational accessibility prediction and wet - lab data . when interpreting accessibility predictions one has to keep in mind , however , that low accessibility does not necessarily exclude a gene from being an in vivo target . mrna regulation is a complex system and the binding of one factor might lead to structural rearrangements which can make a formerly cryptic site accessible or vice versa ( 21 ) . in the context of ares , this concept has been nicely demonstrated by using artificially designed mrna openers and closers to control mrna stability ( 22 ) . the accurate modeling of these combinatorial effects will be among the most challenging issues for future work . university of vienna research platform : structural and functional analysis of mrna molecules targeted by the rna - binding protein tristetraprolin\noutput:\n" }, { "from": "agent", "value": "aresite is an online resource for the detailed investigation of au - rich elements ( are ) in vertebrate mrna 3 - untranslated regions ( utrs ) . ares are one of the most prominent cis - acting regulatory elements found in 3 - utrs of mrnas . various are - binding proteins that possess rna stabilizing or destabilizing functions are recruited by sequence - specific motifs . recent findings suggest an essential role of the structural mrna context in which these sequence motifs are embedded . aresite is the first database that allows to quantify the structuredness of are motif sites in terms of opening energies and accessibility probabilities . moreover , we also provide a detailed phylogenetic analysis of are motifs and incorporate information about experimentally validated targets of the are - binding proteins ttp , hur and auf1 . the database is publicly available at : http://rna.tbi.univie.ac.at/aresite ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: because monopteros ( mp ) transduces a transcriptional response from auxin required for flower formation , we reasoned that feedback from auxin to its transport direction might occur via mp . to investigate this possibility , we first examined the expression pattern of a rescuing mp translational fusion to yellow fluorescent protein for energy transfer ( ypet ) ( pmp : : mp - ypet ) in the shoot apical meristem ( sam ) in comparison to pin1 fused to cfp ( pin1 - cfp ) , and found striking correlations in their localization patterns ( figures 1a1c ) . however , we found that mp marked position i4 ( incipient primordium 4 ) prior to a pin1 convergence appearing at this site ( n = 7 out of 7 ) ( figure 1d ; movie s1 ) . and , although mp and pin1 showed a strong correlation at the i3 stage ( figure 1e ) , a decrease in mp expression could be detected surrounding i1 prior to the characteristic reversal of pin1 polarity toward adjacent regions ( figures 1f and 1 g ) . to compare mp expression to auxin distribution patterns , we also examined expression of the ratiometric auxin marker r2d2 and found its expression pattern to appear almost identical to that of mp ( figures s1a s1j ) . to test whether mp expression is patterned by auxin in the shoot , as found for other tissues , we treated meristems expressing both mp - ypet and r2d2 with auxin or n -1-napthylphthalamic acid ( npa ) and found a similar response ( figures s1k s1r ) , with higher levels of mp - ypet transcripts being detected upon auxin treatment ( figure s1s ) , confirming that auxin levels tightly regulate mp expression . overall , these data are consistent with auxin and mp acting upstream of pin1 polarity changes during early organ formation . to test whether localized mp expression is required for pin1 polarity convergence patterns , we examined plants in which mp cdna was induced under the control of the ubiquitin - 10 promoter ( pubq10 ) using dexamethasone ( dex ) but found no obvious associated phenotype . however , examination of pubq10mpc - ypet expression within these plants revealed that mp was still expressed dynamically and remained correlated with pin1 polarities , similar to the wild - type ( figure s2a ) . to test whether mp expression in these plants was still responsive to auxin , we monitored pubq10mpc - ypet expression in response to 1 - napthaleneacetic acid ( naa ) application and observed an increase and broadening of expression ( figures s2b and s2c ) . to testwhether the pubq10 promoter was auxin responsive , we checked the meristems of control plants expressing pubq10 : : h2b - 2xgfp and found that gfp was expressed more uniformly and did not get upregulated upon auxin addition ( figures s2d and s2e ) . this indicates that cis - elements within the coding region may contribute to the regulation of mp expression by auxin . to further disrupt mp expression , we engineered silent mutations in several putative auxin - response elements within the mp - coding region ( figure s2f ) and induced this modified cdna using the ubq10 promoter ( pubq10ypet - mpc mut ) in wild - type plants . even though this modified cdna was expressed more uniformly and did not respond to exogenous auxin application ( figures s2g s2i ) , no phenotype in terms of organ positioning was observed in wild - type seedlings and inflorescences ( figures s2jwe reasoned that endogenous mp expression may still facilitate the formation of instructive mp gradients in the presence of uniform transgene expression , and thus transformed this construct into mp mutants . although transformed mp mutant seedlings again showed no obvious phenotype ( figures s2n s2q ) , in mp mutant inflorescence meristems uniform expression of ypet - mpc mut resulted in the ectopic growth and lateral fusion of bract - like organs subtending floral meristems ( figures s2r and s2s ) . thus , modulation of mp expression is essential to suppress bract growth and fusion , but not for specifying periodic positions . to further investigate the role of mp activity in regulating organ formation and cell polarity , we truncated mp - ypet to create a constitutively active form of mp , in which domains iii and iv are deleted . although prolonged induction of this form of mp in both wild - type and mp mutants led to transgene silencing , by imaging plants soon after induction we observed an absence of distinct pin1 polarity convergence patterns and the initiation of non - localized growth at the meristem periphery ( figures 2a2e and 2i2k ) . mock - treated wild - type control plants showed normal phyllotactic patterning ( figures 2f2h ) . these data show that localized mp activity is required for localized pin1 polarity convergence patterns and organogenesis , indicating that mp activity plays an instructive rather than permissive role in regulating organ position . to test whether mp feeds back on its own patterns of activation by directing auxin transport , we utilized cre - lox - mediated recombination to generate clones of cells expressing a functional mp gene fused to either venus or ypet under the ubq10 promoter in two loss - of - function mp mutant backgrounds ( mp - t370 and mp - b4149 ) . eight days after induction of cre activity in the central zone of mp mutant meristems using dex - inducible cre - gr ( glucocorticoid receptor ) under the control of the clavata3 promoter , we observed organ - like outgrowths associated with mp clones that were not there previously ( figures 3a and 3b ) . time - lapse imaging revealed that clones expressing mp first appeared 3 days after dex treatment . strikingly , localization of pin1 started to shift in neighboring cells toward these clones as they were displaced into the peripheral zone ( figures 3c3 m and s3h s3j ; movie s2 ) . we also noted a gradual increase in mp and pin1 expression level within the clones over time , with pin1 expression decreasing in adjacent regions farther away ( figures 3e3h , 3j3 m , and s3bs3 g ) , indicating the local accumulation of auxin within the clones and the depletion nearby . by 6 days , the clones had formed outgrowths with pin1 polarity convergence points at their distal tip ( figures 3h and s3e ) . in addition to observing polarity responses in epidermal cells adjacent to the clones , we also observed pin1 polarity responses in cells underlying these clones ( figure 3n ) . furthermore , we observed several examples in which mp clones were located in the l2 ( layer 2 ) and , in these cases , we also observed pin1 polarity convergence patterns in l2 and the overlying epidermis ( figures 3o3q ) . these results demonstrate that local mp expression is sufficient to polarize cells in a non - cell - autonomous manner in multiple cell layers , and imply that auxin - induced transcriptional targets positively feed back on their own expression by influencing auxin transport . because mp triggers gene expression in response to signaling by transport inhibitor response ( tir ) 1 , which is localized intracellularly , this result also strongly supports previous models for phyllotaxis that assume that high levels of intracellular auxin act to polarize pin1 in neighboring cells . because several previous studies have suggested a role for mechanical stresses in orienting cell polarity , and local mp expression most likely alters such stresses by promoting organ growth , we investigated whether a previously proposed model linking intracellular auxin to wall stresses and pin1 localization could account for the polarity patterns we observed in response to local mp expression . this model assumes that intracellular auxin promotes the expression of cell wall enzymes that loosen cell walls and that cells target their pin1 protein toward membranes adjacent to highly stressed walls . due to the common tensile load borne by attached , adjacent cell walls , the loosening of one cell wall triggered by auxin is assumed to increase the tensile stress on the adjacent cell wall , thereby promoting polarization of pin1 in the adjacent cell toward the neighboring cell with high levels of intracellular auxin . using a finite element mechanical model of meristem tissue ( see the supplemental experimental procedures ) , we assumed that auxin - induced mp activity triggers cell wall loosening and simulated this loosening in small patches of cells in different cell layers to determine the predicted polarities of surrounding cells . we found this model could recapitulate polarity responses to epidermal mp clones ( figures s4a and s4b ) and sub - epidermal polarity response to sub - epidermal clones ( figure s4c ) . in contrast , the predicted epidermal polarities to sub - epidermal clones did not match observations ( figure s4d ) . however , adding low levels of loosening in the overlying epidermal cells could restore a match to the simulations ( figure s4e ) , suggesting that residual auxin response may exist in non - mp - expressing cells . we tested this prediction by applying auxin to mp mutant meristems and observed a delayed pin1 expression and limited growth response that could be inhibited by the tir1 inhibitor auxinole ( figures s4fthese results confirm that residual tir1 - dependent auxin activity remains in mp mutants and that if this is taken into account , our results are consistent with a mechanical stress feedback model . simultaneous observation of microtubule orientations together with pin1 in response to mp clones also revealed correlated responses consistent with mechanical model predictions ( figures s4n and s4o ; movie s3 ) . because mp clones are sufficient to reorient pin1 polarities toward the clones in multiple cell layers , we decided to express mp only in the epidermis to test whether epidermal expression of mp per se is sufficient to generate periodic patterns . in wild - type plants expressing mp - ypet under the control of the meristem layer 1 ( ml1 ) promoter , we observed mp - ypet expression to be restricted to the epidermis but patterned in a similar way to the wild - type , and it remained auxin responsive ( figures 4a and 4b ) . to verify that the pml1 promoter was not auxin responsive , we checked the meristems of control plants expressing pml1 : : 2x - cfp - n7 and found that cfp was uniformly expressed and did not show an increase in expression upon auxin application ( figures 4c and 4d ) . in contrast , many transgenic generation 2 ( t2 ) mp mutant plants expressing mp in the epidermis developed fused cotyledons ( 23 % , n = 13 ; 50 % , n = 10 ) and leaves ( figures 4e and 4f ) . although some of these plants failed to develop beyond the seedling stage , less severely affected plants ( 33 % ; n = 26 , 20 ) underwent the transition to flowering . of 13 such plants , 10 exhibited two elongated pin1 polarity convergence and mp expression foci positioned on opposite sides of the sam , with two distinct spirals of organ tissue forming continuous bands leading down the stem ( figures 4g4i ) . other configurations included a single spiral , a whorled pattern , and a whorled / spiral intermediate . time - lapse imaging of plants exhibiting the spiral pattern revealed that in contrast to the wild - type situation , the expression patterns of both pin1 and mp tended to shift laterally , along with convergent patterns of pin1 polarity ( figures 4j and 4k ) . although the initiation of organ growth correlated with the onset of high mp expression , this growth continued after the local maximum of mp and pin1 expression subsequently shifted , thereby creating a continuous spiral of organ tissue . longitudinal reconstructions of optical sections confirmed that whereas both pin1 - cfp and mp - ypet were upregulated in epidermal tissues , both markers were largely absent in cells below ( figures 4l and 4 m ) . notably , no evidence of pro - vascular tissue marked by pin1 was detected ( figure 4 m ) . because vascular tissues have been associated with auxin depletion , we tested whether auxin - triggered auxin depletion could act to stabilize auxin distribution patterns generated by a previously proposed feedback model for auxin transport consistent with our findings ( see the supplemental experimental procedures ) . we found that without negative feedback on auxin concentrations , the auxin maxima generated by this model could easily shift with respect to the underlying cells due to saturation of the transport system , leading to diffusion orleakage of auxin laterally ( movie s4 ) . however , by depleting auxin levels in an auxin - dependent manner , these findings demonstrate that although mp is sufficient in a single - cell layer to mediate the formation of separated auxin maxima ( corresponding to the two foci of mp and pin1 expression observed at the apex ) , consistent with previous studies , additional mp - regulated processes in sub - epidermal tissues such as auxin depletion must exist that prevent movement of spacing patterns with respect to the underlying cells . although tissue - level cues orienting cell polarity in animals appear to be patterned independent of their downstream polarity targets , our data indicate that plants utilize cell polarity to propagate a mobile signal that acts within cells to orient the polarity of neighboring cells such that the signal accumulates locally . having established mp as a central player in this feedback system , a future focus on mp target genes should ultimately lead to a molecular understanding of the signaling processes involved and how these processes are modulated in different plant species and tissue contexts to generate morphological diversity . designed the wet lab experiments , proposed the computer model simulations , and analyzed and interpreted the results . helped design the simulation experiments and analyze their output as well as interpret wet lab experimental results .\noutput:\n" }, { "from": "agent", "value": "summarythe periodic formation of plant organs such as leaves and flowers gives rise to intricate patterns that have fascinated biologists and mathematicians alike for hundreds of years [ 1 ] . the plant hormone auxin plays a central role in establishing these patterns by promoting organ formation at sites where it accumulates due to its polar , cell - to - cell transport [ 2 , 3 , 4 , 5 , 6 ] . although experimental evidence as well as modeling suggest that feedback from auxin to its transport direction may help specify phyllotactic patterns [ 7 , 8 , 9 , 10 , 11 , 12 ] , the nature of this feedback remains unclear [ 13 ] . here we reveal that polarization of the auxin efflux carrier pin - formed 1 ( pin1 ) is regulated by the auxin response transcription factor monopteros ( mp ) [ 14 ] . we find that in the shoot , cell polarity patterns follow mp expression , which in turn follows auxin distribution patterns . by perturbing mp activity both globally and locally , we show that localized mp activity is necessary for the generation of polarity convergence patterns and that localized mp expression is sufficient to instruct pin1 polarity directions non - cell autonomously , toward mp - expressing cells . by expressing mp in the epidermis of mp mutants , we further show that although mp activity in a single - cell layer is sufficient to promote polarity convergence patterns , mp in sub - epidermal tissues helps anchor these polarity patterns to the underlying cells . overall , our findings reveal a patterning module in plants that determines organ position by orienting transport of the hormone auxin toward cells with high levels of mp - mediated auxin signaling . we propose that this feedback process acts broadly to generate periodic plant architectures ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: akinesia , the inability to initiate and execute movements , is a key aspect of impaired motor performance in patients suffering from parkinson 's disease ( pd ) . once set in motion , kinetic function in pdfurthermore , dynamic motor output of pd patients shows a disturbed temporal coordination , resulting in a set of characteristic movement irregularities ( sacks , 1999 ) . gait and speech of pd patients are often hastened , rapid alternating movements are difficult to perform , and motor synchronization to sensory stimuli is globally impaired . a candidate neuronal mechanism involved in these dysregulations of motor rhythmicity in pd patients may encompass pathological levels of oscillatory brain activity within coupled subcortical and cortical networks ( brown , 2003 ; nagasaki et al . , 1978 ) . a characteristic signature of ongoing neuronal activity in the dopamine - depleted motor circuitries of pd patients is abnormal coupling at beta frequencies ( 1330 hz ) . beta activity is excessively synchronized within and between functionally interconnected nodes in the basal ganglia ( bg ) , thalamus and cortex , eventually resulting in impaired motor function ( hutchison et al . , 2004 ; both dopaminergic medication and deep brain stimulation of the subthalamic nucleus ( stn - dbs ) reduce beta - band coupling within and between structures of this functional loop in pd patients . at the same time , these neuromodulatory interventions restore physiological motor output , supporting the functional significance of beta oscillations for information processing in the motor domain ( engel and fries , 2010 ; jenkinson and brown , 2011 ) . beyond the antikinetic effects of elevated beta - band activity in the resting brain state , their dynamic modulation is impaired in pd as well ( doyle et al . , 2005 ) . impaired beta modulation may lead to deficient dynamic scaling and sequencing of complex sensorimotor processes such as gait ( singh et al . ,2013 ) , speech ( hebb et al . , 2012 ) and repetitive movements ( joundi et al . , 2013 ) . external sensory stimuli can temporarily ameliorate some of the motor disabilities of pd patients ( cunnington et al . , rhythmic auditory stimulation ( ras ) improves dysrhythmic locomotion and is frequently used to treat gait disturbances in advanced stages of pd ( mcintosh et al . , 1997 ) . however , sensory facilitation by ras depends on the stimulation frequency with slower presentation rates being more effective than fast rhythms ( enzensberger and fischer , 1996 ) . hitherto , little is known concerning the neural processing of ras in pd patients . more specifically , bg - cortex circuits play a critical role modulating beta - band activity during synchronization tasks as timekeeper for movements ( bartolo et al . , 2014 ; rao et al . , 1997 ; teki , 2014 ) , but it remains unknown how stn - dbs and dopaminergic medication influence the cortical response profile to ras in the absence of overt movement . as a first step , we re - addressed the question whether treatment with levodopa or stn - dbs induces significant changes in ongoing eeg activity focusing , in particular , on the beta - band . to this end , we analyzed the resting state eeg of patients with advanced pd before ( dopa - off versus dopa - on ) and after stn - dbs surgery ( off - dbs versus on - dbs ) . in order to examine the specific influence of bg circuit modulation on rhythm - related auditory processing , we then explored the neurophysiological signatures of ras in a passive listening paradigm with slow ( 2 hz ) and fast ( 4 hz ) stimulus presentation rates under these four experimental conditions . since beta - oscillatory signals reflect timekeeping functions in healthy people ( fujioka et al . , 2012 ) , we hypothesized that ras would reveal an altered beta - band response profile in patients with pd . auditory evoked potential analysis of this dataset has been reported elsewhere ( gulberti et al . , 2015 ) . the present investigation was conducted in agreement with the code of ethics of the world medical association ( declaration of helsinki , 1967 ) and the local ethics committee approved the procedures . twelve patients ( 7 female , 5 male , mean age : 616 years ) with a diagnosis of advanced idiopathic pd ( mean disease duration : 143 years , hoehn & yahr stage : 31 ; hoehn and yahr , 1967 ) and twelve healthy control persons matched in sex , age and education ( 8 female , 4 male , mean age : 658 years ) participated . patients underwent bilateral microelectrode - guided implantation of dbs electrodes in the stn . pre - operatively , all pd patients showed a significant improvement of the motor - subscore ( iii ) of the unified parkinson 's disease rating scale ( fahn et al . , 1987 ) following intake of levodopa . the mean motor score after overnight withdrawal of anti - parkinsonian medication was 3212 , while after intake of levodopa it was reduced to 189 ( t ( 11 ) = 5.54 ; p = 0.0002 ; paired t - test ) . pre - operatively , the daily levodopa - equivalent dose was 1132420 mg . during the period of post - operative recordings , it was reduced to 663354 mg ( t ( 22 ) = 2.96 ; p = 0.0073 ; paired t - test ; conversion factors used for the calculation of levodopa equivalent daily dose after tomlinson et al . , 2010 ) . importantly , all patients demonstrated an adequate global intellectual capacity , when tested with the mini - mental status exam ( folstein et al . , 1975 ; mean score : 291 ) and the mattis dementia rating scale ( mattis , 1988 ; mean score : 1430.5 ) . furthermore , they fulfilled other inclusion criteria for stn - dbs , such as no structural alterations on magnetic resonance imaging ( mri ) , and no concomitant severe medical comorbidities . for all patients dbs electrodes ( model 3389 , medtronic , minneapolis , mn , usa ) and stimulators ( kinetra model 7428 in 7 patients and activa pc model 37,601 in 5 patients , medtronic , minneapolis , mn , usa ) were implanted at the department of neurosurgery at the university medical center hamburg - eppendorf , germany . in short , dujovny frame ( stryker leibinger ) was tightly secured with pins on the patient 's head . gadolinium - enhanced volumetric t1 mri and t2 - weighted spin echo mri sequences were first acquired , and were then fused with computerized tomography scans by means of iplan ( brainlab ) , a commercial treatment planning software . through this procedure , both commissures , the stn - nigra complex and blood vessels could be delineated with high resolution . a reference line connecting the anterior and posterior commissure ( ac pc line ) the intended target coordinates for the stn were 11.512.5 mm from the midline , 12 mm behind the midcommissural point and 2 mm below the line connecting anterior and posterior commissure . for the surgical implantation of the electrodes , burr holes of 810 mm diametersuccessful placement of the implanted dbs electrodes in the region of the stn was assessed by intra - operative microelectrode recordings , by effective intra - operative macrostimulation , by stereotactic reconstruction of electrode contacts on post - operative stereotactic ct scans fused with pre - operative mris , and by a significant improvement in the post - operative updrs motor score in dopa - off condition : on - dbs ( 208 ) vs. off - dbs ( 4010 ; t ( 9 ) = 7.89 ; p two patients were excluded from this paired t - test due to missing post - operative updrs scores . post - operatively , none of the patients showed signs of accidental stimulation of fiber tracks running in the neighboring internal capsule or lemniscal radiation . the first experimental sessions took place 65 days before the implantation of bilateral stn - dbs electrodes for treatment of pd , the second experimental sessions 52 months following dbs surgery . in the pre - operative recording sessions , patients were assessed in ( i ) dopa - on and ( ii ) dopa - off conditions . these two pre - operative recordings always took place on two subsequent days and the order in which the two conditions were recorded was counterbalanced . pd patients were tested after an overnight period of withdrawal from medication ( dopa - off condition ) . it is of note that all post - operative recordings also took place after overnight withdrawal of anti - parkinsonian medication on two different days . post - operatively , the two experimental conditions were : ( iii ) on - dbs , i.e. , during bilateral therapeutic stn - dbs with high - frequencies ( 130240 hz ) and ( iv ) off - dbs , i.e. , with the dbs device switched off . for each subject , stimulation contacts , amplitude and pulse duration were the same as for therapeutic high - frequency stimulation ( see table 1 ) . after switching off the therapeutic high - frequencies dbs , a period of time 25 min was elapsed before starting the recordings in the off - dbs condition . this period has previously been demonstrated to be long enough to induce a significant worsening of motor symptoms following discontinuation of stn - dbs ( temperli et al . , 2003 ) , and this is also in line with clinical observations in our patient group . participants were comfortably seated in front of a 21 - inch monitor at a viewing distance of 155 cm , and written instructions of the task were presented . participants were asked to fixate at a white cross ( diameter : 3 cm ) and to listen passively to the presented auditory stimuli without moving . stimuli consisted of rhythmic metronome - like clicks presented at 11 different stimulation rates , from 1 to 6 hz rhythms in steps of 0.5 hz . for each rhythm - block , a series of 75 clicks were presented . blocks were separated by a silent pause of 6 s. single clicks with a duration of 13 ms each , were presented at 70 db ( spl ) through two loudspeakers located in front of the participant 's head ( bose companion 2 , series ii , framingham , ma , usa ) . at the end of the task , participants were asked to sit quietly and fixate the white cross in front of them for 1 min in order to record ongoing eeg . tri - axial accelerometers fixed on both index fingers ( freescale semiconductor , mma7260qt ) permitted both on - line monitoring and post - hoc quantitation of resting tremor episodes during the recordings . participants ' awareness was constantly tracked throughout the experimental session with the help of eeg and electrooculogram ( eog ) parameters and video / intercom surveillance . eeg activity was recorded referenced to the nose tip from 62 active ag / agcl scalp electrodes mounted in an elastic cap with equidistant montage ( easycap gmbh , herrsching , germany ) . the electrodes had integrated impedance converters fitted directly into the electrode in order to minimize noise from the surrounding area as well as from movement artifacts . this aspect was of particular importance for eeg recordings in pd patients with resting tremor ( see below ) . in order to record eog activities , the data were bandpass - filtered ( 0.016250 hz ) and digitized ( sampling rate : 1000 hz ) using brainamp amplifiers ( brainproducts , munich , germany ) . signal analyses were performed using matlab 7.10 ( mathworks , natick , ma ) , and two freely available open source toolboxes , eeglab 6.03 b ( delorme and makeig , 2004 ) and fieldtrip ( oostenveld et al . , 2011 ) . statistical analysis of the eeg was restricted to a central region of interest ( roi ) , comprising the electrodes with the largest auditory responses . this roi included the averaged signal of the vertex electrode cz and of six neighboring electrodes ( see fig . the sensor - level analysis of eeg data in our study precludes precise statements concerning the specific neural sources . however , it is likely that neuronal activity from frontal cortical areas , supplementary motor area and perhaps more posteriorly located motor areas was picked up by sensors within the central roi . thus , the chosen roi was strategically positioned to sample activity from cortical areas and neural systems with particular relevance to interval timing , rhythm perception , and auditory motor coordination ( fujioka et al . , 2012 ; grahn and brett , 2007 ; harrington et al . , 1998 ; rao et al . , 1997 ; schaal et al . , 2004 ; toma et al . , 2002 ) . a two - step procedure was performed to remove artifacts ( schneider et al . , 2008 ) . first , epochs containing non - stereotyped artifacts ( e.g. , cable movement , swallowing ) were removed . after the reduction of the number of components to 32 by principal component analysis , extended infomax independent component analysis ( ica ) was applied using a weight change 10 as stop criterion . independent components representing artifacts ( e.g. , dbs artifacts , eye blinks , saccadic activity , ecg artifacts ) were removed from the eeg data by back projecting all but these components . low - pass filtering ( cut - off frequencies at 100 and 48 hz for time frequency and power spectrum analysis , respectively ) strongly reduced dbs - related artifacts . despite this , artifacts related to electrical stimulation within the analyzed frequency - range were still present in 5 patients . ica components representing stimulation artifacts were clearly discernible due to their circumscribed scalp distribution involving few neighboring eeg - electrodes positioned over one or both dbs - electrodes . furthermore , these artifacts were characterized by a highly regular and stereotypical appearance throughout the whole recording time as well as by unphysiologically sharp peaks in their activity power spectra . as a final step , outlier epoch - valueswere automatically detected and rejected ( threshold criterion : 100 v ) . in the present study four patients showed resting tremor . to limit the influence of tremor - related muscle artifacts , active eeg electrodes were used and statistical analyses of eeg activities were confined to the central roi . additionally , epochs with extensive tremor artifacts were excluded and ica components representing tremor artifacts were removed from the eeg data . application of this procedure ensured that for each participant at least 90 % of all recorded trials could be retained . a power spectrum analysis ( fast fourier transform ) of the resting - state eegraw data were first low - pass filtered ( 48 hz ) , downsampled to 500 hz and then high - pass filtered ( 2 hz ) . a linear - phase fir filter design using least - squares error minimization was applied .60 - point low - pass filtering was performed and the low - pass transition bandwidth was 7 hz . for high - pass , a 750 - point filtering was performed and the high - pass transition bandwidth was 0.3 hz . this procedure minimized the contribution of movement artifacts , slow drifts ( 2 hz ) and the largest part of the stimulation artifacts in the on - dbs condition ( 130 hz ) as well as line noise ( 50 hz ) artifacts . filtering and application of the above mentioned two - step procedure ensured that at least 50 s of the resting - state eeg recordings could be retained for each participant ( mean : 564 s ) . relative power is not influenced by factors such as electrode impedance , skull thickness or skin conductance . however , the interpretation of variations in frequency bands or group comparisons may be difficult when relying exclusively at relative power values , since frequencies in relative power are not quantified independently of each other ( pivik et al . to facilitate the evaluation of precise contributions to changes in relative power , we decided to present relative power measures in conjunction with absolute power ( pivik et al . , 1993 ) . for the relative power spectrum , we divided every bin ( n = 94 ) of the power spectrum by the sum of the full band power ( 248 hz ) . average power was then computed separately for the 5 main frequency bands : delta ( 24 hz ) , theta ( 48 hz ) , alpha ( 813 hz ) , beta ( 1330 hz ) and gamma ( 3048 hz ) . in the case of absolute power , average power values for the 5 main frequency bands were computed . to compare changes of resting - state power spectra under different conditions and in different groups , we first performed transformations towards the normal distribution for absolute and relative band power as suggested by gasser et al . ( 1982 ) : log x for absolute power and log [ x / ( 1 x ) ] for relative power , where x represents the absolute and the relative band power , respectively . we then performed the statistical analysis for the 5 main frequency bands . to test the variance of the five frequency bands in the different therapy conditions and groups , anovas with repeated measureswere performed in pasw statistics ( pasw statistics for mac version 18.0 , spss inc . , geisser corrected p - values are reported if sphericity was violated ( mauchly 's sphericity test ) . degrees of freedom are reported uncorrected . to test the effect of different treatments on the relative and absolute power distribution in comparison to healthy controls , four separate anovas were performed for the four experimental conditions ( dopa - on , dopa - off , on - dbs and off - dbs ) vs. controls . the repeated measures factor frequency - bands had 5 levels ( relative or absolute power in the five different frequency bands ) . each between - subjects factor had two levels ( each of the four pd - patients conditions vs. controls ) . to test the effect of different treatments on the relative and absolute power distribution in comparison to each other , six repeated measures anovas were performed with the within - subject factors frequency - bands and all combinations of experimental conditions . in case of a significant main effect for group or for treatment ( i.e. , levodopa , surgery and dbs ) or an interaction effect with frequency - bands , subsequent post - hoc analyses with regard to single band differences between groups or treatmentswere performed ( two - sample t - test , pooled for comparisons between patients and control groups or paired - sample t - test for comparisons between the patients conditions ) . correction for multiple comparisons is a relevant general topic concerning the analysis of non - random biological , clinical and physiological data , where real associations are to be expected and a priori hypotheses are generally formulated ( rothman , 2014 ) . as stated in the introduction , we expect a reduction of the pathologically increased beta - band activity of pd patients following levodopa and dbs treatments . having generated a specific hypothesis concerning the differences in resting - state eeg beta - band activity in pd patients implies that post - hoc procedures ( usually used for exploratory studies , where no specific a priori hypotheses have been made ) , and the associated adjustments for multiple comparisons , would not strictly be necessary , as they are reducing type i errors at the expense of increasing type ii errors ( field , 2009 ; perneger , 1998 ; rothman , 2014 ) . nevertheless , for both absolute and relative power , the alpha level of post - hoc analyses was conservatively bonferroni - corrected for the 5 frequency bands ( i.e. , p 0.01 ) . for the analysis of spectral changes in oscillatory activity , continuous raw data were first low - pass filtered ( 100 hz ) , downsampled to 500 hz and then high - pass filtered ( 2 hz ) . a linear - phase fir filter design using least - squares error minimization was applied .30 - point low - pass filtering was performed and the low - pass transition bandwidth was 1 hz . for high - pass , a 750 - point filtering was performed and the high - pass transition bandwidth was 0.3 hz . epochs were then extracted from the continuous data starting 500 ms before click onset and lasting for 1000 ms after click onset . finally , outlier epoch - values were automatically detected and rejected setting a threshold value of 100 v . frequency analysis was performed on frequencies from 3 to 100 hz ( step size 1 hz ) using a hanning taper . using a sliding window approach the taper ( length 100 ms ) was moved from 0.3 to 0.7 s in steps of 5 ms . a 100 ms time window results in a frequency resolution that is best for frequencies above 10 hz . since we were most interested in beta frequencies ( 1330 hz ) , the choice of the above - mentioned taper settings offered a good temporal resolution for this frequency of interest . furthermore the relatively short time window of 100 ms prevented temporal smearing in the lower frequencies , which was important with respect to the short isis of the paradigm . for timefrequency analyses , fourier transformation was performed on the single - trial level prior to averaging . the resulting total power contains both signal components phase - locked and non - phase - locked to the stimulus . power was then baseline corrected for each frequency to obtain the relative signal change : p ( t , f ) corrected = 100 ( p ( t , f ) furthermore , an inter - trial coherence ( itc ) analysis was performed by averaging the phase of the complex spectral estimates across single trials ( makeig et al . , 2004 ; tallon - baudry et al . , 1996 ) . itc is a univariate measure reflecting the phase - locking for specific frequencies at a single channel over trials . thus , it differs from bivariate coherence measures which reflect phase - locking between two separate channels ( bruns , 2004 ; herrmann et al . , values ranging from 0 to 1 indicate how the phases are distributed with respect to stimulus onset : a value of zero means complete randomly distributed phases , while a value of 1 represents a perfect phase - locking to the stimulus . mean total power in the frequency range from 3 to 80 hz was calculated and plotted for all experimental conditions in pd patients and for the control group . time courses of single band power change were calculated and plotted as the mean across the frequencies from 4 to 7.5 hz ( theta ) , 812 hz ( alpha ) , 1330 hz ( beta ) and 3180 hz ( gamma ) . for statistical analysis in the frequency domain , we separated the rhythm conditions into two main groups : ( i ) rhythmic auditory stimulation presented at slow rates ( 1 , 1.5 and 2 hz , hereafter referred to asslow ras ) and ( ii ) fast auditory pacing ( 4 , 4.5 and 5 hz , fast ras ) . this subdivision was suggested by clinical observations and reports in the literature that ras at 12 hz is particularly helpful to alleviate motor impairments , especially gait disturbances , observed in pd ( enzensberger and fischer , 1996 ; mcintosh et al . , in contrast , auditory motor coupling is severely impaired in response to ras with frequencies 3 hz ( freeman et al . , 1993 ; several reports in healthy participants converge on the existence of two distinct timing mechanisms for discrete ( 2 hz ) and continuous ( 3 hz ) movements ( huys et al . , 2008 ; kunesch et al . , 1989 ; szirmai , 2010 ; toma et al . , furthermore , the change from a transient to a steady - state cortical activity , as indexed by the overlap of neuronal responses during fast auditory pacing , starts at ras above 2 hz ( carver et al . , 2002 ) . to avoid overlap between these two putatively distinct timing mechanisms , we excluded auditory stimulation rates between 2.5 and 3.5 hz . moreover , the two fastest auditory stimulation rates ( 5.5 and 6 hz ) were excluded from further analysis to avoid excessive overlapping of power change resettings due to the temporal proximity of auditory events and to guarantee a balanced comparison of three slow vs. three fast ras conditions , respectively . groupingthree slow and three fast frequencies increased the trial number for each condition from 75 to 225 , thus increasing the statistical power for the analyses . moreover , this approach reduced the number of tests between auditory stimulation conditions , minimizing the probability of type - i statistical errors . note that the epochs defined here ( from 0.2 to 0.5 s relative to stimulus onset ) are often longer than the inter - stimulus intervals ( isi ) and thus contain responses to more than one stimulus . this is particularly relevant for the fast ras group containing auditory pacing frequencies up to 5 hz ( i.e. , with an isi interval of 200 ms ) . two adjacent peri - stimulus time - windows were considered for non - parametric cluster - based statistical analysis . a pre - stimulus time - window ranging from 80 to 0 ms ( stimulus onset ) , and a post - stimulus time - window from 0 ms ( stimulus onset ) to 80 ms were tested separately for pre - and post - stimulus intervals . together , both intervals had a length of 160 ms , which is shorter than the isi of the fastest ras condition considered ( i.e. , 5 hz , 200 ms isi ) . cluster - based non - parametric randomization tests were performed for mean values of power and itc between groups ( controls vs. dopa - off and controls vs. on - dbs ) and between conditions ( dopa - on vs. dopa - off and on - dbs vs. dopa - off ) . these tests control the type i error rate in experimental designs involving multiple comparisons by clustering adjacent timefrequency points exhibiting the same effect ( cluster = 0.05 , 1000 randomizations ; maris and oostenveld , 2007 ) . results of power differences between groups and conditions were plotted as z - scores and significant clusters with p - values 0.05 were highlighted . differences in the beta - band power and itc as a function of time ( between groups and between experimental conditions ) were tested performing cluster - based non - parametric analyses of the sampling points of the curves as described above . we applied two - sample t - tests , pooled for comparisons between patients and control groups and paired - sample t - tests for comparisons between the different experimental conditions in patients , respectively . to test whether cortical activity was influenced by experimental conditions in the absence of sensory stimulation , we first investigated possible effects of levodopa and stn - dbs on absolute and relative spectral power of the resting - state eeg ( fig . we focused on spectral power recorded in the central roi , since this region showed the most pronounced eeg - activity modulation in response to the ras . specifically , we intended to characterize beta - band resting - state power changes in this roi in regard to the different treatments . to this end , we performed repeated - measures anova with between - subjects factor group ( patients vs. controls ) and within - subjects factors frequency - bands ( delta , theta , alpha , beta , gamma ) and treatment ( dopa - off , dopa - on , off - dbs , on - dbs ) . table 2 summarizes the results of the anova analysis for both relative and absolute power . relative power measures are displayed in conjunction with absolute power to ensure an accurate evaluation of contributions to changes in relative power ( pivik et al . , 1993 ) . adjusting statistical significance for the number of tests that have been performed is recommended to control for type i errors ( i.e. , detecting an effect that is not present ) . unfortunately , this procedure is often inflating type ii errors ( i.e. , truly important differences are deemed non - significant ) and thus missing real differences ( perneger , 1998 ; rothman , 2014 , 1990 ) . therefore , we report here the uncorrected results , as suggested by a number of statisticians ( bender and lange , 2001 ; perneger , 1998 ; rothman , 2014 , 1990 ; saville , 1990 ; savitz and olshan , 1995 ) . highlightedare p - values , which would survive most conservative bonferroni corrections ( i.e. , p - values 0.0025 for the 20 separate anovas reported in table 2 are marked in bold , and p - values 0.00625 for the 8 power changes comparisons reported in fig . 3 are marked with an asterisk ) . it should be noted that all post - operative recordings took place after overnight withdrawal of anti - parkinsonian medication . for relative powerwe consistently found main effects of frequency - bands and group ( patients vs. controls , fig . the interaction between frequency - bands and group reached significance in the comparison off - dbs vs. controls . significant interaction effects between frequency - bands and treatment were found in the comparison of the two pre - operative conditions dopa - off and dopa - on with the two post - operative conditions off - dbs and on - dbs . compared to the pre - operative baseline measurement in the absence of dopaminergic medication ( dopa - off ) , a significant increase of relative power in the theta frequency band was observed for patients in both post - operative conditions ( see fig . notably , a significant reduction of relative power in the beta and gamma frequency range was observed for the post - hoc comparison dopa - off vs. on - dbs , pointing to a dbs - induced reduction of cortical high - frequency power ( see fig . power from beta and gamma frequencies towards theta was evident in the group of pd patients . in a similar vein , analysis of absolute power revealed main effects of frequency - bands and group ( patients vs. controls ) , and a significant interaction of factors frequency - bands and group for the comparison off - dbs vs. controls . pd patients constantly displayed higher absolute power values than controls across all frequency bands except for beta - band activity in the comparison between controls and patients on - dbs ( fig .1 a , c and table 2 ) . furthermore , and in line with the results on relative power , significant interactions of factors frequency - bands and treatment were found in the comparisons dopa - off vs. off - dbs and on - dbs , as well as dopa - on vs. off - dbs . in line with the results on relative power , post - hoc tests comparing absolute power between dopa - off vs. off - dbs showed a significant increase in theta - band power for patients off - dbs . when directly comparing dopa - off to on - dbs , absolute beta and gamma power was significantly reduced in the on - dbs condition . a similar reduction of absolute beta power with on - dbs was also found in the post - hoc comparisons with the dopa - on condition . notably , beta power in the on - dbs condition was reduced compared to the off - dbs condition in the post - hoc contrast between on - dbs vs. off - dbs ( p = 0.025 ; see inset of fig . however , this difference did not survive a conservative bonferroni correction ( i.e. , p 0.01 ) . taken together , after surgery an increment of theta power with dbs switched off was observed in pd patients . importantly , stn - dbs suppressed high - frequency activities and lowered in particular beta - band oscillatory power to control level . the topographical patterns of absolute power in the eeg were similar for all frequency bands , irrespective of group or experimental condition ( fig . the finding of consistent scalp topographies for resting - state activity before and after surgery as well as in comparison with the control group argues against a significant impact of dbs - artifacts and / or component rejections in our study . we can not categorically exclude possible contributions from undetected dbs - artifact activity , but believe that the results reported here were not significantly biased by our careful artifact - removal procedure . in order to investigate a possible influence of resting tremor on ongoing theta - band activity , we correlated absolute eeg theta power with the corresponding tremor power values as derived from simultaneous accelerometry recordings . to this end , we performed a spectral analysis ( fast fourier transform , same settings as for eeg analysis ) for the accelerometer signals . average tremor power values between 4 and 8 hz were then computed for the two conditions dopa - off and off - dbs , in the absence of anti - parkinsonian medication . due to the non - normal distribution of tremor and theta power values ( shapiro wilk test , alpha level = 0.05 ) , p and rho values were calculated using non - parametric spearman 's correlations . tremor power values did not correlate with theta - band power in the eeg , neither in the pre - operative condition dopa - off ( rho = 0.08 ; p = 0.82 ) nor in the post - operative condition off - dbs ( rho = 0.45 ; p = 0.14 ) . a direct comparison of tremor power between these two pre - and post - operative conditions did not show significant differences ( w ( 11 ) = 25 ; 0.30 ; wilcoxon signed rank test ) . to stay in line with the methods applied before in other studies of resting - state eeg in parkinson 's disease ( bosboom et al . , 2006 ; silberstein , 2005 ; stoffers et al . , 2007 ) , we correlated absolute theta power values also with the corresponding tremor sub - scores in the motor subsection of the updrs ( updrs part iii , sum of items 20 and 21 ) of conditions dopa - off ( mean score 3.83.9 ) and off - dbs ( mean score 5.13.1 ) . updrs tremor scores did not correlate with theta - band power in the eeg , neither in the dopa - off ( rho = 0.21 ; p = 0.51 ) nor in the off - dbs condition ( rho = 0.31 ; p = 0.38 ) . consequently , it is improbable that tremor artifacts accounted for the observed post - operative theta power increase in the eeg , in accordance with previous results reported by bosboom et al . evoked oscillations are phase - locked to the stimuli , i.e. , they reflect those components of the oscillatory signal whose phase is similar after every stimulus presentation . evoked power can be considered as the frequency - domain equivalent of the event - related potential . in contrast , induced neuronal oscillations are not phase - locked to stimulus onset .2 ) , which comprises both induced and evoked oscillatory components . in order to disentangle which parts of the power responses are phase - locked to the stimuli , we analyzed inter - trial coherence ( itc ; fig .4 ) . in the following paragraphs and figures , time frequency analysis results will be presented in succession , first for slow and then for fast ras . during slow ras , two distinct peri - stimulus components could be differentiated in the eeg total power for healthy control participants ( labeled i and ii in fig . ( i ) from 70 to 0 ms before stimulus onset , low - frequency oscillations mainly in the beta - band displayed a local peak .2 b e , this pre - stimulus beta - power modulation was absent in all conditions in pd patients . ( ii ) immediately after stimulus onset , a phasic broad - band ( 480 hz ) power increase was evident , rapidly decaying within the first 120 ms . the duration of this broad - band peak was considerably increased ( for ~ 50 ms ) in pd patients ( fig . treatment , post - stimulus theta and alpha power was excessively high in patients before surgery ( fig . cluster - based statistic of event - related power changes revealed pre - stimulus differences mainly within the beta - band for contrasts between patients in dopa - off and on - dbs vs. controls ( cluster randomization test , p = 0.016 and p = 0.019 , respectively ; upper panels of fig . 3a and d ) . as oscillatory activity in the beta - band ( 1330 hz ) has repeatedly been postulated to play an important role in rhythm perception and audio - motor integration , we thoroughly examined changes in this particular frequency band and visualized its modulation profile as line plots in bottom panels of fig . 