Datasets:

clinicalnlplab

/

PubmedSumm_train

like 0

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: homocysteine ( hcy ) is a sulfhydryl amino acid derived from the metabolism of methionine , an essential amino acid . it can be transsulfurated to cysteine through a pyridoxine - dependent pathway or remethylated to methionine through pathways that are dependent on folates , cobalamin and betaine . hcy concentrations are determined by an interaction between genetic , physiological and environmental factors ; elevated hcy concentrations are related to smoking , coffee and alcohol consumption , insufficient nutrition , a sedentary lifestyle and the intake of certain drugs . there is evidence suggesting that high levels of plasma hcy are a risk factor for vascular disease , fetal malformations , the development of arteriosclerosis , stroke , oxidative stress as well as peripheral vascular and cerebrovascular diseases . elevated hcy may also have direct toxic effects on central nervous system neurons , but it is still debated whether these signs are caused by hcy or whether elevated hcy is secondary , that is , a result of these processes . some reports associate higher hcy concentrations with alzheimer 's disease , psychogeriatric disorders other than dementia , mild cognitive impairment without dementia and poorer cognitive performance in normal aging . the mechanisms involved in these associations are not clearly understood , but particularly in the elderly , these alterations affect the quality of life mainly by restricting social life and gradually reducing independence . a previous study has suggested that physical exercise influences hcy concentrations , but many of the results reported are inconclusive , since they involve only the effects of acute exercise ; another study showed no significant alterations . on the other hand , a further study showed that physical exercise can lead to enhanced cognitive function in terms of memory , attention , reasoning and praxis . in view of the incongruity of the literature , the present study sought to investigate the influence of regular physical exercise on hcy concentrations , the metabolic profile and cognitive function in healthy elderly males before and after an endurance exercise program . the sample initially consisted of 118 volunteers ; however , only 45 healthy sedentary male volunteers aged 60 - 75 years ended the experiment , and they were randomly distributed into 2 groups : a control group ( n = 23 ) and an experimental group ( n = 22 ) , whose demographic data , presented as means sd , are shown in table 1 . prior to the procedure , we performed medical evaluations including electrocardiograms at rest and with effort to assess cardiovascular parameters . the diet was not monitored , and the subjects continued their own eating routines ad libitum ' . all of them were nonsmoking , had no clinical symptoms or indicators of cardiovascular disease , did not take any medication that could alter cardiovascular and cognitive function or plasma hcy concentrations , did not use alcohol or psychotropic drugs , had a sedentary lifestyle ( i.e. no habitual physical activity routine ) as evaluated with a short questionnaire for the measurement of habitual physical activity and by oxygen uptake analysis , had no impaired renal function or current liver disease ( according to clinical examinations ) and had had no surgical intervention in the previous year . all procedures were approved by the research ethics committee at the universidade federal de so paulo / hospital so paulo ( 207/01 ) . the nature of the study , its aims and possible risks were carefully explained to all volunteers beforehand , and they signed consent forms . the volunteers of the control group were asked not to vary their everyday activities or join a fitness program . all were monitored longitudinally through monthly phone calls to maintain contact and keep them informed of the course of the study . they were also informed that although they would not be taking part in the fitness program , they would be invited to do so after the intervention period of the experimental group . the experimental group took part in an aerobic fitness program on alternate days ( 3 times a week ) for 6 months . the sessions were continuous ( with the initial duration of 20 min gradually increasing to a maximum of 60 min ) and conducted on a cycle ergometer ( lifecycle 9500 hr ; life fitness , schiller park , ill . , usa ) after an ergospirometric evaluation [ ventilatory threshold 1 ( vt - 1 ) ] of variations in the subjects ' heart rates . the workload was adjusted according to the principles of the training ; we investigated the relationship between volume and intensity . in all sessions , all volunteers had their arterial pressure checked and their heart frequency monitored using a polar advantage nv device ( polar electro , kempele , finland ) . the intensity of the exercise was determined according to the concept of an anaerobic threshold ' . a thorough neuropsychological assessment was carried out on 2 occasions : before and after the 6 - month physical exercise program . a summary of the experimental design is shown in figure 1 . exercise test . by cardiopulmonary assessment , exhaled gases were analyzed with direct measurement of oxygen consumption ( vo2 ) to determine the vt . this test determined the following variables : peak vo2 , vt - 1 , maximum ventilation , maximum heart rate as well as heart rate and workload at vt - 1 intensity . respiratory and metabolic variables were obtained by measuring respiratory gaseous exchanges ( sensormedics vmax 29 series metabolic measurement cart ; sensormedics , yorba linda , calif . the system was calibrated before the test using known gas concentrations ( o2 and co2 ) , and the flow calibration was carried out using a 3 - liter syringe . this system uses a turbine - type flow linearized by the software to measure lung ventilation . it operates through a mixture chamber , with the sample being analyzed continually to determine exhaled fractions of o2 and co2 at 20 - second intervals ( sensormedics software ) . a hans rudolph flow - by face mask ( hans rudolph inc . , kansas city , mo . , usa ) the procedure involved 25 - watt load increments every 2 min ; the initial warm - up load was 3 min at 25 w , and the test was terminated upon reaching the safety margin for peak vo2 . blood pressure was monitored during testing ( manual sphygmomanometry ) , and heart rate was monitored using a polar advantage nv device at 5 - second intervals . the tests were conducted at the same time of day ( 8 - 11 a.m. ) in an acclimatized and standardized laboratory environment . this test evaluated the concentrated attention and mental control of the volunteers and consisted of 2 stages . in the first stage , individuals were instructed to repeat a sequence of numbers ( direct digits ) , and in the second part , they were required to listen to a sequence of numbers and repeat them in reverse order ( inverse digits ) . the volunteers were asked in what way 2 words ( objects or concepts ) are alike , for instance , how are a poem and a statue alike ? ' the more subjects are capable of abstraction , the higher they will score in the similarities test . following this scoring principle , an answer such asthey are both artworks ' receives the most points ( 2 points ) ; an answer like a representation of something ' is worth 1 point , and an answer like the poem describes the statue ' results in 0 points . this test evaluated spatial / visual orientation , speed of execution , perceptual integration , capacity of planning and organization . a series of 9 geometric designswere presented to the subjects , which they reproduced one at a time with a set of red and white blocks . the latter confronted subjects with 1 of 3 uppercase letters ( f , l or r ) that were rotated from 0 to 180 either in normal or mirrored ( i.e. backward ) orientation . the participants are given a key grid of numbers and matching symbols as well as a test section with numbers and empty boxes . the test consists of filling in as many empty boxes as possible with a symbol matching each number . the score was computed as the number of correctly substituted symbols within the 90 - second time frame . in addition to the 3 tasks that comprise the mental control subtest ( i.e. counting backward from 20 to 1 , reciting the alphabet and adding serial 3s ) , it includes 4 additional tasks : reciting the months of the year forward and backward , an alphabet rhyming task requiring patients to identify letters that rhyme with the word key ' and an alphabet visualization task requiring volunteers to provide all block - printed letters that contain curved linesthis test evaluates the executive aspects of the ability of copying a complex figure and praxis as well as immediate and delayed recall of visual stimuli . it consists of the subtests of copying , immediate recall and 20 - min delayed recall of a complex figure . the rey - osterrieth complex figure ( rocf ) test performances were scored by 2 clinical psychologists using the boston qualitative scoring system ( bqss ) . each 88 cm card contains 1 - 4 figures such as triangles , stars , squares and circles , which are colored red , green , yellow and blue , respectively . wrong ' when they sorted the cards without knowing the principle of classification , and the principle would be changed when they had 8 consecutive correct answers . the order was color - shape - number - color , and so on . in this study , we considered the number of correct responses . toulouse - piron test for concentrated attention . this tool helps in the investigation of 3 areas related to attention : indices of correct response , no response plus wrong response in executing the test and the time taken to complete the test . blood samples . morning blood collection was conducted by surface puncture of the forearm vein , with the volunteers remaining in a seated position and after 12 h of fasting ( both collections before and after the period of study ; after training ) . total hcy concentrations were determined by high - performance liquid chromatography ( shimadzu , kyoto , japan ) with fluorimetric detection and isocratic elution . the total hcy content was calculated with a calibration curve using known hcy concentrations and cystamine as the internal standard . screening of the disease was performed by biochemical and hematological tests including assessments of glucose , uric acid , alkaline phosphatase , bilirubin , creatinine , platelets , hemoglobin , hematocrit , thyroid hormones ( t3 , t4 ) , lipids ( ldl , hdl , triglycerides , vldl ) and prostate - specific antigen ( psa ) . statistical analysis was performed using statistics for windows version 7.0 . to determine the effect of intervention periods ( time effect ) , anova for repeated measurementwas used , followed by the duncan post hoc test ; the t test was also used for independent groups . the minimum significance level was set at 5 % , and data are presented as means sd or means se when necessary . the sample initially consisted of 118 volunteers ; however , only 45 healthy sedentary male volunteers aged 60 - 75 years ended the experiment , and they were randomly distributed into 2 groups : a control group ( n = 23 ) and an experimental group ( n = 22 ) , whose demographic data , presented as means sd , are shown in table 1 . prior to the procedure , we performed medical evaluations including electrocardiograms at rest and with effort to assess cardiovascular parameters . the diet was not monitored , and the subjects continued their own eating routines ad libitum ' . all of them were nonsmoking , had no clinical symptoms or indicators of cardiovascular disease , did not take any medication that could alter cardiovascular and cognitive function or plasma hcy concentrations , did not use alcohol or psychotropic drugs , had a sedentary lifestyle ( i.e. no habitual physical activity routine ) as evaluated with a short questionnaire for the measurement of habitual physical activity and by oxygen uptake analysis , had no impaired renal function or current liver disease ( according to clinical examinations ) and had had no surgical intervention in the previous year . all procedures were approved by the research ethics committee at the universidade federal de so paulo / hospital so paulo ( 207/01 ) . the nature of the study , its aims and possible risks were carefully explained to all volunteers beforehand , and they signed consent forms . the volunteers of the control group were asked not to vary their everyday activities or join a fitness program . all were monitored longitudinally through monthly phone calls to maintain contact and keep them informed of the course of the study . they were also informed that although they would not be taking part in the fitness program , they would be invited to do so after the intervention period of the experimental group . the experimental group took part in an aerobic fitness program on alternate days ( 3 times a week ) for 6 months . the sessions were continuous ( with the initial duration of 20 min gradually increasing to a maximum of 60 min ) and conducted on a cycle ergometer ( lifecycle 9500 hr ; life fitness , schiller park , ill . , usa ) after an ergospirometric evaluation [ ventilatory threshold 1 ( vt - 1 ) ] of variations in the subjects ' heart rates . the workload was adjusted according to the principles of the training ; we investigated the relationship between volume and intensity . in all sessions , all volunteers had their arterial pressure checked and their heart frequency monitored using a polar advantage nv device ( polar electro , kempele , finland ) . the intensity of the exercise was determined according to the concept of an anaerobic threshold ' . a thorough neuropsychological assessment was carried out on 2 occasions : before and after the 6 - month physical exercise program . a summary of the experimental design is shown in figure 1 . exercise test . by cardiopulmonary assessment , exhaled gases were analyzed with direct measurement of oxygen consumption ( vo2 ) to determine the vt . this test determined the following variables : peak vo2 , vt - 1 , maximum ventilation , maximum heart rate as well as heart rate and workload at vt - 1 intensity . respiratory and metabolic variables were obtained by measuring respiratory gaseous exchanges ( sensormedics vmax 29 series metabolic measurement cart ; sensormedics , yorba linda , calif . the system was calibrated before the test using known gas concentrations ( o2 and co2 ) , and the flow calibration was carried out using a 3 - liter syringe . this system uses a turbine - type flow linearized by the software to measure lung ventilation . it operates through a mixture chamber , with the sample being analyzed continually to determine exhaled fractions of o2 and co2 at 20 - second intervals ( sensormedics software ) . a hans rudolph flow - by face mask ( hans rudolph inc . , kansas city , mo . , usa ) the procedure involved 25 - watt load increments every 2 min ; the initial warm - up load was 3 min at 25 w , and the test was terminated upon reaching the safety margin for peak vo2 . blood pressure was monitored during testing ( manual sphygmomanometry ) , and heart rate was monitored using a polar advantage nv device at 5 - second intervals . the tests were conducted at the same time of day ( 8 - 11 a.m. ) in an acclimatized and standardized laboratory environment . this test evaluated the concentrated attention and mental control of the volunteers and consisted of 2 stages . in the first stage , individuals were instructed to repeat a sequence of numbers ( direct digits ) , and in the second part , they were required to listen to a sequence of numbers and repeat them in reverse order ( inverse digits ) . the volunteers were asked in what way 2 words ( objects or concepts ) are alike , for instance , how are a poem and a statue alike ? ' the more subjects are capable of abstraction , the higher they will score in the similarities test . following this scoring principle , an answer such as they are both artworks ' receives the most points ( 2 points ) ; an answer like a representation of something ' is worth 1 point , and an answer like the poem describes the statue ' results in 0 points . block design . this test evaluated spatial / visual orientation , speed of execution , perceptual integration , capacity of planning and organization . a series of 9 geometric designswere presented to the subjects , which they reproduced one at a time with a set of red and white blocks . the latter confronted subjects with 1 of 3 uppercase letters ( f , l or r ) that were rotated from 0 to 180 either in normal or mirrored ( i.e. backward ) orientation . the participants are given a key grid of numbers and matching symbols as well as a test section with numbers and empty boxes . the test consists of filling in as many empty boxes as possible with a symbol matching each number . the score was computed as the number of correctly substituted symbols within the 90 - second time frame . in addition to the 3 tasks that comprise the mental control subtest ( i.e. counting backward from 20 to 1 , reciting the alphabet and adding serial 3s ) , it includes 4 additional tasks : reciting the months of the year forward and backward , an alphabet rhyming task requiring patients to identify letters that rhyme with the word key ' and an alphabet visualization task requiring volunteers to provide all block - printed letters that contain curved lines . rey - osterrieth complex figure test . this test evaluates the executive aspects of the ability of copying a complex figure and praxis as well as immediate and delayed recall of visual stimuli . it consists of the subtests of copying , immediate recall and 20 - min delayed recall of a complex figure . the rey - osterrieth complex figure ( rocf ) test performances were scored by 2 clinical psychologists using the boston qualitative scoring system ( bqss ) . each 88 cm card contains 1 - 4 figures such as triangles , stars , squares and circles , which are colored red , green , yellow and blue , respectively . wrong ' when they sorted the cards without knowing the principle of classification , and the principle would be changed when they had 8 consecutive correct answers . the order was color - shape - number - color , and so on . in this study , we considered the number of correct responses . toulouse - piron test for concentrated attention . this tool helps in the investigation of 3 areas related to attention : indices of correct response , no response plus wrong response in executing the test and the time taken to complete the test . morning blood collection was conducted by surface puncture of the forearm vein , with the volunteers remaining in a seated position and after 12 h of fasting ( both collections before and after the period of study ; after training ) . total hcy concentrations were determined by high - performance liquid chromatography ( shimadzu , kyoto , japan ) with fluorimetric detection and isocratic elution . the total hcy content was calculated with a calibration curve using known hcy concentrations and cystamine as the internal standard . screening of the disease was performed by biochemical and hematological tests including assessments of glucose , uric acid , alkaline phosphatase , bilirubin , creatinine , platelets , hemoglobin , hematocrit , thyroid hormones ( t3 , t4 ) , lipids ( ldl , hdl , triglycerides , vldl ) and prostate - specific antigen ( psa ) . exhaled gases were analyzed with direct measurement of oxygen consumption ( vo2 ) to determine the vt . this test determined the following variables : peak vo2 , vt - 1 , maximum ventilation , maximum heart rate as well as heart rate and workload at vt - 1 intensity . respiratory and metabolic variables were obtained by measuring respiratory gaseous exchanges ( sensormedics vmax 29 series metabolic measurement cart ; sensormedics , yorba linda , calif . the system was calibrated before the test using known gas concentrations ( o2 and co2 ) , and the flow calibration was carried out using a 3 - liter syringe . this system uses a turbine - type flow linearized by the software to measure lung ventilation . it operates through a mixture chamber , with the sample being analyzed continually to determine exhaled fractions of o2 and co2 at 20 - second intervals ( sensormedics software ) . a hans rudolph flow - by face mask ( hans rudolph inc . , the procedure involved 25 - watt load increments every 2 min ; the initial warm - up load was 3 min at 25 w , and the test was terminated upon reaching the safety margin for peak vo2 . blood pressure was monitored during testing ( manual sphygmomanometry ) , and heart rate was monitored using a polar advantage nv device at 5 - second intervals . the tests were conducted at the same time of day ( 8 - 11 a.m. ) in an acclimatized and standardized laboratory environment . this test evaluated the concentrated attention and mental control of the volunteers and consisted of 2 stages . in the first stage , individuals were instructed to repeat a sequence of numbers ( direct digits ) , and in the second part , they were required to listen to a sequence of numbers and repeat them in reverse order ( inverse digits ) . the volunteers were asked in what way 2 words ( objects or concepts ) are alike , for instance , how are a poem and a statue alike ? ' the more subjects are capable of abstraction , the higher they will score in the similarities test . following this scoring principle , an answer such as they are both artworks ' receives the most points ( 2 points ) ; an answer like a representation of something ' is worth 1 point , and an answer like the poem describes the statue ' results in 0 points . block design . this test evaluated spatial / visual orientation , speed of execution , perceptual integration , capacity of planning and organization . a series of 9 geometric designs were presented to the subjects , which they reproduced one at a time with a set of red and white blocks . the latter confronted subjects with 1 of 3 uppercase letters ( f , l or r ) that were rotated from 0 to 180 either in normal or mirrored ( i.e. backward ) orientation . the participants are given a key grid of numbers and matching symbols as well as a test section with numbers and empty boxes . the test consists of filling in as many empty boxes as possible with a symbol matching each number . the score was computed as the number of correctly substituted symbols within the 90 - second time frame . in addition to the 3 tasks that comprise the mental control subtest ( i.e. counting backward from 20 to 1 , reciting the alphabet and adding serial 3s ) , it includes 4 additional tasks : reciting the months of the year forward and backward , an alphabet rhyming task requiring patients to identify letters that rhyme with the word key ' and an alphabet visualization task requiring volunteers to provide all block - printed letters that contain curved lines . rey - osterrieth complex figure test . this test evaluates the executive aspects of the ability of copying a complex figure and praxis as well as immediate and delayed recall of visual stimuli . it consists of the subtests of copying , immediate recall and 20 - min delayed recall of a complex figure . the rey - osterrieth complex figure ( rocf ) test performances were scored by 2 clinical psychologists using the boston qualitative scoring system ( bqss ) . each 88 cm card contains 1 - 4 figures such as triangles , stars , squares and circles , which are colored red , green , yellow and blue , respectively . wrong ' when they sorted the cards without knowing the principle of classification , and the principle would be changed when they had 8 consecutive correct answers . the order was color - shape - number - color , and so on . in this study , we considered the number of correct responses . toulouse - piron test for concentrated attention . this tool helps in the investigation of 3 areas related to attention : indices of correct response , no response plus wrong response in executing the test and the time taken to complete the test . blood samples . morning blood collection was conducted by surface puncture of the forearm vein , with the volunteers remaining in a seated position and after 12 h of fasting ( both collections before and after the period of study ; after training ) . total hcy concentrations were determined by high - performance liquid chromatography ( shimadzu , kyoto , japan ) with fluorimetric detection and isocratic elution . the total hcy content was calculated with a calibration curve using known hcy concentrations and cystamine as the internal standard . screening of the disease was performed by biochemical and hematological tests including assessments of glucose , uric acid , alkaline phosphatase , bilirubin , creatinine , platelets , hemoglobin , hematocrit , thyroid hormones ( t3 , t4 ) , lipids ( ldl , hdl , triglycerides , vldl ) and prostate - specific antigen ( psa ) . statistical analysis was performed using statistics for windows version 7.0 . to determine the effect of intervention periods ( time effect ) , anova for repeated measurementwas used , followed by the duncan post hoc test ; the t test was also used for independent groups . the minimum significance level was set at 5 % , and data are presented as means sd or means se when necessary . table 1 shows the characteristics of the sample ( age , weight , height and bmi ) ; there were no significant intergroup differences ( p 0.05 ) . table 2 presents the results of the cognitive evaluation , comparing values before and after the intervention ; the experimental group performed better in the digit symbol , digit span , block design and toulouse - piron subtests ; in the wcst , there were more trials , fewer errors and more categories completed . the digit symbol subtest scores of the control group were significantly lower , but no meaningful alterations in any other variables were observed ( p 0.05 ) . when the groups were compared after the study period , differences in the following variables were found : digit symbol ( p 0.05 ) , digit span forward ( p 0.05 ) and block design ( p = 0.05 ) as well as the numbers of trials in the wcst ( p 0.05 ) , errors ( p 0.05 ) and categories completed ( p 0.05 ) . figure 2 shows the results of the analysis of plasma hcy concentrations ; no significant changes in mean total hcy values were observed ( p 0.05 ) . the comparison of the experimental group before and after the intervention showed differences in the following variables : vo2 at vt - 1 intensity ( relative and absolute ) , heart rate and workload at the same intensity as well as diastolic pressure before and after ergospirometric testing . when comparing the groups in the postintervention condition , significant differences were verified between the experimental and the control group in the following variables : peak vo2 ( relative and absolute ; p 0.005 and p 0.05 , respectively ) , workload as well as vo2 ( absolute ) at vt - 1 intensity ( p 0.001 and p 0.005 , respectively ) at maximum ventilation ( p 0.05 ) . the serum levels of cholesterol , triglycerides , hdl , glucose , alkaline phosphatase , urea , t3 , t4 and psa were significantly increased when compared with those of the control group ( p 0.05 ) . our study did not show significant reductions in plasma hcy concentrations in elderly males after a 6 - month endurance exercise program , but the intervention was associated with an improvement in some metabolic markers that may have been responsible for the enhanced cognitive function observed . a study performed in 1999 involving young female subjects that performed an exercise on the cycle ergometer at 60 % of the maximal vo2 showed that acute exercise produces significant increases in plasma hcy concentrations . in another study , the authors found that exercise performed until exhaustion significantly increases hcy concentrations , but the real effects of physical exercise on hcy concentrations are not clear . our results suggest that hcy may be more related to nutritional factors ( appropriate food ingestion or absorption , particularly of vitamins ) than to regular physical exercise ( endurance ) , especially in older subjects . a further study demonstrated that continuous physical exercise combined with a high intake of folate and vitamin b12 could be responsible for a reduction of plasma hcy in middle - aged subjects . folate , vitamin b12 and vitamin b6 are important cofactors in the metabolic pathways of hcy , and supplementation with folate has been found to be an effective measure to lower plasma hcy . these data may indicate that our hypothesis that physical exercise alone can not be responsible for a reduction of hcy is correct . however , it is important to bear in mind that the aging process involves morphological , functional , biochemical and psychological modifications , and this process may well be associated with reduced renal function and gastric alterations such as higher ph levels in the stomach , which reduce vitamin b12 and folate absorption , and this may be reflected in the plasma hcy concentrations observed . our study did not monitor diets , so the results should be analyzed with caution ; this represents a limitation of our study . it is noteworthy to mention that although our results showed no significant alterations in plasma hcy concentrations after the endurance exercise program , some volunteers did show a decline in hcy concentrations ( from 24.9 to 14.2 , 28.1 to 16.1 , 18.4 to 14.1 and 18.8 to 11.1 mol / l , respectively ) . this finding could suggest that in addition to the dietary factor , regular physical exercise may help to lower hcy concentrations . perhaps we did not find statistically significant alterations because of the characteristics of the group we studied : they were healthy seniors who had been sedentary for at least 40 years . it seems unlikely that the relatively short intervention period ( 6 months ) could have the effect of reducing hcy concentrations , considering the lengthy period of inactivity reported by the subjects . for safety reasons , it would not be appropriate to raise the intensity of the exercise very much , unless there were longer intervention periods to allow this to be done gradually . a further issue that must be considered is that this age group in general has a diminished ability to adapt to physiological stimuli . we also found that there was an improvement in fitness in the experimental group , with improved maximal uptake of oxygen ( relative and absolute ) and heart rate and workload parameters at vt - 1 intensity . although the exercise was set at a relatively low intensity , there was a significant improvement in the cardiovascular apparatus . according to one study , varying the intensity of physical exercise in relation to vt - 1 leads to beneficial alterations in some physiological parameters . prescribing more intensive exercises leads to a better response to training , thus suggesting that the adaptive response may be intensity dependent . however , the state of the subjects ' physical fitness prior to prescription has to be taken into account , particularly for seniors . long - term sedentary seniors should be put on a low - intensity exercise program . hcy is an important marker for cardiovascular disease , and some findings indicate that hcy is involved in cognitive decline . hcy may damage brain tissue through multiple pathways and may be directly toxic to vascular endothelial cells or induce their dysfunction , leading to breaching of the blood - brain barrier and altered production of nitric oxide . in addition , if hcy crosses the blood - brain barrier or is released by cells within the brain , it can act as a potent neurotoxin by directly interacting with plasma membrane components or by intracellular accumulation of s - adenosyl hcy , inhibiting the methylation of catechol substrates that in turn generate oxyradicals and other cytotoxic , chemically reactive products . on the other hand , several studies have shown that physical exercise is an important means of improving cognitive and cardiovascular function . we found an improvement in cognitive function in our experimental group . upon comparing its post - and preintervention values , this group developed better attentional processes , short - term working memory and general intelligence . the improved physical fitness of the experimental group may explain this beneficial effect on its cognitive performance . one study suggests that physical exercise maintains vascular integrity and improves the flow of oxygen to the brain , thus making the cognitive process faster and more efficient in physically active individuals through improved cerebral circulation and alterations in neurotransmitter synthesis and degradation . furthermore , our hypothesis is that the physical exercise increased the plasma levels of brain - derived neurotrophic factor , which plays an important role in neuroplasticity and participates in neural transmission and modulation as well as cell proliferation and neurogenesis , improving cognitive function . exercise can also decrease the expression of the enzyme neuron - specific enolase and the protein s100b that may worsen cognition ; the assessment of these variables could be important to explain our results and will be our focus in the future . further research is needed to investigate the real effects of regular physical exercise on hcy . issues such as the best intensity and / or type of exercise for reducing hcy concentrations remain unclear . it may well be that better eating and lifestyle habits promote significant changes in these aspects . another possible hypothesis regarding cognitive improvement is based on the metabolic profile , which , at least partially , can be improved by physical exercise : in the present study , a decrease in alkaline phosphatase levels was observed . according to vardy et al . andbrown and thore , an increase in alkaline phosphatase levels is associated with alzheimer 's disease and inversely correlated with cognitive function . furthermore , it appears that alkaline phosphatase is the key enzyme that regulates neurotransmission and thus could play an important role in developmental plasticity and cortical activity , which may possibly be associated with improved cognitive function . other important aspects for good cognitive function are the relationship between rates of glucose and cholesterol concentrations in the blood . individuals with high levels of sugar in the blood had lower cognitive ability than those with low sugar levels . moreover , low total cholesterol levels are associated with cognitive improvement . in the present study , we observed a decrease of glucose and cholesterol levels after 6 months of physical training . these results might partly explain the cognitive improvement observed once the physical exercise had decreased the levels of cholesterol and blood glucose [ see also ref . ] . these investigations of the influence of physical exercise on cognitive function have suggested several mechanisms , which could explain relations to different alterations to the human body . this emphasizes the importance of the promotion of physical exercise for the prevention of current diseases ( obesity as well as metabolic and cardiovascular diseases ) and cognitive decline in humans . another finding of this study was that physical exercise reduced thyroid hormone levels ( t3 and t4 ) . this observation can be made because hypothyroidism and thyrotoxicosis are already associated with a significant decline in cognitive function , and therapy usually leads to an improvement in these symptoms . in contrast , major affective or cognitive dysfunction is not typical of subclinical thyroid dysfunction . subtle deficits in specific cognitive domains ( primarily working memory and executive function ) may exist in subclinical hypothyroidism and thyrotoxicosis , but these are unlikely to cause major problems in most patients [ 53 . ] our data suggest that a 6 - month endurance exercise program does not significantly reduce plasma hcy concentrations in elderly males , but that the intervention is associated with a substantial improvement in cardiorespiratory fitness and metabolic profile , including cholesterol , triglycerides , hdl , glucose , alkaline phosphatase , urea , t3 , t4 and psa , as well as in cognitive function .\noutput:\n" }, { "from": "agent", "value": "backgroundphysical exercise influences homocysteine ( hcy ) concentrations , cognitive function and the metabolic profile . the purpose of this study was to investigate the influence of regular physical exercise on hcy levels , the metabolic profile and cognitive function in healthy elderly males before and after an endurance exercise program.methodsforty - five healthy and sedentary volunteers were randomized into 2 groups : ( 1 ) a control group asked not to change their normal everyday activities and not to start any regular physical exercise program and ( 2 ) an experimental group trained at a heart rate intensity corresponding to ventilatory threshold 1 ( vt - 1 ) for 60 min / day 3 times weekly on alternate days for 6 months using a cycle ergometer . all volunteers underwent cognitive evaluations , blood sample analyses and ergospirometric assessments.resultsa significant improvement in cognitive function was observed in the experimental group compared with the control group ( p < 0.05 ) . no significant changes in hcy levels were observed in the experimental group ( p > 0.05 ) , but there was a significant increase in peak oxygen consumption and workload at vt - 1 as well as a significant improvement in cholesterol , triglycerides , hdl , glucose , alkaline phosphatase , urea , t3 , t4 and prostate - specific antigen compared with the control group ( p < 0.05 ) . conclusionthe data suggest that a physical exercise program does not reduce hcy levels in healthy elderly males , although it improves the cardiovascular and metabolic profile as well as cognitive function ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this study was conducted in the department of pharmacology and toxicology , national institute for pharmaceutical research and development ( niprd ) abuja , nigeria . chloroquine ( sigma aldrich , uk ) and pyrimethamine ( skg pharma ltd . , nigeria ) were procured . saabmal capsules ( halamin , nigeria ) were specially prepared for this study in our laboratory at niprd , abuja , using allium sativum , cymbopogon citratus , vernonia amygdalina , saccharum officinarum , amaranthus caudatus , aloe barbadensis and sesamum indicum were collected from ben amodu farm , abejikolo , kogi state , nigeria . the capsules were stored in air - tight cellophane bags inside a refrigerator at 4c and protected from light until time of drug administration when it was opened , reconstituted in water and appropriate concentrations required were administered orally directly to the experimental animals . swiss albino mice ( 18 - 25 g ) of either sex were acclimatized to laboratory conditions in the animal facility centre of the niprd , abuja . the mice were housed in plastic cages in a well ventilated room ( 255c ) , fed with standard rodent feed and allowed free access to drinking water . chloroquine - sensitive plasmodium berghei berghei ( nk 65 strain ) was obtained from the national institute for medical research ( nimr ) , lagos , nigeria . parasite viability was maintained by continuous re - infection in mice , via intraperitoneal injection . all experiments were carried out after ethical clearance was obtained from the ethics committee of the institute . parasite inoculation : one week after parasite infection of a naive mouse , a leishman - stained thin blood film was prepared from its tail vein blood on the surface of a glass slide for the assessment of parasitaemia . the red blood cell count was determined with a haemocytometer ( thermo fisher scientific , germany ) . using the parasitaemia and red blood cell count of the donor mouse , the blood sample was diluted with normal saline such that 0.2 ml contained approximately 10 parasitized red blood cells . activity in early infection ( 4 - day test ) : the method of peters et al23 was adopted . thirty mice were randomized into five groups of six mice each and inoculated with the parasite on day 0 . four hours later , the mice were treated as follows : group 1 , distilled water , 0.3 ml / kg body weight ( bw ) ; group 2 , saabmal , 100 mg / kg bw ; group 3 , saabmal , 200 mg / kg bw ; group 4 , saabmal , 400 mg / kg bw ; and group 5 , chloroquine , 5 mg / kg bw . treatment was repeated at the same time on days 1 , 2 and 3 . on day 4thin films of tail vein blood were prepared and stained with leishman 's stain . the films were examined microscopically and parasitaemia was expressed as the average count per high power field ( hpf ) . mean parasitaemiatreated x 100 / mean parasitaemiacontrol activity in established infection : the curative activity of the crude extract and in established infection was evaluated using the method of ryley and peters25 . thirty mice were inoculated intraperitoneally with dilute infected blood . on day three , the mice were randomized into five groups of six mice each such that mean parasitaemia level of the groups was almost similar . the treatment was carried out as follows : groups 1 and 2 served as controls and received distilled water and chloroquine ( 5 mg / kg bw ) , respectively , while groups 3 , 4 and 5 were treated with 100 , 200 and 400 mg saabmal / kg bw , respectively . treatment was continued once daily on days 4 to 6 . on day 7 , blood films were made and the level of parasitaemia assessed . the mice were subsequently monitored for mortality and mean survival time of each group was recorded . prophylactic activity : the prophylactic effect of the extract against infection was assessed using the method of peters26 . thirty mice were randomized into five groups ( n = 6 ) and treated once daily for three consecutive days . control groups received distilled water ( 5 ml / kg b.w ) and pyrimethamine ( 1.2 mg / kg b.w ) , while the other groups were treated with 100 , 200 and 400 mg saabmal / kg bw , respectively . on the fourth dayafter 72 h , a thin blood film of each mouse was made and parasitaemia was assessed . the mice were then euthanized by chloroform inhalation and the liver , kidneys and spleen were examined macroscopically . after inspection , the organs were immediately transferred to a plastic containers containing 10 per cent v / v formal saline tissue processing and histopathological examination . light microscopic examination of multiple tissue sections from each organ in all groups was performed . weight and content uniformity - twenty capsules selected randomly from each of the three batches supplied were weighed individually and collectively on an electronic balance ( metler p 167 ) . disintegration test - the disintegration time of the capsules was determined as specified in the british pharmacopoeia27 using an erweka 6 station disintegration tester ( erweka , dreiech , germany ) . three media ( distilled water , simulated gastric and intestinal fluids ) simulating three ph conditions ( 7.0 , 1.2 and 7.5 , respectively ) of the gastrointestinal tract were used . statistical analysis : data were analysed by one - tailed t test and one way anova followed by dunnet 's post hoc test . weight and content uniformity - twenty capsules selected randomly from each of the three batches supplied were weighed individually and collectively on an electronic balance ( metler p 167 ) . disintegration test - the disintegration time of the capsules was determined as specified in the british pharmacopoeia27 using an erweka 6 station disintegration tester ( erweka , dreiech , germany ) . three media ( distilled water , simulated gastric and intestinal fluids ) simulating three ph conditions ( 7.0 , 1.2 and 7.5 , respectively ) of the gastrointestinal tract were used . statistical analysis : data were analysed by one - tailed t test and one way anova followed by dunnet 's post hoc test . weight and content uniformity - twenty capsules selected randomly from each of the three batches supplied were weighed individually and collectively on an electronic balance ( metler p 167 ) . disintegration test - the disintegration time of the capsules was determined as specified in the british pharmacopoeia27 using an erweka 6 station disintegration tester ( erweka , dreiech , germany ) . three media ( distilled water , simulated gastric and intestinal fluids ) simulating three ph conditions ( 7.0 , 1.2 and 7.5 , respectively ) of the gastrointestinal tract were used . statistical analysis : data were analysed by one - tailed t test and one way anova followed by dunnet 's post hoc test . the activity of saabmal was dose - dependent and ranged from 29.39 to 100 per cent . at doses of 200 and 400 mg / kg , saabmal significantly ( p 0.01 ) suppressed parasitaemia relative to the untreated control group . a dose of 400 mg saabmal / kg bw showed remarkable activity ( 100 % suppression ) , similar to the activity of the reference drug , chloroquine ( table i ) . effect of saabmal on early infection ( 4 - day suppression test ) , established infection and prophylactic antiplasmodial activity of saabmal curative antiplasmodial activity : saabmal reduced the levels of parasitaemia in a dose - dependent manner by 56.20 - 95.89 per cent . these effects were significant ( p 0.01 , p 0.05 ) with all doses of saabmal compared with control and chloroquine showing similar activity . survival time was also increased in a non - dose dependent fashion , relative to the untreated control group . the mean survival time of saabmal - treated groups ( 100 and 200 mg / kg ) was noticeably higher than that of the chloroquine - treated group ( table i ) . prophylactic antiplasmodial activity : the prophylactic treatment with 100 , 200 and 400 mg saabmal / kg bw reduced parasitaemia dose - dependently by 4.67 , 53.39 ( p 0.05 ) and 99.75 per cent ( p 0.01 ) , respectively . the activity of 400 mg saabmal / kg bw was comparable to that of pyrimethamine . histopathology : table ii summarizes histopathological findings in the liver , spleen and kidney of groups administered saabmal prophylactically prior to infection with the parasite . compared to the control group which showed moderate amounts of parasitized red blood cells ( rbcs ) in the liver , livers of saabmal - treated groups were devoid of parasitized rbcs , although occassional parasitized cells were seen in the kidney of 100 mg saabmal / kg group . occasional vascular dilatation and pigment granules were observed in the liver of 100 mg saabmal / kg group but these changes were absent in 200 and 400 mg / kg saabmal - treated groups . effect of prophylactic treatment with saabmal on liver , spleen and kidney of infected mice pharmacotechnical properties of the capsules : the pharmacotechnical properties of the capsules were also evaluated ( data not shown ) ; there was low weight variation and high degree of content uniformity . disintegration test results showed that all capsules disintegrated in less than 15 min , thus complying with pharmacopoeial requirement . in vivo screening for antimalarial activity is usually done with rodent malaria parasites , especially plasmodium berghei which has been used extensively in antimalarial drug discovery and development28 . these models are useful screening tools in the prediction of treatment outcome of human infection . consequently , saabmal was screened for antimalarial activity using three models ; prophylactic , suppressive and curative . saabmal suppressed parasitaemia in a dose - dependent manner and at 400 mg / kg b.w completely suppressed parasitaemia , implying that this natural product could be a potent prophylactic antimalarial agent . the significant anti - plasmodial activity of saabmal in established infection placed this product at an advantageous position in terms of malaria treatment in developing countries . the reduction in parasitaemia and the comparative prolongation of mean survival times were indicative of the curative potential of saabmal . although there has been no previous study on the pharmacological activities of saabmal , many of the medicinal plants that constitute saabmalherbal medicines have the advantage of an impressive and long history of safety and efficacy profile , the major problem however , has been lack of adequate documentation . this study has provided scientific evidence on the efficacy and dosage form assessment of saabmal against experimentally induced malaria infection in mice . it is hoped that randomized , controlled clinical trials will be conducted to evaluate the efficacy , tolerability , and safety of saabmal in the human subject . the physical appearance , weight variation , content uniformity as well as the disintegration times of the sampled capsules were found to be satisfactory as they met official compendia specifications27 . all the capsules evaluated showed low weight variation and high degree of content uniformity indicating that the method of formulation used was acceptable for preparing good quality saabmal capsules . the efficacy of a drug mixture can be dependent on the rate at which the tablet or capsule disintegrates in the patient 's gastrointestinal tract . although rapidly disintegrating tablets or capsules do not necessarily ensure fast bioavailability , but it is still an important parameter as it is a pointer to the probable performance of the preparation following administration . the ability to interact strongly with waterall the capsules disintegrated in less than 15 min irrespective of the ph of the investigating media , implying that ph may not have detrimental effect on the disintegration of saabmal capsules . in conclusion , our results confirmed the efficacy of saabmal as an herbal antimalarial formulation with acceptable capsule qualities . however , there is a need for development of an appropriate analytical technique for monitoring drug release from the formulation . this will assist in developing appropriate stability parameters and bioavailability / bioequivalence studies during clinical trials .\noutput:\n" }, { "from": "agent", "value": "background & objectives : malaria is a serious problem in the countries of the developing world . as the malaria parasite has become resistant to most of the antimalaria drugs available currently , there is a need to search for newer drugs . this study reports the pharmaceutical quality and in vivo antimalarial activities of a polyherbal formulation ( saabmal ) used as malarial remedy in nigeria.methods : the antiplasmodial activity of saabmal was determined by using the 4 - day suppressive test in plasmodium berghei - infected mice . the formulation was tried on three different experimental animal models for in vivo antimalarial activities , which are prophylactic , suppressive and curative in mice . chloroquine and pyrimethamine were used as standard drugs for comparison.results : the suppressive study showed that , saabmal ( 200 and 400 mg / kg / bw ) significantly ( p < 0.01 ) produced a suppression ( 29.39 - 100 % ) of parasitaemia in a dose - dependent manner , while the curative study showed that saabmal at 400 mg significantly ( p < 0.01 ) reduced ( 95.80 % ) parasitaemia compared with controls . the mean survival time of saabmal - treated groups ( 100 and 200 mg / kg ) was higher than that of the chloroquine - treated group . histopathologically , no changes were found in the spleen of both untreated and treated groups . saabmal capsules were of good mechanical properties with low weight variation and high degree of content mass uniformity.interpretation & conclusions : the results obtained in this study showed the efficacy of saabmal , a herbal antimalarial formulation against chloroquine sensitive malaria and its potential use in the treatment of uncomplicated malaria infection . further studies need to be done in humans to test its efficacy and safety for its potential use as an antimalarial drug ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: splenic artery aneurysm ( saa ) , one of the most common visceral aneurysms , accounts for 60 % of all visceral aneurysm cases . open surgery is the traditional treatment for saa but has the disadvantages of serious surgical injuries , a high risk of complications , and a high mortality rate . in recent years , with the rapid development of interventional therapies , increasing reports of interventional therapy for saa with improving efficacy are available . here , we describe successfully treating 1 case of saa with an endovascular stent graft delivered via the splenic artery . our 54 - year - old female patient was admitted to the hospital with a 6 - month history of upper left abdominal pain accompanied by intermittent abdominal distention . a physical examination revealed a soft abdomen with deep tenderness in the upper left abdomen and no rebound tenderness or muscle tension , no abdominal mass , a nonpalpable liver and spleen , no percussion pain in the waist or back , and no shifting dullness . vascular sounds could be heard in the upper left abdominal quadrant and the bowel sounds were normal . an enhanced computed tomography ( ct ) scan of the upper abdomen indicated the presence of saa ( figure 1 ) . routine blood examination , erythrocyte sedimentation rate , and liver and kidney function findings were normal . on the 3rd day of admission , celiac artery and right hepatic artery angiography showed thickening of the middle segment of the main trunk of the splenic artery . preoperative computed tomographic ( ct ) image shows a splenic artery aneurysm ( arrow ) . a cobra catheter ( radiofocus , terumo , tokyo , japan ) was then advanced into the opening of the splenic artery , and angiography showed a locally enlarged middle segment of its main trunk with a largest diameter of approximately 2.8 cm consistent with the presentation of saa ( figure 2a ) . a guidewire was delivered into the distal end of the splenic artery , and an 8f guiding multipurpose catheter was placed over the guidewire . the saa was located under digital subtraction angiography ( dsa ) roadmap guidance , and a 6/60 mm stent graft ( fluency ; bard incorporated , karlsruhe , germany ) was delivered and released to cover the aneurysm . ( a ) digital subtraction angiogram demonstrates a splenic artery aneurysm ( arrow ) . ( b ) following interventional procedure : control angiogram show exclusion of aneurysm by the stent - graft . repeated angiography confirmed good stent graft location and shape ; no obvious aneurysm could be visualized , and the distal portion of the spleen was visible ( figure 2b ) . after removal of the arterial sheath , the puncture site of the right femoral artery was sealed by a vascular closure device ( angio - seal ; st jude medical , st paul , minnesota ) . during the procedure , heparin 2000after the procedure , the patient received a subcutaneous injection of low molecular weight heparin calcium 4000 u twice daily for 3 days , 100 mg oral aspirin once daily , and 75 mg oral clopidogrel hydrogen once daily for prophylaxis . a follow - up enhanced ct scan of the upper abdomen showed good stent graft location and shape and no evident infarctions in the spleen after 1 week ( figure 3a ) . an enhanced ct scan showed that the saa remained well separated , the stent graft shape was normal , and the blood flow was unobstructed after 1 year ( figure 3b ) . ( a ) two weeks postembolization axial ct scan with contrast with 3 - dimensional reconstruction showing postembolization segmental splenic infarction . ( b ) ct images with 3 - dimensional reconstruction at 1 - year follow - up show patency of the spleen artery and no aneurysm is identified . our 54 - year - old female patient was admitted to the hospital with a 6 - month history of upper left abdominal pain accompanied by intermittent abdominal distention . she had a 30 - year history of hypertension and was on regular medication . a physical examination revealed a soft abdomen with deep tenderness in the upper left abdomen and no rebound tenderness or muscle tension , no abdominal mass , a nonpalpable liver and spleen , no percussion pain in the waist or back , and no shifting dullness . vascular sounds could be heard in the upper left abdominal quadrant and the bowel sounds were normal . an enhanced computed tomography ( ct ) scan of the upper abdomen indicated the presence of saa ( figure 1 ) . routine blood examination , erythrocyte sedimentation rate , and liver and kidney function findings were normal . on the 3rd day of admission , celiac artery and right hepatic artery angiography showed thickening of the middle segment of the main trunk of the splenic artery . preoperative computed tomographic ( ct ) image shows a splenic artery aneurysm ( arrow ) . a cobra catheter ( radiofocus , terumo , tokyo , japan ) was then advanced into the opening of the splenic artery , and angiography showed a locally enlarged middle segment of its main trunk with a largest diameter of approximately 2.8 cm consistent with the presentation of saa ( figure 2a ) . a guidewire was delivered into the distal end of the splenic artery , and an 8f guiding multipurpose catheter was placed over the guidewire . the saa was located under digital subtraction angiography ( dsa ) roadmap guidance , and a 6/60 mm stent graft ( fluency ; bard incorporated , karlsruhe , germany ) was delivered and released to cover the aneurysm . ( ( b ) following interventional procedure : control angiogram show exclusion of aneurysm by the stent - graft . repeated angiography confirmed good stent graft location and shape ; no obvious aneurysm could be visualized , and the distal portion of the spleen was visible ( figure 2b ) . after removal of the arterial sheath , the puncture site of the right femoral artery was sealed by a vascular closure device ( angio - seal ; st jude medical , st paul , minnesota ) . during the procedure , heparin 2000after the procedure , the patient received a subcutaneous injection of low molecular weight heparin calcium 4000 u twice daily for 3 days , 100 mg oral aspirin once daily , and 75 mg oral clopidogrel hydrogen once daily for prophylaxis . a follow - up enhanced ct scan of the upper abdomen showed good stent graft location and shape and no evident infarctions in the spleen after 1 week ( figure 3a ) . an enhanced ct scan showed that the saa remained well separated , the stent graft shape was normal , and the blood flow was unobstructed after 1 year ( figure 3b ) . ( a ) two weeks postembolization axial ct scan with contrast with 3 - dimensional reconstruction showing postembolization segmental splenic infarction . ( b ) ct images with 3 - dimensional reconstruction at 1 - year follow - up show patency of the spleen artery and no aneurysm is identified . saa is the most common visceral aneurysm , but its cause is not completely clear . the known causative factors include trauma , hormonal fluctuations during pregnancy , portal hypertension , pancreatitis , arterial degeneration , and atherosclerosis . saa rupture results in life - threatening massive blood loss and should be treated proactively . current common percutaneous endovascular treatment methods include coil embolization of splenic aneurysms , endovascular exclusion of splenic aneurysms with stent - graft placement , and bare - metal stent placement combined with aneurysm embolization . depending on the saa lesion location and shape , 1 or more of the above - described treatment methods can be utilized . transcatheter embolization for saa is relatively simple : coils are delivered into the splenic artery and embolize either the aneurysm directly or the regions of the splenic artery proximal and distal to the aneurysm . the disadvantages include splenic infarction caused by total embolization and aneurysmal relapse caused by partial embolization . the application of covered stent grafts allows for saa exclusion while maintaining the blood flow in the splenic artery and is considered an ideal treatment . however , due to the current stiff stent delivery system and the tortuous nature of the splenic arteries , stent graft placement at the aneurysm site is challenging . therefore , the covered stent graft is more commonly used for treating saa in the proximal region of the splenic artery . in recent years , bare - metal stent combined with partial coil embolization has been used to treat the wide - neck saa . due to the smaller diameter and softer nature of the bare - metal stent , their placement in the splenic artery is relatively easier than that of covered stents . through a microcatheter , coils can be delivered and partially embolize the aneurysm while blood flow in the splenic artery is maintained . the saa in the current patient was located in the middle segment of the main splenic artery with a largest diameter of approximately 2.8 cm , which completely meets the criteria for endovascular covered stent graft exclusion treatment . there is a lack of bony landmarks , and therefore accurate localization is challenging in the covered stent graft exclusion treatment of saa . we suggest stent placement under the dsa roadmap mode or the deployment of a separate guiding catheter to locate the aneurysm by continuously injecting contrast agents . furthermore , for the tortuous splenic artery , the selection of an appropriate super - stiff guidewire during the procedure to provide sufficient support and overcome the difficulties related to stent graft delivery and release is necessary . regular follow - up indicated a satisfactory efficacy proving the minimal invasiveness of stent graft exclusion treatment for saa .\noutput:\n" }, { "from": "agent", "value": "abstractsplenic artery aneurysm , one of the most common visceral aneurysms , accounts for 60 % of all visceral aneurysm cases . open surgery is the traditional treatment for splenic artery aneurysm but has the disadvantages of serious surgical injuries , a high risk of complications , and a high mortality rate.we report a case who was presented with splenic artery aneurysm . a 54 - year - old woman complained of upper left abdominal pain for 6 months . an enhanced computed tomography scan of the upper abdomen indicated the presence of splenic artery aneurysm . the splenic artery aneurysm was located under digital subtraction angiography and a 6/60 mm stent graft was delivered and released to cover the aneurysm . an enhanced computed tomography scan showed that the splenic artery aneurysm remained well separated , the stent graft shape was normal , and the blood flow was unobstructed after 1 year.this case indicates a satisfactory efficacy proving the minimal invasiveness of stent graft exclusion treatment for splenic artery aneurysm ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the trial was registered at tctr ( http://www.clinicaltrials.in.th/ ) with the i d : tctr20160125003 . elderly are considered one of the most vulnerable groups in societies all over the world , and special attention is typically paid to them . in recent years , due to lower mortality rates and improved health and increased life expectancy , the number of elders is more than in any period in history . for every 10 people in the world , a person is over 65 years old . in iran , also by increasing the proportion , the number of elders has increased , and , according to the latest statistics , 7.8 % of the country s population is made up of elder people ; due to population growth , it is predicated that the levels during the next decade will reach to 16 % of the total population ( 1 ) . the prevalence of physical disabilities will increase with increasing the population ageing ; thus this inability results from many causes , among them the loss of mobility is of greatest importance ( 2 ) . osteoarthritis is of the most common joint disease and disability in most countries of the world ( 1 , 2 ) . it has a higher incidence rate before age 50 in men and later in women ( 2 ) . the knee is one of the most common joints , where almost 10 % of the population has had knee pain over 65 years ( 3 ) , and about 25 % of people aged 55 years and older have reported a history of knee pain in the past few years . some studies have shown that the use of nonsteroidal anti - inflammatory drugs ( nsaids ) may increase heart disease and cardiovascular or gastrointestinal disorders ( 4 , 5 ) . in a study , it was suggested that nonsteroidal anti - inflammatory drug commonly are prescribed , which will increase the degradation of joint cartilage in osteoarthritis through the inhibition of the synthesis of cartilage matrix ( 6 ) . thus many researchers are looking for drugs , while effective , that have fewer adverse side effects , among which herbal drugs may be mentioned . from the earliest times , the therapeutic effects of medicinal plants have been considered . it is a common belief in islamic countries that nigella sativa is a general healer to cure diseases but can not prevent aging and death . the plant , with the scientific name of nigella sativa , is a member of the ranunculaceae family : it has white flowers , white or blue with milky grains that become black in contact with air . it is native to southern europe and north africa and asia and had been used to treat illnesses by ancient egyptian and greek doctors and avicenna ( 7 ) . nigella sativa oil is composed of 30 % by weight of p - cymene , which is the most original composition , and 61.48 % of the weight is composed of the volatile oil . nigella sativa seeds contain fat , vitamins , minerals , proteins , essential amino acids , and carbohydrates ( 8 ) . there are also other compounds in seeds , such as phospholipids , carotene , calcium , iron , and potassium ( 9 ) . various evidence suggests that , due to the beneficial use of this plant on kidney function , blood pressure regulation system , the ability to detoxify the liver , the respiratory system s ability to dispose of waste , the production of sweat , and textured milk , available evidence indicates that components of nigella sativa oil and active components , especially tq , have antioxidant and anti - inflammatory , anti - inflammatory , and analgesic properties that are applied through the suppression of inflammatory mediators such as prostaglandins and thymoquinone ( 10 ) . hajhashemi and colleagues noted that nigella sativa oil has 20 different chemical compositions , among those the semen parameters and thymoquinone are two major components , which are both systemic and topical prescriptions of anti - inflammatory and analgesic properties ( 11 ) . a study that roghani and colleagues conducted on rats found that oral prescription of nigella sativa for two months resulted in a significant reduction in pain in the rats ( 12 ) . according to a mobility disability caused by osteoarthritis among the elderly , a lot of side effects of synthetic drugs and multiple medications by the elderly exist with no certain cure for it ; thus the prevalence of musculoskeletal disorders has been reported in older people in sabzevar city , especially in the knee joint ( 13 , 14 ) . this study was to evaluate the topical impact of nigella sativa oil and oral acetaminophen on knee osteoarthritis in the elderly residing in a parents nursing home in sabzevar city of iran . this study was conducted as a clinical trial ( crossover ) from november 21 , 2014 , to january 20 , 2014 . procedure of the study was justified in elderly patients with osteoarthritis of the knee in elderly residing in a parents nursing home in sabzevar city in iran . age over 65 years diagnosis of knee osteoarthritis , according to american college rheumatology diagnostic criteria , included 1 ) knee pain on most days of the last month ; 2 ) crepitus ( joint sound in active motion ) ; 3 ) morning stiffness less than 30 minutes ; and 4 ) inflation in the examination of the knee bone , respectively ( 15 ) . knee osteoarthritis was confirmed by a physician , and the use of radiography , knee pain in the past 24 hours , so that the average linear measure - visual pain ( vas : visual analogue score ) is between 47 cm , and the lack of inflammatory diseases , metabolic disorders ( diabetes ) , cancer or malignant diseases , symptoms or a history of liver or kidney failure , treatment with oral corticosteroids in the past 4 weeks or injection in the last 6 months , no fever , lack of sensitivity and allergy nigella sativa oil , not wanting to continue to participate in the study , supplementation with vitamins and minerals or other nutritional supplements , painkillers were the exit standards of the study . after obtaining written consent for their demographic questionnaire , seniors eligible for the study were randomly divided into two groups . in the first stage , for the first group about 1 ml nigella sativa oil was applied on the knee joint three times a day every 8 hours for 1 week . the massaging method was done with the entire palm in a way that continued for 5 minutes , massaged in a clockwise direction at the front and sides of the knee joint . it should be noted that the nigella sativa oil used was owned by barij - e - kashan ; for all subjects , it was maintained away from sunlight and at ambient temperature . the second group was given 325 mg acetaminophen tablets 3 times a day every 8 hours for 3 weeks . then a 1 - month period without medication to wash out was given to each group , and then each treatment group received the contrary drug in the same way as above . if patients were taking the drug irregularly or because of pain medication or because other treatment methods were used , or for whatever reason , and were not able to continue the treatment and completion of the study , they were excluded from the study . the pain intensity was determined using the visual analogue linear scale ( vas ) before and after the first and second stages of the study . the standard was a 10 - inch ruler on which the patient were asked to rate his or her pain intensity from 0 to 10 . before taking the medicationmild pain distances of 0 to 3 , 4 to 7 moderate pain , and severe pain showed 810 ( 16 ) . response to treatment was measured for reduction of more than 5.1 cm on the vas scale in the pain . in the sample size required by the consultant statistics with 95 % confidence level and 5 % error and 90 % power , the study protocol was approved by the ethics committee of the national research center , cairo , egypt . all patients were informed thoroughly about the study , and each patient was asked to sign a consent form . only motivated and cooperative patients , who accepted the periodic recall visits and agreed to sign the consent form , this study was conducted as a clinical trial ( crossover ) from november 21 , 2014 , to january 20 , 2014 . procedure of the study was justified in elderly patients with osteoarthritis of the knee in elderly residing in a parents nursing home in sabzevar city in iran . age over 65 years diagnosis of knee osteoarthritis , according to american college rheumatology diagnostic criteria , included 1 ) knee pain on most days of the last month ; 2 ) crepitus ( joint sound in active motion ) ; 3 ) morning stiffness less than 30 minutes ; and 4 ) inflation in the examination of the knee bone , respectively ( 15 ) . knee osteoarthritis was confirmed by a physician , and the use of radiography , knee pain in the past 24 hours , so that the average linear measure - visual pain ( vas : visual analogue score ) is between 47 cm , and the lack of inflammatory diseases , metabolic disorders ( diabetes ) , cancer or malignant diseases , symptoms or a history of liver or kidney failure , treatment with oral corticosteroids in the past 4 weeks or injection in the last 6 months , no fever , lack of sensitivity and allergy nigella sativa oil , not wanting to continue to participate in the study , supplementation with vitamins and minerals or other nutritional supplements , painkillers were the exit standards of the study . after obtaining written consent for their demographic questionnaire , seniors eligible for the study were randomly divided into two groups . in the first stage , for the first groupabout 1 ml nigella sativa oil was applied on the knee joint three times a day every 8 hours for 1 week . the massaging method was done with the entire palm in a way that continued for 5 minutes , massaged in a clockwise direction at the front and sides of the knee joint . it should be noted that the nigella sativa oil used was owned by barij - e - kashan ; for all subjects , it was maintained away from sunlight and at ambient temperature . the second group was given 325 mg acetaminophen tablets 3 times a day every 8 hours for 3 weeks . then a 1 - month period without medication to wash out was given to each group , and then each treatment group received the contrary drug in the same way as above . if patients were taking the drug irregularly or because of pain medication or because other treatment methods were used , or for whatever reason , and were not able to continue the treatment and completion of the study , they were excluded from the study . the pain intensity was determined using the visual analogue linear scale ( vas ) before and after the first and second stages of the study . the standard was a 10 - inch ruler on which the patient were asked to rate his or her pain intensity from 0 to 10 . before taking the medicationmild pain distances of 0 to 3 , 4 to 7 moderate pain , and severe pain showed 810 ( 16 ) . response to treatment was measured for reduction of more than 5.1 cm on the vas scale in the pain . in the sample size required by the consultant statistics with 95 % confidence level and 5 % error and 90 % power , 37 patients were assessed as probable loss by 10 % to 42 % . the study protocol was approved by the ethics committee of the national research center , cairo , egypt . all patients were informed thoroughly about the study , and each patient was asked to sign a consent form . only motivated and cooperative patients , who accepted the periodic recall visits and agreed to sign the consent form , were enrolled . forty - two patients participated in this study ( two patients were excluded due to noncooperation ) . eighteen ( 45 % ) were male and 22 ( 55 % ) were female , with a mean age of 75.668.9 years and average weight of 69.6714.33 kg . their activity was less than 1 hour a day for being exposed to sunlight 1 to 2 hours per day . r software mixed model showed that mean of pain intensity was 4.230.31 and 4.760.31 in the nigella sativa oil and oral acetaminophen groups , respectively . also , topical use of nigella sativa oil and oral acetaminophen reduced knee pain in elder patients ( p = 0.0001 ) . the r software mixed model showed that pain intensity relief was 0.53 higher in nigella sativa oil compared with oral acetaminophen ( p = 0.01 ) . nigella sativa ( n. sativa ) has a distinct reputation in eastern medicine , and it is a commonly used ingredient in many recipes in south asia and elsewhere ( 17 ) . in this study , the topical use of 1 cc nigella sativa oil 3 times a day for 3 weeks reduced knee pain compared with oral acetaminophen in elderly patients with knee osteoarthritis with moderate pain . more researches have recognized analgesic , antispasm , and anti - inflammatory effects in in vivo and in vitro studies ( 18 , 19 ) . our results were consistent with the results of gheita s study , which was performed on 40 women , who received nigella sativa oil capsules 500 mg twice daily compared with a placebo , he and his colleagues reported that pain was reduced significantly due to improvement of patients ( 20 ) . also tekeoqlu andil - 1 , which showed that tq ( nigella sativa ) demonstrated that the substance can significantly suppress arthritis in mice ( 21 ) . bashir and colleagues ( 2010 ) showed that the ethanol extract of nigella sativa has a significant analgesic effect in albino rats , but the effect on the reduction of sodium diclofenac was less than that , which was not consistent with our research results because , in our study , the effect of nigella sativa oil was more significant than acetaminophen for pain relief ( 22 ) . yet , no study has examined the topical use of nigella sativa oil on pain ; however , emami razavi and colleagues conducted a study on 154 patients with knee pain . they treated patients in three groups as involved groups with frankincense oil - sesame oil in the control group , and diclofenac gel for the positive control group for six weeks . their study confirmed the potential effects of topical administration of frankincense oil in the symptomatic treatment of knee pain ( 23 ) . tested the impact of thymoquinone ( 1 mg / kg , injected in the tail vein ) in rats . they reported that thymoquinone may have a role in treatment of multiple sclerosis ( 24 ) . the anti - inflammatory effect of the n. sativa was observed , and studies have shown that black cumin reduced the pain . suggest that nigella sativa has analgesic and anti - inflammatory effects due to its polyphenols ( 25 ) . naggar and colleagues also stated that nigella sativa extract has analgesic effect on the cns ( 24 ) . several studies also showed that nigella sativa inhibits inflammation with reducing the nitric oxide production and inhibiting cytokines interleukin - 1 and 6 and the transcription factor k inflammation . also , some studies have stated that nigella sativa reduced the synthesis of mcp - 1 , tnf - , and il - 1 and inhibited the histone deacetylases cox - 2 as well as demonstrated its anti - inflammatory properties with the induction of histone hyper acetylation . nigella sativa oil has demonstrated a mild effect on the expression of cox - 1 and pge - 2 in animal models of respiratory allergies ( 2628 ) . this study showed that topical use of nigella sativa oil can be more effective in reducing knee pain in elderly patients than acetaminophen , which is typically used as a safe supplement for the elderly . it is also recommended that the consumption of nigella sativa oil be continued for a longer period of time .\noutput:\n" }, { "from": "agent", "value": "backgroundlimited evidence supports nigella sativa s role as an effective complementary and alternative medicine and the anti - inflammatory effects of nigella sativa on patients with allergic rhinitis.objectivethe aim of this study was to investigate the effect of topical application of nigella sativa oil and oral acetaminophen on pain in the elderly with knee osteoarthritis residing in a parents home in sabzevar.methodsthis study is done as a crossover clinical trial . after obtaining written consent of elderly patients with osteoarthritis of the knee , they were randomly divided into two groups . in step 1 , in group 1 , 1 cc of nigella sativa oil was applied on the knee joint every 8 hours for 3 weeks ; for the second group , every 8 hours for 3 weeks , patients were given 1 tablet of 325 mg acetaminophen . after a period of 1 month without medication to wash out each group , in step 2 , each treatment group received the drug interaction in the same way as above . pain was determined using a visual scale ( vas ) before and after the first and second stages . treatment response was defined as a decrease in pain scores over 1.5 . data analysis was performed with an r software mixed model.resultsthis study was done on 40 elderly patients : 18 ( 45 % ) men and 22 ( 55 % ) women . their mean year and weight were 75.668.9 years and 69.6714.33 kg , respectively . study results showed that topical application of nigella sativa oil and oral acetaminophen reduced pain in elderly with knee osteoarthritis ; after using nigella sativa oil , the reduction of pain was higher ( p = 0.01 ) . conclusionthe results of this study showed that topical application of nigella sativa oil was effective in reducing pain in patients with knee osteoarthritis ; therefore , it is recommended as a safe supplement for these elderly.trial registrationthe trial was registered at tctr ( http://www.clinicaltrials.in.th/ ) with the i d : tctr20160125003.fundingthis study was approved and supported by the sabzevar university of medical sciences ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: despite many advances in anesthetic techniques , severe aortic stenosis ( as ) continues to be associated with high mortality and morbidity . the scenario is further complicated when it coexists with another equally life - threatening illness . we are reporting the management of an unusual case of severe as in new york heart association functional class iii , who presented with subarachnoid hemorrhage ( sah ) . a 50 - year - old female patient , a known case of severe as , presented to us with complaints of acute onset severe headache with nausea and vomiting for 2 days . she had history of marked limitation of physical activities and shortness of breath even on mild routine activity . computed tomography ( ct ) scan [ figure 1 ] and ct angiography [ figure 2 ] of head showed sah ( fisher grade 2 ) with lobulated , saccular anterior communicating artery aneurysm . electrocardiogram suggested left ventricular ( lv ) hypertrophy . transthoracic echocardiography revealed stenotic , calcified , bicuspid aortic valve with area of 0.7 cm , increased pressure gradient ( pg ) across aortic valve [ figure 3 ] ( mean pg 45 mmhg and peak pg 74 mmhg ) , concentric lv hypertrophy and good lv systolic function . complete blood count , liver function , renal function , and coagulation profile tests were normal except hypokalemia ( 2.9 patient was classified as american society of anesthesiologists iiie and accepted for anesthesia and procedure with high - risk informed consent from the patient and relatives . noncontrast ct head showing subarachnoid hemorrhage ( fisher grade 2 ) cerebral ct angiography showing anterior communicating artery aneurysm transthoracic echocardiography with pulse wave doppler showing high pressure gradient across aortic valve after all the preparations , patient was shifted to cerebral digital subtraction angiography ( dsa ) lab . an intravenous line with normal saline was secured through 14 g cannula under local anesthesia ( la ) . a total of 1.2 g of amoxicillin clavulanate was given intravenously for prophylaxis against infective endocarditis ( ie ) . central venous pressure ( cvp ) line was placed with ultrasonography guidance in right internal jugular vein under la . anesthesia was induced with intravenous etomidate ( 10 mg ) and fentanyl ( 50 + 25 mcg ) , followed by vecuronium ( 6 mg ) and lignocaine hydrochloride 2 % ( 4 ml ) . gentle direct laryngoscopy and endotracheal intubation was done with endotracheal tube of internal diameter 7.5 mm . baseline activated clotting time ( act ) was 159 s. total of 6000 units of heparin was used for a target act of 250 - 300 s. potassium chloride was supplemented at 20 meq / h through central venous line . intravenous esmolol infusion was started after bolus injection of 25 mg and titrated for heart rate and mean arterial blood pressure . dsa and anterior communicating artery aneurysm coiling lasted for 3 h. esmolol infusion was titrated from 150 - 300 mg / h for heart rate from 68 to 77 / min and mean arterial pressure from 74 to 80 mmhg . a total of 1 g of intravenous paracetamol was administered toward the completion of procedure . heparin was neutralized with 60 mg of protamine . at the end of the procedure , neuromuscular blockade was reversed with neostigmine and glycopyrrolate and trachea was smoothly extubated . for the next 4 days , she was discharged from the hospital on 12 day of admission with advice for early aortic valve replacement ( avr ) . sah continues to be associated with high mortality and survivors are often left with severe disabilities . as is the most common valvular heart disease , and its incidence increases with age . in a patient with normallv systolic function , severity of as can be classified according to mean aortic valve pg , av area , aortic jet velocity [ tables 1 and 2 ] . severity of aortic stenosis severity of as ( ehj 2010 ) adverse perioperative risk in patients with as depends on the interaction of factors such as the severity of valve disease , concomitant coronary artery disease ( cad ) , and the severity and / or urgency of the surgical procedures . a thorough understanding of as and its course are necessary for the anesthesiologist , for a good perioperative outcome . although prior avr is recommended for patients with severe as , who are awaiting urgent high - risk surgical procedure , this was not possible for our patient with ruptured intracranial aneurysm . chronic obstruction to lv ejection due to as , results in concentric lv hypertrophy rendering the heart susceptible to myocardial ischemia , even without cad . so , large drop in systemic vascular resistance ( svr ) should be avoided in these patients . the goal of perioperative hemodynamic management should be to maintain sinus rhythm , myocardial contractility , preload , and svr . tachycardia , hypertension , and hypotension increase the risk of myocardial ischemia , so should be rapidly corrected . for hemodynamic monitoring , pulmonary artery catheter can be inserted in this situation , but it has its own complications . transesophageal echocardiography is one of the options but is very difficult to use in cerebral dsa lab due to poor patient access . patients with stenotic valvular lesion are considered at high risk for development of ie , so antibiotic prophylaxis was administered with amoxicillin clavulanate . lignocaine hydrochloride was administered intravenously 1 min before laryngoscopy , in order to avoid an increase in systemic and pulmonary artery pressures . propofol is twice as likely as etomidate to evoke hypotension in patients with severe as . adequate levels of analgesia and anesthesia were maintained , throughout the procedure in order to avoid tachycardia and hypertension . esmolol is a short acting - adrenoceptor antagonist with half - life of only 9 min and has no sympathomimetic activity . thus esmolol was administered by intravenous infusion during the whole procedure and titrated for hr and map . hypokalemia has been frequently described in association with sah and female gender is a risk factor for hypokalemia after sah . in conclusion , patients with severe as require careful preoperative , multidisciplinary assessment , and anesthetic planning , before and during neurointervention to optimize cardiac function and outcome in sah .\noutput:\n" }, { "from": "agent", "value": "despite advances in various modalities of management , subarachnoid hemorrhage ( sah ) continues to be associated with high mortality , which is further increased by associated comorbidities . aortic stenosis ( as ) is one such disease which can further complicate the course of sah . we recently managed a known patient of severe as , who presented with aneurysmal sah . patient was planned for eurovascular intervention . with proper assessment and planning , patient was managed with favorable outcome despite the restrictions faced in the neurovascular intervention laboratory ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: toll - like receptor 4 ( tlr4 ) is a mammalian transmembrane receptor protein which , in complex with a myeloid differentiation factor 2 ( md - 2 ) , detects picomolar concentrations of gram - negative bacterial endotoxin ( or lipopolysaccharide , lps ) ( figure 1a ) and initiates an inflammatory signaling cascade aimed at the eradication of bacterial infection . activation of the innate immune response through tlr4md -2-lps complex was shown to contribute to the pathogenesis of numerous inflammatory , autoimmune , and chronic diseases , such as sepsis syndrome , asthma , arthritis , and cancer , which highlights the significance of tlr4 - md - 2 complex as a therapeutic target . therapeutic modulation of the innate immune response by intervention with tlr4md - 2 signaling has grown to a hot topic in the past decade . moreover , activation of tlr4 has been proposed to bridge the innate and adaptive immunity , emphasizing stimulation of the tlr4md - 2 complex by nontoxic ligands as a straightforward way to efficient vaccine adjuvants . lipid a , an amphiphilic membrane - bound portion of lps , represents the major pathogen - associated molecular pattern which drives the activation of tlr4 by binding to the co - receptor protein md - 2 and triggering the dimerization of two tlr4md - 2lps complexes . generally , the binding of hexaacylated bisphosphorylated lipid a ( such as from escherichia coli , figure 1b ) by human tlr4md - 2 complex results in the efficient activation of the innate immune response , whereas underacylated lipid a variants are either inactive or antagonistic ( such as tetraacylated lipid iva , or the synthetic drug candidate eritoran ) . the co - crystal structures of the e. colire - and ra - lps with mouse ( m ) or human ( h ) md - 2tlr4 complex , respectively , unravel that only five long - chain acyl residues of the hexaacylated lipid a are incorporated into the hydrophobic binding pocket of md - 2 whereas the sixth 2 - n - acyl chain is exposed on the surface of md - 2 and is involved in the dimerization interface with the second tlr4 * md - 2 * - lps complex ( figure 1c ) . the phe126 residue of md - 2 is proposed to stabilize the presentation of an acyl tail on the surface of the protein and to serve as hydrophobic switch allowing dimerization to occur . lps - driven homodimerization of tlr4md -2-lps complexes initiates recruitment of adaptor proteins to the intracellular tir ( toll / interleukin - 1 receptor ) domains of tlr4 which ultimately results in the induction of the intracellular inflammatory signaling cascade . in contrast , submerging of all lipid chains of the ligand into the hydrophobic binding groove of md - 2 results in an efficient binding without initiation of signaling , which is a characteristic feature of tlr4md - 2 antagonists . ( a ) structure of lps , with re - lps and lipid a. ( b ) structures of tlr4 agonist e. coli lipid a and mpla . ( c ) co - crystal structure of e. colira - lps - hmd - 2tlr4 ( pdb code : 3fxi ; only lipid a portion of lps is shown for clarity ) , top and side views . phe126 ( orange ) together with 2 - n - acyl chain ( yellow ) creates a hydrophobic patch at the dimerization interface with the second tlr4 * md - 2 * complex ( brown ) . positively charged arg and lys ( blue ) at the rim of the binding pocket of md - 2 are involved in the ionic interactions with the lipid a phosphates . the presence of both 1 - and 4 - phosphate groups of lipid a was shown to be crucial for the efficiency of the dimerization and the potency of the initiated signaling . the absence of 1 - phosphate leads to less efficient dimerization and dampened cytokine production while maintaining sufficient tlr4 - mediated immune activation and full adjuvant activity , which guided the development of monophosphoryl lipid a ( mpla ) , a licensed vaccine adjuvant ( figure 1b ) . despite tremendous intensive research on the interaction of tlr4md - 2 complex with isolated , genetically engineered , and synthetic lipid a s and analogues , the structure activity relationships of the lps - triggered tlr4 activation are not unambiguously established . minor variations in the length and distribution pattern of fatty acyl chains in lipid a typically result in dramatic amendment of tlr4 - mediated immune signaling which can not be rationally predicted . we have addressed the challenges associated with the exploration of structural basis of lps - induced tlr4 activation by development of a novel type of lipid a mimetics wherein the flexible glcn ( 16 ) glcn backbone of lipid a is replaced by the conformationally restricted ( 11 ) - connected disaccharide scaffolds . notably , all lipid a analogues synthesized so far were based either on the native ( 16 ) - diglucosamine or on the more flexible backbones wherein one or both glcn residues were replaced by a linear aglycon . previously we reported on the synthesis and potent anti - endotoxic activity of tetraacylated lipid a mimetics derived from the , ( 11 ) - linked diglucosamine representing an antagonisticallytaking advantage of a striking similarity between the conformation of the nonreducing sugar trehalose [ glc ( 11 ) glc ] and the molecular shape of the ( 16 ) diglucosamine backbone of tlr4md -2-bound agonist e. coli lipid a disclosed in the x - ray structure , we have developed novel agonistic conformationally confined lipid a mimetics based on the two - bond - linked rigid trehalose - type glcn ( 11 ) man scaffold ( figure 2 ) . structure of lipid a mimetics ( , - gm - lams ) 13 based on the conformationally confined glcn ( 11 ) man scaffold . the ( 16 ) diglucosamine backbone represents the most conserved part of lipid a , whereas its acylation and phosphorylation pattern varies within bacterial species . the overall three - dimensional conformation of the intrinsically flexible three - bond - linked glcn ( 16 ) glcn backbone of lipid a is determined by the values of the dihedral angles , , and about ( 16 ) glycosidic and oxymethyl linkages ( figure 3a ) . thus , the relative orientation of glcn rings can be easily adapted by rotation about glycosidic and oxymethyl linkages via altering the corresponding torsion angles . this permits spontaneous adjustment of the shape of lipid a to the geometry of the binding pocket of md - 2 , which complicates the estimation of the activeas seen in the co - crystal structures , the proximal ( reducing ) glcn ring of md -2-bound hexaacylated lipid a adopts an inclined ( or twisted ) orientation which , as we assume , is essential for the exposure of the long - chain 2 - n - acyl residue on the surface of md - 2 followed by dimerization with the second md - 2tlr4 complex ( figure 3a , b ) . x - ray structure - based design of , - gm - lams . ( a ) adjustment of the torsion angles about the ( 16 ) glycosidic linkage in the diglucosamine backbone of lipid a upon binding by md - 2 results in a twisted orientation of the proximal glcn ring for an agonist and in a coplanar orientation of the two glcn rings for antagonist . ( b ) the proximal glcn moiety of md -2-bound e. coli lipid a ( pdb code 3fxi ) adopts inclined orientation which allows the exposure of the 2 - n - acyl chain . ( c ) the molecular shape of , - trehalose ( crystal structure ) resembles the three - dimensional arrangement of glcn ( 16 ) glcn backbone of the md -2-bound e. coli lipid a. ( d ) structure of glcn ( 11 ) man - based lipid a mimetic ( , - gm - lam ) 1 and proposed interaction of 1 with md - 2 . to explore the structural prerequisites needed for an effective receptor complex homodimerization , we have manipulated the flexibility of the carbohydrate backbone of lipid a by fixing its molecular shape in ansince the relative spatial arrangement of the two glcn rings of md -2-bound agonist e. coli lipid a disclosed in the co - crystal structures resembles the arrangement of , - ( 11 ) - connected glucoses in the nonreducing disaccharide trehalose ( figure 3b , c ) , we have developed predictably agonistic lipid a mimetics based on the conformationally confined , - trehalose - like glcn ( 11 ) man scaffold ( figure 3d ) . the values for the torsion angles and , representing rings orientation about the , - ( 11 ) glycosidic linkage ( figure 3d ) , are governed mostly by the anomeric and exo - anomeric effects and are only marginally dependent on the nature of functional groups in variably substituted , - trehaloses . the existence of a single conformational minimum with respect to the dihedrals about glycosidic linkage in , - trehaloses was confirmed by molecular dynamics simulations , whereas the preferred gauchegauche conformation of the substituted , - trehalose and its glc ( 11 ) man analogue was corroborated by x - ray and conformational analysis , respectively . thus , conformationally restrained , - ( 11 ) glycosidic linkage in glcn ( 11 ) man - based lipid a mimetics would impose a specific relative orientation of sugar rings resembling the molecular shape of the diglucosamine backbone of the agonistic md -2-bound lipid a. glcn ( 11 ) man - based lipid a mimetics ( , - gm - lams ) 13 were designed such that the acylation and phosphorylation pattern of the nonreducing ( distal ) glcn residue of e. coli lipid a remains unaffected , whereas the ( 16 ) glycosidic linkage is substituted by an , ( 11 ) glycosidic bond and the reducing ( proximal ) glcn moiety of natural lipid a is exchanged for a nonreducing sugar ( mannose ) having a specific acylation and phosphorylation pattern ( figure 3d ) . the location of the phosphate functionality at c - 6 of the man residue was selected to closely resemble the positioning of a 1 - phosphate group of e. coli lipid a at the secondary dimerization interface of the tlr4 - md -2-lipid a complex ( pdb code 3fxi ) . the site of acylation at the mannose moiety was chosen such that the attachment of the long - chain ( r ) -3-acyloxyacyl residue at man c - 4 would provide a sufficient hydrophobic patch to support the homodimerization and the interaction with the second tlr4 * md - 2 * - ligand complex . upon interaction with the receptor complex , the tetraacylated glcn unit of , - gm - lams 13 was supposed to be fully accommodated within the hydrophobic pocket of md - 2 , whereas the twisted mannose ring should be excluded from the binding site on md - 2 such that the two lipid chains at man c - 4 are presented onto the surface of the protein and involved in the secondary dimerization interface ( figure 3d ) . the axial configuration at c - 2 of mannose should provide , according to the crystal structures , a better fitting to the geometry of the binding pocket of md - 2 and , simultaneously , ensure easier stereocontrol in the 1,2 - trans glycosylation step to , ( 11 ) - linked disaccharide . the assembly of glcn ( 11 ) man , a 1,1 - glycosidically connected ( nonreducing ) disaccharide , represents a formidable synthetic challenge with regard to simultaneous stereocontrol at two anomeric centers . typically , approaches involving conventional glycosylation procedures for the synthesis of trehalose provide moderate stereoselectivity and low yields . since we aimed to establish the , - ( 11 ) glycosidic linkage between an amino sugar and a manno - configured monosaccharide , we could hardly rely on the intramolecular aglycon delivery approach or on the versatile synthetic desymmetrization of the natural trehalose . for the synthesis of bis - andmonophosphorylated lipid a mimetics 13 ( figure 2 ) having non - symmetrically distributed acyloxyacyl functional groups , a convergent approach involving first the preparation of the orthogonally protected glcn ( 11 ) man disaccharide scaffold followed by regioselective phosphorylation and acylation with ( r ) -3-acyloxyacyl fatty acids of variable chain lengths was envisaged ( scheme 1 ) . for the assembly of the glcn ( 11 ) man backbone , a 2 - n - carbamate - protected glucosamine - based lactol was chosen as acceptor , and a 2 - o - levulinoyl ( lev , 4 - oxopentanoyl ) - protected mannose was selected to serve as glycosyl donor . the participating protecting group at c - 2 ( lev ) should allow for a preferable 1,2 - trans mannosylation . since the 2 - o - lev protection had to be exchanged for a 2 - o - me group later in the synthesis , an alternative glycosylation approach using non - participating methyl protection at c - 2 of the mannose - based donor was planned to be explored as well . the 2 - n - carbamates of variably protected glcn - based lactols revealed the highest / ratio ( up to 9:1 ) of the anomeric 1 - oh group , which highlighted these intermediates as the most stereoselective glycosyl acceptors . is responsible for the substantial enrichment with the - anomer . to minimize the number of required orthogonal protecting groups , we intended the use of a glcn acceptor with the pre - installed phosphate group at c - 4 , whereas c - 6 was permanently and c - 3 was temporarily protected . to this end , the 2 - n - troc - protected 4,6 - di - o - benzylidene acetal 4 ( 41 ) was first acetylated to provide 3 - o - acetate 5 , which was subjected to regioselective reductive opening of benzylidene acetal with et3sih / tfoh in ch2cl2 to furnish 6 - o - benzylated compound 6 ( scheme 2 ) . phosphitylation of 4 - oh with bisbenzyl ( diisopropylamino ) phosphoramidite with 1h - tetrazole as catalyst followed by in situ oxidation with meta - chloroperbenzoic acid ( mcpba ) afforded phosphotriester 7 . compoud 7 was either desilylated at c - 1 by treatment with pyridinium hydrofluoride ( hfpy ) in thf to provide a 2 - n - troc - protected axially configured lactol 8 ( / = 9:1 ) or processed to the 2 - n - ( 9 - fluorenylmethyl ) carbamate ( fmoc ) - protected counterpart 9 , which was similarly deprotected at c - 1 to furnish anomeric lactol 10 , again with a high preponderance of the - anomer ( / = 9:1 ) . reagents and conditions : ( a ) ac2o , dmap , pyridine , 97 % ; ( b ) et3sih , tfoh , 4 ms , 78 c , ch2cl2 , 68 % ; ( c ) 1 . mcpba , 78 c , 90 % ; ( d ) hfpy , thf , 91 % for 8 , 94 % for 10 ; ( e ) 1 . the synthesis of the required mannose - based donors commenced with zempln deacetylation of the peracetylated thioethyl glycoside 11 , followed by introduction of a 4,6 - di - o - tert - butylsilylene ( dtbs ) group in 12 ( scheme 3 ) . regioselective benzylation at c - 3 via stannylene acetal intermediate and the agency of benzyl bromide in the presence of ( nbu ) 4ni furnished alcohol 13 in 93 % yield . the 2 - oh group was either levulinoyl - protected by reaction with 4 - oxopentanoic acid , n , n - diisopropylcarbodiimide ( dic ) , and a catalytic amount of 4 - n , n - ( dimethylamino ) pyridine ( dmap ) to give 2 - o - levulinate ester 14 ( 90 % ) or methylated by reaction with mei / nah in dmf to provide 2 - o - methyl ether 15 in 84 % yield . anomeric deprotection with n - bromosuccinimide ( nbs ) in aqueous acetone afforded lactols 16 and 17 , respectively , which were converted to trichloroacetimidates ( tca ) 18 and 20 or to n - phenyl - trifluoroacetimidate ( nptfa ) donors19 and 21 . ( tbu ) 2si ( otf ) 2 , pyridine , dmf , 35 c , 89 % ; ( b ) 1 . bnbr , ( nbu ) 4ni , dmf , toluene , reflux , 93 % ; ( c ) 14 : levoh , dic , dmap , ch2cl2 , 90 % ; ( d ) 15 : mei , nah , dmf , 84 % ; ( e ) nbs , acetone h2o , 24:1 , 0 c , 77 % for 16 and 89 % for 17 ; ( f ) 18 and 20 : ccl3cn , dbu , ch2cl2 , 0 c , 90 % for 18 and 94 % for 20 ; ( g ) 19 and 21 : cf3 ( nph ) ccl , k2co3 , acetone , 99 % for 19 and 93 % for 21 . the key point in our initial approach was to obtain a good double - stereoselectivity in the glycosylation reaction between reducing acceptor 8 ( / = 9:1 ) and the 2 - o - levulinoyl - protected imidate donors 18 or 19 . the participating levulinoyl group at c - 2 of the manno - configured donors 18 and 19 should allow for a selective 1,2 - trans glycosylation . a survey of the literature revealed that a complete - manno selectivity upon application of 2 - o - lev - protected mannosyl donors could be obtained with a variety of acceptors . in an initial glycosylation attempt comprising coupling the tca donor 18 and acceptor 8 using trimethylsilyl trifluoromethanesulfonate ( tmsotf ) as promoter , an orthoester 23 was obtained as the major product ( 23 % ) along with a minor proportion of the target , - disaccharide 22 ( 8 % ) and a concurrently formed donor self - coupling product 24 ( scheme 4a , supplementary si - table 1 ) . with the less reactive nptfa donor 19 or with the thioethyl donor 14the formation of the orthoester was not observed ; however , the desired product 22 was isolated only in trace amounts . ac2o , dmap , pyridine , 85 % ; ( b ) nbs , acetoneh2o , 24:1 , 0 c , 89 % ; ( c ) ccl3cn , dbu , ch2cl2 , 67 % ; ( d ) tmsotf ( 0.05 equiv ) , 4 ms , ch2cl2 , 0 c ; ( e ) ( cf3co ) 2o , cf3cooh , et3sih , ch2cl2 , 0 c , 91 % ; ( f ) 1 . we have hypothesized that the diminished reactivity of the torsionally disarmed 4,6 - di - o - cyclic - protected mannose donor was responsible for the glycosylation failure . accordingly , the 4,6 - di - o - dtbs group in 14 was cleaved and substituted for two acetates to provide 25 , wherein the c5c6 bond was unlocked from the disarming trans gauche conformation . to provide consistency with the previously performed imidate - mediated glycosylations , the thioglycoside at c - 1 was exchanged for a tca group to furnish 27 ( scheme 4b ) . the coupling of 8 and the torsionally unlocked 4,6 - di - o - acetyl donor 27 resulted in the isolation of the , - configured disaccharide 28 , albeit in a similarly low yield ( 8 % ) . thereafter , our attention was turned to the apparently low reactivity of the lactol acceptor 8 affected by the h - bonding between the -1-oh and the carbamate nh groups . to increase the nucleophilicity of the lactol acceptor and to reduce steric constraints , the disarming acetate at c - 3 was exchanged for a tbdms group , and the sterically demanding 2 - n - troc group was replaced by fmoc protection , which provided - lactol acceptor 33 . to this end , compound 30 , made by a highly selective reductive opening of benzylidene acetal in the allyl glycoside 29 , was phosphorylated at c - 4 to give 31 ( scheme 4c ) . reductive cleavage of 2 - n - troc protection with zn in acetic acid followed by reaction with fmoc chloride in the presence ofa etn ( ipr ) 2 furnished 32 , which was anomerically deprotected using [ ir ( cod ) ( ph2mep ) 2 ] pf6 - catalyzed isomerization of the allyl group followed by oxidative cleavage of the 1 - propenyl group with i2 in thfreaction of the 2 - o - levulinoyl tca donor 18 with 33 , however , reproducibly resulted in the formation of the orthoester 34 as the major product ( scheme 4c ) . in retrospect , we assume that the failure of the 2 - o - levulinoyl - protected mannose - based donors to provide the desired glcn ( 11 ) man compound in a glycosylation reaction with glcn - based lactol acceptors was rather related to a particular conformation of the arising trehalose - type , - disaccharide . a successful glycosylation would lead to a sterically hindered coupling product 22 , having overlapping bulky 2 - n - troc / fmoc groups at the glcn moiety and a linear 4 - oxopentanoate ( levulinate ) ester group at c - 2 of mannose , while reciprocal repulsion of the n - carbamate and electron - rich levulinoyl groups could contribute as well . given the failure of 2 - o - levulinoyl - protected mannosyl donors to provide the desired coupling products , the participating protecting group at c - 2 of mannose was exchanged for the 2 - o - me group as in the donors 20 and 21 ( scheme 3 ) . successful application of non - participating groups in the - selective mannosylation has been extensively reported . gratifyingly , the coupling of the 2 - o - me - man imidate donor 21 with the glcn - lactol acceptor 8 allowed for a much higher isolated yield ( 51 % ) of the , - disaccharide 35 ( scheme 5 , table 1 , entry 2 ) . owing to the low reactivity of acceptor 8 , the nptfa donor 21 was found to be superior to the tca donor 20 due to the propensity of the latter to form substantial amounts of the rearranged glycosylamide 45 ( 52 % ) , which is characteristic for glycosylations involving acceptors of diminished reactivity ( table 1 , entries 1 and 2 ) . the isolation of the , - disaccharide 35 was complicated by the concomitant formation of the co - migrating glcnman 38 and glcnman 41 byproducts . glycosylation of the 2 - n - fmoc - protected acceptor 10 by the nptfa donor 21 afforded a similar isolated yield ( 52 % ) of the target , - configured disaccharide 36 ( scheme 5 , table 1 , entry 3 ) . enhancement of the acceptor reactivity by the use of 3 - o - tbdms - protected armedlactol 33 did not improve the yields in the coupling reactions with either donor 20 or 21 ( table 1 , entries 4 and 5 ) , furnishing glcn ( 11 ) man disaccharide 37 in 25 % and 50 % yield , respectively . the yield of the glcn ( 11 ) man disaccharide was related to the ease of its chromatographic purification , which , in turn , was strongly dependent on the protection group pattern . since isolation of the 2 - n - fmoc -3-o - ac - protected 36 from the mixture of anomeric products was the most straightforward , this disaccharide was chosen for further transformation to the target , - gm - lams 13 . the configurations at the anomeric centers of the ( 11 ) - linked disaccharides were assigned on the basis of h and c nmr shifts at the anomeric positions and the jc1 , h1 coupling constants ( si - table 2 ) . to circumvent the severe peak broadening in the h nmr spectrum , the fmoc group in 42 was replaced by a 2 - n - acetate to give acetamide 44 appropriate for the unambiguous signal assignment . the , - linkage in 3537 was confirmed by the large jc1 , h1 coupling constant values of the anomeric carbons ( jc1 , h1 = 170174 hz for - manno - and jc1 , h1 = 173178 hz for - gluco - anomers ) and by the downfield shifts and the corresponding vicinal proton coupling constants jh1 , h2 of the anomeric h - 1 signals ( 5.025.12 , j1 ,2 = 1.5 hz for - manno - and 5.085.23 , j1 ,23.7 hz for - gluco - anomers ) . the - manno linkage in 3840 was corroborated by the typically smaller jc , h coupling constants for the anomeric carbons ( jc1 , h1 = 155157 hz ) and by the upfield shifts of the anomeric h - 1 signals ( 4.6 ppm ) and h - 5 signals ( 3.28 ppm ) , characteristic for - mannosides . having orthogonally protected glcn ( 11 ) man disaccharide scaffold 36 in hand , we next approached the stepwise deprotection and acylation at c - 2 and c - 3 of the glcn fragment . the feasibility of regioselective deacetylation at c - 3 in the