3athe most salient power difference between patients and controls during slow ras was consistently found shortly before stimulus onset . this increase of beta oscillatory activity preceding stimulus onset was absent in patients ( fig . auditory beta power modulation displayed a stereotypical triphasic profile ( see line plots in lower panels of fig . a pre - stimulus beta power increase ( 700 ms ) , returning to baseline levels around stimulus onset was followed by a post - stimulus beta power increase ( 20100 ms ) . while controls showed a clear beta peak shortly ( ~ 40 ms ) before stimulus onset during slow ras ( marked by an arrowhead bottom panels of fig .3 ) , this pre - stimulus beta modulation was absent in patients in dopa - off ( cluster randomization test , p = 0.005 * ) and on - dbs ( cluster randomization test , p = 0.015 ) . note that the post - stimulus beta modulation profile during slow ras was largely similar between the two groups . moreover , the contrast between the two post - operative conditions ( on versus off - dbs ) was statistically not significant .4 depicts the phase - locking across trials as reflected in itc values . according to this itc analysis , only the second ( post - stimulus ) component of the two previously described response components contained phase - locked oscillatory activity ( fig . e ) . the early power increase ( component ii , 0120 ms ) was phase - locked across all frequencies and in particular in the gamma - frequency range around 40 hz . in contrast , component i representing a pre - stimulus increase of beta power ( 1330 hz , 700 ms ) was clearly not phase - locked to the stimulus and may therefore reflect an intrinsically generated oscillatory process . cluster - based statistical analysis of the two peri - stimulus components did not show any significant itc - difference for the abovementioned contrasts , neither in the whole frequency range ( 380 hz ) , nor in the more specific analysis of temporal profiles of beta - band power ( cluster randomization tests , p 0.05 ; data not shown ) . at fast ras , response modulations of the previously described total power response components were still apparent but generally less distinct and of lower magnitude compared to responses during slow auditory pacing ( upper panels of fig . notably , a pre - stimulus beta power increase was still present in healthy control subjects ( component i in fig . ( ii ) post - stimulus amplitude modulation was still dominated by a broad - band power increase in both patients and controls , albeit of shorter duration and smaller magnitude compared to slow ras . similar to slow ras , periodic entrainment of theta - , alpha - and beta - power by fast ras was especially pronounced before dbs surgery ( fig .2 g and h ) . in the post - operative conditions , the overall response modulation level was in the same range as for healthy participants . in particular , the low - frequency content of the dominant broad - band power increase ( component ii ) was much reduced during fast auditory pacing following dbs surgery ( fig . cluster - based statistics of event - related power changes revealed a significant pre - stimulus deficiency of power predominantly in the beta - band in pd patients in dopa - off when compared to controls ( cluster randomization test , p = 0.006 * ; upper panel of fig . post - stimulus differences in the beta - band were significant in the contrasts controls vs. dopa - off ( cluster randomization test , p = 0.034 ; upper panel of fig .3 e ) , dopa - off vs. on - dbs ( cluster randomization test , p = 0.013 ; upper panel of fig .3 f ) and dopa - on vs. dopa - off ( cluster randomization test , p = 0.04 ; upper panel of fig . the specific temporal dynamics of beta - band responses during fast ras also displayed significant differences between patients and controls . for patients off medication , the periodic beta power fluctuations after stimulus onset appeared to be shifted ahead in time when compared to controls , dopa - on and on - dbs ( see line plots in fig . the duration of these stimulus - induced beta peaks were significantly longer in patients off medication ( peak width at half height , 106 ms ) compared to controls ( peak width , 46 ms ; cluster randomization test , p = 0.027 ) . a slight beta decrease , which characterized the power fluctuation immediately before stimulus onset in control subjects , was replaced by gradual ramping of beta power across stimulus onset in patients without levodopa ( cluster randomization test , p = 0.045 ) . interestingly , both dopaminergic medication and dbs normalized the time course and peak duration of stimulus - driven beta power fluctuations in the fast ras condition . this is illustrated by significant differences of beta power line plots for dopa - on compared to dopa - off ( fig .3 g ; cluster randomization test , p = 0.001 * ) and on - dbs compared to dopa - off ( fig . there was no longer a statistical difference between controls and patients with pd on - dbs ( fig .3 h ) . note that in the fast ras condition , the pre - stimulus beta - band increase was still absent for patients with dbs - on ( fig . no statistical significant difference was found for the comparison between off - and on - dbs in the processing of fast ras . itc analysis revealed that , as for the slow ras condition , the pre - stimulus beta - modulation observed in control participants ( component i ) was not phase - locked to the auditory stimuli in pd patients . as for the slow ras condition , cluster - based statistical analysis of the peri - stimulus components did not show any significant itc - difference for the considered contrasts , neither when examining the whole frequency range ( 380 hz ) , nor for the temporal profiles of beta power ( cluster randomization tests , p 0.05 ; data not shown ) . to test the interaction between pre - and post - stimulus beta - band oscillatory activities in controls and in patients for the four therapeutic conditions , correlations of pre - and post - event mean values of beta - band activities were calculated . mean beta power as well as mean itc values were computed for the two adjacent intervals considered for the peri - stimulus statistical analysis ( i.e. , a pre - stimulus time - window from 80 to 0 ms , and a post - stimulus time - window from 0 to 80 ms ) . due to the non - normal distribution of beta power values ( shapiro wilk test , alpha level = 0.05 ) , p and rho values were calculated using non - parametric spearman 's correlations . for slow raspre - stimulus beta power values did not correlate with post - stimulus beta power values , neither in controls ( rho = 0.07 ; p = 0.83 ) , nor in the four therapeutic conditions dopa - off ( rho = 0.21 ; p = 0.51 ) , dopa - on ( rho = 0.18 ; p = 0.57 ) , off - dbs ( rho = 0.02 ; p = 0.96 ) , on - dbs ( rho = 0.24 ; p = 0.44 ) . notably , for the fast ras instead , significant negative correlations were found in controls ( rho = 0.67 ; p = 0.020 ) , in patients in dopa - off ( rho = 0.71 ; p = 0.012 ) and in on - dbs ( rho = 0.70 ; p = 0.014 ) . patients in dopa - on ( rho = 0.50 ; p = 0.099 ) and in off - dbs ( rho = 0.49 ; p = 0.10 ) exhibited a negative correlation trend between pre - and post - stimulus beta power that did not reach significance . as for beta - band power , at slow ras pre - stimulus beta - band itc values did not correlate with post - stimulus beta - band itc values , neither in controls ( rho = 0.20 ; p = 0.53 ) , nor in the four therapeutic conditions dopa - off ( rho = 0.21 ; p = 0.51 ) , dopa - on ( rho = 0.34 ; p = 0.29 ) , off - dbs ( rho = 0.37 ; p = 0.24 ) , on - dbs ( rho = 0.10 ; p = 0.77 ) . also at fast ras , no significant correlations between pre - and post - stimulus beta - band itc values were observed neither in controls ( rho = 0.21 ; p = 0.51 ) , nor in the four therapeutic conditions dopa - off ( rho = 0.14 ; p = 0.67 ) , dopa - on ( rho = = 0.09 ; p = 0.78 ) , off - dbs ( rho = 0.37 ; p = 0.24 ) , and on - dbs ( rho = 0.36 ; p = 0.26 ) . from this correlation analysiswe can exclude carry over effects between pre - and post - event beta - band activities due to the temporal resolution of time frequency analysis and the temporal proximity of events . in such a case we would have expected significant positive correlations between pre - and post - stimulus beta activities , but this case was never observed . importantly , both the itc analysis and the absence of any correlation between pre - and post - stimulus beta - band itc values , suggest that the pre - stimulus beta - modulation in control persons was not phase - locked to the auditory stimuli , and thus the reported pre - stimulus differences are due to changes in intrinsically generated beta - band power . in this study , we have investigated the effects of dopaminergic medication and high - frequency stn - dbs on resting - state eeg - activity and on dynamics of eeg - responses to slow and fast ras with a specific focus on oscillatory activity in the beta frequency range . here , we provide the first evidence for deficient sensory processing of rhythmic auditory stimuli in patients with pd that is both tempo - dependent and sensitive to neuromodulatory treatment . first , chronic stn - dbs led to a reduction of cortical beta - band power in the resting - state , thus providing further support for a specific influence of stn - dbs on cortical beta activity . second , in response to ras beta - band power was consistently peaking shortly before stimulus onset in healthy subjects , which was never observed in pd patients . in the patients group the post - stimulus beta amplitude modulation was also highly abnormal . we could demonstrate that dopaminergic medication and stn - dbs restored a normalized beta modulation profile in patients during fast ras , possibly reflecting alleviations of parkinsonian symptoms with movement at faster rhythms . it is conceivable that surgery - related skull defects such as incompletely sealed burr holes may have resulted in a distorted spread of scalp eeg signals ( litvak et al . ,2011 ; oostenveld and oostendorp , 2002 ) . as discussed elsewhere in detail ( gulberti et al . , 2015 ) , in our study we did not observe topographical changes nor local enhancements of signal amplitude , which might be expected to emerge from skull defects . a further source of concern about perioperative eeg recordings may be related to the stun effect , a temporary post - operative amelioration of parkinsonism due to microlesions as a consequence of electrode implantation ( eusebio and brown , 2009 ) . stun effects are of rather short duration and typically disappear within 1 month after surgery ( jech et al . , post - operative updrs - iii scores in the off - dbs condition ( assessed 35 months following surgery in the dopa off state at time of recordings ) were not significantly different from baseline pre - operative updrs - iii scores ( respectively 4010 and 3412 ; [ t ( 9 ) = 1.66 ; p = 0.13 ] , paired t - test ) . in fact , the slightly increased updrs - score argues against residual effects of surgery - related microlesions . nevertheless , long - term carry - over effects of chronic high - frequency dbs may explain the lack of significant differences in the contrasts between the two post - operative conditions ( on versus off - dbs ) in the processing of slow and fast ras . switching off the stimulator for 30 min was probably not sufficient to reestablish the pre - operative pathological oscillation activity . indeed , at least 3 h off - dbs are required to estimate the whole clinical effect of stimulation ( temperli et al . , 2003 ) . the results of modulation effects of levodopa and dbs on the electrophysiological profile of pd patients could have been partially influenced by the standard procedure applied to test pd patients in the condition of levodopa withdrawal . for medical and ethical reasons , medication is usually suspended only during the night before the experimental recordings ( for ~ 12 h ) . but this period of time is probably too short to reach a genuine dopa - off state , since the clinical effects of dopamine agonists and dopamine degrading inhibitors , which are frequently combined with levodopa treatment , are lasting for several days ( ahlskog et al . , 1994 ; blin , 2003 ) . thus , long - term carry - over effects of anti - parkinsonian medication could not be completely excluded as a factor possibly influencing the electrophysiological profile of pd patients . given the temporal proximity of the events in the fast ras to the oscillatory responses , some pre - stimulus oscillatory activity could potentially be also represented in the post - stimulus activity and vice versa . the local maxima and minima ( i.e. , the peaks of the power activity ) are not shifted by the time frequency analysis methods . as evidenced in fig .3 a and e , in controls the pre post - event beta peaks are clearly separated by a local minima centered around the event , thus minimizing the probability of temporal smearing between these two separate components . moreover , in patients the pre - stimulus beta is absent and the peak of post - stimulus beta activity is occurring at about 80 ms after stimulus , thus temporally distinct from pre - stimulus activities . frequency settings , the significant differences between beta modulations in the different groups or conditions are still reliable , since equally influenced by the temporal resolution of time frequency analysis applied . in conclusion , from the results of the correlations between pre - and post - event mean values of beta - band activities we can exclude carry over effects between pre - and post - event beta - band activities . in such a casewe would have expected significant positive correlations between pre - and post - stimulus beta activities , but this case was never observed . we first addressed the question of possible effects of neuromodulatory interventions on resting - state oscillatory dynamics , particularly focusing on the beta - band . one principal finding was an enhancement of absolute power across a broad range of frequencies in patients with pd compared to healthy controls . this global increase of absolute power in pd patients is in agreement with previous reports ( moazami - goudarzi et al . , 2008 ; tanaka et al . , 2000 ) , which attributed this effect to a pathophysiological chain reaction initiated by the effects of dopamine denervation on bg - thalamo - cortical circuitries . in this concept , thalamo - cortical dysrhythmia ( tcd ) , characterized by a pathological increase of low - frequency oscillatory bursting in thalamo - cortical modules , leads to a pathological augmentation of low - and high - frequency activities in the eeg ( moazami - goudarzi et al . , the finding that theta - band power is increased in patients after dbs surgery is new . slowing of eeg activity in comparison to healthy subjects is a consistent finding in patients with pd ( soikkeli et al . , 1991 ; stoffers et al . , 2007 ) , and increased theta power has been associated with clinical measures of disease progression ( bosboom et al . , 2006 ; serizawa et al . , 2008 ; soikkeli et al . , 1991 ; stoffers et al . , 2007 ) and cognitive decline , respectively ( neufeld et al . , 1994 , 1988it can not be decided with certainty whether the observed theta increase after dbs surgery was related to progression of motor symptoms or reduced cognitive functions , as the latter were not specifically assessed in this study . however , it is of note that the mean patient 's postoperative updrs - iii motor performance off - dbs was only slightly worse compared to preoperative baseline recordings in dopa - off ( 4010 and 3412 , respectively ; [ t ( 9 ) = 1.66 ; p = 0.13 ] , paired t - test ) , thus making a general aggravation of motor symptoms improbable as a cause for the postoperative theta increase . it is conceivable that the drastic reduction of chronic , longer lasting antiparkinsonian medication following surgery ( ~ 40 % in this patient sample ) may have unmasked some low - frequency components in the spectral distribution , which were less prominent in the pre - operative recordings . importantly , compared to pre - operative baseline , stn - dbs also led to a marked reduction of beta - and gamma - power in both absolute and relative resting - state power spectra . there was no longer a statistical difference in absolute beta power between pd patients on - dbs and controls . furthermore , on - dbs was associated with a reduction of beta power compared to off - dbs . thus , stn - dbs had a strong influence on cortical high - frequency activities , particularly in the beta - band . in the context of the tcd framework , pathological elevations of coactivated neighboring thalamo - cortical modules at lower frequencies may result in aberrant high - frequency activity at cortical levels ( llins et al . dbs - induced modulation of inhibitory bg output to the thalamus may in turn reduce abnormal thalamo - cortical rhythmicity and normalize high frequency oscillatory power in cortical networks ( llins et al . motor coordination may depend upon temporally precise neuronal interactions across auditory and motor - related brain areas . a number of recent works have provided evidence for a specific role of beta - band modulation in motor timing ( fujioka et al . , 2012 ; iversen et al . , 2009 , beta - band activity can not be modulated as fast and efficiently as in the healthy brain ( doyle et al . , 2005 ; jenkinson and brown , 2011 ) . rhythmic auditory stimuli have recently been demonstrated to result in a periodic modulation of beta activity within the stn ( joundi et al . , 2013 ) . at a cortical level , rhythmic auditory stimuli ( presented in a passive listening task ) also activate motor - related neural networks ( fujioka et al . , 2012 ; grahn and brett , 2007 ; rao et al . , 2001 ) . fujioka and colleagues observed prominent beta amplitude modulations within supplementary motor area and inferior frontal gyrus during fast auditory pacing ( fujioka et al . , 2012 ) . given the intimate anatomical relationships of these two cortical areas with the stn ( aron and poldrack , 2006 ; haynes and haber , 2013 ; monakow et al . , 1978 ) , it is tempting to speculate that stn - dbs may specifically improve cortical beta - band modulation at faster stimulus rates via modulation of centrofrontal cortical activity . the beta increase that was found to precede stimulus onset in healthy subjects is consistent with the view of beta - band modulation playing an important role for timing functions . this distinct pre - stimulus component , peaking immediately before the expected stimulus onset , was absent in patients with pd , indicating a timekeeping abnormality for isochronous sounds . both the analysis of inter - trial coherence and the absence of any correlation between pre - and post - stimulus beta - band itc values suggest that the broadband response after the stimulus could be related to an auditory evoked response , while the pre - stimulus beta - modulation was not phase - locked to the auditory stimuli , and thus the reported pre - stimulus differences were due to changes in induced beta - band power . this observation is in line with the hypothesis that pre - stimulus beta - band activity could reflect an intrinsically generated neuronal modulation , which may serve predictive functions in rhythm - related tasks ( arnal and giraud , 2012 ; engel and fries , 2010 ; saleh et al . , 2010 ; teki , 2014 ) . while pre - stimulus abnormalities were seen for both slow and fast ras , the post - stimulus beta modulation profile of patients with pd was remarkably unimpaired during slow , but severely impaired during fast ras , especially when off medication . in controls , stimulus - driven beta amplitude modulation was temporally precise , irrespective of pacing frequency , starting only after stimulus presentation . during fast auditory pacing , the timing of this post - stimulus - beta amplitude modulation in patients without dopaminergic therapy became temporally sluggish and was shifted such that it started ramping already before stimulus onset . this may contribute to the loss of temporal alignment with external cues presented at high rates observed in pd patients . interestingly , an additional evoked component was observed in the theta frequency range , emerging around 0.2 s post stimulus during slow ras , and 0.1 s at fast ras . even if this component was not contained in the time window considered here for the peri - stimulus analysis , is intriguing to consider it as a pre - stimulus phase - reset for the next stimulus as described by giraud and poeppel ( 2012 ) and arnal and giraud ( 2012 ) . before dbs surgery , the stimulus - induced periodic modulations of broadband neural activity displayed excessively large oscillation amplitudes , reminiscent of exaggerated resonance or decreased suppression in response to repeating stimuli ( gulberti et al . , 2015 ) . such abnormal sensory monitoring may hamper the ability of pd patients to respond appropriately to rhythmic auditory input and partially underlie their performance deficits during fast auditory pacing . transferred into a clinical context , impaired entrainment of fast sensory rhythmscould also contribute to the patients ' difficulties to synchronize their motor activity with external cues displayed at high rates ( logigian et al . furthermore , defective sensory processing may partly underlie dysrhythmic motor deficits of pd patients , such as the so - called hastening phenomenon . instead of precisely synchronizing with rhythmic external cues , pd patients involuntarily accelerate their motion . in this condition , impaired sensory processing characterized by abnormally high oscillation amplitudes could trigger activity along motor - related cortex - bg loops , decoupling the patient 's motor output from higher order motor control areas and entraining it to a pathological motor rhythm which would then act to involuntarily pace motor actions ( freeman et al . , 1993 ; logigian et al . , 1991 ; nagasaki et al . , 1978 ) interestingly , a more physiological post - stimulus alignment of beta amplitude modulation was restored by levodopa and stn - dbs specifically for fast auditory pacing together with a normalization of the peak size , which was found to be pathologically extended in off medication recordings before dbs surgery . the observed tempo - dependence of sensitivity to neuromodulatory treatment suggests a specific role for distinct cortex - basal ganglia circuitries for rhythm - related processing during fast auditory pacing . if sensory entrainment has an influence on auditory motor coupling , it may thus be proposed that dopamine replacement therapy and stn - dbs may both improve performance of pd patients specifically under conditions of fast auditory pacing . in summary , our results provide evidence for disturbed timekeeping functions directly linked to altered beta - band activity in pd . in particular , we provide evidence for a rate - specific impairment of processing of fast auditory rhythms in pd patients that is both dopamine - dependent and sensitive to therapeutic modulation within cortex - basal ganglia networks . given the proposed role of beta oscillations for interrelated processes such as rhythm perception , interval timing and sensorimotor coordination , an abnormal reactivity of beta - band responses to auditory stimuli as in the present study may contribute to auditoryconversely , in light of the normalizing effects of levodopa and stn - dbs described here , it is tempting to suggest that both treatments may allow for a more dynamic configuration of sensorimotor networks in response to fast ras , possibly not only alleviating parkinsonian impairments of audio motor synchronization during fast auditory external pacing , but also affecting information processes relying on the extraction of predictable temporal cues in both auditory perception and rhythmic activities ( arnal and giraud , 2012 ; bartolo et al .\noutput:\n" }, { "from": "agent", "value": "cortex - basal ganglia circuits participate in motor timing and temporal perception , and are important for the dynamic configuration of sensorimotor networks in response to exogenous demands . in parkinson 's disease ( pd ) patients , rhythmic auditory stimulation ( ras ) induces motor performance benefits . hitherto , little is known concerning contributions of the basal ganglia to sensory facilitation and cortical responses to ras in pd . therefore , we conducted an eeg study in 12 pd patients before and after surgery for subthalamic nucleus deep brain stimulation ( stn - dbs ) and in 12 age - matched controls . here we investigated the effects of levodopa and stn - dbs on resting - state eeg and on the cortical - response profile to slow and fast ras in a passive - listening paradigm focusing on beta - band oscillations , which are important for auditory motor coupling . the beta - modulation profile to ras in healthy participants was characterized by local peaks preceding and following auditory stimuli . in pd patients ras failed to induce pre - stimulus beta increases . the absence of pre - stimulus beta - band modulation may contribute to impaired rhythm perception in pd . moreover , post - stimulus beta - band responses were highly abnormal during fast ras in pd patients . treatment with levodopa and stn - dbs reinstated a post - stimulus beta - modulation profile similar to controls , while stn - dbs reduced beta - band power in the resting - state . the treatment - sensitivity of beta oscillations suggests that stn - dbs may specifically improve timekeeping functions of cortical beta oscillations during fast auditory pacing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: dyslipidemia , characterized by elevated triglyceride ( tg ) , low levels of high - density lipoprotein cholesterol ( hdl - c ) , and the abundance of low - density lipoprotein cholesterol ( ldl - c ) particles , is quite common in patients with type 2 diabetes ( t2 dm ) . while higher levels of tg in both the fasting state and the nonfasting state are considered the dominant lipid abnormality in insulin resistance and play a pivotal role in determining the characteristic lipid profiles of diabetic dyslipidemia , the efforts to understand the pathogenesis of t2 dm are increasingly focusing on the disordered lipid metabolism . recent studies show that changes in lipid profiles may not merely be the consequences of impaired glucose metabolism but also be one of the risk factors accounting for it . it is known that both lipid and glucose are involved in energy metabolism and can be regulated by the liver , which plays a pivotal role in maintaining energy homeostasis during fed - fasting transitions . studies have shown that the liver can produce several secreted proteins such as fibroblast growth factor 21 ( fgf21 ) , 2 - hs - glycoprotein ( fetuin - a ) , and pancreatic - derived factor ( pander ) to help regulate hepatic and systemic glucose and lipid metabolism . in addition , the overproduction of hepatic and intestinal lipoprotein can trigger hypertriglyceridemia and increase the levels of free fatty acids which may induce insulin resistance through downregulating the intracellular glucose -6-phosphate levels . at the same time , the tight - knit partners of tg including long chain acyl - coenzyme a ( lccoas ) , diacylglycerol ( dag ) , and ceramides could also interfere with insulin action . thus , the liver may act as a middle coordinator that bridges the hypertriglyceridemia and insulin resistance . periostin , originally cloned from a mouse osteoblast cell line , is a highly conserved extracellular matrix protein and is implicated in the pathophysiology of tumor development , arthritis , atherosclerosis , and inflammatory diseases . recent studies also report a link between periostin and metabolic diseases via the jnk - mediated suppression of fatty acid oxidation in the liver . the abnormal expression of periostin in the liver is reported to be closely associated with glucose and lipid metabolic disorders and obesity in an obese mouse model . the fatty acid oxidation resulting from the dyslipidemia can upregulate the content of tg in the liver , while the hyperactivation of the jnk pathway contributes to the development of hepatic steatosis , obesity , and insulin resistance . the aim of the present study is to explore the relations among plasma periostin levels , glucose and lipid metabolic parameters , and inflammatory biomarkers in chinese obese and newly diagnosed t2 dm patients . a total of 161 volunteers were selected from outpatients at the first affiliated hospital of chongqing medical university ( chongqing , china ) between june 2014 and july 2015 . the 75 g oral glucose tolerance test ( ogtt ) was performed , and a standard questionnaire was administered . participants were classified into groups as having either normal glucose tolerance ( ngt ) or newly diagnosed t2 dm according to the diagnostic criteria of the world health organization in 1999 . obesity was defined as having a bmi ( body mass index ) 25 kg / m according to the who - western pacific region diagnostic criteria ( 2000 ) . none of the patients had received any treatment including diet , exercise , and medication before the present study . the eligible subjects were ultimately categorized into four subgroups for further analysis : the ngt - normal weight subgroup ( nw ) , the ngt - obese subgroup ( ob ) , the t2dm - nw subgroup , and the t2dm - ob subgroup . subjects were excluded from the study based on the following criteria : acute and chronic complications of diabetes ; smoking and drinking history ; hepatic disease ( nonalcoholic fatty liver disease , virus hepatitis , and autoimmune hepatitis ) or renal and cardiovascular disease ; history of tumor and fracture or sustained hypertension ; acute and chronic infectious diseases or allergic diseases , and those taking medications that could affect their inflammatory status within 3 months ; systemic corticosteroid treatment ; women who were currently pregnant , breastfeeding , or taking contraceptive pills.the present study was approved by the ethical committee of the first affiliated hospital of chongqing medical universityacute and chronic complications of diabetes ; smoking and drinking history ; hepatic disease ( nonalcoholic fatty liver disease , virus hepatitis , and autoimmune hepatitis ) or renal and cardiovascular disease ; history of tumor and fracture or sustained hypertension ; acute and chronic infectious diseases or allergic diseases , and those taking medications that could affect their inflammatory status within 3 months ; systemic corticosteroid treatment ; women who were currently pregnant , breastfeeding , or taking contraceptive pills . anthropometric parameters such as body weight , height , waist circumferences ( wc ) , hip circumferences ( hc ) , and blood pressure ( bp ) were measured in all subjects according to standard protocols . the waist - hip ratio ( whr ) was calculated as the ratio of the waist circumferences and hip circumferences . a fasting blood sample was collected after an overnight fast ( 8 hours ) , and another blood sample was collected after 2 hours as part of the ogtt . plasma samples were obtained from the blood samples by centrifugation at 4c and kept at 80c until use , and all the samples were analyzed within 3 months . glycated hemoglobin ( hba1c ) was determined using the method of high - performance liquid chromatography ( varianttm ii and d - 10 systems , bio - rad , usa ) . fasting insulin ( fins ) was measured using an autoanalyzer ( architect i2000sr system , abbott laboratories , il , usa ) . lipid profiles and liver and kidney functions were detected using a biochemical autoanalyzer ( architect c16000 system , abbott laboratories , il , usa ) . the homeostasis model assessment insulin resistance ( homa - ir ) was calculated as follows : homa - ir = fasting insulin level ( u / ml ) fasting plasma glucose level ( mmol / l ) / 22.5 . plasma periostin , tnf - , and il - 6 levels were determined by the enzyme - linked immunosorbent assays ( elisa ) according to the manufacturer 's instructions ( human elisa kit , wuhan uscn science co. , ltd . , the intra - assay coefficient of variation was 10 % , and the interassay coefficient of variation was 12 % . all statistical analyses were performed using spss version 19.0 ( ibm , armonk , ny ) . data were presented as the mean sd . variables with a skewed distribution including homa - ir and bmi were log - transformed before statistical analysis . student 's t - test and analysis of variance ( anova ) were used for group comparisons , while the interrelatedness of variables was analyzed using the pearson correlation coefficient . partial correlation analysis was performed after controlling for parameters including age , sex , and bmi . multiple regression analysis was also performed to determine the risk factors associated with the plasma periostin levels . the anthropometric and metabolic parameters in different subgroups are shown in table 1 . between the ngt group and the t2 dm group , there were no significant differences in age , systolic blood pressure ( sbp ) , height , weight , and bmi . compared with the ngt group , the t2 dm group had significantly higher levels of diastolic blood pressure ( dbp ) , wc , whr , total cholesterol ( tc ) , ldl - c , tg , fasting plasma glucose ( fpg ) , 2 h postchallenge plasma glucose ( 2 h pg ) , hba1c , fins , tnf - , il - 6 , and homa - ir , whereas the levels of hdl - c were significantly lower in the t2 dm group than in the ngt group ( p 0.05 or 0.01 ) . weight , wc , hc , bmi , and whr and the levels of fins , homa - ir , tg , il - 6 , and tnf - were significantly higher in the ngt - ob subgroup than in the ngt - nw subgroup , whereas the levels of hdl - c were significantly higher in the ngt - nw subgroup than in the ngt - ob subgroup ( p 0.05 or 0.01 ) . compared with the ngt - ob subgroup , the levels of dbp , fpg , 2 h pg , hba1c , fins , tc , il - 6 , and homa - ir were significantly higher in the t2dm - ob subgroup ( p 0.05 or 0.01 ) . compared with the t2dm - nw subgroup , the weight , wc , hc , whr , and bmi , as well as the levels of dbp , hba1c , fins , homa - ir , ldl - c , tg , and tnf - , were significantly higher in the t2dm - ob subgroup , whereas the hdl - c levels were significantly higher in the t2dm - nw subgroup than in the t2dm - ob subgroup ( p 0.05 or 0.01 ) . there were no significant differences in plasma periostin levels between men and women ( 24.783.90 ng / ml versus 25.713.61 ng / ml , p = 0.119 ) . compared with the ngt group , the t2 dm group had significantly higher plasma periostin levels ( 26.334.41 ng / ml versus 24.162.51 ng / ml , p 0.001 ; figure 1 ) . patients with both ob and t2 dm had the highest plasma periostin levels ( figure 2 ) . as shown in table 2 , correlation analysis showed positive associations between plasma periostin levels and parameters including wc , whr , bmi , tc , tg , fpg , 2 h pg , fins , homa - ir , il - 6 , and tnf - ( p 0.05 or 0.001 ) . the plasma periostin levels were negatively correlated with hdl - c levels ( p 0.001 ) . after controlling for age , sex , and bmi , the positive correlations between periostin levels and biomarkers including fpg , 2 h pg , tg , tc , fins , homa - ir , tnf - , and il - 6 and the negative correlation of plasma periostin levels with hdl - c still remained significant ( p 0.05 or 0.001 ) . stepwise multiple regression analysis showed that tg , tnf - , and homa - ir were independently related to plasma periostin levels ( all p 0.001 ) . periostin ( encoded by postn ) is a 90 kda secreted protein composed of a signal peptide and 4 fasciclin - 1 domains . its name is derived from the fact that it was first detected in periosteal osteocytes and osteoblasts . later studies found its widespread expression in tissues that are rich in collagen , such as heart valves , tendons , ligaments , and the cornea . recent studies in both animal and human models show that periostin is involved in the pathophysiology of metabolic diseases . in this study , we found that chinese patients with obesity and t2 dm have significantly higher plasma periostin levels than healthy subjects and that periostin is strongly associated with tg metabolism , chronic inflammation , and insulin resistance . in an obese mouse model , lu et al . found that the overexpression of periostin in the liver induced hepatic steatosis and hypertriglyceridemia via jnk pathway - involved downregulation of ppar , which predominantly regulates the fatty acid oxidation in mitochondria and peroxisomes , whereas genetic knockout of periostin or administration of a periostin - neutralizing antibody significantly improved these induced conditions . in our study , we found that patients with obesity had significantly higher levels of periostin . moreover , periostin levels were positively correlated with tg and tc and negatively correlated with hdl - c , and tg was an independent risk factor influencing plasma periostin levels , after controlling for age , sex , and bmi . these results in humans are in accord with the mouse study mentioned above , and a close relation may exist between periostin and lipid disorders , especially tg metabolism . the main components of metabolic syndrome are insulin resistance , central obesity , hyperglycemia , and dyslipidemia . because tg have emerged as the preferred storage nutrient for buffering against fluctuations in energy demand and availability , dysregulated tg accumulation is closely related to obesity and metabolic syndrome . thus , the underlying mechanism of periostin in the regulation of the metabolic pathway needs further exploration to clarify its clinical points against dyslipidemia , diabetes , and obesity . . found that maternal obesity before pregnancy can change the gene expression profiles in the umbilical cord , and postn has been shown to be one of the elevated genes that participates in the adverse metabolic effects caused by maternal obesity . in addition , bolton et al . used the signal sequence trap ( sst ) method in psammomys obesus to identify the expression of secreted proteins in various tissues between lean , normal glucose tolerance animals ( ngt group ) , overweight and impaired glucose tolerance animals ( igt group ) , and obese t2 dm animals ( t2 dm group ) . there was a progressive increase in periostin expression from the ngt to the t2 dm group , indicating that periostin was strongly correlated with obesity and t2 dm , but the respective effects of obesity and t2 dm on the expression levels of periostin remained unclear . our study was aimed at evaluating different amounts of body fat and glucose tolerance in patients using subgroup analysis . similarly , we observed that subjects in the ob and dm group had higher plasma periostin levels compared with the nw and ngt group , whereas the t2dm - ob subgroup had the highest levels of plasma periostin . in addition , periostin levels were positively correlated with the body fat parameters of bmi , wc , and whr . these data suggest that obesity and impaired glucose metabolism may have a cumulative effect on the plasma levels of periostin . insulin resistance has been recognized as the core feature of obesity and t2 dm , both of which are related to systemic inflammation . previous studies have shown that periostin is critical in regulating various inflammatory microenvironments such as airway inflammation , skin inflammation , atherosclerosis , and hepatic inflammation due to its effect on sustaining or amplifying the inflammatory responses in these pathological contexts . in accord with the previous study , we found that tnf - and il - 6 levels were higher in subjects with ob and t2 dm . further correlation analysis also showed a strong association between plasma periostin levels and tnf - and il - 6 . considering that periostin is well involved in liver tg metabolism , while inflammation is closely related to liver tg metabolism , obesity , and diabetes , we may speculate that the relations between periostin , inflammation , and metabolic disorders are quite strong . as confirmed by lu el al . , continuous glucose infusion via the jugular vein enhanced the expression of periostin in the liver of rats , whereas hepatic postn knockdown improved the fasting glucose levels and insulin sensitivity in db / db mice . a study conducted by amara et al . suggested that the mrna expression of periostin in hepg2 cells was increased nearly 4 times upon treating with tnf - , so it is hypothesized that the high glucose state and inflammatory cytokines may contribute to the regulation of periostin biosynthesis in target tissues and that periostin may in turn decrease the insulin sensitivity . these conclusions are consistent with our study that we found a positive correlation between plasma periostin levels and variables including levels of fpg , 2 h pg , homa - ir , tnf - , and il - 6 . moreover , further adjustment for body fat parameters slightly reduced the positive correlations among periostin , homa - ir , and inflammatory factors . therefore , we speculate that obesity may involve this positive regulatory effect , and further studies are needed to clarify internal connections among periostin , homa - ir , and inflammation . second , our study is cross - sectional , and thus the causality between plasma periostin levels and metabolic parameters can not be explained . in conclusion , the present study found that plasma periostin levels were significantly higher in t2 dm and obese subjects and were strongly associated with tg metabolism , chronic inflammation , and insulin resistance . periostin may act as a scaffold and remodeling protein in inflammatory responses , obesity , and insulin resistance , which may provide new molecular clues for the pathogenesis of t2 dm and obesity .\noutput:\n" }, { "from": "agent", "value": "the purpose of this study is to examine the relations among plasma periostin , glucose and lipid metabolism , insulin resistance and inflammation in chinese patients with obesity ( ob ) , and type 2 diabetes mellitus ( t2 dm ) . plasma periostin levels in the t2 dm group were significantly higher than the ngt group ( p < 0.01 ) . patients with both ob and t2 dm had the highest periostin levels . correlation analysis showed that plasma periostin levels were positively correlated with weight , waist circumference ( wc ) , body mass index ( bmi ) , waist - hip ratio ( whr ) , fasting plasma glucose ( fpg ) , 2 h postchallenge plasma glucose ( 2 h pg ) , glycated hemoglobin ( hba1c ) , triglyceride ( tg ) , total cholesterol ( tc ) , fasting insulin ( fins ) , homeostasis model assessment of insulin resistance ( homa - ir ) , tnf - , and il - 6 ( p < 0.05 or 0.001 ) and negatively correlated with high - density lipoprotein cholesterol ( hdl - c ) ( p < 0.001 ) . multiple linear regression analysis showed that tg , tnf - , and homa - ir were independent related factors in influencing the levels of plasma periostin ( p < 0.001 ) . these results suggested that chinese patients with obesity and t2 dm had significantly higher plasma periostin levels . plasma periostin levels were strongly associated with plasma tg , chronic inflammation , and insulin resistance ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: inhalation injury is a common occupational hazard and may be because of smoke or chemical substances ( fumes ) . chemical inhalation is sometimes cause of severe respiratory distress and may even lead to acute respiratory distress syndrome ( ards ) . phosgene ( carbonyl chloride ; chemical formula cocl2 ) has been widely used as a chemical warfare agent in the past , particularly in world war . its exposure can occurs to the persons working in the manufacturing industries of aniline dyes , polycarbonate resins , coal tar , pesticides , isocyanides , polyurethane , and pharmaceuticals . phosgene inhalation poses significant risk to workers who may be accidently exposed and may be life threatening ; as is illustrated by the following case report . a 25 year old nonsmoker and non alcohalic male laborer suffered inhalation injury to phosgene gas after accidental leakage while working in a pesticide manufacturing factory . immediately after exposure he experienced lacrimation , nausea , and dry cough with burning sensation in his mouth and throat . the patient did not complain of chest pain , hemoptysis orthopnoea or paroxysmal nocturnal dyspnoea . however within 24 hrs his condition worsened and he developed severe respiratory distress thus he was referred to our hospital , a tertiary care referral center for respiratory and intensive care . at the time of admission he was conscious and oriented to time place and person . he was febrile having temperature of 100 f , tachycardia of 130 / min and tachyopnea of 36 / min . using accessory muscle of respiration . his x - ray chest was suggestive of bilateral hilar fluffy shadow characteristic batwing appearance [ figure 1 ] . antibiotic therapy in the form of third generation cephalosporin was started prophylacticaly along with supportive therapy . his endotracheal aspirate culture was sent immediately after intubation and after 48 hours of ventilatory support . he gradually improved with treatment and was successfully weaned off from ventilator on 6 day of icu stay . he was shifted to general ward on 8 day and was discharged from the hospital on 10 day . this patient presented to us as case of inhalation injury after accidental leakage of irritant gas from pesticide factory . we could identify the toxic gas as phosgene only after consultation with the pesticide factory management . phosgene is a chemical irritant , and with the advent of new technology , uses of better protective measure and discovery of newer agents its use being stopped as war gas . now a day 's phosgene exposure can occurs during the manufacture of aniline dyes , polycarbonate resins , coal tar , pesticides , isocyanides , polyurethane and pharmaceuticals . few case reports of occupational phosgene exposure in workers of these industries have been seen . an inhalation of more than 3 ppm concentration of the gas is considered highly toxic . respiratory symptoms may be delayed by a latent period of several hours as is seen in our patient . symptom may range from mild irritation of upper airways and dry cough to adult respiratory distress syndrome depending upon the concentration and duration of exposure . diagnosis of phosgene exposure may be straight forward in workers presenting from such industrial plants where there is a recognized risk . in other situations , a high index of suspicion is required . suspicion should be aroused in presence of characteristic history of a peculiar musty smelling gas . however there is no specific reliable diagnostic test for the confirmation and despite several studies , no parameters in the latent period allow an accurate assessment of the degree of exposure . the pathogenesis of phosgene poisoning is not clearly understood as no human studies are available . only animal studies have given some overview of the pathogenesis and histological changes occurring after the exposure . these studies have shown that within an hour of the exposure pulmonary edema , inflammatory and interstitial changes takes place in the terminal bronchial areas . early changes are characterized by the leakage of the edema fluid , fibrin and erythrocyte from the pulmonary vasculature into the alveolar space and interstitial tissue . the organization of the fibrin and epithelial regeneration starts , characterized by decrease in the edema fluid and inflammatory cells showing transition from pulmonary injury to the repair . any patient with a history and symptoms that suggest the possibility of phosgene exposure should be kept under observation for at least 24 hrs all severe cases benefit from close monitoring and oxygen therapy if oxygen saturation is below 90 % . role of corticosteroid both in nebulised as well as injectable form has been studied in various animal models and human cases . few studies were conducted with use of n - acetyl cystiene , aminophylline , ibuprofen , pentoxyphylline and isoproterenol in animal models . they have shown that these agent are helpful in decreasing the development of pulmonary edema and inflammatory cascade but , human experiment are lacking . our patient did not received either corticosteroid or any of these agents . though role of antibiotics in treatment is not understood and raised leukocyte count may be simple protective response of the bone marrow to the insult . however it took him around 45 days to recover to normal . the complete recovery after phosgene exposuremay take a long time , and most patients continue to complain of exertional dyspnoea for several months after exposure .\noutput:\n" }, { "from": "agent", "value": "irritant gas exposure may lead to significant respiratory distress as is seen in the present case of 25 year old male worker who suffered accidental phosgene inhalation . he remained asymptomatic for six hours but later landed up in acute respiratory distress syndrome in the hospital and required ventilatory support . no investigative feature is diagnostic of the nature of irritant gas . similarly there is no antidote available to the phosgene . only timely administered supportive management may lead to successful outcome ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we and others have shown that it is possible to transfer phenotypes via microbial transplantation in antibiotic - treated animals , superseding the need for gf recipients in these types of studies , though potential problems with reproducibility and concerns of spreading antibiotic resistance genes should be acknowledged . nevertheless , gf animals still seem to be the best controlled model systems for microbial transplantation and thus , given the lack of reliable phenotype transfers , the antibiotic - treated models can not be regarded to serve as good models for discovering novel roles of gut microbiota in disease states where gut microbiota has not previously been implicated . the antibiotic - treated recipients should rather be considered when studying phenotype transfers in conditions already known to be associated with alterations in gut microbiota , such as obesity ( table 1 ) . when it is necessary to use gf animals , an approach where gf parents receive the microbial transplant and the subsequent offspring generations are used as study subjects is advisable to overcome the problems associated with an early gf life . when antibiotic treatment is used as an alternative to the gf state , e.g. , because of limited access to certain gf mouse and rat strains , it should thoroughly be evaluated if the approach is truly applicable in the given situation . with this addendum , we identify a need for systematic experiments investigating the stability of microbial transplantations by addressing 1 ) the recipient status as either gf , antibiotic - treated or spf , and 2 ) different levels of protected housing systems . in addition , the developmental effect on host functions , in particular the immune system should be evaluated in the different recipient types . different research aims within translational microbiome research and the recommended use of either antibiotic - treated or germ - free rodent hosts for the purpose . status of hostresearch aimantibiotic - treatedgerm - freeinvestigate microbial phenotype transfer of manifestations known to be microbiota dependentxxinvestigate microbial phenotype transfer of manifestations not known to be microbiota dependent xinvestigate effect of disrupting the microbiome in certain life stages of the hostx investigate effect of targeting certain groups of bacteriax investigate effect of monocolonization xinvestigate effect of colonization with a few , defined organisms x applicability of antibiotic - treated or germ - free rodents . different research aims within translational microbiome research and the recommended use of either antibiotic - treated or germ - free rodent hosts for the purpose . randi lundberg is partly funded by innovation fund denmark and collaborates with the strategic research center 3 g ( gut , grain & greens ) .\noutput:\n" }, { "from": "agent", "value": "abstractwe recently investigated the applicability of antibiotic - treated recipient mice for transfer of different gut microbiota profiles . with this addendum we elaborate on perspectives and limitations of using antibiotics as an alternative to germ - free ( gf ) technology in microbial transplantation studies , and we speculate on the housing effect . it is possible to transfer host phenotypes via fecal transplantation to antibiotic - treated animals , but problems with reproducibility , baseline values , and antibiotic resistance genes should be considered . gf animals maintained in isolators still seem to be the best controlled models for long - term microbial transplantation , but antibiotic - treated recipients are also commonly utilized . we identify a need for systematic experiments investigating the stability of microbial transplantations by addressing 1 ) the recipient status as either gf , antibiotic - treated or specific pathogen free and 2 ) different levels of protected housing systems . in addition , the developmental effect of microbes on host physiological functions should be evaluated in the different scenarios ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 35 - year - old patient , a former amateur football player , was referred to us due to episodes of incapacitating instability of the right - knee , both at work and leisure . ten years previously , he had suffered a femoral shaft fracture that was treated by intramedullary nailing , followed by removal of the nail 2 years later . clinical examination and magnetic resonance imaging confirmed an old rupture of the acl and a tear in the posterior horn of the medial meniscus . the thigh was held in a clamp , with a pneumatic tourniquet ( pressure , 250 mmhg ) at the top of the leg . the arthroscopy pump used was the fms duo + model ( depuy mitek inc . , raynham , ma , usa ) which controls flow and pressure independently . the irrigation fluid used was a lactated ringer 's isotonic solution with maximum pressure set to 100 mmhg . first the tibial tunnel ( diameter 10 mm ) was drilled with an outside - in guide set at 50 . secondly the outside - in femoral tunnel was drilled ( diameter 9 mm ) . a curet and a shaver were used to facilitate passage of graft into the tunnels . when the graft was passed through the femoral tunnel , one of the bone part broke . the graft was pulled back though but was lacerated and no longer usable , the broken bone part was not big enough to provide a good fixation . the hamstring tendons were not found during surgery because their dissection was compromised by the extravasation . as the patient had not been informed that a graft might be taken from the quadriceps tendon or from the other leg , the operation was abandoned after 105 minutes tourniquet time and around 15 liters of irrigation fluid . after removal of the drapes and tourniquet , swelling of the thigh , right iliac fossa , perineum and scrotum was noted ( fig .1 ) . there was no compartment syndrome and pulses ( posterior tibial and dorsal pedis arteries ) were all normal . the diagnosis of irrigation fluid extravasation was immediately confirmed by an abdominal and pelvic ultrasound , which showed an effusion of the subperitoneal space and scrotum ( fig . immediately after the surgery , we realized that the arthroscopy pump reservoir that would be normally half - filled was filled to maximum capacity ( fig .3 ) ; the pressure values during the operation were much higher than those displayed . a urinary catheter was inserted to monitor diuresis , and the patient was treated with loop diuretics ( furosemide ) for 5 days . during the first two days , the furosemide dosage was 40 mg twice a day ; during the last 3 days , the dosage was 40 mg a day . five months after this incident , we completed an acl reconstruction using the quadriceps tendon , using the tunnels from the first surgery . prior to doing this , we performed a computerized tomography scan to analyze the bone stock , which showed the proximity of the previous intramedullary nail position to the femoral tunnel ( fig .4 ) . at the last recall the patient presented with a stable and pain - free knee . the primary risk factors for extravasation of irrigation fluid into the thigh or calf after a knee arthroscopy are prolonged operation time , excessive intra - articular pressure and capsular tears5 ,6 ) . extravasation occurs most frequently below the knee , with a risk of compartment syndrome7 ,8 ) . bomberg et al. 2 ) reported 3 cases out of 283 arthroscopies . in these cases , the pressure delivered by the arthroscopy pump was 30 mmhg and the tourniquet was never inflated . in 2 of these cases , they reported capsular tears that allowed fluid to escape . romero et al. 3 ) reported a case of fluid extravasation above the knee with intraperitoneal accumulation of fluid after an arthroscopic meniscectomy . , there was a leak of fluid from the capsule with diffusion of the liquid either along the femoral artery where it is in contact with the vastus intermedius , or along the semimembranosus when the tourniquet was not inflated2 ,3 ) . the fall in pressure caused by the leakage was compensated by the arthroscopy pump , which had to deliver a larger volume of fluid in order to maintain sufficient pressure . pressure sensors protect from intra - articular hypertension9 ) but if the level of liquid in the sensor exceeds the operating limit as in the case presented here ( fig .3 ) or in the event of a fault in the sensor itself , the pressure in the knee is no longer controlled and becomes too high . in a cadaver study , noyes and spievack4 ) showed that a rupture of the suprapatellar pouch occurs when the pressures exceeds 200 mmhg and the knee is flexed to 90 . even in the absence of an obvious capsular breach , other warning signs should be heeded , in particular if the volume of irrigation fluid is too high and exceeds 15 liters10 ) . in cases of prolonged surgery , therefore , a regular note should be taken into the inflows and outflows , so that any fluid leakage during the operation can be identified . likewise , regular palpation of the compartments should be carried out due to the seriousness of compartment syndrome in the leg . finally , the right choice of equipment , correct use of the arthroscopy pump and regular maintenance of the pressure sensors should prevent this type of complication9 ) . concerning the treatment of this complication , the most important think is a careful observation of the patient to search signs of a compartmental syndrome . without signs of compartmental syndrome , , we believe the over - filled reservoir led to a dysfunction of the pressure sensor which caused the extravasation . for usthe lack of pressure control is the predisposing factor to this kind of complication . concerning the diffusion of the fluid , we believe that two explanations are possible .1 ) fluid escaped along the femur , despite the presence of a pneumatic tourniquet , due to the narrow space between the femoral tunnel drilled for the ligament reconstruction and the empty medullary channel ( from previous intramedullary nailing ) ( fig . the fluid rose into the intramedullary cavity as far as the trochanteric region before diffusing into the thigh and pelvis .2 ) due to the outside - in femoral technique tunnel , the fluid could spread into the soft tissue along the femoral artery ( like in romero et al . the pneumatic tourniquet was not efficient enough ( considering the high pressure of the irrigation fluid ) to stop the phenomenon . it is more disturbing than dangerous , as it has always healed without sequelae , in our case as well as those described in the literature2 ,3 ) due to the large capacity of the thigh and pelvis . this type of complication can be prevented by the use of an arthroscopy pump with a pressure sensor , regular testing of pressure sensors , and a record of inflows and outflows during long procedures .\noutput:\n" }, { "from": "agent", "value": "extra - articular extravasation of irrigation fluid is relatively common around entry incisions and is usually limited to the subcutaneous tissue . very rarely , extravasation occurs above the knee , in the thigh and even up into the pelvis . we are reporting the second case of irrigation fluid extravasation during a knee arthroscopy , which spread up to the thigh , groin and perineum during anterior cruciate ligament reconstruction , whilst the tourniquet was inflated . in our case , we think that the extravasation was caused by a fault in the pressure sensor due to the fact that the reservoir was over - filled . the irrigation pressure was therefore too high , and the irrigation fluid was able to diffuse , despite the presence of a pneumatic tourniquet , up past the thigh ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: according to textbooks and most of literature in most cases the starting point of the embolus is phlebothrombosis or thrombophlebitis of veins of lower extremities ( 1 - 5 ) . even in cases of diseased heart emboli departureis more often from the lower limbs , than from the heart chambers ( 1 ) . a blockage of the pulmonary artery or one of its branches may occur on site ( in situ ) because of the damage of the wall of the pulmonary artery or its branches - some with no emboli passed by blood ( 1 - 3 ) . there is also a perception that there exists one general disorder of coagulation e.g. thromboplastin activity where thrombi are formed all around the body , even in the pulmonary artery ( 1 ) . pulmonary embolism is very common nowadays , and favoring factors for its occurrence are the chronic diseases and therefore a long lying ( bed rest ) , which leads to the development of phlebothrombosis and a large number of different surgical operations ( 1 - 6 ) . phlebothrombosis and thrombophlebitis of lower extremities veinsphlebothrombosis of pelvic and abdominal veins usually after surgerythrombophlebitis and phlebothrombosis of veins of lower extremities after trauma and various surgical operationsintracardiac thrombosis of the right cardiac ventriclethrombosis of the pulmonary artery or some of its branches in situthere are other , less common types of emboli : e.g. tissue cells , fat , oil , gas embolism and the like ( 1 ) phlebothrombosis and thrombophlebitis of lower extremities veins phlebothrombosis of pelvic and abdominal veins usually after surgery thrombophlebitis and phlebothrombosis of veins of lower extremities after trauma and various surgical operations intracardiac thrombosis of the right cardiac ventricle thrombosis of the pulmonary artery or some of its branches in situ there are other , less common types of emboli : e.g. tissue cells , fat , oil , gas embolism and the like ( 1 ) factors dependent on the patient : age over 40 yearsobesityimmobilization / bed rest / - lying in bed for longer than 4 daysdeep vein thrombosis or pulmonary embolism in historythrombophilia , deficiency of antithrombin ( at ) iii factor , protein c , protein s ; lupus anticoagulant , resistance to activated protein c , hemocistinemija ( 2,4,5 ) immobilization / bed rest / - lying in bed for longer than 4 days deep vein thrombosis or pulmonary embolism in history thrombophilia , deficiency of antithrombin ( at ) iii factor , protein c , protein s ; lupus anticoagulant , resistance to activated protein c , hemocistinemija ( 2,4,5 ) factors dependent on the type of illness or surgery trauma or surgery : especially the pelvis , hip , legmalignant processes - particularly in the pelvis , abdomen , primary or metastaticheart failurerecent myocardial infarctionhormonal therapy ( estrogen , progesterone ) using the contraceptive pillsparaplegiasevere infectionintestinal inflammationspolycythemiaparaproteinemiabehcet s diseaseparoxysmal nocturnal haemoglobinuria ( 2,4,6 ) trauma or surgery : especially the pelvis , hip , leg malignant processes - particularly in the pelvis , abdomen , primary or metastatic recent myocardial infarction hormonal therapy ( estrogen , progesterone ) using the contraceptive pills intestinal inflammations paroxysmal nocturnal haemoglobinuria ( 2,4,6 ) it is not always easy to make a diagnosis or suspect of acute pte because it occurs suddenly , the clinical picture is developing rapidly and quickly withdraw , and often has rapid fatal ending ( in patients with massive embolism ) . the disease occurs suddenly , often in previously perfectly healthy people ( 1 - 6 ) . phlebothrombosis and thrombophlebitis of lower extremities veinsphlebothrombosis of pelvic and abdominal veins usually after surgerythrombophlebitis and phlebothrombosis of veins of lower extremities after trauma and various surgical operationsintracardiac thrombosis of the right cardiac ventriclethrombosis of the pulmonary artery or some of its branches in situthere are other , less common types of emboli : e.g. tissue cells , fat , oil , gas embolism and the like ( 1 ) phlebothrombosis and thrombophlebitis of lower extremities veins phlebothrombosis of pelvic and abdominal veins usually after surgery thrombophlebitis and phlebothrombosis of veins of lower extremities after trauma and various surgical operations intracardiac thrombosis of the right cardiac ventricle thrombosis of the pulmonary artery or some of its branches in situ there are other , less common types of emboli : e.g. tissue cells , fat , oil , gas embolism and the like ( 1 ) factors dependent on the patient : age over 40 yearsobesityimmobilization / bed rest / - lying in bed for longer than 4 daysdeep vein thrombosis or pulmonary embolism in historythrombophilia , deficiency of antithrombin ( at ) iii factor , protein c , protein s ; lupus anticoagulant , resistance to activated protein c , hemocistinemija ( 2,4,5 ) immobilization / bed rest / - lying in bed for longer than 4 days deep vein thrombosis or pulmonary embolism in history thrombophilia , deficiency of antithrombin ( at ) iii factor , protein c , protein s ; lupus anticoagulant , resistance to activated protein c , hemocistinemija ( 2,4,5 ) factors dependent on the type of illness or surgery trauma or surgery : especially the pelvis , hip , legmalignant processes - particularly in the pelvis , abdomen , primary or metastaticheart failurerecent myocardial infarctionhormonal therapy ( estrogen , progesterone ) using the contraceptive pillsparaplegiasevere infectionintestinal inflammationspolycythemiaparaproteinemiabehcet s diseaseparoxysmal nocturnal haemoglobinuria ( 2,4,6 ) trauma or surgery : especially the pelvis , hip , leg malignant processes - particularly in the pelvis , abdomen , primary or metastatic recent myocardial infarction hormonal therapy ( estrogen , progesterone ) using the contraceptive pills intestinal inflammations paroxysmal nocturnal haemoglobinuria ( 2,4,6 ) it is not always easy to make a diagnosis or suspect of acute pte because it occurs suddenly , the clinical picture is developing rapidly and quickly withdraw , and often has rapid fatal ending ( in patients with massive embolism ) . the disease occurs suddenly , often in previously perfectly healthy people ( 1 - 6 ) . objective of this study is to determine the most common risk factors and etiologic factors of pulmonary tromboembolism in patients treated in the intensive care unit of clinic for pulmonary diseases and tuberculosis podhrastoviin three - year - period from 2008 . to 2010 . we analyzed retrospectively patients who were treated in the intensive care unit of clinic for pulmonary diseases and tb podhrastovi in sarajevo due to pulmonary thromboembolism during the three - year period : since 2008 . to 2010 . pulmonary thromboembolism was proven by high resolute computed tomography ( ct ) of thoracic organs and at the majority of patients diagnosis was confirmed by ventilation / perfusion scintigraphy ( v / p spect ) and with the appropriate laboratory tests ( d - dimmers , platelets , fibrinogen , and in selected patients protein c , protein s and at iii factor was determined ) . in all patients echo ( ultrasound preview of the abdomen and pelvis ) was done and all patients were examined by angiologist , and when there was indication color - doppler of lower extremities veins was made . in all patients we searched for risk and etiologic factors of pte , and we analyzed how many patients had risk factors for pte , how many had clear etiology of pte , and how many patients had been proven to have associated risk factors and etiologic factors of pte . results are presented in table 1 , 2 , 3 and 4 ( as a risk factor we did not use age over 40 years ) and graph 1 , 2 . detected risk factors in 10 male patients : 2 operations , 3 long bed - rest ( 2 because of brain stroke , and 1 because of kidney failure ,1 trauma ( bone leg fracture ) , 1 malign disease , 2 heart failure and 1 paraplegia . etiologic factors ( phlebothrombosis or thrombophlebitis of lower extremities ) were detected in 4 patients - in 1 of them associated with malign disease . detected risk factors in 19 female patients : 6 operations , 4 heart failures , 3 traumas ( leg fracture ) , 1myocardial infarct ( mi ) , 1 brain stroke , 1 malign disease , 1 thrombophilia , 1 relapse , 1 long bed - rest ( kidney failure ) . etiologic factors ( phlebothrombosis or thrombophlebitis of lower extremities ) were detected in 5 of them : 2 associated with operation , 1 with recidivated pte , 1 with trauma , 1 with thrombophilia . ( 4 patients had history of deep phlebothrombosis , but now there was no evidence about relapse ) . detected risk factors in 29 male patients : 9 operations , 4 myocardial infarcts ,3 brain strokes , 3 heart failures , 3 malign diseases ; 2 long bed rests ( 1 hemiplegia , 1 comma posttraumatic ) , 1 trauma fracture of leg bone , 1 thrombophilia , 1 obesity , 1 severe infection , 1 associated brain stroke and myocardial infarct . etiologic factors ( phlebothrombosis or thrombophlebitis of lower extremities ) were detected in 6 patients and in 4 of them associated with : operation , trauma , comma and heart failure , but in two of them we did not detected risk factors . detected risk factors in 22 female patients : 10 operations , 5 heart failures , 2 long bed - rest ( because neurological disease ) , 1 brain stroke , 1 obesity , 1 trauma - leg bone fracture , 1 malign disease , 1 delivery ( birth child ) . etiologic factors ( phlebothrombosis or thrombophlebitis of lower extremities ) were detected in 4 patients - all associated with surgical operation . detected risk factors in 17 male patients : 5 operations , 4 associated heart failures with brain stroke , 2 myocardial infarcts , 2 heart failures , 1valvular heart defect , 2 traumasleg bone fracture , 1 long bed - rest because of general arteriosclerosis . etiologic factors ( phlebothrombosis or thrombophlebitis of lower extremities ) were detected in 6 patients : in one of them associated with operation , in one with long bed rest , in 4 of them we did not detected risk factors . detected risk factors in 27 female patients : 14 operations , 3 associated brain stroke and heart failure , 2 heart failures , 2 long bed rest ( 1 because of general arteriosclerosis and 1 for kidney failure ) , 1 myocardial infarct , 1 malign disease with operation , 1 trauma - leg bone fracture , 1 relapse of pte ,1 delivery - birth child , 1 using contraceptive pills . etiologic factors ( phlebothrombosis or thrombophlebitis of lower extremities ) were detected in 2 patients ; one associated with operation and one with long bed rest - general arteriosclerosis . for years 2008 . and 2009 . chi - square test did not show significant dependency in risk factors of pte between males and females for years 2008 . chi - square test showed significant dependency in risk factors of pte between males and females , c2 ( 1 , n = 80 ) = 0.393 p = 0.001 . chi - square test did not show significant dependency in etiological factors of pte between males and females for observed years . this table shows detected risk and etiologic factors in all patients ( male and female treated in three - year - period ) . pulmonary embolism is very common nowadays , and favoring factor for its occurence are the chronic diseases and therefore a long lying in bed , which leads to the development of phlebothrombosis and a large number of different surgical operations ( 1 - 6 ) . in textbooks and most of literature it is still saying that in most cases the starting point of the embolus in pte is phlebothrombosis or thrombophlebitis of veins of lower extremities ( 1 - 6 ) . working in a practice with a large number of patients with exactly diagnosed pte by appropriate diagnostic procedures we noticed that in most our patients we were not be able to determine the risk factor or etiologic factor for the development of pte so we decided to analyze that cases again retrospectively . in this studywe have attempted to determine by a retrospective analysis the most common risk factors and causes - etiologic factors of pte in patients treated in the intensive care unit of the clinic for pulmonary diseases and tb podhrastovi in sarajevo during the three - year - period from 2008. - 2010 . in 222 patientstreated of pte risk factors for pte were detected in 124 or 55.86 % of patients , causes - etiologic factors of pte were detected in 31 patients or 13.96 % , and both risk factors and etiologic factors of pte in one patient were detected in 18 or 8.11 % patients . we can conclude that in our patients the most common risk factors were surgical operations , traumas - first of all fractures of leg bones , heart failure nearly always with cardiac arrhythmias , recent myocardial infarct , brain stroke , long bed rest , and most common etiologic factors were phlebothrombosis or thrombophlebitis of lower extremities ) , but in most of our patients with exactly diagnosed pte we were not be able to find out neither the risk factor nor the etiologic factor of pte . pulmonary thromboembolism is the most striking and characteristic appearance of thromboembolic disease . in clinical practiceit is not always easy to make a diagnosis or even suspect to acute pte because it occurs suddenly , the clinical picture develops rapidly and quickly withdraw , and often has rapid fatal ending ( in patients with massive embolism ) . pte is very serious disease that very often has fatal prognosis , and can develop with previously entirely healthy people , we are often not able to detect risk and etiologic factors of pte , and because of that as soon as we become suspicious of its presence we have to made appropriate diagnostic procedures and include appropriate therapy . we can after , during the clinical treatment of patient , look for risk and etiologic factors and try to influence them .\noutput:\n" }, { "from": "agent", "value": "introduction : pulmonary thromboembolism ( pte ) is the most serious manifestation of thromboembolic disease.objective : to determine the most common risk and etiologic factors of pulmonary tromboembolism in patients treated in intensive care unit of clinic for pulmonary diseases and tb podhrastovi in three - year - period from 2008 . to 2010 . material and methods : we retrospectively analysed patients with pte treated in intensive care unit of clinic for pulmonary diseases and tb podhrastovi in three - year period from 2008 . to 2010 . pte was diagnosed by high resolute computed tomography , in most of them ventilatory / perfusion scintigraphy ( v / p spect ) was made , with proper laboratory analyses ( d - dimmer , platelets , fibrinogen , and if it was needed protein c , s and at iii factor were examined ) . in all of them echosonography of abdomen and pelvis was done , also the examination by angiologist , and in patients with indications echosonography of the heart and color doppler of leg veins was made . we analysed risk and etiologic factors for pte in each patient.results : in 222 treated patients with pte risk factors were found in 124 or 55.86 % patients , etiologic factors were found in 31 or 13.96 % , and both risk and etiologic factors in one patient were found in 18 or 8.11 % patients.conclusion : pte is very serious disease that very often has fatal prognosis , and can develop with previously entirely healthy people , and as soon as we become suspicious of its presence we have to made appropriate diagnostic procedures and include appropriate therapy . we can after look for risk and etiologic factors and try to influence them ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the united states department of agriculture ( usda ) and the department of health and human services ( dhhs ) jointly issue the dietary guidelines for americans every 5 years . based on these guidelines , initiatives like mypyramid and more recently , myplate , were developed to remind individuals to make healthy food choices and to be physically active . fruits ( 1.5 cups / day ) , vegetables ( 2.5 cups / day ) , whole grains ( 6 ounces / day ) , low - fat dairy ( 3 cups / day ) , and lean meats ( 5 ounces / day ) comprise the list of usda recommended food groups . consumption of dietary patterns consistent with the recommended food groups has been associated with a lower incidence of cancer , heart disease , and an overall reduction in mortality . despite the potential benefits , adherence to recommended dietary guidelinesis extremely low . nationally , 8090 % of individuals fail to consume the recommended amount for each food group . a potential contributor to individuals failing to meet dietary guidelines is psychological stress defined as the extent to which an individual perceives that his or her demands exceed the individual 's ability to cope . stress has been linked to eating behavior in previous research . in a 2005 study of triethnic , low - income women , stress , along with several other psychosocial factors , was associated with a less healthful diet . black women , in particular , report high levels of psychological stress even after controlling for socioeconomic factors and experience excess morbidity and mortality related to many diseases with diet - related risk factors such as obesity , hypertension , type 2 diabetes , and some cancers compared to white women . when considering black women living in the deep south , these health disparities are even greater . black women living in the deep south have a higher prevalence of obesity , cancer , stroke , and hypertension than black women living in other parts of the country . while there is some data available regarding the dietary patterns of blacks , it is limited in nature for blacks living in the deep south , a region where dietary practices may still be largely influenced by historical ( e.g. , slavery ) and sociocultural ( e.g. , family traditions , economic conditions , and cultural norms ) factors unique to the region . to our knowledge , there are no published studies that have examined whether stress may influence adherence to the dietary guidelines for americans food group recommendations among black women living in the deep south . the purpose of this study was to examine the relationship between perceived stress and adherence to food group recommendations among these black women . secondary outcomes included primary macronutrient ( e.g. , total fat , carbohydrate , and protein ) and energy intake . we hypothesized that higher perceived stress would be negatively associated with meeting dietary guidelines and overall healthy eating habits . participants were recruited through an ongoing academic - community partnership between academic researchers and community partners in 20 counties across alabama and mississippi . within each county , black women who were at least 20 years of age were recruited from april 2011 through august 2011 by a local paid staff person who lived either in or near the county of interest . potential participants were recruited by local staff through word of mouth , social networks , and / or community institutions ( e.g. , churches , health departments , and schools / educational programs ) . all study - related protocols and questionnaires received approval from the university of alabama at birmingham ( uab ) institutional review board ( irb ) for human subjects . the data collection schedule is illustrated in figure 1 . participants completed all self - assessment surveys , height and weight measurements , and an interviewer - administered 24 - hour dietary recall in a single on - site visit . while being on site , participants were also scheduled for a follow - up telephone call during which research staff completed the second 24 - hour dietary recall within one week of the site visit . a 13 - item demographic data collection tool was used to gather the following : residence ( rural , urban ) ; age ; education ( less than high school , high school or equivalency certificate ( ged ) , some college , college degree , or higher ) ; employment ( not employed , employed , and retired / disabled ) ; household income ( $ 10,000 , $ 10,000 $ 29,999 , $ 30,000 $ 49,999 , $ 50,000 , or more ) ; and history of selected health conditions ( cancer , diabetes , heart disease / stroke , high blood pressure , and high cholesterol ) . participants ' weight and height were measured by trained research staff according to a standardized protocol . weight was measured in indoor clothing , without shoes , on a calibrated digital scale ( seca 847 , hanover , md ) . height was measured using a calibrated stadiometer ( seca 217 , hanover , md ) . twenty - four hour dietary recalls were conducted using the national cancer institute 's automated self - administered 24 - hour recall tool ( nci asa - 24 ) , beta version . the nci asa - 24 is a web - based tool for capturing 24 - hour dietary intake drawn from the usda 's automated multiple - pass method . this web - based program allows researchers to enter dietary recall data via a respondent portal that is linked to a researcher site where data are saved for future download . typically , the nci asa - 24 employs computer - assisted self - interviewing ( casi ) methodology to guide the respondent through multiple steps of recalls including meal - based quick list , meal gap review , detail pass ( included quantity consumed ) , forgotten foods , and final review . however , due to both reading and computer literacy issues within our targeted population , research staff performed the 24 - hour recalls in a one - on - one interviewer format . data output includes a summary of respondent quick list and nutrients as well as mypyramid equivalents from reported food and beverages . two scheduled recalls were conducted : one weekday and one weekend day to better capture typical intake patterns . the rationale for two recalls was based on pilot testing with a similar population as the study target group . pilot participants suggested that our target audience would likely complete one recall and perhaps a second one , but they suggested that beyond that , people like them would not be interested as they may view this as getting too much in their business particularly since this was not a nutrition intervention study . while 3 recalls have been suggested as the optimal number of recalls , it has also been noted that factors such as demographics ( e.g. , race , geographic region ) and method of data collection ( e.g. , self - administered versus interview ) should be taken into account when making final decisions . resnicow et al . conducted a study in african american adults in the deep south in which dietary carotenoid values for both 1 and 3 days of 24 - hr recalls were estimated using dietary recall software and compared with measured serum carotenoid values . based on resnicow 's work , as well as our pilot testing of the feasibility of collection , we chose to capture 2 recall days ( 1 weekday , 1 weekend day ) , both interviewer administered , with 1 in - person and 1 over the phone . trained research staff conducted one recall in - person and a second recall over the telephone . the primary dietary outcome of interest was whether or not participants met the recommended number of servings for usda recommended food groups : fruits , vegetables , whole grains , low - fat dairy , and lean meats . secondary dietary outcomes of interest were overall energy and primary macronutrient intakes ( e.g. , fat , carbohydrate , and protein ) . participants completed the pss - 10 , a ten - item scale used to assess the degree to which situations in one 's life are appraised as stressful . the pss - 10 has been found to have adequate internal test - retest reliability ( cronbach 's alpha = .88 ) and is positively correlated with a variety of self - report and behavioral indices of stress in adult populations . the pss - 10 is not diagnostic in nature and cut - points have not been established , although there are population norms for comparison ( xwomen = 13.7 ; xblacks = 14.7 ) . scores can be used to infer relative stress levels or within - group comparisons , with higher scores on the pss - 10 indicating greater perceived stress ( possible range 040 ) . for the stratified analysis conducted in this study , we performed a median - split to categorize participants into categories relative to one another ( lower stress versus higher stress ) . descriptive statistics were calculated as means for continuous variables including age , bmi , calories , and macronutrients ; median for pss - 10 score due to nonnormal distribution ; and frequencies for categorical variables including residence , education , employment , household income , and food group recommendation adherence . unadjusted analyses to examine between - groups differences and associations included t - tests for continuous variables , chi - square tests for categorical variables , and pearson correlations to test for associations between continuous variables . the relationship between pss - 10 score as the predictor and adherence to food group recommendations ( yes or no for the following groups : meets fruits ; meets vegetables ; meets dairy ; meets grains ; meets meats and beans ; and meets all groups ) was examined with logistic regression controlling for age in years , total energy intake in kcal , bmi ( kg / m ) , and income ( referent group = $ 10,000 , $ 10,000 $ 29,999 , $ 30,000 $ 49,999 , and $ 50,000 ) . similarly , the relationship between pss - 10 score as the predictor and macronutrient intakes ( protein , fat , and carbohydrates in grams ) was examined with linear regression models controlling for age , energy , bmi , and income ; a similar model ( excluding energy as a control variable ) examined the relationship between pss - 10 score and total calories ( kcal ) . similar regression models that included stress as a categorical variable ( lower stress versus higher stress ) based on a median split were also conducted . participants were 355 obese black women with a mean bmi and age of 36.5 kg / m and 49.8 years ( range 2086 years ) , respectively . the majority of participants reported some education beyond high school ; however , only about half were employed , and 63 % reported an annual household income of less than $ 30,000 . nearly 64 % of participants reported at least one health condition that has been previously associated with diet in the literature including a current or previous diagnosis of cancer ( 9.3 % ) , diabetes ( 28.2 % ) , heart disease / stroke ( 7.6 % ) , hypertension ( 63.7 % ) , or high cholesterol ( 34.6 % ) . for this study , the presence of one of the aforementioned health conditions was not associated with dietary intake and did not influence the relationship between stress and diet ( data not shown ) . overall , participants reported a mean pss - 10 score of 15.36.8 ( median = 16 ; range 035 ; cronbach 's = 0.82 ) . after being stratified as higher stress and lower stress based on the median score ( i.e. , those with pss - 1016 were categorized as higher stress ; those with pss - 1016 were categorized as lower stress ) , differences in sociodemographic factors emerged . participants in the higher stress group were significantly younger ( p 0.001 ) and had a significantly higher bmi ( p = 0.05 ) than those in the lower stress group . the lower stress group was more educated and more likely to be not currently working compared to individuals in the higher stress group ( table 1 ) . overall , participants ' adherence to the dietary guidelines for americans food group recommendations was minimal . nearly one - third of the sample did not meet the recommended intake for any of the food group categories . another 35 % met the recommended intake for only 1 category , while the proportion of remaining participants who met recommendations for 2 , 3 , or 4 categories was 25 % , 8 % , and 1 % , respectively . the proportion of women who did not meet each of the food group recommendations did not differ by stress level . overall mean values for calorie , total fat , carbohydrate , and protein intake were 1453.0 kcal , 57.7 g , 172.9 g , and 66.5 g , respectively . unadjusted and adjusted analyses , controlling for age , bmi , energy , and income , indicated no significant relationships between pss - 10 score and meeting recommended food groups or primary macronutrient intake ( table 2 ) . there were no differences in macronutrient or energy intake by stress group ( calories : 1443 versus 1465 kcal , p = 0.77 ; total fat : 57 versus 58 g , p = 0.90 ; carbohydrate : 171 versus 175 g , p = 0.70 ; and protein 66 versus 66 g , p = 0.86 for lower stress versus higher stress ) . our findings demonstrate inadequate intake across all recommended food groups for the majority of our sample of black women living in the deep south . failure to adopt a dietary pattern consistent with usda guidelines and recommendations may partially explain the health disparities seen among black women living in the deep south . for instance , nearly 64 % of women in our sample reported hypertension compared to a national average of 45 % for black women in the us . similarly , the prevalence of diabetes and high cholesterol among participants in the current study was higher than the national averages for black women ( diabetes : 23 % versus 13 % ; high cholesterol : 35 % versus 28 % ) . research has shown that dietary patterns consistent with usda guidelines can reduce morbidity and mortality from leading chronic conditions and it is critical to continue to conduct rigorous research to identify potential barriers ( e.g. , stress , availability , economic , and environment ) and facilitators ( e.g. , education , social support , and health promoting interventions ) for meeting the recommendations . the low level of adherence to recommended food group intake is consistent with previous studies , particularly for impoverished individuals , although the proportion of nonadherent individuals is even higher among the population in the current study . for example , george et al . examined compliance with dietary guidelines among a low - income sample of postpartum women and found that , for most food groups , one - quarter or less of participants were compliant . though higher stressed women were significantly heavier than the lower stress group , we did not observe a significant relationship between dietary intake and stress level among participants . this lack of relationship between food group intake and stress level is inconsistent with previous research in other populations . the current findings may be explained by a utilization of coping strategies outside of food , for example , spirituality , which may mitigate the impact of stress on eating behaviors for black women in the deep south participants . despite the fact that we observed no direct relationship between stress and dietary intake in our sample , other modifiable environmental and sociocultural factors including coping strategies , cost / availability of food , cultural food practices , and nutrition - related knowledge may contribute to food choices and should be further studied . limitations . the findings of this study are limited by potential recall bias or misreporting of dietary intake data . though we are unable to determine the true amount of underestimation among participants in the current study , if we conservatively assume that participants ' energy intake should be at least equal to their basal metabolic rate , it would suggest that 67 % of our study sample underreported their energy intake on the days of recall . we used the harris - benedict equation to estimate basal energy needs , and on average , the underestimation was 33 % below basal metabolic rate , ranging from negligible to greater than 50 % for some . reported that only 7 % of women underreported both energy intake and protein suggesting a bias towards greater underreporting of fat , carbohydrate , and alcohol . this underreporting of energy and intake of macronutrients that have been linked to stress in other larger studies may have biased our ability to detect any relationship between dietary intake and stress in our sample . sensitivity analyses using the assumptions about underestimation described above also revealed that women who underestimated their energy intake had significantly higher bmis than women who did not underestimate energy intake . this finding taken together with the fact that women who reported higher stress levels had higher bmis than those with lower stress increases the likelihood that potential relationships between diet and stress were biased towards the null due to misreporting of dietary data . another limitation is that the overall stress level of the sample population was not high and showed limited variability , which is contrary to some previous reports , but may be explained by a phenomenon known as the superwoman schema adopted by some black women . the superwoman schema role includes an obligation to manifest an image of strength and minimize reports of stress . therefore , decreased endorsement of stress and / or misreporting of dietary intake may have limited our ability to detect significant relationships between stress and dietary intake . additionally , particular subgroups exhibiting high stress may have a unique dietary pattern that was not observable in this study group . another limitation of the study findings is that mypyramid equivalents , which are now considered antiquated by some due to the introduction of myplate , were used in the data analysis . however , at the time of study development and inception , mypyramid was the standard endorsed by the usda and guided the development of the study protocol . though mypyramid and myplate differ visually , the information about diet content and amount remains the same . therefore , the proportion of participants who met food group recommendations would not change based upon which food group guide was utilized in the study protocol . the academic - community partnership that conducted this research was responsive to the input of the community which wanted to focus efforts on the diet and nutrition of community members . thus , physical activity , which may have influenced the relationship between stress , dietary intake , and bmi in this sample , was not measured . research has shown that higher stressed individuals are more likely to be sedentary and that physical activity can reduce stress . additional research has also shown that , among a sample of black women , those who were more physically active also ate more fruits and vegetables . since physical activity is related to both stress level and dietary intake , participants ' physical activity level may have mediated the relationship between stress and dietary intake and may also explain why those in the higher stress strata had a higher mean bmi . among this group of black women living in the deep south , adherence to the food groups outlined in the dietary guidelines is minimal but does not appear to be linked to higher psychological stress . though previous research has suggested that stress is a barrier to meeting recommendations , the current study suggests that more appropriate measurements of key variables ( e.g. , stress , dietary intake ) may be needed to adequately investigate relationships between stress and dietary intake . additionally , other factors that may contribute to dietary behaviors may need to be considered in this unique population . future research can incorporate qualitative methods and analyses to further explore why individuals in our target population , on average , fail to meet dietary recommendations . additional exploration of the relationship between stress , diet , and adherence to dietary guidelines , including utilization of more objective measures and a more in - depth consideration of coping and physical activity , is warranted in this group .\noutput:\n" }, { "from": "agent", "value": "black women in the deep south experience excess morbidity / mortality from obesity - related diseases , which may be partially attributable to poor diet . one reason for poor dietary intake may be high stress , which has been associated with unhealthy diets in other groups . limited data are available regarding dietary patterns of black women in the deep south and to our knowledge no studies have been published exploring relationships between stress and dietary patterns among this group . this cross - sectional study explored the relationship between stress and adherence to food group recommendations among black women in the deep south . participants ( n = 355 ) provided demographic , anthropometric , stress ( pss - 10 ) , and dietary ( nci asa - 24 hour recall ) data . participants were obese ( bmi = 36.5 kg / m2 ) and reported moderate stress ( pss - 10 score = 16 ) and minimal adherence to dietary guidelines for americans food group recommendations ( 1/3 did not meet recommendations for any food group ) . participants reporting higher stress had higher bmis than those reporting lower stress . there was no observed relationship between stress and dietary intake in this sample . based on these study findings , which are limited by potential misreporting of dietary intake and limited variability in stress measure outcomes , there is insufficient evidence to support a relationship between stress and dietary intake ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this genus comprises of gram - negative , strictly - aerobic , non - fermenting , non - fastidious , non - motile , catalase - positive , oxidase - negative bacteria with dna g + c content of 39.0 % to 47.0 % . according to euzeby 's list of prokaryotic names with standing in nomenclature ( http://www.bacterio.cict.fr/a/acinetobacter.html ) acinetobacter guillouiae proposed by nemec et al . was isolated from sewage - containing gas - work effluent and shares characteristics corresponding to those of the genus acinetobacter . a. guillouiae strain msp 4 - 18 , isolated from a mangrove soil sample from parangipettai ( 1130n , 7947e ) , tamil nadu , india , was grown on tryptic soya agar medium ( tsa ; himedia ) at 30 c . genomic dna was extracted from 36 hour old culture using zr fungal / bacterial dna miniprep as per manufacturer 's instructions . amplification and sequencing of 16s rrna was performed as described by mayilraj et al . . identification was confirmed using 16s rrna sequencing . to determine the phylogenetic relationship of strain msp4 - 18 , the 16s rrna sequence consisting of 1502 bp was compared with those of type strains of species of related genera and identification of phylogenetic neighbors and the calculation of pairwise 16s rrna gene sequence similarities were achieved using the eztaxon server and aligned using mega version 5.0 . bootstrap analysis was performed to assess the confidence limits of the branching ( fig . 1 ) . the genome of a. guillouiae msp 4 - 18 was sequenced using the illumina - hiseq 1000 technology . sequencing resulted in 26,685,818 paired - end reads ( insert size of 350 bp ) with a length of 101 bp . a total of 26,465,246 high - quality reads with approximately 550 coverage were assembled with clcbio wb6 ( word size 40 and bubble size 60 ) to obtain 94 contigs ( n50 , 128,068 bp ) of 4,848,959 bp and average g + c content of 38.0 % . the functional annotation was carried out by rast ( rapid annotation using subsystem technology ) , fig .2 shows the subsystem distribution of a. guillouiae strain msp 4 - 18 , trna was predicted by trnascan - se 1.23 and rrna genes by rnammer 1.2 . the genome contains 3 rrna genes ( 5s - 23s - 16s ) and 69 aminoacyl - trna synthetase genes . a total of 4543 coding regions ( 2294 genes transcribed from the positive strand and 2249 from the negative strand ) were found in the genome , of which 3052 ( 67 % ) could be functionally annotated . the genome coding density is 83 % with an average gene length of 883 bp . the annotated genome has 106 genes responsible for resistance to antibiotic and toxic compounds including 13 genes for mdr efflux pumps . sixty five genes are involved in oxidative stress , 12 in osmotic stress , 15 for heat shock and several others for response to various other stresses , to make a total of 107 genes responsible for stress response in this organism . the functional comparison of the genome sequences available on the rast server revealed the closest neighbors of a. guillouiae msp 4 - 18 as acinetobacter baumanii ab0057 ( score 502 ) followed by a. baumanii aye ( score 500 ) , acinetobacter johnsonii sh046 ( score 494 ) and a. baumanii acicu ( score 494 ) . the a. guillouiae msp 4 - 18 whole genome shot gun ( wgs ) project which has been deposited at ddbj / embl / genbank under the project accession asqg00000000 of the project ( 01 ) has the accession number asqg01000000 and consists of sequences asqg01000001asqg01000094 . the authors declare that there is no conflict of interest on any work published in this paper .\noutput:\n" }, { "from": "agent", "value": "the genus acinetobacter consists of 31 validly published species ubiquitously distributed in nature and primarily associated with nosocomial infection . we report the 4.8 mb genome of acinetobacter guillouiae msp 4 - 18 , isolated from a mangrove soil sample from parangipettai ( 1130n , 7947e ) , tamil nadu , india . the draft genome of a. guillouiae msp 4 - 18 has a g + c content of 38.0 % and includes 3 rrna genes ( 5s , 23s , 16s ) and 69 aminoacyl - trna synthetase genes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the myelodysplastic syndrome ( mds ) are a heterogeneous assembly of hematologic disorders illustrated commonly by impaired hematopoiesis resulting in varied cytopenias and an increased threat of converting into acute myeloid leukemia ( aml ) . high - throughput genomic methods currently uncover a diverse collection of mutated genes located within the genetic profile of many mds patients . however , the role of cytogenic analysis and its corresponding benefit , diagnosis , prognosis , and therapeutic strategies , have not been fully established to date . mds is frequently diagnosed in older males and those with previous exposure to benzene , chemotherapy or radiotherapy .4000 - 50,000 new cases are diagnosed each year in the us alone , with and estimated incidence rate of 4.3 per 100,000 . up to half of all patients with mds presentimpaired hematopoietic stem cell proliferation and differentiation leads to abnormal cell morphology and physiology with subsequent increase in morbidity . common symptoms vary and can include fatigue and weakness from anemia , infections from neutropenia , or bleeding from thrombocytopenia . studies have demonstrated that 40 - 65 % of patients with mds experience hemorrhagic complications due to thrombocytopenia , with these complications being cited as the cause of death in 10 - 20 % of individuals with mds . patients who exhibit persistent refractory thrombocytopenia require physicians to more closely monitor bleeding complications and amplify the complexity of establishing correct treatment options . identifying the patients who exhibit this rare subset type of mds is critical in reducing morbidity and mortality in this patient population . a 71 year - old caucasian male ex - smoker without any significant past medical history presented to the emergency department complaining of worsening redness and swelling in his left lower leg . he presented five days earlier and was given antibiotic treatment which did not resolve the problem . on physical exam bp 119/68 mhg , pulse 61 / min , resp 17 / min , temp : 96.6 f , o2 saturation 96 % on room air . laboratory testing showed hemoglobin 12.2 g / dl , wbc 7.3 k / ul , platelet count 26 k / ul , neutrophils 29 , lymphocytes 20 % , mcv 73.2 fl , glucose 120 mg / dl , bun 14 mg / dl , creatinine 0.8 mg / dl , calcium 8.7 mg / dl , albumin 4.3 g / dl , sodium 137 mmol / l , potassium 4 mmol / l , chloride 100 mmol / l , and co225 mmol / l . x - ray ruled out osseous contribution to his problem and venous doppler was negative for dvt . a review of hospital records noted previous findings of thrombocytopenia as far as four years earlier . considering pancytopenia an oncology consult was called who reviewed the peripheral smear which showed slight anisocytosis , monocytosis with marked thrombocytopenia with some giant platelets , no pseudo - pelger - huet cells or circulating blasts were noted ( figure 1a ) . given the laboratory findings , leukemia was considered as a differential and therefore a bone marrow biopsy was performed which showed the differential ( table 3 ) granulopoiesis , hypercellular marrow with increased myelomonocytic cells and megakaryocytogenesis ( figure 1b , c ) . immunohistochemistry showed cd117 : about 5 - 10 % positive cells , consistent with immature cells / blasts , cd34 : no increase in cd34 positive cells , cd163 : highlights predominantly monocytic component , cd123 : negative . fish was performed for bcr / abl1 to detect the ( 9:22 ) translocation associated with cml and less commonly all or aml were normal . cytogenic testing demonstrated an abnormal karyotype 46 , xy , del ( 20 ) ( q11 .2 q13 .3 ) ( 20 ) ( figure 2 ) . patient was diagnosed with myelodysplastic syndrome , unclassified ( mds - u ) with refractory thrombocytopenia . anemia is ordinarily part of a bi - or pancytopenia , with independent neutropenia and thrombocytopenia cell lines being unusual . refractory thrombocytopenia is a rare , but potentially lethal complication that increases complexity in treatment for the physician and increased morbidity for the patient . genetic abnormalities are playing an expanded role in classifying prognosis and treatment , as well as the potential for mds to transform into cml . this is especially true where there is a high proportion of cells in the g1 stage of the cell cycle . one potential cytogenic marker for clonal evolution is del ( 20 ) , which was present in our patient . the del ( 20 ) is commonly found in patients with cml after tyrosine - kinase inhibitor therapy with and without remission . this marker does not necessarily indicate a worse case scenario of cml clonal divergence or disease progression and only 1.7 % of people with mds exhibit this alteration . from a prognostic standpoint , this clonal abnormality is considered good with a median survival of 4.8 years and a progression to aml median time at 9.4 years . this particular mutation is found in approximately 21 % of mds cases and has been shown to be a non - favorable prognostic mutation . the asxl1 ( additional sex combs like 1 ) is implicated in chromatin remodeling and gene repression . it is believed to be responsible for repression of multiple transcription genes . the 13.3 break point correlates to the gnas locus and is found in less than 1 % of mds diagnoses . this gnas complex ( guanine nucleotide regulatory protein ) activated g - proteins , modulates various hormonal controls , and even stimulates the ras pathway . its role in mds is less understood and hasnt been as well studied in hematologic cancers as much as in solid tumors . cytotoxic agents , antibodies or immunosuppression treatments , allogeneic stem cell transplantation , and blood products to correct hypocellularity have been the mainstay of most regimens . multiple therapies are introduced as a result of the theory that different cell lines are arrested and / or deranged in various stages of the cell cycle . because of the preleukemic and potential myeloblastic nature of mds , dozens of cytotoxic agents have been utilized to combat cell abnormal cell differentiation , but have had varied success to date . the outcomes of theses treatments are very dependent on which somatic gene mutation ( s ) are present and whether or not they are responsive to the chemotherapeutic agent used . allogeneic stem cell transplantation is usually limited to younger high - risk patients and rarely in very healthy older patients . as of date , this is the only curative treatment of higher - risk myelodysplastic syndromes , with prolonged disease - free survival of 35 - 50 % . immune mediated hematopoietic apoptosis caused by cytotoxic t - cells , ifn - producing cd4 + cells , and th17 cells is reduced by administering immune modulators . this has shown to not only help increase the reduced cell lines , but gives patients a more robust immune response which is crucial to reducing their morbidity and mortality . specific and standard therapeutic approaches are made to increasing single or multiple cell line deficiencies . the goal in these treatments is to correct the cytopenias ( s ) involved as with any related reduction of the hematopoietic cell lines . a reduction in any cell line can lead to potential adverse outcomes in patients . after an extensive review of the current literature , it is evident that thrombocytopenia is one of the most serious problems found in many patients with mds , yet normally successfully treated . in few cases , due to potentially unique genetic mutations , identification of specific gene mutations and advances in treatment options will hopefully provide forthcoming guidance on detecting at - risk patients in the future .\noutput:\n" }, { "from": "agent", "value": "myelodysplastic syndromes ( mds ) represent a variety of clonal abnormalities , possibly preleukemic and display numerous phenotypic manifestations . specific mutations carry high morbidity and mortality rates due to cell line dysplasia . mds commonly presents with symptoms related to anemia , and approximately two - thirds will develop thrombocytopenia , a rare , but potentially lethal complication that increases complexity in treatment and morbidity , and may be due to unique genetic mutations leading to refractory thrombocytopenia , ultimately leading to an overall reduction in survival . careful identification and monitoring of this patient subdivision can significantly reduce morbidity and mortality , and potential identification of specific gene mutations and advances in treatment options will hopefully provide guidance on detecting at - risk patients in the future . we present a case of a man with mds - u ( karyotype 46 , xy , del ( 20 ) ( q11 .2 q13 .3 ) ( 20 ) with no detected jak2 v617f mutation ) , who in despite of appropriate evidenced based treatment , continued to exhibit refractory thrombocytopenia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the pittsburgh epidemiology of diabetes complications ( edc ) study is a historical , prospective investigation of incident cases of childhood - onset type 1 diabetes diagnosed , or seen within 1 year of diagnosis , at the children s hospital of pittsburgh between 1950 and 1980 . a total of 658 patients who were eligible and willing to participate in the study had an initial clinical assessment between 1986 and 1988 ( mean age 28 years ; mean duration of diabetes 19 years ) and have been subsequently reexamined or surveyed biennially for up to 20 years . for the analyses in this study , edc study participants who were free of cad at study entry and had three stored samples ( blood and either 24 - h or overnight urine ) available before the development of cad ( for incident cases ) or the end of follow - up were selected for study ( n = 356 ) . given availability , samples were chosen to reflect an early , midpoint , and late assessment during a participant s follow - up . thus , biologic determinations were approximately 6 years apart for noncases , whereas , given the shorter available follow - up for those developing cad , biomarker measurements were approximately 4 years apart for incident cases . demographic , health care , diabetes self - care , and medical history information were ascertained via self - administered questionnaires before each clinic visit . blood pressure was measured with a random zero sphygmomanometer after a 5 - min rest ( 7 ) , and hypertension was defined as blood pressure 140/90 mmhg or use of antihypertensive medications . although the definition of hypertension has been altered in recent years , given that the majority of the follow - up within the edc study , which was initiated in 1986 , falls within the time period during which hypertension was still defined as 140/90 mmhg , we felt that it would not be appropriate to reclassify the cohort retrospectively . nevertheless , statistical analyses were repeated using 130/80 mmhg as the cutoff points for the definition of hypertension . stable glycosylated hemoglobin ( hba1 ) was measured by ion exchange chromatography ( isolab , akron , oh ) for the first 18 months and by automated high - performance liquid chromatography ( diamat , biorad , hercules , ca ) for the subsequent 10 years ; the two assays were highly correlated ( r = 0.95 ) . for follow - up beyond 10 years , hba1c was measured with the dca 2000 analyzer ( bayer , tarrytown , ny ) . the dca 2000 and diamat assays also were highly correlated ( r = 0.95 ) . original hba1 ( 19861998 ) and later hba1c values ( 19982004 ) were converted to standard hba1c values aligned with the diabetes control and complications trial ( dcct ) using regression formulae derived from duplicate assays [ dcct hba1c = ( 0.83 diamat hba1 ) + 0.14 and dcct hba1c = ( dca hba1c 1.13 ) / 0.81 ] . hdl cholesterol was determined enzymatically after precipitation with heparin and manganese chloride , using a modified version of the lipid research clinics method ( 8 ) . cholesterol and triglycerides were measured enzymatically ( 9,10 ) . urinary albumin was measured by immunonephelometry ( 11 ) , and creatinine was assayed using an ectachem 400 analyzer ( eastman kodak co. , rochester , ny ) . glomerular filtration rate was estimated using the equation used in the chronic kidney disease epidemiology collaboration study ( 12 ) . cad was defined as myocardial infarction confirmed by q - waves on electrocardiogram ( minnesota code 1.1 , 1.2 ) or hospital records , angiographic stenosis 50 % , revascularization , or death due to cad . plasma levels of - and - tocopherol as well as urinary 15 - isoprostane f2 t ( isop ) were measured from samples collected at the clinical visit at three time points during the 20 - year follow - up of the edc study and stored at 70c until the present analyses . the concentrations of - and - tocopherol in plasma samples anticoagulated with edta were measured under subdued lighting , as previously reported ( 13,14 ) . the coefficient of variation between runs is 6.0 and 2.8 % for - tocopherol and - tocopherol , respectively . the effect of prolonged storage on serum antioxidant samples was addressed within the multiple risk factor intervention trial ( mrfit ) ; no appreciable degradation was seen in samples stored at 50 to 70c ( 15 ) . urine samples were obtained in 24 - h ( 58 % ) or overnight ( 42 % ) collections . the same type of timed sample was used at all time points for a given individual . levels of isop were measured using a competitive elisa procedure developed by oxford biomedical research ( oxford , mi ) , which has a correlation ( r ) of 0.8 with gas chromatography mass spectrometry procedures . because there are no published data on the potential effects of prolonged storage on the measurement of isop , we simultaneously performed the assay on stored ( 20 - and 10 - year ) samples and fresh samples from 6 controls and 11 individuals with type 1 diabetes without renal failure . isop levels were similar and within the normal range at all time points ( controls : 0.96 , 1.6 , and 1.01 ng / mg creatinine , respectively ; individuals with type 1 diabetes : 1.3 , 1.2 , and 0.98 ng / mg creatinine , respectively ) , suggesting stability of the assay . all statistical analyses were conducted using sas version 9.3 ( sas institute , cary , nc ) . given the dependence of plasma tocopherol concentration on lipid levels , - and - tocopherol were reported per unit cholesterol ( 16 ) . urinary isop ( in nanograms per milliliter ) were normalized for urinary creatinine concentration and expressed as nanograms per milligram of creatinine . univariate associations between measurements at the first time point ( baseline ) and subsequent cad status were determined using the student t test for normally distributed continuous variables or the wilcoxon two - sample rank sum test for nonnormally distributed continuous variables . the or fisher exact test were used as appropriate for univariate analysis of categorical variables . since - tocopherol has been shown to act as a pro - oxidant under conditions of low reactive oxidant fluxes ( 17 ) , spearman rank correlations were used at each time point for the entire cohort , and separately for incident cases and noncases , to investigate the association between - tocopherol and urinary isop according to high versus low / normal hba1c . mixed models were used to graph trajectories of the main independent variables over time by subsequent cad status . trajectories were plotted as a function of time : time before cad incidence in cases and time before the end of follow - up in noncases ; cubic splines with continuous second derivatives were used to smooth lines ( 18 ) . the genmod procedure in saswas used to assess the association between the repeated measurements of the main independent variables and cad incidence after adjustment for duration of diabetes and significant univariate risk factors . nonnormally distributed variables were logarithmically transformed to more closely satisfy the assumption of normality for entry into multivariable models ( as noted in tables 13 and fig . participant characteristics at the first time point ( baseline ) by subsequent cad status multivariable mixed models for the subsequent development of cad number of cases and noncases at each time point - tocopherol and urinary isop trajectories ( a ) and - tocopherol - to - urinary isop ratio trajectories ( b ) ( adjusted for duration of diabetes , race , sex , bmi , having ever smoked , hba1c , hypertension , hdl and non - hdl cholesterol , albumin excretion rate ( log ) , estimated glomerular filtration rate , and white blood cell count ) before a cad event or the end of follow - up . all statistical analyses were conducted using sas version 9.3 ( sas institute , cary , nc ) . given the dependence of plasma tocopherol concentration on lipid levels , - and - tocopherol were reported per unit cholesterol ( 16 ) . urinary isop ( in nanograms per milliliter ) were normalized for urinary creatinine concentration and expressed as nanograms per milligram of creatinine . univariate associations between measurements at the first time point ( baseline ) and subsequent cad status were determined using the student t test for normally distributed continuous variables or the wilcoxon two - sample rank sum test for nonnormally distributed continuous variables . the or fisher exact test were used as appropriate for univariate analysis of categorical variables . since - tocopherol has been shown to act as a pro - oxidant under conditions of low reactive oxidant fluxes ( 17 ) , spearman rank correlations were used at each time point for the entire cohort , and separately for incident cases and noncases , to investigate the association between - tocopherol and urinary isop according to high versus low / normal hba1c . mixed models were used to graph trajectories of the main independent variables over time by subsequent cad status . trajectories were plotted as a function of time : time before cad incidence in cases and time before the end of follow - up in noncases ; cubic splines with continuous second derivatives were used to smooth lines ( 18 ) . the genmod procedure in saswas used to assess the association between the repeated measurements of the main independent variables and cad incidence after adjustment for duration of diabetes and significant univariate risk factors . nonnormally distributed variables were logarithmically transformed to more closely satisfy the assumption of normality for entry into multivariable models ( as noted in tables 13 and fig . participant characteristics at the first time point ( baseline ) by subsequent cad status multivariable mixed models for the subsequent development of cad number of cases and noncases at each time point - tocopherol and urinary isop trajectories ( a ) and - tocopherol - to - urinary isop ratio trajectories ( b ) ( adjusted for duration of diabetes , race , sex , bmi , having ever smoked , hba1c , hypertension , hdl and non - hdl cholesterol , albumin excretion rate ( log ) , estimated glomerular filtration rate , and white blood cell count ) before a cad event or the end of follow - up . the concentrations of measured biomarkers of interest ( i.e. , urinary isop and - and - tocopherol ) over time in the entire study group are given in supplementary table 1 . the concentration of - tocopherol increased over time , paralleling the increase in the use of vitamin supplements in the entire edc population ( data not shown ) . no statistically significant changes , however , were observed overall in urinary isop or - tocopherol . among individuals free of cad at study entry and with stored samples available at three times during the 20 - year follow - up ( n = 356 ) , 88 ( 24.7 % ) developed a cad event . participant characteristics at the first of three time points ( baseline ) by subsequent cad status are shown in table 1 . as expected , individuals who subsequently developed cad were more likely to be older , with a longer duration of diabetes and higher blood pressure , lipid levels , albumin excretion rate , and white blood cell count compared with those who did not develop an event . incident cases were also more likely to have smoked , have micro - or macroalbuminuria , and lower estimated glomerular filtration rate . although no significant differences in urinary isop , - tocopherol per unit cholesterol , or the ratio of - tocopherol to urinary isop were observed between subsequent cases and noncases , it is surprising that - tocopherol ( not adjusting for cholesterol ) was elevated among subsequent cases , whereas - tocopherol levels per unit cholesterol were elevated in individuals without cad compared with subsequent cases . in investigating the strength and direction of a potential association between urinary isop and - tocopherol concentrations , generally inverse associations were observed regardless of the level of glycemic control ( 7.5 or 7.5 % ) or subsequent cad status , although the strength of the correlation differed by time point ( data not shown ) . separate mixed models were constructed for each main independent variable [ i.e. , urinary isops ( per milligram of urinary creatinine ) , plasma - and - tocopherol ( per unit cholesterol ) , and the - tocopherol - to - isop ratio ] to assess the independent association between repeated measurements of each variable and the subsequent development of cad ( table 2 ) . in multivariable mixed models , a borderline significant direct association was observed between urinary isop concentrations and cad ( p = 0.06 ) , whereas a significant inverse association was observed between plasma - tocopherol concentration and cad ( p = 0.02 ) . repeated measurements of - tocopherol concentration did not seem to independently relate to subsequent cad status ( p = 0.54 ) . interestingly , the - tocopherol - to - urinary isop ratio was strongly inversely associated with cad ( p = 0.003 ) . similar results of an inverse association between the - tocopherol - to - urinary isop ratio and cad incidence ( p = 0.04 ) were observed when including in the data from analyses of an additional 93 individuals with isop measured only in morning 4 - hour clinic urine samples .1 b ) from the fully adjusted models ( table 2 ) before the occurrence of a cad event or the end of follow - up ( table 3 gives the number of cases and noncases at each point during the follow - up period ) . although differences did not appear to be of a great magnitude throughout the follow - up period , - tocopherol and the - tocopherol - to - urinary isop ratio were higher , especially during the 7 years before a cad event or the end of follow - up , whereas urinary isop concentrations were lower among individuals who remained free of a cad event . these data suggest that among individuals with type 1 diabetes , the profile of oxs ( i.e. , urinary isoprostanes ) and its potential antioxidant defense ( i.e. , plasma - tocopherol ) differ over time in those who develop incident cad compared with those who do not . this difference is particularly apparent in the 7 years before the incident event and is well characterized by the ratio of - tocopherol to urinary isop . no association was observed between repeated measures of plasma - tocopherol and subsequent development of cad . thus , a direct association of urinary isop concentrations after adjustment for other covariates was observed , whereas plasma - tocopherol and the - tocopherol - to - urinary isop ratio were inversely related to subsequent cad status . clinical trials of the effect of the use of antioxidant vitamin supplements in both the general population as well as individuals with diabetes have generally suggested no benefit of supplementation for the primary prevention of cardiovascular disease and even an increased mortality risk ( 5 ) . indeed , a meta - analysis of six randomized clinical trials comparing cardiovascular death risk with vitamin e versus placebo reported no benefit of supplementation , whereas similar meta - analyses for the effect of - carotene supplementation suggested an increased risk of both all - cause and cardiovascular disease mortality ( 19 ) . interestingly , however , secondary prevention trials have provided somewhat more encouraging results for vitamin e supplementation , especially for myocardial infarction ( 2022 ) , although not all studies agree ( 23 ) . we also have previously shown that a protective effect of - tocopherol against cad seemed to be confined to persons with type 1 diabetes and kidney disease in a small case - control study ( 6 ) . thus , an issue raised is whether antioxidants may provide protection against cardiovascular disease only in susceptible population subgroups , such as those with a prior diagnosis ( secondary prevention ) or who are genetically susceptible . indeed , in three clinical trials a reduced risk of cardiovascular disease with vitamin e therapy was apparent only among individuals with both type 2 diabetes and the haptoglobin 22 genotype ( 2426 ) . we also have previously raised the premise that an adequate response ( e.g. , antioxidant intake ) to a specific insult ( e.g. , oxs ) may reduce or delay the development of pathologic conditions associated with the insult ( 27 ) . thus , despite difficulties in recognizing markers representing protection or resistance in response to a specific stress , the concurrent evaluation of markers representing insult against those representing protection from or resistance to insults has great implications . in the current study , we aimed to assess whether an adequate antioxidative response to oxs could delay or prevent the development of cad in a cohort of individuals with long - standing type 1 diabetes . given that the majority of clinical trials of antioxidant supplementation in relation to cardiovascular disease focused on vitamin e , we measured the plasma concentration of - and - tocopherol . the former has been reported to have greater biologic activity and to be the only form maintained in human plasma ( 28 ) , whereas the latter is the form most commonly found in the american diet ( 4 ) . we further assessed levels of urinary isops , prostaglandin - like compounds derived primarily from nonenzymatic , free radical - induced peroxidation of arachidonic acid ( 29 ) . contrary to reactions catalyzed by enzymes , it is reasonable to assume that the attack by reactive oxygen species on arachidonic acid yields equimolar levels of all f - series isoprostanes . f2 - isoprostanes , the first isoprostane class discovered , are detectable in their esterified form in all normal biological tissues and in their free form in all normal biological fluids , including plasma and urine ( 3,30 ) . importantly , their concentration in urine is stable and not affected by arachidonic acid auto - oxidation or daily variation ( 29,31 ) , contributing to their establishment as the gold standard biomarker of oxidant stress . the framingham heart study reported that urinary isoprostane concentrations were significantly associated with smoking , diabetes , and bmi , suggesting a role for systemic oxs in cardiovascular disease ( 32 ) . a small case - control study from germany also noted that urinary isoprostane excretion increased with an increasing number of traditional coronary heart disease risk factors ( 33 ) . indeed , several case - control studies of humans suggested the presence of elevated isoprostane concentrations in either plasma or urine among individuals with cardiovascular disease ( 3337 ) . thus , plasma isoprostane levels were shown to be higher in individuals with atherosclerosis of the carotid or iliofemoral arteries ( 34 ) , as well as among those with angiographic evidence of cad ( 35 ) , compared with controls . urinary isoprostane levels also were reported to be increased with both subclinical atherosclerosis ( 36 ) and manifest cad ( 33,36,37 ) . an important question that remained unanswered , however , was , is oxs the initiator of processes leading to the development of cad ? similarly to previous reports in the general population , we also observed a direct association between urinary concentrations of isoprostane and subsequent cad in individuals with type 1 diabetes , although the association was not very strong , perhaps suggesting that the level of oxs per se is not the sole critical factor in disease pathogenesis , at least in this population . however , simultaneous evaluation of urinary isop and plasma - tocopherol resulted in significant effects for both biomarkers . the - tocopherol - to - urinary isop ratio over time was even more significant for subsequent cad , consistent with the hypothesis that an adequate response to an insult may reduce risk associated with that insult . thus , although the edc study is not a clinical trial , our findings point to the value of concurrent evaluation of insult and response to that insult to identify risk and potentially lead to novel approaches to preventing the progression of insults to full disease ( e.g. , by selective administration of antioxidant therapy to those with a low - tocopherol - to - isop ratio ) , an approach that may merit further evaluation . nonetheless , whether findings from the current study in type 1 diabetes could be directly applied to the general population is unclear . indeed , it has been shown that urinary isoprostane levels are increased when type 1 diabetes is diagnosed , and although they were shown to decline after 16 weeks of insulin treatment , isoprostane concentrations seem to remain elevated in persons with type 1 diabetes compared with controls ( 38 ) . it is , then , possible that a relationship with cad may be more difficult to observe in this compared with the general population if increased levels of oxs are present in type 1 diabetes before the initiation of atherosclerosis . pro - oxidant properties of - tocopherol have previously been described , especially at low oxidant flukes and in the absence of co - antioxidants ( 17 ) . thus , a direct association between isop and - tocopherol may have been expected at lower levels of glycemic control ( hba1c 7.5 % ) , contrary to our observations in this study . these findings , however , may suggest that the distribution of hba1c , even at lower levels , did not achieve the level of radical flux , leading to tocopherol - mediated peroxidation . strengths of the current study comprise the large cohort of individuals with type 1 diabetes , the long ( 20 - year ) prospective follow - up , and the biennial assessment of both risk factors and the outcome . in addition , the measurement of plasma levels of the antioxidants - and - tocopherol at three time points is also a strength because , contrary to dietary intake or supplement use data , plasma concentrations reflect biologically relevant levels of the vitamins . finally , the measurement of urinary isop concentration , currently considered the gold standardbiomarker of oxs , at three time points during the follow - up period is a further asset of this study . as with any research study , conclusions based on this investigation are limited by several weaknesses , imposed by our choice of study design and the assumptions we made . thus , although measuring biomarkers and assessing risk factors at multiple time points would have improved the precision of measurements , individuals with fewer than three stored samples had to be excluded from these analyses . this practice would have affected study participants with inadequate stored samples ( whether due to failure to collect samples , inadequate sample collection , or use of samples for previous analyses ) , especially those exhibiting cardiovascular and / or fatal events earlier during the follow - up period . moreover , despite improved precision , biomarker assessment at three time points over a 20 - year follow - up may not be an adequate representation of an individual s oxs status . we further restricted the assessment of oxs and antioxidative response to measurements of urinary isop and plasma tocopherol concentrations , respectively , among an array of currently known oxidative / antioxidative biomarkers . whether other combinations of markers of stress and response or whether the total antioxidative potential / reserve of an individual may be more relevant to the subsequent risk for cad can not be derived from these data . nevertheless , previous published reports of an association between total antioxidant status and cardiovascular outcomes have produced conflicting results ( 6,3942 ) . finally , we can not exclude the presence of subclinical cad at study entry , a common limitation of both observational studies and clinical trials . in conclusion , lower - tocopherol and the - tocopherol - to - urinary isop ratio were inversely related to cad ; to a lesser extent , higher urinary isop concentrations were directly related to cad . these data thus provide some support for the hypothesis that a greater capability ( - tocopherol ) to respond to oxs ( isoprostanes ) relates to cad incidence .\noutput:\n" }, { "from": "agent", "value": "objectivealthough oxidative stress ( oxs ) is thought to contribute to atherosclerosis and coronary artery disease ( cad ) , little is known about the variability in an individual s ability to respond to oxs . therefore , we assessed potential indices of response to oxs and evaluated whether they modify the association between oxs and cad.research design and methodswe evaluated plasma - and - tocopherol per unit cholesterol ( potential response markers ) ; urinary 15 - isoprostane f2 t per milligram creatinine ( isoprostane [ isop ] , a potential stress marker ) ; and the - tocopherol - to - isop ratio ( as a measure of response to stress ) , measured three times during 20 years of follow - up , in relation to cad incidence in a cohort with childhood - onset type 1 diabetes ( n = 658 ; mean age at baseline , 28 years ; duration of diabetes , 19 years ) . participants with three samples ( blood and either 24 - h or overnight urine ) available before the onset of cad or the end of follow - up ( n = 356 ) were selected for study.resultsin multivariable mixed models , - tocopherol over time was inversely associated with cad ( = 0.27 ; p = 0.02 ) , whereas a direct association was observed for isop ( = 0.0008 ; p = 0.06 ) . moreover , the - tocopherol - to - isop ratio was strongly and inversely related to cad incidence ( = 0.72 ; p = 0.003 ) , whereas in a separate model including - tocopherol and isop , both biomarkers maintained statistical significance . no association was observed for - tocopherol ( = 0.22 ; p = 0.54 ) . conclusionsthese data suggest that a greater potential capability ( - tocopherol ) to respond to oxs ( urinary isop ) relates to cad incidence ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: traumatic pulmonary artery pseudoaneurysms ( papas ) remain a rare entity with only 24 cases reported in the english literature . we present the case of a 21 - year - old - active male who developed a pulmonary artery and vein pseudoaneurysm 60 days postinjury after gunshot wound to the chest . this case is unique because of the concomitant venous pseudoaneurysm , history of deep vein thrombosis ( dvt ) and management decision . a 21 - year - old active duty marine sustained a through - and - through gunshot wound to the right chest while under enemy fire . the patient initially underwent needle decompression in the field and was transferred to the nearest forward operation base ( fob ) for further management . patient present to the fob with gcs 15 , systolic blood pressure of 80 , pulse of 130 beats / min and oxygen saturation of 90 % . emergent tube thoracostomy was performed with approximately 2000 ml blood loss in the emergency room . he was taken to the operation room where he underwent repositioning of the chest tube and a second tube thoracostomy with initial output of 100 ml . on - tablethoracotomy was considered , but a decision was made to observe patient because he was hemodynamically stable and chest tubes output where minimum after the second chest tube placement . postoperative chest computed topography ( ct ) showed extensive pulmonary contusion , bullet track but no vascular injury . on postinjury day three , a chest x - ray was suspicious for retained hemothorax and a decision was made to explore the patient . at exploration via video - assisted thoracoscopy , active bleeding from intercostals artery at the posterior gunshot wound was noted and successfully ligated and the retained hemothorax was evacuated . there was no bleeding from the lung parenchyma during the thoracoscopy . the patient arrived to our facility 9 days postinjury with right chest tube to suction , hemodynamically stable , saturation of 99 % in room air and on enoxaparin 30 mg subcutaneously twice a day . the chest tube was place on water seal and then pulled out 24 hours later . the patient was placed on therapeutic weight - based enoxaparin for his left common femoral vein thrombosis and discharged home with instruction to follow - up with the coumadin clinic for anticoagulation . however , patient was lost to follow - up and presented to an outside hospital with complaint of intermittent hemoptysis , non - productive cough and chest pain for 3 days . chest ct showed two enhancing lesion connected to the pulmonary artery concerning for arteriovenous malformation ( avm 's ) . per our institution policy , the patient was transferred to our facility for further management . on presentation , the patient was hemodynamically stable , vitals normal and without further episodes of hemoptysis . chest ct angiogram showed a large ( 3.12.5 - cm ) pseudoaneurysm arising from a sub - segmented branch of the right upper lobe posterior segment pulmonary artery [ figures 1a and b ] and a small ( 1.81.6 - cm ) segment from the right upper lobe pulmonary vein [ figure 2 ] . owing to the associated pulmonary vein pseudoaneurysm which is a relative contraindication for anticoagulation , the patient underwent uncomplicated coil embolization of the papa [ figure 3 ] and placement of retrievable inferior vena cava ( ivc ) filter and was discharged home after 24 hours of observation . at 30 and 120 dayspost - coiled embolization , the patient remained asymptomatic and chest ct showed persistent resolution of the pseudoaneurysm [ figure 4 and figure 5 ] . ( b ) ct scan showing pulmonary artery pseudoaneurysm ct scan showing pulmonary vein pseudoaneurysm angiogram demonstrating coiled pulmonary artery pseudoaneurysm ct scan 30 - days post - coiled embolization ct scan 120 - days post - coiled embolizationthe paucity of cases is due to the following reasons : low flow pressure to allow healing by hemostasis and fibrosis preventing pseudoaneurysm and high mortality rate or need for immediate surgery after injury . most traumatic papas are due to penetrating chest injuries among reported cases . other non - traumatic etiology include mycotic , syphilitic or mycobacterial infection and vascular abnormalities such as cystic medial necrosis , behcet 's disease and marfan syndrome . hemoptysis is the most common presentation due to leakage of blood into the bronchial tree by the aneurysm . presentation ranges from few weeks to years after initial injury based on the few reported cases in the english literature . high clinical suspicious is required for diagnosis in patient with previous history of trauma who presents with hemoptysis ; however , chest ct and / or pulmonary angiogram ( gold standard ) are required for diagnosis and confirmation since findings on chest radiographs are not specific . traditionally , lung resection was the main treatment ; however , lung - sparing therapy such as aneurysectomy or coil embolization angiographically are gaining grounds . recently , fluoroscopically guided percutaneous injection of thrombin was employed in the management of angiographically inaccessible papa . in an acute presentation , angiographical embolization is preferred because it allows for continue observation of the patient and prevents early lung resection . lesions that are not symptomatic require some form of therapy due to potential fatal rupture and subsequent exsanguinations . similarly , most reports recommend some form of treatment despite possible spontaneous resolution for the same reason . in this present case , a 23 - year male developed traumatic pulmonary artery and vein pseudoaneurysm almost 60 days after gunshot wound to the chest . the patient was symptomatic and treatment option was very challenging due to the presence of pulmonary vein pseudoaneurysm and history of left common femoral vein dvt . coil embolization of the artery pseudoaneurysm was performed , since this played a major role in patient 's symptoms . the pulmonary vein pseudoaneurysm was very small , with low intraluminal pressures and therefore was not coil embolized [ figure 6 ] . instead , ivc filter was placed due to the history of dvt and contraindication for anticoagulation . thirty day follow - up chest ct showed successful coil embolization of the artery and resolution of the venous pseudoaneurysm . to the best of our knowledgethis is the second case with both pulmonary artery and venous aneurysm after penetrating injury to the chest . arrow indicating uncoiled pulmonary vein pseudoaneurysm knowledge about traumatic pulmonary artery or venous pseudoaneursym is limited due to the long latency on presentation , paucity of cases and high mortality associated with this entity . the current knowledge about traumatic pulmonary artery is from a few cases reports and our case adds to this limited database . in general , diagnosis should be suspected in any patient who presents with hemoptysis after chest trauma and a persistent organized area of consolidation on chest x - ray . chest ct and angiogram will confirm diagnosis and treatment should be initiated as soon as possible due to 50 % mortality when these lesions rupture . off - note , we would like to emphasize that thoracotomy remains the current management of massive hemothorax despite our initial conservative management . traumatic pulmonary artery or vein pseudoaneurysms are extremely rare with only 24 cases reported in the english literature . hemoptysis is the common complaint and can present a few weeks to years from the initial injury . historically , formal surgical resection has been required ; however , angioembolization is gaining grounds and serving as future initial option for hemorrhage control in traumatic papa . the views expressed in this case report are those of the author and do not reflect the official policy of the department of the navy ( don ) , department of defense ( dod ) or us government . we certify that all individuals who qualify as authors have been listed ; each has participated in the conception and design of this work , the writing of the document , and the approval of the submission of this version ; that the document represents valid work ; that if we used information derived from another source , we obtained all necessary approvals to use it and made appropriate acknowledgements in the document ; and that each takes public responsibility for it .\noutput:\n" }, { "from": "agent", "value": "traumatic pulmonary artery or vein pseudoaneurysms are extremely rare and angiographic management is gaining grounds . these pseudoaneurysms are caused by both penetrating and blunt chest trauma . we presents a unique case of coexisted pulmonary vein and artery pseudoaneurysm due to penetrating chest trauma managed by angioembolization and inferior vena cava filter insertion for concomitant deep vein thrombosis ( dvt ) due to contraindication to anticoagulation . the present case represents only the second case of coexisted pulmonary vein and artery pseudoaneurysm and the first with associated dvt making management decision complicated ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: until now , only four cases have been described of elderly patients without comorbidity with simultaneous bilateral hip fractures following low - energy traumas . a unilateral hip fracture is a very common diagnosis in most hospitals , while bilateral hip fractures are not . a literature study did yield many case reports describing bilateral fractures caused ; however , they had been caused by violent forces or in patients with metabolic disorders . simultaneous bilateral hip fractures due to a simple fall in a patient with no relevant comorbidity appear to be very rare . we , however , present the case of an elderly patient with simultaneous bilateral hip fractures after a simple mechanical fall who did not suffer from any predilecting comorbidities . a 90 - year - old man was admitted to our emergency department after a simple fall from his bed ( height 1 m ) . he had wanted to get out of bed independently and had forgotten that he needed his walker . he was found on the floor by caretakers after a call for help and was unable to get up . his medical history was remarkable for obesity ( body mass index , 35 ) , cardiac ischemia , parkinson s disease and chronic renal insufficiency . before hospital admission , he resided in a convalescent home and he mobilized with the aid of a walker . clinical examination revealed external rotation of both legs and pain on passive movement of both sides of the hips . plain radiographs of the pelvis showed bilateral slightly displaced intertrochanteric fractures of both femoral bones ( fig .1 ) . in the ao classification of trochanteric femoral fractures classified as type 31 . a3 , a reverse oblique fracture with the fracture line passing between the minor and major trochanters , with an abduction of the proximal fragment due to the pull of the abductor muscles . there were no signs of osteoporosis or osteopenia due to decreased mobility nor did the patient have any signs of an underlying malignant illness on chest x - ray . the glomerular filtration rate was 34 with slightly increased serum values of urea ( 13.6 mmol / l ) and creatinine ( 152 mol / l ) . surgical treatment was discussed with the patient and his family , and informed consent was obtained . under general anesthesiaboth fractures were treated by bilateral intramedullary nailing using the extended stryker gamma3 intramedullary nail fixation ( kalamazoo , mi ) in one surgical session . the extended gamma nails were locked statically leaving the possibility to convert them to the dynamic state at a later point in time . the combined surgical procedure lasted 4 hours and 21 minutes with an estimated blood loss of 200 ml and without occurrence of hypotension , bradycardia or decreased oxygen saturation . the patient was able to mobilize , fully bearing weight , supervised by a physical therapist within 4 days postoperatively . he was ready to be discharged back to his convalescent home 9 days postoperatively with improved kidney function ( glomerular filtration rate of 51 ) . figure 1 : plain anterior posterior radiograph of the right hip showing a displaced intertrochanteric neck of femur fracture . plain anterior posterior radiograph of the left hip showing a slightly displaced intertrochanteric neck of femur fracture . plain anterior posterior radiograph of the right hip showing a displaced intertrochanteric neck of femur fracture . plain anterior posterior radiograph of the left hip showing a slightly displaced intertrochanteric neck of femur fracture . a retrospective study in a level i trauma center concluded that over a 10 - year period , only 8 out of 2426 patients with hip fractures had simultaneous bilateral hip fractures ( 0.3 % ) , all following high - energy traumas . following low - energy traumas simultaneous bilateral hip fractures are progressively infrequent , especially in patients without relevant comorbidity . the first case describing this rarity was published in 1997 by kumar delineating the case of an 89 - year - old woman after a simple trip and fall in her own home . her medical and surgical history included hypertension and cecal carcinoma for which she underwent a right colectomy 10 years earlier . the pathology report showed mild osteoporosis . in 2008 , grisoni described two elderly patients with simultaneous bilateral hip fractures , both were women of 86 and 88 years of age sustaining the fractures after simple mechanical fall and significant comorbid health conditions : ( i ) hypertension , coronary artery disease , congestive heart failure , atrial fibrillation and chronic renal insufficiency and ( ii ) chronic obstructive pulmonary disease , hypertension , coronary artery disease and breast cancer . sood in 2009 reported the first man sustaining these fractures ; an 84 - year - old man who fell down three steps of stairs and sustained bilateral neck of femur fractures . a low - energy trauma is a common mechanism of injury often leading to a unilateral hip fracture in the elderly . we must conclude that simple mechanical falls can , very rarely , also lead to simultaneous bilateral hip fractures in patients with no specific risk factors other than their age . clinicians must be alert to the possibility of simultaneous bilateral hip fractures especially in the elderly . none declared . figure 2 : compilation of intraoperative radiographs demonstrating correct placement of the gamma nails bilaterally .\noutput:\n" }, { "from": "agent", "value": "simultaneous bilateral hip fractures are rare , mostly being caused by violent forces or in patients with bone metabolism disorders . we present the case of an elderly patient who sustained simultaneous bilateral hip fractures following a simple fall without having any known predilecting comorbidities other than advanced age . only four cases have been described of elderly patients without comorbidity with simultaneous bilateral hip fractures following low - energy traumas . this rareness potentially leads to misses of this diagnosis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although noninvasive ventilation ( niv ) has been used to treat acute respiratory failure for well over a decade , our knowledge on how best to apply it continues to evolve . relatively little debate surrounds its use for acute respiratory failure due to exacerbations of chronic obstructive pulmonary disease , cardiogenic pulmonary edema or in immunocompromised hosts . however , its appropriate use to treat hypoxemic respiratory failure , particularly patients with acute lung injury / acute respiratory distress syndrome ( ali / ards ) , remains unclear . in the previous issue of critical care , rana andrana and colleagues evaluated the outcomes of an observational cohort of patients with ali treated with niv as the initial mode of therapy . of a total of 358 patients started on niv at one hospital over a 6 month period , 79 were identified as having ali as defined by bilateral chest infiltrates , a pao2 / fio2300 and no evidence of left heart failure . after excluding do not recussitate / do not intubate patients and two who declined to participate , 54 patients were left for analysis . two - thirds of this group ( 38 patients or 70.3 % ) failed niv , including all 19 patients with shock . when those patients without shock were evaluated in a multivariate logistic regression analysis , metabolic acidosis ( odds ratio 1.27 , 95 % confidence interval 1.030.07 per unit of base deficit ) and severe hypoxemia ( odds ratio 1.03 , 95 % confidence interval 1.011.05 per unit decrease in pao2 / fio2 ) remained significant predictors of niv failure . although statistically significant , these odds ratios demonstrate a very weak association . identifying factors that reliably predict niv failure is desirable so that patients likely to fail can be excluded . antonelli and colleagues found that a pao2 / fio2 ratio of 146 or less after one hour of niv was an independent risk factor for intubation ( odds ratio 2.51 ) . the rana study found that the mean pao2 / fio2 in the niv success group was 147 and 112 in the failure group , but the timing of the measurement relative to the initiation of niv was not specified . also , although patients who showed improved oxygenation with niv tended to have better outcomes , this did not reach significance . the small numbers and lack of a clear oxygenation threshold for niv failure limits the clinical applicability of these data . acidosis has also been identified as a predictor of niv failure in earlier trials , and the finding by rana and colleagues that metabolic acidosis was associated with niv failure may reflect the greater severity of illness in the patients who failed . again , the lack of a threshold value for acidosis limits the clinical applicability of these findings . nonetheless , the findings underline the importance of obtaining baseline arterial blood gases when assessing ali / ards patients for receipt of niv . considering that hypotensiveshock has been considered a contraindication to niv in many of the controlled trials , it is a bit shocking that 35 % of the patients who were included in the rana cohort had septic shock . although the authors are correct in stating that no prior evidence supported the proscription , their finding that all 19 patients with septic shock who were placed on niv failed should lay the issue to rest and solidify the place of septic shock on the list of contraindications to niv . limitations of cohort analyses like that of rana and colleagues include the lack of prospective criteria for initiation of niv and intubation in the face of niv failure . patients with worse oxygenation indexes or metabolic acidoses or septic shock are intubated because the clinicians were responding to preconceived biases and the predictors , in essence , are self - fulfilling prophecies . lacking a control group , this possibility can not be rejected . this is a particular limitation when interpreting the finding that outcomes were much better in patients succeeding on niv than in those who failed ( mortality none versus 68 % , respectively ) . this finding is predictable , of course those who avoid intubation tend to do well . butlacking controls , it is impossible to know whether the group as a whole ( successes and failures ) did better or worse than it would have had intubation been the initial therapy . this is of particular concern in view of the trial of esteban and colleagues , which showed an increased intensive care unit mortality among niv patients whose intubation was delayed compared to controls . the concern is that some patients treated with niv as initial therapy might have had their needed intubations delayed . in addition to conferring better outcomes on the successes , niv might have worsened outcomes in patients whose intubations were delayed . the study by squadrone and colleagues is reassuring in this regard in that it demonstrated that patients failing niv fared no worse than patients intubated from the start , but the patients had chronic obstructive pulmonary disease , not ali / ards . an interesting and provocative speculation by the authors is that the higher tidal volumes among patients who failed niv contributed to excessive lung stretch , worsening lung injury and contributing to niv failure . it seems at least equally likely that the larger tidal volumes were markers of more severe disease , reflecting higher rates of catabolism and larger dead spaces , and this explains the worse outcomes . however , we agree that it is an intriguing hypothesis that requires more study . what messages should we take away from the study by rana and colleagues regarding the selection of appropriate ali patients for a trial of niv ? is there a severity of acute respiratory failure beyond which niv should not be used ? with our current niv technology , it seems sensible to exclude patients from consideration who have multi - organ dysfunction , or are poor candidates for niv by virtue of inability to cooperate or protect the airway , or because of excessive secretions . clearly , niv should be avoided in patients with shock , severe hypoxemia or acidosis . the more difficult issue is whether there is a threshold of severity for hypoxemia and acidosis beyond which niv should be considered contraindicated . the study by rana and colleagues does not provide sufficient precision to answer the question , even in the context of prior studies . for now , we recommend selecting ali / ards patients for niv according to general selection guidelines . these patients should be closely monitored in an intensive care unit setting and , if there is no improvement in oxygenation ( pao2 / fio2 into the range of 150 ) , ph or vital signs within the first 1 to 2 hours , intubated . the greatest value of the rana and colleagues study is to highlight the need for larger prospective studies to better define criteria for selecting ali / ards patients for niv . ali / ards = acute lung injury / acute respiratory distress syndrome ; niv = noninvasive ventilation .\noutput:\n" }, { "from": "agent", "value": "the selection of patients with acute lung injury / acute respiratory distress syndrome ( ali / ards ) to receive noninvasive ventilation ( niv ) is challenging , partly because there are few reliable selection criteria . the study by rana and colleagues in the previous issue of critical care identifies metabolic acidosis and a lower oxygenation index as predictors of niv failure , although it is unable to identify threshold values . it also demonstrates that treating patients with niv for ali / ards and shock is an exercise in futility . future studies need to focus on criteria that will enable selection of patients for whom niv will have a high likelihood of success ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we examined three datasets in which non - hispanic white and black adult subjects without known diabetes had both an ogtt and a1c measured ( 15 ) . in the screening for impaired glucose tolerance ( sigt ) study ( 16 ) , health care system employees and community members in atlanta were eligible if they were aged 18 or above , were non - hispanic white or black race , had no prior diagnosis of diabetes , were not pregnant or breastfeeding , were not taking glucocorticoids , and were well enough to work . the national health and nutrition examination surveys ( nhanes ) assessed adults and children across the u.s . in nhanes iii ( 17 ) , 2,057 non - hispanic black or white subjects ( to match the sigt study population ) aged 40 years with no known history of diabetes had an ogtt , meeting the inclusion criteria . in nhanes 20052006 ( 18 ) , age , bmi , blood pressure , lipids , and family history were categorized using conventional criteria . after subjects with missing data were excluded , there were 2,014 subjects in nhanes iii and 1,111 subjects in nhanes 20052006 , as described previously ( 15 ) . plasma glucose and a1c measurements have been described previously ( 1618 ) . glucose tolerance was classified by ada criteria on the basis of glucose levels in a single 75 - g ogtt . subjects were grouped as normal glucose tolerance ( fasting plasma glucose [ fpg ] 100 mg / dl , with 2 - h plasma glucose 140 mg / dl ) , pre - diabetes ( impaired fasting glucose with fpg 100125 mg / dl and 2 - h plasma glucose 200 mg / dl and / or impaired glucose tolerance with fpg 126 mg / dl and 2 - h plasma glucose 140199 mg / dl ) , and diabetes ( fpg 126 mg / dl or 2 - h plasma glucose 200 mg / dl ) . the additional iec criteria identified subjects as normal ( a1c 6 % ) , high risk for diabetes ( a1c 6.06.4 % ) , and diabetes ( a1c 6.5 % ) , whereas new ada criteria identified subjects as normal ( a1c 5.7 % ) , high risk ( a1c 5.76.4 % ) , and diabetes ( a1c 6.5 % ) . dysglycemia includes pre - diabetes or diabetes ( ogtt ) or high risk or diabetes ( a1c ) . means and frequencies were determined in aggregate and by subgroup analysis of the different glucose tolerance categories . the discriminative effectiveness of screening was evaluated by the area under receiver operating characteristic ( roc ) curves using sas 9.2 ( sas institute , cary , nc ) for the nhanes data and spss 15.0 ( spss , chicago , il ) for sigt study data . all nhanes analyses were conducted using sas 9.2 and sudaan version 10 ( rti international , research triangle park , nc ) to account for the complex survey design . prevalence estimates from nhanes studies were weighted , except where noted or when small sample sizes made weighting estimates unstable ; 95 % cis were calculated using the wilson score method . paired t tests compared rates of apparent false - positive and false - negative identification of diabetes or high risk in black and white subjects . population estimates were derived from the results of the weighted nhanes 20052006 dataset and applied to non - hispanic black or white adults for whom data were available ( 156 million individuals ) . a1c measurements used ngsp certified systems ( supplementary material , available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc10-0433/dc1 ) . glucose tolerance was classified by ada criteria on the basis of glucose levels in a single 75 - g ogtt . subjects were grouped as normal glucose tolerance ( fasting plasma glucose [ fpg ] 100 mg / dl , with 2 - h plasma glucose 140 mg / dl ) , pre - diabetes ( impaired fasting glucose with fpg 100125 mg / dl and 2 - h plasma glucose 200 mg / dl and / or impaired glucose tolerance with fpg 126 mg / dl and 2 - h plasma glucose 140199 mg / dl ) , and diabetes ( fpg 126 mg / dl or 2 - h plasma glucose 200 mg / dl ) . the additional iec criteria identified subjects as normal ( a1c 6 % ) , high risk for diabetes ( a1c 6.06.4 % ) , and diabetes ( a1c 6.5 % ) , whereas new ada criteria identified subjects as normal ( a1c 5.7 % ) , high risk ( a1c 5.76.4 % ) , and diabetes ( a1c 6.5 % ) . dysglycemia includes pre - diabetes or diabetes ( ogtt ) or high risk or diabetes ( a1c ) . means and frequencies were determined in aggregate and by subgroup analysis of the different glucose tolerance categories . the discriminative effectiveness of screening was evaluated by the area under receiver operating characteristic ( roc ) curves using sas 9.2 ( sas institute , cary , nc ) for the nhanes data and spss 15.0 ( spss , chicago , il ) for sigt study data . all nhanes analyses were conducted using sas 9.2 and sudaan version 10 ( rti international , research triangle park , nc ) to account for the complex survey design . prevalence estimates from nhanes studies were weighted , except where noted or when small sample sizes made weighting estimates unstable ; 95 % cis were calculated using the wilson score method . paired t tests compared rates of apparent false - positive and false - negative identification of diabetes or high risk in black and white subjects . population estimates were derived from the results of the weighted nhanes 20052006 dataset and applied to non - hispanic black or white adults for whom data were available ( 156 million individuals ) . as reported previously ( 16 ) , the 1,581 sigt study subjects had an average age of 48 years and bmi of 30.3 kg / m ; 42 % were male , and 58 % were black . the 2,014 nhanes iii subjects had an average age of 55 years and bmi of 27.3 kg / m ; 47 % were male , and 10 % were black . the 1,111 nhanes 20052006 subjects had an average age of 46 years and bmi of 28.5 kg / m ; 49 % were male , and 13 % were black ( supplementary tables 1a1c , available in an online appendix ) . using ogtt results , 5.8 % of the combined study subjects had new diabetes , and 36 % had pre - diabetes ( table 1 ) . moreover , the proportions were similar in the three study populations : 4.6 and 33 % in the sigt study ( 16 ) , 7.6 and 38 % in nhanes iii , and 5.2 and 36 % in nhanes 20052006 ( supplementary tables 1a1c ) . in contrast , assessment by a1c was different from ogtt characterization : 2.3 % of combined subjects were categorized as diabetes and 6.2 % were high risk by iec criteria , whereas 2.3 % were categorized as diabetes and 19.5 % were high risk by ada criteria . the three populations were categorized in similar proportions by a1c with the iec and ada criteria . subjects identified by ogtt compared with a1c diagnoses every subject was mapped according to an ogtt and a1c diagnostic criteria into 33 tables , and the percentage of the subjects within each dataset was determined . each value in the upper rows is the mean and sem of row - wise percentages , and percentage of subjects in each ogtt category is also included . the lower rows show the percentage of the entire population . * data in a1c categories for diabetesthus , compared with an ogtt , a1c testing resulted in more normal diagnoses ( categorizations ) and fewer high risk and diabetes diagnoses with both the iec and ada criteria . the ada criteria resulted in a distribution of diagnoses more similar to those with the ogtt criteria by identifying more subjects as high risk and fewer subjects as normal . the different distribution for ogtt versus the a1c criteria was seen in males , females , and non - hispanic whites but not in non - hispanic blacks ( supplemental tables 1a1c ) , in whom a1c diagnoses of diabetes and high risk using the ada criteria were more frequent . a1c - based categorizations were mostly incorrect for ogtt diagnoses of both pre - diabetes and diabetes . use of both the ada and the iec criteria would result in more false - positive and false - negative categorizations than with the ogtt ( table 2 ) , generally more false - negative than false - positive results . the iec criteria generated more false - negative and fewer false - positive results than the ada criteria . incorrect identifications across the three datasets averaged 90 and 71 % for pre - diabetes ( by iec and ada criteria , respectively , combining false - positive and false - negative results ) , 84 and 65 % for dysglycemia ( all false - negative results ) , and 70 % for diabetes ( all false - negative results ) . extrapolating the nhanes 20052006 findings to the non - hispanic american adult population , a1c testing would incorrectly identify diabetes in 6.5 million ( false - positive and false - negative results ) . a1c testing for pre - diabetes would also be incorrect for 43 million americans using the ada criteria and 52 million using the iec criteria , with the majority of those being pre - diabetic by an ogtt but normal by a1c ( table 2 ) . importantly , the ada criteria would also label non - hispanic americans with normal results on the ogtt ( 5.8 million as high risk and 75,000 as diabetes ) . rates of correct and incorrect classification correct or incorrect classification within each diagnostic category was evaluated in each dataset , and the average sem of the rates across the three datasets is listed . % correct is the proportion of subjects with a given ogtt diagnostic criterion who were correctly identified by a1c diagnostic criteria . incorrect diagnoses were false positive ( fp ) and false negative ( fn ) , which were further categorized as being incorrectly normal , high risk , or diabetes per a1c testing . sigt study proportions were calculated from raw data ; nhanes proportions were calculated from weighted estimates . roc curve analyses were performed to determine whether screening categorization by a1c versus ogtt was independent of cutoff values . roc curve areas were lowest for pre - diabetes and higher for diabetes ( fig .1 ) . only for diabetes were areas under the roc curve areas 0.80 ( 0.82 in the sigt study , 0.80 in nhanes iii , and 0.83 in nhanes 20052006 ) , whereas for pre - diabetes they were lowest ( 0.65 in sigt study , 0.62 in nhanes iii , and 0.68 in nhanes 20052006 ) , and intermediate for dysglycemia ( 0.67 in the sigt study , 0.66 in nhanes iii , and 0.70 in nhanes 20052006 ) . roc curve analyses for each of the three datasets , showing a1c screening to detect pre - diabetes , dysglycemia , and diabetes . , 0.5 % intervals of a1c ; , ada and iec cutoff for diabetes at a1c = 6.5 % ; , ada cutoff for high risk at a1c = 5.7 % ; , iec cutoff for high risk at a1c = 6.0 % . points are labeled with a1c values . , sigt study ; , nhanes iii ; , nhanes 20052006 . to assess alternative cutoffs , we evaluated sensitivity , specificity , positive predictive value , and negative predictive value for different a1c cutoffs across the three datasets ( supplementary table 2 , available in an online appendix ) . both the iec and the ada criteria are specific for diagnosing diabetes and pre - diabetes ( 90 % specificity above a1c cutoffs of 6.0 % ) but insensitive for both diabetes ( 34 % at a1c cutoff 6.5 % ) and pre - diabetes ( lowest with iec criteria : 31 % above the cutoff of 5.7 % and 13 % above the a1c cutoff of 6.0 % ) . approximately equalsensitivity and specificity would be provided by cutoffs of 5.35.5 % for pre - diabetes or dysglycemia and of 5.55.8 % for diabetes . the sum of sensitivity and specificity was maximized at 5.45.6 % for pre - diabetes , 5.55.6 % for dysglycemia , and 5.75.9 % for diabetes . however , even cutoffs maximizing the sum of sensitivity and specificity for the nhanes 20052006 dataset ( a1c 5.4 % for high risk and 5.7 % for diabetes ) would incorrectly identify diabetes in 21 million ( 19 million false - positive results and 2.2 million false - negative results ) and incorrectly identify high risk in 59 million non - hispanic american adults , with fewer false - positive results but more false - positive results at these lower cutoffs . repeating the above analyses with a higher fasting plasma glucose cutoff for normal glucose tolerance ( fpg 110 mg / dl ) did not change the results ( see supplementary tables 2 , 3 , and 4 , and supplementary figthere would be more false - negative results and fewer false - positive results ( fig .2 ) in non - hispanic whites than blacks with both the iec and ada criteria ( p 0.05 for both ) . of those with diabetes by ogtt , 78 % of whites vs. 51 % of blacks would have false - negative results ( p 0.01 ) , whereas 0.3 % of whites vs. 1.8 % of blacks without diabetes would have false - positive results ( p = 0.15 ) . with the iec criteria for high risk , 94 % of whites vs. 77 % of blacks with pre - diabetes by ogtt would have false - negative results , whereas 1.7 % of whites vs. 9.0 % of blacks without pre - diabetes would have false - positive results ( p 0.02 that whites have more false - negative and less false - positive results ) . at the lower ada cutoff for high risk , there would be fewer false - negative but more false - positive results : 78 % of whites vs. 56 % of blacks with pre - diabetes by ogtt would have false - negative results , whereas 8.5 % of whites vs. 18 % of blacks without pre - diabetes would have false - positive results ( p 0.05 that whites have more false - negative than false - positive results ) . however , the percentage of incorrectly identified high - risk subjects ( false - negative plus false - positive results ) with a1c screening for pre - diabetes was lower with the ada criteria : 96 % of whites and 86 % of blacks with the iec criteria vs. 87 % of whites and 73 % of blacks with the ada criteria . rates of false - positive and false - negative a1c screening compared with ogtt screening according to race across the three study populations . the rates of subjects with false - positive ( fp ) and false - negative ( fn ) results for black and white subgroups across the populations are shown as mean sem . with extrapolation from the nhanes 20052006 dataset , a1c screening with the iec and ada criteria would incorrectly identify diabetes ( false - positive or false - negative results ) in 470,000 black and 6 million white non - hispanic americans . the iec criteria would incorrectly identify high risk in 6 million black and 42 million white non - hispanic americans . although there would be fewer missed subjects using the ada criteria , potentially incorrect diagnoses would only be reduced for non - hispanic black adults , incorrectly identifying high risk in 4 million black but 47 million white non - hispanic americans . our analyses demonstrate that the iec and ada a1c diagnostic criteria have limitations for use in screening , which include 1 ) high specificity but low sensitivity , 2 ) intrinsic inaccuracy even with alternative cutoffs , and 3 ) discrepant application to different racial groups . the results are consistent with two different methodologies for measurement of a1c ( immunoassay in the sigt study and high - performance liquid chromatography in nhanes ) and with one dataset including black and white volunteers ( the sigt study ) and two others representative of the non - hispanic american population ( nhanes iii and nhanes 20052006 ) . although our findings support diagnosing diabetes by the proposed a1c criteria as rarely false positive , use of the proposed criteria would not be a good screening strategy to identify the many americans who currently have unrecognized diabetes or pre - diabetes as found with ogtts , a diagnostic standard currently used around the world . although the iec and ada did not recommend use of their criteria for screening , a1c testing has attractive features , including simplicity , standardization , availability , low day - to - day variability , and lack of need for prior fasting or restriction in time of measurement , and a1c is widely used as an indicator of diabetes control . in addition , the iec stated that a1c may be better than glycemic criteria for diagnosing diabetes ( 4 ) , and the ada listed the a1c criteria above the glycemic criteria ( 5 ) . however , other workers have questioned the use of a1c measurements for diagnosis ( 6,19 ) . the iec criteria would miss diagnoses of diabetes and pre - diabetes in an older , predominantly white american population ( 8 ) , and in another nhanes population with measurement of fpg but no ogtts ( 7 ) , and roc curve areas , sensitivity and specificity were similar to those in the current study with an american population enriched in hispanic adults ( 12 ) . there was greater variability in the international studies ( 911,13 ) , possibly reflecting ethnic and racial differences as well as differences in the underlying rates of undiagnosed diabetes ( 9,11 ) . none of the studies found the iec high - risk criteria to be similar to pre - diabetes with ogtts ( 10,11,13 ) . it is beyond our analysis to address the accuracy of ogtt versus a1c , but they differ intrinsically . a1c within an individual fluctuates little from day to day , whereas an ogtt can reflect day - to - day differences in insulin secretion and insulin action . as such , a1c should better assess glycemic trends over several months , whereas an ogtt should better assess immediate glucose homeostasis . moreover , there is substantial interindividual variation in a1c at the same levels of glycemia ( 20,21 ) , reflecting differences in red cell penetration , glycation , hemoglobin species , red cell half - life , vitamin and medication status , and others factors ( 22 ) . such variation would be expected to make it more difficult for a1c measurements to distinguish small differences in glycemia , e.g. , pre - diabetes versus normal . our findings that the proposed a1c criteria result in more false - positive and fewer false - negative results in blacks compared with whites are consistent with previous reports that at similar glucose levels , a1c levels are higher in blacks than whites ( 23 ) . the strengths of our study include assessments in 4,500 subjects , similarity of findings across multiple datasets with different a1c methodologies , evaluation of both iec and ada criteria , comparison of the general utility of a1c screening with the specific problems of the proposed criteria , and the identification of potential problems in applications to different racial / ethnic groups . one limitation is performance of only a single ogtt , but such an approach reflects clinical practice . moreover , abnormal results on a single ogtt was highly predictive of subsequent diabetes in pima indians ( 24 ) , and differences found on repeat studies should be included in the variability of the roc curve analyses . we also did not search for factors that can be problematic for a1c measurements , such as hemoglobinopathies and anemia . further studies would be required before our findings with the ada criteria could be generalized to other racial / ethnic groups , but problems with the iec criteria have been reported with diverse populations ( 8,9,12 ) . although a1c screening may be of limited value , better test characteristics appear to be provided by measuring random plasma glucose ( 25 ) or glucose 1 h after a 50 - g oral glucose challenge ( 16 ) ; either could be obtained opportunistically during office visits , at any time of day , and without a prior fast . other tests or combinations of testsmay also be useful , and it is possible that health economics analyses would identify one or another test as being more cost - effective in different patient populations and clinical settings . we still need to identify previously unrecognized diabetes and pre - diabetes to initiate preventive management .