presence of the adjacent 2 - n - fmoc carbamate and the base - labile phosphotriester group at c - 4 in 36 was first examined ( si - scheme 1 ) . among a variety of tested conditions , application of aqueous hydroxylamineprovided the best reproducible results for the exclusive removal of 3 - o - acetate ( si - table 3 ) . cleavage of the 3 - o - ac group to furnish 46 was accompanied by the migration of the phosphate from c - 4 to the liberated hydroxyl group at c - 3 to give 47 ( scheme 6 ) . besides , a partial hydrolytic loss of one benzyl protecting group in the phosphotriester 46 leading to formation of the phosphodiester 48 was also observed . indeed , when the reaction was terminated prior to completion ( 48 h ) , the formation of the undesired byproducts 47 and 48 could be largely avoided ( 2 % and 9 % , respectively ) , providing 3 - o - deacylated compound 46 in 53 % yield ( si - table 3 ) . repeated chromatographic purifications of the disaccharide 46 partly account for the relatively low yield .50 % nh2oh , thf , 0 c : 46 ( 53 % ) , 47 ( 2 % ) , 48 ( 9 % ) , recovered 36 ( 15 % ) ; ( b ) 49 , dic , dmap , ch2cl2 , 0 c , 83 % ; ( c ) dbu , ch2cl2 ; ( d ) 50 , edc , chcl3 ; ( e ) hfpy , thf ; ( f ) 57 + 59 , dic , dmap , 50 , ch2cl2 , 0 c ; ( g ) 58 + 60 , dic , dmap , 51 , ch2cl2 , 0c ; ( h ) 1 . ( bno ) 2pn ( ipr ) 2 , 1h - tetrazole , ch2cl2 , 2 ) mcpba , 78 c , 91 % for 61 , 89 % for 62 ; ( i ) pd black , toluene meoh , 1:1 , 72 % for 1the first ( r ) - 3 - ( tetradecanoyloxy ) tetradecanoyl residue at c - 3 of the glcn moiety was introduced by reaction of 46 with - acyloxyacyl acid 49 under the agency of dic and a catalytic amount of dmap to provide 52 in 83 % yield ( scheme 6 ) . notably , strictly equimolar amounts of dic and fatty acid 49 , and a catalytic quantity of dmap at 0 c , had to be applied to suppress the concomitant formation of the co - migrating 3 - o - tetradecanoyl ( 53 ) and 3 - o - alkenoyl ( 54 ) byproducts ( 11 % and 3 % , respectively ) . application of higher amounts of dic and / or fatty acid aimed to accelerate the transformation resulted in augmented formation of 53 and 54 , which could be rationalized by a probable - elimination or rearrangement of the in situ - formed o - acyl - oxyacylisourea intermediate . formation of a 3 - o - alkanoyl side product similar to 53 in the dic / dmap - mediated condensation had been previously reported , though no elimination byproduct such as 54 was detected . since esterification with - acyloxyacyl fatty acids under steglich conditionsis routinely applied in the synthesis of lipid a s and analogues which often display high bioactivity at picomolar doses , this finding is of importance for the preparation of lipid a - based compounds of the uppermost purity . subsequent fmoc cleavage in 52 with dbu followed by edc - mediated n - acylation with ( r ) - 3 - ( dodecanoyloxy ) tetradecanoic acid 50 provided tetraacylated disaccharide 55 . conversion of 4,6 - di - o - dtbs derivative 55 into diol 56 was performed under standard conditions with hfpy in thf . to introduce acyl and phosphate functional groups at mannose c - 4 and c - 6 , respectively , without additional protecting group manipulation , the regioselectivity of the acylation of the diol 56 with the acyloxyacyl acids 50 or 51 was first examined . since hydroxyl groups in the substituted trehaloses are known to differ in reactivity due to both steric and electronic effects , we expected that , in a heavily substituted glcn ( 11 ) man disaccharide 56 , positions c - 4 and c - 6 at the man moiety could be discriminated in a subsequent acylation procedure . indeed , the major outcome of dic / dmap - mediated acylation of 56 with the acids 50 or 51 was not the intrinsically expected primary 6 - oh - derived acylation products , but the 4 - o - acyloxyacyl derivatives 57 and 58 in 51 % and 65 % yield , respectively , having a 6 - oh group at the mannose unit accessible for the ensuing phosphorylation . minor amounts of the 4,6 - bis - o - acylated derivatives 59 and 60 ( 24 % and 13 % , respectively ) were isolated as well . although the 6 - oh group of the mannose residue in glcn ( 11 ) man disaccharide 56 is somewhat remote from the 2 - nh of the glcn moiety , the crystal structures of , - trehalose - based compounds indicate spatial proximity of the two groups . thus , it could be assumed that the intramolecular hydrogen bonding ( 2 - nh6 - oh ) exerts an adverse effect on the reactivity of the primary hydroxyl group at man c - 6 . furthermore , the bulkiness of the in situ - formed acyloxyacyl - activated ester resulting from the reaction of the fatty acids 50 or 51 with dic / dmap could also explain the limited access to the sterically hindered 6 - oh group in the , - trehalose - like disaccharide 56 . next , the free 6 - oh group in the hexaacylated disaccharides 57 and 58 was phosphorylated by reaction with dibenzyl - ( n , n - diisopropylamino ) phosphoramidite in the presence of a mild acid catalyst , 1h - tetrazole , and subsequent oxidation with mcpba at 78 c to furnish the bisphosphorylated hexaacylated products 61 and 62 in 91 % and 89 % yield , respectively . final debenzylation by hydrogenation of 57 , 61 , and 62 on pd - black followed by purification with gel permeation chromatography on sephadex sx1 in toluenemethanol ( 2:1 ) afforded target bisphosphorylated lipid a mimetics 1 and 2 and a monophosphorylated counterpart 3 . in contrast to native lipid a , compounds 1 and 2 do not possess a labile anomeric phosphate functionality ; consequently , they were isolated and biologically assessed as free acids at the phosphates and could be stored in aqueous solution at 4 c for several months without any noticeable sign of degradation , which was confirmed by maldi - tof analysis . the propensity of the , - gm - lams 13 to stimulate tlr4 - mediated immune signaling was first assessed in the htlr4 / hmd - 2 / cd14 transfected human embryonic kidney ( hek ) 293 cells ( hek - blue ) . since we were particularly interested in the molecular recognition mechanisms implicated in the binding of lps by the md - 2tlr4 complex wherein the lipid a / re - lps portion of lps is exclusively involved , we evaluated the activities of , - gm - lams 13 compared to e. colire - lps ( figure 1a ) . it has been previously shown that the minimum structural requirement for the expression of the highest cytokine - inducing potency resides in re - lps , which entails two 3 - deoxy - d - manno - oct -2-ulosonic acid ( kdo ) residues in addition to lipid a ( supporting information , si - figure 1a ) . moreover , the re - lps has a defined molecular weight ( mw ) similar to the mw range for lipid a mimetics ( 1.82.2 kda ) , in contrast to wild - type lps having variable mw ( 1015 kda ) , so that the direct comparison of a dose - dependent response between compounds 13 and re - lps is more appropriate . the tlr4 - stimulating activity of lipid a mimetics 13 was examined over a wide concentration range by monitoring of the activation of the nf - b regulated signal transduction pathway via measuring the induction of secreted embryonic alkaline phosphatase ( seap ) and compared to the responses elicited by e. colire - lps and sm - mpla . remarkably , the glycosylation at c - 6 of lipid a with kdo residues was reported to be responsible for the 1020-fold enhancement of the activity of the kdo / kdo2 - lipid a ( re - lps ) compared to lipid a alone in the nanomolar concentration range . notably , conformationally confined , - gm - lam 2 based on just a disaccharide scaffold displayed nf - b activation ( ec50 = 0.08 nm ) similar to those of re - lps ( ec50 = 0.04 nm ) and e. coli lps ( ec50 = 0.08 nm , si - figure 1a ) , and the tlr4 saturation plateau was reached at a concentration of 1 ng / ml for both ligands ( figure 4 ) . compound 1 , having a 2ch2 - longer acyl side chain at man c - 4 compared with , - gm - lam 2 , was a less efficient activator of nf - b ( ec50 = 0.4 nm ) , so that its tlr4 saturation plateau was reached at a concentration of 5 ng / ml . thus , shortening of a lipid side chain at c - 4 of the mannose moiety by 2ch2 resulted in a 5-fold increase of tlr - 4 stimulating activity , which underlines the significance of hydrophobic interactions at the dimerization interface . along this line , synthetic manipulation of the length of the acyl side chain at man c - 4 could be used for fine - tuning of the htlr4 - mediated activity in , - gm - lams . the monophosphate 3 was , as expected , significantly less active ( ec50 = 31 nm ) than its bisphosphorylated counterpart 1 , but it showed a more potent activation profile than sm - mpla at concentrations above 10 ng / ml . dose - dependent activation of tlr4 signaling in htlr4 / hmd - 2 / hcd14 - transfected hek293 cells ( hek - blue ) by lipid a mimetics 13 compared to e. colire - lps and s. minnesota mpla . lipid a mimetics 13 were examined for the ability to initiate the expression of tumor necrosis factor - ( tnf - ) , interleukin - 8 ( il - 8 ) , and monocyte chemotactic protein - 1 ( mcp - 1 ) in the human monocytic macrophage - like cell line thp - 1 , which expresses md - 2 , cd14 , and a variety of cell surface receptors , including tlr4 . the dose - dependent stimulating activity of synthetic lipid a mimetics was cytokine - specific , revealing higher potency in the induction of the expression of tnf - and il - 8 by , - gm - lams 1 and 2 than by re - lps / lps ( figure 5a , b , si - figures 2 and 3 ) . the release of mcp - 1 induced by , - gm - lam 2 was clearly more effective than the production of this chemokine by re - lps and compound 1 ( figure 5c ) . expression of myd88 - dependent chemokine mcp - 1 is associated with the activation of the intracellular tlr4md - 2 complex . the dampened induction of the expression of cytokines by , - gm - lam 3 correlates to its chemical structure missing a phosphate group at man c - 6 . our results indicate that both , - gm - lams 1 and 2 are more potent activators of the myd88 signaling pathway than re - lps / lps ( figure 5 , si - figure 4 ) . dose - dependent expression of cytokines induced by , - gm - lams 13 in human macrophage cell line thp - 1 compared to e. colire - lps . ( a ) production of tnf - . ( b ) induction of the expression of il - 8 . the ability of lipid a mimetics 13 to induce the production of tnf - and il - 6 from bone marrow - derived macrophages ( bmdm ) in mice was subsequently examined and compared to that of synthetic e. coli lipid a and e. coli mpla , which are reliable positive controls due to their chemical purity and homogeneity ( figure 6 ) . the maximum level of tnf - ( 4000 pg / ml ) was detected in bmdm cultivated in the presence of 1 nm , - gm - lam 1 or 2 , whereas the same quantity of the parent lipid a resulted in release of half the amount of tnf - ( 2000 pg / ml ) . on the other hand , monophosphoryl , - gm - lam 3 exhibited a dampened ability to express tnf - ( 500likewise , 1 nm ( 1.8 ng / ml ) of 1 or 2 triggered the release of a 3-fold higher amount of il - 6 ( 1500 pg / ml ) compared to lipid a ( 500 pg / ml ) . monophosphate 3 revealed a dose - dependent cytokine induction profile showing only marginal expression level of il - 6 at a concentration of 1 nm but higher il - 6 release than mpla at concentrations above 1 nm . induction of expression of tnf - and il - 6 by lipid a mimetics 13 in mbmdm compared to synthetic e. coli lipid a and e. coli mpla . e. coli o111 : b4 lps was used as positive control ( 1 nm ) . to test the impact of selected , - gm - lams 1 and 3 on maturation of human dendritic cells ( hdcs ) , immature monocyte - derived hdcs were stimulated with 1 and 3 in a wide concentration range or with e. coli lps as positive control . dcs are able to persistently sense pathogen - associated molecular patterns and present antigens to t lymphocytes , thereby initiating an adaptive immune response . dcs treated with lps acquired a distinctive morphologic phenotype and , when analyzed by flow cytometry , displayed characteristic markers of mature dcs . stimulation of dcs with 1 ( 1 mg / ml ) was as potent as that with lps in inducing dcs maturation and up - regulation of the co - stimulatory molecules cd86 , as well as the antigen - presenting structures mhc class i and mhc class ii , which are necessary for the induction of an adaptive immune response ( si - figure 5 ) . none of the , - gm - lams exerted cytotoxic effects on dcs , as determined by propidium iodide staining ( data not shown ) . activated dcs were examined for the production of pro - inflammatory cytokines tnf - , il - 6 , and il - 12 , which contribute to the modulation of the t cell response and innate effector functions . the release of tnf - and il - 6 reached nearly maximum levels ( attained with 10 ng / ml lps ) at the , - gm - lam 1 concentration of 1 ng / ml ( figure 7a ) . also the expression of il - 12 , which promotes the development of adaptive immune cells and is involved in coordinating innate and adaptive immunity , was efficiently induced by , - gm - lam 1 , indicating its potential adjuvant capacity . the release of tnf - , il - 6 , and il - 10 , a unique cytokine with a wide spectrum of anti - inflammatory effects , in dcs induced by monophosphate 3 was , in agreement with the experiments in the recombinant htlr4 / hmd - 2 signaling system , less efficient compared to that induced by 1 ( figure 7b ) . expression of cytokines induced by , - gm - lams 1 and 3 in human dendritic cells . ( a ) induction of cytokine production by 1 in dcs . ( b ) expression of tnf - , il - 6 , and il - 10 induced by monophoshorylated , - gm - lam 3 compared to its bisphosphorylated counterpart 1 . e. coli lps ( 10 ng / ml ) was used as a positive control . reagents and solvents were purchased from commercial suppliers and used without further purification unless otherwise stated . dichloromethane was distilled from cah2 and stored over activated 4 molecular sieves ( ms ) . other solvents were dried by storage over activated ms for at least 48 h prior to use [ toluene ( 4 ) , acetonitrile ( 3 ) , and dmf ( 3 ) ] . residual moisture was determined by colorimetric titration on a mitsubishi ca - 21 karl fischer apparatus and did not exceed 20 ppm for dry solvents . reactions were monitored by tlc performed on silica gel 60 f254 hptlc precoated glass plates with a 25 mm concentration zone ( merck ) . spots were visualized by uv light followed by dipping into a h2so4p - anisaldehyde solution or a ninhydrin etoh solution and subsequent charring at 250 c . preparative hplc was performed with linear solvent gradients on a ymc pack sil - 0625020 mm , s - 5 m , 6 nm column ( column a , loadings 50150 mg ) , or on a ymc pack sil - 0625010 mm , s - 5 m , 6 nm column ( column b , loadings 550 mg ) . preparative mplc was performed on silica gel 60 ( 230400 mesh , merck ) . size exclusion chromatography was performed on sephadex lh20 or bio - beads sx1 ( biorad ) supports . iii 600 spectrometer ( h at 600.22 mhz ; c at 150.92 mhz ; p at 242.97 mhz ) or on a bruker dpx 400 spectrometer ( h at 400.13 mhz ; c at 100.61 mhz ; p at 161.68 mhz ) using standard bruker nmr software . chemical shifts are reported in ppm , where h nmr spectra in cdcl3 are referenced to internal tms and c - spectra are referenced to the corresponding solvent signal ( 77.0 ppm for cdcl3 ) . nmr spectra in other solvents are referenced to residual solvent signals ( for acetone - d6 , 2.05 and 29.84 ppm ; for meod , 3.31 and 49.00 ppm , h and c nmr , respectively ) . p nmr spectra in cdcl3 are referenced according to iupac recommendations from 2001 from a referenced h nmr spectrum . in the disaccharides , hplc - ms was performed by injections of 0.010.1 % ch3cn solutions into a shimadzu lc - 10ad vp system equipped with two gradient pumps , a degasser , a shimadzu lcms 2020 detector , and an alltech 3300 elsd detector . analytes were eluted over a phenomenex jupiter 5 c4300a column using mobile phase a = h2o ( 0.1 % hcooh ) and mobile phase b = ch3cn ( 0.1 % hcooh ) in linear gradients from 5 % b to 100 % b and a flow rate of 0.5 ml / min . high - resolution mass spectrometry ( hrms ) was carried out on 110 mg / l acetonitrile solutions via lc - tof ms ( agilent 1200sl hplc and agilent 6210 esi - tof , agilent technologies ) . the mass spectrometer was tuned with agilent tune mix to provide a mass accuracy below 2 ppm . maldi - tof ms was performed in the negative - ion mode using a bruker autoflex speed instrument with 6 - aza -2-thiothymine ( att ) as matrix . optical rotation was measured on a perkinelmer 243b polarimeter equipped with a haake water circulation bath and a haake d1 immersion circulator for temperature control . a solution of glycosyl donor 21 ( 613 mg , 1.03 mmol ) and acceptor 10 ( 596 mg , 0.751 mmol ) in dry ch2cl2 ( 22 ml ) was stirred with powdered activated 4 molecular sieves at room temperature ( r.t . ) for 1 h under an atmosphere of ar . the mixture was cooled to 0 c , and a solution of tmsotf ( 9 l , 52 mol ) in dry ch2cl2 ( 450 l of a stock solution prepared from 20 l of tmsotf in 1 ml of ch2cl2 ) was added . the mixture was stirred at 0 c for 30 min , and the reaction was quenched by addition of saturated aqueous ( sat . the mixture was warmed to r.t . and diluted with etoac ( 100 ml ) , the solids were removed by filtration over a pad of celite , and the filtrate was concentrated . the residue was purified by mplc ( two successive columns : toluene etoac , 4:11:10:1 followed by hexaneetoac , 3:12:1 ) to afford 36 ( 469 mg , 391 mol , 52 % ) , 39 ( 186 mg , 155 mol , 20 % ) , and 42 ( 44 mg , 37 mol , 5 % ) . disaccharide 36 : rf = 0.32 ( hexane etoac , 1:1 ) ; d = + 61 ( c 0.9 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) 7.767.75 ( m , 2h , arom ) , 7.577.56 ( m , 1h , arom . ) , 7.527.51 ( m , 1h , arom ) , 7.457.23 ( m , 24h , arom ) , 5.23 ( t , 1h , j3 ,2 = j3 ,4 = 10.0 hz , h - 3 ) , 5.20 ( d , 1h , j1 ,2 = 3.5 hz , h - 1 ) , 5.12 ( s , 1h , h - 1 ) , 5.03 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.994.93 ( m , 4h , op ( o ) ( och2ph ) 2 ) , 4.90 ( d , 1h , jnh ,2 = 9.6 hz , nh ) , 4.82 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.534.47 ( m , 2h , h - 4 , ch2 , fmoc ) , 4.52 ( ab , 1h , j = 11.7 hz , ch2ph ) , 4.44 ( ab , 1h , j = 11.8 hz , ch2ph ) , 4.32 ( t , 1h , j4 ,3 = j4 ,5 = 9.5 hz , h - 4 ) , 4.20 ( t , 1h , j = 7.4 hz , ch , fmoc ) , 4.104.07 ( m , 2h , h - 2 , ch2 , fmoc ) , 4.05 ( dd , 1h , j6a ,5 = 4.8 hz , j6a ,6 b = 10.3 hz , h - 6a ) , 3.96 ( t , 1h , j6b ,5 = j6b ,6 a = 10.3 hz , h - 6b ) , 3.793.76 ( m , 2h , h - 5 , h - 6a ) , 3.723.68 ( m , 2h , h - 3 , h - 5 ) , 3.63 ( dd , 1h , j = 5.9 hz , 11.0 hz , h - 6b ) , 3.41 ( s , 1h , h - 2 ) , 3.40 ( s , 3h , ch3 , me ) , 1.87 ( s , 3h , ch3 , ac ) , 1.06 ( s , 9h , 3ch3 , dtbs ) , 0.96 ( s , 9h , 3ch3 , dtbs ) ; c nmr ( 151 mhz , cdcl3 ) 171.58 ( co , ac ) ,155.69 ( co , fmoc ) , 143.79 , 143.47 , 141.23 , 141.20 ( 4cq , fmoc ) , 138.73 , 137.78 ( 2cq , ch2ph ) , 135.46 ( cq , jc , p = 6.8 hz , op ( o ) ( och2ph ) 2 ) , 135.39 ( cq , jc , p = 7.3 hz , op ( o ) ( och2ph ) 2 ) , 128.72 , 128.63 , 128.36 , 128.32 , 128.01 , 127.94 , 127.79 , 127.77 , 127.70 , 127.67 , 127.61 , 127.14 , 125.12 , 125.02 , 120.00 ( 28ch , arom ) , 93.70 ( c - 1 , jc , h = 173 hz ) , 93.07 ( c - 1 , jc , h = 172 hz ) , 79.59 ( c - 2 ) , 77.84 ( c - 3 ) , 74.78 ( c - 4 ) , 74.03 ( ch2ph ) , 73.55 ( ch2ph ) , 73.49 ( c - 4 , jc4 , p = 5.9 hz ) , 71.35 ( c - 3 ) , 70.63 ( c - 5 , jc5 , p = 5.9 hz ) , 69.70 ( op ( o ) ( och2ph ) 2 ) , 69.66 ( op ( o ) ( och2ph ) 2 ) , 69.19 ( c - 5 ) , 68.29 ( c - 6 ) , 67.70 ( ch2 , fmoc ) , 66.36 ( c - 6 ) , 59.68 ( ch3 , me ) , 53.65 ( c - 2 ) , 46.91 ( ch , fmoc ) , 27.41 , 27.04 ( 6ch3 , dtbs ) , 22.56 ( cq , dtbs ) , 20.70 ( ch3 , ac ) , 19.79 ( cq , dtbs ) ; p nmr ( 243 mhz , cdcl3 ) 2.02 ; hrms ( esi ) m / z calcd for c66h78no16psi + h 1200.4900 [ m + h ] , found 1200.4900 . a biphasic mixture of 36 ( 192 mg , 160 mol ) in thf ( 4 ml ) and aq . hydroxylamine ( 50 % , 4 ml ) was vigorously stirred at 0 c for 48 h. the mixture was diluted with etoac ( 50 ml ) and washed with aq . citric acid ( 0.25 m , 70 ml ) , sat . the residue was purified by hplc ( two successive columns : toluene etoac , 1:1 , and hexane etoac , 3:11:1 , column a ) to afford 46 , unreacted 36 ( 56 % ) , 47 , and 48 . the recovered 36 ( 108 mg , 90 mol ) was subjected to two additional reaction cycles to afford , after isolation by hplc , compounds 46 ( overall yield : 99 mg , 85 mol , 53 % ) , 47 ( 4 mg , 3.5 mol , 2 % ) , and 48 ( 16 mg , 15 mol , 9 % ) . disaccharide 46 : rf = 0.60 ( toluene etoac , 1:1 ) ; d = + 72 ( c 1.0 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) 7.767.75 ( m , 2h , arom ) , 7.617.58 ( m , 2h , arom ) , 7.417.23 ( m , 24h , arom ) , 5.25 ( s , 1h , h - 1 ) , 5.094.99 ( m , 6h , h - 1 , ch2ph , op ( o ) ( och2ph ) 2 ) , 4.794.74 ( m , 2h , ch2ph , nh ) , 4.634.56 ( m , 1h , ch2 , fmoc ) , 4.47 ( s , 2h , ch2ph ) , 4.32 ( t , 1h , j = 9.4 hz , h - 4 ) , 4.284.22 ( m , 2h , h - 4 , ch , fmoc ) , 4.194.13 ( m , 1h , ch2 , fmoc ) , 4.074.05 ( m , 1h , h - 6a ) , 3.983.88 ( m , 1h , h - 2 ) , 3.95 ( t , 1h , j = 10.4 hz , h - 6b ) , 3.813.75 ( m , 1h , h - 3 ) , 3.71 ( td , j = 4.8 hz , j = 10.1 hz , h - 5 ) , 3.693.60 ( m , 3h , h - 3 , h - 5 , h - 6a ) , 3.55 ( dd , j = 5.2 hz , j = 10.9 hz , h - 6b ) , 3.40 ( s , 3h , ch3 , me ) , 3.36 ( s , 1h , h - 2 ) , 1.06 ( s , 9h , 3ch3 , dtbs ) , 0.95 ( s , 9h , 3ch3 , dtbs ) ; c nmr ( 151 mhz , cdcl3 ) 143.87 , 143.78 , 141.27 , 141.25 ( 4cq , fmoc ) , 138.84 , 137.77 ( 2cq , ch2ph ) , 135.28 , 135.24 ( 2cq , op ( o ) ( och2ph ) 2 ) , 128.91 , 128.78 , 128.73 , 128.65 , 128.36 , 128.24 , 127.93 , 127.84 , 127.73 , 127.71 , 127.67 , 127.58 , 127.17 , 127.08 , 125.32 , 125.19 , 119.96 , 119.95 ( 28ch , arom ) , 93.81 ( c - 1 ) , 93.48 ( c - 1 ) , 79.81 ( c - 2 ) , 77.69 ( c - 3 ) , 74.83 ( c - 4 ) , 73.84 , 73.63 ( 2ch2ph ) , 70.98 ( c - 3 ) , 70.49 , 70.32 ( c - 5 , jc , p = 8.9 hz , op ( o ) ( och2ph ) 2 , jc , p = 5.7 hz , ) , 70.04 ( op ( o ) ( och2ph ) 2 , jc , p = 5.6 hz ) , 69.20 ( c - 5 ) , 68.36 ( c - 6 ) , 67.59 ( ch2 , fmoc ) , 66.40 ( c - 6 ) , 59.61 ( ch3 , me ) , 54.79 ( c - 2 ) , 47.14 ( ch2 , fmoc ) , 27.46 , 27.06 ( 6ch3 , dtbs ) , 22.59 , 19.81 ( 2cq , dtbs ) ; p nmr ( 243 mhz , cdcl3 ) 0.43 ; hrms ( esi ) m / z calcd for c64h767no15psi + h 1158.4795 [ m + h ] , found 1158.4790 . to a stirred solution of 46 ( 95 mg , 82 mol ) in dry ch2cl2 ( 500 l ) were added solutions of 49 ( 37 mg , 82 mol ) in dry ch2cl2 ( 200 l ) , dmap ( 1 mg , 8 mol ) in dry ch2cl2 ( 90 l of a stock solution 11 mg of dmap in 1 ml of ch2cl2 ) , and dic ( 10 mg , 82 mol ) in dry ch2cl2 ( 150 l ) at 0 c , and the mixture was stirred for 2.5 h. then additional portions of 49 ( 37 mg , 82 mol ) and dic ( 10 mg , 82 mol ) were added , and the mixture was stirred for 4.5 h at 0 c , diluted with etoac ( 50 ml ) , and washed with aq . citric acid ( 0.25 m , 50 ml ) , sat . the residue was purified by hplc ( hexane etoac , 5:13:1 ) to afford 52 ( 109 mg , 68 mol , 83 % ) as a colorless syrup . fractions containing byproducts were purified by hplc ( hexane etoac , 4:13:1 , column b ) to afford 53 ( 12 mg , 9 mol , 11 % ) and 54 ( 3 mg , 2.2 mol , 3 % ) . compound 52 : rf = 0.66 ( toluene etoac , 1:1 ) ; d = + 44 ( c 1.0 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) 7.757.74 ( m , 2h , arom ) , 7.597.58 ( m , 1h , arom ) , 7.547.53 ( m , 1h , arom ) , 7.457.43 ( m , 2h , arom ) , 7.407.23 ( m , 22h , arom ) , 5.32 ( d , 1h , jnh ,2 = 8.5 hz , nh ) , 5.27 ( d , 1h , j1 ,2 = 3.0 hz , h - 1 ) , 5.24 ( t , 1h , j3 ,4 = j3 ,2 = 10.0 hz , h - 3 ) , 5.205.16 ( m , 1h , - ch ) , 5.11 ( s , 1h , h - 1 ) , 5.04 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.984.94 ( m , 4h , op ( o ) ( och2ph ) 2 ) , 4.81 ( ab , 1h , j = 11.8 hz , ch2ph ) , 4.50 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.474.41 ( m , 2h , h - 4 , ch2 , fmoc ) , 4.41 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.32 ( t , 1h , j4 ,5 = j4 ,3 = 9.5 hz , h - 4 ) , 4.18 ( t , 1h , j = 7.4 hz , ch , fmoc ) , 4.154.12 ( m , 1h , ch2 , fmoc ) , 4.084.04 ( m , 2h , h - 2 , h - 6a ) , 3.96 ( t , 1h , j6b ,5 = j6b ,6 a = 10.2 hz , h - 6b ) , 3.803.73 ( m , 4h , h - 3 , h - 5 , h - 5 , h - 6a ) , 3.61 ( dd , 1h , j = 6.0 hz , j = 11.1 hz , h - 6b ) , 3.39 ( s , 1h , h - 2 ) , 3.38 ( s , 3h , ch3 , me ) , 2.49 ( dd , 1h , j = 8.3 hz , j = 16.1 hz , - ch2 ) , 2.40 ( dd , 1h , j = 4.4 hz , j = 16.1 hz , - ch2 ) , 2.192.10 ( m , 2h , - ch2 ) , 1.541.50 ( m , 2h , - ch2 ) , 1.421.35 ( m , 2h , - ch2 ) , 1.301.06 ( m , 38h , 19ch2 ) , 1.05 ( s , 9h , 3ch3 , dtbs ) , 0.94 ( s , 9h , 3ch3 , dtbs ) , 0.88 ( t , 6h , j = 7.1 hz , 2 - ch3 ) ; c nmr ( 151 mhz , cdcl3 ) 173.23 , 171.16 ( 2co ) , 155.91 ( co , fmoc ) , 143.74 , 143.66 , 141.22 , 141.19 ( 4cq , fmoc ) , 138.83 , 137.87 ( 2cq , ch2ph ) , 135.55 , 135.51 ( 2cq , op ( o ) ( och2ph ) 2 ) , 128.71 , 128.64 , 128.38 , 128.33 , 128.16 , 128.04 , 127.94 , 127.80 , 127.68 , 127.66 , 127.62 , 127.21 , 127.18 , 125.29 , 125.18 , 119.95 ( 28ch , arom ) , 94.02 ( c - 1 ) , 93.25 ( c - 1 ) , 79.76 ( c - 2 ) , 78.15 ( c - 3 ) , 74.84 ( c - 4 ) , 74.23 ( ch2ph ) , 73.65 ( c - 4 , jc4 , p = 5.7 hz ) , 73.51 ( ch2ph ) , 71.21 ( c - 3 ) , 70.69 ( c - 5 , jc5 , p = 5.3 hz ) , 69.79 ( - ch or c - 5 ) , 69.78 ( op ( o ) ( och2ph ) 2 , jc , p = 6.5 hz ) , 69.74 ( op ( o ) ( och2ph ) 2 , jc , p = 6.1 hz ) , 69.21 ( - ch or c - 5 ) , 68.36 ( c - 6 ) , 67.92 ( ch2 , nhfmoc ) , 66.40 ( c - 6 ) , 59.70 ( ch3 , me ) , 53.80 ( c - 2 ) , 47.01 ( ch , fmoc ) , 38.96 ( - ch2 ) , 34.37 ( - ch2 ) , 34.09 ( - ch2 ) , 31.91 , 29.68 , 29.65 , 29.62 , 29.52 , 29.49 , 29.38 , 29.35 , 29.30 , 29.17 , 27.46 , 27.07 , 24.98 , 22.68 ( 20ch2 , 6ch3 , dtbs ) , 22.59 , 19.79 ( 2cq , dtbs ) , 14.10 ( 2 - ch3 ) ; p nmr ( 243 mhz , cdcl3 ) 1.71 ; hrms ( esi ) m / z calcd for c92h128no18psi + na 1616.8513 [ m + na ] , found 1616.8526 . to a stirred solution of 52 ( 104 mg ,65 mol ) in dry ch2cl2 ( 1 ml ) was added dbu ( 20 l , 134 mol ) at 0 c , and the stirring was continued for 1.5 h at r.t . the mixture was diluted with etoac ( 25 ml ) and washed with aq . the mixture was purified by silica gel chromatography ( hexane etoac , 3:1 ( 0.1 % et3n ) 1:1 ( 0.1 % et3n ) to afford the crude amine ( 78 mg ) , rf = 0.28 ( hexane etoac , 1:1 ) . to a stirred solution of the intermediate amine ( 78 mg ) in dry chcl3 ( 400 l ) were added a solution of 50 ( 29 mg , 68 mol ) in dry chcl3 ( 150 l ) and a solution of edchcl ( 13 mg , 68 mol ) in dry chcl3 ( 200 l ) at r.t . the mixture was stirred for 1.5 h , and then additional amounts of 50 ( 29 mg , 68 mol ) and edchcl ( 13 mg , 68 mol ) were added . the mixture was stirred for 3 h , diluted with chcl3 ( 30 ml ) , and washed with waterthe residue was purified by mplc ( hexane etoac , 4:13:1 ) to afford 55 ( 91 mg , 51 mol , 78 % over two steps ) as a colorless syrup : rf = 0.44 ( hexane etoac , 2:1 ) ; d = + 35 ( c 1.0 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) 7.437.42 ( m , 2h , ch2ph ) , 7.357.22 ( m , 18h , ch2ph ) , 6.10 ( d , 1h , jnh ,2 = 7.9 hz , nh ) , 5.235.12 ( m , 2h , 2 - ch ) , 5.20 ( d , 1h , j1 ,2 = 3.6 hz , h - 1 ) , 5.17 ( dd , j3 ,4 = 9.0 hz , j3 ,2 = 11.1 hz , h - 3 ) , 5.08 ( d , 1h , j1 ,2 = 1.5 hz , h - 1 ) , 5.01 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.964.92 ( m , 4h , 2ch2 , op ( o ) ( och2ph ) 2 ) , 4.77 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.48 ( ab , 1h , j = 11.8 hz , ch2ph ) , 4.39 ( ab , 1h , j = 11.8 hz , ch2ph ) , 4.384.35 ( m , 1h , h - 4 ) , 4.30 ( t , j4 ,3 = j4 ,5 = 9.5 hz , h - 4 ) , 4.25 ( ddd , 1h , j2 ,1 = 3.6 hz , j2 , nh = 7.8 hz , j2 ,3 = 11.2 hz , h - 2 ) , 4.03 ( dd , 1h , j6a ,5 = 5.0 hz , j6a ,6 b = 10.3 hz , h - 6a ) , 3.93 ( t , 1h , j6b ,5 = j6b ,6 a = 10.4 hz , h - 6b ) , 3.763.74 ( m , 2h , h - 5 , h - 6a ) , 3.71 ( dd , 1h , j3 ,2 = 3.3 hz , j3 ,4 = 9.6 hz , h - 3 ) , 3.63 ( td , 1h , j5 ,6 a = 4.9 hz , j5 ,4 = j5 ,6 b = 9.9 hz , h - 5 ) , 3.56 ( dd , 1h , j = 6.1 hz , j = 10.8 hz , h - 6b ) , 3.39 ( dd , 1h , j2 ,1 = 1.6 hz , j2 ,3 = 3.2 hz , h - 2 ) , 3.34 ( s , 3h , ch3 , me ) , 2.482.32 ( m , 4h , 2 - ch2 ) , 2.282.19 ( m , 4h , - ch2 , - ch2 ) , 1.601.46 ( m , 8h , 2 - ch2 , - ch2 , - ch2 ) , 1.281.23 ( m , 72h , 36ch2 , fatty acids ) , 1.07 ( s , 9h , 3ch3 , dtbs ) , 1.01 ( s , 9h , 3ch3 , dtbs ) , 0.890.86 ( m , 12h , 3 - ch3 , - ch3 ) ; c nmr ( 151 mhz , cdcl3 ) 173.53 , 173.26 , 171.26 , 169.79 ( 4co ) , 138.90 , 137.89 ( 2cq , ch2ph ) 135.56 , 135.51 ( 2cq , op ( o ) ( och2ph ) 2 ) 128.71 , 128.63 , 128.36 , 128.31 , 128.18 , 128.05 , 127.85 , 127.63 , 127.62 , 127.59 ( 20ch , ch2ph ) , 93.80 ( c - 1 ) , 93.11 ( c - 1 ) , 79.74 ( c - 2 ) , 78.25 ( c - 3 ) , 74.65 ( c - 4 ) , 74.11 ( ch2ph ) , 73.86 ( c - 4 ) , 73.47 ( ch2ph ) , 70.90 , 70.76 ( c - 3 , c - 5 ) , 70.09 , 70.01 ( 2 - ch ) , 69.77 , 69.75 , 69.74 , 69.72 ( 2ch2 , op ( o ) ( och2ph ) 2 ) , 69.33 ( c - 5 ) , 68.44 ( c - 6 ) , 66.36 ( c - 6 ) , 59.57 ( ch3 , me ) , 51.66 ( c - 2 ) , 40.95 , 39.29 ( 2 - ch2 ) , 34.58 , 34.46 ( ch2 , ch2 , 2ch2 ) , 31.93 , 31.92 , 29.72 , 29.69 , 29.66 ,29.62 , 29.57 , 29.52 , 29.39 , 29.36 , 29.25 , 29.22 , 25.26 , 25.19 , 25.05 , 25.04 , 22.68 ( 38ch2 ) 27.53 , 27.29 ( 6ch3 , dtbs ) , 22.64 , 19.87 ( 2cq , dtbs ) , 14.09 ( 3 - ch3 , - ch3 ) ; p nmr ( 242.97 mhz , cdcl3 ) 1.67 ; hrms ( esi ) m / z calcd for c103h166no19psi + na 1780.1453 [ m + na ] , found 1780.1430 . to a stirred solution of 55 ( 91 mg , 51 mol ) in dry thf ( 3 ml ) in a ptfe vial was added a solution of hfpy ( 70 % , 50 l ) at 0 c . the residue was purified by silica gel chromatography ( toluene etoac , 3:1 ) to afford 56 ( 78 mg , 47 mol , 92 % ) : rf = 0.22 ( toluene etoac , 1:1 ) ; d = + 41 ( c 1.0 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) 7.437.22 ( m , 20h , ch2ph ) , 6.34 ( d , 1h , jnh ,2 = 8.2 hz , nh ) , 5.26 ( d , 1h , j1 ,2 = 3.7 hz , h - 1 ) , 5.22 ( dd , 1h , j3 ,4 = 9.1 hz , j3 ,2 = 11.0 hz , h - 3 ) , 5.145.10 ( m , 1h , - ch ) , 5.13 ( d , 1h , j1 ,2 = 1.6 hz , h - 1 ) , 5.055.01 ( m , 1h , - ch ) , 4.974.93 ( m , 4h , 2ch2 , op ( o ) ( och2ph ) 2 ) , 4.79 ( ab , 1h , j = 11.6 hz , ch2ph ) , 4.49 ( ab , 1h , j = 11.8 hz , ch2ph ) , 4.42 ( q , 1h , j4 ,3 = j4 ,5 = jh , p = 9.2 hz , h - 4 ) , 4.40 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.26 ( ddd , 1h , j1 ,2 = 3.5 hz , j2 , nh = 8.0 hz , j2 ,3 = 11.2 hz , h - 2 ) , 3.923.88 ( m , 1h , h - 4 ) , 3.843.79 ( m , 2h , h - 3 , h - 6a ) , 3.763.74 ( m , 3h , h - 5 , h - 6a , h - 6b ) , 3.603.56 ( m , 2h , h - 5 , h - 6b ) , 3.30 ( s , 3h , ch3 , me ) , 3.303.28 ( m , 1h , h - 2 ) , 2.70 ( s , 1h , oh ) , 2.482.42 ( m , 3h , - ch2 ) , 2.39 ( dd , 1h , j = 6.2 hz , j = 15.3 hz , - ch2 ) , 2.342.26 ( m , 2h , - ch2 ) , 2.232.20 ( m , 2h , - ch2 ) , 1.651.46 ( m , 8h , 2ch2 , ch2 , ch2 ) , 1.311.21 ( m , 72h , 36ch2 ) , 0.890.86 ( m , 12h , 3 - ch3 , - ch3 ) ; c nmr ( 151 mhz , cdcl3 ) 174.65 , 173.48 , 171.15 , 170.08 ( 4co ) , 138.10 , 137.87 ( 2cq , ch2ph ) , 135.47 ( 2cq , op ( o ) ( och2ph ) 2 ) , 128.72 , 128.63 , 128.60 , 128.31 , 128.17 , 128.04 , 128.01 , 127.63 , 127.59 ( 20ch , ch2ph ) , 93.14 ( c - 1 ) , 92.56 ( c - 1 ) , 78.78 ( c - 3 ) , 77.38 ( c - 2 ) , 73.76 ( c - 4 , c - 5 ) , 73.48 , 72.76 ( 2ch2ph ) , 71.33 ( - ch ) , 71.02 ( c - 3 ) , 70.62 ( c - 5 , jc5 , p = 5.0 hz ) , 70.01 ( - ch ) , 69.82 ( 2ch2 , op ( o ) ( och2ph ) 2 ) , 68.42 ( c - 6 ) , 67.84 ( c - 4 ) , 63.04 ( c - 6 ) , 59.03 ( ch3 , me ) , 51.70 ( c - 2 ) , 41.50 , 39.09 ( 2 - ch2 ) , 34.74 , 34.60 , 34.41 , 34.23 ( ch2 , ch2 , 2ch2 ) , 31.92 , 31.91 , 29.70 , 29.68 , 29.65 , 29.61 , 29.58 , 29.54 , 29.47 , 29.43 , 29.37 , 29.34 , 29.20 , 29.18 , 25.28 , 25.17 , 25.01 , 24.99 , 22.67 ( 38ch2 ) , 14.08 ( 3 - ch3 , - ch3 ) ; p nmr ( 243 mhz , cdcl3 ) 1.80 ; hrms ( esi ) m / z calcd for c95h150no19p + na 1663.0432 [ m + na ] , found 1663.0424 . to a stirred solution of 56 ( 21 mg , 13 mol ) and dmap ( 0.15 mg , 1.3 mol ) in dry ch2cl2 ( 500 l ) was added a solution of fatty acid 50 ( 6.5 mg , 15 mol ) in ch2cl2 ( 50 l of a stock solution prepared from 26 mg of 50 in 200 l of ch2cl2 ) . the mixture was cooled to 0 c , and dic ( 1.9 mg , 15.4 mol ) from a 50 mg / ml stock solution in toluene was added dropwise over a period of 1 h. then additional amounts of 50 ( 1.3 mg , 3.1 mol ) and dic ( 0.4 mg , 0.3 mol ) from the indicated stock solutions were successively added ( dic was added dropwise over 30 min ) at 0 c . the mixture was diluted with etoac ( 20 ml ) and washed with aqthe residue was purified by hplc ( two consecutive columns : toluene etoac , 3:12:1 , and hexane etoac , 3:11:1 , column b ) to afford 57 ( 13.5 mg , 6.6 mol , 51 % ) as a syrup . fractions containing byproduct 59 were purified by hplc ( hexane etoac , 5:13:1 ) to afford 59 ( 7.6 mg , 3.1 mol , 24 % ) as a syrup . compound 57 : rf = 0.27 ( hexane etoac , 1:1 ) ; d = + 68 ( c 1.0 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) 7.387.21 ( m , 20h , ch2ph ) , 6.37 ( d , 1h , jnh ,2 = 8.2 hz , nh ) , 5.245.15 ( m , 5h , h - 1 , h - 3 , h - 4 , 2 - ch ) , 5.12 ( d , 1h , j1 ,2 = 2.0 hz , h - 1 ) , 5.075.03 ( m , 1h , - ch ) , 4.974.94 ( m , 4h , op ( o ) ( och2ph ) 2 ) , 4.69 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.48 ( ab , 1h , j = 11.8 hz , ch2ph ) , 4.42 ( ddd , 1h , j4 ,3 = j4 ,5 = jh , p = 9.3 hz , h - 4 ) , 4.40 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.24 ( ddd , 1h , j2 ,1 = 3.6 hz , j2 , nh = 8.1 hz , j2 ,3 = 11.1 hz , h - 2 ) , 3.94 ( dd , 1h , j3 ,2 = 3.1 hz , j3 ,4 = 9.4 hz , h - 3 ) , 3.753.72 ( m , 2h , h - 5 , h - 6a ) , 3.623.55 ( m , 4h , h - 5 , h - 6a , h - 6b , h - 6b ) , 3.303.29 ( m , 1h , h - 2 ) , 3.29 ( s , 3h , ch3 , me ) , 2.60 ( dd , 1h , j = 7.6 hz , 15.5 hz , - ch2 ) , 2.542.47 ( m , 3h , - ch2 ) , 2.44 ( dd , 1h , j = 7.2 hz , 15.0 hz , - ch2 ) , 2.37 ( dd , 1h , j = 5.6 hz , 15.1 hz , - ch2 ) , 2.302.27 ( m , 2h , - ch2 ) , 2.242.19 ( m , 4h , 2 - ch2 ) , 1.621.48 ( m , 12h , - ch2 , 2 - ch2 , 3 - ch2 ) , 1.301.22 ( m , 106h , 53ch2 ) , 0.890.86 ( m , 18h , 4 - ch3 , 2 - ch3 ) ; c nmr ( 151 mhz , cdcl3 ) 173.64 , 173.40 , 173.10 , 171.43 , 169.93 , 169.88 ( 6co ) , 138.01 , 137.88 ( 2cq , ch2ph ) , 135.55 , 135.51 ( 2cq , op ( o ) ( och2ph ) 2 ) , 128.71 , 128.64 , 128.53 , 128.32 , 128.12 , 128.11 , 128.04 , 127.93 , 127.65 , 127.59 ( 20ch , ch2ph ) , 94.03 ( c - 1 ) , 93.51 ( c - 1 ) , 77.81 ( c - 2 ) , 75.89 ( c - 3 ) , 73.67 ( c - 4 , jc4 , p = 5.8 hz ) , 73.49 ( ch2ph ) , 72.74 ( c - 5 ) , 72.52 ( ch2ph ) , 71.09 ( c - 3 ) , 70.84 ( - ch ) , 70.69 ( c - 5 , jc5 , p = 5.3 hz ) , 69.95 , 69.88 ( 2 - ch ) , 69.77 , 69.73 ( 2ch2 , op ( o ) ( och2ph ) 2 ) , 68.36 ( c - 6 ) , 68.35 ( c - 4 ) , 61.71 ( c - 6 ) , 59.10 ( ch3 , me ) , 51.81 ( c - 2 ) , 41.38 , 39.16 , 39.02 ( 3 - ch2 ) , 34.60 , 34.53 , 34.44 , 34.28 , 34.05 ( - ch2 , 2 - ch2 , 3 - ch2 ) , 31.93 , 29.73 , 29.70 , 29.67 , 29.62 , 29.60 , 29.57 , 29.55 , 29.54 , 29.52 , 29.48 , 29.42 , 29.39 , 29.37 , 29.36 , 29.33 , 29.28 , 29.20 , 25.36 , 25.17 , 25.10 , 25.01 , 22.69 ( 56ch2 ) , 14.10 ( 4 - ch3 , 2 - ch3 ) ; p nmr ( 243 mhz , cdcl3 ) 1.71 ; hrms ( esi ) m / z calcd for c121h198no22p + na 2071.4035 [ m + na ] , found 2071.4036 . to a stirred solution of 57 ( 11 mg , 6 mol ) and dibenzyl n , n - diisopropylphosphoramidite ( 10 l , 25 mol , 90 % ) in dry ch2cl2 ( 400 l ) was added a solution of 1h - tetrazole ( 54 l , 24 mol , 0.45 m in ch3cn ) under an atmosphere of ar . the mixture was stirred for 1 h and then cooled to 78 c , and a solution of mcpba ( 7 mg , 70 % ) in ch2cl2 ( 54 l ) was added . after being stirred for 45 min , the reaction was quenched by addition of et3n ( 5 l ) , and then the mixture was warmed to r.t . , diluted with ch2cl2 ( 10 ml ) , and washed with sat . the residue was purified by hplc ( two consecutive columns : toluene etoac , 10:15:11:1 followed by hexaneetoac , 2:11:1 , column b ) to afford 61 ( 11 mg , 5 mol , 89 % ) as a syrup : rf = 0.53 ( hexane etoac , 1:1 ) ; d = + 31 ( c 1.0 , chcl3 ) ; h nmr ( 600 mhz , cdcl3 ) 7.387.21 ( m , 30h , ch2ph ) , 6.46 ( d , 1h , jnh ,2 = 8.3 hz , nh ) , 5.30 ( t , 1h , j4 ,5 = j4 ,3 = 9.8 hz , h - 4 ) , 5.235.16 ( m , 3h , h - 3 , 2 - ch ) , 5.15 ( d , 1h , j1 ,2 = 3.7 hz , h - 1 ) , 5.10 ( d , 1h , j1 ,2 = 2.0 hz , h - 1 ) , 5.105.06 ( m , 1h , - ch ) , 5.034.93 ( m , 8h , 2op ( o ) ( och2ph ) 2 ) , 4.67 ( ab , 1h , j = 12.1 hz , ch2ph ) , 4.45 ( ab , 1h , j = 11.8 hz , ch2ph ) , 4.434.39 ( m , 1h , h - 4 ) , 4.38 ( ab , 1h , j = 11.9 hz , ch2ph ) , 4.304.26 ( m , 1h , h - 2 ) , 4.074.04 ( m , 2h , h - 6a , h - 6b ) , 4.01 ( dd , 1h , j3 ,2 = 3.0 hz , j3 ,4 = 9.6 hz , h - 4 ) , 3.893.86 ( m , 1h , h - 5 ) , 3.74 ( dd , 1h , j6a ,5 = 1.7 hz , j6a ,6 b = 10.8 hz , h - 6a ) , 3.723.69 ( m , 1h , h - 5 ) , 3.56 ( dd , 1h , j6b ,5 = 5.9 hz , j6b ,6 a = 10.8 hz , h - 6b ) , 3.28 ( t , 1h , j = 2.6 hz , h - 2 ) , 3.23 ( s , 3h , ch3 , me ) , 2.582.52 ( m , 3h , - ch2 ) , 2.482.44 ( m , 2h , - ch2 ) , 2.412.38 ( m , 1h , - ch2 ) , 2.342.24 ( m , 2h , - ch2 ) ,2.202.16 ( m , 4h , - ch2 , - ch2 ) , 1.611.49 ( m , 12h , - ch2 , 2 - ch2 , 3 - ch2 ) , 1.291.22 ( m , 106h , 53ch2 ) , 0.890.86 ( m , 18h , 4 - ch3 , 2 - ch3 ) ; c nmr ( 151 mhz , cdcl3 ) 173.89 , 173.25 , 172.94 , 171.20 , 169.77 , 169.07 ( 6co ) , 137.99 , 137.85 ( 2cq , ch2ph ) , 135.98 , 135.94 , 135.56 , 135.51 ( 4cq , op ( o ) ( och2ph ) 2 ) , 128.69 , 128.63 , 128.54 , 128.46 , 128.44 , 128.30 , 128.28 , 128.14 , 128.02 , 127.96 , 127.92 , 127.88 , 127.64 , 127.60 ( 30ch , ch2ph ) , 93.36 ( c - 1 ) , 93.18 ( c - 1 ) , 77.55 ( c - 2 ) , 75.96 ( c - 3 ) , 73.69 ( c - 4 , jc4 , p = 6.1 hz ) , 73.49 , 72.47 ( 2ch2 , ph ) , 71.24 , 70.96 , 70.66 , 70.60 , 69.82 , 69.76 ( c - 3 , c - 5 , c - 5 , - ch , 2 - ch ) , 69.78 , 69.74 , 69.70 , 69.32 ( 4ch2 , op ( o ) ( och2ph ) 2 ) , 68.48 ( c - 6 ) , 67.50 ( c - 4 ) , 66.15 ( c - 6 ) , 59.02 ( ch3 , me ) , 51.44 ( c - 2 ) , 41.56 , 38.96 , 38.77 ( 3 - ch2 ) , 34.77 , 34.55 , 34.41 , 34.20 , 34.00 ( - ch2 , 2 - ch2 , 3 - ch2 ) , 31.94 , 31.92 , 29.75 , 29.73 , 29.69 , 29.67 , 29.65 , 29.63 , 29.56 , 29.54 , 29.51 , 29.47 , 29.39 , 29.36 , 29.31 , 29.19 , 25.37 , 25.17 , 25.12 , 25.01 , 22.68 ( 56ch2 ) , 14.09 ( 4 - ch3 , 2 - ch3 ) ; p nmr ( 243 mhz , cdcl3 ) 1.61 , 1.69 ; hrms ( esi ) m / z calcd for c135h211no25p2 + na 2331.4638 [ m + na ] , found 2331.4618 . a solution of 61 ( 10 mg , 4.3 mol ) in toluene meoh ( 1 ml , 1:1 ) was hydrogenated over pd - black ( 5 mg , 47 mol ) for 20 h. the mixture was diluted with ch2cl2etoh ( 1:1 , 10 ml ) , and the solids were removed by filtration ( syringe filter , regenerated cellulose , 45 m ) . the filtrate was concentrated , and the residue was purified by size exclusion chromatography on bio - beads sx1 ( 200400 mesh , 260 cm , tolueneappropriate fractions were concentrated , and the residue was dissolved in dmso ( 2 ml ) and freeze - dried to afford 1 ( 6.0 mg , 3.4 mol , 79 % ) as a white solid : rf = 0.29 ( chcl3meoh h2o , 50:28:6 ) ; h nmr ( 600 mhz , cdcl3meod , 3:1 ) 5.29 ( d , 1h , j1 ,2 = 3.8 hz , h - 1 ) , 5.275.22 ( m , 4h , h - 1 , h - 3 , 2 - ch ) , 5.145.09 ( m , 1h , - ch ) , 5.00 ( t , 1h , j4 ,5 = j4 ,3 = 9.7 hz , h - 4 ) , 4.31 ( dt , 1h , j = 9.7 hz , j = 9.9 hz , h - 4 ) , 4.17 ( dd , 1h , j2 ,1 = 3.7 hz , j2 ,3 = 10.9 hz , h - 2 ) , 4.03 ( dd , 1h , j3 ,2 = 3.6 hz , j3 ,4 = 9.5 hz , h - 3 ) , 4.023.98 ( m , 1h , h - 6a ) , 3.943.87 ( m , 2h , h - 6a , h - 6b ) , 3.793.75 ( m , 2h , h - 5 , h - 6b ) , 3.733.69 ( m , 1h , h - 5 ) , 3.49 ( dd , 1h , j2 ,1 = 1.8 hz , j2 ,3 = 3.5 hz , h - 2 ) , 3.48 ( s , 3h , ch3 , me ) , 2.682.60 ( m , 4h , 2 - ch2 ) , 2.522.45 ( m , 2h , - ch2 ) , 2.332.29 ( m , 6h , - ch2 , 2 - ch2 ) , 1.671.54 ( m , 12h , - ch2 , 2 - ch2 , 3 - ch2 ) , 1.351.23 ( m , 106h , 53ch2 ) , 0.89 ( t , 18h , j = 7.0 hz , 4 - ch3 , 2 - ch3 ) ; p nmr ( 243 mhz , cdcl3meod , 3:1 ) 0.38 , 0.01 ; ms ( maldi ) m / z calcd for c93h175no25p h 1767.186 [ m - h ] , found 1767.058 . for maldi - tof ms ,1 l of a solution of 1 ( 0.5 mg / ml in ch2cl2etoh , 1:1 ) was mixed with 6 - aza -2-thiothymine matrix ( 3 mg / ml etoh20 mm aq . compound 2 ( 12 mg , 5.3 mol ) was prepared from 62 in a manner similar to the synthesis of 1 , which afforded 2 ( 8.0 mg , 4.6 mol , 87 % ) as a white fluffy solid : rf = 0.38 ( chcl3meoh h2o , 50:28:6 ) ; h nmr ( 600 mhz , cdcl3meod , 3:1 ) 5.29 ( d , 1h , j1 ,2 = 3.6 hz , h - 1 ) , 5.275.21 ( m , 4h , h - 1 , h - 3 , 2 - ch ) , 5.145.09 ( m , 1h , - ch ) , 5.00 ( t , 1h , j4 ,5 = j3 ,4 = 9.7 hz , h - 4 ) , 4.31 ( dt , 1h , j4 ,5 = j4 ,3 = j4 , p = 9.7 hz , h - 4 ) , 4.194.13 ( m , 1h , h - 2 ) , 4.03 ( dd , 1h , j3 ,2 = 3.5 hz , j3 ,4 = 9.5 hz , h - 3 ) , 4.013.98 ( m , 1h , h - 6a ) ,3.943.88 ( m , 2h , h - 6a , h - 6b ) , 3.793.74 ( m , 2h , h - 5 , h - 6b ) , 3.733.69 ( m , 1h , h - 5 ) , 3.49 ( dd , 1h , j2 ,1 = 1.8 hz , j2 ,3 = 3.4 hz , h - 2 ) , 3.48 ( s , 3h , ch3 , me ) , 2.702.60 ( m , 4h , 2 - ch2 ) , 2.522.45 ( m , 2h , - ch2 ) , 2.332.29 ( m , 6h , - ch2 , - ch2 , - ch2 ) , 1.651.55 ( m , 12h , 3 - ch2 , - ch2 , - ch2 , - ch2 ) , 1.371.22 ( m , 102h , 51ch2 ) , 0.89 ( t , 18h , j = 7.0 hz , 4 - ch3 , - ch3 , - ch3 ) ; p nmr ( 243 mhz , cdcl3meod , 3:1 ) 0.42 , 0.01 ; ms ( maldi ) m / z calcd for c91h171no25p 2 h 1739.154 [ m - h ] , found 1739.160 . compound 3 ( 5.6 mg , 2.7 mol ) was prepared from 57 in a manner similar to the synthesis of 1 , which afforded 3 ( 3.7 mg , 2.2 mol , 81 % ) as a white fluffy solid : rf = 0.47 ( chcl3meoh h2o , 50:28:6 ) ; h nmr ( 600 mhz , cdcl3meod , 3:1 ) 7.16 ( d , 1h , jnh ,2 = 8.3 hz , nh ) , 5.265.17 ( m , 5h , h - 1 , h - 1 , h - 3 , 2 - ch ) , 5.125.08 ( m , 1h , - ch ) , 5.04 ( t , 1h , j4 ,3 = j4 ,5 = 9.8 hz , h - 4 ) , 4.30 ( dt , 1h , j4 ,5 = j4 ,3 = j4 , p = 9.9 hz , h - 4 ) , 4.244.19 ( m , 1h , h - 2 ) , 4.04 ( dd , 1h , j3 ,2 = 3.5 hz , j3 ,4 = 9.6 hz , h - 3 ) , 3.94 ( dd , 1h , j = 2.9 hz , j = 13.0 hz , h - 6a ) , 3.753.71 ( m , 1h , h - 6b ) , 3.713.67 ( m , 1h , h - 5 ) , 3.663.62 ( m , 1h , h - 5 ) , 3.573.54 ( m , 2h , h - 6a , h - 6b ) , 3.513.48 ( m , 1h , h - 2 ) , 3.49 ( s , 3h , ch3 , me ) , 2.692.58 ( m , 4h , 2 - ch2 ) , 2.49 ( dd , 1h , j = 6.9 hz , j = 14.9 hz , - ch2 ) , 2.43 ( dd , 1h , j = 5.9 hz , j = 14.9 hz , - ch2 ) , 2.322.28 ( m , 6h , - ch2 , 2 - ch2 ) , 1.671.54 ( m , 12h , - ch2 , 2 - ch2 , 3 - ch2 ) , 1.381.22 ( m , 106h , 53ch2 ) , 0.89 ( t , 18 , j = 7.0 hz , 4 - ch3 , 2 - ch3 ) ; p nmr ( 243 mhz , cdcl3meod , 3:1 ) 0.68 ; ms ( esi ) m / z calcd for c93h174no22p h 1687.219 [ m - h ] , found 1687.205 . a secreted nf - b - dependent reporter ( hekblue htlr4 ) , e. coli o111 : b4 lps , e. coli serotype r515 re - lps , s. minnesota r595 mpla ( sm - mpla ) , and synthetic e. coli mpla were purchased from invivogen . lipid a mimetics 13 were reconstituted in dmso to provide 1 mg / ml stock solutions . further dilutions were made with cell medium ( rpmi or dmem ) supplemented with 10 % fcs so that the final amount of dmso in the cell culture did not exceed 0.01 % . the cells were stimulated with the solutions of compounds 13 or lps / re - lps in dmem supplemented by 10 % fcs at the indicated concentrations . the final amount of dmso in the cell culture did not exceed 0.005 % for 1 and 2 or 0.01 % for 3 . the compounds were added in a total volume of 20 l to 25000 hek - blue htlr4 cells in 180 l plates and were incubated for 2024 h at 37 c and 5 % co2 . seap levels were determined by incubation of 20 l of challenged cell supernatants with 180 l of detection reagent ( quanti - blue ) , and the color development was measured at 650 nm using a spectrophotometer ( spectramax 190 ) . data were combined from n = 3 independent experiments ; error bars indicate standard error of the mean . thp - 1cells were grown in rpmi - 1640 cell - culture medium ( life technologies ) that was supplemented with 2 mm l - glutamine , 100 u / ml penicillin , 100 g / ml streptomycin , and 10 % fcs . cells were seeded in a 96 - well plate at 10 cells / well in 150 l of complete medium and stimulated by 200 nm tpa for 24 h to induce the differentiation into macrophage - like cells . on the next day the cells were washed twice with complete culture medium to discard the cells that did not adhere , refreshed with 200 l of complete medium , and left for 1 h to recover . cells were stimulated with , - gm - lams 13 at the indicated concentration and with e. colire - lps ( or e. coli o111 : b4 lps ) , which were added as solutions in 10 l of complete medium . the cells were incubated for 18 h , and the supernatants were analyzed for tnf - , il - 8 , and mcp - 1 by elisa ( bd biosciences ) . bone - marrow - derived microphages ( bmdms ) were isolated and differentiated from the bone marrow of c57bl / 6j mice . the erythrocytes were lysed with 0.88 % ammonium chloride , 15 min at 37 c . a single - cell suspension of the bone marrow cells was then seeded in cell culture flasks at a concentration of 110 cells / ml in rpmi supplemented with 20 % fbs and 40 ng / ml recombinant m - csf . the cell culture medium was changed on day 3 . on day 6 , the differentiated cells were trypsinized , counted , and seeded in 24 - well plates at a concentration of 110 cells / ml in rpmi supplemented with 10 % fbs . after 24 h , the cells were stimulated with lipid a mimetics 13 and with synthetic e. coli lipid a / mpla ( e. coli o111 : b4 lps was used as positive control ) for 16 h. the nanomolar concentrations of 13 were calculated according to the mw of the synthetic compounds . the supernatants were then tested for cytokines using ready - set - go elisa kits ( ebioscience ) . human peripheral blood monocytes were cultured for 6 days in gm - csf and il - 4 to receive immature monocyte - derived dcs and were then stimulated with the indicated concentrations of 1 and 3 using 10 ng / ml lps as positive control ( solutions in prmi containing 10 % fcs and 0.0050.01 % dmso ) . the amounts of il - 6 , il - 12 , il - 10 , and tnf - in the supernatants of the cells were analyzed after 24 h by luminex . results are representative of three independent experiments for 1 and of two experiments for 3 .\noutput:\n" }, { "from": "agent", "value": "the endotoxic portion of lipopolysaccharide ( lps ) , a glycophospholipid lipid a , initiates the activation of the toll - like receptor 4 ( tlr4 ) myeloid differentiation factor 2 ( md - 2 ) complex , which results in pro - inflammatory immune signaling . to unveil the structural requirements for tlr4md -2-specific ligands , we have developed conformationally restricted lipid a mimetics wherein the flexible glcn ( 16 ) glcn backbone of lipid a is exchanged for a rigid trehalose - like glcn ( 11 ) man scaffold resembling the molecular shape of tlr4md -2-bound e. coli lipid a disclosed in the x - ray structure . a convergent synthetic route toward orthogonally protected glcn ( 11 ) man disaccharide has been elaborated . the , - ( 11 ) linkage was attained by the glycosylation of 2 - n - carbamate - protected - glcn - lactol with n - phenyl - trifluoroacetimidate of 2 - o - methylated mannose . regioselective acylation with ( r ) -3-acyloxyacyl fatty acids and successive phosphorylation followed by global deprotection afforded bis - and monophosphorylated hexaacylated lipid a mimetics . glcn ( 11 ) man - based lipid a mimetics ( , - gm - lam ) induced potent activation of nf - b signaling in htlr4 / hmd - 2 / cd14 - transfected hek293 cells and robust lps - like cytokines expression in macrophages and dendritic cells . thus , restricting the conformational flexibility of lipid a by fixing the molecular shape of its carbohydrate backbone in the agonistic conformation attained by a rigid glcn ( 11 ) man scaffold represents an efficient approach toward powerful and adjustable tlr4 activation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: initially , palliative chemotherapy in lung cancer was decided on the basis of histology . whether it was nonsmall - cell lung cancer ( nsclc ) or small - cell lung cancer was sufficient to decide treatment . however , currently , not merely histological subclassifications ( squamous cell carcinoma or adenocarcinoma ) but also the mutation analysis determines the treatment . the discovery of driver mutations and development of small molecules targeting them has changed the way we treat nsclc today . lung cancer treatment guidelines now recommend that at least epidermal growth factor receptor ( egfr ) tyrosine kinase domain mutation analysis and alk rearrangement must be done before starting treatment . treatment recommendations are based on the results of these analysis . at our center , we follow these international guidelines . however , frequently we encounter a situation where either the patient or the treating physician is unwilling to wait for the mutation analysis report . in an attempt to understand the reasons why either the patient or the physicians are unwilling to wait for the report we did an audit of all consecutive nsclc patients who came to medical oncology lung cancer outpatient department . the objective of this audit was to determine the proportion of patients refusing to wait for the report and the reasons for the same . all patients with lung referred for palliative chemotherapy are counseled about their diagnosis , stage , prognosis and treatment options . then they are asked to wait till the availability of mutation analysis report ( if applicable ) and treatment is then started according to institutional local guidelines . in this database from november 2014 , we routinely started entering the patients and physicians willingness for waiting for treatment , till the availability of mutation report . in addition , we would also enter the reason for not waiting for the report . the reasons for not waiting were coded as below : patients reason for not waiting : logistics : patient does not have social support to stay in mumbaisymptomatic : patient feels his / her symptoms are not adequately controlled by symptomatic medications and hence wants immediate chemotherapypoor general condition : patient feels his / her general condition is poor , it may deteriorate further if he / she waitsnot willing for rebiopsy : initially , biopsy has inadequate tissue but the patient is not willing for rebiopsy hence does not want to wait . physicians reason for not waiting : eastern cooperative oncology group performance status ( ecog ps ) 2 - 4 : physician feels that patients ps is poor , it may deteriorate further if he / she waitssymptomatic : physician feels that patients symptoms are not adequately controlled by symptomatic medications and hence recommends immediate chemotherapyemergency : patient has superior vena cava obstruction ( svco ) or spinal cord compression or other oncologic emergency that warrants immediate treatmentothers : patient has already been started on chemotherapy outside our hospital . patients reason for not waiting : logistics : patient does not have social support to stay in mumbaisymptomatic : patient feels his / her symptoms are not adequately controlled by symptomatic medications and hence wants immediate chemotherapypoor general condition : patient feels his / her general condition is poor , it may deteriorate further if he / she waitsnot willing for rebiopsy : initially , biopsy has inadequate tissue but the patient is not willing for rebiopsy hence does not want to wait . logistics : patient does not have social support to stay in mumbai symptomatic : patient feels his / her symptoms are not adequately controlled by symptomatic medications and hence wants immediate chemotherapy poor general condition : patient feels his / her general condition is poor , it may deteriorate further if he / she waits not willing for rebiopsy : initially , biopsy has inadequate tissue but the patient is not willing for rebiopsy hence does not want to wait . physicians reason for not waiting : eastern cooperative oncology group performance status ( ecog ps ) 2 - 4 : physician feels that patients ps is poor , it may deteriorate further if he / she waitssymptomatic : physician feels that patients symptoms are not adequately controlled by symptomatic medications and hence recommends immediate chemotherapyemergency : patient has superior vena cava obstruction ( svco ) or spinal cord compression or other oncologic emergency that warrants immediate treatmentothers : patient has already been started on chemotherapy outside our hospital . eastern cooperative oncology group performance status ( ecog ps ) 2 - 4 : physician feels that patients ps is poor , it may deteriorate further if he / she waits symptomatic : physician feels that patients symptoms are not adequately controlled by symptomatic medications and hence recommends immediate chemotherapy emergency : patient has superior vena cava obstruction ( svco ) or spinal cord compression or other oncologic emergency that warrants immediate treatment others : patient has already been started on chemotherapy outside our hospital . all nsclc cancer patients seen in lung cancer medical oncology outpatient department between november 2014 and january 2015 were selected for this analysis subjected to following criteria . in addition , data regarding ecog ps , stage , pathology , patient 's decision regarding willingness to wait for mutation report and the reason for it and physicians willingness to wait for mutation report and the reason for it were extracted . electronic medical records andr studio version 3.1.2 ( r : a language and environment for statistical computing , r core team , vienna , austria ) was used for analysis . the relationship between patients willingness to wait and factors was explored by fisher 's exact test for count data . the factors considered were ecog ps ( 0 - 2 vs. 3 - 4 ) , the presence of cough ( yes , no ) , the presence of hemoptysis ( yes , no ) , the presence of fatigue ( yes , no ) , and the presence of breathlessness ( yes , no ) . similarly was the relationship between physicians willingness to wait and factors was explored . binary logistic regression analysis was performed for multivariate analysis to identify independent factors influencing patients and physicians decision . the agreement analysis between patients decision and physician decisionit was kept in mind that the doctor 's decision to some extent may be influenced by patient 's decision and vice versa . as we were not sure about the assumption of decision independence between doctors and patients , we avoided the application of agreement analysis in this situation . hence , the percentage correct value was estimated from the contingency table in this study . all patients with lung referred for palliative chemotherapy are counseled about their diagnosis , stage , prognosis and treatment options . then they are asked to wait till the availability of mutation analysis report ( if applicable ) and treatment is then started according to institutional local guidelines . in this database from november 2014 , we routinely started entering the patients and physicians willingness for waiting for treatment , till the availability of mutation report . in addition , we would also enter the reason for not waiting for the report . the reasons for not waiting were coded as below : patients reason for not waiting : logistics : patient does not have social support to stay in mumbaisymptomatic : patient feels his / her symptoms are not adequately controlled by symptomatic medications and hence wants immediate chemotherapypoor general condition : patient feels his / her general condition is poor , it may deteriorate further if he / she waitsnot willing for rebiopsy : initially , biopsy has inadequate tissue but the patient is not willing for rebiopsy hence does not want to wait . physicians reason for not waiting : eastern cooperative oncology group performance status ( ecog ps ) 2 - 4 : physician feels that patients ps is poor , it may deteriorate further if he / she waitssymptomatic : physician feels that patients symptoms are not adequately controlled by symptomatic medications and hence recommends immediate chemotherapyemergency : patient has superior vena cava obstruction ( svco ) or spinal cord compression or other oncologic emergency that warrants immediate treatmentothers : patient has already been started on chemotherapy outside our hospital . patients reason for not waiting : logistics : patient does not have social support to stay in mumbaisymptomatic : patient feels his / her symptoms are not adequately controlled by symptomatic medications and hence wants immediate chemotherapypoor general condition : patient feels his / her general condition is poor , it may deteriorate further if he / she waitsnot willing for rebiopsy : initially , biopsy has inadequate tissue but the patient is not willing for rebiopsy hence does not want to wait . logistics : patient does not have social support to stay in mumbai symptomatic : patient feels his / her symptoms are not adequately controlled by symptomatic medications and hence wants immediate chemotherapy poor general condition : patient feels his / her general condition is poor , it may deteriorate further if he / she waits not willing for rebiopsy : initially , biopsy has inadequate tissue but the patient is not willing for rebiopsy hence does not want to wait . physicians reason for not waiting : eastern cooperative oncology group performance status ( ecog ps ) 2 - 4 : physician feels that patients ps is poor , it may deteriorate further if he / she waitssymptomatic : physician feels that patients symptoms are not adequately controlled by symptomatic medications and hence recommends immediate chemotherapyemergency : patient has superior vena cava obstruction ( svco ) or spinal cord compression or other oncologic emergency that warrants immediate treatmentothers : patient has already been started on chemotherapy outside our hospital . eastern cooperative oncology group performance status ( ecog ps ) 2 - 4 : physician feels that patients ps is poor , it may deteriorate further if he / she waits symptomatic : physician feels that patients symptoms are not adequately controlled by symptomatic medications and hence recommends immediate chemotherapy emergency : patient has superior vena cava obstruction ( svco ) or spinal cord compression or other oncologic emergency that warrants immediate treatment others : patient has already been started on chemotherapy outside our hospital . all nsclc cancer patients seen in lung cancer medical oncology outpatient department between november 2014 and january 2015 were selected for this analysis subjected to following criteria . in addition , data regarding ecog ps , stage , pathology , patient 's decision regarding willingness to wait for mutation report and the reason for it and physicians willingness to wait for mutation report and the reason for it were extracted . electronic medical records andr studio version 3.1.2 ( r : a language and environment for statistical computing , r core team , vienna , austria ) was used for analysis . the relationship between patients willingness to wait and factors was explored by fisher 's exact test for count data . the factors considered were ecog ps ( 0 - 2 vs. 3 - 4 ) , the presence of cough ( yes , no ) , the presence of hemoptysis ( yes , no ) , the presence of fatigue ( yes , no ) , and the presence of breathlessness ( yes , no ) . similarly was the relationship between physicians willingness to wait and factors was explored . binary logistic regression analysis was performed for multivariate analysis to identify independent factors influencing patients and physicians decision . the agreement analysis between patients decision and physician decisionit was kept in mind that the doctor 's decision to some extent may be influenced by patient 's decision and vice versa . as we were not sure about the assumption of decision independence between doctors and patients , we avoided the application of agreement analysis in this situation . hence , the percentage correct value was estimated from the contingency table in this study . one hundred and fifty - six ( 92.8 % ) patient had stage iv disease whereas 11 patients ( 7.2 % ) had stage iii disease ( not a candidate for radical treatment ) . the ecog ps was 0 , 1 , 2 , 3 , and 4 in 3 patients ( 1.8 % ) , 85 patients ( 50.6 % ) , 42 patients ( 25.0 % ) , 36 patients ( 21.4 % ) , and 2 patients ( 1.2 % ) , respectively . cough , hemoptysis , pain , breathlessness and fatigue were reported by 124 patients ( 73.8 % ) , 22 patients ( 13.9 % ) , 91 patients ( 54.2 % ) , 106 patients ( 63.1 % ) , and 88 patients ( 52.4 % ) , respectively . out of 168 patients , 111 patients ( 66.1 % ) the reasons provided by patients for not waiting were symptomatic status in 23 patients ( 40.1 % ) , a poor general condition in 19 patients ( 33.3 % ) , the logistic issue in 14 ( 24.6 % ) and others in 01 ( 2.0 % ) . different factors affecting patients decision making out of 168 patients , in 112 patients ( 66.6 % ) physicians were willing to wait for biopsy report while in 56 patients ( 33.4 % ) they were not . the reasons for not waiting were symptomatic status in 28 patients ( 50.0 % ) , poor ps in 22 patients ( 39.4 % ) , emergency in 03 patients ( svco - 2 , spinal cord compression - 1 ) , and others in 3 patients ( 05.3 % ) . the reasons provided in others were old age in 2 patients and in 1 patient the chemotherapy had already been started . factors affecting physicians decision are shown in table 2 . though ecog ps ( p = 0.00 ) , breathlessness ( p = 0.00 ) and fatigue ( p = 0.00 ) were associated with physicians decision of not waiting for the report on univariate analysis only poor ps ( 0.00 ) was an independent factor influencing the decision identified on multivariate analysis . different factors affecting physicians decision making the 22 table of the decision of patients and physician is shown in table 3 . one hundred and fifty - six ( 92.8 % ) patient had stage iv disease whereas 11 patients ( 7.2 % ) had stage iii disease ( not a candidate for radical treatment ) . the ecog ps was 0 , 1 , 2 , 3 , and 4 in 3 patients ( 1.8 % ) , 85 patients ( 50.6 % ) , 42 patients ( 25.0 % ) , 36 patients ( 21.4 % ) , and 2 patients ( 1.2 % ) , respectively . cough , hemoptysis , pain , breathlessness and fatigue were reported by 124 patients ( 73.8 % ) , 22 patients ( 13.9 % ) , 91 patients ( 54.2 % ) , 106 patients ( 63.1 % ) , and 88 patients ( 52.4 % ) , respectively . out of 168 patients , 111 patients ( 66.1 % ) were willing to wait for biopsy report while 57 ( 33.9 % ) were not . the reasons provided by patients for not waiting were symptomatic status in 23 patients ( 40.1 % ) , a poor general condition in 19 patients ( 33.3 % ) , the logistic issue in 14 ( 24.6 % ) and others in 01 ( 2.0 % ) . out of 168 patients , in 112 patients ( 66.6 % ) physicians were willing to wait for biopsy report while in 56 patients ( 33.4 % ) they were not . the reasons for not waiting were symptomatic status in 28 patients ( 50.0 % ) , poor ps in 22 patients ( 39.4 % ) , emergency in 03 patients ( svco - 2 , spinal cord compression - 1 ) , and others in 3 patients ( 05.3 % ) . the reasons provided in others were old age in 2 patients and in 1 patient the chemotherapy had already been started . factors affecting physicians decision are shown in table 2 . though ecog ps ( p = 0.00 ) , breathlessness ( p = 0.00 ) and fatigue ( p = 0.00 ) were associated with physicians decision of not waiting for the report on univariate analysis only poor ps ( 0.00 ) was an independent factor influencing the decision identified on multivariate analysis . the 22 table of the decision of patients and physician is shown in table 3 . a major challenge faced by physicians is to convince patients to perform investigations which make it possible to plan personalized treatment and in addition to patiently wait for such a report is available . literature from the western world clearly shows that patients are willing to do this . a study from north america by cuffe et al . highlighted that 99 % of patients in adjuvant setting and 97.4 % in palliative setting respectively , are willing to undergo pharmacogenomic testing that would identify the cohort of patients who would benefit from therapy . though the majority of patients wanted to be a part of the decision - making process , 20 % of patients lack the basic knowledge to do so . a similar attitude toward pharmacogenetic testinghowever , in our study , surprisingly one - third of patients even after being counseled regarding the benefit of egfr mutation testing were not willing to wait for the report . egfr and alk testing is a part of routine protocol and hence , we recommend tissue biopsy in all nsclc patients . hence , the sample for mutation testing is acquired at the time of diagnostic confirmation itself . the report at our center is provided within 2 weeks which is at par with the international standards . inspite of this , we face opposition from many patients to wait for the report and hence we wanted to identify the factors responsible . even the large studies done in western countries have identified a small proportion of patients who are resistant to such testing but they fail to identify the reason behind this resistance . our analysis determines that poor symptom control ( 40.1 % ) was the major reason for patient resistance to wait . the reason behind this may be that a dedicated palliative care clinic for lung cancer is not available for these patients . if the reason were uncontrolled comorbidity or disease related immediately correctable ( pleural effusion ) cause then may be a repeat interview after corrective treatment may help the patient to change their decision . however , in case of poor ps because of other causes , waiting for report is unjustifiable . this is reflected in the fact that poor ps patients and those with breathlessness were recommended the immediate start of therapy without awaiting the molecular report . the third common reason given by patients was logistics which was mainly because of lack of social support for staying in the city . this is a problem peculiar to our tertiary care referral center that draws patients from all parts of the country . we have planned corrective steps toward improving patients compliance with the recommendation to wait for egfr report . we are conducting group discussion meetings between patients , relatives , doctors and social workers so that in a more elaborate way , with the aid of audio - visual presentations the importance of mutation testing can be stressed . we thought that this step is necessary , as the western population is nearly 100 % literate but nearly 20 % of indian population is illiterate and hence the basic knowledge of decisions need to be explained in more simplified manner with visual aids . further efforts will be made for getting a dedicated palliative care expert for better management of symptoms preferably located near the medical oncology lung clinic . facility would be provided for patients to access their reports online itself with a telephonic alert so that these patients staying far away can revisit our center or a center nearby for starting appropriate treatment . finally , we are planning to expedite our lab efforts so that reports can be available within 1 week and develop liquid biopsy based molecular tests . we plan to repeat our analysis after 1 year of implementation of these measures to quantify the effect of our measures . at present , in our setup , nearly one - third of our nsclc patients opt for immediate chemotherapy treatment and are unwilling to wait for mutation analysis report .\noutput:\n" }, { "from": "agent", "value": "background : palliative chemotherapy + / targeted therapy in accordance with mutation profile is the norm in nonsmall - cell lung cancer ( nsclc ) . the objective of this audit was to determine the proportion of patients and physicians , who are unwilling to wait for the mutation report and the reasons thereof.materials and methods : all newly diagnosed nsclc patients , post biopsy , seen at our center between november 2014 and january 2015 were included . the relationship between patient and physician decision and objective factors was explored by fisher 's exact test . the factors considered were eastern cooperative oncology group performance status ( ecog ps ) , the presence of a cough , hemoptysis , fatigue , and breathlessness . the agreement between patients and physician decision was tested by contingency table.results : out of 168 patients , 57 were unwilling to wait for driver mutation report ( 33.9 % 95 % confidence interval [ ci ] 27.2 - 41.4 % ) . the most common reason provided by patients was symptomatic status ( 23 , 40.1 % ) . no other objective factor except ps ( p = 0.00 ) was associated with patient 's decision . in 56 patients ( 33.4 % 95 % ci 26.6 - 40.7 % ) , physicians were unwilling to wait . among the tested factors ecog ps ( p = 0.000 ) , breathlessness ( p = 0.00 ) and fatigue ( p = 0.00 ) were associated with the decision of not waiting for the report . the percentage corrected value of contingency between patients and physician decision was 78.74 % . conclusion : at present , in our setup , nearly one - third of our nsclc patients opt for immediate chemotherapy treatment and are unwilling to wait for mutation analysis report . the major reasons for such attitude is poor symptom control and deteriorating general condition ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tetralogy of fallot is the most common form of cyanotic congenital heart disease accounting for about 10 % of all cases of congenital heart diseases .1 it consists of interventricular septal defect , right ventricular outflow tract obstruction , an overriding aorta and right ventricular hypertrophy . without corrective surgery , few patients with tetralogy of fallot reach adulthood with an average life expectancy of 12 years .2 we present the case of a 25 - year old man with an uncorrected tetralogy of fallot . a 25 year - old man presented to our cardiology clinic with recurrent easy fatiguability , breathlessness on moderate exertion ( which is usually relieved by squatting ) and palpitations from childhood . there was no history of paroxysmal nocturnal dyspnoea ; neither was there pedal , facial or abdominal swellings . the patient is not a known hypertensive , diabetic or asthmatic . on examination , he was plethoric , had both central and peripheral cyanosis and grade 3 finger clubbing . there was no peripheral oedema . cardiovascular system examination revealed a pulse of 88 beats per minute , moderate volume and regular . the blood pressure was 100/80 mmhg , apex beat was localised in the 5th left intercostal space within the mid clavicular line and there was left parasternal heave . on auscultation , there was first and second heart sounds , loud pulmonary component of second heart sound , and grade 4/6 pansystolic murmur which was loudest at the left lower sternal edge . chest radiography showed an enlarged cardiac silhouette with left ventricular preponderance , left - sided aortic arch and dilated pulmonary arteries . electrocardiography showed sinus rhythm , right atrial enlargement , biventricular hypertrophy with secondary st - t wave abnormalities . echocardiography showed a membranous ventricular septal defect measuring 20.9 mm with a right to left shunting of 1.12 m / second , minimal aortic override ( with aortic diameter of 34.5 mm ) , hypertrophied septal wall measuring 14 mm in diastole , small volume left ventricular cavity with left ventricular ejection fraction in the lower limits of normal ( 55 % ) . there was also right ventricular hypertrophy with the right ventricular free wall of 11.2 mm , dilated right atrium with right atrial area of 26.14 cm , bicuspid pulmonary valve with a small pulmonary artery of 14.6 mm , subpulmonary stenosis with right ventricular outflow tract gradient of 1.15 mmhg . the patient remained clinically stable for four years after his initial presentation , but died suddenly at the age of 29 years in a private facility close to his neighbourhood from hypoxic spells . although uncorrected tetralogy of fallot has been reported in patients as old as 52 years to 86 years ,38 this is the oldest patient to the best of our knowledge with uncorrected tetralogy of fallot being reported in our environment . without corrective surgery 10 % of patientssurvive to their thirties while only 3 % reach their forties or older .2 three main factors have been identified for the longetivity in natural survivors with unoperated tetralogy of fallot . first is the small pulmonary artery with presumed slow development of subpulmonary obstruction .9 another factor identified is that of left ventricular hypertrophy10 as seen in our patient who had a inter - ventricular wall thickness of 14 mm in diastole . it is said that left ventricular hypertrophy acts by delaying the shunting of blood from the right to left ventricle .11 the third factor is extracardiac shunting including patent ductus arteriosus or systemic to pulmonary shunting through internal mammaries .12 in our patient there was no demonstrable patent ductus arteriosus but there were dilated pulmonary arteries on the chest radiograph which is highly suggestive of a right to left shunt . our patient died from hypoxic spells which has been documented as the most common cause of death in uncorrected tetralogy of fallot .13 we propose that the longetivity in this patient is partly due to left ventricular hypertrophy and possibly systemic to pulmonary shunting via internal mammary arteries .\noutput:\n" }, { "from": "agent", "value": "tetralogy of fallot is the most common form of cyanotic congenital heart disease . survival after the age of 12 years without corrective surgery is rare . we present the case of a 25 year - old man with uncorrected tetralogy of fallot . possible reasons for the longetivity in this patient are left ventricular hypertrophy and systemic to pulmonary shunting through internal mammary arteries ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: nonalcoholic fatty liver disease ( nafld ) represents a wide spectrum of hepatic disorders in clinical practice , the prevalence in the general population is 10 % ~ 30 % , and the number increases greatly whether in developing or developed countries . it has been convincingly associated with insulin resistance and metabolic syndrome ( ms ) ; most patients are overweight or frankly obese , with altered glucose metabolism , dyslipidemia , and raised blood pressure , all contributing to the disorders . people with nafld harbor the same cardiovascular risk factors ( hypertension , dyslipidaemia , obesity , physical inactivity , insulin resistance , endothelial dysfunction , and inflammation ) that place them at high risk of cardiovascular events . recently , some studies showed that subjects with nafld have an elevated risk of increased carotid intima media thickness , reduced endothelial function , increased coronary artery calcification , and increased arterial stiffness . however , other studies indicated that nafld was not associated with ms and cardiovascular disease . despite these results , it remained controversial whether nafld was a marker or an independent mediator that promotes cardiovascular disease , and the effect of nafld on the risk of future cardiovascular events has not been well established . hence , we performed a systematic review and meta - analysis with the most updated prospective data to evaluate the association of nafld with the risk of incident cardiovascular outcomes in patients . the search strategy was in accordance with the recommendations of the meta - analysis of observational studies in epidemiology ( moose ) group . we searched embase ( 1947 to october 16 , 2012 ) , medline ( 1947 to october 16 , 2012 ) , the cochrane library ( 1947 to october 16 , 2012 ) , science citation index ( web of knowledge ) ( 1947 to october 16 , 2012 ) , and pubmed ( 1947 to october 16 , 2012 ) , using the search terms nonalcoholic fatty liver disease ornafld or fatty liver and cardiovascular disease or myocardial ischemia or mi or myocardial infarct or ischemic heart disease or coronary heart disease or coronary artery disease or angina or stroke or cerebrovascular disease or cerebrovascular attack or cerebral ischemia or brain ischemia or intracranial hemorrhage . an article was considered relevant if it reported quantitative estimates of the unadjusted and ( or ) multivariable adjusted ( i.e. , age , sex , smoking history , diabetes duration , hba1c , ldl cholesterol , ggt ( gamma - glutamyl transpeptidase ) levels , and use of medications ( i.e. , hypoglycemic , antihypertensive , lipid - lowering , or antiplatelet drugs ) , or additional adjustment for the presence of metabolic syndrome and / or nafld ) odds ratio with corresponding 95 % confidence interval ( ci ) for the log relative risk for cardiovascular events . nafld patients were evaluated at least by abdominal ultrasound or computed tomography ( ct ) . cardiovascular events include coronary heart disease ( such as myocardial infarction , angina pectoris , and ischemic stroke ) , cerebrovascular disease ( such as cerebral hemorrhage ) , and peripheral vascular disease . the criteria of national cholesterol education program adult treatment panel iii ( ncep atp iii ) are used to characterize the metabolic syndrome ( ms ) . unpublished papers , nonhuman studies , letters / case reports , studies enrolling 10 subjects or subjects aged 12 years , editorials , reviews , no cardiovascular endpoints , no multivariate adjusted cardiovascular events estimate , or using inadequate case definition were excluded . the data extraction was performed independently by two authors and included first author , date of publication , location of research group , number of analyses , characteristics of participants , study design , outcome measures , and selection criteria . we extracted the unadjusted and ( or ) multivariable adjusted odds ratio for cardiovascular events and corresponding 95 % ci in the statistical analysis . the quality of the selected studies was assessed independently by two authors using the newcastle - ottawa scale ( nos ) for cohort and cross - sectional studies . star rating system to judge quality based on three aspects of the study : selection of study groups , comparability of study groups , and ascertainment of either the exposure or outcome of interest . any discrepancies were addressed by a joint reevaluation of the original article with another author . the results of each study were reported as an odds ratio . to measure the outcome , the dersimonian - laird method and random - effects model ( rem ) results were expressed as pooled odds ratios ( or ( 95 % confidence intervals , cis ) ) . we assessed whether a significant level of difference existed using mantel - haenszel chi - square tests . if the chi square test was significant below p = 0.05 , we quantified the amount of heterogeneity using i statistics . meta - analyses were performed for unadjusted and multivariate adjusted cardiovascular events estimate with nafld and ms , separately . we used the stata10 software package for the meta - analysis of observational studies . in the forest plots , or valuesseven hundred and forty articles were excluded by review of abstract because they did not address people with nafld , or they did not assess the association between nafld and cardiovascular disease . by reviewing full articles , 56 articles were rejected because they ( 1 ) have no multivariate adjusted cardiovascular events estimate , ( 2 ) fatal endpoints only , ( 3 ) had no original data ( review , editorials ) , or ( 4 ) were duplicate publications . finally , six studies ( figure 1 ) were included in our analysis . the main characteristics of the studies included in this analysis are provided in table 1 . among them , one study originated from korea , one from israel , three from italy ( they were conducted by the same research group among diabetics , but three studies did not include the same participants ) , and one from japan , a total of 7,042 participants . according to the nos score , the six studies were of high quality . these six studies all reported adjusted odds ratio with corresponding 95 % ci , which allowed us to pool their data into a further analysis . figure 2 shows a univariate meta - analysis unadjusted odds ratio for cardiovascular disease with nafld . we did not find significant evidence of heterogeneity across studies ( p for heterogeneity 0.05 ) . the fixed effects summary estimate shows an increased risk of cardiovascular disease ( odds ratio 1.88 , 95 % confidence interval 1.68 to 2.10 ; p 0.001 ) and no major asymmetrical appearance in the funnel plot . thus , we did a multivariable adjusted odds ratio meta - analysis based on the primary outcome reported in all studies for cardiovascular disease with nafld . the analyses were based on the random - effect model and are presented in figure 3 . = 5 ) , p = 0.04 , i - squared = 56.9 % , and 2 = 0.0373 . the random effects summary estimate shows an increased risk of cardiovascular disease after adjustment for established cardiovascular risk factors ( age , sex , diabetes duration , hba1c , smoking history , ldl cholesterol , ggt levels and use of medications ( i.e. , hypoglycemic , antihypertensive , lipid - lowering or antiplatelet drugs ) and ncep atp iii - defined ms ) ( odds ratio 1.50 , 95 % ci 1.21 to 1.87 ; p 0.001 ) . we found evidence of heterogeneity across studies ( p for heterogeneity 0.05 ) but no major asymmetrical appearance in the funnel plot . we also did meta - analysis stratifying by study type for cross - sectional and prospective studies based on the primary outcome reported in five studies . the heterogeneity between cross - sectional studies chi - square = 1.82 , df = 2 , p = 0.403 , and i - squared = 0.0 % . we did not find significant evidence of heterogeneity across cross - sectional studies ( p for heterogeneity 0.05 ) . the subgroup summary estimate shows increased risk of cardiovascular disease ( odds ratio 1.82 , 95 % ci 1.60 to 2.07 ; p 0.001 ) and no major asymmetrical appearance in the funnel plot . the heterogeneity between the prospective studies chi - square = 5.97 , df = 1 , p = 0.015 , and i - squared = 83.3 % . the subgroup summary estimate shows increased risk of cardiovascular disease ( odds ratio 2.05 , 95 % ci 1.65 to 2.55 ; p 0.001 ) and no major asymmetrical appearance in the funnel plot . we also did meta - analysis based on half of the studies only included diabetic patients . the heterogeneity chi - square = 4.98 , df = 2 , p = 0.083 , and i - squared = 59.8 % . we did not find significant evidence of heterogeneity across studies ( p 0.05 ) . the estimate shows an increased risk of cardiovascular disease ( odds ratio 1.34 , 95 % ci 1.17 to 1.54 ; p 0.001 ) and no major asymmetrical appearance in the funnel plot . nafld is a hepatic manifestation of the metabolic syndrome , it is closely related to other clinical features of the metabolic syndrome , and thus cardiovascular disease is increased in nafld and represents the main cause of death in these patients . however , given the shared features between nafld , the metabolic syndrome , and traditional cardiovascular risk factors , it remains uncertain whether nafld is an independent risk factor for increased cardiovascular event . several previous studies have demonstrated that patients with nafld have significantly higher rates of prevalent coronary , cerebrovascular , and peripheral vascular disease than their counterparts without nafld . however , the lack of diagnostic uniformity and difficulty in accurately quantifying the severity of nafld in the various published studies make interpretation of the results challenging and sometimes contradictory . there is an urgent need to ensure a more homogeneous evaluation of study outcomes . to provide a more objective basis for clinical recommendations , we conducted a meta - analysis , which recruited a total of 7,042 individuals from 2 prospective and 4 cross - sectional studies . to our knowledge , this is the first meta - analysis on this topic that provides a complete analysis of the potentially harmful role of nafld on cardiovascular disease . in our previous cross - sectional study which was conducted among 560 cases of in - patients type 2 diabetes mellitus patients from january 2002 to january 2009 in southern china , we found that nafld was associated with a higher prevalence of coronary heart disease in type 2 diabetes , and that plasma alt levels may act as a marker . in this meta - analysis , we confirmed previous data demonstrating the high prevalence of cardiovascular disease in nafld patients . more importantly , our findings extend the work of recent small studies showing that patients with nafld , as assessed by ultrasonography or computed tomography ( ct ) , had a significant association with cardiovascular mortality . in our analysis , we found that nafld was a predictor of cardiovascular events ( pooled univariate odds ratio 1.88 , 95 % ci 1.68 to 2.10 ; p 0.001 ) . even after adjustment for confounders ( age , sex , diabetes duration , hba1c , smoking history , ldl cholesterol , ggt levels and use of medications ( i.e. , hypoglycemic , antihypertensive , lipid - lowering or antiplatelet drugs ) , and ncep atp iii - defined ms ) , the association remained significant ( pooled multivariate odds ratio 1.50 , 95 % ci 1.21 to 1.87 ; p 0.001 ) . this analysis shows that nafld is an independent novel predictor for cardiovascular events , even when other components of the metabolic syndrome are taken into account . because of the link between the two disorders , and that the majority of patients diagnosed with nafld are asymptomatic , more careful surveillance of these patients will be needed . patients should be educated as it is our experience that they become singularly focused on liver enzymes and ignore more important cardiovascular health . all nafld patients should be evaluated for their metabolic , cardiovascular , and liver - related risk . firstly , similar to other reports , the diagnosis of nafld obtained in our study was based on ultrasonography or computed tomography ( ct ) and the exclusion of known causes of chronic liver disease but was not confirmed by liver biopsy . although liver biopsy remains the gold standard for nafld diagnosis and evaluation , it is difficult to conduct in large populations , and ultrasonography remains the most common way of diagnosing nafld in clinical practice due to its good sensitivity and specificity in detecting moderate and severe steatosis . secondly , nafld ranges from simple steatosis ( ss ) to nonalcoholic steatohepatitis ( nash ) . one recent meta - analysis showed that compared to ss , nash has a higher liver - related ( or for nash : 5.71 , 2.3114.13 ; or for nash with advanced fibrosis : 10.06 , 4.3523.25 ) but not cardiovascular mortality ( or : 0.91 , 0.421.98 ) . in our study , we did not take the nafld histological subtypes into account . despite these limitations , first , this analysis was obtained by pooling data from a number of clinical trials ; the heterogeneity between studies was less evident , which significantly increased the statistical power of the analysis compared to a single study . second , the quality of studies included in the current meta - analysis was based on the nos . third , the included studies originated from different countries and included a variety of ethnic backgrounds , allowing for the generalization of our results . finally , because this meta - analysis was based on unadjusted and multivariate adjusted estimates , separately , the results of it are possibly the most precise estimate available of the strength of the relation between nafld and future risk of cardiovascular events . in conclusion , our results suggest that nafld is a strong independent predictor of cardiovascular disease and may play a central role in the cardiovascular risk of ms . when nafld is diagnosed , the person 's overall cardiovascular risk factor profile should be reviewed to ensure that risk factors are being appropriately modified .\noutput:\n" }, { "from": "agent", "value": "nonalcoholic fatty liver disease ( nafld ) is closely correlated with insulin resistance and several metabolic syndrome features , but whether it could increase the risk of cardiovascular disease remains undefined . to assess the association between nafld and the risk of cardiovascular outcomes , we systematically searched the medline , embase , and the cochrane library database ( 1947 to october 2012 ) by using medical subject heading search terms and a standardized protocol . randomized controlled trials , case - control , and prospective studies carried out in human adults , in which the unadjusted and multivariate adjusted odds ratios with corresponding 95 % confidence interval ( ci ) for cardiovascular disease with nafld were reported . the search yielded 4 cross - sectional studies and 2 prospective cohort studies including 7,042 participants . the pooled effects estimate showed that nafld was a predictor of cardiovascular disease ( odds ratio 1.88 , 95 % ci , 1.68 to 2.01 ; p < 0.001 ) . the random effects summary estimate indicated that nafld retained a significant association with cardiovascular outcomes independent of conventional risk factors after adjustment for established cardiovascular risk factors ( odds ratio 1.50 , 95 % ci , 1.21 to 1.87 ; p < 0.001 ) . these results indicate that nafld is a strong independent predictor of cardiovascular disease and may play a central role in the cardiovascular risk of metabolic syndrome ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: alzheimer 's disease ( ad ) is the most common form of dementia in the elderly . it is a progressive neurodegenerative disorder characterised by a decline in cognitive function and also profound alterations in mood and behaviour . the pathology of the disease is characterised by the presence of extracellular amyloid peptide deposits , soluble amyloid - protein and hyperphosphorylated tau protein leading to the formation of intracellular neurofibrillary tangles in the brain . the aetiology and pathogenesis of the disease are currently poorly understood , and the present management is to a large extent symptomatic and focused on ameliorating the cognitive deficits . however , although many hypotheses have been put forward for the aetiology of the disease , increased inflammation and oxidative stress appear to be key features contributing to the pathology of the disease . the omega - 3 polyunsaturated fatty acids ( pufa ) , eicosapentaenoic acid ( epa ) , and docosahexaenoic acid ( dha ) have well - characterised effects on inflammation and may have neuroprotective effects in a number of neurodegenerative conditions including ad . the purpose of this paper is to review the neuroprotective effects of epa and dha in ad with emphasis on their potential for modulating amyloidosis and the increased oxidative stress and inflammation seen with ad and explore their potential application as therapeutic agents . a major hallmark of ad is the overproduction of amyloid - peptide ( a ) , which results in the formation of plaques . a peptides are produced by successive proteolysis of amyloid precursor protein ( app ) by - site app - cleaving enzyme - 1 ( bace1 ) followed by - secretase . this cleavage is imprecise and produces a variants , which include those ending at residues 40 ( a 40 ) and 42 ( a 42 ) . the a 42 is deposited earliest and most abundantly in plaques . a has been shown to induce lipid peroxidation in brain cell membranes and increase production of the lipid peroxidation products 4 - hydroxynonenal and acrolein , and this may in part account for neurodegeneration in ad brain . several groups have investigated the role of dha - enriched diets in animal models of ad and amyloidosis . in a series of studies hashimoto and colleagues pretreated rats with dha ( 300 mg / kg per day for 12 weeks ) before an infusion of a 1 - 40 . dha had a significantly protective effect against the decrease in learning ability and reduced the oxidative stress induced by the a infusion in the cerebral cortex and hippocampus . pretreatment with dha also prevented a-induced impairment of an avoidance ability - related memory function . this group also investigated the protective effects of the dha pretreatment before a infusion on synaptosomal membranes properties . dha content significantly increased along with both lateral and rotational membrane fluidity , whereas the cholesterol to phospholipid molar ratio and lipid peroxidation decreased . elevated cholesterol increases a levels in both in vitro and in vivo models of ad , and the generation , accumulation , and clearance of a are regulated by cholesterol , suggesting an important role for cholesterol in the pathogenesis of ad . indeed , cholesterol is now a recognized risk factor in the pathogenesis of ad . furthermore , a generation may be determined by dynamic interactions of app with lipid rafts , since app inside rafts undergoes cleavage by - secretase , whereas app outside rafts undergoes cleavage by - secretase . lipid rafts are lateral assemblies of sphingolipids and cholesterol within the membrane , and it has been suggested that age - related increases in cholesterol in lipid rafts provides a cooperative environment for accumulation of a in plasma membranes . it is therefore of interest to note that omega - 3 pufas reduce the level of cholesterol in neuronal membranes , moreover cholesterol has a low affinity for dha - containing phospholipids and therefore alterations in the level of membrane dha will affect the formation of lipid rafts . it may be that the effects of dha on cholesterol levels and lipid raft formation represent an important , but as - yet relatively unexplored , neuroprotective mechanism . recent work by green and coworkers has shown that dha reduces the levels of soluble and intraneuronal a and somatodendritic tau protein in the 3xtg ad mouse model . the reduction was attributed to a decrease in the steady - state levels of presenilin 1 . importantly , when dha was combined with either arachidonic or docosapentaenoic acids ( both omega - 6 pufas ) the efficacy of dha diminished over time , with the effects lost by 9 months . however , the additional presence of docosapentaenoic acid in the diet reduced levels of early - stage phospho - tau epitopes , which correlated with the positive outcome of a reduction in phosphorylated ( activated ) c - jun n - terminal kinase , a putative tau kinase . it may be that the interrelationship between omega - 6 and omega - 3 pufas is a further important but neglected area of research . dha has also been shown to significantly increase levels of the sorting protein lr11 / sorla in primary rat neurons , aged nontransgenic mice , and aged dha - depleted appsw ad mice . this increase reduces the trafficking of the amyloid precursor protein to secretases involved in the - amyloidogenic pathway , and reduced lr11 / sorla expression is strongly correlated with ad neuropathology . dha also attenuates a secretion in cytokine - stressed human neural cells , and this is accompanied by formation of neuroprotectin d1 .10,17 s - docosatriene , also known as neuroprotectin d1 , is a metabolite of dha , which has been shown to have potent anti - inflammatory and neuroprotective effects in neural systems and stroke . dha and neuroprotectin d1 were reduced in the hippocampus cornu ammonis region 1 ( ca1 ) of ad brains , but not in the thalamus or occipital lobes of the same brains . furthermore , expression of cytosolic phospholipase a2 and 15 - lipoxygenase , which are key enzymes in neuroprotectin d1 biosynthesis , was altered in ad hippocampus . neuroprotectin d1 also repressed the a 42 - triggered activation of proinflammatory genes and upregulated the antiapoptotic genes encoding bcl - 2 , bcl - xl , and bfl - 1 ( a1 ) . the soluble amyloid precursor protein - alpha ( app - ) stimulated the biosynthesis of neuroprotectin d1 from dha . these results suggest that the beneficial effects of dha may in part also be mediated via the production of neuroprotectin d1 , which induces anti - apoptotic and neuroprotective gene expression and consequently suppresses a 42 - induced neurotoxicity . positive effects of dha treatment have not however been universally reported and a recent study by arendash and co - workers found that a high omega - 3 pufa diet provided no significant benefit in terms of decreasing the levels of soluble / insoluble hippocampal a levels or improving cognitive performance in neither amyloid precursor protein ( app ) - sw and ps1 double transgenic or wild - type mice . the authors did find that higher cortical levels of omega - 6 pufa in both the transgenic and wild type mice were associated with impaired cognitive function , as measured by the radial arm water maze and morris water maze tests . it may be that if dha is acting via a reduction in the steady - state levels of presenilin 1 , as suggested by green and co - workers , the overexpression of presenilin 1 in the transgenic mouse model used in this study overwhelms the capacity of dha , and therefore this model may not accurately reflect the potential effects in patients , especially those affected by sporadic ad . furthermore , the omega - 3 pufa experimental diet contained high levels of epa , which may have antagonised the effects of dha ( 4.7 % epa and 5.7 % dha expressed as % total fat ) by for example competing for enzymes in the neuroprotectin d1 biosynthetic pathway . an additional mechanism leading to a decrease in a levels has been suggested by a study investigating the effect of omega - 3 pufa enrichment on gene expression in aged rats . in this study , there was a 10-fold increase in transthyretin transcription following treatment , and since transthyretin is an a protein scavenger , the authors concluded that the omega - 3 pufa - induced expression could potentially prevent amyloid aggregate formation . indeed serot and co - workers found an inverse relationship between transthyretin levels in cerebrospinal fluid and the severity of dementia in ad patients . for example , vitamin a deprivation results in deposition of a in the cerebral blood vessels and downregulation of the retinoic acid receptor , rar in adult rat forebrain , and app / presenilin 1 double mutant transgenic mice treated for 8 weeks with retinoic acid show significantly decreased a deposition , tau phosphorylation , activation of microglia and astrocytes , attenuated neuronal degeneration and improved spatial memory compared to controls . retinoic acid regulates gene expression via its nuclear receptors : the retinoic acid receptors ( rars ) and retinoid x receptors ( rxrs ) . dha and epa have been reported to act as endogenous ligands of rxrs , and omega - 3 pufa supplementation has recently been shown to reverse age - related decreases in the levels of rar , rxr , and rxr in the aged rat forebrain . it may be that omega - 3 pufas are acting at a fundamental level of cell regulation by controlling gene expression via these receptors . omega - 3 pufa may also be acting at proliferator - activated receptors ( ppars ) , in particular ppar . ppars are involved in the control of the expression of a variety of genes involved in lipid energy metabolism and inflammation . in vitro a uptake and clearance from glial and neuronal medium is increased by ppar . in models of ad ppar agonistsreduce bace1 transcription and expression in app transgenic mice , ppar agonist and ibuprofen treatment reduce the expression of bace1 and a 42 amyloid deposits in the hippocampus and cortex of appv717i mice , and ppar agonists protect neurons against a-induced mitochondrial damage , apoptosis , and oxidative stress . furthermore , treatment with ppar agonists significantly improves measures of cognition in mild ad and mild cognitively impaired subjects compared to a placebo . ppar 's are known to bind to and be activated by epa , dha , and dha metabolites and omega - 3 pufa supplementation has also been shown to reverse age - related decreases in the levels of ppar in the aged rat forebrain . there are a number of inflammatory events that occur in the brain as a response to the presence of a. the key event appears to be the presence of activated microglia in the vicinity of the a-containing plaques . microglial activation results in the sustained production of proinflammatory cytokines , growth factors , complement molecules , and adhesion molecules . it has also been demonstrated that exposure of microglia to - amyloid fibrils leads to the production of reactive oxygen species and neurotoxins and activated microglia generate and release large numbers of superoxide ions , thereby increasing oxidative stress . the remainder of this paper will focus on this increased oxidative stress and inflammation and the potential role of omega - 3 pufa . the importance of increased oxidative stress , lipid peroxidation , and lipid peroxidation products has consistently been shown in the pathogenesis of ad . for example , increased lipid peroxidation has been detected in the frontal , temporal , parietal , and occipital cortices of ad patients . moreover , significantly increased levels of the lipid peroxidation products 4 - hydroxynonenal and acrolein , are found in the hippocampus / parahippocampal gyrus , superior and middle temporal gyrus , and cerebellum of subjects with mild cognitive impairment and early ad compared to age - matched controls , suggesting that lipid peroxidation occurs as an early event in the pathogenesis of ad . this is consistent with evidence from animal models of ad , where increased oxidative stress is also found in the appsw ( tg2576 ) transgenic mouse model of ad amyloidosis . cerebral cortical and hippocampal homogenates were found to have higher levels of lipid peroxidation than those from wild - type mice , and lipid peroxidation preceded amyloid plaque formation . isoprostanes are prostaglandin - like compounds formed in situ by nonenzymatic free radical - catalysed lipid peroxidation . f2 - isoprostanes are derived from the omega - 6 pufa , arachidonic acid , f3 - isoprostanes from epa and f4 - isoprostanes , also called neuroprostanes , from dha . measurement of isoprostanes provides a sensitive marker of in vivo lipid peroxidation . measurements comparing the level of isoprostanes and neuroprostanes between ad and matched controls in different regions of postmortem brains show a pufa - specific pattern of lipid peroxidation . there is an increase in esterified neuroprostanes in the occipital and temporal lobes , whereas f2 - isoprostanes in these regions are unchanged . similar results were found by reich and coworkers , in the superior and middle temporal gyri , hippocampus , inferior parietal lobule , and cerebral cortex . there were increased levels of neuroprostanes while f2 - isoprostanes levels were unchanged . these results show a selective pattern of lipid peroxidation occuring in ad , whereby dha appears especially vulnerable and arachidonic acid is unaffected . these results may reflect more than simply the regional distribution of pufa , since grey matter , where dha is more abundant , has a significantly greater susceptibility to oxidative stress than white matter . levels of f2 - isoprostanes and neuroprostanes was measured in the grey and white matter of brains from rats at intervals between 4 and 100 weeks of age . the level of neuroprostanes were consistently 20-fold greater than f2 - isoprostanes , whereas dha content was only two - fold greater than arachidonic acid , suggesting that dha is especially prone to oxidative stress . pufas are particularly susceptible to lipid peroxidation and as such are a potential abundant source of destructive peroxidation products . the in vitro peroxidisability of unsaturated fatty acids is linearly dependent upon the number of bis - allylic positions , such that the peroxidisability of dha is five times greater than that of the omega - 6 pufa linoleic acid , which contains only two double bonds . this increased susceptibility would help to explain the vulnerability of membrane dha to lipid peroxidation and may also suggest that elevating omega - 3 pufa intake in situations of increased oxidative stress , such as ad , would further increase production of toxic peroxidation products . although some studies have shown increased lipid peroxidation following dietary supplementation with dha and epa in plasma , liver , and kidney others have shown that epa and dha enriched diets do not increase levels of lipid peroxidation . indeed , rather than increasing lipid peroxidation dha has been shown to be neuroprotective by actually decreasing lipid peroxidation in the brain . for example , rats being fed a diet enriched with dha showed a significantly reduced level of cerebral lipid peroxide compared to controls , and the level of peroxidation was inversely related to the cerebral dha / arachidonic acid ratio . furthermore , tg2576 transgenic mice being fed a dha deficient diet have significantly elevated levels of oxidised proteins compared to the control group , whereas the levels of oxidised proteins were significantly reduced in a dha supplemented group . overall , these results suggest that dha may function in an antioxidant role , at least in the brain . yavin and colleagues have suggested a number of potential mechanisms for these observed antioxidant effects . membrane bound dha may act as a trap for reactive oxygen species , dha may be able to enhance the activity of endogenous antioxidant enzymes , or phosphatidylethanolamine plasmalogens containing dha may contain intrinsic antioxidant properties . dha has also been shown to induce antioxidant defences by enhancing cerebral activities of catalase , glutathione peroxidase , and levels of glutathione . furthermore , work by green and colleagues suggests that dha may reduce reactive oxygen species production by increasing nitric oxide production , which may decrease the cellular oxygen pool and consequently reduce the amount of reactive oxygen species and generate lipid peroxides . the increased lipid peroxidation and concomitant damage to membrane pufa have the potential to significantly reduce the brain levels of pufa and specifically dha . however , a recent review found that low dha is not consistently observed in plasma or brain of ad patients . although the authors did note wide variability between studies and suggested that it may be too early to draw any reliable conclusions . they did however report ad to be consistently associated with significantly lower phosphatidylethanolamine and phosphatidylcholine concentrations in the frontal cortex and hippocampus and the dha content of hippocampal phosphatidylethanolamine is significantly lower compared to age - matched controls . dha is particularly enriched in phosphatidylethanolamine , and this is therefore an important cellular store of dha . furthermore , in the hippocampal ca1 region of ad patients unesterified dha and neuroprotectin d1 levels are reported to be about one - half and one - twentieth of those in age - matched controls , respectively . it may therefore be hypothesised that although dha decreases do not appear widespread or large in magnitude , these selective decreases in the hippocampus may have profound effects on specific cellular pools and the subsequent production of key dha metabolites . in comparison with nondemented elderly subjects virtually all the inflammatory cytokines and chemokines so far investigated appear to be upregulated in ad patients , including il - 1 , il - 6 , tnf - , il - 8 , transforming growth factor - ( tgf - ) , and macrophage inflammatory protein - 1 ( mip - 1 ) , for reviews see . the most notable proinflammatory cytokines produced by microglial cells , il - 1 and il - 1 are found throughout the brain of ad patients at autopsy . il - 1 induces formation of reactive oxygen species , causing lipid peroxidation , and depletes membrane pufa levels . il - 1 also triggers microglial activation and increases expression of amyloid precursor protein . age - related increases in il - 1 are coupled with increased activity of mapk , c - jun - n - terminal kinases ( jnk , a stress activated map kinase ) , and p38 kinase and enhanced caspase - 3 activity ( an effector of apoptosis ) . map kinases mediate many specific cellular responses , including apoptosis and stress responses . for example , epa reversed the age - related increases in il - 1 concentration and activation of p38 and caspase - 3 . the epa supplementation also restored age - related decreases in arachidonic acid and dha concentrations and decreased reactive oxygen species accumulation . it has also recently been shown that il - 1 reduces acetylcholine release in rats , which correlates with memory deficits , and epa supplementation prevents the effects of il - 1 and significantly improves memory . epa and dha are the precursors of a diverse array of second messengers , called resolvins and docosanoids , with potent anti - inflammatory and proresolving actions . resolution of inflammation has traditionally been thought of as a passive process ; however , recent evidence suggests that resolution is an active process involving the biosynthesis of local lipid derived mediators within the resolution phase , called resolvins . the d class resolvins , derived from dha block tnf -- induced il - 1 transcripts in brain and resolvin e1 ( rve1 ) , produced from epa , reduces il - 12 production via the chemr23 receptor .10,17 s - docosatriene , also known as neuroprotectin d1 is produced from dha and potently blocks the generation of both tnf - and ifn - c by stimulated t cells . together , these data suggest that the omega - 3 pufa metabolites have the potential to decrease inflammation by decreasing inflammatory cytokine production . most human dietary supplementation studies investigating the effects of omega - 3 pufa on cytokine production have typically examined the effects of high epa rather than dha preparations . epa and dha have differing effects on inflammatory response and they should not be considered as having mechanistic equivalence . furthermore , epa and dha produce distinct metabolites , and it may be that dha is the more potent immunological modulator via production of neuroprotectin d1 . a recent trial supplemented 174 ad patients with a high dha preparation ( 1.7 g dha and 0.6 g epa or placebo for 6 months ) . the dha / epa supplemented patients had significantly reduced il - 1 , and il - 6 release from lipopolysaccharide stimulated peripheral blood mononuclear cells compared to the placebo group , although tnf - , il - 8 , il - 10 and granulocyte colony - stimulating factor were not affected . the mechanism by which dha and epa are able to attenuate inflammatory processes has yet to be elucidated ; however it is likely that these observed effects are mediated at the level of gene regulation by modifying the actions of transcription factors , with nuclear factor - kappa b ( nf - b ) a being potential candidate . nf - b has many diverse functions in the nervous system and regulates a large number of genes encoding many inflammatory cytokines , such as il - 1 , il - 6 , inf - , and mcp - 1 ; however , it also regulates anti- and proapoptotic proteins including bcl - 2 , bcl - xl , bcl - xs , bax , cyclooygenase - 2 , and inducible nitric oxide synthase . nf - b activation occurs following a signalling cascade initiated by external inflammatory stimuli and involves the phosphorylation and subsequent degradation of the ib inhibitory subunit , which allows nf - b translocation to the nucleus and the subsequent activation of expression of target genes . the role of nf - b appears to be determined by cell type and timing of activation . for example , activation of nf - b in neurons associated with amyloid deposits is currently thought to be neuroprotective , whereas induction of nf - b in glia may be neurotoxic . for reviews see . epa or omega - 3 pufa supplemented media decreases lipopolysaccharide - induced activation of nf - b and tnf - levels in cultured macrophages and monocytes , importantly , dha suppresses il - 6 production and activation of nf - b in lipopolysaccharide / interferon - stimulated glial cells , suggesting omega - 3 pufas may have direct effects on inflammatory cytokine production via effects on the nf - b signalling pathway . however , their site of action in this pathway and specific effects in neurons are yet to be determined . although there are strong correlations between low tissue levels of omega - 3 pufa and increased risk of ad , and low dietary intakes of omega - 3 pufa and cognitive decline and ad , the results of dietary intervention studies have so far failed to live up to expectations raised by the preclinical and epidemiological studies . in the first study to look at the effects of omega - 3 pufa in ad , yehuda and colleagues conducted a 4 week double - blind trial with 100 ad patients . the supplemented group showed improvements in mood , cooperativity , short - term memory , appetite , sleep , and spatial orientation , whereas no improvements were seen in the placebo group . a subsequent pilot study investigated the effects of 500 mg epa given twice daily for 12 weeks in patients with ad . no differences were found and the authors concluded that epa had no effects on cognition . a larger study in 174 patients found that administration of 1.7 g of dha and 0.6 g of epa per day for 6 months in patients with mild to moderate ad did not delay the rate of cognitive decline , although , positive effects were observed in a small subgroup of patients with very mild ad ( mmse 27 points ) . therefore , current evidence appears to indicate that the beneficial effects of omega - 3 pufas are more related to limiting the progression of cognitive decline , as most clinical trials have so far failed to demonstrate the efficacy of omega - 3 pufa treatment after the onset of ad symptoms . however , it should be noted that preclinical studies have focused on the effects of dha and its metabolites , whereas clinical studies have investigated epa , or may have used insufficient doses of dha . in brain tissue , dha - derived metabolites promote resolution and protect neural cells from neurodegeneration and may therefore be the more important omega - 3 pufa in modulating the secretion of cytokines and inhibiting neuroinflammation and oxidative stress in ad . furthermore , recent evidence suggests that the beneficial effects of omega - 3 pufa on reducing the risk of dementia and ad may be reduced by the presence of the apolipoprotein e 4 ( apoe 4 ) allele . it is hoped that future clinical studies will help clarify these issues and the relative roles and utility of dha and epa in the treatment of ad .