\noutput:\n" }, { "from": "agent", "value": "objectivean international expert committee ( iec ) and the american diabetes association ( ada ) proposed diagnostic criteria for diabetes and pre - diabetes based on a1c levels . we hypothesized that screening for diabetes and pre - diabetes with a1c measurements would differ from using oral glucose tolerance tests ( ogtt ) . research design and methodswe compared pre - diabetes , dysglycemia ( diabetes or pre - diabetes ) , and diabetes identified by the proposed criteria ( a1c 6.5 % for diabetes and 6.06.4 % [ iec ] or 5.76.4 % [ ada ] for high risk / pre - diabetes ) with standard ogtt diagnoses in three datasets . non - hispanic white or black adults without known diabetes who had a1c and 75 - g ogtt measurements were included from the prospective screening for impaired glucose tolerance study ( n = 1,581 ) , and from the national health and nutrition examination survey ( nhanes ) iii ( n = 2014 ) , and nhanes 20052006 ( n = 1,111 ) . resultsogtts revealed pre - diabetes in 35.8 % and diabetes in 5.2 % of combined study subjects . a1c provided receiver operating characteristic ( roc ) curve areas for diabetes of 0.790.83 , but roc curve areas were 0.70 for dysglycemia or pre - diabetes . the proposed criteria missed 70 % of individuals with diabetes , 7184 % with dysglycemia , and 8294 % with pre - diabetes . compared with the iec criteria , the ada criteria for pre - diabetes resulted in fewer false - negative and more false - positive result . there were also racial differences , with false - positive results being more common in black subjects and false - negative results being more common in white subjects . with use of nhanes 20052006 data , 5.9 million non - hispanic u.s . adults with unrecognized diabetes and 4352 million with pre - diabetes would be missed by screening with a1c.conclusionsthe proposed a1c diagnostic criteria are insensitive and racially discrepant for screening , missing most americans with undiagnosed diabetes and pre - diabetes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: empty sella ( es ) is a rare disorder which can be due to pituitary surgery for tumours , spontaneous infarction in pituitary tumours , benign intracranial hypertension , lymphocytic hypophysitis , sheehan 's syndrome , cranial irradiation , trauma or idiopathic patients with es may be asymptomatic or present with features of one or more pituitary hormone deficiencies . asymptomatic pituitary hyperplasia in patients with primary hypothyroidism varies from 25 % to 81 % , and is especially common in patients with thyroid stimulating hormone ( tsh ) levels 50 iu / ml ( 70 % ) , which is usually reversible within weeks to months of levothyroxine replacement . symptoms of raised intracranial tension ( ict ) due to growing sellar / suprasellar mass are uncommon in these patients and their usual presenting feature is overt symptoms of primary hypothyroidism . occasionally pituitary adenomas have been described in patients with primary hypothyroidism , which resolved with levothyroxine therapy . we present a man with severe short stature due to chronic untreated hypothyroidism who initially had features of raised ict and subsequently over 21 years developed es along with multiple pituitary hormone deficiency ( mphd ) . a 27 - year - old man , born of non - consanguineous marriage , with normal perinatal history and milestones , complained of recurrent episodes of vomiting with headache since 6 years of age along with generalized weakness , fatigue ability , malaise and swelling of the body . however , he did not seek formal medical advice at that time due to lack of awareness and poverty . evaluation for the persisting headache at 11 years of age ( 1995 ) lead to a computerized tomography ( ct ) brain , which showed a homogenously enhancing midline mass in the pituitary fossa suggestive of pituitary hyperplasia [ figure 1 ] . computerized tomography brain with contrast showing homogenously enhancing mass in the sella suggestive of pituitary hyperplasia ( 11 years age ; 1995 ) he presented to us for the first time 6 years back ( in 2005 , 21 years age ) with persistence of the previous complaints . examination at that time was significant for grade - 2 soft goitre , depressed nasal bridge , absent axillary and pubic hair , and bilateral testicular volume of 8 ml each . biochemical evaluation revealed severe primary hypothyroidism , a diagnosis which was likely missed all these years [ table 1 ] . patient responded dramatically to treatment , with rapid resolution of all symptoms within months along with a height gain of 28 cm in 6 years ( from 105 cm to 133 cm ) [ table 1 ] . changes in height , bone age and thyroid function with levothyroxine replacement over 6 years he now complained of progressively worsening nausea , vomiting and fatigue for the last 1 year , along with weight loss . examination was significant for severe short stature ( height - 133 cm ; standard deviation score - 7.36 ) , normal blood pressure ( 90/60 mm hg ) , lack of facial hair and signs of masculinization , normal phallus , tanner - ii stage public hair and bilateral testicular volume of 8 ml [ figure 2 ] . hormonal evaluation this time was significant for secondary hypocortisolism , low igf - 1 and hypogonadotropic hypogonadism [ table 2 ] . t1 weighted ( t1w ) mri brain ( after 6 years of levothyroxine therapy ) revealed an es with intact posterior pituitary signal [ figure 3 ] . profile of the patient showing short stature , with pre - pubertal facial features ; stadiometer showing sever short stature ( height 133 years at 27 years age ) hormonal analysis showing multiple pituitary hormone deficiency t1w mri brain ( saggital section ) showing empty sella ( arrow ) ; coronal section showing es with stalk visible till the floor of sella ( arrow ) ( 27 years age , 2011 ) hydrocortisone supplementation was started at 15 mg per day . testosterone propionate 20 mg , testosterone phenlypropionate 40 mg and testosterone isocaprote 40 mg injection ( sustanon - 100 , organon , india ) was started every 3 weekly . the loss of thyroxine feedback inhibition and the subsequent overproduction of thyrotropin - releasing hormone ( trh ) in a patient with long - standing primary hypothyroidism results in hyperplasia of the thyrotroph cells and subsequent enlargement of the pituitary gland . occurrence of es following treatment of primary hypothyroidism is extremely uncommon and only three cases reported to the best of our knowledge . panhypopituitarism as a sequel of pituitary hyperplasia secondary to untreated primary hypothyroidism has not been reported to the best of our knowledge . our patient likely had primary hypothyroidism since 6 years of age , a diagnosis which was missed until 21 years of age . pituitary hyperplasia [ figure 1 ] was a result of this lack of feedback inhibition of trh mediated tsh release . treatment of primary hypothyroidism even at 21 years of age leads to significant height improvement ( 28 cm ) [ table 1 ] . the protracted phase of untreated hypothyroidism ( 15 years ) may have led to uncontrolled thyrotroph hyperplasia , damaging the adjacent somatotrophs , corticotrophs and gonadotrophs , leading to mphd and es . this is perhaps the first report of panhypopituitarism developing in a patient of primary hypothyroidism who had pituitary hyperplasia . evaluation of anterior pituitary function is advisable in patients of chronic untreated primary hypothyroidism , especially those who have headache or visual disturbances .\noutput:\n" }, { "from": "agent", "value": "asymptomatic reversible pituitary hyperplasia is common in patients with untreated primary hypothyroidism . occurrence of empty sella ( es ) in this scenario is extremely rare ( only three reports till the date ) and panhypopituitarism has not been reported in such patients . we report a 27 year man with severe short stature ( height - 133 cm ; standard deviation score - 7.36 ) and delayed puberty who had symptoms suggestive of hypothyroidism along with chronic persistent headache since 6 years of age . pituitary imaging done for headache at 11 years age showed pituitary hyperplasia . he was diagnosed of primary hypothyroidism for the 1st time at 21 year age , a diagnosis which was likely missed for 15 years . levothyroxine therapy leads to resolution of all symptoms and a height gain of 28 cm over last 6 years . evaluation for lack of progression of puberty along with chronic nausea , vomiting , fatigue and weight loss for the last 1 year revealed secondary hypocortisolism ( 9 am cortisol - 4.8 mcg / dl ; acth - 3.2 pg / ml ) , growth hormone deficiency ( igf - 1 : 65 ng / ml ; normal : 117 - 325 ng / ml ) and hypogonadotrophic hypogonadism ( 9 am testosterone : 98 ng / dl ; [ 280 - 1500 ] lh - 0.01 miu / l [ 1.14 - 5.75 ] ) with es on magnetic resonance imaging ( mri ) brain . uncontrolled thyrotroph hyperplasia due to chronic untreated primary hypothyroidism for 15 years may have been damaging the adjacent corticotrophs , somatotrophs and gonadotrophs resulting in panhypopituitarism and empty sella . this is perhaps the first report of panhypopituitarism with empty sella syndrome developing in a patient with pituitary hyperplasia , a sequel of chronic untreated primary hypothyroidism ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: laparoscopic surgery is as safe as open colorectal surgery , and laparoscopic colorectal cancer surgery is possible but should be performed within clinical studies and at surgical centers that have sufficient experience with laparoscopic colorectal surgery for benign diseases . in addition to the ongoing discussion about the oncologic safety of this approach , it is not yet clear whether the laparoscopic approach offers significant immunological advantages over the conventional approach . some have suggested that the differences in cytokine and immune response noted after laparoscopic colorectal surgery are related to the extent of abdominal wall trauma , and thus one would anticipate less marked differences following laparoscopic - assisted colectomy . the intestinal epithelium undergoes a process of continuous renewal and consist of cells in various stages of differentiation . the integrity of the intestinal epithelium is critical to health and any damage to the cells can influence the proliferation and differentiation , leading to altered cell population and functional changes in the intestine . the intestine acts as a barrier to the luminal contents , which include bacteria and endotoxins . the gut barrier is altered in some pathological conditions such as shock , trauma , or surgical stress , resulting in bacterial and / or endotoxin translocation from the gut lumen into the systemic circulation . this has been implicated in postoperative complications , such as systemic inflammatory response syndrome ( sirs ) and multiorgan failure ( mof ) . as laparoscopic colorectal surgery is recognized as a mini - invasive surgery ; in this prospective randomized study , we investigated the effect of surgical intervention on intestinal permeability ( ip ) , and endotoxemia in patients undergoing elective colectomy for colon cancer comparing laparoscopic with open approach . from march 2007 to february 2015 , we studied , in a prospective randomized study , 123 patients ( pts ) consecutively ( 73 men and 47 women ; mean age , 69.4 years ) with colon cancer [ table 1 ] . patients were randomly assigned to be treated with laparoscopic or open approach , according to a computer - generated table of random numbers . the patient and the surgeon were informed about the type of approach just before the intervention . the ethical committee of faculty of medicine of the university of l'aquila approved the study protocol , and informed consent was obtained for every patient . colon cancer : open ( group1 ) and laparoscopic resection ( group 2 ) patients with a known immune dysfunction ( advanced liver disease , human immunodeficiency virus ( hiv ) infection , hepatitis c virus infection ) and cardiac or pulmonary insufficiency were excluded for the study . patients were also excluded if they had evidence of intraperitoneal sepsis or peritoneal contamination and if they had received antibiotics whitin 2 weeks prior to surgery . during hospitalization , patients were not given antispastic drugs , steroids , or nonsteroidal anti - inflammatory drugs ( nsaids ) . the patients were classified according to the american society of anesthesiologists ( asa ) grading system as grade i , ii , or iii [ table 1 ] . thirty - six patients had primary adenocarcinoma of the colon and 50 of the sigmoid colon . open resection ( or ) was performed on 61 patients , while laparoscopic resection ( lr ) was adopted for 62 patients [ table 1 ] . minimally - invasive colorectal surgery was performed as a laparoscopic - assisted procedure with removal of the resected specimen method by a horizontal minilaparotomy ( mean 5.8 cm : range 5 - 8 cm ) just above the mons pubis . laparoscopic surgery was performed using a 4 - trocar technique with 1 trocar ( 10 mm ) inserted through a paraumbilical incision ( camera port ) . two additional ( 5 - or 10 mm ) trocars were inserted in the right and left of lower abdomen , and one trocar ( 12 mm ) was inserted in the midline just above the mons pubis ( the site of the minilaparotomy ) . after removal of the resected specimen and preparation of the stapler anastomosis , we closed the minilaparotomy and reintroduced the pneumoperitoneum . conventional colorectal surgery was performed through a vertical midline incision ranging from 5 to 10 cm above the umbilicus to the mons pubis . after removing the resected specimenall operations were performed by a single surgeon ( gianfranco amicucci , m.d . ) . the tnm system is the most widely used means for classifying the extent of cancer spread : 40 patients , stage i ; 50 patients , stage ii ; 30 patients , stage iii ; and 3 patients , stage iv . all these patients did not receive any neoadjuvant therapy . as shown in table 1 , age , sex , asa grades , body mass index ( bmi ) , blood transfusions , time of anesthesia , and operation were comparable in the two groups , except , obviously , for incision length . pre - anesthesia was accomplished using atropine ( 0.01 mg / kg ) plus promethazine ( 0.5 mg / kg ) , with the addition of sodium thiopental ( 5 mg / kg ) and atracurium ( 0.5 mg / kg ) and tracheal intubation and assisted ventilation using nitrogen dioxide ( no2 ) / oxygen ( o ) 2:1 . after intubation , anesthesia was maintained with oxygen in air , sevoflurane and remifentanil ( 0.25 mg / kg / min ) . serial venous blood samples were taken at pre - induction ( 0 ) , intraoperatively ( 30 , 60 , 90 , 120 , and 180 min ) and at 12 , 24 , and 48 h after surgery . blood was stored in pyrogen - free tubes an centrifuged at 4 c and 2000 rpm for 10 min and divided into sterile cryotubes ( nunc 36341 , intermed , denmark ) and stored at 80 c until analysis for subsequent determination of endotoxin . intestinal permeability was assessed preoperatively and at day 1 and 3 after surgery , using the lactulose / mannitol differential absorption test . this test is nontoxic , non - invasive , simple to perform , relatively inexpensive , and reproducible . a pretest sample of urine was collected after 6 h of fasting to measured the baseline sugar in the urinary tract . after the pretest sample was obtained , patients were given 10 g of lactulose and 5 g of mannitol dissolved in 100 ml of water orally or via nasogastric tube . urine was collected for 6 h , divided , and stored at -20 c until assayed . mannitol excretion was corrected by subtraction of baseline values determined in the pre - test samples , and the lactulose / mannitol excretion ratios ( l / m ratio ) were calculated . endotoxin was quantified in duplicates using a modified chromogenic limus amoebocyte lysate assay ( quadratech , epsom , uk . ) . plasma samples and standard test were diluted in 1:10 pyrogen - free water and heated to 75 c for 10 min to remove plasma inhibitors . the concentration of endotoxin in the sample was taken as the average of the duplicates calculated from standard curve . the assay has a sensitive of 8 pg / ml and is linear in the range 8 - 100 pg / ml . each aliquot was assayed for endotoxin only once . if the assay gave poor duplicates or very high values , indicating a possible contamination , a fresh portion of the same sample was retested . statistical analysis was performed using the mann - whitney u test or spearman 's rank - correlation coefficient ( rs ) where appropriate with revelance taken at the 5 % level . serial venous blood samples were taken at pre - induction ( 0 ) , intraoperatively ( 30 , 60 , 90 , 120 , and 180 min ) and at 12 , 24 , and 48 h after surgery . blood was stored in pyrogen - free tubes an centrifuged at 4 c and 2000 rpm for 10 min and divided into sterile cryotubes ( nunc 36341 , intermed , denmark ) and stored at 80 c until analysis for subsequent determination of endotoxin . intestinal permeability was assessed preoperatively and at day 1 and 3 after surgery , using the lactulose / mannitol differential absorption test . this test is nontoxic , non - invasive , simple to perform , relatively inexpensive , and reproducible . a pretest sample of urine was collected after 6 h of fasting to measured the baseline sugar in the urinary tract . after the pretest sample was obtained , patients were given 10 g of lactulose and 5 g of mannitol dissolved in 100 ml of water orally or via nasogastric tube . urine was collected for 6 h , divided , and stored at -20 c until assayed . mannitol excretion was corrected by subtraction of baseline values determined in the pre - test samples , and the lactulose / mannitol excretion ratios ( l / m ratio ) were calculated . endotoxin was quantified in duplicates using a modified chromogenic limus amoebocyte lysate assay ( quadratech , epsom , uk . ) . plasma samples and standard test were diluted in 1:10 pyrogen - free water and heated to 75 c for 10 min to remove plasma inhibitors . the concentration of endotoxin in the sample was taken as the average of the duplicates calculated from standard curve . the assay has a sensitive of 8 pg / ml and is linear in the range 8 - 100 pg / ml . each aliquot was assayed for endotoxin only once . if the assay gave poor duplicates or very high values , indicating a possible contamination , a fresh portion of the same sample was retested . statistical analysis was performed using the mann - whitney u test or spearman 's rank - correlation coefficient ( rs ) where appropriate with revelance taken at the 5 % level . the lr required almost the same operating time of the or [ table 1 ] . hospitalization was shorter for lr , but was not statistically significant [ table 1 ] . in the laparoscopic group , the intention - to - treat analysis was performed , and these 5 patients were included in the analysis : 3 patients with left colon cancer and 2 patients with right colon cancer were converted to the open procedure . no difference was observed in the preoperative l / m ratios in the two groups of patients [ figure 1 ] . intestinal permeability measured by lactulose / mannitol excretion ratio ( l : m ratio ) , * p 0.05 versus pre - operative . no difference between open and laparoscopic group the l / m ratio was significantly increased in the open and closed group the first day ( 0.1300.004 and 0.1280.004 , respectively ) compared with the preoperative level ( 0.0220.006 ; p 0.05 ) , but no differences were found between laparoscopic and open surgery group [ figure 1 ] . the systemic endotoxin concentration rose significantly , in both groups , during the course of surgery and returned to near baseline by day 2 . a significant correlation was observed between the maximum systemic endotoxin concentration and intestinal permeability measured at d1 ( rs = 0.917 ; p = 0.001 ) in the open group [ figure 3a ] and in the laparoscopic group ( rs = 0.926 ; p = 0.001 ) ; [ figure 3b ] . systemic endotoxin concentration ( mean sem ) , * p 0.05 versus preoperative . no difference between open and laparoscopic group correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio ( l / m ratio ) in the open group . ( rs = 0.917 ; p = 0.001 ) correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio ( l / m ratio ) in the laparoscopic group . ( rs = 0.926 ; p = 0.001 ) five patients ( 8 % ) underwent conversion from laparoscopic to open procedure [ table 1 ] . these patients had intestinal permeability parameters , and systemic endotoxin concentration value similar in the open and closed group . for these patients , intestinal permeability parameters , and systemic endotoxin concentration value are similar to the group they belong to . no difference was observed in the preoperative l / m ratios in the two groups of patients [ figure 1 ] . intestinal permeability measured by lactulose / mannitol excretion ratio ( l : m ratio ) , * p 0.05 versus pre - operative . no difference between open and laparoscopic group the l / m ratio was significantly increased in the open and closed group the first day ( 0.1300.004 and 0.1280.004 , respectively ) compared with the preoperative level ( 0.0220.006 ; p 0.05 ) , but no differences were found between laparoscopic and open surgery group [ figure 1 ] . the systemic endotoxin concentration rose significantly , in both groups , during the course of surgery and returned to near baseline by day 2 . a significant correlation was observed between the maximum systemic endotoxin concentration and intestinal permeability measured at d1 ( rs = 0.917 ; p = 0.001 ) in the open group [ figure 3a ] and in the laparoscopic group ( rs = 0.926 ; p = 0.001 ) ; [ figure 3b ] . systemic endotoxin concentration ( mean sem ) , * p 0.05 versus preoperative . no difference between open and laparoscopic group correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio ( l / m ratio ) in the open group . ( rs = 0.917 ; p = 0.001 ) correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio ( l / m ratio ) in the laparoscopic group . five patients ( 8 % ) underwent conversion from laparoscopic to open procedure [ table 1 ] . these patients had intestinal permeability parameters , and systemic endotoxin concentration value similar in the open and closed group . complications are reported in tables 1 and 2 . for these patients , intestinal permeability parameters , and systemic endotoxin concentration valueuntil now , it has been reported that the degree of post - operative inflammation is reduced after laparoscopic surgery . other groups also observed significantly better preservation of lymphocytes subpopulations , neutrophil function , and cell - mediated immunity after laparoscopic versus open colorectal surgery . furthermore , it has been observed that cell - mediated immunity , as assessed by delayed - type hypersensitivity testing in humans , is better preserved after laparoscopic vs open colorectal resection . this lesser degree of operative stress was also confirmed by experimental animal studies by kuntz et al . one group of investigators , in single center randomized trials , have reported that patients with colon carcinoma ( stage iii ) undergoing laparoscopic colectomy had a significantly higher disease - free survival rate with mean follow - up of 43 months than patients treated by conventional open approaches . laurent et al also reported a better survival rate in patients with stage iii tumors . in a rct trial in patients with mid and low rectal cancer and by morino et al . in a prospective comparative study which focused on patients with extraperitoneal rectal cancer treated with laparoscopic or open surgerymore recently , law et al . reported in a comparative monocenter series with a median follow - up of 34 months in patients with stage ii and iii rectal cancer , a 5 - year actuarial survival of 71 % in the laparoscopic group compared to 59 % survival rate in the open - group , also identifying laparoscopy as one of the independent significant factors associated with better survival at the multivariate analysis . supporting evidence of the beneficial oncological role of laparoscopy includes its impact on surgical stress response , cellular immunity , cytokine relase , intraoperative tumor manipulation , and blood transfusion . moreover , during the early postoperative period , laparoscopic patients seem to display decreased levels of pro - inflammatory and vascular endothelial growth factor ( vegf ) compared to open . however , in additional to ongoing discussion about the oncologic safety of laparoscopic approach it is still not completely clear whether this approach offers significant immunological advantages over the conventional open approach . reported in a prospective comparative study that in patients with stage iii colorectal cancer , the cellular immune factors were significantly decreased ; however there was no significant difference between the laparoscopic and open groups except for the mhla - dr : monocyte human leukocyte antigen - dr that was affected less by the laparoscopic group compared to the open group . the intestinal epithelium is a self - renewing arising from stem cell located at or near the base of the crypts . anup et al . , using a rat model , showed that laparotomy with mild intestinal handling can result in permeability alterations and oxidative stress in the enterocytes , mainly as a results of activation of xanthine oxidase , and the damage is reversible with time . we have proved the change of intestinal permeability only in patients undergoing open cholecystectomy , with no change occurring in the laparoscopic group . in the open technique , the peritoneum is manipulated , the small intestine handled , and the mesentery placed under traction , while in the laparoscopic cholecystectomy , these are absent or minimized . in this study ( gut barrier function , and systemic endotoxemia after laparotomic or laparoscopic resection for colon cancer ) , a change of intestinal permeability was demonstrated both in patients undergoing open colorectal surgery and in patients undergoing laparoscopic colorectal surgery . the l : m ratio was significantly increased in the both groups at day 1 compared with the preoperative level , but no difference were found between laparoscopic and open surgery group . since the since groups were similar , the greatest factor in difference between the groups of patients may be effect of surgical approach on intestinal manipulation . these factors ( manipulation of peritoneum , etc . ) , which are integral parts of the open approach , evidently are also involved in laparoscopic colo - rectal approach . laparoscopic - assisted colorectal resections , on the other hand , require an incision substantially larger than that typically required for other advanced laparoscopic procedures , such as gastric bypass or antireflux procedures . in our opinion , no difference , in intestinal permeability , noted after laparoscopic operations , as regards to the open group , is related to the extent of abdominal wall trauma . furthermore , in regards to colectomy , there is a wide variation in the size of the incision , needed to extract the specimen and facilitate the anastomosis , dependent on body habitus , the size of the specimen and the surgeon . in our study , the size of the minilaparotomy changed from 5 to 8 cm ( mean 5.8 cm ) . unfortunately , a substantial proportion of colectomy studies do not provide detailed information regarding incision length . in addition , there is no consensus amongst surgeons as to what constitutes a laparoscopic - assisted procedure or conversion . other variables that may impact the results of intestinal permeability studies include blood transfusion and the extent and location ( right versus left ) of the bowel resection performed . therefore , when evaluating the intestinal permeability , the colectomy population is much more heterogenous in regards to procedure performed and abdominal wall trauma induced than other advanced procedures . the surgical approach on intestinal manipulation may lead to the production of vasoactive agents that can cause both local and systemic hemodynamic changes . there is evidence to support the role of prostaglandins is causing these hemodynamic responses , even though the exact mechanism leading to their generation is not fully understood . the mucosa of the intestine and the endothelium of blood vessels contain enzymes capable of synthesizing prostaglandins , production of which may be initiated by neural , ischemic , toxic , or mechanical stimuli . the generation of these vasoactive prostaglandins can therefore induce splanchnic ischemia with subsequent disruption of mucosal integrity and increased intestinal permeability . therefore , intestinal manipulation may lead to the endotoxemia detected in the systemic circulation , in patients undergoing colorectal surgery . the results of the present study concur with this suggestion , as endotoxine was found in the systemic circulation in the open and laparoscopic groups of patients . the systemic endotoxin concentration rose significantly , in the both groups , during the course of surgery but returned to near baseline by day 2 and no difference were found between laparoscopic an open surgery group . this implies that mere manipulation of the intestine may have a deleterious effect on intestinal mucosa . regardless of the etiology of impaired mucosal barrier function , permeation of luminal contents across the bowel wall does occur and results in the endotoxemia . endotoxin is a potent stimulator of release of cytokines , such as interleukin - 6 and tumor necrosis factor . these inflammatory mediators play an important role in the pathogenesis of systemic inflammatory response syndrome and multiple - organ dysfunction syndrome . however , the significance of the correlation between systemic endotoxin concentration and increased intestinal permeability remains unclear . in our study , the endotoxemia was detected mainly during the intraoperative period , but the increased intestinal permeability was observed only 24 h after surgery . although it would be easy to suggest that endotoxemia was due to an increase in bowel permeability , one may develop independently of the other . indeed , endotoxemia is known to reduce splanchnic blood flow and cause disruption of mucosal barrier function . furthermore , exposing the peritoneal cavity to the atmosphere may in it self lead to endotoxemia . in some cases , intestinal permeability , and endotoxemia was detected somewhat higher in the laparoscopic than the open surgery , although such data are not statistically significant . in ten patients including five with rectosigmoid cancer , and five from the splenic flexure cancer , the operation went beyond 4 h ; three of these cases were part of the initial laparoscopic experience . this study confirms our preliminary data , but further prospective randomized studies are required , especially in advanced laparoscopic procedures ( carcinoma of the middle and low rectum ) , also considering whether the surgeon 's experience provides an additional biological and metabolic advantage for the patients . in this study ( gut barrier function , and systemic endotoxemia after laparotomic or laparoscopic resection for colon cancer ) , a change of intestinal permeability was demonstrated both in patients undergoing open colorectal surgery and in patients undergoing laparoscopic colorectal surgery . the l : m ratio was significantly increased in the both groups at day 1 compared with the preoperative level , but no difference were found between laparoscopic and open surgery group . since the since groups were similar , the greatest factor in difference between the groups of patients may be effect of surgical approach on intestinal manipulation . these factors ( manipulation of peritoneum , etc . ) , which are integral parts of the open approach , evidently are also involved in laparoscopic colo - rectal approach . laparoscopic - assisted colorectal resections , on the other hand , require an incision substantially larger than that typically required for other advanced laparoscopic procedures , such as gastric bypass or antireflux procedures . in our opinion , no difference , in intestinal permeability , noted after laparoscopic operations , as regards to the open group , is related to the extent of abdominal wall trauma . furthermore , in regards to colectomy , there is a wide variation in the size of the incision , needed to extract the specimen and facilitate the anastomosis , dependent on body habitus , the size of the specimen and the surgeon . in our study , the size of the minilaparotomy changed from 5 to 8 cm ( mean 5.8 cm ) . unfortunately , a substantial proportion of colectomy studies do not provide detailed information regarding incision length . in addition , there is no consensus amongst surgeons as to what constitutes a laparoscopic - assisted procedure or conversion . other variables that may impact the results of intestinal permeability studies include blood transfusion and the extent and location ( right versus left ) of the bowel resection performed . therefore , when evaluating the intestinal permeability , the colectomy population is much more heterogenous in regards to procedure performed and abdominal wall trauma induced than other advanced procedures . the surgical approach on intestinal manipulation may lead to the production of vasoactive agents that can cause both local and systemic hemodynamic changes . there is evidence to support the role of prostaglandins is causing these hemodynamic responses , even though the exact mechanism leading to their generation is not fully understood . the mucosa of the intestine and the endothelium of blood vessels contain enzymes capable of synthesizing prostaglandins , production of which may be initiated by neural , ischemic , toxic , or mechanical stimuli . the generation of these vasoactive prostaglandins can therefore induce splanchnic ischemia with subsequent disruption of mucosal integrity and increased intestinal permeability . therefore , intestinal manipulation may lead to the endotoxemia detected in the systemic circulation , in patients undergoing colorectal surgery . the results of the present study concur with this suggestion , as endotoxine was found in the systemic circulation in the open and laparoscopic groups of patients . the systemic endotoxin concentration rose significantly , in the both groups , during the course of surgery but returned to near baseline by day 2 and no difference were found between laparoscopic an open surgery group . this implies that mere manipulation of the intestine may have a deleterious effect on intestinal mucosa . regardless of the etiology of impaired mucosal barrier function , permeation of luminal contents across the bowel wall does occur and results in the endotoxemia . endotoxin is a potent stimulator of release of cytokines , such as interleukin - 6 and tumor necrosis factor . these inflammatory mediators play an important role in the pathogenesis of systemic inflammatory response syndrome and multiple - organ dysfunction syndrome . however , the significance of the correlation between systemic endotoxin concentration and increased intestinal permeability remains unclear . in our study , the endotoxemia was detected mainly during the intraoperative period , but the increased intestinal permeability was observed only 24 h after surgery . although it would be easy to suggest that endotoxemia was due to an increase in bowel permeability , one may develop independently of the other . indeed , endotoxemia is known to reduce splanchnic blood flow and cause disruption of mucosal barrier function . furthermore , exposing the peritoneal cavity to the atmosphere may in it self lead to endotoxemia . in some cases , intestinal permeability , and endotoxemiawas detected somewhat higher in the laparoscopic than the open surgery , although such data are not statistically significant . in ten patients including five with rectosigmoid cancer , and five from the splenic flexure cancer , the operation went beyond 4 h ; three of these cases were part of the initial laparoscopic experience . this study confirms our preliminary data , but further prospective randomized studies are required , especially in advanced laparoscopic procedures ( carcinoma of the middle and low rectum ) , also considering whether the surgeon 's experience provides an additional biological and metabolic advantage for the patients . in conclusion , during laparoscopic colorectal procedure : a wide variation in the size of the incision was needed to extract the specimen and facilitate anastomosis.subsequent manipulation of peritoneum and the intestine handled . a wide variation in the size of the incision was needed to extract the specimen and facilitate anastomosis . this might explain why no differences were observed , in regards to the intestinal permeability and endotoxin concentration versus the open procedure .\noutput:\n" }, { "from": "agent", "value": "purpose : the gut barrier is altered in certain pathologic conditions ( shock , trauma , or surgical stress ) , resulting in bacterial and / or endotoxin translocation from the gut lumen into the systemic circulation . in this prospective randomized study , we investigated the effect of surgery on intestinal permeability ( ip ) and endotoxemia in patients undergoing elective colectomy for colon cancer by comparing the laparoscopic with the open approach.patients and methods : a hundred twenty - three consecutive patients underwent colectomy for colon cancer : 61 cases were open resection ( or ) and 62 cases were laparoscopic resection ( lr ) . ip was measured preoperatively and at days 1 and 3 after surgery . serial venous blood sample were taken at 0 , 30 , 60 , 90 , 120 , and 180 min , and at 12 , 24 , and 48 h after surgery for endotoxin measurement.results : ip was significantly increased in the open and closed group at day 1 compared with the preoperative level ( p < 0.05 ) , but no difference was found between laparoscopic and open surgery group . the concentration endotoxin systemic increased significantly in the both groups during the course of surgery and returned to baseline levels at the second day . no difference was found between laparoscopic and open surgery . a significant correlation was observed between the maximum systemic endotoxin concentration and ip measured at day 1 in the open group and in the laparoscopic group.conclusion : an increase in ip , and systemic endotoxemia were observed during the open and laparoscopic resection for colon cancer , without significant statistically difference between the two groups ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: citation analysis is of central importance in research evaluation ( adam , 2002 ; bird , 2008 ; bornmann et al . , 2008 ; fava et al . , 2004 ; garfield , 1972 ; gisvold , 1999 ) , in spite of its shortcomings ( sancho , 1992 ; seglen , 1997 ) . moreover , almost all bibliometric measures , including impact factor ( garfield , 2006 ; whitehouse , 2002 ) and h - index ( glnzel , 2006 ; hirsch , 2007 ) , are functions of article citations . as a result , it is also important to study factors and variables which can influence citation counts . it is generally believed that the visibility of an article can influence its citation count . lay media are previously suggested to have a role in increasing the citation counts of a scientific article ( callaham et al . some authors have reported that , on average , open access articles are cited more than non - open access articles ( lawrence , 2001 ; norris et al . , 2008 ) , although this claim is disputed by others ( calver and bradley , 2010 ; davis , 2011 ; davis et al . , 2008 ; lansingh and carter , 2009 ) . on the other hand , it is believed that many authors do not necessarily read the articles to cite them ( braun et al . , 2010 ; marashi , 2005 ) , but rather adopt citations from the reference list of some subsequent papers ( braun et al . , 2010 ) . all these findings suggest that citations to an article might strongly depend on the visibility , rather than the merit of the article . with the popularity of web 2.0 in recent years , it has been suggested that the social media can also influence scientific article citations ( bar - ilan et al . , 2012 ; although scientific entries in wikipedia are typically written by anonymous authors , many scientists may still try to find information in this website , because of its high visibility and the simplicity of the language used ( figure 1 ( fig .1 ) suggests that wikipedia entries have high visibility to the authors of scholarly articles , especially in recent years . in the present work , we investigate whether the opposite is also true , i.e. , inclusion of scholarly references in wikipedia significantly affects the citation trends . the materials and methods of this work are presented in the supplementary information . in the first part of this study , we investigated the effect of inclusion of articles in wikipedia on their citation counts . the inclusion time was defined as the origin of time , i.e. , year zero . citation analysis was performed on the five - year period of [ -2 , - 1,0 , +1 , +2 ] . normalized citation count in year i , ci , was computed for each of the analyzed articles .2 ) , it is obvious that relatively high coefficients of determination ( r values ) in the linear regression of data are observed . in a closer look , the analyzed articles , on average , have an increasing trend in the years [ -2 , - 1,0 ] . however , this increasing trend does not continue in years + 1 and + 2 .2 ) , namely social systems , chaos theory and systems biology , either in year + 1 or in year + 2 , a decrease in the citation trend is observable . this observation may question the increasing trend of the citations . one may argue that the observed increase in the number of citations occurs independently of inclusion of article in wiki pedia . for example , such a trend is expected because of the inclusion of an increasing number of articles in scopus during time .1 ) may not be more than what is expected by chance . in order to study the citations while correcting for the intrinsically increasing citation counts , we computed the citation propensity of the articles ( see the materials and methods section ) . the citation propensity in year i , pi , measures the tendency of an article to be cited more than what is expected by chance . finally , pi = 1 shows a citation tendency in year i equal to a random year . this concept is comparable to the amino acid propensity for protein secondary structures , which is the tendency of an amino acid to be included in - helix or - sheet structures ( chou and fasman , 1974 ; marashi et al .3 ) shows the results of the propensity analysis . in years 0 and + 1 , in all of the three cases , especially in case of systems biology , citation propensity is almost constant and close to 1 . however , in year + 2 in all of the cases we observe a considerable decrease in the propensities . figure 3 ( fig .3 ) suggests that the increase in the number of citations after inclusion in wikipedia ( figure 2 ( fig .2 ) ) can be simply due to the general increase in the number of citations during time . in the present study , we show that inclusion of articles in wikipedia does not increase the propensity of articles to be cited . interestingly , the reverse is reported to be true , i.e. , wikipedia selectively lists high impact articles shortly after their publication ( evans and krauthammer , 2011 ) . it has been previously observed that visibility of an article , e.g. , mendeley user counts ( bar - ilan et al . , 2012 ; li and thelwall , 2012 ) , bookmarks in citeulike ( bar - ilan et al . , 2012 ) and tweets in twitter ( eysenbach , 2011 ) does the article impact increase these visibility measures , or the visibility is the cause of the increase in the scholarly citation counts of the article ?\noutput:\n" }, { "from": "agent", "value": "it has been suggested that the visibility of an article influences its citation count . more specifically , it is believed that the social media can influence article citations.here we tested the hypothesis that inclusion of scholarly references in wikipedia affects the citation trends . to perform this analysis , we introduced a citation propensity measure , which is inspired by the concept of amino acid propensity for protein secondary structures . we show that although citation counts generally increase during time , the citation propensity does not increase after inclusion of a reference in wikipedia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: xanthogranulomatous endometritis ( xge ) or histiocytic endometritis ( he ) is a rare and chronic inflammation of the endometrium . xge has been reported in various organs such as kidneys , gallbladder , stomach , anorectal region , urinary bladder , testis , vagina , bone , and salivary gland . however , involvement of female genital tract is very rare . xge is characterized by an intense collection of foamy histiocytes , plasma cells , lymphocytes , few polymorphonuclear cells , with or without the presence of multinucleated giant cells which are seen surrounding and / or destroying the normal structures of the tissue affected . the xge inflammation may be so extensive so as to make an impression of endometrial carcinoma clinically and on imaging studies . it may lead to a fatal outcome in case if not treated in time . till datehere , we report another case presenting as pyometra and causing diagnostic misinterpretation of a carcinoma on imaging . a 72 - year - old female , para 4 presented with complaints of foul - smelling yellowish - white discharge per vaginam for the past 4 days and postmenopausal bleeding for 1 day . the patient was moderately built and nourished . per vaginal examination revealed a bulky uterus with clear bilateral fornices . ultrasonography of the endometrium revealed a bulky uterus with a thickened endometrial lining measuring 25 mm containing a pyometra . magnetic resonance imaging of the abdomen confirmed the ultrasound findings and in addition revealed cervical stenosis [ figure 1 ] . a volume of 500 ml of pus was drained from the uterine cavity which was sterile on culture . in view of the clinical and radiological findings , an endometrial biopsy was performed which revealed sheets of histiocytes having an abundant foamy cytoplasm , along with a dense mixed inflammatory infiltrate comprising plasma cells , lymphocytes , and neutrophils . most of the endometrial glands were destroyed and an occasional remnant gland seen was atrophic [ figure 2a ] . special stains such as pas , gms , and gram stain done did not reveal the presence of any organism . the foamy histiocytes were strongly positive for cd68 ( for detection of monocytes and macrophages , ready to use , clone pgm1 , mouse monoclonal , dako denmark . ) [ figure 2b ] , and the presence of both cd3 ( for detecting t - lymphocytes , ready to use , clone ps1 , mouse monoclonal , dako denmark ) and cd20 ( for detection of b - lymphocytes , ready to use , clone l26 , mouse monoclonal , dako denmark ) positive lymphocytes suggested a polyclonal origin and thus an inflammatory process . multiple sections studied did not reveal the presence of any malignancy . a final histopathological diagnosis of xge was made . magnetic resonance imaging of the abdomen revealed a bulky uterus with a thickened endometrial lining measuring 25 mm containing a pyometra . cervical stenosis was seen in addition ( a ) photomicrograph reveals sheets of histiocytes having an abundant foamy cytoplasm , along with a dense mixed inflammatory infiltrate comprising of plasma cells , lymphocytes , and neutrophils surrounding a distorted , atrophic endometrial gland . most of the endometrial glands were destroyed and an occasional remnant gland seen was atrophic ( h and e , 400 ) . although xge was first described by barua et al . in 1978 , it is very uncommon with less than 25 reported cases in the world literature till date . . however , the term xge is preferred as it not only reflects on the inflammatory nature of the process but also unifies the similar morphologic findings seen in other organs . on histopathological examination , xge is characterized by the presence of histiocytes with abundant cytoplasm which appears foamy and granular , variable numbers of multinucleated giant cells , chronic inflammatory cells , necrotic material , hemorrhage , calcium , and hemosiderin . the pathogenesis of xge appears to be chronic inflammation associated with pyometra due to postmenopausal cervical stenosis or cervical carcinoma . it is postulated that a complex interaction of elements such as obstruction , inflammation , generation of free radicals , and lipid peroxidation ( as seen in irradiated tissue ) is responsible for the development of this entity . badhe et al . have reported a case of xge in association with a malignant mixed mullerian tumor of the uterus . the authors have proposed that rapidly growing tumors which show extensive areas of hemorrhage and necrosis that could itself lead to xge in the absence of any irradiation . in our case , obstruction occurred due to cervical stenosis as there was no evidence of malignancy on histopathological examination . although some authors have proposed infection by escherichia coli or proteus vulgaris as a cause of xge , in our patient we could not isolate any organism either on culture or special stains . the development of xge may be influenced by various factors including tumor bulk , or death of tumor cells following irradiation , necrosis , presence of intrauterine hemorrhage , cervical stenosis , and preexisting vascular compromise including atherosclerosis . the necrotic tumor cells , inflammatory cells , and red blood cells are a good source of lipid and provide the necessary elements for the development of xge . the presence of cd68 positive foamy histiocytes and a chronic lymphocytic infiltrate positive for cd3 and cd20 favors an inflammatory process over a carcinoma . the absence of concentric , calcific bodies ( michaelis gutmann bodies ) and negative 1 antitrypsin staining of the sheets of foamy histiocytes are helpful clues to exclude a malakoplakia . not only the irregular , necrotic appearance of xge may mimic a carcinoma on gross examination but also the sheets of histiocytes infiltrating the deeper tissue can mimic clear cell carcinomas or clear cell sarcomas and may pose a diagnostic challenge to a young pathologist . awareness of this entity is important for both the gynecologist and the pathologist as xge can mimic malignancy on clinical examination and imaging studies . the presence of xge does not rule out the coexistence of a carcinoma , which should be diligently searched for and requires extensive sampling of tissues to rule out any focus of malignancy .\noutput:\n" }, { "from": "agent", "value": "xanthogranulomatous endometritis ( xge ) is an uncommon but well - established histopathological entity seen affecting the kidney and gallbladder . involvement of the endometrium is very rare , with only a few case reports in world literature till date . histologically , it is characterized by the replacement of the endometrium by sheets of foamy histiocytes , plasma cells , lymphocytes , giant cells , and siderophages . we present a case of a 74 - year - old female who presented with foul - smelling discharge and postmenopausal bleeding of a short duration . clinical examination and imaging studies revealed a pyometra , cervical stenosis . a suspicion of carcinoma was raised . since xge may mimic an endometrial carcinoma clinically and pathologically , knowledge of this unusual and rare inflammatory pathology is important for both the gynecologists and the pathologists ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: exome sequences were obtained for 6,823 individuals , who were sequenced to high - coverage ( median depth 100x ) on an illumina gaii or hiseq2000 . library construction , exome capture , sequencing , mapping , calling and filtering were performed as previously described , with minor modifications ( and see supplementary information ) . we developed a simulation approach based on coalescent theory to estimate allele age , which was applied to 1,146,401 autosomal snvs with known ancestral states .\noutput:\n" }, { "from": "agent", "value": "establishing the age of each mutation segregating in contemporary human populations is important to fully understand our evolutionary history1 ,2 and will help facilitate the development of new approaches for disease gene discovery3 . large - scale surveys of human genetic variation have reported signatures of recent explosive population growth4 - 6 , notable for an excess of rare genetic variants , qualitatively suggesting that many mutations arose recently . to more quantitatively assess the distribution of mutation ages , we resequenced 15,336 genes in 6,515 individuals of european ( n = 4,298 ) and african ( n = 2,217 ) american ancestry and inferred the age of 1,146,401 autosomal single nucleotide variants ( snvs ) . we estimate that ~ 73 % of all protein - coding snvs and ~ 86 % of snvs predicted to be deleterious arose in the past 5,000 - 10,000 years . the average age of deleterious snvs varied significantly across molecular pathways , and disease genes contained a significantly higher proportion of recently arisen deleterious snvs compared to other genes . furthermore , european americans had an excess of deleterious variants in essential and mendelian disease genes compared to african americans , consistent with weaker purifying selection due to the out - of - africa dispersal . our results better delimit the historical details of human protein - coding variation , illustrate the profound effect recent human history has had on the burden of deleterious snvs segregating in contemporary populations , and provides important practical information that can be used to prioritize variants in disease gene discovery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cutaneous toxicities classically known to present with bleomycin are flagellate erythema , bullous dermatitis , pigmentation , raynaud 's phenomenon , scleroderma , stomatitis , drug rash , hair , and the nails manifestations . bleomycin is used in ( dermatology ) for various skin cancers , warts , keloids , and scars , at the same time it is known to cause cutaneous side - effects resulting from its use . cutaneous ( toxicities ) classically known to present with bleomycin are flagellate erythema bullous dermatitis , pigmentation , raynaud 's phenomenon , scleroderma , stomatitis , drug rash , hair , and the nails manifestations . lipodystrophy is a common manifestation in systemic lupus erythematosus nephritis , scleroderma , sjgren syndrome , recurrent pyogenic infections , immune thrombocytopenic purpura , thyroiditis , and hiv . lipodystrophy is also a common complication in patients who are taking protease inhibitors , insulin , corticosteroids , i m penicillin g , iron dextran , diphtheria / pertussis / tetanus ( dpt ) vaccine , and recombinant growth hormone . although , cutaneous toxicity is known to exist with the use of bleomycin , to the best of our knowledge there exists no isolated case report presenting as bleomyicn - induced lipodystrophy having potential cosmetic implications in women . we hereby report bleomyicn - induced lipodystrophy in 20 - year - old female ; weight 48 kg , height 1.65 m diagnosed with a case of germ cell carcinoma of the ovary ( endodermal sinus tumor ) reported in adverse drug reaction monitoring ( under pvpi ) centre vde no . preoperative cancer marker levels were as follows : ca - 125 = 26.6 u / ml ; alpha fetoprotein = 3765 ng / ml ; human chorionic gonadotropin 1 miu / ml . ultrasonography ( usg ) helped in establishing the diagnosis of an ovarian tumor / mass . postoperative histopathological findings confirmed it as a case of germ cell carcinoma of the ovary ( endodermal sinus tumor , also known as a yolk sac tumor ) . postoperatively , the patient was started with injections of bleomycin ( 30 mg / m d1 , d8 and d15 ) ; injections of etposide ( 100 mg / m i.v . d1 and d5 ) and cisplatin ( 20 mg / m i.v . d1 and d5 ) combination in cyclic manner . the patient developed acquired partial lipodystrophy with subcutaneous fat loss limited to the trunk and left side of the back within 3 days of the first cycle [ figures 13 ] . the patient had no history of smoking , alcohol consumption , any substance abuse , associated pathology , concurrent drug or vaccine intake . bleomycin - induced acquired partial lipodystrophy on abdomen bleomycin - induced acquired partial lipodystrophy on back bleomycin - induced acquired partial lipodystrophy on left lateral side of back there was no history of such an episode in the past . all basic investigations including complete blood count , hemoglobin , erythrocyte sedimentation rate , routine urine , stool examination , blood sugar , liver function test , renal function test , lipid profile , electrocardiogram , and usg were found to be normal . since the adverse drug reaction ( adr ) was not serious and had only cosmetic implications in the young woman , the patient was continued with the same drugs in cyclic manner and the cause of the adr was most likely thought to be associated with bleomycin because of its known cutaneous toxicities . no treatment was given to the patient , and she is still on follow - up . thus , the appearance of bleomycin - induced partial lipodystrophy could not be explained by a concurrent disease , other drug or chemicals . dechallenge improved the condition and rechallenge resulted in reappearance of the adr . on literature searchthis adr can be labeled probable with a score of 7 on naranjo 's scale for causality assessment as per causality assessment . since this adrwas not studied for dose dependent response and was unpredictable / unusual it could be clearly labeled as a type - b class of adr . lipodystrophy is also a common complication in patients on protease inhibitors , insulin , corticosteroids , i m penicillin g , iron dextran , dpt vaccine , and recombinant growth hormone . management of these patients includes cosmetic surgery , diet , and drug therapy for control of associated dyslipidemia if any . however , the possibility of an autoimmune reaction resulting into a cutaneous manifestation in the form of lipodystrophy appears to be the likely possibility in view of its time relationship . the current adr highlights the need to create awareness by oncologist / physicians for patients receiving bleomycin to ameliorate the dual psychological trauma as result of ongoing pathology and due to cosmetically unacceptable adr in the form of lipodystrophy before initiation of the treatment . to best of our knowledge , this is the first report of bleomycin - induced acquired partial lipodystrophy having potential cosmetic implications in a young woman . this is the first report of bleomycin - induced acquired partial lipodystrophy having potential cosmetic implications in a young woman . this is the first report of bleomycin - induced acquired partial lipodystrophy having potential cosmetic implications in a young woman .