\noutput:\n" }, { "from": "agent", "value": "alzheimer 's disease is the most common form of dementia in the elderly and is a progressive neurodegenerative disorder characterised by a decline in cognitive function and also profound alterations in mood and behaviour . the pathology of the disease is characterised by the presence of extracellular amyloid peptide deposits and intracellular neurofibrillary tangles in the brain . although many hypotheses have been put forward for the aetiology of the disease , increased inflammation and oxidative stress appear key to be features contributing to the pathology . the omega - 3 polyunsaturated fats , eicosapentaenoic acid ( epa ) , and docosahexaenoic acid ( dha ) have well - characterised effects on inflammation and may have neuroprotective effects in a number of neurodegenerative conditions including alzheimer 's disease . the aims of this paper are to review the neuroprotective effects of epa and dha in alzheimer 's disease , with special emphasis on their role in modulating oxidative stress and inflammation and also examine their potential as therapeutic agents ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: anomalous origin of the right coronary artery from the pulmonary artery ( arcapa ) is a very rare congenital heart defect .123 ) most arcapa cases are isolated anomalies , but approximately 25 - 30 % is found to be associated with other structural heart defects .4 ) in 1885 , the first cases of arcapa were described by brooks .5 ) most affected patients are asymptomatic and their anomalies were detected incidentally . this is completely different from the anomalous origin of the left coronary artery from the pulmonary artery ( alcapa ) , which without definitive surgical treatment can frequently lead to death early in life .6 ) however , sudden cardiac death from arcapa has been reported as well .7 ) the most common symptoms which would require the patient to seek medical attention are murmurs followed by chest pain , and symptoms of congestive heart failure .7 ) the natural history of arcapa is difficult to describe because of the relatively small number of reported cases . definitive therapy requires surgical translocation of the anomalous right coronary artery ( rca ) to the aortic root .6 ) 1 was an 8 - month - old male with a weight of 7.5 kg suffering from seizures . electrocardiographic ( ecg ) examination revealed an inverted t wave in leads v1 - v4 . on transthoracic echocardiogram ( tte ) , there was a dilated left main coronary artery ( 0.24 cm diameter - identified according to online software , version 3.7.0 [ ped ( z ) - pediatric calculator ; daniel grfe , germany ] for calculating coronary artery z score ) with a suspected diagnosis of arcapa associated with good left ventricular ejection fraction ( lvef ) . a computed tomographic angiography ( cta ) was carried out and confirmed the diagnosis of arcapa and also revealed an aberrant right subclavian artery along with a right dominant coronary circulation . the patient underwent reimplantation of the anomalous rca ( which was originating from the right anterolateral aspect of the pulmonary artery [ pa ] ) into the ascending aorta . for that , a complete cardiopulmonary bypass ( cpb ) with aortobicaval cannulation was prepared and moderate hypothermia ( 28 - 32 ) was used . a large coronary ostial button , which contains the rca , was harvested from the pulmonary artery , and the rca was mobilized as well . then , an opening was made in the left anterolateral aspect of the aorta followed by direct implantation of the rca . the defect in the sinus of the pulmonary artery was reconstructed with a fresh autologous pericardial patch . the patient was weaned off the cpb without inotrope support . in the intensive care unit ( icu ) a low dose of milrinone ( 0.25 mcg / kg / min ) was administered along with unfractioned heparin infusion with a dose of 50 units / hour in order to keep the partial thromboplastin time ( ptt ) between 60 to 90 seconds . the intubation time lasted 16 hours and the patient was discharged after 5 days on digoxin , captopril , aspirin , phenobarbital , and propranolol . at the 3 - year follow - up period , the patient appeared well , and was without any dyspnea or chest pain along with a lvef of 65 % measured by tte . patient no. 2 was an 18 - month - old male with a weight of 9.8 kg who was asymptomatic ; during a routine checkup a 2/6 systolic murmur was heard in the left second intercostal space , ecg was normal . however , tte demonstrated a dilated left coronary artery ( 0.3 cm diameter ) and normal left and right ventricular function without any associated lesions . cta revealed an rca originated from the right side of the pa with an anterior course in relation to the ascending aorta along with a right dominant coronary system ( fig . the patient underwent reimplantation of the anomalous rca into the ascending aorta , with the origin of the rca from the right facing sinus of the pa adjacent to the commissure . the patient was weaned off the cpb without inotrope support . in the icu milrinone with a dose of 0.5 mcg / kg / minwas administered along with unfractioned heparin infusion with a dose of 100 units / hour . the intubation time lasted 26 hours and the patient was discharged after 6 days on aspirin and furosemide . at the one - year follow - up , the patient was asymptomatic ( no chest discomfort or dyspnea ) with a lvef of 66 % measured by tte . patient no. 3 was a 4 - year - old male with a weight of 15 kg who was asymptomatic . however , during hospitalization for upper respiratory tract infection , the ecg revealed an inverted t wave in leads v1 - v4 , and consecutively tte was performed and demonstrated a dilated left coronary artery with normal left and right ventricular functions . coronary angiography demonstrated a dilated left main coronary artery and a retrograde flow in the rca with runoff into the pa with a left dominant coronary circulation . the patient underwent reimplantation of the anomalous rca into the ascending aorta , with the origin of the rca from the right facing sinus of the pa . the intubation time lasted 40 hours during which he was extubated for the first time after 16 hours but reintubated because of agitation and restlessness . he was then discharged after 6 days on digoxin , captopril , aspirin , and furosemide . the patient did not show any signs of dyspnea or chest pain and had a lvef of 70 % measured by tte at 6 - month follow - up . coronary artery anomalies arise embryologically as a result of either malrotation of the spiral septum dividing the truncus or malpositioning of the coronary buds themselves . the higher incidence of alcapa compared to arcapa may be explained by the proximity of the left coronary bud to the pa sinus . the pathophysiology of arcapa depends on the direction of blood flow in the coronary artery and its influence on oxygen delivery to the myocardium .8 ) the severity of ventricular ischemia is determined by the shunt size , the degree of collateral circulation , and myocardial oxygen demands .7 ) because right ventricular oxygen demands are lower than that of the left ventricle , the ventricular ischemia in the arcapa is less prominent than in the alcapa .7 ) however , patients with right dominant coronary circulation do not tolerate arcapa compared with those with a left dominant system .8 ) in our series , the 8 and 18 - month - old patients had right dominant coronary circulations , while the 4 - year - old patient had a left dominant one . although all patients presented asymptomatically with preserved left and right ventricular function , the role of coronary circulation dominance on arcapa presentation can not be confirmed . the diagnosis of arcapa is mainly incidental ,6 ) but some patients present with a murmur , chest pain , or symptoms of congestive heart failure .7 ) however , the patients presented in this report did not suffer from cardiac symptoms , and only one patient had a murmur , which led to the diagnosis of arcapa . on the other hand , two other patients had ischemic changes on an ecg found in the setting of routine check - up for non - cardiac complaints . advances in diagnostic technologies have resulted in an increase in the rate of diagnosis of arcapa during infancy and early childhood .8 ) cardiac cta and cardiac magnetic resonance is a gold standard diagnostic tool providing an excellent visualization of anomalous coronary arteries .7 ) in our cases , the diagnosis was suspected by the tte as a dilated left coronary artery was detected and confirmed by a cta in two patients and by angiography in the other . associated anomalies such as aortopulmonary window , tetralogy of fallot , and septal defects have been reported in 22 % of patients .6 ) however , except for an aberrant right subclavian artery in one patient , the arcapa was an isolated anomaly in our patients . surgery is indicated on the diagnosis of arcapa , even in asymptomatic patients to prevent the development of myocardial ischemia and sudden cardiac death .9 ) different surgical procedures have been described for the management of arcapa . the ligation of rca at its origin from the pulmonary trunk with or without concomitant grafting to the rca is one option . however , the long - term patency of the graft is debatable .9 ) another option is the reimplantation of the anomalous rca from the pulmonary artery into the anterior wall of the ascending aorta to reestablish a dual coronary artery system , which results in a better outcome compared with single coronary ostium system .9 ) 10 ) in our cases , we used the reimplantation technique in all patients , which was also associated with no cases of in - hospital mortality . reports describing follow - up of arcapa after surgical correction are rare .8 ) the follow - up period of our cases was six months , one year , and three years , and neither late mortality nor complications were detected during the follow - up period . however , the risk for potential late complications exists , and long - term follow - up of patients is warranted . it may be recommended to perform an annual postoperative echocardiographic screening due to some studies reporting an incidence of clot in the reimplanted rca . in conclusion , the use of reimplantation techniques for arcapa repair can result in good outcomes with the establishment of a dual coronary system to prevent the continuous risk of sudden cardiac death and myocardial ischemia in such cases .\noutput:\n" }, { "from": "agent", "value": "anomalous origin of the right coronary artery from the pulmonary artery ( arcapa ) is a very rare congenital heart defect . herein , we describe three cases of arcapa in an 8 months old , 18 months old , and 4 year old child . two cases were incidentally diagnosed using a computed tomographic angiograph , and the other was incidentally diagnosed using a coronary angiograph . these cases underwent a reimplantation technique on diagnosis and resulting in positive clinical outcomes during the follow - up period which was a mean of 1.5 years ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the jewel of the east coast , visakhapatnam is a coastal port city , situated in andhra pradesh , located on the eastern shore of india , nestled among the hills of the eastern ghats and facing the bay of bengal to the east . fishery is an important economic activity of the of the district ; fishermen population living in about 59 fishery villages and hamlets on coastline stretching to a length of 132 kilometers , covering 11 coastal mandals . about 13,000 fishermen families eke out their livelihood from marine , inland and brackish water fishing . the peoples residing in coastal regions of visakhapatnam , engaged in fishery , supposed to be affected by the workload of this energy - demanding occupation over their physical fitness , which not only refers cardiorespiratory fitness and muscular strength , but also in the full range of physical qualities which can be understood as an integrated measurement of all functions and structures involved in the performance . their occupation demands a better physical fitness , but the health status and physical fitness data of fishermen of india is quite scanty . in adults , low physical fitness ( mainly cardiorespiratory fitness ) seems to be a stronger predictor of both cardiorespiratory and all - cause mortality than any other well established risk factors . thus , the aim of this investigation was to determine the physical efficiency of the local peoples engaged in fishery and also to determine the influence of occupational workload over certain fitness parameters of young adults among fishing communities residing in araku valley of visakhapatnam district , thus , to test the hypothesis that physically demanding occupations have an influence over the physical fitness pattern of workers . in this cohort study , 25 young fishermen ( mean age of 22.81.92 years ) of araku valley of visakhapatnam district , andhra pradesh , were randomly selected to participate in the study as exposed group . twenty - five subjects are also randomly selected from college students ( mean age of 21.92.25 years ) of kolkata , west bengal as unexposed group . subjects were instructed to take their last meal at least 2 h before conducting the test in order to avoid the specific dynamic action ( sda ) of food . consent from each participant was taken for conducting the study , and the experiments were carried out following institutional ethical permission . all the experiments were carried out and measurements were taken in temperature of 20 - 25c and relative humidity of about 45 - 50 % in winter season in india ( 2010 - 2011 ) , to avoid seasonal influence on fitness pattern . to minimize the experimenter bias each measurementwas taken for three times and the mean was represented as final result . the body mass index ( bmi ) was measured by the following formula : bmi = mass ( kg ) / ( height in m ) . body fat percentage was also calculated by a predictive formula using bmi , age , and gender : adult body fat % = ( 1.20 bmi ) + ( 0.23 age ) - 10.8 - 5.4 ( for male subjects ) . dubois and dubois formula was used for estimating body surface area ( bsa ) . resting heart ratewhen two successive heart rate scores become equal then it was considered as resting heart rate . physical fitness index ( pfi ) was calculated by measuring heart rate after performing harvard step test ( hst ) developed by brouha et al . , using long form pfi equation . however , following modified hst under indian condition , using stool of 51 cm high stepping up and down with a rate of 30 cycles / min for 3 min or up to exhaustion . exhaustion is defined as when the subject can not maintain the stepping rate for 15 seconds . the recovery pulse was counted at 1 to 1.5 , 2 to 2.5 and 3 to 3.5 minutes of recovery . to calculate the anaerobic power , the height of ascend , the body weight , and the duration ( seconds ) was noted by the stopwatch . at firstthe work done is calculated by the following formulae : work done = body weight height of ascend 0.002342 . from the calculated workdone the anaerobic power is obtained by the following formula : nomogram of astrand - ryhming was used to determinate the maximum oxygen uptake capacity or vo2 max . it was estimated ( or predicted ) by indirect method using the nomogram , from the peak heart rate ( obtained during recording of pfi by hst ) and body weight of the subject . the cross - sectional point from these two bars of peak heart rate and body weight indicated the predicted vo2 max of the subject . energy expenditure ( ee ) has also been determined by another predictive formula using peak heart rate ( hr ) scores recorded during hst : ee ( kcal min ) = -1.42 + ( 0.045 peak h.r ) . curvilinear distances were taken around the midpoint of upper arm ( muac ) , thigh ( tc ) , calf muscle ( cc ) , waist ( wc ) and buttock ( bc ) . comparison of parameters between control and young fishermen was done by two tailed unpaired t - test , using microsoft excel - 2007 and the result was considered as significant when the two - tailed p 0.05 . the height ( cm ) and body weight ( kg ) of 25 control subjects is 164.67.21 and 59.37.5 ( mean sd ) , respectively and those of young fishermen of araku valley are 162.36.33 and 56.19.3 ( mean sd ) , respectively . all mean values of physical parameters ( bmi , bsa and fat percentage ) are represented in table 1 . other than body fat percentage no significant differences were found in the physical parameters between the two groups . comparison of the various characteristics in fishermen as case group ( n = 25 ) and students as control group ( n = 25 ) using t test table 1 also represents comparative aspects of physical fitness variables ( including pfi ) . comparative aspect of physical efficiency measures i.e. , anaerobic power , energy expenditure and predicted aerobic capacity ( vo2 max ) showed young fishermen of araku has a greater anaerobic power and vo2 max but less expenditure of energy for a specific work than control subjects . anthropometric measures reflect the nutritional status of both groups , which may affect the fitness pattern . this study is based on a small - scale random sample of fishermen who were actively engaged in fishing for more than 2 years . the data can be assumed to be representative for young people employed in fishing occupation of araku valley of visakhapatnam district . thus , the study was carried out to characterize the cardiorespiratory fitness along with their physical parameters . the findings of the present study revealed that physical parameters ( height , weight , bmi , and bsa ) of young adults among fishing communities of visakhapatnam did not significantly differ from that of the control group . however , young fishermen was found to have significantly less body fat percentage than the reference control group , which may be due to their young age ; hence have a propensity for being leaner rather than obese . it has also been reported that in andhra pradesh more than 24.8 % of men were reported to be underweight , which rank 15 among the 28 states of india . on the other hand , resting heart rate and aerobic capacity or maximum oxygen uptake capacity ( vo2 max ) has widely been considered to be a reliable and valid measure of cardiorespiratory fitness and endurance . in the present study , a lower resting heart rate was observed in young fishermen than the control subjects that indicate the better physical condition ( endurance ) of the fishermen . such physical differences may be due to their lifestyle and occupational need , which requires extra energy expenditure for their daily activities resulting in some adaptive changes . activities that demand strength increases ventricular muscle mass , which results in increased force of contraction and hence , cardiac output which may be the cause significant increase of resting blood pressure . however , guyton emphasized that , during heavy workload stretching of muscle causes vasoconstriction , which resulted in restriction of blood flow and in turn increased systolic pressure . he further reported that pooling of blood in many parts of the body causes vasoconstriction in muscles and thus increased the diastolic pressure . results of the present study show the changes in systolic and diastolic blood pressure , as recorded , was similar to the findings of astrand . both , the systolic and diastolic pressure showed significant difference in respondents . though , increased blood pressure in young fishermen is an indicator of effect of their workload on physiological parameters , but it is of great concern that if they retain high blood pressure for long time , it may have harmful effects on their health . because , increased blood pressure is a widespread condition , which affects a large portion of the population in developed countries , including fishing communities . several international studies from spain , the netherlands , poland , croatia , and finland indicate high blood pressure among fishermen . it is an important risk factor for cardiovascular and cerebrovascular disease , as well as a significant preventable cause of mortality . according to the world health organization ( who ) , hypertension is a risk factor for cardiovascular disease , which accounts for an estimated 17 million deaths each year . brouha et al . suggested that for a specific workload , better the physical condition of the individual , more rapid will be the return of heart rate to its resting level and consequently lower recovery cardiac cost . similar results were found in fishermen where the return of the heart rate to its resting level was more rapid than that of control subjects . moreover , the peak heart rate is lesser in comparison to control subjects indicating their better physical condition . their pulse rate recovered quickly , which an indicator of better fitness which is reflected in significantly higher pfi and lower energy expenditure and they also have better anaerobic power than sedentary workers [ table 1 ] . muac is the best ( i.e. , in terms of age independence , precision , accuracy , sensitivity and specificity ) case - detection method for nutritional status . as young fishermen perform work related to strength more than control subjects , according to their life - style , so they should have more upper arm circumference [ table 1 ] , which is also an estimate of energy storage and protein mass of the body which is an indirect estimate of strength , but no significant difference was observed in upper arm circumference between the two groups . waist - to - hip ratio ( whr ) is found to be insignificant in respondents than control subjects , which are another indicator of less fat percentage in young fishermen than control subjects , which may be caused due to their poor nutritional status . present study indicates that the health of young fishermen residing at coastal regions of visakhapatnam district , india is better than the control subjects and their occupational workload has positive influence over their physical parameters .\noutput:\n" }, { "from": "agent", "value": "background : the people residing in coastal areas of visakhapatnam are mostly engaged in fishery , which is always been a physically demanding job , and numerous factors have direct or indirect impact on the health of fishermen ; but , the data about their physical fitness or health status is quite scanty . thus , the present study was conducted to assess their cardiorespiratory fitness pattern , as well as morphometric characters , which may be influenced by their occupation.methods : in this retrospective cohort study , 25 young fishermen ( mean age of 22.8 1.92 years ) were randomly selected from araku valley of visakhapatnam district , andhra pradesh and compared with 25 subjects who were randomly selected from college students ( mean age of 21.9 2.25 years ) of kolkata , west bengal . some physical and physiological fitness variables including height , weight , body mass index , body surface area , physical fitness index , anaerobic power , and energy expenditure were measured along with their morphometric characters.results : analysis of data indicated a significant difference in blood pressure , physical fitness index , energy expenditure , body fat percent and anaerobic power among fishermen compared to controls . however , there were no changes in morphometric characters between the two groups.conclusions : findings of this small - scale population - based study indicated that health and physical fitness of young fishermen is under the influence of both occupational workload and nutritional status , as found by body composition and morphometric characters ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: data from the world health organization ( who ) global survey on maternal and perinatal health between 2004 and 2008 showed that 9.6 % of all the deliveries involved labor induction . among the countries surveyed , the incidence of labor induction of america was 11.4 % , while that of china was only 6.4 % . in the united states , the incidence of labor induction increased significantly from 9.0 % in 1989 to 18.4 % in 1997 , to over 23 % in 2009 . in china , however , changes of nationwide data of the incidence of labor induction are still lacking . on the other hand , increasing the incidence of the cesarean section has become a public health problem in china since the past 20 years . apart from the nonclinical factors that drive women and obstetricians to choose cesareans , failure of induce labor and lack of an effective medicine to induce labor in china , are two of the main clinical reasons for the increased rate . some women choose elective cesarean sections just because they are worried about an unsuccessful labor induction . prostaglandins ( pgs ) are widely used for cervical ripening and labor induction ; according to the chinese guideline for cervical ripening and labor induction in late pregnancy , dinoprostone and misoprostol are both recommended . vaginal prostaglandin e2 ( pge2 ) ( dinoprostone ) has been shown to increase the chance of vaginal delivery in 24 h compared with a placebo . however , dinoprostone is costly and must be refrigerated or frozen during transportation and storage because of its thermal instability , which restricts its use in undeveloped regions in china . vaginal misoprostol has been shown to be associated with less use of epidural analgesia , more vaginal deliveries within 24 h , and more uterine hyperstimulation compared with vaginal pge2 . compared with dinoprostone , misoprostol is stable at the room temperature , which is more convenient for storage and administer ; moreover , its relatively inexpensive price makes it more acceptable . although 25 - g misoprostol is recommended in the chinese guidelines for labor induction , no tablets with an accurate 25 - g dose of misoprostol are currently available in china . in this study , we conducted the first double - blinded , prospective randomized controlled clinical trial in china to evaluate the efficacy and safety of intravaginal misoprostol in cervical ripening and labor induction in term pregnancy in nulliparous women , by using a misoprostol tablet with 25 - g dosage . we hope our data from chinese women can contribute to the world 's database of using misoprostol as a labor inductor , and help to reduce the high incidence of cesarean section in this country . this double - blinded , prospective randomized controlled clinical study of misoprostol was conducted in 6 university hospitals across china from may 2012 to february 2013 . the study was performed in accordance with the guidelines of the declaration of helsinki and was approved by the ethics committees of each hospital . all the investigators involved in the participant enrollment and subsequent follow - up have been trained and are certified to perform clinical trials according to the good clinical practice issued by the china food and drug administration . the 25 - g vaginal misoprostol tablets and placebo tablets with consistency in color , dosage , shape , smell , packaging , and tags were produced and freely provided by guangzhou regenex pharmaceuticals ltd . , nulliparous women with a live singleton pregnancy who were eligible for induction labor were recruited in this study . all subjects were aged 20 years or older ; had a gestational age between 37 and 42 weeks , with head fetal presentation and intact amniotic membrane . all subjects were induced labor for the indications according to the chinese guideline of cervical ripening and labor induction during the third trimester pregnancy ( draft ) but demonstrated an unfavorable cervix ( cervical bishop score 6 ) . women were excluded if any of the following criteria was met : placenta previa , placenta abruption , breech or transverse presentation , significant cephalopelvic disproportion , preeclampsia or eclampsia , suspected macrosomia , emergent fetal distress , fetal congenital malformation , and prior uterine surgical procedure history . women with severe chronic diseases of the cardiac , pulmonary , hepatic , renal , hematopoietic , endocrine , or immune system ; acute infection ; cervical carcinoma ; and contra - indications for the use of pg analogues ( glaucoma , asthma , epilepsy , and allergy to pg ) were also excluded . the incidences of vaginal deliveries achieved within 24 h ranged from 61.3 % to 75 % for the misoprostol group and 010 % for the placebo group ; the bishop scoring increases 3 in 12 h were about 50 % for the misoprostol group and 25 % for the placebo group . we estimated the sample size according to the incidences of bishop scoring changes , which needed more sample size than those of vaginal deliveries within 24 h did , at a two - sided alpha = 0.05 with 80 % power . to determine as many adverse events of misoprostol as possible , the sample size ratio of the misoprostol : placebo group was set to 3:1 . using pass software , we determined the sample size of 41 for placebo , and 123 for misoprostol group . for consideration of the sample loss rate , we increased the sample size by 20 % for the placebo group and 40 % for the misoprostol group . finally , a final total sample size of 225 , with 175 patients receiving misoprostol and 50 receiving placebo ( at a ratio of 7:2 ) , was decided . both participants and investigators were masked to group assignment , and data remained blinded to researchers until study enrollment was complete . randomized via a computerized randomization sequence , misoprostol : placebo ratio was set to 7:2 in each block . a total of 25 blocks were distributed among the hospitals . in case of emergent unblinding , an envelope with a blinding code and the participant 's group was distributed with the tablets to the investigators . tablets of 25 - g misoprostol or placebo were applied into the posterior fornix of the vagina at an interval of 4 h ( repeated up to 3 times ) for labor induction . the second and / or third doses were not administered to women who had three uterine contractions per 10 min sustained for 3060 s each , spontaneous membrane rupture , uterine hyperstimulation , fetal heart rate abnormality , or who had previous undissolved tablets in the vagina . this protocol was based on the international federation of gynecology and obstetrics ( figo ) misoprostol recommended dosages , the who recommendations for induction of labor , and the cochrane review by hofmeyr et al . the bishop scores were assessed each time the second or third tablet was going to be placed , and 12 h and 24 h apart from the first tablet if the labor was not completed . labor inductions by amniotomy , intravenous drip of oxytocin , or vaginal dinoprostone were applied 24 h after the first tablet was provided , if the women ( both the misoprostol and placebo groups ) were still not in labor . the primary outcome measure was the incidence of cumulative bishop score increases 3 within 12 h or vaginal delivery achieved within 24 h. the secondary outcome measures included the incidence of onset of labor within 24 h , median induction - onset of labor interval , the incidence of women requiring oxytocin augmentation , and incidence and indications of cesarean section deliveries . maternal safety measures included fever , nausea , vomiting or diarrhea , incidence of uterine hyperstimulation with or without fetal heart incidence changes , postpartum hemorrhage , precipitate delivery , genital tract laceration , instrument - assisted vaginal deliveries , uterine rupture , and amniotic fluid embolism , among others . fetal and neonatal safety measures included fetal heart rate abnormality , meconium - stained amniotic liquor , and apgar score 7 at 5 min . all adverse events were recorded from the time of the first dose of the study treatment until discharge from the hospital . the data were processed using sas 9.13 software ( sas institute , cary , nc , usa ) , and two - sided p 0.05 was considered significant . continuous data are described as the mean standard deviation ( sd ) or median and quartile range , while categorical data are described as the frequency and percentage . covariance analysis was used to control for center effects and to compare whether the effectiveness index at baseline was balanced . dichotomous variables were compared between the groups using the chi - square test or fisher 's exact test , and continuous variables were analyzed using the independent student 's t - test . the differences in the induction - onset of labor intervals were evaluated by log - rank test with kaplan meier survival estimates . nulliparous women with a live singleton pregnancy who were eligible for induction labor were recruited in this study . all subjects were aged 20 years or older ; had a gestational age between 37 and 42 weeks , with head fetal presentation and intact amniotic membrane . all subjects were induced labor for the indications according to the chinese guideline of cervical ripening and labor induction during the third trimester pregnancy ( draft ) but demonstrated an unfavorable cervix ( cervical bishop score 6 ) . women were excluded if any of the following criteria was met : placenta previa , placenta abruption , breech or transverse presentation , significant cephalopelvic disproportion , preeclampsia or eclampsia , suspected macrosomia , emergent fetal distress , fetal congenital malformation , and prior uterine surgical procedure history . women with severe chronic diseases of the cardiac , pulmonary , hepatic , renal , hematopoietic , endocrine , or immune system ; acute infection ; cervical carcinoma ; and contra - indications for the use of pg analogues ( glaucoma , asthma , epilepsy , and allergy to pg ) were also excluded . the incidences of vaginal deliveries achieved within 24 h ranged from 61.3 % to 75 % for the misoprostol group and 010 % for the placebo group ; the bishop scoring increases 3 in 12 h were about 50 % for the misoprostol group and 25 % for the placebo group . we estimated the sample size according to the incidences of bishop scoring changes , which needed more sample size than those of vaginal deliveries within 24 h did , at a two - sided alpha = 0.05 with 80 % power . to determine as many adverse events of misoprostol as possible , the sample size ratio of the misoprostol : placebo group was set to 3:1 . using pass software , we determined the sample size of 41 for placebo , and 123 for misoprostol group . for consideration of the sample loss rate , we increased the sample size by 20 % for the placebo group and 40 % for the misoprostol group . finally , a final total sample size of 225 , with 175 patients receiving misoprostol and 50 receiving placebo ( at a ratio of 7:2 ) , was decided . both participants and investigators were masked to group assignment , and data remained blinded to researchers until study enrollment was complete . randomized via a computerized randomization sequence , misoprostol : placebo ratio was set to 7:2 in each block . a total of 25 blocks were distributed among the hospitals . in case of emergent unblinding , an envelope with a blinding code and the participant 's grouptablets of 25 - g misoprostol or placebo were applied into the posterior fornix of the vagina at an interval of 4 h ( repeated up to 3 times ) for labor induction . the second and / or third doses were not administered to women who had three uterine contractions per 10 min sustained for 3060 s each , spontaneous membrane rupture , uterine hyperstimulation , fetal heart rate abnormality , or who had previous undissolved tablets in the vagina . this protocol was based on the international federation of gynecology and obstetrics ( figo ) misoprostol recommended dosages , the who recommendations for induction of labor , and the cochrane review by hofmeyr et al . the bishop scores were assessed each time the second or third tablet was going to be placed , and 12 h and 24 h apart from the first tablet if the labor was not completed . labor inductions by amniotomy , intravenous drip of oxytocin , or vaginal dinoprostone were applied 24 h after the first tablet was provided , if the women ( both the misoprostol and placebo groups ) were still not in labor . the primary outcome measure was the incidence of cumulative bishop score increases 3 within 12 h or vaginal delivery achieved within 24 h. the secondary outcome measures included the incidence of onset of labor within 24 h , median induction - onset of labor interval , the incidence of women requiring oxytocin augmentation , and incidence and indications of cesarean section deliveries . maternal safety measures included fever , nausea , vomiting or diarrhea , incidence of uterine hyperstimulation with or without fetal heart incidence changes , postpartum hemorrhage , precipitate delivery , genital tract laceration , instrument - assisted vaginal deliveries , uterine rupture , and amniotic fluid embolism , among others . fetal and neonatal safety measures included fetal heart rate abnormality , meconium - stained amniotic liquor , and apgar score 7 at 5 min . all adverse events were recorded from the time of the first dose of the study treatment until discharge from the hospital . the data were processed using sas 9.13 software ( sas institute , cary , nc , usa ) , and two - sided p 0.05 was considered significant . continuous data are described as the mean standard deviation ( sd ) or median and quartile range , while categorical data are described as the frequency and percentage . covariance analysis was used to control for center effects and to compare whether the effectiveness index at baseline was balanced . dichotomous variables were compared between the groups using the chi - square test or fisher 's exact test , and continuous variables were analyzed using the independent student 's t - test . the differences in the induction - onset of labor intervals were evaluated by log - rank test with kaplan meier survival estimates . a total of 225 women were randomized and treated with at least one tablet of misoprostol ( n = 175 ) or placebo ( n = 50 ) . of these , 3 women who withdrew consent were lost to follow - up . therefore , 222 women with 173 for misoprostol group and 49 for placebo were included in full analysis set and analyzed for effective measurements . the two groups had no significant difference in the baseline demographic or the indications for labor induction [ table 1 ] . the indications for labor induction included : over 41 weeks of gestation , maternal complications ( gestational hypertension or gestational diabetes mellitus ) , nonreassuring fetal status ( oligohydramnios or poor placental function ) , and informed choices . among the 175 women recruited in the misoprostol group , 20 , 83 , and 72 women received one , two , and three doses of 25 - g misoprostol over an 8 - h dosing period , respectively . baseline demographic and indications for labor induction of the participants bmi : body mass index . the incidence of cumulative bishop score increases 3 within 12 h or vaginal delivery within 24 h in the misoprostol group was significantly higher than that in the placebo group ( 64.2 % vs. 22.5 % , relative risk [ rr ] : 2.9 , 95 % confidence interval [ ci ] : 1.46.0 ) [ table 2 ] . comparison of the efficacy outcome measures between the misoprostol group and the placebo group ci : confidence interval . we also compared the incidence of cumulative bishop score increases 3 within 12 h and the incidence of vaginal delivery within 24 h in the two groups separately , and found both of these incidences in the misoprostol group are higher than those in the placebo group [ table 2 ] . the incidence of onset of labor within 24 h in the misoprostol group was significantly higher than that of the placebo group ( 48.0 % vs. 18.4 % , rr : 2.6 , 95 % ci : 1.25.7 ) [ table 2 ] . the median induction - onset of labor intervals in both groups were not able to be calculated because the incidence of onset of labor in each group was 50 % . however , when comparing the induction - onset of labor intervals between the two groups by log - rank test , we found the misoprostol group had significantly shorter induction - onset of labor intervals than the placebo group ( p = 0.0003 ) [ figure 2 ] . meier survival estimates of the difference in the induction - onset of labor intervals between the misoprostol group ( n = 173 ) and placebo group ( n = 49 ) . * significant difference ( p = 0.0003 ) . there was no significant difference in the median process time of vaginal labor ( in hours , median [ q1q3 ] ) between the two groups ( 6.4 [ 4.88.5 ] vs. 6.8 [ 5.09.6 ] , p = 0.695 ) [ table 2 ] . although the incidence of oxytocin augmentation requirement in the misoprostol group tended to be lower than that of the placebo group , there was no significant difference between the two groups ( 25.4 % vs. 36.7 % , rr : 0.7 , 95 % ci : 0.41.4 ) [ table 2 ] . similarly , although the incidence of cesarean section deliveries in the misoprostol group tended to be lower than that of the placebo group , there was no significant difference between the two groups ( 39.3 % vs. 49.0 % , rr : 0.8 , 95 % ci : 0.41.5 ) [ table 2 ] . when comparing the indications for caesarean sections between the two groups , although there was a trend of more operations for suspected fetal distress and fewer for prolonged labor progress in the misoprostol group , this did not reach statistical significance ( p = 0.683 ) [ table 3 ] . comparison of indications for cesarean delivery in the misoprostol and placebo groups , n ( % ) there were no significant differences in the incidences of any of the analyzed maternal and fetal adverse events between the two groups . there were no cases of precipitate delivery , uterine rupture , and amniotic embolism during the study , while uterine hyperstimulation with or without fetal heart rate abnormalities could be seen in both groups . three postpartum hemorrhages were found in the misoprostol group , as compared to none in the placebo group , and the incidence of meconium - stained liquor tended to be higher in the misoprostol group ; however , these data did not reach statistical significance [ table 4 ] . comparison of the incidence of maternal and fetal adverse events in the misoprostol group and the placebo group , n ( % ) * includes the women who had a hysterectomy because of postpartum hemorrhage . eight hours after the third tablet of misoprostol was provided , this woman underwent a cesarean section , because her baby showed a frequent late deceleration in the latent period . during the section , this woman experienced a blood loss of over 5000 ml due to uterine atony , and her vital signs were unstable until she underwent the hysterectomy . the incidence of cumulative bishop score increases 3 within 12 h or vaginal delivery within 24 h in the misoprostol group was significantly higher than that in the placebo group ( 64.2 % vs. 22.5 % , relative risk [ rr ] : 2.9 , 95 % confidence interval [ ci ] : 1.46.0 ) [ table 2 ] . comparison of the efficacy outcome measures between the misoprostol group and the placebo group ci : confidence interval . we also compared the incidence of cumulative bishop score increases 3 within 12 h and the incidence of vaginal delivery within 24 h in the two groups separately , and found both of these incidences in the misoprostol group are higher than those in the placebo group [ table 2 ] . the incidence of onset of labor within 24 h in the misoprostol group was significantly higher than that of the placebo group ( 48.0 % vs. 18.4 % , rr : 2.6 , 95 % ci : 1.25.7 ) [ table 2 ] . the median induction - onset of labor intervals in both groups were not able to be calculated because the incidence of onset of labor in each group was 50 % . however , when comparing the induction - onset of labor intervals between the two groups by log - rank test , we found the misoprostol group had significantly shorter induction - onset of labor intervals than the placebo group ( p = 0.0003 ) [ figure 2 ] . meier survival estimates of the difference in the induction - onset of labor intervals between the misoprostol group ( n = 173 ) and placebo group ( n = 49 ) . there was no significant difference in the median process time of vaginal labor ( in hours , median [ q1q3 ] ) between the two groups ( 6.4 [ 4.88.5 ] vs. 6.8 [ 5.09.6 ] , p = 0.695 ) [ table 2 ] . although the incidence of oxytocin augmentation requirement in the misoprostol group tended to be lower than that of the placebo group , there was no significant difference between the two groups ( 25.4 % vs. 36.7 % , rr : 0.7 , 95 % ci : 0.41.4 ) [ table 2 ] . similarly , although the incidence of cesarean section deliveries in the misoprostol group tended to be lower than that of the placebo group , there was no significant difference between the two groups ( 39.3 % vs. 49.0 % , rr : 0.8 , 95 % ci : 0.41.5 ) [ table 2 ] . when comparing the indications for caesarean sections between the two groups , although there was a trend of more operations for suspected fetal distress and fewer for prolonged labor progress in the misoprostol group , this did not reach statistical significance ( p = 0.683 ) [ table 3 ] . comparison of indications for cesarean delivery in the misoprostol and placebo groups , n ( % ) there were no significant differences in the incidences of any of the analyzed maternal and fetal adverse events between the two groups . there were no cases of precipitate delivery , uterine rupture , and amniotic embolism during the study , while uterine hyperstimulation with or without fetal heart rate abnormalities could be seen in both groups . three postpartum hemorrhages were found in the misoprostol group , as compared to none in the placebo group , and the incidence of meconium - stained liquor tended to be higher in the misoprostol group ; however , these data did not reach statistical significance [ table 4 ] . comparison of the incidence of maternal and fetal adverse events in the misoprostol group and the placebo group , n ( % ) * includes the women who had a hysterectomy because of postpartum hemorrhage . eight hours after the third tablet of misoprostol was provided , this woman underwent a cesarean section , because her baby showed a frequent late deceleration in the latent period . during the section , this woman experienced a blood loss of over 5000 ml due to uterine atony , and her vital signs were unstable until she underwent the hysterectomy . this study is the first double - blinded , prospective randomized controlled clinical trial evaluating the efficacy and safety of intravaginal misoprostol in cervical ripening and labor induction in term pregnancy in china . we found that , compared with the placebo , 25 - g intravaginal misoprostol significantly increased the incidence of cumulative bishop score increases 3 within 12 h or vaginal delivery within 24 h from the start of labor induction , without significantly increasing the maternal and fetal complications and adverse events , which is consistent with other previous studies on the topic . our data also showed that 25 - g intravaginal misoprostol significantly increased the incidence of onset of labor within 24 h and reduced the induction - onset of labor interval when compared with a placebo , which is in agreement with previous reports . our findings suggested intravaginal misoprostol 25 g is efficacious and safe in labor induction and cervical ripening in term pregnancy . on the other hand , 25 - g intravaginal did not significantly reduce the median duration of vaginal labor . further , when we compared the duration of each of the three periods of vaginal labor between the two groups , we similarly did not find any significant difference between the misoprostol and placebo groups ( data not shown ) . this result differs from that of two other randomized controlled trials , which reported a shorter duration of the latency period or active period in the misoprostol group . however , both of these previous studies lacked placebo controls , and may hence have an inherent performance and / or detection bias . our double - blinded , prospective randomized controlled study suggested that 25 - g intravaginal misoprostol could only shorten the induction - onset of labor interval , but it does not have prolonged effects on the process of vaginal labor , as long as the labor starts . herein , although we found that the incidence of caesarean section deliveries in the misoprostol group tended to be lower than in the placebo group , no significant difference was found . similarly , when analyzing the indication of cesarean section , although we found that there was a trend of more operations for fetal distress and fewer for prolonged labor progress in the misoprostol group , it did not reach statistical significance . in the previous studies about misoprostol use in labor induction , the rates of caesarean section in the misoprostol groups were inconsistent , although they tended to be reduced . a recent network meta - analysis of labor induction with pgs found that intravaginal misoprostol ( both tablets 50 g and 50 g ) significantly reduced the cesarean section risk compared with placebo . the insignificance of the difference of the cesarean section rate between the misoprostol and placebo groups in our study might be attributable to the limited numbers of patients recruited , and the effect of misoprostol on reducing the cesarean section rate should be further studied in the future . in terms of the safety assessments , although there were no significant differences in the incidences of the adverse events / serious adverse events between the two groups , there were still some severe adverse events , including one case of hysterectomy due to overwhelming postpartum hemorrhage caused by uterine atony in the misoprostol group . in the previous studies of misoprostol in labor induction , neonatal and maternal mortality , and serious morbidity outcomesour study suggests that , although the incidence of serious adverse events of intravaginal misoprostol insert for labor induction was low , clinicians should still be careful and be aware of the possible complications when using misoprostol for labor induction . in our study , our protocol was decided according to the figo misoprostol recommended dosages , which changed to intravaginal 25 - g misoprostol every 6 h in 2012 , after we had fixed our protocol . until now , no study has been performed on the differences between 4 - hourly and 6 - hourly intravaginal misoprostol in labor induction , although both interval hours have been used in the clinical studies . thus , more studies are needed to determine the optimal interval time for intravaginal misoprostol as a labor inducer . although this was a randomized , double - blinded , controlled study , several limitations exist . first , the inclusion and exclusion criteria may limit the generalizability of the data , particularly the stringent criterion of exclusion of any maternal or fetal compromise . moreover , the solubility of the misoprostol tablets in the vagina , which might affect the onset time of the effectiveness of the tablets , was not recorded in this study . in conclusion , our study suggested that 25 - g intravaginal misoprostol every 4 h is efficacious in labor induction and cervical ripening without significantly increasing the rates of maternal and fetal complications and adverse events . further , 25 - g intravaginal misoprostol could reduce the induction - onset of labor interval , but did not show any effects on the process of vaginal labor . clinicians should always be vigilant of the maternal and fetal complications when using misoprostol as a labor inducer . herein , we provided data from the first double - blinded , prospective randomized controlled study on misoprostol for cervical ripening and labor induction in china . our data from chinese women can contribute to the world 's database of using misoprostol as a labor inductor , and help to reduce the high incidence of cesarean section in this country . the funding source was involved in the study design , but not in the collection , analysis , and interpretation of the data , writing of the report , or decision to submit the article for publication . the funding source was involved in the study design , but not in the collection , analysis , and interpretation of the data , writing of the report , or decision to submit the article for publication .