\noutput:\n" }, { "from": "agent", "value": "bleomycin toxicity predominantly affects the skin and lungs . cutaneous toxicity classically known to present with bleomycin are flagellate erythema and drug rash . we hereby report an isolated case of ( bleomyicn ) - induced acquired partial ( lipodytrophy ) having potential cosmetic implications in a young women prescribed postoperatively following a case of germ cell carcinoma of ovary ( endodermal sinus tumor ) ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in early breast cancers , accurate assessment of individual patient prognosis is key to good clinical decision making . at present , a number of prognostic prediction tools are available either commercially or as free online programs to aid adjuvant chemotherapy - related decision making . oncotype - dx and mammaprint , the 2 widely used commercial microarray gene expression - based prognostic tests , are steadily gaining popularity in western oncology practices as powerful tools in risk stratification , and selection and optimization of drug regimens for women with early breast cancer . nevertheless , these assays are inaccessible for a vast majority of the global oncology community , as they are expensive . online , a free , web - based prognostic calculator , is far more cost effective than mammaprint . in asia , a substantial proportion of women are diagnosed with estrogen receptor ( er ) - negative tumors , in part owing to the younger age at diagnosis of breast cancer in the population . it has been previously shown that almost half of the breast cancers in several asian settings including hong kong , singapore , and india occurred in premenopausal women and approximately 45 % of patients had er - negative breast cancers . online prognostication tools may therefore be valuable in clinical practice and have been proposed to guide adjuvant chemotherapy decision making , at institutional and even at national levels in affluent countries ( http://www.predict.nhs.uk/technical.html ) . previous studies in the united states and the netherlands have shown that the use of prognostic prediction tools were common among the oncologists . at present , there are several free web - based prognostication programs to predict the survival of early breast cancer such as adjuvant ! these prognostic models have been validated in western settings and generally seem to possess good calibration and discriminatory accuracy , with very few exceptions . however , a series of validation studies conducted within multiethnic asian patients with breast cancer had consistently shown that adjuvant ! the utility of predict albeit remains unclear given that it has not been validated in asian settings . predict is a web - based prognostication tool , which estimates the probability of survival for individual patients with breast cancer and the impact of systemic treatment choices on their survival probability ( http://www.predict.nhs.uk/ ) . online , predict uses an algorithm that , additionally , includes mode of detection , human epidermal growth factor receptor ( her2 ) status , as well as ki67 status , but does not include patient 's comorbidity . an advantage of predict is that it was developed for 2 end users , the clinicians and the patients with breast cancer , involved in chemotherapy decision making . the model was developed using a population - based cancer registry in the united kingdom , and externally validated in a second united kingdom - based registry and also a large cohort of canadian patients with breast cancer . giventhat predict is free , user friendly , and easily accessible , it may provide an economically feasible option to guide adjuvant chemotherapy decision making in resource - limited settings . malaysia is a middle - income country in southeast asia that comprises 3 major ethnic groups , that is , malays , chinese , and indians . the prognostic prediction performance of predict was assessed using a large hospital - based prospective cohort of multiethnic patients with breast cancer in malaysia . this study obtained ethics approval from the ethics committee of the university malaya medical centre ( ummc ) , kuala lumpur , malaysia . as the study relies on nonidentifiable registry - based data , the ummc is an academic tertiary hospital situated in the relatively affluent part of kuala lumpur , malaysia , and caters to a predominantly middle - class urban population . the ummc breast cancer registry is a prospective hospital - based registry of consecutive women who were newly diagnosed with breast cancer since 1993 . the registry has been approved by the ethical review committee of the institution and encompasses data on patient 's demography ( including age and ethnicity ) , tumor characteristics ( including pathological data on tumor size , number of involved lymph nodes , tumor grade based on bloom scarff richardson classification , er status , and her2 status based on immunohistochemistry testing ) , as well as treatment . treatment data include type of treatment ( surgery , chemotherapy , radiotherapy , and endocrine therapy ) , type of surgery ( mastectomy , breast - conserving surgery ) , chemotherapy regimen , and type of endocrine therapy . data on ki67 status were not available as it was not tested in a vast majority of patients with breast cancer . although data on use of trastuzumab were also not available in this registry , its use in the hospital was extremely low during the study period . for this study , consecutive patients who were newly diagnosed with invasive nonmetastatic breast cancer from 1998 , when second - generation ( anthracycline - based ) chemotherapy was introduced in the hospital , until 2006 , allowing at least 5 years of follow - up ( or until 2002 , allowing 10 years of follow - up ) were identified . patients were included if they had undergone complete surgical treatment ( ie , mastectomy or breast - conserving surgery followed by radiotherapy ) . we excluded women with er - positive tumors who did not receive hormone therapy , and those with missing information on chemotherapy regimen . patients receiving first - generation chemotherapy were also excluded given that first - generation regimes were not included in predict 's algorithm . the final validation dataset for 5 - year survival validation comprise 1480 women . for validation of 10 - year survival , the vital status of patients were obtained by direct linkage with the national registration department in malaysia that has the mortality records of all malaysians , using patients unique identity card number . as passive follow - up was done , we were able to follow - up all patients . follow - up time was calculated , starting at date of diagnosis with breast cancer until death ( all cause ) , or censored at the end of follow - up ( march 2013 , date of linkage with national mortality registry ) . for each patient , data on age ( continuous ) , mode of detection ( screen detected , symptomatic , unknown ) , tumor size ( continuous ) , number of involved lymph nodes ( continuous ) , er status ( positive , negative , undefined ) , tumor grade ( grade 1 , grade 2 , grade 3 , undefined ) , her2 status ( positive , negative , undefined ) , ki67 status ( entered as undefined for all patients ) , and adjuvant chemotherapy regimen ( no chemotherapy , second - generation chemotherapy , third - generation chemotherapy ) were manually entered . for every entry , the program predicted 5 and 10 - year overall survival ( os ) for 4 different scenarios , that is , survival with no adjuvant treatment , benefit of adjuvant hormone therapy , additional benefit of adding adjuvant chemotherapy to adjuvant hormone therapy , and additional benefit of adding trastuzumab to adjuvant chemotherapy and hormone therapy . the survival probability corresponding to the actual treatment received by the individual patient was recorded . for instance , in the event a patient did not receive adjuvant chemotherapy , the predicted os for no adjuvant treatment will be extracted from the output charts generated by predict tool . in order to ensure accuracy , all the predict scores were calculated by 2 research personnel , and further audited by a third person in a random sample of 10 % of patients . meier analysis was used to estimate the observed 5 and 10 - year os in the entire study population and within subgroups . the predicted 5 and 10 - year osthe calibration of the predict model , the observed and predicted 5 and 10 - year os rates were compared . a goodness - of - fit . a p value of 0.05 for this test was considered to represent a significant difference between the observed and predicted mortality . model calibration was further assessed within strata of other prognostic subgroups . the observed 5 and 10 - year mortality estimates were plotted against quintiles of predicted mortality . receiver - operating characteristic ( roc ) analysis was performed to assess the discriminatory performance of predict ( ie , its ability to discern patients having good prognosisthe area under the roc curve ( auc ) gives an indication of the discriminatory performance of the model , whereby it can be interpreted as the proportion of patients who are correctly predicted to be alive or dead at 5 and 10 years . an auc of 0.5 indicates no discriminative performance whereas an auc of 1.0 indicates perfect discrimination . the national institutes of health consensus development conference recommends administration of adjuvant chemotherapy for node - negative breast tumors when tumor size is 1 cm , irrespective of hormone receptor status . within this subgroup of women , subsequently , the program was used to predict the os benefit conferred by chemotherapy in women in the above subgroup . the utility of predict is less clear in patients who have received neoadjuvant chemotherapy , as the program per se does not specify whether the model is suitable for use in this subset of patients . the tumor size and lymph node status entered in this analysis comprised values following administration of neodjuvant chemotherapy . analyses were performed using spss for window version 20.0 ( spss inc . , chicago , il ) . the ummc is an academic tertiary hospital situated in the relatively affluent part of kuala lumpur , malaysia , and caters to a predominantly middle - class urban population . the ummc breast cancer registry is a prospective hospital - based registry of consecutive women who were newly diagnosed with breast cancer since 1993 . the registry has been approved by the ethical review committee of the institution and encompasses data on patient 's demography ( including age and ethnicity ) , tumor characteristics ( including pathological data on tumor size , number of involved lymph nodes , tumor grade based on bloom scarff richardson classification , er status , and her2 status based on immunohistochemistry testing ) , as well as treatment . treatment data include type of treatment ( surgery , chemotherapy , radiotherapy , and endocrine therapy ) , type of surgery ( mastectomy , breast - conserving surgery ) , chemotherapy regimen , and type of endocrine therapy . data on ki67 status were not available as it was not tested in a vast majority of patients with breast cancer . although data on use of trastuzumab were also not available in this registry , its use in the hospital was extremely low during the study period . for this study , consecutive patients who were newly diagnosed with invasive nonmetastatic breast cancer from 1998 , when second - generation ( anthracycline - based ) chemotherapy was introduced in the hospital , until 2006 , allowing at least 5 years of follow - up ( or until 2002 , allowing 10 years of follow - up ) were identified . patients were included if they had undergone complete surgical treatment ( ie , mastectomy or breast - conserving surgery followed by radiotherapy ) . we excluded women with er - positive tumors who did not receive hormone therapy , and those with missing information on chemotherapy regimen . patients receiving first - generation chemotherapy were also excluded given that first - generation regimes were not included in predict 's algorithm . the final validation dataset for 5 - year survival validation comprise 1480 women . for validation of 10 - year survival , in this study , the vital status of patients were obtained by direct linkage with the national registration department in malaysia that has the mortality records of all malaysians , using patients unique identity card number . as passive follow - upfollow - up time was calculated , starting at date of diagnosis with breast cancer until death ( all cause ) , or censored at the end of follow - up ( march 2013 , date of linkage with national mortality registry ) . for each patient , data on age ( continuous ) , mode of detection ( screen detected , symptomatic , unknown ) , tumor size ( continuous ) , number of involved lymph nodes ( continuous ) , er status ( positive , negative , undefined ) , tumor grade ( grade 1 , grade 2 , grade 3 , undefined ) , her2 status ( positive , negative , undefined ) , ki67 status ( entered as undefined for all patients ) , and adjuvant chemotherapy regimen ( no chemotherapy , second - generation chemotherapy , third - generation chemotherapy ) were manually entered . for every entry , the program predicted 5 and 10 - year overall survival ( os ) for 4 different scenarios , that is , survival with no adjuvant treatment , benefit of adjuvant hormone therapy , additional benefit of adding adjuvant chemotherapy to adjuvant hormone therapy , and additional benefit of adding trastuzumab to adjuvant chemotherapy and hormone therapy . the survival probability corresponding to the actual treatment received by the individual patient was recorded . for instance , in the event a patient did not receive adjuvant chemotherapy , the predicted os for no adjuvant treatment will be extracted from the output charts generated by predict tool . in order to ensure accuracy , all the predict scores were calculated by 2 research personnel , and further audited by a third person in a random sample of 10 % of patients . kaplan meier analysis was used to estimate the observed 5 and 10 - year os in the entire study population and within subgroups . the predicted 5 and 10 - year osthe calibration of the predict model , the observed and predicted 5 and 10 - year os rates were compared . a goodness - of - fittest was also performed to assess the fit of predict model . a p value of 0.05 for this test was considered to represent a significant difference between the observed and predicted mortality . receiver - operating characteristic ( roc ) analysis was performed to assess the discriminatory performance of predict ( ie , its ability to discern patients having good prognosisthe area under the roc curve ( auc ) gives an indication of the discriminatory performance of the model , whereby it can be interpreted as the proportion of patients who are correctly predicted to be alive or dead at 5 and 10 years . an auc of 0.5 indicates no discriminative performance whereas an auc of 1.0 indicates perfect discrimination . the national institutes of health consensus development conference recommends administration of adjuvant chemotherapy for node - negative breast tumors when tumor size is 1 cm , irrespective of hormone receptor status . within this subgroup of women , subsequently , the program was used to predict the os benefit conferred by chemotherapy in women in the above subgroup . the utility of predict is less clear in patients who have received neoadjuvant chemotherapy , as the program per se does not specify whether the model is suitable for use in this subset of patients . the tumor size and lymph node status entered in this analysis comprised values following administration of neodjuvant chemotherapy . analyses were performed using spss for window version 20.0 ( spss inc . , chicago , il ) . in this cohort of asian women with early breast cancer , the median age at diagnosis was 50 years ( quartile 1 : 44 years , quartile 3 : 58 years ) . a large proportion was chinese ( n = 994 , 67 % ) , followed by malays ( n = 281 , 19 % ) , indians ( n = 192 , 13 % ) , and other races ( n = 13 , 1 % ) . a vast majority of patients were symptomatic at presentation ( n = 1421 , 96 % ) , whereas only 4 % of women in this study had mammographic screening - detected breast cancer . the median tumor size at presentation was 3 cm ( quartile 1 : 2 cm , quartile 3 : 4 cm ) , and 663 patients had lymph node involvement ( 46 % ) . data on er and her2 status were not available in 47 and 179 patients , respectively , whereas tumor grade was unknown in 259 women . within patients with available information , er and her2 were expressed in approximately 771 ( 54 % ) and 496 ( 38 % ) patients , respectively , whereas 484 ( 40 % ) patients had high - grade tumors . among 1054 patients who received adjuvant chemotherapy , 17 patients ( 1.6 % ) only 38 women ( 4 % ) had received taxane - based ( third - generation ) regimes , whereas 1016 women received anthracycline - based ( second - generation ) regimes . a majority of patients who received endocrine therapy were given tamoxifen , whereas 25 received aromatase inhibitors and 20 received tamoxifen followed by aromatase inhibitors . figure 1 shows the distribution of the predicted 5 and 10 - year os as estimated by predict in our patients . although most patients had high predicted 5 and 10 - year os , a smaller number of women were predicted to have low os . as the predicted scores were negatively skewed , we reported the median score . distribution of predicted ( a ) 5 and ( b ) 10 - year overall survival in asian women with early breast cancer by predict tool . in patients with er - positive breast cancers , endocrine therapy was estimated to confer an additional survival benefit of 2.6 % and 5.3 % in 5 and 10 years , respectively . administration of adjuvant chemotherapy in this group of women was predicted to provide an additional os benefit of 1.7 % and 3.7 % at 5 and 10 years , respectively . among patients with er - negative breast cancers , the program predicted that adjuvant chemotherapy would confer an additional os benefit of 9.5 % and 11.3 % at 5 and 10 years , respectively . although predict tool had predicted that of 1480 patients with complete follow - up of 5 years , 203 would have died , we had observed 184 deaths . among 472 patients with complete follow - up of 10 years , the predicted number of deaths was 106 , whereas in reality , a total of 122 deaths were observed . overall , predict was accurate in predicting short - term survival ; the predicted 5 - year os was 86.3 % versus the actual observed 5 - year os that was 87.6 % ( difference : 1.3 % ) . however , the tool slightly overestimated long - term survival ; the predicted 10 - year os was 77.5 % whereas the observed 10 - year os was 74.2 % ( difference : 3.3 % ) . the corresponding p value for goodness - of - fit test for 10 - year os was 0.12 . the program seems to have performed fairly well in patients with good prognosis and only displayed overoptimism in patients with the poorest prognosis ( lowest quintile ) ( figure 2 ) . calibration plot of observed mortality with 95 % confidence interval against predicted mortality by quintiles of the predicted value , at ( a ) 5 and ( b ) 10 years after diagnosis . predict was also accurate in most subgroups of patients , except in several subgroups wherein a tendency of the program to be overoptimistic was noted ( tables 1 and 2 ) . in women aged 40 years , 5 - year os was overestimated by 6.8 % whereas 10 - year os was overestimated by 17.2 % . the program also seems to be overoptimistic in predicting 10 - year os in malay patients , with a difference of about 10 % ( p = 0.06 ) . although the model seems to have underestimated short - term survival in patients with er - negative tumors , the underestimation was not seen in prediction of long - term survival . analysis based on her2 status , however , yielded conflicting results ( tables 1 and 2 ) . calibration of predict in asian women with early - stage breast cancer : 5 - year survival calibration of predict in asian women with early - stage breast cancer : 10 - year survival within patients with node - negative tumors measuring 1 cm , predict was accurate whereby the predicted 5 and 10 - year oss were 90.3 % and 82.0 % , respectively , whereas the observed 5 and 10 - year oss were 93.3 % ( 95 % confidence interval [ ci ] : 92.596.1 ) and 82.2 % ( 95 % ci : 76.587.9 ) , respectively . within this subset of patients , the program had predicted that adjuvant chemotherapy would only confer an additional survival benefit of 1.2 % at 5 years , and 3.0 % at 10 years irrespective of hormonal receptor status . it was found that predict was persistently overoptimistic in predicting both short - term and long - term os among patients who had received neoadjuvant chemotherapy , by approximately 6 % ( tables 1 and 2 ) . the roc analysis of predict showed that the model discriminated good and poor survivors fairly well , with an auc of 0.78 ( 95 % ci : 0.740.81 ) and 0.73 ( 95 % ci : 0.680.78 ) for 5 and 10 - year survival , respectively . within this large cohort of women with early - stage breast cancer from a middle - income setting , predict performed well in terms of calibration and discrimination . however , predict substantially overestimated survival in very young patients with breast cancer , as well as in patients who have received neoadjuvant chemotherapy . the current finding that predict is accurate in predicting os in early breast cancers and performs robustly across a majority of patient subgroups suggest that the program may be clinically useful in similar asian settings . it is felt that the program can safely be used to refrain chemotherapy administration in patients demonstrating low survival benefit from adjuvant chemotherapy . for instance , the national institutes of health consensus development conference had recommended administration of adjuvant chemotherapy for node - negative breast tumors when tumor size is 1 cm , irrespective of hormone receptor status . however , in this subset of patients within the current study , predict had predicted that the additional os benefit conferred by adjuvant chemotherapy at 10 years was only 3 % , underscoring the importance of tailoring treatment approaches based on individual patient prognoses . nevertheless , the margin of benefit that is deemed appropriate for decision - making is arbitrary and depends on individual physicians and patients . the cambridge breast unit ( united kingdom ) , for instance , uses the absolute 10 - year survival benefit from chemotherapy to guide decision making for adjuvant chemotherapy ; no chemotherapy if 3 % ; chemotherapy discussed as a possible option if 3 % to 5 % ; and chemotherapy recommended if 5 % . based on the current findings , predict is not recommended for use in very young asian women with breast cancer . a common weakness shared between predict and adjuvant ! online is that both models poorly performed in very young patients , not only in asians but also in whites . patients diagnosed with breast cancer at a very young age have poor survival , and the current variables included in the predict algorithm seem unable to adequately prognosticate this subgroup of patients . in this study , predict marginally overestimated 10 - year os by about 3 % . a previous validation study of adjuvant ! online within our setting had shown that the model was generally overoptimistic across most subgroups of patients , whereby the 10 - year os was overestimated by approximately 7 % ( 95 % ci : 3.010.4 ) . these results , taken together with the accurate performance of predict in predicting 5 - year os , seem to suggest that systematic differences in background mortality ( including comorbidities ) , between our study population and populations where the above models were developed ( ie , united kingdom and united states ) , are more likely to play a central role in explaining the overoptimism pertaining to long - term survival predictions . for instance , life expectancy in 2010 for a female at 50 years of age in malaysia was 78.4 years , whereas in the united kingdom and united states , it was 83.9 and 83.1 years , respectively ( http://www.worldlifeexpectancy.com/world-healthrankings ) . nevertheless , differences in lifestyle after breast cancer between the western and asian populations may also explain disparities in long - term survival . this is in view that studies from other high - income asian settings such as korea and taiwan have also shown that western - derived long - term survival prediction models may still be overoptimistic in asian populations . differences in life expectancy and lifestyle after diagnosis of breast cancer may also explain the overoptimism of predict in predicting long - term survival among patients of malay ethnicity . although information on her2 status was available , the testing was not routine prior to 2005 in ummc and was highly selective , whereby patients with the highest and lowest baseline prognosis were not tested . we are uncertain of the influence of lack of data on ki67 status on our results , given that the model was still largely able to accurately prognosticate our patients with breast cancer . although predict was recently adapted to include ki67 status in its algorithm , it is important to note that the added prognostic value of ki67 is yet to be externally validated due to lack of appropriate populations ( http://www.predict.nhs.uk/technical.shtml ) . furthermore , there is a general lack of clarity in standardizing assessment of these factors for routine clinical practice , particularly in determining optimal cutoff values to establish ki67 status . it is also acknowledged that the number of patients in some subgroup analyses were relatively small , which may have resulted in unstable estimates . furthermore , an inherent issue with predict is that the model does not include patient 's comorbidity . this maybe problematic in multiethnic asian women given that asian populations have been found to have higher risk of cardiovascular diseases compared with their white counterparts . considering that breast cancer therapy , particularly radiotherapy , chemotherapy , and her2 - targeting therapy , may be associated with cardiac toxicity , it may be necessary that predict is optimized to take into account the baseline cardiovascular risk profiles of asian patients . this may be done using newer sophisticated techniques such as artificial neural networks and machine learning . online breast cancer prognostic prediction tools may play a valuable role in clinical practice to aid chemotherapy - related decision making as they are more cost effective than molecular profiling . although previous studies , which validated adjuvant ! online , consistently showed that the program is overoptimistic in middle and high - income asian settings , the current validation exercise of predict reaffirms that western - derived prognostic scoring systems may still be relevant and applicable in asian patients . nevertheless , it is important to note that validation of such tools are extremely crucial and a prerequisite for adoption into clinical practices in other settings . in conclusion , predict possesses appreciable clinical utility in resource - limited settings . the program may potentially serve as a clinical decision aid for both patients with breast cancer and physicians in therapeutic decision making . however , predict may not be suitable for use in very young patients ( ie , 40 years at diagnosis ) , and patients who have received neoadjuvant chemotherapy . future studies are required to optimize the model in asian settings by inclusion of data on comorbidities and assess the impact of using predict on multidisciplinary tumor board decisions . it is also pertinent to determine the usefulness of the program to patients , in understanding their prognoses and helping them make adjuvant treatment - related decisions .\noutput:\n" }, { "from": "agent", "value": "abstractweb - based prognostication tools may provide a simple and economically feasible option to aid prognostication and selection of chemotherapy in early breast cancers . we validated predict , a free online breast cancer prognostication and treatment benefit tool , in a resource - limited setting.all 1480 patients who underwent complete surgical treatment for stages i to iii breast cancer from 1998 to 2006 were identified from the prospective breast cancer registry of university malaya medical centre , kuala lumpur , malaysia . calibration was evaluated by comparing the model - predicted overall survival ( os ) with patients actual os . model discrimination was tested using receiver - operating characteristic ( roc ) analysis.median age at diagnosis was 50 years . the median tumor size at presentation was 3 cm and 54 % of patients had lymph node - negative disease . about 55 % of women had estrogen receptor - positive breast cancer . overall , the model - predicted 5 and 10 - year os was 86.3 % and 77.5 % , respectively , whereas the observed 5 and 10 - year os was 87.6 % ( difference : 1.3 % ) and 74.2 % ( difference : 3.3 % ) , respectively ; p values for goodness - of - fit test were 0.18 and 0.12 , respectively . the program was accurate in most subgroups of patients , but significantly overestimated survival in patients aged < 40 years , and in those receiving neoadjuvant chemotherapy . predict performed well in terms of discrimination ; areas under roc curve were 0.78 ( 95 % confidence interval [ ci ] : 0.740.81 ) and 0.73 ( 95 % ci : 0.680.78 ) for 5 and 10 - year os , respectively.based on its accurate performance in this study , predict may be clinically useful in prognosticating women with breast cancer and personalizing breast cancer treatment in resource - limited settings ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: acute myocardial infarction ( ami ) is a common manifestation of coronary heart disease that affected 800000 adults in the united states in 2010.1 concomitant with advances in prehospital and hospital treatment , inhospital survival after ami has dramatically improved .2 many patients are being discharged from the hospital into the community who are at risk for being readmitted to the hospital due to a variety of contributory factors and reasons .3 , 4 although not all hospital readmissions can be prevented , excess readmissions within a short time frame can be a marker of poor quality of care and efficiency . since the centers for medicare and medicaid services ( cms ) began publicly reporting 30day riskstandardized readmission rates for heart failure , ami , and pneumonia as performance measures ,530 day hospital readmission rates have become a quality performance measure for patients hospitalized with ami .5 , 6 there has been considerable interest from hospitals and clinicians to better understand and improve modifiable factors associated with 30day hospital readmissions , which are increasingly being linked to hospital reimbursement .7 although several studies have reported 30day rehospitalization rates among patients surviving hospitalization for ami ,4 , 8 , 9 few have examined risk factors for being readmitted to the hospital during the following month by using multivariable regression analyses . moreover , there are little contemporary data that describe longterm trends in 30day rehospitalization rates , the reasons for rehospitalization , as well as sociodemographic , clinical , and treatmentrelated factors that may affect 30day rehospitalization rates among patients surviving an ami . our primary study objective was to describe relatively contemporary decade long ( 20012011 ) trends in the frequency of 30day rehospitalizations among patients surviving hospitalization for an ami . our secondary study objective was to describe patient characteristics , clinical factors , and treatment practices associated with an increased risk of 30day rehospitalizations among residents of central massachusetts discharged from the 3 principal medical centers in central massachusetts after an ami . data from the worcester heart attack study were used in this study .10 , 11 , 12 , 13described elsewhere in detail ,10 , 11 , 12 , 13 the worcester heart attack study is an ongoing populationbased investigation examining longterm trends in the descriptive epidemiology of ami in residents of the worcester , ma , metropolitan area ( 2010 census 518000 ) hospitalized at all 16 medical centers in central massachusetts on an approximate biennial basis between 1975 and 2011.10 , 11 , 12 , 13 due to hospital closures , mergers , or conversion to longterm care or rehabilitation facilities , fewer hospitals ( n = 11 ) have been providing care to greater worcester residents during recent years . computerized printouts of patients discharged from all greater worcester hospitals with possible ami ( international classification of disease , ninth revision [ icd ] codes : 410 to 414 , 786.5 ) were identified , and cases of possible ami were independently validated by using predefined criteria for ami .10 , 11 , 12 , 13 these criteria included a suggestive clinical history , increases in several serum biomarkers ( eg , creatine kinase [ ck ] , ckmb , and troponin values ) , and serial electrocardiographic findings during hospitalization consistent with the presence of ami . patients who satisfied at least 2 of these 3 criteria and were residents of the worcester metropolitan area , because this study is population based , were included . because the focus of the current study was rehospitalization after hospital discharge for ami , we included adult residents of the worcester metropolitan area who survived their index hospitalization for ami in 2001 , 2003 , 2005 , 2007 , 2009 , and 2011 . we further restricted our study population to patients hospitalized at the 3 largest tertiary care and community medical centers in central massachusetts ( umassmemorial health care and st . this was done since the majority ( 90 % ) of patients hospitalized for ami in central massachusetts were discharged from these facilities , which also have excellent electronic medical records . the patient 's index hospitalization occurred in any of the 3 study hospitals , as did any subsequent rehospitalization . patients who had their index hospitalization or their rehospitalization outside of these major medical centers were not included in this study . this study was approved by the institutional review board at the university of massachusetts medical school and that informed consent was waived . trained nurses and physicians abstracted information on patient demographic characteristics , medical history , clinical data , and treatment practices through the review of hospital medical records . these factors included patient 's sociodemographic characteristics ( eg , age , sex , race , marital status ) , year of hospitalization , hospital length of stay , history of previously diagnosed comorbidities ( eg , stroke , diabetes , heart failure ) , ami order ( initial versus prior ) and ami type ( stsegment elevation myocardial infarction [ stemi ] versus nonstemi [ nstemi ] ) .14 , 15 information on the development of important inhospital complications including atrial fibrillation ,16 cardiogenic shock ,17 heart failure ,18 and stroke19 was also collected . data on the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures ( cardiac catheterization , percutaneous coronary intervention [ pci ] , and coronary artery bypass grafting [ cabg ] ) during hospitalization , and pharmacotherapies at the time of hospital discharge , including the prescribing of 4 effective cardiac medications ( angiotensin converting inhibitors [ aceis ] / angiotensin type ii receptor blockers [ arbs ] , aspirin , blockers , and lipidlowering agents ) , were obtained . a rehospitalization was defined as the patient 's first admission to a study hospital within 30 days of discharge after their index hospitalization for ami during the years under study . two of the study investigators adjudicated whether the principal reason for readmission was due to either an ami , cardiovascular disease ( cvd ) ( excluding ami ) related , or non cvdrelated readmission based on the review of information contained in hospital medical records . indications for cvdrelated hospitalizations included unstable angina , heart failure , type ii diabetes mellitus , and chronic ischemic heart disease . for ease of analysis and interpretation , we aggregated the 6 individual study years into 2 year strata of 20012003 ( earliest ) , 20052007 ( middle ) , and 20092011 ( most recent ) for purposes of examining trends in our principal study outcomes . differences in the distribution of various patient demographic and clinical characteristics between patients hospitalized during the 3 aggregated periods were examined using the anova test for continuous variables and the test for categorical variables . the cochranarmitage tests and linear regression models were used to assess for linear trends over time among categorical and continuous variables , respectively . shortterm rehospitalization rates were examined by calculating the frequency of having a first rehospitalization within 30 days among patients discharged from the hospital after their index ami during the years under study . we examined the reasons for being rehospitalized during this period and calculated the causespecific 30day rehospitalization rates . multivariableadjusted logistic regression analyses were performed to examine the association between the main explanatory variable of period of hospitalization ( 20012003 , earliest ; 20052007 , middle ; and 20092011 , most recent ) and the outcome of whether the patient was rehospitalized during the following 30 days while adjusting for several potentially confounding variables of prognostic importance . we dummy coded the variable of time period of hospitalization with the earliest period ( 20012003 ) serving as the reference group . several covariates associated with rehospitalization after ami in prior studies3 , 4 were examined including age , sex , race ( white versus nonwhite ) , marital status ( married versus not married ) , ami order ( initial versus prior ) , ami type ( stemi versus nstemi ) , previously diagnosed comorbid conditions ( angina , atrial fibrillation , heart failure , hypertension , peripheral vascular disease , stroke , diabetes , chronic obstructive pulmonary disease , depression , and chronic kidney disease ) , hospital clinical complications ( atrial fibrillation , heart failure , cardiogenic shock , and stroke ) , and hospital length of stay . we further adjusted for hospital treatment practices , including the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures ( cardiac catheterization , pci , and cabg ) , and the prescribing of 4 guideline recommended cardiac medications ( aceis / arbs , aspirin , blockers , and lipidlowering agents ) at the time of hospital discharge during the patient 's index hospitalization in our regression analyses to examine the potential effects of hospital treatment practices on 30day rehospitalization trends . we repeated the same analyses after excluding patients ( n = 165 ) who were not rehospitalized but died within the 30day postdischarge period . in addition , we repeated the same analyses by treating patients who were not rehospitalized but died within the 30day postdischarge period as those who had a 30day readmission . the results of our logistic regression analyses were presented as multivariableadjusted odds ratios ( or ) and accompanying 95 % cis , which were calculated based on standard errors clustered at the hospital level to account for potential withinhospital correlation with variance adjustment through the use of morel 's small sample bias correction .20 all statistical analyses were conducted by using sas version 9.3 ( sas institute , inc ) . trained nurses and physicians abstracted information on patient demographic characteristics , medical history , clinical data , and treatment practices through the review of hospital medical records . these factors included patient 's sociodemographic characteristics ( eg , age , sex , race , marital status ) , year of hospitalization , hospital length of stay , history of previously diagnosed comorbidities ( eg , stroke , diabetes , heart failure ) , ami order ( initial versus prior ) and ami type ( stsegment elevation myocardial infarction [ stemi ] versus nonstemi [ nstemi ] ) .14 , 15 information on the development of important inhospital complications including atrial fibrillation ,16 cardiogenic shock ,17 heart failure ,18 and stroke19 was also collected . data on the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures ( cardiac catheterization , percutaneous coronary intervention [ pci ] , and coronary artery bypass grafting [ cabg ] ) during hospitalization , and pharmacotherapies at the time of hospital discharge , including the prescribing of 4 effective cardiac medications ( angiotensin converting inhibitors [ aceis ] / angiotensin type ii receptor blockers [ arbs ] , aspirin , blockers , and lipidlowering agents ) , were obtained . a rehospitalization was defined as the patient 's first admission to a study hospital within 30 days of discharge after their index hospitalization for ami during the years under study . two of the study investigators adjudicated whether the principal reason for readmission was due to either an ami , cardiovascular disease ( cvd ) ( excluding ami ) related , or non cvdrelated readmission based on the review of information contained in hospital medical records . indications for cvdrelated hospitalizations included unstable angina , heart failure , type ii diabetes mellitus , and chronic ischemic heart disease . for ease of analysis and interpretation , we aggregated the 6 individual study years into 2 year strata of 20012003 ( earliest ) , 20052007 ( middle ) , and 20092011 ( most recent ) for purposes of examining trends in our principal study outcomes . differences in the distribution of various patient demographic and clinical characteristics between patients hospitalized during the 3 aggregated periods were examined using the anova test for continuous variables and the test for categorical variables . the cochranarmitage tests and linear regression models were used to assess for linear trends over time among categorical and continuous variables , respectively . shortterm rehospitalization rates were examined by calculating the frequency of having a first rehospitalization within 30 days among patients discharged from the hospital after their index ami during the years under study . we examined the reasons for being rehospitalized during this period and calculated the causespecific 30day rehospitalization rates . multivariableadjusted logistic regression analyses were performed to examine the association between the main explanatory variable of period of hospitalization ( 20012003 , earliest ; 20052007 , middle ; and 20092011 , most recent ) and the outcome of whether the patient was rehospitalized during the following 30 days while adjusting for several potentially confounding variables of prognostic importance . we dummy coded the variable of time period of hospitalization with the earliest period ( 20012003 ) serving as the reference group . several covariates associated with rehospitalization after ami in prior studies3 , 4 were examined including age , sex , race ( white versus nonwhite ) , marital status ( married versus not married ) , ami order ( initial versus prior ) , ami type ( stemi versus nstemi ) , previously diagnosed comorbid conditions ( angina , atrial fibrillation , heart failure , hypertension , peripheral vascular disease , stroke , diabetes , chronic obstructive pulmonary disease , depression , and chronic kidney disease ) , hospital clinical complications ( atrial fibrillation , heart failure , cardiogenic shock , and stroke ) , and hospital length of stay . we further adjusted for hospital treatment practices , including the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures ( cardiac catheterization , pci , and cabg ) , and the prescribing of 4 guideline recommended cardiac medications ( aceis / arbs , aspirin , blockers , and lipidlowering agents ) at the time of hospital discharge during the patient 's index hospitalization in our regression analyses to examine the potential effects of hospital treatment practices on 30day rehospitalization trends . we repeated the same analyses after excluding patients ( n = 165 ) who were not rehospitalized but died within the 30day postdischarge period . in addition , we repeated the same analyses by treating patients who were not rehospitalized but died within the 30day postdischarge period as those who had a 30day readmission . the results of our logistic regression analyses were presented as multivariableadjusted odds ratios ( or ) and accompanying 95 % cis , which were calculated based on standard errors clustered at the hospital level to account for potential withinhospital correlation with variance adjustment through the use of morel 's small sample bias correction .20 all statistical analyses were conducted by using sas version 9.3 ( sas institute , inc ) . the study population consisted of 4810 adult residents of the worcester metropolitan area who survived their hospitalization for ami at the 3 major central massachusetts medical centers between 2001 and 2011 ( table 1 ) . overall , the average age of this population was 68.9 years , 41.8 % were women , 92.4 % were white , and 54.6 % were married . characteristics of patients who survived an ami : worcester heart attack study , 20012011 ami indicates acute myocardial infarction . pvalues derived from anova tests for continuous variables and tests for categorical variables . p values derived from cochranarmitage tests for categorical variables and linear regression models for continuous variables . during the most recent years under study , patients who survived their ami were more likely to be younger and have a history of hypertension , peripheral vascular disease , diabetes , or chronic kidney disease than were patients who were hospitalized during earlier study periods ( table 1 ) . between 2001 and 2011 , 32.6 % of our study sample was diagnosed with a stemi , which declined from 34.0 % in 20012003 to 31.1 % in 20092011 . the average hospital length of stay in this study population was 5.5 days , which declined from 6.4 days in 20012003 to 4.7 days in 20092011 ( table 1 ) . in addition , the likelihood of developing cardiogenic shock and stroke during hospitalization remained relatively low ( 3.5 % and 1.4 % overall , respectively ) , whereas the incidence rates of inhospital heart failure and atrial fibrillation were considerably higher ( 34.4 % and 18.8 % overall , respectively ) during the years under study ( table 1 ) . the average postdischarge 30day rehospitalization rates decreased from 20012003 ( 20.5 % ) to 20092011 ( 15.8 % ) ( p for trend = 0.001 ) ( table 2 ) . the proportion of patients who were rehospitalized was the highest ( 6.6 % ) during the first week ( 0 to 7 days ) after hospital discharge and continued to decrease as the length of postdischarge time increased ( figure 1 ) . rehospitalizations that occurred during the first week after hospital discharge accounted for 35.6 % of all 30day rehospitalizations ; this proportion decreased from 39.2 % in 20012003 to 27.2 % in 20092011 . association between time period of hospitalization and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study , 20012011 ( n = 4810 ) acei indicates angiotensinconverting inhibitors ; ami , acute myocardial infarction ; arbs , angiotensin type ii receptor blockers ; cabg , coronary artery bypass grafting ; or , odds ratio ; pci , percutaneous coronary intervention . adjusted for age , sex , race , marital status , and previously diagnosed comorbid conditions . adjusted for sociodemographic characteristics , comorbid conditions , ami order , ami type , inhospital complications , and hospital length of stay . adjusted for sociodemographic characteristics , comorbid conditions , inhospital factors , and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures ( cardiac catheterization , pci , and cabg ) and prescribing of 4 guidelinerecommended cardiac medications ( aceis / arbs , lipidlowering agents , blockers , and aspirin ) at the time of hospital discharge . rates of rehospitalizations within 30 days after hospital discharge among patients who survived an acute myocardial infarction : worcester heart attack study , 20012011 ( n = 4810 ) . in examining the specific causes of 30day rehospitalizations , 53.9 % were cvd related ( excluding ami ) , 38.1 % were noncvd related , and 8.0 % were due to a recurrent ami during the years under study . the overall causespecific 30day rehospitalization rates due to cvd , noncvd , and ami were 10.0 % , 7.0 % , and 1.5 % , respectively , during the years under study ( figure 2 ) . cvdrelated reasons decreased ( p for trend 0.001 ) during the years under study , while no significant changing trends in 30day rehospitalization rates due to cvd ( excluding ami ) or ami were observed ( figure 2 ) . causespecific 30day rehospitalization rates after hospital discharge among patients who survived an ami : worcester heart attack study , 20012011 ( n = 4810 ) . ami indicates acute myocardial infarction ; cvd , cardiovascular diseases exclude ami . in examining changing trends in 30day rehospitalizations after adjusting for several demographic characteristics , comorbidities , and inhospital clinical factors , there was no significant difference in the odds of having a 30day rehospitalization in 20052007 ( or 0.88 , 95 % ci 0.74 to 1.04 ) , but there was a reduced odds of being rehospitalized during the subsequent 30 days ( or 0.74 , 95 % ci 0.61 to 0.91 ) among patients who survived an ami in 20092011 , in comparison with those discharged in 20012003 ( table 2 ) . after further adjustment for medical procedures and treatments received during hospitalization , there was a significantly reduced odds of being rehospitalized during the subsequent 30 days ( or 0.78 , 95 % ci 0.65 to 0.93 ) in 20092011 compared with those discharged from the hospital in 20012003 ( table 2 ) . we observed similar results after excluding patients who were not rehospitalized but died during the 30day postdischarge period . we also observed similar results when we analyzed these patients as those who had a 30day hospital readmission . using multivariableadjusted regression analyses , we examined the role of various prognostic factors associated with 30day rehospitalizations in all study patients ( table 3 ) . female sex , having previously diagnosed heart failure and chronic kidney disease , and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized for any reason within 30 days after hospital discharge . on the other hand , patients who received various coronary diagnostic and interventional procedures ( cardiac catheterization and pci and / or cabg ) had a reduced odds for being rehospitalized within 30 days after hospital discharge compared with those who did not undergo these procedures ( table 3 ) . we observed similar factors that were significantly associated with 30day rehospitalizations after excluding patients who were not rehospitalized but died during the 30day postdischarge period . we also observed similar factors associated with hospital readmission when we analyzed these patients as having had a 30day hospital readmission . association between various prognostic factors and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study , 20012011 ( n = 4810 ) acei indicates angiotensinconverting inhibitor ; ami , acute myocardial infarction ; arb , angiotensin type ii receptor blocker ; cabg , coronary artery bypass grafting ; or , odds ratios ; pci , percutaneous coronary intervention . adjusted for study period , sociodemographic characteristics , and comorbidities . adjusted for study period , sociodemographic characteristics , comorbid conditions , ami order , ami type , inhospital clinical complications , and hospital length of stay . adjusted for study period , sociodemographic characteristics , comorbid conditions , inhospital factors , and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures ( cardiac catheterization , pci , and cabg ) and prescribing of 4 guidelinerecommended cardiac medications ( aceis / arbs , lipidlowering agents , blockers , and aspirin ) at the time of hospital discharge . the study population consisted of 4810 adult residents of the worcester metropolitan area who survived their hospitalization for ami at the 3 major central massachusetts medical centers between 2001 and 2011 ( table 1 ) . overall , the average age of this population was 68.9 years , 41.8 % were women , 92.4 % were white , and 54.6 % were married . characteristics of patients who survived an ami : worcester heart attack study , 20012011 ami indicates acute myocardial infarction . pvalues derived from anova tests for continuous variables and tests for categorical variables . p values derived from cochranarmitage tests for categorical variables and linear regression models for continuous variables . during the most recent years under study , patients who survived their ami were more likely to be younger and have a history of hypertension , peripheral vascular disease , diabetes , or chronic kidney disease than were patients who were hospitalized during earlier study periods ( table 1 ) . between 2001 and 2011 , 32.6 % of our study sample was diagnosed with a stemi , which declined from 34.0 % in 20012003 to 31.1 % in 20092011 . the average hospital length of stay in this study population was 5.5 days , which declined from 6.4 days in 20012003 to 4.7 days in 20092011 ( table 1 ) . in addition , the likelihood of developing cardiogenic shock and stroke during hospitalization remained relatively low ( 3.5 % and 1.4 % overall , respectively ) , whereas the incidence rates of inhospital heart failure and atrial fibrillation were considerably higher ( 34.4 % and 18.8 % overall , respectively ) during the years under study ( table 1 ) . the average postdischarge 30day rehospitalization rates decreased from 20012003 ( 20.5 % ) to 20092011 ( 15.8 % ) ( p for trend = 0.001 ) ( table 2 ) . the proportion of patients who were rehospitalized was the highest ( 6.6 % ) during the first week ( 0 to 7 days ) after hospital discharge and continued to decrease as the length of postdischarge time increased ( figure 1 ) . rehospitalizations that occurred during the first week after hospital discharge accounted for 35.6 % of all 30day rehospitalizations ; this proportion decreased from 39.2 % in 20012003 to 27.2 % in 20092011 . association between time period of hospitalization and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study , 20012011 ( n = 4810 ) acei indicates angiotensinconverting inhibitors ; ami , acute myocardial infarction ; arbs , angiotensin type ii receptor blockers ; cabg , coronary artery bypass grafting ; or , odds ratio ; pci , percutaneous coronary intervention . adjusted for age , sex , race , marital status , and previously diagnosed comorbid conditions . adjusted for sociodemographic characteristics , comorbid conditions , ami order , ami type , inhospital complications , and hospital length of stay . adjusted for sociodemographic characteristics , comorbid conditions , inhospital factors , and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures ( cardiac catheterization , pci , and cabg ) and prescribing of 4 guidelinerecommended cardiac medications ( aceis / arbs , lipidlowering agents , blockers , and aspirin ) at the time of hospital discharge . rates of rehospitalizations within 30 days after hospital discharge among patients who survived an acute myocardial infarction : worcester heart attack study , 20012011 ( n = 4810 ) . in examining the specific causes of 30day rehospitalizations , 53.9 % were cvd related ( excluding ami ) cvd related , and 8.0 % were due to a recurrent ami during the years under study . the overall causespecific 30day rehospitalization rates due to cvd , noncvd , and ami were 10.0 % , 7.0 % , and 1.5 % , respectively , during the years under study ( figure 2 ) . the average postdischarge 30day rehospitalization rates due to non cvdrelated reasons decreased ( p for trend 0.001 ) during the years under study , while no significant changing trends in 30day rehospitalization rates due to cvd ( excluding ami ) or ami were observed ( figure 2 ) . causespecific 30day rehospitalization rates after hospital discharge among patients who survived an ami : worcester heart attack study , 20012011 ( n = 4810 ) . ami indicates acute myocardial infarction ; cvd , cardiovascular diseases exclude ami . in examining changing trends in 30day rehospitalizations after adjusting for several demographic characteristics , comorbidities , and inhospital clinical factors , there was no significant difference in the odds of having a 30day rehospitalization in 20052007 ( or 0.88 , 95 % ci 0.74 to 1.04 ) , but there was a reduced odds of being rehospitalized during the subsequent 30 days ( or 0.74 , 95 % ci 0.61 to 0.91 ) among patients who survived an ami in 20092011 , in comparison with those discharged in 20012003 ( table 2 ) . after further adjustment for medical procedures and treatments received during hospitalization , there was a significantly reduced odds of being rehospitalized during the subsequent 30 days ( or 0.78 , 95 % ci 0.65 to 0.93 ) in 20092011 compared with those discharged from the hospital in 20012003 ( table 2 ) . we observed similar results after excluding patients who were not rehospitalized but died during the 30day postdischarge period . we also observed similar results when we analyzed these patients as those who had a 30day hospital readmission . using multivariableadjusted regression analyses , we examined the role of various prognostic factors associated with 30day rehospitalizations in all study patients ( table 3 ) . female sex , having previously diagnosed heart failure and chronic kidney disease , and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized for any reason within 30 days after hospital discharge . on the other hand , patients who received various coronary diagnostic and interventional procedures ( cardiac catheterization and pci and / or cabg ) had a reduced odds for being rehospitalized within 30 days after hospital discharge compared with those who did not undergo these procedures ( table 3 ) . we observed similar factors that were significantly associated with 30day rehospitalizations after excluding patients who were not rehospitalized but died during the 30day postdischarge period . we also observed similar factors associated with hospital readmission when we analyzed these patients as having had a 30day hospital readmission . association between various prognostic factors and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study , 20012011 ( n = 4810 ) acei indicates angiotensinconverting inhibitor ; ami , acute myocardial infarction ; arb , angiotensin type ii receptor blocker ; cabg , coronary artery bypass grafting ; or , odds ratios ; pci , percutaneous coronary intervention . adjusted for study period , sociodemographic characteristics , and comorbidities . adjusted for study period , sociodemographic characteristics , comorbid conditions , ami order , ami type , inhospital clinical complications , and hospital length of stay . adjusted for study period , sociodemographic characteristics , comorbid conditions , inhospital factors , and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures ( cardiac catheterization , pci , and cabg ) and prescribing of 4 guidelinerecommended cardiac medications ( aceis / arbs , lipidlowering agents , blockers , and aspirin ) at the time of hospital discharge . the results of this large observational study suggest that , among greater worcester residents who survived their hospitalization for an ami at the major medical centers in central massachusetts between 2001 and 2011 , nearly 1 in 5 patients remained at risk for being rehospitalized within 30 days and 36 % of all 30day rehospitalizations occurred during the first week after hospital discharge during the years under study . our findings suggest a decline in the odds of being rehospitalized during the first 30 days after hospital discharge in the most recent years under study , though this odds was slightly attenuated after further adjustment for hospital treatment practices . in addition , we identified several demographic and clinical factors associated with an increased odds for being rehospitalized during the first month after hospital discharge for ami . reducing hospital readmissions is a national priority to improve the quality of patient care and lower health care spending .5 , 7 , 21 this is because excess hospital readmissions indicate potentially poor health care quality or inadequate coordination of postdischarge care , represent a significant burden to both patients and the health care system , and are costly .5 , 7 , 21 several prior studies have examined the frequency of 30day rehospitalizations after ami .4 , 8 , 9 between 2007 and 2009 , nearly 1 in every 5 medicare feeforservice patients discharged from all acute care hospitals in the united states after an ami was readmitted within 30 days after hospital discharge .8 in a recent study that used an allpayer administrative data set from california , which consisted of 107256 hospitalizations for ami among adults younger than 65 years between 2007 and 2009 , the 30day rehospitalization rate was 15 % .9 a retrospective cohort study conducted in 3 hospitals in olmsted county , mn , during 19872010 found that the 30day readmission rates among adult patients who survived their hospitalization for a first ami were 23 % during 19871992 , 22 % during 19932004 , and 19 % during the most recent period under study ( 20052010 ) .4 in our study , we found similar results in that nearly onefifth of adult greater worcester residents who survived their hospitalization for an ami on a biennial basis between 2001 and 2011 were readmitted to the hospital within 30 days after hospital discharge . in addition , our study observed an encouraging decline in the odds of having a 30day rehospitalization during the most recent years ( 20092011 ) under study after adjustment for several potentially confounding variables of prognostic importance . since june 2009 , the cms began publicly reporting 30day riskstandardized readmission rates for ami as one of the major hospital performance measures .5 further , the patient protection affordable care act of 2010 , through the establishment of the medicare hospital readmissions reduction program , has created new payment penalties ( effective october 1 , 2012 ) to reduce readmissions because hospitals with excess readmissions can lose up to 3 % of their medicare reimbursement by 2015.7 although some early evidence suggests that the medicare hospital readmissions reduction program has had a positive impact on reducing the rates of 30day rehospitalization among medicare beneficiaries ,22 there remains no clear consensus on how many hospital readmissions may in all actuality be preventable . moreover , there are also concerns about potential flaws in the methodology for determining excess readmissions and computation of the penalty to hospitals .21 thus , it remains of considerable public health and clinical importance to continue monitoring contemporary trends in 30day rehospitalization rates after ami given ongoing refinement of the methodological approach by the cms to predict the risk of hospital readmissions according to various patient , provider , and health systems characteristics . with regard to the timing of hospital readmissions , a recent study that analyzed medicare feeforservice claims data ( 20072009 ) on 30day readmissions after hospitalization for ami showed that 40 % of all 30day readmissions occurred during the first week after hospital discharge .8 another recent study using 20072009 administrative data from the state of california found that 19 % of readmissions occurred within 0 to 3 days , and 21 % occurred during 4 to 7 days , after hospital discharge for ami .9 similar to these results , our study found that 36 % of all 30day rehospitalizations occurred during the first week after hospital discharge for ami . these findings suggest that proper arrangement of transitional care and continuing followup with patients during the first several days to first week post hospital discharge can be beneficial in reducing hospital readmission rates within 30 days among these patients . encouragingly , we also observed a decline in the proportion of patients who were readmitted during this particularly highrisk period during the years under study , which may suggest that efforts at reducing hospital readmissions may be paying dividends in reducing shortterm hospital readmissions . while we did not have specific information available to more fully describe and characterize any efforts that were being carried out at participating study hospitals to reduce their hospital readmission rates for patients discharged after an ami , moreaggressive systemwide efforts were being put in place in 2011 at umassmemorial health care to systematically measure and reduce the rates of hospital readmissions at these 2 medical centers . a retrospective cohort study of adult patients in olmsted county , mn ,4 who were discharged from the hospital after a first ami found that 43 % of 30day rehospitalizations after ami were related to the incident ami , 30 % were unrelated , and 27 % had an unclear relationship . the investigators also reported that about 8 % of all 30day rehospitalizations were due to a recurrent ami .4 a recent study of medicare feeforservice beneficiaries hospitalized for ami at all acute care hospitals in the united states between 2007 and 2009 showed that 10 % of patients were readmitted for the same condition after their index ami hospitalization .8 we observed similar results in that 8 % of all 30day rehospitalizations were due to ami , and a significant proportion ( 38 % ) of all 30day rehospitalizations were noncvd related . as the prevalence of comorbid conditions and aging of the american population increase over time , and efforts continue to be focused on the enhanced use of effective secondary prevention strategies to improve the postdischarge outcomes of patients with ami , 30day rehospitalizations after ami due to noncvd causes require further attention . indeed , declining lengths of hospital stay , number and complexities of evidencebased medications , older age of this patient population , increased use of observation units , and primary focus on the patient 's underlying heart condition , but not on other important comorbidities these patients have been previously diagnosed with , may have in part contributed to the high rate of nonrecent research has also suggested that patients discharged from the hospital may be vulnerable to posthospitalization syndrome , which puts them at risk for rehospitalization for conditions unrelated to their initial hospitalization .23 further research is needed to confirm the association between this syndrome and other hospital and postdischarge factors that may place patients at risk for noncvdrelated hospital readmissions and identify effective strategies for reducing readmissions . although efforts remain ongoing to find strategies that hospitals can use to prevent many readmissions , there is an ongoing debate on whether the hospital is the appropriate entity to be held accountable for all shortterm readmissions , particularly when many of the events and circumstances that are associated with readmission may take place outside of the hospital setting and after the administration of effective acute care . these factors include patients lifestyle behaviors and practices ; employment , marital , and financial status ; adherence to discharge instructions and medications ; and the availability and quality of postdischarge care . thus , reducing the frequency of hospital readmissions requires considerable collaborations , not only from hospitals but also from patients and their caregivers and other community professionals and providers across the continuum of health . due to ongoing and planned changes in national reimbursement policies ,7 there has been great interest from health care providers to better understand and improve modifiable factors associated with 30day rehospitalizations . a recent study in olmsted county , mn , examined factors associated with 30day rehospitalizations after an incident ami .4 the investigators found that certain comorbid conditions , a longer hospital stay , and complications of coronary angiography and revascularization or reperfusion were associated with an increased risk of being rehospitalized .4 our study observed that patients with a history of previously diagnosed heart failure and chronic kidney disease and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized during the first month after hospital discharge for ami . although most of these factors are not modifiable , these findings suggest that health care providers should pay extra attention to these highrisk groups of vulnerable patients to prevent potential early readmissions when planning hospital discharge and postdischarge management . future studies examining the postdischarge transitions of care in higherrisk patients , including those with multiple comorbid conditions and hospital clinical complications , remain needed to achieve greater declines in 30day rehospitalizations in this patient population . despite the potential for confounding by indication given the nonrandomized nature of the present investigation , our multivariable regression analyses adjusting for the use of various hospital treatment practices showed that the use of invasive coronary interventions was associated with a reduced odds of being rehospitalized among patients hospitalized with ami during the decadelong period under study . furthermore , encouraging declines in 30 day rehospitalizations during the years under study were slightly attenuated after adjustment for hospital treatment practices , suggesting the beneficial effects of various cardiac treatment practices on 30day readmission rates . a recent study examining 30day rehospitalizations after an acute coronary syndrome among 5219 patients enrolled in the australian and new zealand populations of the global registry of acute coronary events ( grace ) between 1999 and 2007 also observed similar results in that coronary revascularization during the acute hospital stay was associated with a reduced odds of being rehospitalized during the next month .24 the strengths of the present study include its large population of residents of all ages and both sexes from a major central massachusetts metropolitan area who were hospitalized with a confirmed ami and examination of relatively contemporary decadelong trends in 30day rehospitalization rates among hospital survivors of an ami . several limitations need to be acknowledged , however , in the interpretation of the present findings . because our study population included only patients who had been hospitalized and discharged at 3 central massachusetts medical centers , one needs to be careful in extrapolating our findings to those who reside in other geographic areas . if a rehospitalization occurred outside of the worcester metropolitan area or at other medical centers in central massachusetts , it was not captured , although it is expected that this number would be quite small and unlikely to have changed during the years under study . this is because most patients typically return to their hospital of admission and the large tertiary care and community hospitals included in the present investigation capture the vast majority of hospitalizations that occur among residents of the worcester metropolitan area . because study patients were predominantly white , the generalizability of our findings to other race / ethnicity groups may be limited . there is also the potential for unmeasured confounding in our observed associations because we did not have information available on several patientassociated characteristics , such as income , education , psychosocial factors , and treatment preference , that may have affected the end points examined . we were unable to collect information on other factors that have been shown to affect 30day rehospitalization after ami , including transitions of care and patients adherence to various postdischarge treatment regimens . finally , although our study observed an encouraging decline in 30day rehospitalizations during the most recent years ( 20092011 ) under study , future studies remain warranted to continue monitoring changes in 30day rehospitalization rates after the implementation of financial penalties to hospitals due to excess readmissions in 2012.7 reducing hospital readmissions is a national priority to improve the quality of patient care and lower health care spending .5 , 7 , 21 this is because excess hospital readmissions indicate potentially poor health care quality or inadequate coordination of postdischarge care , represent a significant burden to both patients and the health care system , and are costly .5 , 7 , 21 several prior studies have examined the frequency of 30day rehospitalizations after ami .4 , 8 , 9 between 2007 and 2009 , nearly 1 in every 5 medicare feeforservice patients discharged from all acute care hospitals in the united states after an ami was readmitted within 30 days after hospital discharge .8 in a recent study that used an allpayer administrative data set from california , which consisted of 107256 hospitalizations for ami among adults younger than 65 years between 2007 and 2009 , the 30day rehospitalization rate was 15 % .9 a retrospective cohort study conducted in 3 hospitals in olmsted county , mn , during 19872010 found that the 30day readmission rates among adult patients who survived their hospitalization for a first ami were 23 % during 19871992 , 22 % during 19932004 , and 19 % during the most recent period under study ( 20052010 ) .4 in our study , we found similar results in that nearly onefifth of adult greater worcester residents who survived their hospitalization for an ami on a biennial basis between 2001 and 2011 were readmitted to the hospital within 30 days after hospital discharge . in addition , our study observed an encouraging decline in the odds of having a 30day rehospitalization during the most recent years ( 20092011 ) under study after adjustment for several potentially confounding variables of prognostic importance . since june 2009 , the cms began publicly reporting 30day riskstandardized readmission rates for ami as one of the major hospital performance measures .5 further , the patient protection affordable care act of 2010 , through the establishment of the medicare hospital readmissions reduction program , has created new payment penalties ( effective october 1 , 2012 ) to reduce readmissions because hospitals with excess readmissions can lose up to 3 % of their medicare reimbursement by 2015.7 although some early evidence suggests that the medicare hospital readmissions reduction program has had a positive impact on reducing the rates of 30day rehospitalization among medicare beneficiaries ,22 there remains no clear consensus on how many hospital readmissions may in all actuality be preventable . moreover , there are also concerns about potential flaws in the methodology for determining excess readmissions and computation of the penalty to hospitals .21 thus , it remains of considerable public health and clinical importance to continue monitoring contemporary trends in 30day rehospitalization rates after ami given ongoing refinement of the methodological approach by the cms to predict the risk of hospital readmissions according to various patient , provider , and health systems characteristics . with regard to the timing of hospital readmissions , a recent study that analyzed medicare feeforservice claims data ( 20072009 ) on 30day readmissions after hospitalization for ami showed that 40 % of all 30day readmissions occurred during the first week after hospital discharge .8 another recent study using 20072009 administrative data from the state of california found that 19 % of readmissions occurred within 0 to 3 days , and 21 % occurred during 4 to 7 days , after hospital discharge for ami .9 similar to these results , our study found that 36 % of all 30day rehospitalizations occurred during the first week after hospital discharge for ami . these findings suggest that proper arrangement of transitional care and continuing followup with patients during the first several days to first week post hospital discharge can be beneficial in reducing hospital readmission rates within 30 days among these patients . encouragingly , we also observed a decline in the proportion of patients who were readmitted during this particularly highrisk period during the years under study , which may suggest that efforts at reducing hospital readmissions may be paying dividends in reducing shortterm hospital readmissions . while we did not have specific information available to more fully describe and characterize any efforts that were being carried out at participating study hospitals to reduce their hospital readmission rates for patients discharged after an ami , moreaggressive systemwide efforts were being put in place in 2011 at umassmemorial health care to systematically measure and reduce the rates of hospital readmissions at these 2 medical centers . a retrospective cohort study of adult patients in olmsted county , mn ,4 who were discharged from the hospital after a first ami found that 43 % of 30day rehospitalizations after ami were related to the incident ami , 30 % were unrelated , and 27 % had an unclear relationship . the investigators also reported that about 8 % of all 30day rehospitalizations were due to a recurrent ami .4 a recent study of medicare feeforservice beneficiaries hospitalized for ami at all acute care hospitals in the united states between 2007 and 2009 showed that 10 % of patients were readmitted for the same condition after their index ami hospitalization .8 we observed similar results in that 8 % of all 30day rehospitalizations were due to ami , and a significant proportion ( 38 % ) of all 30day rehospitalizations were noncvd related . as the prevalence of comorbid conditions and aging of the american population increase over time , and efforts continue to be focused on the enhanced use of effective secondary prevention strategies to improve the postdischarge outcomes of patients with ami , 30day rehospitalizations after ami due to noncvd causes require further attention . indeed , declining lengths of hospital stay , number and complexities of evidencebased medications , older age of this patient population , increased use of observation units , and primary focus on the patient 's underlying heart condition , but not on other important comorbidities these patientshave been previously diagnosed with , may have in part contributed to the high rate of nonrecent research has also suggested that patients discharged from the hospital may be vulnerable to posthospitalization syndrome , which puts them at risk for rehospitalization for conditions unrelated to their initial hospitalization .23 further research is needed to confirm the association between this syndrome and other hospital and postdischarge factors that may place patients at risk for noncvdrelated hospital readmissions and identify effective strategies for reducing readmissions . although efforts remain ongoing to find strategies that hospitals can use to prevent many readmissions , there is an ongoing debate on whether the hospital is the appropriate entity to be held accountable for all shortterm readmissions , particularly when many of the events and circumstances that are associated with readmission may take place outside of the hospital setting and after the administration of effective acute care . these factors include patients lifestyle behaviors and practices ; employment , marital , and financial status ; adherence to discharge instructions and medications ; and the availability and quality of postdischarge care . thus , reducing the frequency of hospital readmissions requires considerable collaborations , not only from hospitals but also from patients and their caregivers and other community professionals and providers across the continuum of health . due to ongoing and planned changes in national reimbursement policies ,7 there has been great interest from health care providers to better understand and improve modifiable factors associated with 30day rehospitalizations . a recent study in olmsted county , mn , examined factors associated with 30day rehospitalizations after an incident ami .4 the investigators found that certain comorbid conditions , a longer hospital stay , and complications of coronary angiography and revascularization or reperfusion were associated with an increased risk of being rehospitalized .4 our study observed that patients with a history of previously diagnosed heart failure and chronic kidney disease and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized during the first month after hospital discharge for ami . although most of these factors are not modifiable , these findings suggest that health care providers should pay extra attention to these highrisk groups of vulnerable patients to prevent potential early readmissions when planning hospital discharge and postdischarge management . future studies examining the postdischarge transitions of care in higherrisk patients , including those with multiple comorbid conditions and hospital clinical complications , remain needed to achieve greater declines in 30day rehospitalizations in this patient population . despite the potential for confounding by indication given the nonrandomized nature of the present investigation , our multivariable regression analyses adjusting for the use of various hospital treatment practices showed that the use of invasive coronary interventions was associated with a reduced odds of being rehospitalized among patients hospitalized with ami during the decadelong period under study . furthermore , encouraging declines in 30 day rehospitalizations during the years under study were slightly attenuated after adjustment for hospital treatment practices , suggesting the beneficial effects of various cardiac treatment practices on 30day readmission rates . a recent study examining 30day rehospitalizations after an acute coronary syndrome among 5219 patients enrolled in the australian and new zealand populations of the global registry of acute coronary events ( grace ) between 1999 and 2007 also observed similar results in that coronary revascularization during the acute hospital staythe strengths of the present study include its large population of residents of all ages and both sexes from a major central massachusetts metropolitan area who were hospitalized with a confirmed ami and examination of relatively contemporary decadelong trends in 30day rehospitalization rates among hospital survivors of an ami . several limitations need to be acknowledged , however , in the interpretation of the present findings . because our study population included only patients who had been hospitalized and discharged at 3 central massachusetts medical centers , one needs to be careful in extrapolating our findings to those who reside in other geographic areas . if a rehospitalization occurred outside of the worcester metropolitan area or at other medical centers in central massachusetts , it was not captured , although it is expected that this number would be quite small and unlikely to have changed during the years under study . this is because most patients typically return to their hospital of admission and the large tertiary care and community hospitals included in the present investigation capture the vast majority of hospitalizations that occur among residents of the worcester metropolitan area . because study patients were predominantly white , the generalizability of our findings to other race / ethnicity groups may be limited . there is also the potential for unmeasured confounding in our observed associations because we did not have information available on several patientassociated characteristics , such as income , education , psychosocial factors , and treatment preference , that may have affected the end points examined . we were unable to collect information on other factors that have been shown to affect 30day rehospitalization after ami , including transitions of care and patients adherence to various postdischarge treatment regimens . finally , although our study observed an encouraging decline in 30day rehospitalizations during the most recent years ( 20092011 ) under study , future studies remain warranted to continue monitoring changes in 30day rehospitalization rates after the implementation of financial penalties to hospitals due to excess readmissions in 2012.7 the results of this large observational investigation provide insights into trends and causes of 30day rehospitalizations , and factors associated with an increased risk of 30day rehospitalizations , among patients who survived hospitalization for an ami between 2001 and 2011 . the likelihood of subsequent rehospitalizations during the following month remained frequent ; however , we observed an encouraging decline in the 30day rehospitalization rate during the most recent years under study . although most of the identified risk factors were not readily modifiable , our findings can , we hope , lead to better development of innovative , patientcentered , intervention strategies that can improve inhospital management and followup care that will further reduce the 30day rehospitalization rates of patients discharged from the hospital after an ami . this research was made possible by the cooperation of participating hospitals in the worcester metropolitan area . partial salary support for drs gore and goldberg was provided for by national institutes of health grant 1u01hl10526801 .\noutput:\n" }, { "from": "agent", "value": "backgroundthere are limited data available describing relatively contemporary trends in 30day rehospitalizations among patients who survive hospitalization after an acute myocardial infarction ( ami ) in the community setting . we examined decadelong ( 20012011 ) trends in , and factors associated with , 30day rehospitalizations in patients discharged from 3 central massachusetts hospitals after ami.methods and resultsresidents of the worcester , ma , metropolitan area discharged after ami from 3 central massachusetts hospitals on a biennial basis between 2001 and 2011 comprised the study population ( n = 4810 ) . logistic regression analyses were used to examine the association between selected factors and 30day rehospitalizations . the average age of this population was 69 years , 42 % were women , and 92 % were white . during the years under study , 18.5 % of patients were rehospitalized within 30 days after hospital discharge . crude 30day rehospitalization rates decreased from 20.5 % in 20012003 to 15.8 % in 20092011 . after adjusting for several patient characteristics , there was a reduced odds of being rehospitalized in 20092011 ( odds ratio 0.74 , 95 % ci 0.610.91 ) compared with 20012003 ; this trend was slightly attenuated after further adjustment for hospital treatment practices . female sex , having previously diagnosed heart failure and chronic kidney disease , and the development of inhospital cardiogenic shock and heart failure were associated with an increased odds of being rehospitalized.conclusionswhile the likelihood of subsequent shortterm rehospitalizations remained frequent , we observed an encouraging decline during the most recent years under study . several highrisk groups were identified for purposes of heightened surveillance and intervention efforts to reduce the likelihood of being readmitted ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the scientific evidence for rapid climate change is compelling and most experts in the field have now reached a consensus : the earth 's climate is changing . evidence for this includes increasing global temperature , sea level rise ( fig . 1 ) , warming oceans , shrinking ice sheets , declining arctic sea ice , glacial retreat , increasing extreme events , ocean acidification , and decreased snow cover ( http://climate.nasa.gov/evidence/ ) . for instance , global warming is booming the market for air conditioning , which is expected to grow in the coming decades . the explosive growth of the air conditioning market and the increased fossil fuel burning in response to increased temperatures may contribute to greenhouse gas emissions and , again , to global warming . indeed , the discovery that chlorofluorocarbons are major contributors to ozone layer breakdown , resulted in their replacement by hydrochlorofluorocarbons and , more recently , by hydrofluorocarbons ( dahl , 2013 ) . hydrofluorocarbons are better coolants and have no impact on ozone depletion , but they are super - greenhouse gases with high potential to contribute to global warming ( dahl , 2013 ) . hence , the solution for the ozone layer breakdown is contributing to the greenhouse gas effect . climate change may impact human health and wellbeing in many ways , including by facilitating the spread of many infectious agents . for instance , the changing scenarios of major vector - borne diseases ( e.g. , malaria , leishmaniasis , chagas disease ) have been linked to several factors , including urbanization and deforestation , changing demographics in both developing and developed countries , economic crisis , increased global movement of people and animals , and climate change ( colwell et al . , 2011 ) . for quite some time , scientists have endeavoured to predict large - scale responses of infectious diseases to climate change ( reviewed in altizer et al . , 2013 ) , as many components of the transmission cycles of vector - borne diseases are inextricably tied to climate ( harvell et al . , 2002 , altizer et al . , 2013 ) . for instance , many blood - feeding arthropods such as ticks spend the bulk of their life cycle in the environment and their development , survival and population dynamics depend on many factors , including host availability , vegetation coverage , and climate ( randolph , 2009 , dantas - torres , 2010 ) . climate change may influence tick distribution and density , as well as the risk of tick - borne pathogen transmission to humans ( reviewed in lger et al . , 2013 ) . the climate change debate is warming up in the scientific meetings and becoming a priority on the agenda of both scientists and policy decision makers . on the occasion of the impact of environmental changes on infectious diseases ( iecid ) meeting , held in the 2015 in sitges , spain , i was challenged to give a 20 - min keynote talk on climate change , biodiversity , ticks and tick - borne diseases . because 20 min is not enough to deal with such a complex subject , the objective of this article is to logically extend my rationale presented on the occasion of the iecid meeting . this article is not intended to be an exhaustive review , but an essay on climate change , biodiversity , ticks and tick - borne diseases . over the past 4.5 billion years , our planet has passed through ice ages , warmer interglacial periods , such as the present holocene epoch that began about 10,000 years ago ( thompson , 2010 ) . the planet has also witnessed at least five big mass extinctions ( jablonski , 2002 ) and , throughout these years , it has shaped its surface , pretty much helped by the world 's most dominant species : homo sapiens . indeed , when our ancestors took the decision to move out from africa ( shriner et al . , 2014 ) , in fact , many of the global changes we are witnessing in the present days may be partly attributed to anthropogenic factors . since ancient times , humans have killed wild animals for obtaining food and decimated forests for many reasons , including for building villages ( ... towns , cities , metropolis and megalopolis ) , crop plantation , cattle grazing , and road construction ( diamond , 1997 ) . amazingly , it is estimate that over 475 million wild animals ( fig . 2 ) are killed on brazilian roads each year ( http://cbee.ufla.br/portal/atropelometro/ ) . furthermore , modern humans are also currently obtaining natural gas and oil by utilizing hydraulic fracturing ( ellsworth , 2013 ) , burning fossil fuels as never before and even exploring petroleum in deep waters ( fisher et al . , 2014 ) . the impact of these human activities is unpredictable in the long term , but will certainly influence the course of our existence on earth . tropical deforestation , mainly for grazing cattle and cropland expansion ( morton et al . , 2006 , armenteras et al . , 2013 ) , creates a drier , hotter climate in the tropics . for instance , land surface acts as a strong global carbon sink and a recent study reported a long - term decreasing trend of the amazon carbon sink ( brienen et al . , 2015 ) , underscoring the importance of preserving tropical forests , not only to protect our global biodiversity but also to mitigate eminent deleterious effects on earth 's climate . human development may benefit our way of living today , but also affect our future . all these changes , including our changing behaviour in response to these changes , may affect all kinds of living creatures , including wild animals ( potential hosts for deadly pathogens ) and arthropods such as ticks and mosquitoes , the most important groups of vectors of pathogens from a medico - veterinary perspective ( dantas - torres et al . transformation of natural environments ( e.g. , tropical forests ) into farming lands and urban settlements , introduction of invasive alien species , pollution of land , air and water , sustained over - exploration of natural resources , and unsustainable harvesting of wild plants and animals are among the main drivers of biodiversity loss ( http://www.iucn.org/what/biodiversity/ ) . for example , across the tropics , between 1980 and 2000 , more than 55 % of new agricultural land ( fig .3 ) became available at the expense of intact forests ( gibbs et al . , 2010 ) . furthermore , using a global earth - system model coupled with fine - scale habitat suitability models and parameterized according to four global scenarios of human development , visconti et al . ( 2011 ) identified future hotspots of terrestrial mammal loss worldwide , particularly in africa and the americas . it may be anticipated that the growing world human population and the consequently increasing demand for food will cause profound changes in terms of hydric resources , land cover , and global biodiversity in the coming years . the increased amount of greenhouse gases in the atmosphere , which is also intimately linked to human development ( fig .4 ) , is among the man - made causes of climate change ( shepherd , 2012 , mller et al . , 2013 ) . since the industrial revolution , increased greenhouse gas emissions ( e.g. , combustion of fossil fuels for electricity and heat generation , transportation , and manufacturing , land use changes ) have greatly contributed to the natural greenhouse gas effect ( malhi et al . , many studies have recently investigated the effects of climate change on the earth 's biodiversity . the predicted impact of climate change on biodiversity may vary widely , depending on several variables ( e.g. , method of analysis , taxonomic group , biodiversity loss metrics , spatial scales and time periods considered ) . in their review , ( 2012 ) came to the conclusion that the majority of models indicate alarming consequences for biodiversity , with the worst - case scenarios leading to extinction rates that would qualify as the sixth mass extinction in the history of the earth . this has been just been confirmed ( ceballos et al . , 2015 ) andthe scenario is expected to be worse in the fore coming decades , not only due to climate changes and but also other factors such as deforestation ( struebig et al . , 2015 ) . one may prognosticate that human development and climate change will negatively affect biodiversity at local to global scales . accordingly , there is now weighty evidence that decreases in biodiversity increase risk of transmission of different infectious diseases ( keesing et al . , 2010 , cardinale et al . , 2012 , ( 2015 ) highlighted that the biodiversity - disease relationship is a multifactorial process and suggested the use of a multidimensional approach , whereby the same disease system could be studied in different ecological zones . new databases ( e.g. , predicts and biofrag databases ) are being made available and will be useful for future assessments on terrestrial biodiversity responses to human impacts ( hudson et al . , 2014 , pfeifer et al . , 2014 ) . these biodiversity databases will also be critical for future investigations on the relationship between biodiversity and tick - borne pathogen transmission risk . tick questing activity , reproduction , and survival , depend on several factors that , in turn , have a direct impact on tick distribution and abundance ( estrada - pea et al . these include vegetation coverage , host availability , moisture and temperature conditions , photoperiod , and human activities . a very good account on the ecological physiology of ticks may found elsewhere ( randolph , 2009 ) . recent , long - term studies have demonstrated changes in the distribution of the castor bean tick ixodes ricinus in different parts of its range . for instance , data from a 30 - year study conducted in sweden indicated a clear expansion of the distribution range of this tick towards northern latitudes ( jaenson et al . , 2012 ) . indeed , the range of i. ricinus in sweden increased by 9.9 % during the observation period and most of expansion occurred in the north ( north of 60n ) where the tick 's coverage area doubled from 12.5 % in the early 1990s to 26.8 % in 2008 . another long - term study carried out from 1977 to 2011 in russia reported an increase in the abundance of i. ricinus in the eastern part of its range ( korotkov et al . , 2015 ) . these studies have shown that the northward spreading of i. ricinus in sweden and russia appear to be associated to climate change , particularly to the occurrence of milder winters and extended growing seasons . host population dynamics , in response to climate change or due to human activities , may also have played a role in this process . on the occasion of the iecid meeting in sitges , someone asked me about the threshold temperature for i. ricinus , considering that winter temperatures in sweden and russia may be very cold for any living creature ( a brazilian would be inclined to agree ) . i probably did not elaborate a proper answer for that question , because the relationship between tick development rates and temperature is nonlinear ( randolph , 2009 , estrada - pea et al . , ( 2014 ) stated while the idea of fixed temperature thresholds applying across populations may be a convenient assumption from the point of view of predicting the distribution of ticks , it may lack realism . for instance , it has been demonstrated that geographically separated populations of i. ricinus show clinal variation in the response of questing to temperature , suggesting that physiological thresholds are not fixed in this species ( gilbert et al . , 2014 ) . in the united kingdom , the onset of larval activity coincides with a threshold of 10 c ( randolph et al . , 2002 ) , whereas the threshold temperature for activity by questing nymphs and adults of i. ricinus has been estimated as a weekly mean daily maximum temperature of approximately 7 c ( randolph , 2009 ; and references cited therein ) . interestingly , questing nymphs and adults of i. ricinus may be found during winter in southern italy , the southernmost part of its distribution range , often in sympatry with the winter tick haemaphysalis inermis ( fig . both species can be collected with mean daily temperature below 5 c in southern italy ( dantas - torres and otranto , 2013a , dantas - torres and otranto , 2013b ) . the limiting temperature for winter survival depends on a range of factors , including tick species , developmental stage , number of days of tick exposure to a given temperature , and snow cover . for instance , i. ricinus can survive 24 - h exposure to temperatures ranging from 14.4 c to 18.9 c , but exposure for 30 days to only 10 c can be lethal for a high proportion of unfed nymphs and diapausing engorged larvae and nymphs ( knlle and dautel , 1997 ) . northern temperate tick species ( e.g. , i. ricinus and ornate cow tick dermacentor reticulatus ) are well adapted to survive in sub - zero temperatures ( medlock et al . , 2013 ) , but the capacity to supercool to temperatures of 17 c appears to be an inherent ability of many tick species , regardless geographic origin ( dautel and knlle , 1996 ) . thaw cycles , which may be more detrimental ( medlock et al . , 2013 ) . on the antarctic peninsula , the seabird tick ixodes uriae is exposed to extreme environmental conditions during the off - host phase of its life cycle ( benoit et al . , 2007 ) . an interesting study has demonstrated that winter temperature affects the prevalence of i. uriae in the brnnich 's guillemot uria lomvia ; an increase of 1 c in the average winter temperature at the nesting colony site was associated with a 5 % increase in the number of infested birds in the subsequent breeding season ( descamps , 2013 ) . climate change will likely increase the climatic niche of i. ricinus in europe , including in northern eurasian regions ( e.g. , sweden and russia ) that were previously unsuitable for this species ( porretta et al . , 2013 ) . however , the response of ticks to climate change will vary widely from region to region and according to tick species . a recent ecological niche model for i.ricinus in europe under a changing climate scenario predicted a potential habitat expansion of 3.8 % in all of europe . interestingly , this model indicated habitat expansion in some areas ( e.g. , scandinavia , the baltics , and belarus ) and habitat contraction in others ( e.g. , alps , pyrenees , interior italy , and north - western poland ) ( boeckmann and joyner , 2014 ) . projected temperature changes also increased the basic reproductive number ( r0 ) of the blacklegged tick ixodes scapularis in canada and in the united states ( ogden et al . ( 2015 ) recently reported that projected warming by the 2050s is expected to advance the timing of average nymph and larva activity by 811 and 1014 days , respectively . the effect of climate change ( particularly of increased temperatures ) in tropical zones may be deleterious to some species , adversely affecting habitat suitability and forcing certain tick species to colonize new areas . in south africa , for example , it has been predicted that increasing the temperature by 2 c will decrease habitat suitability for four tick species ( i.e. , the african blue tick rhipicephalus decoloratus , the south african bont tick amblyomma hebraeum , the brown ear tick rhipicephalus appendiculatus and the small smooth bont - legged tick hyalomma truncatum ) ( estrada - pea , 2003 ) . another study suggested that the progressive increase in temperatures seems to be forcing the dispersion of tropical bont tick amblyomma variegatum towards areas outside of zones that have a prolonged dry period in zimbabwe ( estrada - pea et al . , high temperatures adversely affect tick questing activity , especially at dry conditions ( randolph , 2009 ) . in southern italy , we observed a decline in the questing activity by nymphs and adults of i. ricinus during summer ( dantas - torres and otranto , 2013a ) . interestingly enough , questing activity by larvae was apparently not affected in the same area . we have also observed a seasonal variation in the effect of climate on the biology of brown dog tick ( rhipicephalus sanguineus sensu lato ) in southern italy ( dantas - torres et al . , 2011 ) . indeed , high temperatures may be deleterious under low humidity conditions , even for ticks that are physiologically adapted to drier environments , such as the brown dog tick ( yoder et al . , the issues of global changes , climate change and tick - borne diseases are becoming the order of the day ( logiudice et al . , 2008 , gray et al . , 2009 , keesing et al . , 2010 , estrada - pea et al . , 2012 , , 2014b , ogden et al . , 2013 , estrada - pea and de la fuente , 2014 , granter et al . , 2014 , parham et al . , 2015 , medlock and leach , 2015 ) . there is convincing evidence indicating the direct or indirect effects of global changes on tick - borne diseases . importantly , it is impossible to disconnect the mutual influences of global changes such as deforestation , land use change , and climate change on tick - borne pathogen transmission systems , as several of these factors may act synergistically on hosts , vectors , pathogens and humans themselves . many recent studies have investigated the influence of climate change on tick - borne disease upturn in different parts of the world . ( 2008 ) correlated a cluster of mediterranean spotted fever cases to a warming - mediated increase in the aggressiveness of brown dog ticks . climate change has been implicated as an important driving force for the expansion of the taiga tick ixodes persulcatus habitat and the incidence of tick - borne encephalitis in the north of european russia ( tokarevich et al . , it is also recognized that i. ricinus and borrelia burgdorferi sensu lato are spreading to northern latitudes and to higher altitudes as a result of the effects of climate change on host populations and on tick development , survival and seasonal activity ( mannelli et al . , 2012 , lger et al . nonetheless , the relationship between climate change and tick - borne diseases is not uniform across all regions and tick species . for instance , feria - arroyo et al . ( 2014 ) used a maximum entropy approach to forecast the present and future distribution of b. burgdorferi - infected i. scapularis in the texasaccording to this modelling approach , habitat suitable for the distribution of i. scapularis in the texasthe increased incidence of tick - borne encephalitis in sweden during 20112012 is apparently more correlated to host population dynamics than to climate factors ( palo , 2014 ) . the impact of climate change on tick - borne diseases has long been a subject of debate ( gilbert , 2010 , randolph , 2010 ) and is still a controversial issue . while some models suggest dramatic range expansions of ixodes ticks and tick - borne diseases as a result of climate warming , predicted distributions may also vary widely with the models assumptions ( ostfeld and brunner , 2015 ) . it has been stated that the impact of global warming on tick - borne diseases will be more evident at the geographical limits of current distributions , where suboptimal temperatures are currently limiting the spread of infected vectors ( randolph , 2013 ) . ostfeld and brunner ( 2015 ) argued that more data on key tick - demographic and climatic processes , as well as the incorporation of non - climatic processes are required to develop better models .2014 ) developed a model to investigate the joint effects of seasonal temperature variation and host community composition on b. burgdorferi transmission by i. scapularis . they proposed a stage - structured periodic model by integrating seasonal tick development and activity , multiple host species and complex pathogen transmission routes between ticks and reservoirs . in such model , climate warming can amplify and slightly change the seasonality of disease risk . both the dilution and amplification effects could be detected by feeding the model with different animal hosts . although there has been considerable debate on the biodiversity - buffers - disease paradigm ( randolph and dobson , 2012 , randolph and dobson , 2013 , ostfeld , 2013 , salkeld et al . , 2013 , wood et al . , 2014 ) , recent studies assessing the effects of host diversity on lyme disease risk or incidence at both small and large scales have found very strong support for dilution effect ( turney et al . , 2014 , werden et al . , 2014 ) . indeed , a new meta - analysis of 202 effect sizes on 61 parasite species provided widespread support for dilution effects across different ecological contexts , indication that biodiversity declines could increase human and wildlife diseases and decrease crop and forest production ( civitello et al . , 2015 ) . in common sense , chaos denotes extreme confusion , disorder , a state in which behaviour and events are not controlled by anything , in sum , a pandemonium . for instance , i say very often these days to my wife : the car traffic in recife is becoming chaotic . in greek mythology , chaos ( greek , khaos ) is the most ancient of gods , formless or void state preceding the creation of the universe . but only recently , i also came to understanding that , in mathematics , chaos theory is a field that studies the behaviour of dynamical systems ( rickles et al . , 2007 ) . the principle is that small changes in the initial conditions will result in different outcomes for such dynamical systems ; this sensitive dependence on initial conditions is the so - called butterfly effect . the chaos theory has many potential applications , including in medicine ( philippe , 1993 ) , ecology ( hastings et al . , 1993 ) and evolution ( ferrire and fox , 1995 ) . the response of ticks to changes in climate and in densities of their hosts can be variable . for instance , manipulations of models ( even deterministic ones ) can produce different outcomes , including tick populations that either rise or fall under increasing host densities , depending on initial conditions ( dobson , 2014a ) . tick - borne pathogen transmission systems are also difficult to predict ( perhaps , unpredictable ) in the long term , because of the possibility of chaotic behaviour ( sensitive dependence on initial conditions ) . the existence of complex ecological processes ( e.g. , trophic cascades ) and their possible influences on the tick - host - pathogen triad increase the complexity of models of multi - host transmission systems . for instance , a trophic cascade is ecological process that starts at the top of the food chain and fall down to the bottom ( paine , 1980 ) . food - webs may be influenced by top - down effects from carnivores to plants and by bottom - up effects that link plants to herbivores and higher trophic levels , and the importance of each in a given ecosystem is a subject of debate ( muhly et al . , 2013 ) . a classical example of a trophic cascade is what happened in the yellowstone national park in the united states , when grey wolves ( canis lupus ) were reintroduced in 1995 ( beyer et al . , 2007 , kauffman et al . , 2010 , ripple and beschta , 2012 , dobson , 2014b , ripple et al . , 2014 ) . in his talk for more wonder , rewild the world filmed july 2013 at tedglobal 2013 , george monbiot presented a very exciting description of what happened in this park , explaining how wolves transformed not just the local ecosystem , but also its physical geography ( see video at : http://www.ted.com/talks/george_monbiot_for_more_wonder_rewild_the_world ) . even if the relationship between grey wolf reintroduction and increased fruit availability and consumption by grizzly bears ( ursus arctos ) in the yellowstone national park is an on - going debate ( barber - meyer , 2015 , ripple et al . , 2015 ) , the occurrence of a wolf - inducted trophic cascade in this area is evident . the reintroduction of wolves triggered important changes in the local ecosystem , when they started preying on ungulates , particularly elk ( cervus elaphus ) ( metz et al . the interactions between wolves , ungulates , coyotes ( canis latrans ) , red foxes ( vulpes vulpes ) , and so on , resulted in important changes in terrestrial mammal and bird communities in the yellowstone national park . trophic cascades may potentially affect the transmission dynamics of pathogens such as b. burgdorferi , through dilution and / or amplification effects . ( 2012 ) elaborated a theoretical model suggesting that changes in predator communities may have cascading impacts that facilitate the emergence of lyme disease . they showed that increases in lyme disease in the north - eastern and mid - western united states over the past three decades coincide with a range - wide decline of a key small - mammal predator , the red fox , likely due to expansion of coyote populations , being uncorrelated with deer abundance as usually thought . our dead - end journey on this planet begins from the moment we are born . in the famous 1955 play auto da compadecida , by the late ariano suassuna , the character chic says about his friend 's death : cumpriu sua sentena e encontrou - se com o nico mal irremedivel , aquilo que a marca de nosso estranho destino sobre a terra , aquele fato sem explicao que iguala tudo o que vivo num s rebanho de condenados , porque tudo o que vivo morre ; translated from the portuguese this means : he fulfilled his sentence and met with the only irredeemable evil , which is the mark of our strange destiny on earth , that unexplainable fact that equates all living beings into a flock of convicts , because all that is alive dies . when chic ( the most cowardly of men and an insatiable liar ) said all that is alive dies he was fatally telling the truth . although we may be living shorter lifespans than we could ( werfel et al . , 2015 ) , nobody lives forever . buteven if life is finite , our existence is still an intriguing , unpredictable process . indeed , improvements in healthcare practices , nutrition , housing , sanitation , working conditions , and efforts towards a more universal access to healthcare have greatly increased our lifespan in the past centuries , even in developing countries ( atun et al . , 2015 ) . plants , terrestrial mammals , birds , reptiles , fishes , insects and other invertebrates are all influenced and , to some extent , dependent on climate . earth 's climate used to be cooler than today . since the end of the last ice age ( 10,000 years ago ) , we have lived in a relatively warm period with stable carbon dioxide concentration . over the last 200 years , the rate of carbon dioxide accumulation due to our emissions has increased to unprecedented levels ( http://www.theccc.org.uk/ ) . this is amplifying the natural greenhouse effect and contributing to changes in the earth 's climate , including atmospheric and oceanic warming ( shevenell et al . , 2011 ) . hence , the impact of climate change on biodiversity and on tick - borne diseases at local to global scales is unpredictable . some causes and consequences of climate may vary in space and time , sometimes being reversible . can we reforest and re - wild the world ? will this positively influence our existence on this planet ? the relationship between tick development rates and temperature is nonlinear , as the relationship between entomological measures of infection and human risk of vector - borne diseases ( hollingsworth et al . , 2015 ) . moreover , there are also several methodological caveats ( e.g. , use of inadequate environmental variables , differences between real and visible tick populations ) that should be taken into account while developing models to investigate tick responses to changes in climate and host densities ( dobson , 2014a , estrada - pea et al . , 2014a , estrada - pea et al . , 2015further studies are needed to investigate the complex relationships between landscape , climate , host communities ( biodiversity ) , tick demography ( see balashov , 2012 ) , pathogen diversity , human demography , human behaviour , economics , politics , and human exposure to pathogens , also considering all ecological processes ( e.g. , trophic cascades ) and other possible interactions ( mutual effects of increased greenhouse gas emissions and increased deforestation rates ) . the elevated number of variables and of interacting factors involved and their complexity make tick - borne pathogen transmission systems beyond ( current ) human comprehension ( box 1 ) . strong commitment of scientists and professionals from different disciplines ( e.g. , medicine , veterinary , parasitology , biology , ecology , epidemiology , statistics , geography , physics , mathematics , and anthropology ) will be needed to address tick - borne diseases from a broad perspective . it may be anticipated that warmer winters and extended autumn and spring seasons will continue to drive the expansion of the distribution of some tick species ( e.g. , i. ricinus ) to northern latitudes and to higher altitudes . livestock movements will also play a role in the latitudinal dispersion of ticks in some areas ( fig . nonetheless , it remains unclear whether and to what extent climate change will influence the upsurge of tick - borne diseases in new areas and / or their re - emergence in core endemic areas . certainly , other factors such as urbanization , population growth , economic downturn , and political crisis ( sumilo et al . , 2008 , godfrey and randolph , 2011 ) should also be considered while assessing this multifaceted problem . furthermore , it is now more evident than ever that biodiversity loss may increase disease risk ( see civitello et al . , 2015 ) . human development is transforming most of earth 's natural systems , but the health impacts of ecosystem alteration are still poorly understood ( reviewed in myers et al . , 2013 ) . human behaviour is also a strong determinant of environmental health , animal health and human health . with regard to tick - borne diseases , changes in human behaviour may result in diverging outcomes in terms of transmission risk . even if general conditions are favourable to transmission in a given region , the avoidance of tick - infested habitats by people could change the outcome of the transmission risk model . likewise , even if a person bitten by a tick , the rapid removal of this tick may reduce the transmission risk to near zero .