\noutput:\n" }, { "from": "agent", "value": "background : in china , no multicenter double - blinded prospective randomized controlled study on labor induction has been conducted till now . this study is to evaluate the efficacy and safety of intravaginal accurate 25 - g misoprostol tablets for cervical ripening and labor induction in term pregnancy in nulliparous women.methods : this was a double - blinded , prospective randomized controlled study including nulliparous women from 6 university hospitals across china . subjects were randomized into misoprostol or placebo group with the sample size ratio set to 7:2 . intravaginal 25 - g misoprostol or placebo was applied at an interval of 4 h ( repeated up to 3 times ) for labor induction . primary outcome measures were the incidence of cumulative bishop score increases 3 within 12 h or vaginal delivery within 24 h. safety assessments included the incidences of maternal morbidity and adverse fetal / neonatal outcomes.results : a total of 173 women for misoprostol group and 49 women for placebo were analyzed . the incidence of cumulative bishop score increases 3 within 12 h or vaginal delivery within 24 h was higher in the misoprostol group than in the placebo ( 64.2 % vs. 22.5 % , relative risk [ rr ] : 2.9 , 95 % confidence interval [ ci ] : 1.46.0 ) . the incidence of onset of labor within 24 h was significantly higher in the misoprostol group than in the placebo group ( 48.0 % vs. 18.4 % , rr : 2.6 , 95 % ci : 1.25.7 ) ; and the induction - onset of labor interval was significantly shorter in the misoprostol group ( p = 0.0003 ) . however , there were no significant differences in the median process time of vaginal labor ( 6.4 vs. 6.8 h ; p = 0.695 ) , incidence ( 39.3 % vs. 49.0 % , rr : 0.8 , 95 % ci : 0.41.5 ) and indications ( p = 0.683 ) of cesarean section deliveries , and frequencies of maternal , fetal / neonatal adverse events between the groups.conclusion : intravaginal misoprostol 25 g every 4 h is efficacious and safe in labor induction and cervical ripening ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: baclofen is a gamma - aminobutyric acid type b ( gaba - b ) receptor agonist used primarily in the treatment of spasticity and in recent years it has gained popularity as an anti - craving medicine for the treatment of alcohol dependence syndrome .1,2 ) the anti - craving and anti - reward effects of baclofen are attributed to its agonist effect on gaba - b receptors in the ventral tegmental area , which are reported to control the activity of mesolimbic dopamine neurons , one of the major pathways in the regulation of the reinforcing properties of drugs of addiction .3,4 ) baclofen is found to be effective and well tolerated by patients with hepatic impairment also . a provisional evidence of dose - response effect has been demosntarted by addolorato et al. 5 ) with 20 mg three times a day ( tds ) dose found to be more effective than 10 mg tds in suppression of carving for alcohol . there have been individual case reports of using baclofen in a much higher dose , i.e. 270 mg / day for suppressing the craving for alcohol . however there is no systematic study on the use of higher doses .6,7 ) however recently published case reports have shown several serious safety concerns which includes drowsiness , seizure vulnerability , risk for triggering specific pharmacologic withdrawal syndrome and intoxication .811 ) baclofen has previously been reported for inducing behavioural disinhibition and manic like symptoms .1,2 ) due to its mood elevating property its abuse potentiality can not be ruled out . here we are presenting a case of baclofen abuse in a patient with alcohol dependence with comorbid major depressive disorder who reported to have used baclofen in order to overcome his depression . a 36 years old hindu , literate married male patient from urban background took treatment for alcohol dependence and recovered well . he was better but often on , he used to drink alcohol along with his medication baclofen . on enquiry he was found to be having moderate depression with sleep problem for last 1 year . so he was prescribed with quetiapine 100 mg daily along with mirtazepine 15 mg , escitalopram 20 mg , lorazepam 2 mg , and baclofen 20 mg daily . so he discontinued coming for checkup . on the next visit when he came after seven months he revealed that he was only taking mirtazepine 15 mg , lorazepam 2 mg and whenever he takes baclofen 80 mg daily along with those medication he feels much better . his family member also gave history that whenever he takes baclofen 80 mg and sometimes more than that dose his confidence increases becomes irritable and angry . but his work function remains same without deterioration . on understanding his change of behavior after abusing baclofen 80 mg they stopped baclofen butinterestingly during his hypomanic phase he never took alcohol which is most probably for taking baclofen which is an anti - craving drug for alcohol . there have been many case reports depicting manic or hypomanic episode resulting from use of baclofen .1,2 ) the mood elevating property of baclofen has not been properly known . however it is postulated that mood altering property of baclofen may be due to its gaba - b receptor agonist action which results ( a ) acceleration of noradrenaline turnover by changing post synaptic receptor density and ( b ) up regulation of serotonin ( 5ht2 ) receptor thereby leading to diminished liberation of serotonin .12 ) to our knowledge , abusing baclofen due to it mood elevating property has not been reported till date in literature . our patient who did not show any improvement on antidepressant medicines reported to have felt better in terms of his mood state whenever he takes baclofen . the patient may be regarded as a case of resistant depression as per the criteria . he reported that whenever he takes higher doses of baclofen his confidence increases becomes irritable and angry . hypomania / mania symptom checklist ( hcl - 32 ) by angst et al. 13 ) was applied and the score was found to be 12 . naranjo algorithm14 ) was also applied to ascertain the occurrence of such hypomanic symptoms in the patients and the results are shown in table 1.15 ) in our case the score was 7 which means hypomania is probably related to baclofen use and because of it he has started abusing baclofen . baclofen has in recent time gained popularity as an anti - craving agent due to its safety profile in hepatic compromised patients . however , one must be very cautious in using it because of its abuse potential due to its mood elevating property . one possible positive outcome of this report may be that it may be a potential area of research to find out whether baclofen can be used in the treatment of resistant depression .\noutput:\n" }, { "from": "agent", "value": "baclofen is a gamma - aminobutyric acid type b receptor agonist used as an anti - craving agent for treatment of alcohol dependence . it has gained popularity in the recent times because it is well tolerated even in patients with hepatic impairments . herein we are summarizing the latest literature about baclofen induced hypomania and are reporting a case of baclofen abuse because of its mood elevating property in a patient of alcohol dependence with comorbid major depressive disorder . literature review and case study of a 36 - year - old male with alcohol dependence with comorbid major depressive disorder was prescribed with tablet baclofen as an anti - craving agent along with antidepressant medicines . the patients who did not improve with conventional antidepressant therapy started feeling better in terms of his mood symptoms on taking tablet baclofen . owing to the mood elevating property he started abusing baclofen . despite its safety profile in hepatic impairment , one must be very cautious in prescribing baclofen because of its mood altering property which may account for its abuse potentiality ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: expression of genes is regulated at many different levels , transcription of dna being one of the most critical stages . specific configurations of transcription factors ( tfs ) that interact with gene promoter regions are recruited to activate or modulate the production of a given transcript . many of these tfs possess the ability to recognize a small set of genomic sequence footprints called tf - binding sites ( tfbss ) . these motifs are typically 615 bp long and in some cases , they show a high degree of variability . in additionbecause of these flexible binding rules , computational methods for the identification of regulatory elements in a promoter sequence tend to produce an overwhelming amount of false positives . however , the identification of conserved regulatory elements present in orthologous gene promoters ( also called phylogenetic footprinting ) has proved to be more effective to characterize such sequences ( 13 ) . in fact , the ever - growing availability of more genomes and the constant improvement of bioinformatics algorithms hold great promise for unveiling the overall network of gene interactions of each organism ( 4 ) . typically , computational methods to detect regulatory elements use their own training set of experimental annotated tfbss . these annotations are usually collected from bibliography or from general repositories of gene regulation information , such as jaspar ( 5 ) and transfac ( 6 ) . however , each program establishes different criteria and formats to retrieve and display the data that forms the final training set , which makes the comparison between different methods very difficult . the construction of a good benchmark to evaluate the accuracy of several pattern discovery methods is therefore not a trivial procedure ( 7 ) . although important efforts are being carried out to standardize the construction of collections of promoter regions ( 8 ) or the presentation of experimental data ( 9 ) , there is a clear necessity to provide stable and common datasets for future algorithmic developments . in this direction , we present here the release 1.0 of the abs database constructed from literature annotations that have been experimentally verified in human , mouse , rat or chicken . we have gathered from the literature a collection of experimentally validated binding sites that are conserved in at least two orthologous vertebrate promoters . the compiled data are suitable for training both classical pattern discovery programs and new emerging comparative methods . flat files accomplishing the gff standard format were used to store and query the information . the genbank accession number of the sequences in each bibliographical reference was utilized to retrieve the promoters . such sequences were mapped on to the corresponding refseq annotations to ensure we were retrieving the actual promoter . the dbtss database ( 10 ) was finally used to refine the annotation of the tsss . since it is the region in which most experimental studies have been focused on , we considered the sequence 500 bp immediately upstream the annotated tss , as the promoter region in this first release . for each annotated promoter , we only included experimentally tested sites in this proximal region whose motifs were correctly identified in at least two species , i.e. orthologous sites . every known binding site was mapped on to the corresponding promoter sequence by blastn ( 11 ) . those matches that exhibited 80 % of identity between the sequence of the original site and the mapped motif in the promoter region were rejected . we computed blastn ( 11 ) , clustalw ( 12 ) , avid ( 13 ) and lagan ( 14 ) alignments of the orthologous promoters from each gene . moreover , we produced a dotplot of word matches with emboss ( 15 ) to visualize unusually conserved regions . for comparative assessments , computational predictions using the jaspar ( 5 ) , transfac ( 6 ) and promo ( 16 ) collections of position weight matrices were calculated . a very restrictive threshold of 0.85 was used to remove those predicted tfbss whose score was below this value , creating a first group of more reliable predictions . a second group of predictions was produced using a more flexible threshold of 0.70 ( see the abs website for further information about the scoring method ) . release 1.0 of abs database contains 100 annotated orthologous genes , each entry corresponding to two or more species . there is a clear predominance of human and mouse annotations : 73 entries contain at least annotations for human mouse orthologs . a total of 650 experimental binding sites from 68 different tfs are associated with abs entries , covering 8624 nt . in average , three tfbss per sequence have been mapped on to the promoters with an average length of 13.3 nt per site . the tfs that appear more frequently are tbp ( 14.6 % of sites ) , sp1 ( 13.6 % ) and cebp ( 5.6 % ) . those tfs are known to be part of the core of many eukaryotic promoters ( see the abs documentation for further details about the contents of the database ) . the abs database can be accessed through a simple cgi / perl - based web interface at . the following functionalities are implemented in the current release ( see figure 1 ) : for each gene in the collection , show the orthologous promoters and a list of experimentally verified tfbss annotated on the corresponding sequence . promoter sequence alignments , computational predictions , dotplots and cross - references to other well - known databases , such as genbank , entrez gene and pubmed , are also provided for each annotation.retrieve all of the binding motifs associated with a given tf , filtering by species . moreover , a global alignment of the motifs is provided and the corresponding sequence logo representation is displayed by using weblogo ( 17 ) . this information could be used to produce new profiles for subsequent detection of this tf in other promoters.retrieve all of the promoter sequences in which at least one binding site for a given tf was annotated . these sequences and the associated motifs could be used to generate datasets based on known sites to train motif - finding programs.the gene catalogue , the promoter sequences , the collection of annotations , the sequence alignments and the computational predictions are also individually distributed in several flat files . for each gene in the collection , show the orthologous promoters and a list of experimentally verified tfbss annotated on the corresponding sequence . promoter sequence alignments , computational predictions , dotplots and cross - references to other well - known databases , such as genbank , entrez gene and pubmed , are also provided for each annotation . retrieve all of the binding motifs associated with a given tf , filtering by species . moreover , a global alignment of the motifs is provided and the corresponding sequence logo representation is displayed by using weblogo ( 17 ) . this information could be used to produce new profiles for subsequent detection of this tf in other promoters . retrieve all of the promoter sequences in which at least one binding site for a given tf was annotated . these sequences and the associated motifs could be used to generate datasets based on known sites to train motif - finding programs . the gene catalogue , the promoter sequences , the collection of annotations , the sequence alignments and the computational predictions are also individually distributed in several flat files . the abs database aims to become a platform to evaluate new algorithms for the discovery of novel regulatory elements in a set of related gene promoters ( e.g. orthologous promoters or co - regulated genes from microarray experiments ) . in addition to the data retrieval functions , two on - line applications are available to perform the benchmarking of such algorithms ( see figure 2 ) : constructor is a web server to produce synthetic datasets based on the abs annotations . the design of the benchmark is highly flexible allowing to customize the number of sequences , their length , the background nucleotide distribution , the number of motifs to plant on them , the probability to plant a motif , the species and the tfs for which the associated motifs will be randomly selected from the known sites collection . the output consists of the artificial sequences with the embedded motifs , the list of motifs and a graphical representation of the occurrences in the sequences produced with the program gff2ps ( 18 ) . evaluator is a web server to determine the accuracy of a set of predicted motifs in several sequences using a list of known binding sites as a reference set . a complete accuracy assessment at both nucleotide and site levels is computed using the standard measures in the field ( 7,19 ) . the design of the benchmark is highly flexible allowing to customize the number of sequences , their length , the background nucleotide distribution , the number of motifs to plant on them , the probability to plant a motif , the species and the tfs for which the associated motifs will be randomly selected from the known sites collection . the output consists of the artificial sequences with the embedded motifs , the list of motifs and a graphical representation of the occurrences in the sequences produced with the program gff2ps ( 18 ) . evaluator is a web server to determine the accuracy of a set of predicted motifs in several sequences using a list of known binding sites as a reference set . a complete accuracy assessment at both nucleotide and site levels is computed using the standard measures in the field ( 7,19 ) . the abs database can be accessed through a simple cgi / perl - based web interface at . the following functionalities are implemented in the current release ( see figure 1 ) : for each gene in the collection , show the orthologous promoters and a list of experimentally verified tfbss annotated on the corresponding sequence . promoter sequence alignments , computational predictions , dotplots and cross - references to other well - known databases , such as genbank , entrez gene and pubmed , are also provided for each annotation.retrieve all of the binding motifs associated with a given tf , filtering by species . moreover , a global alignment of the motifs is provided and the corresponding sequence logo representation is displayed by using weblogo ( 17 ) . this information could be used to produce new profiles for subsequent detection of this tf in other promoters.retrieve all of the promoter sequences in which at least one binding site for a given tf was annotated . these sequences and the associated motifs could be used to generate datasets based on known sites to train motif - finding programs.the gene catalogue , the promoter sequences , the collection of annotations , the sequence alignments and the computational predictions are also individually distributed in several flat files . for each gene in the collection , show the orthologous promoters and a list of experimentally verified tfbss annotated on the corresponding sequence . promoter sequence alignments , computational predictions , dotplots and cross - references to other well - known databases , such as genbank , entrez gene and pubmed , are also provided for each annotation . retrieve all of the binding motifs associated with a given tf , filtering by species . moreover , a global alignment of the motifs is provided and the corresponding sequence logo representation is displayed by using weblogo ( 17 ) . this information could be used to produce new profiles for subsequent detection of this tf in other promoters . retrieve all of the promoter sequences in which at least one binding site for a given tf was annotated . these sequences and the associated motifs could be used to generate datasets based on known sites to train motif - finding programs . the gene catalogue , the promoter sequences , the collection of annotations , the sequence alignments and the computational predictions are also individually distributed in several flat files . the abs database aims to become a platform to evaluate new algorithms for the discovery of novel regulatory elements in a set of related gene promoters ( e.g. orthologous promoters or co - regulated genes from microarray experiments ) . in addition to the data retrieval functions , two on - line applications are available to perform the benchmarking of such algorithms ( see figure 2 ) : constructor is a web server to produce synthetic datasets based on the abs annotations . the design of the benchmark is highly flexible allowing to customize the number of sequences , their length , the background nucleotide distribution , the number of motifs to plant on them , the probability to plant a motif , the species and the tfs for which the associated motifs will be randomly selected from the known sites collection . the output consists of the artificial sequences with the embedded motifs , the list of motifs and a graphical representation of the occurrences in the sequences produced with the program gff2ps ( 18 ) . evaluator is a web server to determine the accuracy of a set of predicted motifs in several sequences using a list of known binding sites as a reference set . a complete accuracy assessment at both nucleotide and site levels is computed using the standard measures in the field ( 7,19 ) . the design of the benchmark is highly flexible allowing to customize the number of sequences , their length , the background nucleotide distribution , the number of motifs to plant on them , the probability to plant a motif , the species and the tfs for which the associated motifs will be randomly selected from the known sites collection . the output consists of the artificial sequences with the embedded motifs , the list of motifs and a graphical representation of the occurrences in the sequences produced with the program gff2ps ( 18 ) . evaluator is a web server to determine the accuracy of a set of predicted motifs in several sequences using a list of known binding sites as a reference set . a complete accuracy assessment at both nucleotide and site levels is computed using the standard measures in the field ( 7,19 ) . the abs database has been developed to fill the existing gap in the availability of consistent datasets to train and compare different pattern discovery programs . the lack of standard collections of tfbss is specially serious in the case of phylogenetic footprinting data . the collection described here contains 650 experimental tfbss identified in human , mouse , rat and chicken genes . in addition , two web applications ( constructor and evaluator ) are included in this first release to facilitate the development of new motif - finding programs using the abs annotations . in the next release , we plan to increase the number of annotations adding known sites in regulatory regions different from the proximal promoter and eventually incorporate binding motifs from other species . examples of the abs data retrieval system showing the annotation of a gene , the set of binding motifs from a given tf in human and mouse and the extraction of the promoter sequences containing such annotations . protocol to evaluate the accuracy of an external motif - finding program on a synthetic dataset generated by planting motifs from abs in randomly generated sequences .\noutput:\n" }, { "from": "agent", "value": "information about the genomic coordinates and the sequence of experimentally identified transcription factor binding sites is found scattered under a variety of diverse formats . the availability of standard collections of such high - quality data is important to design , evaluate and improve novel computational approaches to identify binding motifs on promoter sequences from related genes . abs ( ) is a public database of known binding sites identified in promoters of orthologous vertebrate genes that have been manually curated from bibliography . we have annotated 650 experimental binding sites from 68 transcription factors and 100 orthologous target genes in human , mouse , rat or chicken genome sequences . computational predictions and promoter alignment information are also provided for each entry . a simple and easy - to - use web interface facilitates data retrieval allowing different views of the information . in addition , the release 1.0 of abs includes a customizable generator of artificial datasets based on the known sites contained in the collection and an evaluation tool to aid during the training and the assessment of motif - finding programs ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "recently , a debate has manifested in the spatial learning literature regarding the shape parameters by which mobile organisms orient with respect to the environment . on one hand are principal - axis - based strategies which suggest that organisms extract the major and minor principal axes of space which pass through the centroid and approximate length and width of the entire space , respectively . on the other hand are medial - axis - based strategies which suggest that organisms extract a trunk - and - branch system similar to the skeleton of a shape . with competing explanations comes the necessity to devise experiments capable of producing divergent predictions . here , we suggest that a recent experiment ( i.e. , sturz and bodily , 2011a ) may be able to shed empirical light on this debate . specifically , we suggest that a reevaluation of the design reveals that the enclosures used for training and testing appear to produce divergent predictions between these strategies . we suggest that the obtained data appear inconsistent with a medial - axis - based strategy and that the study may provide an example of the types of designs capable of discriminating between these geometric strategies of surface - based orientation . such an approach appears critical to fundamental issues regarding the nature of space and spatial perception ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the scourge of hiv / aids infection has assumed occupational dimensions that may be regarded as another face of stigma and discrimination , even from the health sector . clients with hiv often encounter a number of barriers when trying to access treatment , such as negative attitudes of health care providers and long waits at health care facilities . the government of nigeria has the mandate to guarantee the fundamental human rights of her citizens including the right to health ; the right to privacy and informed consent ; the right to be free from torture and cruelty , inhuman or degrading treatment ; the right to life , liberty and security of person ; the right to dignity ; the rights to non - discrimination , equal protection , and equality before the law ; and the right to information ( 1 ) . how well government has been able to do thisstigma and discrimination triggered by hiv and aids epidemic could lead to significant human rights violations for persons living with hiv / aids ( 2 ) . stemming from fear of contracting hiv infection , discrimination adds to the daily struggles faced by the growing number of people living with hiv / aids in many parts of the world . thus individuals living with hiv / aids need to know their rights and need to advocate for themselves whenever their rights are threatened . situation is worsened by harms of a weak health care system , which does not respect patients rights . in the early days of the epidemic , physicians who carry out seriously invasive procedures claim the right to know whether or not their patients are infected with hiv , including the right to screen patients for the virus ( 3 ) . conversely , patients undergoing seriously invasive procedures claim the right to know if their physician is infected with hiv . one could argue that a patient has exactly such a right - to - know on the general grounds of informed consent ; that is , the patient is entitled to information not only about the risks of specific tests or treatments but about other dimensions of health care that might also pose risks ( 4 ) . in 1991 , the american center for disease control ( cdc ) recommended that health care workers ( hcws ) infected with hiv should be reviewed by an expert panel and should inform patients of their serologic status before engaging clients in invasive procedures ( 5 ) . despite studies confirming an infinitesimal level of risk of transmission from infected health care workers to clients , hiv infection alone may not justify restricting any health care worker s professional duties , regardless of the procedures performed as recommended by the cdc ( 5 ) . health care workers may conceal their positive hiv status for the same fear of stigma and discrimination ( 6 ) . the issues surrounding the management of the hiv - infected health care providers are complex and are made more difficult by the lack of relevant data and court precedents . the magnitude of risk of hiv transmission from health care provider to patient is still un - documented . therefore , the questions raised regarding such risk can not be answered by factual evidence at this time . many issues of litigations are however better left to the discretion of competent courts for interpretation so that the rights of both clients and health care providers would not be infringed upon . the objective of this study was to assess perceived rights of hiv positive clients and health care workers towards hiv status disclosure and service provision in lagos state in southwestern nigeria . this is a descriptive cross sectional study to assess perceived rights of hiv positive clients and health care workers towards hiv status disclosure and service provision in lagos in southwestern nigeria . lagos was the former capital of nigeria , mostly urbanized and with a prevalence rate of about 4 % which is still around the average for nigeria ( 7 ) . there were numerous health facilities in the state providing treatment , care and support to hiv positive clients , at various points within the hospital . facilities with full services were usually being referred to as comprehensive sites , while stand alone sites provide some specific services usually through referral and tracking systems already in place . eligible respondents were health care workers giving care to hiv positive clients , and at least for about one year . two of the three senatorial districts in the state were chosen by simple random sampling using simple balloting . in stage ii , from an average of ten facilities per district , five facilities giving hiv care were chosen at random . in stage three , doctors and nurses were conveniently selected for this study among the list of cadres of hospital workers , and because they frequently come in contact with hiv positive clients , and even clients of unknown status . these include eligible health care workers within the facility including from referral units involved in hiv care such as voluntary counseling and testing ( vct ) clinic , art clinic , tuberculosis clinics , and prevention of mother to child transmission clinics . using the formular for calculation of sample size for population less than 10,000 , a total of 260 health care workers were recruited into the study using a knowledge prevalence figure of 0.5 ( 8 ) . research instruments were semi structured , self administered pre tested questionnaires divided into four sections , and administered by three trained assistants over a period of twelve visits . eligible health care staffs on outside posting , core administrative and management staffs , interns and staffs that have spent less than one year in service were excluded from this study . study variables include background data about respondents , perceived rights of clients towards health care provider and vice versa as regards service provision and disclosure of hiv status . data was presented in forms of frequency tables , while association between categorical variable was determined at a significant level of p0 .05 . table 1 shows that thirty six ( 13.8 % ) of respondents were in the age group of 20 - 29 years while 96 ( 37.0 % ) are in the age group of 30 - 39 years . mean age of respondents was 39.3 ( 3.7 ) years , 52 ( 20.0 % ) were males , 208 ( 80.0 % ) respondents are married while 48 ( 18.5 % ) are single . sixty eight ( 26.2 % 0 are doctors while 192 ( 73.8 % ) are nurses by profession . table ii shows that two hundred and forty eight ( 95.4 % ) of respondents had given care to hiv positive clients before . about 216 ( 83.1 % ) think they could be infected when caring for an hiv positive client . while 224 ( 86.2 % ) thinks that it is necessary to screen all clients for hiv before care , 252 ( 96.9 % ) one hundred and eight four ( 70.8 % ) of the health workers studied believed that it is the right of health care workers to know the hiv status of clients before commencement of treatments , 36 ( 13.8 % ) agreed that health care workers have the right to refuse to treat or carry out procedure on hiv positive clients , 188 ( 72.3 % ) agreed that hiv positive clients could infect others including other clients . twenty ( 7.7 % ) believed that hiv positive health care workers should not be allowed to handle clients clinically , 72 ( 27.7 % ) believed that it is the right of hiv positive clients to know the hiv status of health care workers before attending to them , 36 ( 13.8 % ) of respondents has ever disclosed their hiv status to clients before carrying out procedures on them . a majority of respondents believed that hiv positive clients have the right to life , right not to be stigmatized against and the right to mix and freely associate with other people . about 157 ( 60.3 % ) of respondents knew his or her hiv status , fifty six ( 21.5 % ) of respondents were willing to show a hiv positive clients who insist on knowing health care worker s hiv status , 84 ( 32.3 % ) believed that clients have the right to refuse a known hiv positive health care workers to treat or carry out some procedures while 44 ( 24.6 % ) are now willing to always discuss and disclose his or her hiv status with clients . there was no statistically significant association between readiness to disclose hiv status and believe that health care workers have the right to know the status of clients before giving them treatment ( { p = 0.02 ) . majority however believed that they could be infected by caring for an hiv positive client . this findings supports another study in which hiv / aids was found to be increasingly being viewed as an occupational transmitted disease for physicians despite the evidence that human immunodeficiency virus ( hiv ) is exceedingly hard to transmit in health care ( 1 ) . in another study , health staffs are worried about occupational exposure , and they often have high levels of anxiety and fear when dealing with hiv - positive persons ( 9 ) . some physicians may overestimate their risk exposure and so become overly cautious in low or no - risk situations ( 10 ) . four fifth of respondents in this study thinks that it was necessary to screen all clients for hiv before care , the main reason for this could be to ascertain the hiv status of clients with a view to prevent cross infections . this brings the ethical issue of compliance , with the principle of informed consent after voluntary confidential counseling and testing to limelight . some hospitals , irrespective of what the law may permit , already screened their patients without specific informed consent ( 3 ) . hiv / aids is a syndrome of grave magnitude , and hiv infection in a client or a health worker may be a risk source to clients being taken care of and other clients . the possibility of such infection led in the first instance to widespread discussion about the desirability and even perhaps the moral obligation to test all patients as they entered healthcare settings , in order to allow health workers to exercise exposure - avoidance measures in the care of patients whether infected or not . almost all respondents in this study however believed that universal preventive measures should be taken on all clients . this is important as a result of common knowledge of the hiv window period , and that a significant percentage of clients may take longer time to seroconvert and should not be taken as truly negative until proven otherwise . apart from hiv , some other infections may be contracted from clients by health workers contact with bodily fluid of clients . about three quarter of the health workers studied believed that it is the right of health care workers to know the hiv status of clients before commencement of treatments , about one tenth agreed that health care workers have the right to refuse to treat or carry out procedure on hiv positive clients . in a similar supportive study , physicians who carry out seriously invasive procedures claim the right to know whether their patients are infected with hiv , including the right to screen patients for the virus ( 3 ) . another study in tanzania documented a wide range of discriminatory and stigmatizing practices , and categorized them broadly into neglect , differential treatment , denial of care , testing and disclosing hiv status without consent , and verbal abuse / gossip ( 11 ) . however only a little less than two thirds studied respondents knew his or her hiv status . very few of studied respondents believed that hiv positive health care workers should not be allowed to handle clients clinically , about one quarter believed that it is the right of clients to know the hiv status of health care workers before attending to them , while majority also believed that clients also has the right to refuse a known hiv positive health care workers to treat or carry out some procedures . this finding supports a study in which patients undergoing seriously invasive procedures claim the right to know if their physician is infected with hiv ( 4 ) . the claims and counterclaims by clients and health care workers , of right of rights to know each others status and right to be screened may have a lot of implications for the health system . litigations are bound to arise which in this country takes time to get resolved and ultimately make clients to suffer more in accessing care . in addition , doctor - patient relationship for example may be adversely affected and this may undermine trust in service provisions and within the health care system . argument for health care worker s disclosure of status may suffice , but may not necessarily be strong enough to warrant disclosure by a health care worker to client since risk of contracting hiv infection may not be as high compared to other methods of transmission . however , authors felt that health - care workers should indeed offer information about risks in the course of medical care in response to patients worries about hiv infection . while the privacy of either suspected or confirmed hiv positive health care workers or clients could be jeopardized by this strained relationship , the health worker may be further stigmatized as some clients may not want to choose infected doctors or health care workers to treat them , and this may discourage the generality of health workers from going for hiv testing . there is a need to strengthen the legal system into making legal interpretation of issues and decision on such matters of claims and counter claims to know hiv status without fear or favour to any of the parties concerned . this is also an argument for a review of training curriculum of health students on medico legal issues , as well as better involvement of more health care workers including doctors in medico legal issues and forensic medicine . emphasis should be placed on health care workers considering all clients as potentially being positive and negative ones being in the window period . in addition , the attitude of health care workers towards disclosure as discovered in this study also suggests a need to be more careful to avoid inter professional conflicts within the health systems , as well as between clients and their care providers . in the modern day rapidly changing atmosphere of health care , the rights of the patient have been given prominence . patient rights have recently become the center of national attention in the practice of medicine . however clients autonomy may supersedes all other rights while the health workers right also needs recognition . autonomy can also be defined as the freedom and authority to choose one s own actions . respect for the autonomy of patients is an important goal though it can conflict with a competing ethical principle . this belief is the central premise of the concept of informed consent and shared decision making . as a patient , you have certain rights , some are guaranteed by federal law , such as the right to get a copy of your medical records , and the right to keep them private . many countries and states have additional laws protecting patients , and healthcare facilities often have a patient bill of rights . some countries have pushed for legislation of a patients bill of rights to safeguard this autonomy disclosures of hiv status can damage the privacy of persons living with hiv or aids and have other negative consequences such as stigma , discrimination , violence , and social isolation . disclosure may also lead to serious economic harm , including loss of employment , insurance , or housing . on the other hand , disclosure of information about hivmay be required for public a typical approach taken by many laws is to establish a default rule that the privacy of hiv information should be protected and only disclosed under specified circumstances . beyond these specified exceptions , disclosures of hiv information , whether intentional or negligent , will constitute a breach of privacy and may result in civil liability , criminal penalties , or other serious sanctions , such as suspension of medical license . however discrimination remains , even within the scientific community where the risk of infection has resulted in reluctance to treat hiv - positive individuals ( 12 ) . aside from moral arguments , scientific evidence has not been able to support such a position . healthcare institutions should develop specific policies to deal with such exposure for source health care professionals who refuse testing . direct denials of care on the basis of hiv status are often prohibited under general anti - discrimination legislation or through disability or hiv - specific laws . some countries have chosen to enact specific protections against discrimination based on hiv status in the health sector within national legislation or policy . legal frameworks that address the workplace and occupational health and safety issues also may contribute to antidiscrimination protections . while antidiscrimination laws and policies provide a clear message that it is inappropriate to refuse to treat hiv - positive persons due to their hiv status . it is thus important to go into more evidence based research that could reveal more facts and information on extent and nature of occupational exposure in patienthealth care workers relationship , encourage health care workers to go for hiv testing , and encourage health care workers to be ethical in their practice and dealing with clients , and ultimately reduce possible litigation measures that could dent the image of the health sector . both hiv positive clients and health care providers have rights under the law as regards disclosure of test results to each other as conditions for service provision . both should embrace counseling and testing of hiv , work towards reduction in stigma and discrimination and respect each others right . the legal system should be strengthened to address and interprete issues of rights between clients and their health care providers .\noutput:\n" }, { "from": "agent", "value": "introduction : close interaction between clients and health care workers as regards disclosure , refusal of treatment and right to know status has been a subject of debate in legal and medical quarters . the objective of this study was to assess perceived rights of health care workers towards disclosure of hiv status in lagos state in southwestern nigeria.methods : this was a descriptive cross sectional study carried out among 260 health care workers using multistage sampling technique . research instruments were semi structured self administered and pre tested questionnaires . data was analyzed using the spss softwares.results : mean age of respondents was 39.3 ( +3.7 ) years . one hundred and eight four ( 70.8 % ) of the health workers studied said that it is the right of health care workers to know the hiv status of clients before commencement of treatments , and 36 ( 13.8 % ) agreed that health care workers have the right to refuse to treat or carry out procedure on known hiv positive clients . twenty ( 7.7 % ) said that hiv positive health care workers should not be allowed to handle clients clinically , 72 ( 27.7 % ) believed that it is the right of hiv positive clients to know the hiv status of health care workers before attending to them , 36 ( 13.8 % ) of respondents has ever disclosed their hiv status to clients before carrying out procedures on them . fifty six ( 21.5 % ) of respondents were willing to show their result results to a hiv positive clients who insist on knowing his or her hiv status , 84 ( 32.3 % ) believed that clients has the right to refuse a known hiv positive health care workers to treat or carry out some procedures.discussion : there was no statistically significant association between readiness to disclose hiv status and believing that health care workers have the right to know the status of clients before given them treatment ( { p < 0.05 ) . conclusion : the need to balance out perceived rights of health care workers and clients would assist in provision of quality services to hiv positive clients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the aging of society along with the lack of caregivers forces innovations to help people in their daily lives . nowadays , robots come in many forms and can be used in many ways to help people with disabilities . although much research has been done in the field resulting in several prototypes , few assistive robots exist in common use today . the high costs and the uncertainty regardingfor example , an engineering design with only healthy subjects many times leads to a system not appropriate for the target population of persons with a disability . engineers , therapists , physiatrists , and ergonomics experts as well as the end users ( people with disabilities ) should be a part of the design team from the beginning of any such effort . to this end , the design team should be able to measure the satisfaction of the end users at any stage of the development phase . measuring user satisfaction helps to measure the overall quality of a product or service . tracking user satisfaction during the development phase can help developers and researchers make sure that the changes they are making improve the product / service for users . in customer relationship management , user ( or customer ) satisfaction is a measure of the degree to which a product or service meets the user 's expectations . consumer satisfaction is a central concept in many domains ( business , research , etc . ) and has held a central position in marketing since the 1950s until today , with an increasing interest and importance . the realization of this importance has led to a proliferation of research on consumer satisfaction . according towe can distinguish two different types of user satisfaction : the process - oriented approach ( equal to the difference between expected satisfaction and achieved satisfaction ) and the outcome - oriented approach ( as an attribute extracted from a product or service after its consumption ) . the evaluation of any technology device requires the objective and subjective assessment of the product / service . an objective assessment is one that needs no professional judgment to give a score correctly , while subjective assessment yields many possible answers of varying quality and requires professional judgment to give a score . subjective assessment records the facts presented by the end user that show his / her perception , understanding , and interpretation of what is happening and therefore measures his / her satisfaction . the evolution of information and communication technologies ( ict ) along with nanotechnology and other sciences ( e.g. , medicine and behavioral science ) presents a unique potential for innovative technology products and services that help people in their daily lives . the application of such innovations in healthcare has already driven in products that some years ago belonged to the scientific imagination sphere . for example , robotic technology has provided the opportunity to benefit the lives of people with disabilities ( i.e. , as a manipulator mounted on a desk or wheelchair or mobile base or body worn ; as a mobility or communication assistant ; etc . ) . many commercial products are available nowadays for mobility and manipulation for people with physical disabilities ( e.g. , the tek rmd and the manus robotic arm ) , for telepresence purposes , and so forth , while others are being developed at research institutions worldwide . to this end , researchers are struggling to collect end users ' sentiments towards the technologies developed in order to match the products with the real needs of the end customers . rehabilitation robotics is a special branch of robotics which focuses on machines that can be used to help people recover from severe physical trauma or assist them in activities of daily living . rehabilitation robotics has applications in all areas of physical therapy , presenting a wide range of advancements in robotic prosthesis and other domains . another important sector is that of assistive robotics , which tries to combine and integrate several technologies in order to meet the needs of people with various disabilities . focusing on the healthcare sector , quality of care and patient satisfaction are major issues . thus , the assessment of any service or device from the perspective of the patient is crucial . the current study is concerned with the question of whether any reliable and valid instruments have been developed to assess assistive or rehabilitation robot devices from the user 's perspective . to the best of our knowledge , a search of peer - reviewed published literature was conducted in january 2016 for articles related to the subjective assessment of assistive or rehabilitation robot devices . this was performed through the internet via medline , pubmed , scopus , and cirrie . the keywords used ( employing boolean phrases ) in the searches included the following : satisfaction , assessment , assess , user , subjective , robot , robotic , assistive , rehabilitation , psychometric , test , scale , metrics , evaluation , usability , acceptability , and acceptance . the resulting publications were examined in a first step for potential inclusion based on their title and abstract , while we excluded any duplication . in a second step , after reviewing the abstract and title , the remaining publications underwent a full text review . after the initial screening ( reviewing the titles and abstracts and removing duplicates ) , the number was reduced to 312 articles . the eligibility criteria for inclusion were as follows : ( i ) studies involve assistive or rehabilitation robot devices ( e.g. , socially assistive robots , robot controlled wheelchairs , and exoskeleton devices ) , ( ii ) at least one outcome measure was used in the study , ( iii ) the study should include formative , process , or summative evaluation that assesses the rehabilitation or assistive robot device , ( iv ) the study was a peer - reviewed article ( published in a journal or conference ) , and ( v ) articles are written in the english language . finally , all articles were evaluated in terms of the clarity of the evidence presented . the main factors for excluding many articles included the following : ( i ) article was not written in english , ( ii ) the study provided a descriptive summary of the evaluation without giving more details ( e.g. , questionnaire / scale used ) , ( iii ) the number of participants in the study was very limited ( 3 participants ) or undefined , ( iv ) articles / studies were in the following subject areas : biochemistry , genetics and molecular biology , mathematics , chemical engineering , social sciences , materials science , physics and astronomy , psychology , arts and humanities , immunology and microbiology , agricultural and biological sciences , decision sciences , dentistry , energy , environmental science , business management and accounting , chemistry , earth and planetary science , pharmacology - toxicology and pharmaceutics , and undefined , ( v ) articles were in books and notes , and ( vi ) they assessed the technology used through quantitative data only ( objective evaluation ) . for data extraction and analysis purposes we followed the cochrane research methodology . the processing and organization of the articles was made using the ms excel and endnote x6 .0.2 programs . even though the initial query returned a large number of articles ( n = 3147 ) , only 312 ( 9.914 % of 3147 ) underwent a full text review . finally , 31 articles ( 9.935 % of 312 ) met the inclusion criteria and were included in the review . a wide range of rehabilitation and assistive robot devices are reviewed in table 1 ( e.g. , wheelchairs , exoskeleton devices , socially assistive robots , therapeutic systems , telepresence systems , and haptic technologies ) . the majority of the research presented was conducted in the united states of america ( 15.2 % ) and italy ( 12.1 % ) , followed by canada ( 9.1 % ) , netherlands ( 9.1 % ) , japan ( 9.1 % ) , france ( 9.1 % ) , spain ( 9.1 % ) , the united kingdom ( 6.1 % ) , germany ( 6.1 % ) , south korea ( 3 % ) , portugal ( 3 % ) , israel ( 3 % ) , and austria ( 3 % ) . in the majority of the studies there were a limited number of patients participating either due to research / pilot testing or due to difficulty finding the right participants fitting in the study . twenty - two out of the thirty - one studies used patients to evaluate the device , while three recruited college or university students , two recruited healthcare professionals , and the remaining four used healthy subjects . the last column of table 1 presents the number of items ( questions ) used in each study under the subjective measure used . in table 1 , when used , means that there is no evidence ( at least to the authors ' knowledge ) that the specific subjective measure / scale is valid or reliable . the authors decided to use this instead of marking the specific measure as not valid or not reliable because the articles report the scale as valid . however , after searching the literature , we found no evidence on the validity and reliability of the scale in the language used in the specific study ; so , we decided to present it as being in question in terms of its validity and reliability in the language used . moreover , in the last column of the table there may appear two values separated by a comma . this means that the study used two different subjective measures and each value in the column represents the number of items ( questions ) used for each one of them . the review of the literature provided a thorough survey of evaluations for rehabilitation or assistive robot devices concerning the satisfaction and the subjective assessment of the end users . the review began with a great number of articles returned ( n = 3147 ) but was ultimately narrowed to 312 of which 31 were finally included in the review . the majority of the articles failed to meet the inclusion criteria presented because most of the studies evaluated the devices by using only objective measures ( e.g. , fugl - meyer scale , modified ashworth scale , barthel index , and nasa - tlx ) and other clinical measurements relevant to the scope and the population of the study . it is really impressive that the great majority ( 66.7 % ) of the research included in the review used custom - made subjective measures to evaluate the satisfaction of the end users and assess the rehabilitation or assistive robot device used subjectively . someone should also consider the following facts : two ( 2 ) studies used semistructured interviews due to the lack of any valid and reliable subjective measurement instrument.two ( 2 ) studies used the canadian occupational performance measure ( copm ) which is a semi - interview that enables an open dialogue between the end user and the therapist on issues of importance to the patient . it is designed to identify occupational performance problems faced by the patient . during the interview , the therapist tries to identify daily occupations of importance that the patient wants to do , needs to do , or is expected to do but is unable to accomplish . other domains are also covered , like self - care , productivity , or leisure . due to the nature of copm , as described above , it can not be adopted in all kinds of purpose rehabilitation or assistive devices.four ( 4 ) studies used the system usability scale ( sus ) which is a quick and dirty ten - item scale for administering after usability tests . however , this scale measures only basic issues of the device and does not take into account other very important issues , like the adaptability of the device , the feeling of safety , the social perception of the user when using the device , the individual dimensions of the device , if it fits well in the environment of the end user , and so forth . so , this scale can capture only very basic issues of the subjective assessment needed for robot - based devices.one ( 1 ) study utilized the telehealthcare satisfaction questionnaire - wearable technology ( tsq - wt ) . there has not yet been published ( at least to the authors ' knowledge ) any article in any language related to the validity and reliability of this questionnaire . thus , it can not be considered a reliable and valid instrument for the subjective assessment of a technology device.two ( 2 ) studies utilized the quebec user evaluation of satisfaction with assistive technology ( quest 2.0 ) scale . according to holz et al . moreover , it has been tested for its validity and reliability in several applications and languages . although this scale is used with assistive devices , del - ama et al. used only 7 of the 12 questions incorporated in the original questionnaire in their study.according to the previous analysis , it is apparent that finally 93.9 % of the reviewed studies used neither valid nor reliable instruments to assess the robot devices . only 6.1 % of them used a validated measure ( the quest scale ) , which can assess only a subset of the desired aspects ( as described in the next paragraphs ) . two ( 2 ) studies used semistructured interviews due to the lack of any valid and reliable subjective measurement instrument . two ( 2 ) studies used the canadian occupational performance measure ( copm ) which is a semi - interview that enables an open dialogue between the end user and the therapist on issues of importance to the patient . it is designed to identify occupational performance problems faced by the patient . during the interview , the therapist tries to identify daily occupations of importance that the patient wants to do , needs to do , or is expected to do but is unable to accomplish . other domains are also covered , like self - care , productivity , or leisure . due to the nature of copm , as described above , it can not be adopted in all kinds of purpose rehabilitation or assistive devices . four ( 4 ) studies used the system usability scale ( sus ) which is a quick and dirty ten - item scale for administering after usability tests . however , this scale measures only basic issues of the device and does not take into account other very important issues , like the adaptability of the device , the feeling of safety , the social perception of the user when using the device , the individual dimensions of the device , if it fits well in the environment of the end user , and so forth . so , this scale can capture only very basic issues of the subjective assessment needed for robot - based devices . one ( 1 ) study utilized the telehealthcare satisfaction questionnaire - wearable technology ( tsq - wt ) . there has not yet been published ( at least to the authors ' knowledge ) any article in any language related to the validity and reliability of this questionnaire . thus , it can not be considered a reliable and valid instrument for the subjective assessment of a technology device . two ( 2 ) studies utilized the quebec user evaluation of satisfaction with assistive technology ( quest 2.0 ) scale . moreover , it has been tested for its validity and reliability in several applications and languages . although this scale is used with assistive devices , del - ama et al. used only 7 of the 12 questions incorporated in the original questionnaire in their study . in the early years of many technical fields , the research community often utilizes a wide range of metrics that are not comparable due to a bias towards application specific measures . the primary difficulty in defining common metrics is the incredibly diverse range of human - robot or robot assisted applications . thus , although metrics from other fields ( hci , human factors , etc . ) can be applied to satisfy specific needs , identifying metrics that can accommodate the entire application space may not be feasible . attempts to categorize both objective and subjective metrics have been made . according to the usus evaluation framework for human - robot interaction the factors usability , social acceptance , user experience , and societal impacteach category is divided into specific metrics , either objectively or subjectively measured : usability . performance expectancy , effort expectancy , attitude towards using technology , self - efficacy , forms of grouping , attachment , and reciprocity.user experience . embodiment , emotion , human - oriented perception , feeling of security , and coexperience with robots.societal impact . all effects of the introduction of robotic agents ' consequences for the social life of a specific community ( taking into account cultural differences ) in terms of quality of life , working conditions and employment , and education.among these , the authors propose that the following could be tested using end - user questionnaires , which means that they could be considered subjective : utility . it refers to how an interface can be used to reach a certain goal or to perform a certain task . the more the tasks the interface is designed to perform , the more the utility it has.performance expectancy . it is the degree to which an individual believes that using the system will help him or her to attain gains in performance.effort expectancy . it indicates to which extent the user perceives that a system will be easy to use.attitude towards using technology . it is the sum of all positive or negative feelings and attitudes about solving working tasks supported by a humanoid robot.self - efficacy . it is an affection - tie that one person forms between themselves and another person or object a tie that binds them together in space and endures over time.reciprocity . it describes the relationship between a system and its environment and can be measured by investigating the different perturbatory channels like morphology , which has impact on social expectations.emotion . an emotion is an essential part in social interaction ; it has to be incorporated in the assessment and design of robots.feeling of security . it is important to investigate how to design human - robot interactions in a way that humans experience them to be safe.coexperience . coexperience describes experiences with objects regarding how individuals develop their personal experience based on social interaction with others.societal impact . societal impact describes all effects the introduction of robotic agents results in for the social life of a specific community taking into account cultural differences in terms of quality of life , working conditions , employment , and education.the above categorization is the most full and detailed , including aspects that are rarely taken into account when it comes to evaluating a robotic assistant . most researchers , however , when evaluating an assistive device / technology tend to use questionnaires that give information on the aforementioned fields . however , as bartneck et al . mention , due to their naivety and the amount of work necessary to create a valid questionnaire , developers of robots have a tendency to quickly cook up their own questionnaires . this conduct results in two main problems : firstly , the validity and reliability of these questionnaires have often not been evaluated and , secondly , the absence of standard questionnaires makes it difficult to compare the results from different researchers . the findings of our review study support this conclusion . however , the existing variety of questionnaires that could be useful for the assessment of rehabilitation or assistive robot devices is narrow , for the reasons described above . effectiveness , efficiency , learnability , flexibility , robustness , and utility . social acceptance . performance expectancy , effort expectancy , attitude towards using technology , self - efficacy , forms of grouping , attachment , and reciprocity . embodiment , emotion , human - oriented perception , feeling of security , and coexperience with robots . societal impact . all effects of the introduction of robotic agents ' consequences for the social life of a specific community ( taking into account cultural differences ) in terms of quality of life , working conditions and employment , and education . utility . it refers to how an interface can be used to reach a certain goal or to perform a certain task . the more the tasks the interface is designed to perform , the more the utility it has . performance expectancy . it is the degree to which an individual believes that using the system will help him or her to attain gains in performance . it indicates to which extent the user perceives that a system will be easy to use . it is the sum of all positive or negative feelings and attitudes about solving working tasks supported by a humanoid robot . it is an affection - tie that one person forms between themselves and another person or object a tie that binds them together in space and endures over time . reciprocity . it describes the relationship between a system and its environment and can be measured by investigating the different perturbatory channels like morphology , which has impact on social expectations . emotion . an emotion is an essential part in social interaction ; it has to be incorporated in the assessment and design of robots . it is important to investigate how to design human - robot interactions in a way that humans experience them to be safe . coexperience describes experiences with objects regarding how individuals develop their personal experience based on social interaction with others . societal impact describes all effects the introduction of robotic agents results in for the social life of a specific community taking into account cultural differences in terms of quality of life , working conditions , employment , and education . as derived from the current review , quest 2.0 may be one questionnaire that can be used in the examined field . however , a strategy that would target maximum coverage of the subjective measures spectrum would require the combined use of two ( or more ) questionnaires , since quest 2.0 covers only some subjective aspects ( mainly : feeling of security , perceived effectiveness , and ease of use ) . we should therefore look into the literature for other valid and reliable scales that are used in different sectors and may be applicable to the examined domain . other valuated and relevantly common used questionnaires we found in the bibliography were the assistive technology device predisposition assessment - ( atdpa - ) device form and the psychosocial impact of assistive devices scale ( piads ) . the atdpa - device form is more relevant in context than the piads , targeting the evaluation of overall user experience with assistive technology , while piads only emphasizes the psychosocial impact of assistive devices , without targeting the evaluation of the actual experience of interacting with a robot device , but rather the impact that this interaction has on quality of life ( qol ) . other questionnaires such as the use - it questionnaire were ruled out from the very beginning , since they were not well valuated or not widely used from researchers in the bibliography . it seems therefore that a combination of the quest 2.0 questionnaire and the assistive technology device predisposition assessment - ( atdpa - ) device form covers most of the desirable user - experience aspects , with ensured validity and reliability . however , no scales have been identified yet in the literature that could be adopted well and measure the individual functionalities of rehabilitation or assistive robot devices . to this end , the authors developed and are currently examining a new scale called pytheia in order to fill the identified gap . more specifically , according to the results from the exploratory factor analysis ( efa ) with varimax rotation performed , the pytheia instrument presents a three - factor model ( the independent functionalities factor , the fit to use , and the ease of use factors ) . the overall cronbach of pytheia was found to be 0.793 , indicating sufficient consistency . the icc was excellent ( icc = 0.992 , p = 0.000 ) , indicating that the pytheia total scores were highly consistent between initial assessment and reassessment . the paired - samples t - test between the two instances of administration indicated no statistically significant systematic bias ( p = 0.059 ) . pearson 's r correlation coefficient indicated stability of participants ' responses over time ( pearson 's r = 0.984 , p = 0.000 ) . examination of item convergent validity showed that all item intercorrelations for all item pairings were strong or excellent . pearson 's r ranged from 0.946 to 0.996 for the first factor independent functionalities , from 0.465 to 0.724 for the second fit to use , and from 0.354 to 0.732 for the third factor ease of use . this provides evidence that all subscales ' items are related to the same construct . in this paper we conducted a systematic review of the literature in order to identify existing scales for the subjective assessment of rehabilitation and assistive robot devices . we found that most of the studies are utilizing either custom - made questionnaires or interviews that are neither valid nor reliable instruments to represent the subjective opinion and perception of the end users . there is therefore a great gap in the subjective assessment of rehabilitation or assistive robot devices . the absence of standard scales / questionnaires for the subjective assessment of robot - based devices makes it difficult to design products that meet exactly the needs of the intended end users , to further improve prototypes , or to compare the results from different researchers . based on the findings of the review , in order to further improve the subjective assessment of rehabilitation and assistive robot devices it is necessary for each study to ( i ) select as subjects the appropriate target group based on clear and valid inclusion criteria , ( ii ) involve a sufficient number of representative subjects , ( iii ) analyse statistically the collected data , and ( iv ) select an established methodology in order to enable comparison between results of different studies .\noutput:\n" }, { "from": "agent", "value": "the objective of the current study is to identify and classify outcome measures currently used for the assessment of rehabilitation or assistive robot devices . we conducted a systematic review of the literature using pubmed , medline , cirrie , and scopus databases for studies that assessed rehabilitation or assistive robot devices from 1980 through january 2016 . in all , 31 articles met all inclusion criteria . tailor - made questionnaires were the most commonly used tool at 66.7 % , while the great majority ( 93.9 % ) of the studies used nonvalidated instruments . the study reveals the absence of a standard scale which makes it difficult to compare the results from different researchers . there is a great need , therefore , for a valid and reliable instrument to be available for use by the intended end users for the subjective assessment of robot devices . the study concludes by identifying two scales that have been validated in general assistive technology devices and could support the scope of subjective assessment in rehabilitation or assistive robots ( however , with limited coverage ) and a new one called pytheia , recently published . the latter intends to close the gap and help researchers and developers to evaluate , assess , and produce products that satisfy the real needs of the end users ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: there have been many attempts over the past decades for automating cancer grading in tissue , most notably in breast and prostate tissue , where the standard scoring systems in use are the elston and gleason grading systems , respectively . more recently , high classification rates were obtained for the simple case of discriminating between low - grade and high - grade cancer in prostate tissue . there have been attempts in at performing the classification task and extracting a large and diverse feature set including color , texture , morphometric , fractal , and wavelet features . often this is followed by a feature reduction method such as sequential forward feature selection as in or similar greedy algorithms , which , though being suboptimal approaches , are motivated by the fact that the feature set is large and a brute force or branch - and - bound method may become intractable or computationally inefficient . often a main factor that limits automated classification lies not in the choice of classifier but in the choice of feature set . the discriminative ability of a classifier is limited by the extent to which the classes themselves are separate in feature space . for well - represented classes , the intrinsic overlap and proximity of the classes in feature spacethe selection of a large number of different types of features is common in practice and is often an indication of lack of knowledge as to what features exactly have discriminative power ; instead it reflects speculation over which features may prove useful or may have a contributing role . however , choosing a plethora of features , whether informative or not , increases the dimensionality of the feature space and often exposes the classification task to the peaking phenomenon . furthermore , this shifts the burden of the problem toward feature selection or extraction which is often difficult to solve in a manner that is true to the final objective ( i.e. , the final classification rate ) , and this is due to computational limitations and the prevalence of either suboptimal criteria or criteria that are often not aligned with the final objective . it is therefore important to select a discriminative set of features that is able to separate among the different classes . one reason lies in the difficulty of translating the experience and observations of the human expert , that is , the trained pathologist , into well - defined features that can be extracted automatically from the image . moreover , due to the complexity of the tissue structure and subjectivity of the grading process , especially among the intermediate grades , there is no clear consensus as to which features or combination of features is to be used consistently . upon deeper examination , we find that experts ' rules tend to eventually branch out into increasingly complicated conditions and exceptions . there is therefore a problem in identifying features explicitly , and moreover even when such features have been suggested by pathologists , the complexity and variability of the images and tissue structures in addition to variables relating to stain absorption can still obstruct the extraction of such features in a reliable manner that allows for automation . in general , there is a sensitive balance between overadapting to the complexity of the problem on the one hand and weakly accounting for it on the other hand such as the case when extracting global texture features without taking into account any knowledge of tissue architecture . both of these extreme approaches may lead to inadequate results and an inability to generalize well . in the approach that we propose , we avoid the explicit extraction of structure properties ( such as nuclei shape , glandular unit shape , and thickness of epithelium layer ) beyond a rough decomposition of images into a few classes based on the staining . yet , the method is still strongly founded on the architecture of glandular tissue ( such as breast or prostate ) and relies upon detecting glandular lumen and tissue components as a starting point . we use sequential region expansion to sample the space around lumen regions in the form of rings and preserve the statistics and component ratios within these rings in order to describe and represent these regions in an implicit manner . during the progression of cancer into advanced stages , when a glandular unit transforms into cribriform shape or splits into multiple lumen regions , such a phenomenon should be detected by the method due to the unusual presence of lumen and other structures in the outer sampling rings which reflects on the shape of the extracted profile curve and consequently on its classification and labeling . as opposed to most local neighborhood sampling or bag of features methods that either are patch - based or result in orderless , histogram - based features , the method we propose does the sampling around a given ( lumen ) region as opposed to a pixel , while preserving the region 's boundary shape and encoding spatial distance from it . the contributions of our work can be stated as follows.we present a new approach to encode features in complex tissue images such as prostate and breast . the approach called statistical proximity sampling relies on a method of boundary expansion around lumen regions ; it uses rings or neighborhood strips around these regions while preserving the boundary shapes.the method is able to simultaneously encode the relative quantitative proportions of each tissue type around a lumen region as well as the spatial distribution of these proportions from the central lumen region , resulting in highly descriptive and discriminative features.combining this neighborhood - based feature description with multiple - instance learning , we are able to represent complex images in an efficient and information - preserving manner , which is more consequential than representing an entire image with a single feature vector . we present a new approach to encode features in complex tissue images such as prostate and breast . the approach called statistical proximity sampling relies on a method of boundary expansion around lumen regions ; it uses rings or neighborhood strips around these regions while preserving the boundary shapes . the method is able to simultaneously encode the relative quantitative proportions of each tissue type around a lumen region as well as the spatial distribution of these proportions from the central lumen region , resulting in highly descriptive and discriminative features . combining this neighborhood - based feature description with multiple - instance learning , we are able to represent complex images in an efficient and information - preserving manner , which is more consequential than representing an entire image with a single feature vector . to highlight the context of our work , we briefly describe below the elston and gleason grading systems and how our method relates to some important aspects of these . tubularity , where the presence of glandular tissue in the sample is given a score from 1 to 3 , ranging , respectively , from healthy tissue ( prevalently glandular ) to solid tumors ( scarcely glandular ) . the second component is nuclear pleomorphism and is concerned with nuclear size , shape , and chromatin texture ; this attribute is also assigned a score from 1 to 3 depending on the morphological irregularities of nuclei . the third component of grading is mitotic activity which corresponds to growth rate and is determined by counting dividing cells , ranging from a low cell count ( score 1 ) to a high cell count ( score 3 ) . the final , high - level elston gradeis then derived by summing up the individual scores from the three parts : a sum of 35 points is defined as elston grade i , 6 - 7 as grade ii , and 8 - 9 as grade iii . analogously , gleason grading for prostate is based on five patterns , which are highly dependent on tissue architecture and the description of glandular units . the patterns from 1 to 5 are described by how glands alter form while transitioning from small , well - defined , and closely packed units , corresponding to well - differentiated carcinoma ( pattern 1 ) , to larger glandular units with increased interglandular distances , corresponding to moderately differentiated carcinoma ( pattern 2 ) , until the glands are no longer recognizable and cells start to invade surrounding tissue in neoplastic clumps . in pattern 5 , thus , in conclusion , both gleason grading and the first component of elston grading are based on patterns that are defined by the amount and architecture of glandular units and tubules present in the tissue sample . the ability to identify tubules and glandular structures is an essential requirement for both grading systems . while there is a lot of work on identifying nuclear pleomorphism and mitotic count , as most recently in , our contribution in this paper is to propose a new effective way of extracting information concerning glandular architecture , which is directly related to the first component in elston grading and is an essential part of gleason grading . in particular , what we present in this paper is a method that enables us to distinguish between images with tubular structures , denoted by c1 , and images lacking tubular structures , denoted by c0 , where these images are taken from both healthy and cancerous breast tissue , since we want to be able to identify tubules in both healthy and cancer tissue samples . the grading of cancerous tissue of glandular organs such as prostate and breast is to a large extent based on the tissue architecture around the glandular lumen regions . in previous work , we have presented automated methods for color decomposition and pattern - based image segmentation that result in density or probability maps , one per stained tissue type . in the current work , we present a method that uses such types of maps as input for deriving a set of features based on statistically sampling the neighborhood of lumen regions . our method proceeds in the following manner.a tissue image is softly classified into a set of k probability maps using any method such as color decomposition ( see ) or a pattern analysis approach ( see ) ; an example is shown in figure 1 , where the k tissue types correspond to lumen , epithelium , nuclei , and stroma.starting from the lumen regions , each region is separately dilated by a square structuring element in sequential unit steps forming a set of rings or annuli around the original lumen space ( see figure 2 ) . these rings are regarded as neighborhood strips from which we will gather statistics on the quantity and location of surrounding tissue types . the boundary shape is preserved within a reasonable number of sampling rings.within each ring , we compute the proportions of the different tissue types ( lumen , epithelium , nuclei , and stroma ) using the derived probability maps . thus , for each ring , we obtain a vector of length k. for instance , a vector such as [ 0.2 , 0.4 , 0.1 , 0.3 ] in a given ring indicates that the relative proportions of lumen , epithelium , nuclei , and stroma are 20 % , 40 % , 10 % , and 30 % , respectively.the vectors obtained in step ( 3 ) are stacked , forming a single vector of length r k , where r is the number of rings used , that is , neighborhood strips . thus each lumen region from step ( 1 ) will be represented by such a feature vector of length r k. an example of these vectors is shown in figure 4 , where there are 4 lumen regions and consequently 4 such feature vectors plotted using different colors.we present each image as a bag or collection of feature vectors corresponding to lumen regions in the image . thus , we use multiple - instance learning to represent an image using a collection of feature vectors and perform the classification of each image based on its contents . we also use the bag dissimilarity approach to decouple the classification task from the multiple - instance formulation , allowing us to use any type of classifier without difficulty . a tissue image is softly classified into a set of k probability maps using any method such as color decomposition ( see ) or a pattern analysis approach ( see ) ; an example is shown in figure 1 , where the k tissue types correspond to lumen , epithelium , nuclei , and stroma . starting from the lumen regions , each regionis separately dilated by a square structuring element in sequential unit steps forming a set of rings or annuli around the original lumen space ( see figure 2 ) . these rings are regarded as neighborhood strips from which we will gather statistics on the quantity and location of surrounding tissue types . the boundary shape is preserved within a reasonable number of sampling rings . within each ring , we compute the proportions of the different tissue types ( lumen , epithelium , nuclei , and stroma ) using the derived probability maps . thus , for each ring , we obtain a vector of length k. for instance , a vector such as [ 0.2 , 0.4 , 0.1 , 0.3 ] in a given ring indicates that the relative proportions of lumen , epithelium , nuclei , and stroma are 20 % , 40 % , 10 % , and 30 % , respectively . the vectors obtained in step ( 3 ) are stacked , forming a single vector of length r k , where r is the number of rings used , that is , neighborhood strips . thus each lumen region from step ( 1 ) will be represented by such a feature vector of length r k. an example of these vectors is shown in figure 4 , where there are 4 lumen regions and consequently 4 such feature vectors plotted using different colors . we present each image as a bag or collection of feature vectors corresponding to lumen regions in the image . thus , we use multiple - instance learning to represent an image using a collection of feature vectors and perform the classification of each image based on its contents . we also use the bag dissimilarity approach to decouple the classification task from the multiple - instance formulation , allowing us to use any type of classifier without difficulty . in step ( 2 ) , it is possible to use dilations with larger steps or with a larger structuring element when deriving the rings . this would make the collected statistics less noisy but would also decrease the spatial resolution of the collected data ( analogous to the effect of applying a moving average filter ) . we begin by explaining the method through an example for the case of prostate tissue . figure 1 shows a cross - section of prostate tissue that has been stained with a sirius - hematoxylin stain combination along with the resulting image decomposition into four probability maps which represent in this case the classes corresponding to lumen , epithelium , nuclei , and stromal regions . note that the decomposition method used for prostate tissue follows from our previous work in . the proximity sampling method takes as input the probability maps generated from the decomposition , regardless of which method was employed for the latter . the image selected for decomposition in figure 1 is a cropped image of size 183339 and was chosen to contain only a small number of lumen regions so that the number of feature profiles that follow remains tractable for display . the probability maps were automatically rearranged according to a descending order of mean intensity value . this allows the automatic selection of the lumen class as the first image in this ordered sequence . in what follows , we discuss in detail how the main feature vector of the statistical proximity sampling method is obtained . the method proceeds by statistically sampling the neighborhood around each lumen in terms of class component quantities . by sequential dilation of the lumen region and subtraction of the preceding area , we obtain concentric rings or annuli progressing spatially away from the lumen in either inward , outward , or both directions , extending the lumen shape ( see figure 2 ) . within each ring , the fraction of each class component , that is , lumen , epithelium , nuclei , and stroma , is computed as a ratio of the sum of class posterior probabilities within the ring to the total area of the ring . these are then concatenated into a vector with k = 4 parts , where k is the number of classes . the number of dilations or rings we have used in this case for illustration was 30 . this creates a profile of how these class quantities are changing spatially as one moves away from the lumen within its neighborhood . as cancer progresses from benign to malignant , the different grades of cancer are expected to exhibit different patterns in terms of the quantities and order of these class components around the lumen which would result in different profile curves sampled from these rings . the shape of the curve captures spatial ( order ) information and represents statistical quantification of the classes . figure 3 shows lumen regions extracted from the corresponding posterior map and labeled according to their 4 - connected neighborhood ; that is , pixels that are adjacent diagonally are not considered neighbors . figure 4 shows the profile curves obtained , one for each of the four lumen regions . the first 30 elements represent the changing amount of neighboring lumen within those rings ; the second part consisting of another 30 elements represents that of epithelium , the third part that of nuclei , and the fourth that of stroma . to validate and understand what the curves represent , one should compare the profile of each lumen to its spatial neighborhood shown in figure 3 . the colors shown in figure 4 have been set to match those lumen regions shown in figure 3 . for example , the cyan curve represents the cyan colored lumen region . from figure 3 , we notice that the sampling rings should contain a considerable fraction of lumen due to the large neighboring lumen region shown in red color . similar analysis follows for the other parts of the curve in which one can see how each class component varies as one moves away from the lumen region . the fourth part of the curve is particularly easy to notice since there is no stromal component close enough to the cyan luminal region . alternatively , in order to show how the different luminal regions compare to each other in terms of the spatial composition of their proximities , we replot the curves of figure 4 such that the proportions of the four different tissue types ( lumen , epithelium , nuclei , and stroma ) across the rings are shown in a relative frequency pie chart for each luminal region separately . this is illustrated in figure 5 , where each subplot represents a luminal region indicated by the color of the central rectangle , and we note here that each of these exhibits a different profile . we note that the previous example was based on the spectral decomposition of tissue that was specifically stained ( using sirius - hematoxylin ) in order to express the different relevant tissue components ( see ) . however , in order to illustrate that the proposed concept is robust and generally applicable , we have also applied it to images of breast cancer tissues from the human protein atlas database which are stained using hematoxylin - eosin + dab to visualize general background tissue structures and specific proteins . as an example , we show a cropped image region of size 362450 selected from the casefigure 6 shows the decomposition of the image into four classes corresponding to lumen , stroma , nuclei , and dab . figure 7 shows four selected lumen regions from the posterior map of the lumen class in order to display their respective feature curves as based on the proximity sampling method described above . finally , figure 8 shows the profile curves for this example , where the number of sampling rings around each lumen was set to 10 . in a similar manner to the previous example , several detailed conclusions may be drawn from these figures ; however the most general one is that these feature curves capture the statistical distribution of the classes around each lumen region and may therefore be used to classify those regions . to test our method , we used a dataset consisting of images of breast tissue sections obtained from the human protein atlas project , where every image has been assigned a malignancy grade by an expert . the assigned class labels denoted by c0 and c1 are associated with the tubule - based elston grading , where the main factor is the absence ( c0 ) or presence ( c1 ) of milk ducts in the tissue . note that all microscopy images of the given dataset were acquired under the same magnification level of 40 . the dataset consists of tissue sections containing cells , glands , and luminal regions , and the proximity sampling method we have proposed applies in general also for images of tissue types that contain similar structures in living organisms . in the dataset , an image may contain several lumen regions . a feature vector is derived for each of these lumen regions using the proximity sampling method described . the aim is to train a classifier on the labeled , that is , graded , images in order to predict the label of a new image automatically . thus , there is an inherent relation between the formulation of this problem and multiple - instance learning . in the context of the latter , the feature vectors derived from the lumen regions in an image may be regarded asinstances or objects and the image itself as a bag or compound object consisting of one or more instances . the instances themselves are not labeled , but rather only the bag carries a label , which in this case is the tubule - based grade assigned by the pathologists . . some of the instances in a bag may be less important in contributing to the bag label , whereas one or more may be key instances , belonging to the so - called concept , that significantly define the bag label . for example , an image may contain one gland unit that characterizes a grade 3 cancer region , in addition to several noncontributing , background lumen regions . in such a case , one of the instances belongs to the concept that contributes to the grade 3 label . the multiple - instance learning approach is more flexible than standard classification approaches in that the representation allows us to encode more information from a single image by considering it as a collection of feature vectors rather than encoding the entire image by a single feature vector . images of real life objects ( such as tissue sections ) often contain a lot of important subregions with different characteristics and may be therefore too complex to be represented by a single feature vector . the multiple - instance representation is highly informative in this situation since it encodes information from different regions in an image , each of which may contribute to the final grade or label of the image as a whole . however , the classification task that ensues becomes more complex as a classifier is trained and optimized over the dataset . therefore , in order not to add complexity to the construction of a classifier and preserve the flexibility of the task , we follow the bag dissimilarity approach described in , which does not attempt to locate a concept but rather uses a similarity measure across bags , which are seen as sets of instances . the dissimilarities computed between the bags become the new features , and this allows us to construct any classifier in this new feature space , thus decoupling the original multiple - instance problem from the classification task itself . moreover , the bag dissimilarity approach allows us to consider multiclass data , that is , data with several grades , whereas in the traditional multiple - instance learning problem only two classes , namely , a positive and a negative class , are considered at any given time , and a one - against - one or one - against - all approach is often used in the classification of multiclass situations . insofar , we have presented a new vectorial proximity - based feature for describing tissue architecture around glands , and we proceed in the next section to demonstrate its usefulness as a feature descriptor . however , in order to evaluate whether more conventional scalar features add any information to the new feature , we have implemented four classical , well - known scalar features that are simple to compute from each lumen region . the first is the size of the region , while the other measures relate to its shape and are the bending energy , area - to - perimeter ratio , and convexity ratio . bending energy is defined around the lumen perimeter based on the chain code sequence and is given by eb = p = 1 ( p ) , where ( p ) is a smoothed version of the curvature signal ( p ) = tan ( ( yc ( p ) yc ( p 1 ) ) / ( xc ( p ) xc ( p 1 ) ) ) , where ( xc ( p 1 ) , yc ( p 1 ) ) and ( xc ( p ) , yc ( p ) ) are two consecutive points of the curvature . the minimum value is 2 / r and is attained for a circle of radius r. this feature is an indicator of convexity / concavity of the lumen boundary . the area - to - perimeter ratio is defined as ( 4a ) / p , where p is the perimeter and a the area of the lumen region . convexity is defined as alumen / aconvex hull , where alumen is the area of the lumen region and aconvex hull is the area covered by the convex hull encompassing the lumen region . this ratio is in the range and is closer to 1 when the lumen shape is convex and closer to 0 when highly irregular such as the case of cribriform grade 3 - 4 glandular units in prostate tissue , for instance . these lumen shape features are then compared with the main proximity feature vector , and classification results are presented in section 3 . for each image in the dataset , we have used our proximity - based feature method to obtain a set of descriptive features . then we used multiple - instance learning to represent each image as a bag of instances and transform the feature space into a dissimilarity space by computing the distances among the different bags . the mil toolbox and various classifiers were used for this purpose . our dissimilarity matrix is computed among the bags based on the linear assignment distance measured between sets . the dataset is then randomly split into a training set and a test set , and cross - validation procedures are used throughout . note that ten sampling rings were used for the statistical proximity sampling method throughout all cases resulting in 40 - element feature vectors for the case of the breast dataset since the number of classes was four using the hematoxylin - eosin + dab stain . figure 10 shows the classification rates and classifier learning curves using only the features derived by the statistical proximity sampling method . note that the parameters for the support vector classifier and k - nearest neighbor classifier were optimized using leave - one - out cross - validation over a training set comprising randomly 25 % of the original dataset . the 10-fold cross - validation rates for all classifiers over the remaining test set are then computed . the highest classification rates were obtained using the k - nearest neighbor classifier and the support vector classifier with 93.4 % and 94.2 % correct classification for the breast dataset , respectively . note that assigning misclassification costs for different classes may be set as desired through the regularization parameter of svc if needed . for comparison , a similar procedure was applied , however , using only the 4 classical lumen shape features that were described in section 2.3 . although we do not explore unsupervised methods for malignancy grading in this paper , we would like to highlight the possibility of applying a clustering - based approach coupled with an information criterion for classifying images . we demonstrate in what follows how clustering may be applied to classify instances in the absence of bag labels . in other words , we attempt to identify and locate key clusters or groups of instances forming main clusters . a bag label ( i.e. , image grade ) may then be obtained using a voting scheme over the cluster labels of the instances that belong to it . to study whether there may be an inherent number of clusters in the data possibly due to a certain fixed number of neighborhood descriptions that tend to recur around lumen regionswe clustered the breast dataset using the gaussian mixture model ( gmm ) several times with a varying number of clusters k ranging from 1 to 10 , and we computed the bic values as defined by bic = 2ln ( l ) + kln ( n ) , where n is the number of objects in the data , l is the likelihood value of the mixture fit , and k is the number of clusters . note that the mixture model was initialized randomly 10 times for each value of k. as the number of clusters increases , we expect the log - likelihood to increase monotonically ; however the bic measure also includes the model parameters into the tradeoff , which in this case is the number of clusters k. the optimal mixture model would have a high log - likelihood yet at a lowest possible complexity k. a plot of the bic values versus the number of clusters is shown in figure 11 . we deduce in this case that for the breast dataset the optimal number of clusters at which the bic curve attains a minimum is 2 . this result does not necessarily imply that there are 2 clusters in the data in an absolute sense . when using the akaike information criterion ( aic ) , we note in figure 11 that the optimal number of clusters at which the curve attains a minimum becomes 4 , since aic in this case penalizes model complexity less heavily than bic and thus results in the selection of a larger model . conclusively , this might suggest that a model selection of 2 , 3 , or 4 classes in this case is a reasonable choice . we have presented a general and simple method for statistically describing the distribution of glandular structures around lumen regions . the method makes use of sampling based on an iterative region expansion procedure that preserves the shape of the lumen areas . one advantage of this approach is that , by analyzing the neighborhoods of lumen regions and preserving the spatial and statistical information in these proximities , we avoid the need to extract explicit features concerning the underlying tissue structures themselves . the result is a set of feature vectors containing spatial and statistical information that may be used to describe regions in tissue images for a large variety of purposes , among which is tubule - based grading , as we have demonstrated in this paper . the input required for the method can be either a set of probability or binary maps derived from soft or crisp classification regardless of the supervised or unsupervised method ( e.g. , ) used to generate these maps . the method is also robust and its dependence on the quality of these maps is minimal since the approach does not attempt to derive any precise cellular or subcellular features , which would require accurate image segmentation . due to the natural complexity of biological tissue and the grading process , we have avoided the single feature vector based representation used in standard pattern recognition . automated grading was instead done using a bag dissimilarity approach while treating the problem in a similar manner to multiple - instance learning . since images of tissue sections often contain various spatial subregions which may have completely different properties and characteristics , such an approach is more capable of encoding the diverse content and level of information represented in these images . classification results using cross - validation have shown that the statistical proximity sampling method presented is able to provide a set of discriminative features for tubule - based cancer grading . a possible drawback of the dissimilarity approach we have used in our classification is that although the classification task itself is accomplished and the diagnosis is automated , no single concepthowever , alternative multiple - instance learning methods that are based on the notion of finding a concept may be used for this purpose if needed . the advantage of identifying a concept is that it becomes then possible to visually map the concept or its instances back to the corresponding regions in the image . the results obtained for the hpa dataset in this paper are meant to illustrate the potential of our approach in feature extraction and grading and its prospect for further extended studies over large datasets and possible combination with complementary approaches that address other aspects of grading ( such as nuclear pleomorphism and mitotic count ) , possibly leading to applications in the clinical context . a comprehensive automated system that would be able to eventually assign high - level grading akin to that by pathologists would undoubtedly have to incorporate , in addition to the work described in this paper , methods that are designed to address nuclear pleomorphism and mitotic count ( as most recently in ) . the final aim is to aid pathologists in the malignancy grading of cancer . as a first step towards that goal , we have in this paper addressed tubule - based grading , which contributes to one of the three components for malignancy grading under the ellis - elston system and which is also considered an important factor in gleason grading .