\noutput:\n" }, { "from": "agent", "value": "we have killed wild animals for obtaining food and decimated forests for many reasons . nowadays , we are burning fossil fuels as never before and even exploring petroleum in deep waters . the impact of these activities on our planet is now visible to the naked eye and the debate on climate change is warming up in scientific meetings and becoming a priority on the agenda of both scientists and policy decision makers . on the occasion of the impact of environmental changes on infectious diseases ( iecid ) meeting , held in the 2015 in sitges , spain , i was invited to give a keynote talk on climate change , biodiversity , ticks and tick - borne diseases . the aim of the present article is to logically extend my rationale presented on the occasion of the iecid meeting . this article is not intended to be an exhaustive review , but an essay on climate change , biodiversity , ticks and tick - borne diseases . it may be anticipated that warmer winters and extended autumn and spring seasons will continue to drive the expansion of the distribution of some tick species ( e.g. , ixodes ricinus ) to northern latitudes and to higher altitudes . nonetheless , further studies are advocated to improve our understanding of the complex interactions between landscape , climate , host communities ( biodiversity ) , tick demography , pathogen diversity , human demography , human behaviour , economics , and politics , also considering all ecological processes ( e.g. , trophic cascades ) and other possible interacting effects ( e.g. , mutual effects of increased greenhouse gas emissions and increased deforestation rates ) . the multitude of variables and interacting factors involved , and their complexity and dynamism , make tick - borne transmission systems beyond ( current ) human comprehension . that is , perhaps , the main reason for our inability to precisely predict new epidemics of vector - borne diseases in general ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: chronic myeloid leukemia ( cml ) is the most common form of adult leukemia in india . past decade has seen a major shift in the management and outcome of this once upon a time , uniformly fatal disease . imatinib is presently the first line treatment of newly diagnosed cml in chronic phase , accelerated phase disease and even in blast crisis . advances in translational research leading to better the drug development has seen the emergence of second generation tyrosine kinase inhibitors and src kinase inhibitors leading to successful treatment of imatinib resistant cases . with these developments , cml is really becoming a chronic disease such as diabetes and hypertension . imatinib became available to indian patients in year 2002 and since then it has changed the scenario of cml in india . the present report describes our experience with this drug in patients of cml on follow - up . all adult patients diagnosed as cml at our unit during the period from 2002 to 2008 , were treated with imatinib . patients , who were on regular follow - up and reported in the months of may and june 2010 , were analyzed for side - effects and molecular response to treatment with imatinib . all newly diagnosed patients were started on oral dose of 400 mg of imatinib daily . the dose of imatinib was increased if patients showed evidence of disease progression . at diagnosis , all patients underwent complete physical examination , complete hemogram , and hepatic and renal function tests . after starting the treatment blood countswere performed weekly until patients achieved complete hematological response ( chr ) and then monthly . all patients underwent quantitative assessment of bcr - abl ratio by reverse - transcription polymerase chain reaction ( rt - pcr ) method at baseline and every 6 monthly . bone marrow and cytogenetic studies were not performed routinely at follow - up as most of the patients were not keen for an invasive painful procedure and also because of logistics and technicalities associated with cytogenetic assessment . standard criteria for chr , which included normalization of blood parameters and disappearance of clinical symptoms and signs including splenomegaly , major molecular response ( mmor ) was defined as bcr - abl / abl ratio of less than 0.05 % or 3 log reduction from the baseline transcript values , whereas complete molecular response was defined as undetectable levels of bcr - abl transcripts , were applied . in our unit , 176 patients of cml were enrolled in glivec international patient assistance program ( gipap ) from 2002 till 2008 . of these 176 patients , the 75 patients presented to the out - patient department in the months of may and june 2010 . the data of these 75 patients was analyzed for various parameters including toxicity profile and molecular responses . there were patients with median follow - up of months and patients have completed almost 10 years . nearly 60 % of patients presented with splenomegaly , 29 % had hepatomegaly whereas only 4 % had peripheral lymphadenopathy as shown in table 1 . patient characteristics ( demographics and presentation features ) is as given below hematologic response : complete hematological response was seen in 97 % of patients . the median time to attainment of chr was 4.3 weeks ( range from 2 weeks to 2 months . ) molecular response : in our analysis , 10 % of patients had achieved mmor by 6 months , 30 % of the patients achieved mmor by 12 months . by 18 months , 55 % of patients had achieved mmor and by 24 months 67 % of patients had achieved mmor as shown in figure 1 and 2 . only 10 % of patients , who had achieved mmor , subsequently lost the molecular response . showing molecular response achieved by patient at different time intervals showing trend in achievement of major molecular response as function of time dose escalationwas carried out in 10 % of patients for loss of molecular response . in the toxicities , as shown in table 2 , 55 % of patients had skin pigmentation changes including malar rash , followed by complains of edema and or weight gain in 47 % of patients . the imatinib was well tolerated , 15 % of patients had abnormalities of blood count parameters and only 3 % had derangement of liver function test . hematologic response : complete hematological response was seen in 97 % of patients . the median time to attainment of chr was 4.3 weeks ( range from 2 weeks to 2 months . ) molecular response : in our analysis , 10 % of patients had achieved mmor by 6 months , 30 % of the patients achieved mmor by 12 months . by 18 months , 55 % of patients had achieved mmor and by 24 months 67 % of patients had achieved mmor as shown in figure 1 and 2 . only 10 % of patients , who had achieved mmor , subsequently lost the molecular response . showing molecular response achieved by patient at different time intervals showing trend in achievement of major molecular response as function of timedose escalation was carried out in 10 % of patients for loss of molecular response . in the toxicities , as shown in table 2 , 55 % of patients had skin pigmentation changes including malar rash , followed by complains of edema and or weight gain in 47 % of patients . the imatinib was well tolerated , 15 % of patients had abnormalities of blood count parameters and only 3 % had derangement of liver function test . the natural history of cml has seen a dramatic change with the introduction of imatinib . in pre imatinib era the average survival for patients used to be few yearsnatural course of the disease used to pass through phases of chronic phase to accelerated phase to blast crisis and within a year or so of the blast crisis used to succumb to their disease . now , we see patients maintained in chronic phase for a very long duration of time and accelerated phase and blast crisis have become uncommon in patients treated with imatinib . in our patient population , the median age was 41 yrs ( range 18 - 66 yrs ) which is concordance with other studies published from this subcontinent . the male female ratio in our study is 2:1 , which may not be representative because of highly selective patient population studied . majority of patients presented with splenomegaly and the mean white blood cell count was 46,000 ranging from 36000 - 300000 / cmm . hematological remission was obtained in 97 % patients , which is in concurrence with the other studies . the median time to chr was 4.3 weeks ( range from 2 weeks to 10 weeks ) . most of the studies reported so far from sub - continent have not reported molecular response assessment in their studies . the uniqueness of our study is follow - up with molecular response monitoring . after starting on the treatment , the first to get corrected is hematologic parameters followed by cytogenetic and molecular criteria . of which the molecular response assessment is the most sensitive and specific for cml , which is usually measured by quantitative rt - pcr , which can be easily performed on bone marrow or peripheral blood sample . molecular monitoring using pcr is a sensitive assay that can measure disease burden even in patients who have achieved complete cytogenetic remission and thus may be able to identify patients at higher risk of resistance or relapse . ( 2002 ) in their study has shown that bcr - abl / abl ratio is an accurate surrogate of the contemporary marrow cytogenetic response in patients treated with imatinib and in their subsequent studies have shown that early trends in bcr - abl / abl ratio enables prediction of cytogenetic response after 6 months of therapy . nearly , 30 % of our patients achieved mmor s by 12 months and by 18 months 55 % of our patients achieved mmor s. patients continued to achieve mmor beyond 48 months and at median 60 months of follow - up we had a mmor of about 70 % . only 10 % of the patient who achieved mmor by 18 months had lost their responses subsequently . the study by prasad et al . showed that 37.5 % patients achieved cmor in first 6 months and remaining patients who did not achieve cmor at 6 mo failed to do so even at 1 year also , which is in contrast to our observations that molecular response is an ongoing process , and there exists a sub set of patients who respond slowly , but go on to achieve molecular responses even later than 48 months period . patients who achieve early molecular responses are more likely to have durable cytogenetic responses along with better progression - free survival . the molecular response assessment avoided the bone marrow examination procedure , which is a painful invasive test for which almost all of patients were reluctant to undergo periodically . furthermore , the testing requires an intensive technical process , for which expertise and logistics might not be possible . however , cytogenetic testing may be reserved for special situations like increasing bcr - abl transcripts , which may indicate loss of response and may help in detecting clonal evolution . thus monitoring molecular responses in cml may be a good parameter , especially in our country . furthermore , by molecular response monitoring more timely decisions can be made regarding the investigative and management protocols besides predicting the therapeutic outcome .\noutput:\n" }, { "from": "agent", "value": "the data presents 75 chronic myeloid leukemia patients diagnosed over a period 6 years i.e. from 2002 to 2008 . the most common presentation was splenomegaly and 97 % achieved complete hematological response at median duration of 4.3 weeks . the uniqueness of this study is follow - up with molecular response monitoring . nearly , 30 % patients achieved major molecular response ( mmor ) by 12 months . 70 % of patients achieved mmor by median time of 60 months . only 10 % of the patient who achieved mmor by 18 months had lost their responses subsequently ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the age - standardized incidence is approximately 1 per 100,000 women in the united states and few cases have been reported since 1957.2 - 4 hcc is aggressive during pregnancy and has a poor prognosis with an overall one - year survival of 23 % , which could be explained by two main etiologies : estrogen elevation which accelerates the evolution of hcc and immune suppression during pregnancy . we present a case of hcc in a 41 - year - old pregnant patient who referred to our academic hospital with abdominal pain , icter , laboratory features of microangiopathic hemolytic anemia and low alpha fetoprotein ( afp ) . a 41 - year - old pregnant woman referred to our hospital in the 22nd week of gestational age with right upper abdominal pain and jaundice . she had mild abdominal pain six weeks before presentation which was aggravated one week before admission . four days before admission , she had icter , tea colored urine and edema in her lower extremities . she had nausea and vomiting but no headache , blurred vision or bleeding was mentioned . a past history was remarkable for two abortions and one live birth prior to this pregnancy . she took only ferrous sulfate and aspirin in this pregnancy and no other drugs , herbal medicines or oral contraceptives ( ocps ) . there was no history of blood transfusion , hepatitis or exposure to aflatoxin in her past history however her father died from hcc due to hepatitis b virus ( hbv ) . laboratory investigations showed features of microangiopathic hemolytic anemia that included schistocytes , elevated prothrombin time and erythrocyte sedimentation rate ( esr ) , and negative viral markers ( negative hbsag and hbcab ) . differential diagnoses of hellp syndrome , thrombotic thrombocytopenic purpura ( ttp ) or acute fatty liver of pregnancy ( aflp ) were made for further evaluation and management . her blood pressure was 110/70 mmhg with a pulse rate of 110 beats / min , respiratory rate about 18 / min and oral temperature of 37c . her abdomen was tender , particularly in the right upper quadrant , but without rebound and guarding . lower extremities had 3 + pitting edema and there were ecchymotic lesions at previous injection sites . blood electrolytes were normal but there was direct hyperbilirubinemia and liver enzymes showed a cholestatic pattern . peripheral blood smear showed features of microangiopathic hemolytic anemia that included target cells , tear drop and nucleated rbcs , and numerous schistocytes . urine analysis was positive for microscopic hematuria and proteinuria.a 24 - hour urine collection showed 226 milligrams of protein . viral markers of hbv and hcv , autoantibodies and adisintegrin - like and metalloproteinase with thrombospondin type 1 motif ( adamts ) - 13 antigen and antibody ( markers for thrombotic thrombocytopenic pupura = ttp ) were all negative . afp level was 90.7 and cancer antigen 125 ( ca125 ) titer was 1000 . transabdominalsonography showed a normal fetus with a gestational age of about 23 weeks and normal amniotic fluid in the breech position . no lesion was noted in the portal vein , which had a diameter of 10 mm . a possible diagnosis of hellp was made and supportive care for correction of coagulation disorder with fresh frozen plasma ( ffp ) and corticosteroids were administrated . because of deterioration in her mental state in conjunction with an increased bilirubin level and international normalized ratio ( inr ) , the pregnancy was terminated . vaginal delivery was not possible because of the patient s decreased mental state so a cesarean section was performed . the fetus was delivered and transferred to nicu but expired because of immaturity . at laparotomy , approximately one liter of ascitic fluid was noted in the abdomen and the liver had multiple malignant appearing mass lesions , which were biopsied with wedge resection . surgical specimen of the liver showed pleomorphic appearances that confirmed hepatocellular carcinoma ( hcc ) ( arrows ) . after delivery the patient experienced progressive loss of conscious along with multi - organ failure and unfortunately died after a few days . hcc during pregnancy is very rare and only 48 cases have been reported since roddie s first report in 1957 until 2010 according to a pubmed literature review . the incidence of hcc in pregnant women is about 1 per 100,000 , of which most reside in africa and asia . according to the literature , the mean age of pregnant women with hcc was 28.94.4 years after 1995 . these women had fewer pregnancies , fewer signs and symptoms , and higher survival rates compared to women diagnosed before 1995 who were older ( 31.47.2 years ) , diagnosed late in pregnancy and many of whom received no curative treatment . choi et al . have shown that in the african or asian race , particularly among the chinese , hbv and ocps are the main etiologies for hcc during pregnancy . our case had negative hbsag , hbcab , and hcv ab levels and had no past history of ocp consumption . our case was 41 years old and diagnosis was made in during the fourth pregnancy . the risk of hcc increases with parity4 as shown in the present case but is very low in those who are hbsag non - carriers , with an incidence of 0.55 per 100,000 in women reported by fwuet al . hcc is rare during pregnancy because of the lower incidence of hcc in women during the reproductive years and infertility that is due to cirrhosis . pregnancy may have an adverse effect on the progression of hcc because of the effects of estrogen viral hepatitis carcinogenesis , however some authors disagree . late menopause , early menarche , ocps and multiparity have been reported as risk factors for hcc , again suggestive of the negative impact of pregnancy on hcc . estrogen can increase hepatocyte mitosis , hypervascularity , free radicals , reactivate hbv and decrease humoral immunity .11 , 12 hcc is asymptomatic in its early stages during pregnancy but right upper quadrant pain or the presence of a mass , weight loss and hepatomegaly have been the most frequent presentations , however our case presented with nausea and vomiting and abnormal liver enzymes which have been rare in reported cases ( each , 6.4 % in the literature ) . our patient had hemolytic microangiopathic anemia , which was not found in previous cases and had no history of weight loss . in addition , a family history of hcc was only found in 8 % of cases3 , which again was present in our case . in our case , the afp level was about 90ng / ml and unusual for hcc . maternal afp levels are used to screen for down syndrome or neural tube defects and it has been suggested that elevated afp in a pregnant patient with a normal fetus is indicative of maternal disease , particularly hcc . however afp screening for hcc lacks sensitivity because it depends on maternal weight , age , diabetes and ethnicity . previous studies have shown that 10 % of pregnant women can have hcc with normal afp levels and 55.3 % have afp levels less than 400 ng / ml , thus afp alone has a high positive predictive value . ca 125 , which is primarily used for ovarian cancer could be rarely elevated in hcc ; elevations more than 1000ng / dl as seen in our patient have been previously reported . other laboratory abnormalities that include hyperbilirubinemia , prolonged of prothrombin time and hypoalbuminemia , which were present in this case have been reported in less than 10 % of previous studies . our patient also had multiple lesions and her barcelona clinic liver cancer staging system ( blcl staging ) was stage 4 . choi et al . reported 33.3 % of their patients had multiple lesions and 21.7 % were blcl stage 4 . liver resection is the best management if possible but in cases such as ours termination of pregnancy as soon as possible is recommended .1 , 3 improvement in the surgery methods would result in a three - year survival rate of 62.5 % and the potential for uneventful pregnancy in such cases . hcc during pregnancy has a poor outcome and 20 % of patients have distant metastasis at presentation according to previous reports , however fibrolamellar hcc has a better prognosis . delivery was by cesarean section in 44.82 % and live births were present in only 58.7 % cases . unfortunately our patient and her fetus both died soon after diagnosis and cesarean section . as conclusion , those with a family history of cancer should be more closely worked up , even if they present with unusual manifestations .\noutput:\n" }, { "from": "agent", "value": "hepatocellular carcinoma ( hcc ) is very rare during pregnancy and has a worse prognosis in pregnant women compared to those who are not pregnant . we present a case of hcc in a 41 - year - old pregnant patient who was referred to our academic hospital.the patient presented with chief complaints of abdominal pain , jaundice , edema and hypertension . laboratory results were notable for elevated liver enzymes and features of microangiopathic hemolytic anemia with normal alpha fetoprotein ( afp ) and elevated cancer antigen 125 ( ca125 ) . at laparotomy for termination of pregnancy , multiple massive lesions were detected in the liver . histologic evaluation showed features of hcc.hcc must be included in the differential diagnosis of any pregnant patient who presents with elevated liver enzymes and hemolysis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: primary hepatic carcinoma is one of the most common malignant digestive system tumors , and hepatocellular carcinoma accounts for 90 % of its pathological type . hepatocellular carcinoma is the sixth most common malignant tumor and the second leading cause of cancer - related mortality worldwide . the prognosis of hepatocellular carcinoma is particularly dismal due to the high degree of malignancy , insidious onset , rapid progress , and the likelihood of invasion and metastasis . in addition , treatment options are often limited because often patients also present with hepatitis and cirrhosis . most patients have middle - and advanced - stage disease when they are diagnosed with hepatocellular carcinoma , and complete surgical resection is often precluded because of early dissemination of tumor . potential palliative care includes percutaneous ablation , hepatic artery intervention , and / or systemic chemotherapy in these patients ; however , the palliative abilities of these strategies for preserving quality of life and survival are very limited . therefore , the development of an effective systemic regimen for hepatocellular carcinoma is still a major challenge . currently , the only approved systemic therapy for the treatment of hepatocellular carcinoma is sorafenib according to 2 phase iii randomized controlled trials ( rcts ) . these 2 studies have confirmed the survival benefits of sorafenib among patients with advanced hepatocellular carcinoma in different regions , but some patients were not good candidates for this treatment due to the low objective response rate ( orr ) , unobvious improvement in tumor - related symptoms , unsatisfactory survival benefits , lack of appropriate predictive factors for treatment response , difficulty in selecting appropriate patients , or the high cost of the drug . since the early 1950s , many traditional chemotherapy drugs including 5 - fluorouracil ( 5 - fu ) , adriamycin ( adm ) / epirubicin ( eadm ) , cisplatin , mitomycin c , and etoposide have been successively applied in the treatment of hepatocellular carcinoma . previous studies have shown that the orr is only 0 % to 10 % when a single cytotoxic agent is used . moreoverin addition , the quality and results of studies may be affected by the scientific development of the time and the level of clinical research . therefore , there is a lack of sufficient and powerful evidence to support the survival benefits of systemic chemotherapy for advanced hepatocellular carcinoma . in recent years , a series of new - generation chemotherapeutic drugs , including oxaliplatin , gemcitabine , and capecitabine , has been widely used . the high efficiency and low toxicity achieved in the treatment of gastric and pancreatic cancer greatly inspired new systemic chemotherapy for advanced hepatocellular carcinoma . the each study for the first time proved that oxaliplatin - based systemic chemotherapy is effective and safe in the treatment of asian patients with advanced hepatocellular carcinoma . many subsequent studies also demonstrated the survival benefits of oxaliplatin - based chemotherapy for hepatocellular carcinoma patients . however , the baseline characteristics of patients may affect the efficacy and safety of oxaliplatin - based chemotherapy in the treatment of advanced hepatocellular carcinoma . here , we carried out a meta - analysis using all available prospective studies to evaluate the efficacy and safety of oxaliplatin - based chemotherapy in the treatment of advanced hepatocellular carcinoma . this meta - analysis was conducted according to the criteria of the preferred reporting items for systemic reviews and meta - analyses statement . a comprehensive literature search was carried out using the pubmed , cochrane library , embase , and web of science databases from their inception to june 2016 . potentially relevant studies were retrieved using the following search items : hepatocellular carcinoma or hepatocellular cancer or primary liver cancer or primary hepatic cancer and oxaliplatin . in addition , we also manually searched references cited in the original studies or review articles to identify any additional relevant studies . the following inclusion criteria for retrieved studieswere applied : ( 1 ) study design : prospective cohort study or rct ; ( 2 ) study population : patients with advanced hepatocellular carcinoma confirmed by clinical findings and / or pathological lesions and a life expectancy of 2 months or more ; ( 3 ) interventions : oxaliplatin - based chemotherapy ; chemotherapeutic agents must have been terminated at least 4 weeks before study entry or other antitumor treatments ; ( 4 ) outcome measures : reporting of orr and progression - free survival ( pfs ) or overall survival ( os ) ; and ( 5 ) safety outcomes : incidences of grade 3/4 hematological and nonhematological toxicities . the grade of toxicity was assessed according to the common toxicity criteria v2 .0 of the national cancer institute ( http://ctep.cancer.gov/reporting/ctc.html ) . studies were excluded if they : ( 1 ) were reviews , case reports , retrospective studies , or repeated publication of data ; ( 2 ) involved 30 patients ; ( 3 ) were written in any language but english ; and ( 4 ) presented incomplete basic data or were of low quality . orr is defined as the proportion of all treated patients who had a best objective tumor response of either complete response ( cr ) or partial response ( pr ) after treatment . pfs is defined as time from randomization to the first occurrence of disease progression or death from any cause of a cancer - related event . os is defined as the time from randomization to death from any cause , censoring patients who did not die at the date last known alive . two authors ( zyh and hl ) independently abstracted the following data from each included study using a standardized form : name of the first author , year of publication , region of study conducted , study design , sample size , median age of the patients , child - pugh a , disease stage , chemotherapy regimens , orr , median / 1 - year os , median / 1 - year pfs , and numbers of main grade 3/4 toxicities ( neutropenia , thrombopenia , anemia , neurotoxicity , diarrhea , and nausea / vomiting ) . any disagreement in the data extraction was resolved by consultation with the third author . the methodological quality of the included rcts was evaluated in accordance with the guidelines in the cochrane reviewers handbook . ottawa scale ( nos ) was used to assess the quality of a prospective cohort study . the scale consists of 3 items , including patient selection , comparability of the study groups , and outcome assessment . studies with a score 6 points were considered to be of high quality . risk ratios and 95 % confidence intervals ( cis ) were computed for outcome measures as dichotomous outcomes . hazard ratios were summarized to analyze the time - to - event data as outcomes . the heterogeneity of the pooled effect sizes across studies was tested by the cochrane q test and i - statistic . if p 0.05 on the cochrane q test or i was 50 % , a random effects model was selected ; otherwise , a fixed - effect model was preferred for homogeneous outcomes . potential publication bias was tested using funnel plots , begg 's rank correlation , and egger 's linear regression test . ethics : ethical approval was not necessary as this study is a systematic review and meta - analysis . this meta - analysis was conducted according to the criteria of the preferred reporting items for systemic reviews and meta - analyses statement . a comprehensive literature search was carried out using the pubmed , cochrane library , embase , and web of science databases from their inception to june 2016 . potentially relevant studies were retrieved using the following search items : hepatocellular carcinoma or hepatocellular cancer or primary liver cancer or primary hepatic cancer and oxaliplatin . in addition , we also manually searched references cited in the original studies or review articles to identify any additional relevant studies . the following inclusion criteria for retrieved studies were applied : ( 1 ) study design : prospective cohort study or rct ; ( 2 ) study population : patients with advanced hepatocellular carcinoma confirmed by clinical findings and / or pathological lesions and a life expectancy of 2 months or more ; ( 3 ) interventions : oxaliplatin - based chemotherapy ; chemotherapeutic agents must have been terminated at least 4 weeks before study entry or other antitumor treatments ; ( 4 ) outcome measures : reporting of orr and progression - free survival ( pfs ) or overall survival ( os ) ; and ( 5 ) safety outcomes : incidences of grade 3/4 hematological and nonhematological toxicities . the grade of toxicity was assessed according to the common toxicity criteria v2 .0 of the national cancer institute ( http://ctep.cancer.gov/reporting/ctc.html ) . studies were excluded if they : ( 1 ) were reviews , case reports , retrospective studies , or repeated publication of data ; ( 2 ) involved 30 patients ; ( 3 ) were written in any language but english ; and ( 4 ) presented incomplete basic data or were of low quality . orr is defined as the proportion of all treated patients who had a best objective tumor response of either complete response ( cr ) or partial response ( pr ) after treatment . pfs is defined as time from randomization to the first occurrence of disease progression or death from any cause of a cancer - related event . os is defined as the time from randomization to death from any cause , censoring patients who did not die at the date last known alive . two authors ( zyh and hl ) independently abstracted the following data from each included study using a standardized form : name of the first author , year of publication , region of study conducted , study design , sample size , median age of the patients , child - pugh a , disease stage , chemotherapy regimens , orr , median / 1 - year os , median / 1 - year pfs , and numbers of main grade 3/4 toxicities ( neutropenia , thrombopenia , anemia , neurotoxicity , diarrhea , and nausea / vomiting ) . any disagreement in the data extraction was resolved by consultation with the third author . the methodological quality of the included rcts was evaluated in accordance with the guidelines in the cochrane reviewers handbook . ottawa scale ( nos ) was used to assess the quality of a prospective cohort study . the scale consists of 3 items , including patient selection , comparability of the study groups , and outcome assessment . studies with a score 6 points were considered to be of high quality . all the analyses were conducted using stata statistical software ( version 12.0 ) . risk ratios and 95 % confidence intervals ( cis ) were computed for outcome measures as dichotomous outcomes . hazard ratios were summarized to analyze the time - to - event data as outcomes . the heterogeneity of the pooled effect sizes across studies was tested by the cochrane q test and i - statistic . if p 0.05 on the cochrane q test or i was 50 % , a random effects model was selected ; otherwise , a fixed - effect model was preferred for homogeneous outcomes . potential publication bias was tested using funnel plots , begg 's rank correlation , and egger 's linear regression test . ethics : ethical approval was not necessary as this study is a systematic review and meta - analysis . after screening of the titles and abstracts , 23 papers were excluded . after reviewing the full - text manuscripts , nine of the included studies had a single - arm design , and 1 study was an rct . a total of 525 patients with advanced hepatocellular carcinoma received oxaliplatin - based chemotherapy across the 10 studies . patients in 9 studies did not receive any systemic chemotherapy , whereas 20.65 % patients had completed systemic chemotherapy before 4 weeks in 1 study . the chemotherapy regimens included folfox4 , gemox alone , or in combination with cetuximab , bevacizumab , sorafenib , xelox , or in combination with bevacizumab , or oxaliplatin plus doxorubicin . the patients continued sorafenib as maintenance therapy after receiving treatment with gemox plus sorafenib in 1 study . the number of cycles ranged from 2 to 8.7 . one rct reported the detailed method of randomization and lost follow - up but none reported allocation concealment . of the prospective studies , the representativeness of the cases in 4 studies was poor . all the included studies reported the orr , including the complete remission rate and partial remission rate .2 a , heterogeneity across 10 studies was significant ( i = 69.1 % , p = 0.001 ) , and the pooled orr was 14.4 % ( 95 % ci 9.219.6 % ) in the random effects model .2 b ) and egger 's linear regression test ( p = 0.002 ) but not on the begg 's rank correlation test ( p = 0.152 ) . forest plots showing objective remission rates from eligible studies in a random effects model ( a ) and funnel plots of objective remission rate ( b ) . subgroup analyses indicated that the pooled orr was 13.9 % ( 95 % ci 6.821.0 % ) in asian patients and 12.8 % ( 95 % ci 6.818.7 % ) in western patients ( fig . the t test indicated that there was no significant difference in this value between the asian and western subgroup ( p = 0.867 ) . in addition , the pooled orr was 16.8 % ( 95 % ci 5.627.9 % ) with the gemox regimen and 15.1 % ( 95 % ci 5.1 % 25.1 % ) with the xelox regimen . there was no significant difference between gemox and xelox regimen subgroup ( p 0.05 ) . nine studies reported median os or 1 - year os data . the pooled median pfs and os were 4.7 and 9.4 months , respectively . the pooled 1 - year pfs was 19.3 % ( 95 % ci 10.428.1 % ; i = 77.7 % , p the pooled 1 - year os was 35.7 % ( 95 % ci 27.543.9 % ; i = 65.2 % , p = 0.005 ) in a random effects model ( fig . there was evidence of publication bias for the 1 - year pfs and os according to the symmetrical funnel plots , begg 's rank correlation test , and egger 's linear regression test ( data not shown ) . forest plots showing 1 - year progression - free survival ( a ) and overall survival ( b ) from eligible studies in a random effects model . in asian patients , the pooled 1 - year pfs was 12.5 % ( 95 % ci 025.9 % ) in 2 studies ( fig .5 a ) , and the pooled 1 - year os was 30.5 % ( 95 % ci 19.641.4 % ) in 4 studies ( fig . the pooled median pfs and os were 4.7 and 9.5 months , and the pooled 1 - year pfs ( fig .6 b ) were 19.6 % ( 95 % ci 12.826.3 % ) and 42.4 % ( 95 % ci 33.551.4 % ) in a fixed effects model , respectively . there was no significant difference in the 1 - year pfs or os between asian and western patients ( p 0.05 ) . forest plots showing 1 - year progression - free survival ( a ) and overall survival ( b ) from eligible studies in asian patients . forest plots showing 1 - year progression - free survival ( a ) and overall survival ( b ) from eligible studies in western patients . the most often reported grade 3/4 hematological and nonhematological toxicities were neutropenia , thrombopenia , anemia , neurotoxicity , diarrhea , and nausea / vomiting . as shown in table 3 , the pooled incidences of grade 3/4 adverse events were 17.2 % ( 95 % ci 10.424.1 % ) for neutropenia , 9.2 % ( 95 % ci 6.724.1 % ) for thrombopenia , 6.0 % ( 95 % ci 4.08.1 % ) for anemia , 4.8 % ( 95 % ci 1.67.9 % ) for neurotoxicity , 3.1 % ( 95 % ci 1.64.7 % ) for diarrhea , and 1.8 % ( 95 % ci 0.63.1 % ) for nausea / vomiting . both the begg 's rank correlation and egger 's linear regression test indicated publication bias in pooled grade 3/4 toxicities . subgroup analyses indicated that the pooled incidences of grade 3/4 neutropenia , thrombopenia , anemia , neurotoxicity , diarrhea , and nausea / vomiting were 19.2 % ( 95 % ci 9.828.6 % ) , 7.7 % ( 95 % ci 5.010.3 % ) , 6.0 % ( 95 % ci 4.08.1 % ) , 1.0 % ( 95 % ci 02.0 % ) , 2.7 % ( 95 % ci 1.14.3 % ) , and 1.6 % ( 95 % ci 0.23.0 % ) in asian patients , whereas the corresponding incidences in western studies were 14.7 % ( 95 % ci 1.128.3 % ) , 18.2 % ( 95 % ci 11.724.8 % ) , 7.2 % ( 95 % ci 2.811.7 % ) , 8.0 % ( 95 % ci 3.312.7 % ) , 16.0 % ( 95 % ci 6.026.0 % ) , and 2.9 % ( 95 % ci 06.3 % ) , respectively . t tests showed that there were significant differences in the incidences of thrombopenia , neurotoxicity , and diarrhea ( p 0.05 ) , but not in the incidences of neutropenia , anemia , and nausea / vomiting ( p 0.05 ) . after screening of the titles and abstracts , 23 papers were excluded . after reviewing the full - text manuscripts , nine of the included studies had a single - arm design , and 1 study was an rct . a total of 525 patients with advanced hepatocellular carcinoma received oxaliplatin - based chemotherapy across the 10 studies . patients in 9 studies did not receive any systemic chemotherapy , whereas 20.65 % patients had completed systemic chemotherapy before 4 weeks in 1 study . the chemotherapy regimens included folfox4 , gemox alone , or in combination with cetuximab , bevacizumab , sorafenib , xelox , or in combination with bevacizumab , or oxaliplatin plus doxorubicin . the patients continued sorafenib as maintenance therapy after receiving treatment with gemox plus sorafenib in 1 study . the number of cycles ranged from 2 to 8.7 . one rct reported the detailed method of randomization and lost follow - up but none reported allocation concealment . of the prospective studies , the representativeness of the cases in 4 studies was poor . all the included studies reported the orr , including the complete remission rate and partial remission rate .2 a , heterogeneity across 10 studies was significant ( i = 69.1 % , p = 0.001 ) , and the pooled orr was 14.4 % ( 95 % ci 9.219.6 % ) in the random effects model .2 b ) and egger 's linear regression test ( p = 0.002 ) but not on the begg 's rank correlation test ( p = 0.152 ) . forest plots showing objective remission rates from eligible studies in a random effects model ( a ) and funnel plots of objective remission rate ( b ) . subgroup analyses indicated that the pooled orr was 13.9 % ( 95 % ci 6.821.0 % ) in asian patients and 12.8 % ( 95 % ci 6.818.7 % ) in western patients ( fig . the t test indicated that there was no significant difference in this value between the asian and western subgroup ( p = 0.867 ) . in addition , the pooled orr was 16.8 % ( 95 % ci 5.627.9 % ) with the gemox regimen and 15.1 % ( 95 % ci 5.1 % 25.1 % ) with the xelox regimen . there was no significant difference between gemox and xelox regimen subgroup ( p 0.05 ) . seven studies reported median pfs or 1 - year pfs data . nine studies reported median os or 1 - year os data . the pooled 1 - year pfs was 19.3 % ( 95 % ci 10.428.1 % ; i = 77.7 % , p the pooled 1 - year os was 35.7 % ( 95 % ci 27.543.9 % ; i = 65.2 % , p = 0.005 ) in a random effects model ( fig . there was evidence of publication bias for the 1 - year pfs and os according to the symmetrical funnel plots , begg 's rank correlation test , and egger 's linear regression test ( data not shown ) . forest plots showing 1 - year progression - free survival ( a ) and overall survival ( b ) from eligible studies in a random effects model . in asian patients , the pooled 1 - year pfs was 12.5 % ( 95 % ci 025.9 % ) in 2 studies ( fig .5 a ) , and the pooled 1 - year os was 30.5 % ( 95 % ci 19.641.4 % ) in 4 studies ( fig . the pooled median pfs and os were 4.7 and 9.5 months , and the pooled 1 - year pfs ( fig .6 b ) were 19.6 % ( 95 % ci 12.826.3 % ) and 42.4 % ( 95 % ci 33.551.4 % ) in a fixed effects model , respectively . there was no significant difference in the 1 - year pfs or os between asian and western patients ( p 0.05 ) . forest plots showing 1 - year progression - free survival ( a ) and overall survival ( b ) from eligible studies in asian patients . forest plots showing 1 - year progression - free survival ( a ) and overall survival ( b ) from eligible studies in western patients . the most often reported grade 3/4 hematological and nonhematological toxicities were neutropenia , thrombopenia , anemia , neurotoxicity , diarrhea , and nausea / vomiting . as shown in table 3 , the pooled incidences of grade 3/4 adverse events were 17.2 % ( 95 % ci 10.424.1 % ) for neutropenia , 9.2 % ( 95 % ci 6.724.1 % ) for thrombopenia , 6.0 % ( 95 % ci 4.08.1 % ) for anemia , 4.8 % ( 95 % ci 1.67.9 % ) for neurotoxicity , 3.1 % ( 95 % ci 1.64.7 % ) for diarrhea , and 1.8 % ( 95 % ci 0.63.1 % ) for nausea / vomiting . both the begg 's rank correlation and egger 's linear regression test indicated publication bias in pooled grade 3/4 toxicities . subgroup analyses indicated that the pooled incidences of grade 3/4 neutropenia , thrombopenia , anemia , neurotoxicity , diarrhea , and nausea / vomiting were 19.2 % ( 95 % ci 9.828.6 % ) , 7.7 % ( 95 % ci 5.010.3 % ) , 6.0 % ( 95 % ci 4.08.1 % ) , 1.0 % ( 95 % ci 02.0 % ) , 2.7 % ( 95 % ci 1.14.3 % ) , and 1.6 % ( 95 % ci 0.23.0 % ) in asian patients , whereas the corresponding incidences in western studies were 14.7 % ( 95 % ci 1.128.3 % ) , 18.2 % ( 95 % ci 11.724.8 % ) , 7.2 % ( 95 % ci 2.811.7 % ) , 8.0 % ( 95 % ci 3.312.7 % ) , 16.0 % ( 95 % ci 6.026.0 % ) , and 2.9 % ( 95 % ci 06.3 % ) , respectively . t tests showed that there were significant differences in the incidences of thrombopenia , neurotoxicity , and diarrhea ( p 0.05 ) , but not in the incidences of neutropenia , anemia , and nausea / vomiting ( p 0.05 ) . we identified 10 prospective studies investigating the efficacy and safety of oxaliplatin - based chemotherapy in 525 patients with advanced hepatocellular carcinoma . the selected studies had obvious clinical heterogeneity mainly due to differences in the countries or ethnic groups of participants , study design , intervention , or statistical methods . we tested the presence and degree of heterogeneity by the cochrane q test and i - statistic . moreover , we also made a subgroup analysis to explore the potential source of heterogeneity in order to ensure the accuracy of statistical analysis . the major findings of this meta - analysis were that the orr , median pfs , and os were 14.4 % , 4.7 months , and 9.4 months , respectively . the clinical efficacy was not inferior to that of sorafenib , which demonstrated that oxaliplatin - based chemotherapy was effective in the treatment of advanced hepatocellular carcinoma . specifically , except for a 17.2 % incidence of neutropenia , the incidences of other grade 3/4 toxicities were low , and death events were rare . there may be geographical variation in the distribution of hepatocellular carcinoma in asian and western countries . subgroup analysis showed that there were no significant differences in the efficacy of oxaliplatin for the treatment of hepatocellular carcinoma between the asian and western patients . however , we could not determine the best oxaliplatin - based chemotherapy regimen due to the lack of significant differences in the clinical efficacy between the folfox and xelox regimens . because evidence of publication bias was detected in some variables analyzed , sorafenib is the only approved standard treatment for medically fit patients with advanced hepatocellular carcinoma , and its use was supported by high level , evidence - based medicine . however , patients who received sorafenib monotherapy only achieved a relatively low orr and limited survival benefits . nevertheless , a series of new molecular target drugs including sunitinib , everolimus , erlotinib , axitinib , linifanib , and brivanib have failed to further improve the survival time compared to sorafenib among patients with advanced hepatocellular cancer in randomized phase iii trials . as for the intrinsic resistance and / oracquired drug resistance of hepatocellular cancer cells , the clinical efficacy of conventional cytotoxic drugs was not satisfactory among patients for systemic chemotherapy . a series of combination chemotherapies based on the first - generation platinum drug pdd has been applied in the treatment of hepatocellular carcinoma , but its efficacy was not satisfactory , and severe toxicities in particular were observed . oxaliplatin , a third - generation cisplatin analog , has more broad antitumor activity , based on rapid and stronger inhibition of dna replication through the formation of dna - platinum macromolecular adducts in cancer cells . in recent years , a multicenter , open - label , randomized , phase iii ( each ) study in an asian region involved 371 patients who had advanced hepatocellular carcinoma , and the patients were randomly assigned to the folfox4 or doxorubicin group . in the folfox4 group , the median os , median pfs , and orr were 6.40 months , 2.93 , months , and 8.15 % , respectively . however , in the doxorubicin group , the median os and pfs and orr were 4.97 and 1.77 months and 2.76 % , respectively . subgroup analyses revealed that folfox4 treatment was associated with greater median os , median pfs , and orr compared with doxorubicin in chinese patients . the each study for the first time demonstrated that folfox4 has a certain orr as well as better survival benefits for the treatment of advanced hepatocellular carcinoma . these findings not only subvert the traditional concept but also change the current situation of the lack of standard systematic chemotherapy for the management of advanced hepatocellular carcinoma . a well - designed systematic review and pooled analysis summarized the benefits of oxaliplatin - based chemotherapy in advanced hepatocellular carcinoma in patients not exposed to sorafenib . thirteen prospective or retrospective case series and phase ii or iii clinical trials that enrolled advanced hepatocellular carcinoma patients treated with first - line oxaliplatin - based chemotherapy were included in this review . the pooled orr , median pfs and os were 16.8 % , 4.2 and 9.3 months , respectively . the median pfs , os , and 1 - year os were 4.5 months , 11 months , and 42.3 % in western patients , respectively . conversely , the median pfs , os , and 1 - year os were 2.43 months , 6.47 months , and 30.5 % in asiatic patients . this study highlighted that asian and western patients had different outcomes when treated with oxaliplatin - based systemic chemotherapy . however , in our meta - analysis , we only included prospective studies in order to reduce selection bias . overall , the pooled orr , median pfs , and os were similar to those reported by a previous systematic review . however , there was no significant difference in the clinical efficacy including orr , pfs , and os between the asian and western patients in our study . although oxaliplatin - based chemotherapy achieved a high incidence of orr and benefits of pfs and os , a major concern for both patients and physicians is the potential for adverse events caused by the chemotherapy regimen . this meta - analysis suggested that the most often reported grade 3/4 adverse events were neutropenia ( 17.2 % ) , thrombopenia ( 9.2 % ) , anemia ( 6.0 % ) , neurotoxicity ( 4.8 % ) , diarrhea ( 3.1 % ) , and nausea / vomiting ( 1.8 % ) . it should be noted that the toxicity assessment in our meta - analysis was not stable due to obvious publication bias . liver cirrhosis and hepatic dysfunction obviously increased the risk of adverse events , because several chemotherapeutic drugs are metabolized through the liver . however , oxaliplatin was demonstrated to offer well tolerable hepatic toxicity in patients with hepatic dysfunction . first , most of included studies had a single - arm prospective design because rcts of oxaliplatin - based chemotherapy for the treatment of advanced hepatocellular carcinoma have not been widely carried out , which might affect the reliability of our findings . second , the relatively small sample size of the included studies may have been the cause of some selection bias and diminished the statistical power of effect estimates . third , significant heterogeneity was observed in the main analysis across studies , and the dosage and composition of the chemotherapy regimen may be the sources of heterogeneity . fourth , our study can not determine a better or optimal companion agent for an oxaliplatin - based chemotherapy regimen due to the limited number of publications available on the use of oxaliplatin in combination with different chemotherapy agents . finally , this meta - analysis was based on study - level data ; we could not determine the prognostic factors associated with relief and clinical benefits because of a lack of patient - level information . this meta - analysis suggested that oxaliplatin - based chemotherapy may achieve a certain response rate and survival benefits in the treatment of advanced hepatocellular carcinoma in both asian and western patients . in addition , oxaliplatin - based chemotherapy appeared to be safe and well - tolerated . moreover , the efficacy and safety of oxaliplatin - based chemotherapy need to be further verified in direct comparisons with sorafenib or systemic chemotherapy combined sorafenib in rcts with large sample sizes .\noutput:\n" }, { "from": "agent", "value": "abstractbackground : many clinical studies have demonstrated the survival benefits of oxaliplatin - based chemotherapy for advanced hepatocellular carcinoma patients . therefore , we aim to evaluate the efficacy and safety of oxaliplatin - based chemotherapy in patients with advanced hepatocellular carcinoma by conducting a meta - analysis of prospective studies.methods : a comprehensive literature search was performed using the pubmed , cochrane library , embase , and web of science databases from their inception to june 2016 . only prospective studies evaluating oxaliplatin - based chemotherapy in patients with advanced hepatocellular carcinoma were selected . the main outcomes included objective response rate ( orr ) , progression - free survival ( pfs ) , overall survival ( os ) , and main adverse events.results : ten prospective studies involving 525 patients were included . the pooled orr , 1 - year pfs , and os were 14.4 % ( 95 % confidence interval [ ci ] 9.219.6 % ) , 9.3 % ( 95 % ci 1028 % ) , and 35.7 % ( 95 % ci 2744 % ) , respectively , for oxaliplatin - based chemotherapy . the median pfs and os were 4.7 and 9.4 months , respectively . the incidences of grade 3/4 toxicities of neutropenia , thrombopenia , anemia , neurotoxicity , diarrhea , and nausea / vomiting were 17.2 % , 9.2 % , 6.0 % , 4.8 % , 3.1 % , and 1.8 % , respectively . subgroup analysis revealed that the pooled orr was 13.9 % ( 95 % ci 6.821 % ) in asian patients and 12.8 % ( 95 % ci 6.818.7 % ) in western patients . for asian patients , the median pfs and os were 4.2 and 9.2 months , and the 1 - year pfs and os were 12.5 % and 30.5 % , respectively . for western patients , the median pfs and os were 4.7 and 9.5 months , and the 1 - year pfs and os were 19.6 % and 42.4 % , respectively . there were no significant differences in the orr , 1 - year pfs , and os ( p > 0.05 ) between asian and western patients.conclusions : oxaliplatin - based chemotherapy appears to be effective and safe for the treatment of advanced hepatocellular carcinoma ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: lupus vulgaris is the most common type of cutaneous tuberculosis , with most varied manifestations . it is a chronic and progressive form occurring in individuals with high degree of tuberculin sensitivity and moderate immunity . a characteristic feature of lupus vulgaris is its extremely chronic course with slow but steady growth of the lesions over a period of many years , even decades . we report a case of lupus vulgaris with very large sized , multiple plaques occurring at less common sites . a 40 - year - old man presented with large plaques of 30 years duration over right upper limb , right side of the chest and back , and right lower limb . the lesion started as a small papule over right upper limb near the elbow when he was 10 years old . since then it steadily grew in size to involve whole of the limb and also the right side of the chest and back . he developed similar lesions , one over the right thigh after about 2 years of the first lesion that gradually enlarged to involve most of the thigh circumferentially and one more lesion over the left side of the back since one year [ figure 1 ] . there was no history of trauma prior to the onset of the lesions or the past history suggestive of tuberculosis of any part of the body . clinical photograph showing a large plaque over right upper limb and right side of the chest before treatment on examination , there were three plaques , two large and one small , with well - defined borders and irregular margins : plaque no .1 : involving right upper limb , right side of the chest and back measuring about 6045 cm.plaque no .2 : about 63 cm over the left side of the back.plaque no .3 : over right thigh , involving circumferentially , measuring about 40 cm longitudinally and 50 cm circumferentially . plaque no .1 : involving right upper limb , right side of the chest and back measuring about 6045 cm . plaque no .3 : over right thigh , involving circumferentially , measuring about 40 cm longitudinally and 50 cm circumferentially . within the plaque , there were areas of thick hyperkeratosis and large , thick adherent crusts on an erythematous base . ulceration at some places and areas of scarring and atrophy in between the areas of hyperkeratosis were present . hematological investigations revealed anemia ( hb : 10.1 g % ) , raised erythrocyte sedimentation rate ( 67 mm / first hour ) . the mantoux test was strongly positive with a reading of 2220 mm at 72 h. chest x - ray was normal . histopathologic examination of the biopsy specimen revealed hyperplastic epidermis , upper and mid - dermis showing numerous noncaseating epitheloid granulomas with langhan 's type of giant cells [ figure 2 ] . skin biopsy showing hyperplastic epidermis , upper and mid dermis showing noncaseating epitheloid granulomas with langhan 's type of giant cells based on clinical features and investigations , a diagnosis of lupus vulgaris was made and the patient was started on antitubercular treatment cat - i . there was dramatic improvement in skin lesions within 3 weeks and after 6 weeks the lesions showed 7080 % of improvement . after 12 weeks , there was almost total healing of the lesions [ figure 3 ] . it usually occurs through contiguous extension of the disease from underlying affected tissue or hematogenous or lymphatic spread . lupus vulgaris is the most common type of cutaneous tuberculosis in india and commonly seen in the lower half of the body involving legs , thighs , buttocks , and feet . it is attributed to the habit of children playing without clothing or shoes and defecating in the open . pyogenic infection of the gluteal region is also common in india and the breach in the integrity of the skin can serve as a portal of entry for the afb . the initial lesion is a small , reddish - brown papule or nodule which later forms larger plaques by peripheral enlargement and coalescence that show evidence of healing and scarring in one area and activity in another . atrophic scarring , with or without ulceration , is a prominent feature of lupus vulgaris . the common variants are : plaque form , ulcerative and mutilating form , vegetative form , papular and nodular form and tumor - like ( hypertrophic ) form . the plaque form is the common type that presents as flat plaques with irregular or serpigenous edges , surface may be smooth or covered with psoriasiform scale . large plaques may show irregular areas of scarring with islands of active lupus tissue , the edge may be thickened and hyperkeratotic . histopathology shows tuberculoid granulomas composed of lymphocytes , plasma cells , epitheloid cells and giant cells , scant or absent central caseation , in the superficial dermis . after a thorough search of the literature , the largest size of lupus vulgaris lesion we could find was 3025 cm . ours may be the first case showing largest lesions measuring 6045 cm and 4050 cm . other special features in our case were multiplicity ( lv commonly presents as a single lesion ) and extreme chronicity of the lesions , and occurrence at less common sites such as upper limb , chest , and back . this case also shows the level of ignorance among patients and consequent failure to take proper anti - tuberculous treatment despite extensive campaign in print and audiovisual media .\noutput:\n" }, { "from": "agent", "value": "cutaneous tuberculosis continues to be an important public health problem even with the availability of highly effective anti - tuberculous drugs . it constitutes 0.1 % of all cases of extrapulmonary tuberculosis . lupus vulgaris is the most common form of cutaneous tuberculosis that occurs in previously sensitized individuals with a moderate degree of immunity against tubercle bacilli . the different types of lupus vulgaris include plaque , ulcerative , vegetative , papular and nodular , and tumor forms . a 40 - year - old man presented with large multiple plaques over right upper limb , right side of chest and back , and right lower limb for the past 30 years . histopathology showed numerous noncaseating granulomas with langhan 's type of giant cells . the mantoux test showed strong positivity and there was excellent response to anti - tuberculous treatment . this case is being reported because of its extreme chronicity of 30 years duration , unusually large size and multiplicity of lesions ." } ]