\noutput:\n" }, { "from": "agent", "value": "due to the complexity of biological tissue and variations in staining procedures , features that are based on the explicit extraction of properties from subglandular structures in tissue images may have difficulty generalizing well over an unrestricted set of images and staining variations . we circumvent this problem by an implicit representation that is both robust and highly descriptive , especially when combined with a multiple instance learning approach to image classification . the new feature method is able to describe tissue architecture based on glandular structure . it is based on statistically representing the relative distribution of tissue components around lumen regions , while preserving spatial and quantitative information , as a basis for diagnosing and analyzing different areas within an image . we demonstrate the efficacy of the method in extracting discriminative features for obtaining high classification rates for tubular formation in both healthy and cancerous tissue , which is an important component in gleason and tubule - based elston grading . the proposed method may be used for glandular classification , also in other tissue types , in addition to general applicability as a region - based feature descriptor in image analysis where the image represents a bag with a certain label ( or grade ) and the region - based feature vectors represent instances ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: biomarkers of airway inflammation and oxidative stress can be measured noninvasively using exhaled breath condensate ( ebc ) sampling of airway lining fluid . leukotriene b4 ( ltb4 ) , a potent neutrophil chemoattractant , and 8 - isoprostane , which is formed during oxidative stress conditions by free - radical peroxidation of arachidonic acid , are examples of biomarkers that have been measured in ebc from chronic obstructive pulmonary disease ( copd ) patients . the absolute concentration of these mediators has varied greatly between studies , despite use of identical immunoassay methods . for example , mean values of ltb4 in copd patients have ranged from 10 pg / ml ( biernacki et al 2003 ) to 100 pg / ml ( montuschi et al 2003 ) . similarly , mean values of 8 - isoprostane in copd patients have ranged from 9 pg / ml ( biernacki et al 2003 ) to 47 pg / ml ( kostikas et al 2003 ) . the disparity between published findings may be attributable to the small sample sizes often used , or to method variability . the reproducibility of ebc ltb4 and 8 - isoprostane has not been well documented in copd patients . this issue was highlighted as an important area for future research by the recent american thoracic society / european respiratory society ( ats / ers ) task force document on ebc methodology ( hovarth et al 2005 ) . the current study was designed to investigate the variability of these mediators in copd patients . twenty - four patients with copd ( 16 male , mean age 65 ; 10 current smokers , mean pack years 40 ; mean % predicted forced expiratory volume in one second [ fev1 ] 54 % standard deviation [ sd ] 13.5 % ) diagnosed according to current criteria ( ncccc 2004 ) were recruited . exclusion criteria were history of asthma or atopy , and respiratory tract infection within 2 weeks of sample collection . subjects were asked to refrain from caffeine and cigarettes for 2 hours prior to each visit . written informed consent was obtained and the local ethics committee approved the study . three aspects of reproducibility were studied in all subjects : 1 ) within day ( wd ) reproducibility was assessed by the collection of 2 samples of ebc separated by 1 h. 2 ) between day ( bd ) reproducibility was assessed by the collection of a further ebc sample 1 week later ; this measurement was compared with the first collection one week earlier .3 ) within array ( wa ) reproducibility was assessed by analysis in triplicate of each sample . ebc was collected during tidal breathing for 10 minutes without a nose peg ( ecoscreen , jaegar , hoechberg , germany ) . subjects were instructed to breathe normally through their mouth and to temporarily discontinue collection if they needed to swallow saliva or cough . ltb4 and 8 - isoprostane were measured by enzyme immunoassays ( cayman chemical , ann arbour , mi , usa ) . the lower limits of detection were 13 pg / ml and 5 pg / ml for ltb4 and 8 - isoprostane respectively . samples with a concentration below the limit of the assay were assigned a level of 0 pg / ml . three statistical approaches were used to assess variability : 1 ) coefficient of variation was used to assess wd , bd , and wa variability .2 ) the repeatability coefficient was used to analyse within assay variation ; this estimated the limits of the differences that can be expected to occur between 95 % of repeated assays performed on the same sample . similarly , the bland - altman method with limits of agreement was used to assess wd and bd variability ; this estimates the differences that can be expected to occur between 95 % of samples collected at different times from the same subject ( bland and altman 1986 ) . the group mean and 95 % confidence intervals for the wd and bd differences were determined . the coefficients of variation are shown in table 1 ; the wa coefficient of variation for both ltb4 and 8 - isoprostane was lower than the corresponding values for wd and bd variability . the repeatability coefficient for the 8 - isoprostane assay was 18.6 pg / ml and for the ltb4 assay was 13.2 pg / ml . in contrast , the limits of agreement for wd and bd variability were large , demonstrating that levels of ltb4 and 8 - isoprostane can change markedly in some individuals even within 1 h ( table 2 ; figure 1 , 2 ) . limits of agreement for current smokers were in some cases wider than those for ex - smokers for both 8 - isoprostane and ltb4 ( table 3 ) . this is the first study to fully report the variability of ebc 8 - isoprostane and ltb4 in copd patients . using the bland altman method , a robust technique for quantifying the potential variability during repeated sampling from the same subject , we observed considerable wd and bd variability for these biomarkers . previous studies using these biomarkers have either failed to investigate intra - subject variability or have reported variability as beingminimal . there are several reasons why the variability of ebc mediators may have been underestimated in these studies . firstly , ebc variability has been studied in healthy subjects ( csoma et al 2002 ) . it is probable that within subject variability in patients with lung inflammation will be higher . secondly , the use of the coefficient of variation and correlation coefficients provide statistics using arbitrary values that do not relate to the units of the measurement being studied . thirdly , coefficient of variation , correlation coefficients and group mean statistics provide information about overall group differences . these types of analysis do not inform us of the potential for repeated samples from a single individual to vary over time . in the current study we observed no significant change in the group mean values over time . this does not mean that there was no variability ; the bland altman method graphically shows that while some individuals have highly reproducible measurements over time , there was considerable variation in the samples from other subjects , which contributed to the wide limits of agreements . the interpretation of the limits of agreements is , for example , that repeated 8 - isoprostane sampling on different days can be expected to vary from 61.4 pg / ml to 75.7 pg / ml in an individual simply due to natural variability . using this assay as a biomarker to detect a significant biological change ( greater than assay variability ) in an individual , such as an exacerbation , would require a change greater than these limits of agreement . the variability observed in this study may be explained either by ( 1 ) true changes in the composition of the airway lining fluid , ( 2 ) variability due to the sample collection methodology , or ( 3 ) the variability of the immunoassay method used to analyse the sample . the contribution of these 3 factors will now be considered : 1 ) we have recently shown marked wd and bd variability of ebc ph in copd patients compared with that seen in healthy subjects , indicating that there are changes in the composition of ebc in copd patients over time ( borrill et al 2005 ) . in the current study , there was some evidence of greater variability in current smokers compared with ex - smokers . acute smoking was found to cause an increase in ebc 8 - isoprostane after 15 minutes , but not at 5 h ( montuschi et al 2000 ) . in the current study , variation in the time since the last cigarette may have contributed to the variability observed .2 ) inconsistencies in the rate of aerosolization of airway lining fluid during sample collection may lead to increased variability . attempts have been made to correct for this using dilution factors ( effros et al 2003 ) and further study in this area is required .3 ) the coefficient of variation showed lower within assay variability for both ltb4 and 8 - isoprostane compared with within subject variation . this was confirmed by the repeatability coefficients for each assay which were lower than the limits of agreement between samples . the numerical value of the repeatability coefficient can be considered to be equivalent to the magnitude of the limits of agreement , which enables direct comparison . this indicates that the repeatability of the assay itself can not fully explain the degree of within subject variability observed . in a study by van hoydonk and colleagues ( 2004 ) , however , levels of ltb4 were below the limit of detection in a large number of samples , which may indicate the poor sensitivity of this assay . in a study by carpagnano and colleagues ( 2003 ) some samples had levels which were below the limit of detection of the assay . this suggests that the authors either diluted the standard below the level recommended , or that they extrapolated the standard curve below the lowest concentration of standard . these are not standard practices for immunoassays and are likely to lead to a loss of accuracy . to avoid these potential errors , we defined the lower limit of detection of the assay as the lowest concentration on the standard curve . methods such as mass spectroscopy may offer advantages over immunoassays in terms of increased sensitivity and reduced variability ( cap et al 2004 ; montuschi et al 2004 ) . overall , it is likely that the variability we have reported is multifactorial , with changes in the composition of the airway lining fluid , variability due to the sample collection methodology , and immunoassay variability and sensitivity all contributing . the high level of variability observed casts doubt on the current ebc methodology used to assess ltb4 and 8 - isoprostane . differences between patients with disease and controls can only be properly evaluated with knowledge of the variability of the method .\noutput:\n" }, { "from": "agent", "value": "the reproducibility of exhaled breath condensate ( ebc ) mediators is not well documented in chronic obstructive pulmonary disease ( copd ) . this study assessed within assay ( wa ) , within ( wd ) and between day ( bd ) reproducibility of ebc leukotriene b4 ( ltb4 ) and 8 - isoprostane . three ebc samples were collected from 24 copd patients separated by 1 h and 1 wk , to assess wd and bd reproducibility . wa reproducibility was assessed by sample analysis by enzyme immunoassay in triplicate . wa coefficient of variation for ltb4 and 8 - isoprostane ( 18.2 % and 29.2 % , respectively ) was lower than corresponding values for wd ( 47.7 % and 65.3 % , respectively ) and bd ( 75.7 % and 79.1 % , respectively ) . repeatability coefficient for 8 - isoprostane and ltb4 assays were 18.6 pg / ml and 13.2 pg / ml , respectively . group mean differences for wd and bd were small and statistically nonsignificant . using the bland altman method , there were wide limits of agreement for wd ( 51.6 to 47.2 for 8 - isoprostane and 31.8 to 31.4 for ltb4 ) and bd reproducibility ( 61.4 to 75.7 for 8 - isoprostane and 29.3 to 38.6 for ltb4 ) . this is the first study to fully report the variability of ebc 8 - isoprostane and ltb4 in copd . wa variability and group mean changes were small . however , we observed considerable wd and bd variability for these biomarkers ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tourette syndrome is a childhood - onset neuropsychiatric disorder first reported by the french physician georges gilles de la tourette in 1885 . it is characterized by a combination of multiple motor and one or more vocal tics . tourette syndrome is distinguished by erratic movements of the whole body accompanied by sporadic instances of aimless spitting and shouting and is unpleasant to those around the patient . moreover , it is a chronic disorder with repetitive cycles of waxing and waning distress for both the patient and the patient 's family . the onset of tourette syndrome is during childhood , and the prevalence is 3-fold higher in boys ( 4 - 5 per 10,000 ) than in girls ,1 ) although a statistically assured epidemiologic study has not been conducted in south korea . bipolar disorder is difficult to diagnose in children and adolescents due to mood swings that are incompatible with the diagnostic and statistical manual of mental disorders 4th edition ( dsm - iv ) diagnostic criteria for bipolar disorder , difficulty differentiating bipolar symptoms from normal developmental changes , and the inability of children and adolescents to adequately describe their symptoms . recently , pediatric bipolar disorder has been linked to suicide and increased risk of psychotic symptoms . to date , no systematic research on the prevalence of pediatric bipolar disorder in south korea has been conducted . however , according to studies outside of korea , pediatric bipolar disorder is significantly increasing , with a predicted prevalence of approximately 1 % , similar to adults , although these results are not without controversy .2,3 ) patients with tourette syndrome commonly have additional neuropsychiatric disorders ; a global study involving 3,500 tourette syndrome patients demonstrated a comorbidity rate of 88 % . the most frequent comorbidity was attention deficit hyperactivity disorder ( adhd ) , and a variety of other neuropsychiatric disorders , such as obsessive - compulsive disorder and mood disorders , were observed with tourette syndrome . increased incidence of anxiety , insomnia , hostility , coprolalia , self - injurious behavior , and personality disordershas also been observed .4 ) depressive and manic symptoms were especially common comorbidities , and it has been suggested that these symptoms are inevitable rather than being a result of motor or vocal tics .5 ) when tourette syndrome is accompanied by bipolar disorder , stress induced by manic symptoms is thought to exacerbate tics ,6 ) and conversely , tics are thought to stimulate or protract manic symptoms by giving rise to serious problems in both social and educational situations .7 ) therefore , adequate treatment of each disorder is required to prevent a vicious cycle that will impede treatment of the individual disorders . although up - to - date treatments are available for tourette syndrome ,8 ) few studies have investigated pediatric bipolar disorder , and there are no reports available on the treatment of children and adolescents with tourette syndrome and manic symptoms . therefore , we report the diagnosis and treatment of a 15 - year - old boy with tourette syndrome and bipolar disorder . a 15 - year - old male presented with vocal tics and motor tics consisting of shouting , grimacing , and twisting the neck to the right . he was reluctant to go to school because he did not get along with friends and his violent behavior and irritable mood frequently interfered with his home life . the patient had febrile convulsions at the age of 2 years and received treatment in a pediatric clinic . his parents separated when the patient was 5 years old , and they divorced 3 years later . during his parents ' separation , the patient began frequent blinking of his eyes , and his twin brother yawned frequently . while the tics of the patient 's twin brother were transient and improved spontaneously over time , the patient 's tics began to include loud sounds , and even coprolalia . the patient 's father scolded him harshly and physically punished him in an attempt to correct his behavior . as a consequence , he was anxious and developed insomnia . in kindergarten , the patient began to manifest inattention , hyperactivity , and impulsiveness . the patient was bullied by his classmates in school because of his tics and restless behavior during class . at that timehe underwent outpatient treatment with 20 - mg imipramine , 15 - mg aripiprazole , and 27 - mg methylphenidate irregularly from 2006 to 2008 . although the patient 's motor and vocal tics improved with treatment , he remained depressed and refused to go to school because he believed that he was a slow learner , and his facial tics made him ugly . when he went back to school without medication , he often fought with his classmates due to his irritability . the patient took a leave of absence from middle school in 2008 when his vocal tics increased and became louder . the patient was prescribed 50 - mg sertraline , 4.5 - mg haloperidol , and 1 - mg benztropine intermittently at a local mental health clinic . however , his tics waxed and waned , and he became increasingly irritable . the patient also screeched and was ill - tempered with his mother , resulting in a first hospitalization . the patient 's electroencephalography and brain magnetic resonance imaging tests were normal , and clinical psychological tests revealed an intelligence quotient ( iq ) of 89 ( verbal iq , 92 and performance iq , 87 ) on the korean education development institute - wechsler intelligence scale for children and abnormal findings on the adhd diagnostic system , stroop , and color - trail tests . the patient demonstrated impaired understanding of social circumstances and a pattern of actions associated with unstable , discordant , and impulsive behaviors . he was easily stimulated to aggressive behavior and became agitated in response to neutral social stimulation . the patient was emotionally unstable , overly sensitive , and felt on edge . during this hospitalization , he was placed on 50 - mg imipramine , 4 - mg risperidone , and 27 - mg methylphenidate and discharged following improved symptoms . when he returned to school , the patient was placed in a special class because of conflicts with , and bullying by , his classmates . the patient continued to receive medication at a local clinic and was prescribed 20 - mg escitalopram , 6 - mg risperidone , 10 - mg diazepam , and 2 - mg benztropine . the patient graduated from middle school in 2012 , discontinued his school work , and stayed home because his vocal tics increased , and he was extremely distracted . now that the patient remained home , he had an increasing number of conflicts with his parents . when the patient became dysphoric , he easily lost his temper , and used rapid , pressured , and loud speech with his family , which interfered with family life . moreover , as he grew increasingly talkative and uncontrollable , he fought with his twin brother and displayed unstable moods . he manifested impulsivity , aggressive behavior , distractibility , irritability , and abnormally increased energy . his motor and vocal tics increased in frequency , and he would shout \" ahk \" multiple times per day , shake his whole body , and display self - injurious behavior by striking walls with his elbow when he felt frustrated . eventually , the patient became unmanageable and was hospitalized for the second time . the patient 's diagnosis was changed to bipolar ii disorder , and escitalopram and risperidone were discontinued gradually , while aripiprazole was added . the yale global tic severity scale score ( ygtss ) 9 ) was 17 for vocal tics and 15 for motor tics . the motor tics , which were disturbing to others , and the shouting vocal tics decreased by one - third while taking 20 - mg aripiprazole and 20 - mg atomoxetine ; additionally , an improvement in manic behavior was noted . when the aripiprazole and atomoxetine doses were increased to 25 and 40 mg , the tics and manic symptoms became aggravated . therefore , the doses of aripiprazole and atomoxetine were decreased to 20 and 25 mg , respectively , to which 250 mg of valproate was added . the patient was discharged when the ygtss9 ) decreased to 5 for vocal tics and 3 for motor tics and the ymrs10 ) decreased to 9 . at presentthis case involves a child initially diagnosed with a tic disorder who later also received a diagnosis of bipolar disorder . the patient 's initial diagnosis was tourette syndrome with adhd accompanied by depression and anxiety . the administration of antidepressants revealed the manic symptoms of bipolar disorder including hyperactivity , excitation , distractibility , decreased need for sleep , and pressured speech . ultimately , the patient 's symptoms improved following the administration of an antipsychotic agent reported to be effective in tic and bipolar disorders . although a clear relationship between tourette syndrome and bipolar disorder has not been defined , mood swings and aggressiveness frequently occur in patients with tourette syndrome , and many studies suggest that the two disorders are related .4,7,8 ) comings and comings5 ) reported that 19.1 % of patients with tourette syndrome experienced manic symptoms , whereas the control group displayed no signs of manic symptoms ; they suggested that tourette syndrome and bipolar disorder may have a similar gene locus . the 16q22 - 23 region has been proposed as a candidate region for the primary or modifying genetic factors resulting in tourette syndrome and bipolar disorder phenotypes .11 ) although the susceptibility sequence of tourette syndrome has not been identified by gross chromosomal rearrangement studies , chromosomal rearrangements related to tourette syndrome , including cytogenetically invisible deletions , duplications , and inversions , appear to be associated with bipolar disorder .12 ) a study of 205 patients with tourette syndrome identified 15 ( 7 % ) patients with bipolar disorder , a four - fold higher prevalence than in the normal population , and males with tourette syndrome were at a greater risk for bipolar disorder than were females . these results indicate a connection between the two diseases .7,8,11,13,14,15 ) another study found that one ( 3 % ) of 38 control group patients had bipolar disorder , and four ( 13 % ) of 32 childhood tourette syndrome patients and 11 ( 28 % ) of 39 childhood chronic tic disorder patients had bipolar disorder . the difference in the prevalence of bipolar disorder was statistically significant .16 ) a study of 90 adult tourette syndrome patients undergoing regular treatments found that 30 also suffered from bipolar disorder . bipolar disorder was most common in tourette syndrome patients with mild tics and was associated with a wide variety of other psychopathologies .17 ) in a study of 156 adolescent tourette syndrome patients ,18 ) 19 ( 12 % ) patients were hospitalized , and the significant predictor of hospitalization was bipolar disorder . there is evidence to suggest that the medications used to treat tourette syndrome may induce bipolar disorder . patients with distinct clinical risk factors and a positive family history of adhd and tourette syndrome who were given guanfacine who developed hypomanic or manic symptoms .19 ) stimulants are often used to treat adhd , even in the context of tourette syndrome . these routinely used stimulants may precipitate bipolar disorder in vulnerable individuals and contribute to the association between tourette syndrome and bipolar disorder . other comorbidities encountered in tourette syndrome patients may be important to the association between tourette syndrome and bipolar disorder . adhd is common in patients with tourette syndrome and is known to be associated with bipolar disorder .20 ) the systematic evaluation of bipolar disorder among childhood tourette syndrome patients may face substantial obstacles . the combined results of 16 studies investigating mood variations in 5,409 tourette syndrome patients found that 13 - 76 % had a depressive disorder .3 ) however , it is difficult to identify these symptoms in childhood . childhood tourette syndrome patients are more likely to have a depressive disorder than adolescent patients , and the symptoms and indications that define a hypomanic or depressive episode vary with age . therefore , distinguishing childhood depression from other disorders is rather challenging .21 ) however , 50 - 66 % of adults report symptom onset before the age of 18 years , with 28 % reporting them before 13 years of age .22 ) of children with major depressive disorder , 20 - 49 % experience a full manic episode by adulthood .23 ) a positive family history of bipolar disorder increases the risk of mania in a depressed child ; however , the exact risk in these children is not known . proposed clinical clues for the first episode of bipolar depression include acute onset , psychosis , prominent irritability , labile mood , and poor or brief hypomanic response to antidepressants . furthermore , features of atypical depression , including hypersomnia , hyperphagia , and other neurovegetative symptoms , may indicate a risk of future manic episodes .24 ) furthermore , for manic symptoms to be diagnosed in adolescents , euphoria , grandiosity , decreased need for sleep , or increased goal - directed activities need to be identified .25 ) in the present case , the patient was admitted to a hospital on two occasions because he was uncontrollable and evidenced unstable mood , frequent excitation , and loud shouting vocal tics . initially the patient was diagnosed with tourette syndrome and adhd and experienced symptoms of anxiety , frustration , depression , irritation , restlessness , instability , sleep disturbances , and coprolalia . the patient was also diagnosed with a depressive episode and was treated immediately with anti - tic and antidepressant medications , which led to symptom improvement . however , his condition was unstable , and he experienced repeated relapses resulting in treatment modifications . prior to the patient 's most recent hospitalization , he experienced a manic episode involving excitation and hyperactivity that persisted for more than one week , rendering hospitalization inevitable . therefore , it is essential for clinicians to discriminate the depressive episodes of bipolar disorder from those of other depressive disorders in tourette syndrome patients with accompanying anxiety and irritability before administering antidepressants . because tourette syndrome and bipolar disorder are closely related and often coexist , simultaneous diagnosis and treatment of these two disorders should be approached with cautionrecently , there have been concerns about the diagnosis and treatment of bipolar disorder and early depressive episodes . reported diagnostic procedures include measurement of amygdala and limbic system activity , with lower values indicative of a disease state , as well as identification of a short serotonin transporter gene allele . however , as there are no biological markers that can predict bipolar disorder , the diagnosis of bipolar disorder in a patient with no previous manic symptoms requires meticulous clinical examination including a thorough family history .26 ) psychosocial factors , such as stressful life events and social rhythm disruptions induced by tic symptoms are also related to bipolar disorder .20 ) therefore , while stress from tic symptoms can provoke excitation , impulsiveness , and anxiety , these conditions are indistinguishable from manic symptoms induced by tourette syndrome itself , causing difficulty in the evaluation of bipolar disorder in a tourette syndrome patient . the patient in the present case had tic symptoms accompanied by adhd and suffered from anxiety , depression , excitation , and insomnia induced by stress from conflicts with his parents , resulting in his leaving school . these symptoms did improve with treatment including antidepressant and antipsychotic agents such as imipramine and sertraline . however , when the patient 's medication were discontinued , he developed symptoms of euphoria , grandiosity , decreased need for sleep , and difficulty completing goal - directed activities , as well as an exacerbation of tic symptoms , especially shouting . the etiology of bipolar disorder in tourette syndrome patients remains obscure , but the possibility of these two disorders possessing diverse but common neurophysiological properties , such as similar noradrenaline , dopaminergic , and serotonin neurotransmitter levels , remains . various pharmacologic and non - pharmacologic treatments for tic disorder have been reported .27,28,29 ) the treatment of comorbid disorders in patients with tic disorders is as important as the treatment of the tic disorder , but minimal research has been carried out regarding the treatment of manic symptoms in adolescents and even less on the treatment of manic symptoms in adolescents with tourette syndrome . kerbeshian et al. 15 ) reported that the incidence and intensity of motor and vocal tics was affected by mood and both can be exacerbated in a manic state . therefore , if treatment is focused on either the tics or the manic symptoms alone , the patient 's progress will not be favorable . aripiprazole is a partial dopamine agonist reportedly effective in patients with tourette syndrome and manic symptoms .30,31 ) aripiprazole has been approved for the treatment of bipolar disorder in adolescents by the united states food and drug administration ( fda ) and was approved for treatment of bipolar and tic disorders by the korean fda . it should also be noted that other agents such as risperidone , ziprasidone , pimozide , haloperidol , and clonidine have produced meaningful effects in patients with chronic tics . therefore , positive effects may also be seen in patients with tourette syndrome and bipolar disorder treated with these drugs .32 ) this case report details the diagnosis and treatment of an adolescent patient with tourette syndrome and bipolar disorder . current clinical research on the safety and adverse effects of the pharmacologic treatment of adolescents with tourette syndrome and bipolar disorder is insufficient , and further research is needed .\noutput:\n" }, { "from": "agent", "value": "tourette syndrome consists of multiple motor tics and one or more vocal tics . psychopathology occurs in approximately 90 % of tourette syndrome patients , with attention - deficit / hyperactivity , mood , and obsessive - compulsive disorders being common . additionally , tourette syndrome and bipolar disorder may be related in some individuals . however , it is unclear why bipolar disorder may be overrepresented in tourette syndrome patients , and more research is needed . herein , we report the case of a 15 - year - old boy diagnosed with both tourette syndrome and bipolar disorder , whose symptoms improved with aripiprazole , atomoxetine , and valproate . the patient was diagnosed with tourette syndrome at 8 years of age when he developed tics and experienced his first depressive episode . the patient had a poor response to a variety of antidepressants and anti - tic medications . a combination of valproate and aripiprazole stabilized both the patient 's tics and mood symptoms . it is important to assess individuals with tourette syndrome for other disorders , including bipolar disorder . the treatment of children and adolescents with both tourette syndrome and bipolar disorder is an important clinical issue ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pakistan lies in a high - risk geographical area with one - fifth ( 21 % ) of the cancers occurring in males and about one - tenth ( 11 % ) in females . general anesthesia ( ga ) and airway management of patients scheduled for head and neck cancer surgery is challenging for the anesthesiologist . the incidence of difficult airway is high due to factors like restricted head and neck movement , limited mouth opening or reduction of upper airway space due to the tumor or previous surgery . in addition , upper airway anatomy may be distorted due to the tumor , previous operation or fixation of the tissue of the oral cavity , pharynx or larynx by surgical scarring or fibrosis due to radiation . this retrospective study was conducted to review airway management strategies used in patients who underwent head and neck cancer surgery in our tertiary care institution . our secondary objective was to observe the effect of airway management techniques on postoperative length of hospital stay ( plos ) . we performed a retrospective chart review of a cohort of 400 patients who underwent head and neck cancer surgery at our institution . exemption from ethical approval for this study was provided by ethical committee of our university hospital , ( protocol number : 2556 - ane - erc - 13 ) on 25 april 2013 , before collecting the data . data were collected retrospectively between 2006 and 2010 from the patient medical records in the hospital database system . all patients undergoing head and neck surgery due to oral and oro - pharyngeal cancers , laryngeal tumors , hypo - pharyngeal and parotid carcinomas with or without neck dissection were included . variables were predefined before the start of the study , and a special form was designed and used for data collection . preoperative records were reviewed for co - morbid conditions and assessment of difficult airway ( mouth opening , mallampati classification and head and neck movements ) . all this information is routinely recorded in our institutional preoperative forms . any previous head and neck cancer surgery or radiation historyintra - operative anesthesia records were reviewed for use of induction agents , technique of airway management and route of intubation . the need for emergency tracheostomy was also noted . from the postoperative records , we noted the time of extubation , need for postoperative ventilation , analgesia given in the recovery room , extended stay in recovery room ( defined as stay of more than 2 h ) and any postoperative airway related complication like airway obstruction , emergency surgical airway , cardiac arrest , postoperative ventilation , unanticipated hemorrhage or unexpected intensive care unit ( icu ) admission . the plos was defined as the interval between the date of surgery to date of hospital discharge or death . all statistical analyses were performed using statistical package for social sciences version 19 ( spss inc . , chicago , il , usa ) . mean and standard deviation were computed for quantitative variables ; median ( interquartile range [ iqr ] ) was computed for plos and after normality assumption mann - whitney test was applied . two hundred and eighty - nine ( 72.3 % ) of the 400 patients were male , and 111 ( 27.8 % ) female . seventy - nine ( 19.75 % ) patients had previous head and neck cancer surgery and were operated for recurrence or flap reconstruction . preoperatively restricted mouth opening was present in 171 ( 42.8 % ) patients ; 199 ( 49.8 % ) had mallampati score of 3 or above . signs of upper airway obstruction were present in 30 ( 7.5 % ) patients [ table 1 ] . 264 ( 66 % ) patients had oral and oro - pharyngeal cancers , 84 ( 21 % ) had laryngeal tumors , 19 ( 4.75 % ) hypo - pharyngeal tumors while 33 ( 8.25 % ) had parotid tumors or tumors originating outside the oral cavity . demographic and preoperative characteristics of the patients ( n = 400 ) 308 ( 77 % ) patients were induced with intravenous induction agents and 40 ( 10 % ) with inhalational induction . fifty two ( 13 % ) patients were managed under sedation . one of them was a patient of carcinoma of pharynx with grade 4 cormack and lehane grade on laryngoscopy , whereas the second was a patient of carcinoma tongue where conventional intubation had failed . anesthetic and airway management techniques ( n = 400 ) nasotracheal route was used to secure airway in 177 ( 44.25 % ) patients while , in 142 ( 35.5 % ) patients , airway was managed by oral intubation .54 ( 13.5 % ) patients had tracheostomy performed at the end of the procedure for postoperative airway management . in 267 ( 66.8 % ) patients , the airway management device was removed just after the end of the operation . no patients required emergency tracheostomy for airway maintenance in the post - anesthesia care unit . one patient was shifted to the icu postoperatively for mechanical ventilation because of inadequate ventilatory efforts . this patient was a 55 - year - old female who had a history of long - standing hypertension , ischemic heart disease and chronic liver disease due to hepatitis c. she underwent a laryngectomy and bilateral neck dissection for carcinoma of larynx . the duration of procedure was 4 h and tracheostomy was performed at the end of surgery . there was no other airway - related morbidity or mortality during the peri - operative period .114 ( 28.5 % ) patients had an extended stay ( defined as a stay of more than 2 h ) and seven overnight stay in the recovery room .170 ( 42.5 % ) patients received only opioid - based analgesia while 69 ( 17.3 % ) received multimodal analgesia for pain management in the recovery room . median ( iqr ) hospital stay after surgery was 6 days ( iqr = 3 ) in patients who had a tracheostomy performed for airway management . this was significantly higher ( p = 0.0005 ) compared to 4 days ( iqr = 3 ) in patients whose airway was managed with oro - tracheal or naso - tracheal intubation [ figure 1 ] . median postoperative hospital stay in patients undergoing head and neck surgery with and without tracheostomy ( p = 0.0005 ) ; ( ) median ; ( * ) extreme value and ( o ) outlierscancer is now becoming a serious threat to health in many asian countries , and is now the leading cause of death in the asia pacific region . institution - based data on cancer incidence in pakistan shows cancer of head and neck as the most frequent malignancy recorded in males ( 32.62 % ) . a marked increase in oral cavity cancer in both genders has been observed over the last decade . the major risk factors are smoking , areca nut , betel quid or paan and tobacco chewing , naswar ( snuff ) , paan masala and gutka ( a highly addictive substance and a known carcinogen ; a preparation of crushed areca nut also called betel nut , tobacco , catechu , paraffin , slaked lime and sweet or savory flavorings ) and poor nutrition . the highest recorded rate for larynx cancer for males in asia is seen in karachi , pakistan with the males exhibiting a 6-fold higher risk than the females . in our experience , the factors that contribute to the difficulty in managing airway peri - operatively are the presence of oral cancer growth , anatomical changes and fibrosis due to prior surgery or radiotherapy , lengthy surgical procedure , bulky flap reconstruction and edema around the airway . in patients with supraglottic obstructionthe airway can be managed using techniques such as awake orotracheal intubation using conventional or fiber - optic laryngoscopy , awake nasotracheal intubation , intubation following inhalational induction , rapid sequence induction or tracheostomy under local anesthesia . awake tracheostomy is one of the options of restoring the airway in patients with airway obstruction and is associated with a low rate of complications if performed appropriately . - the benefits of tracheostomy need to be balanced against its risks . complications of tracheostomy include hemorrhage , obstruction , displacement , local infection , pulmonary infection , fistulae , tracheal stenosis and stomal tumor recurrence . in cases with supraglottic obstruction , which include oral cancerawake intubation is not preferable because it may be technically difficult due to the presence of pathology . the passage of tracheal tube over the fiber - optic bronchoscope is sometimes impossible . in our studyfiber - optic intubation is an essential skill for patients where conventional oro - tracheal intubation is anatomically difficult , like in patients with upper airway tumors . the benefits of naso - tracheal intubation in head and neck surgery outweigh the potential disadvantages . bonner and taylor recommend induction of ga using an inhalational agent and rapid sequence induction with barbiturates and muscle relaxant as the two preferred choices in head and neck surgery . have shown that patients with oral cancer can be safely managed without the routine use of tracheostomy using nasotracheal intubation . in 54 ( 13.5 % ) of our patients , common problems relating to the airway that are associated with major head and neck surgery are oedema of the larynx , pharynx and posterior tongue and the presence of bulky reconstructive flaps . bilateral neck dissections and resections of the mandible , tongue and floor of mouth are at a high risk of these complications . performing elective tracheostomy as part of the original procedure makes the airway management safer . none of our patients had any major intraoperative and immediate postoperative complications unlike the experience in published literature . cook et al . found that 39 % of postoperative complications in head and neck surgery in all nhs hospitals in uk over a 1 - year period were airway related . moorthy et al . have recommended a systematic approach for securing the airway for laryngeal tumor surgery and hence reducing emergency situations like lost airway , bleeding or dislodgement of tumor pieces . between 1985 and 1999 , persistent intubation attempts were associated with death and brain damage . in a recent publication , agra et al . observed postoperative complications in a cohort of 124 patients after en bloc salvage surgery for head and neck cancer . four patients ( 3.2 % ) died within the postoperative period due to systemic complications and carotid artery rupture . plos was significantly longer ( p = 0.0005 ) in those patients who had a tracheostomy done compared to those without . the median plos in our study was much shorter than that reported by other authors . penel et al . from france reported a median postoperative stay of 21 days ( iqr : 17 - 30 days ) in 260 patients . agra et al . reported the length of stay ( los ) as 7.4 days per patient without complications . one of the reasons of a shorter plos in our institution could be that ours is a private institution where all expenses are borne by the patients . in addition , in eastern culture , there is ample family support available when the patients are nursed at home . los is important as longer stay may have consequences like increased chances of infection , increase in morbidity and mortality , delayed rehabilitation , increased financial burden and discomfort to family members . studies like ours provide a means to improve services and management of patients but have some limitations . about 80 % of our patients with head and neck cancers were managed without a tracheostomy . there was no major morbidity or mortality reported related to the airway except in one patient who had unanticipated icu admission . median hospital stay after surgery was significantly longer ( p = 0.0005 ) in patients who had a tracheostomy done for airway management compared with those managed without it .\noutput:\n" }, { "from": "agent", "value": "background and aims : general anesthesia and airway management of patients for head and neck cancer surgery is a challenge for the anesthesiologist . appropriate assessment and planning are essential for successful airway management . our objectives were to review airway management strategies in patients undergoing head and neck cancer surgery in our tertiary care institution and also to observe the effect of airway management techniques on postoperative length of hospital stay ( plos ) . material and methods : a retrospective medical record review of 400 patients who underwent major head and neck cancer surgery in our institution was conducted . a special form was used , and records were searched for airway and anesthetic management in the operating room and recovery room , and for plos.results : 289 ( 72.25 % ) of the patients were male , and 111 ( 27.75 % ) female . 49.8 % of patients had mallampati score of 3 and 4 . airway was managed with tracheostomy in 81 ( 20.25 % ) patients ; nasal intubation was performed in 177 ( 44.25 % ) and oral intubation in 142 ( 35.5 % ) patients . postoperative emergency tracheostomy was not done in any of the patients.conclusion : median postoperative hospital stay was significantly longer ( p = 0.0005 ) in patients who had a tracheostomy performed compared with those where the airway was managed without it ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: s. globisoprus wild - type and mutant strains were grown on isp4 agar medium or cultured in a9 liquid medium as described .15 escherichia coli dh5 and et1256716 were cultured in luria - bertani ( lb ) broth .17 micrococcus luteus atcc 9431 was grown on lb agar .17 cosmid pbs10064 and plasmid pwhm125018 were described previously . general dna manipulations were performed according to standard procedures .17 pcr reactions were performed using pfx dna polymerase according to the manufacturer 's instructions ( invitrogen , carlsbad , ca ) . the pcr fragment obtained using pfx was treated with taq dna polymerase from invitrogen ( carlsbad , ca ) for 10 min at 72 c to add the terminalstreptomyces protoplasts preparation and transformation were performed as described previously .19 homologous sequence database searching was executed with blast . cosmid pbs1006 was used as a template to clone the three regulators for c - 1027 production by pcr . the sgcr1 gene was amplified by pcr using primers 5 - cgaggatccgcggatggattacacg - 3 ( sgcr1 upstream , bamhi ) and 5 - cctctagaagtaggccgtcaacggc - 3 ( sgcr1 downstream , xbai ) and inserted into pgem - t easy after adding terminalthe sgcr1 gene was excised as a 1.1 - kb bamhi / xbai fragment and inserted into the same sites of pwhm1250 to generate pbs1107 , in which the expression of sgcr1 is under the control of the constitutive erme * promoter . similarly , the sgcr2 gene was amplified by pcr using primers 5 - cttctagagggagttacggtgaccacg - 3 ( sgcr2 upstream , xbai ) and 5 - ttctgcagggccctggtcaccc - 3 ( sgcr2 downstream , psti ) and inserted into pgem - t easy after adding terminalplasmid pbs1097 with sgcr2 under the control of erme * was then constructed by inserting the 0.9 - kb psti / xbai sgcr2 fragment into the same sites of pwhm1250 . for sgcr3 overexpression , the sgcr3 gene was amplified by pcr using primers 5 - cgaaagcttgcccaggagaagggaaac - 3 ( sgcr3 upstream , hindiii ) and 5 - gggacgcgtcgctcagctcc - 3 ( sgcr3 downstream , mlui ) , inserted into pgem - t easy after adding terminalafter removal of the terminator between the erme * promoter and the hindiii site in pwhm1250 as a 0.5 - kb sphi fragment , the sgcr3 gene was cloned as a 1.2 - kb hindiii / mlui fragment into the same sites of the modified pwhm1250 to afford pbs1108 , in which the expression of sgcr3 is under the control of erme * . finally , pbs1107 , pbs1097 , and pbs1108 were introduced into the wild - type s. globisporus strain by protoplast transformation to afford recombinant s. globisporus strains sb1014 , sb1015 , and sb1016 that overexpress sgcr1 ( sb1014 ) , sgcr2 ( sb1015 ) , and sgcr3 ( sb1016 ) , respectively .4 plasmid pbs1109 , in which sgcr2 and sgcr3 are expressed in tandem under the control of erme * , was constructed by inserting the 1.2 - kb hindiii / mlui fragment of sgcr3 into the same sites of pbs1097 . similarly , insertion of the 1.1 - kb bamhi / xbai fragment of sgcr1 into the same sites of pbs1109 yielded pbs1110 , in which erme * controlled the expression of all three genes sgcr1 , sgcr2 , and sgcr3 . introduction of pbs1109 and pbs1110 into the wild - type s. globisporus strain by protoplast transformation finally afforded the recombinant strains sb1017 ( sgcr2r3 overexpressing ) and sb1018 ( sgcr1r2r3 overexpressing ) , respectively , that overexpress the selected regulatory genes in tandem .4 s. globisporus wild - type and recombinant strains were cultured in a9 medium using a two - step fermentation for c - 1027 and heptaene production as described4 ,15 and then treated to obtain three fractions as follows : ( fraction 1 ) the cells were pelleted by centrifugation ; ( fraction 2 ) the supernatant was adjusted to ph 4.0 and centrifuged to collect the precipitate ; and ( fraction 3 ) the remaining supernatant was saturated to 70 % with ammonium sulfate , incubated at 4c for 3 hours , and the precipitated proteins were collected by centrifugation . the c - 1027 chromophore was isolated from fraction 3 by acetone extraction as described previously .15 fractions 1 and 2 were combined and extracted with acetone to isolate the heptaene metabolite .11 the acetone extracts were detected directly by hplc after being concentrated .5,11 c - 1027 production was assayed against m. luteus atcc 9431 as described previously .4,15 for the liquid a9 medium cultures , the ammonium sulfate - precipitated fraction 3 containing the c - 1027 chromoprotein complex was dissolved in the same volume of water and 5 ul of the resultant solution was used for each bioassay . for the solid isp4 plates ( 25 ml isp4 in a 9 cm petri dish ) growing s. globisporus strains , a round agar block of 0.5 cm diameter was placed directly onto an m. luteus - seeded lb agar plate for antibacterial assay . hplc analysis was performed with a c18 column ( 5 m , 250 mm 4.6 mm , alltech , lexington , ky ) on a varian hplc system with an in - line prostar 330 pda detector ( woburn , ma ) . hplc detection of the c - 1027 chromophore was the same as described previously .15 for hplc analysis of the heptaene , the column was eluted at a flow rate of 1 ml / min with a gradient of acetonitrile with 0.1 % trifluoroacetic acid from 50 % to 100 % for 15 min and maintained 100 % for a further 10 min . s. globisoprus wild - type and mutant strains were grown on isp4 agar medium or cultured in a9 liquid medium as described .15 escherichia coli dh5 and et1256716 were cultured in luria - bertani ( lb ) broth .17 micrococcus luteus atcc 9431 was grown on lb agar .17 cosmid pbs10064 and plasmid pwhm125018 were described previously . general dna manipulations were performed according to standard procedures .17 pcr reactions were performed using pfx dna polymerase according to the manufacturer 's instructions ( invitrogen , carlsbad , ca ) . the pcr fragment obtained using pfx was treated with taq dna polymerase from invitrogen ( carlsbad , ca ) for 10 min at 72 c to add the terminalstreptomyces protoplasts preparation and transformation were performed as described previously .19 homologous sequence database searching was executed with blast . cosmid pbs1006 was used as a template to clone the three regulators for c - 1027 production by pcr . the sgcr1 gene was amplified by pcr using primers 5 - cgaggatccgcggatggattacacg - 3 ( sgcr1 upstream , bamhi ) and 5 - cctctagaagtaggccgtcaacggc - 3 ( sgcr1 downstream , xbai ) and inserted into pgem - t easy after adding terminalthe sgcr1 gene was excised as a 1.1 - kb bamhi / xbai fragment and inserted into the same sites of pwhm1250 to generate pbs1107 , in which the expression of sgcr1 is under the control of the constitutive erme * promoter . similarly , the sgcr2 gene was amplified by pcr using primers 5 - cttctagagggagttacggtgaccacg - 3 ( sgcr2 upstream , xbai ) and 5 - ttctgcagggccctggtcaccc - 3 ( sgcr2 downstream , psti ) and inserted into pgem - t easy after adding terminalplasmid pbs1097 with sgcr2 under the control of erme * was then constructed by inserting the 0.9 - kb psti / xbai sgcr2 fragment into the same sites of pwhm1250 . for sgcr3 overexpression , the sgcr3 gene was amplified by pcr using primers 5 - cgaaagcttgcccaggagaagggaaac - 3 ( sgcr3 upstream , hindiii ) and 5 - gggacgcgtcgctcagctcc - 3 ( sgcr3 downstream , mlui ) , inserted into pgem - t easy after adding terminalafter removal of the terminator between the erme * promoter and the hindiii site in pwhm1250 as a 0.5 - kb sphi fragment , the sgcr3 gene was cloned as a 1.2 - kb hindiii / mlui fragment into the same sites of the modified pwhm1250 to afford pbs1108 , in which the expression of sgcr3 is under the control of erme * . finally , pbs1107 , pbs1097 , and pbs1108 were introduced into the wild - type s. globisporus strain by protoplast transformation to afford recombinant s. globisporus strains sb1014 , sb1015 , and sb1016 that overexpress sgcr1 ( sb1014 ) , sgcr2 ( sb1015 ) , and sgcr3 ( sb1016 ) , respectively .4 plasmid pbs1109 , in which sgcr2 and sgcr3 are expressed in tandem under the control of erme * , was constructed by inserting the 1.2 - kb hindiii / mlui fragment of sgcr3 into the same sites of pbs1097 . similarly , insertion of the 1.1 - kb bamhi / xbai fragment of sgcr1 into the same sites of pbs1109 yielded pbs1110 , in which erme * controlled the expression of all three genes sgcr1 , sgcr2 , and sgcr3 . introduction of pbs1109 and pbs1110 into the wild - type s. globisporus strain by protoplast transformation finally afforded the recombinant strains sb1017 ( sgcr2r3 overexpressing ) and sb1018 ( sgcr1r2r3 overexpressing ) , respectively , that overexpress the selected regulatory genes in tandem .4 s. globisporus wild - type and recombinant strains were cultured in a9 medium using a two - step fermentation for c - 1027 and heptaene production as described4 ,15 and then treated to obtain three fractions as follows : ( fraction 1 ) the cells were pelleted by centrifugation ; ( fraction 2 ) the supernatant was adjusted to ph 4.0 and centrifuged to collect the precipitate ; and ( fraction 3 ) the remaining supernatant was saturated to 70 % with ammonium sulfate , incubated at 4c for 3 hours , and the precipitated proteins were collected by centrifugation . the c - 1027 chromophore was isolated from fraction 3 by acetone extraction as described previously .15 fractions 1 and 2 were combined and extracted with acetone to isolate the heptaene metabolite .11 the acetone extracts were detected directly by hplc after being concentrated.5,11c - 1027 production was assayed against m. luteus atcc 9431 as described previously .4,15 for the liquid a9 medium cultures , the ammonium sulfate - precipitated fraction 3 containing the c - 1027 chromoprotein complex was dissolved in the same volume of water and 5 ul of the resultant solution was used for each bioassay . for the solid isp4 plates ( 25 ml isp4 in a 9 cm petri dish ) growing s. globisporus strains , a round agar block of 0.5 cm diameter was placed directly onto an m. luteus - seeded lb agar plate for antibacterial assay . hplc analysis was performed with a c18 column ( 5 m , 250 mm 4.6 mm , alltech , lexington , ky ) on a varian hplc system with an in - line prostar 330 pda detector ( woburn , ma ) . hplc detection of the c - 1027 chromophore was the same as described previously .15 for hplc analysis of the heptaene , the column was eluted at a flow rate of 1 ml / min with a gradient of acetonitrile with 0.1 % trifluoroacetic acid from 50 % to 100 % for 15 min and maintained 100 % for a further 10 min . manipulation of pathway regulation is an efficient strategy to increase specific secondary metabolite production .12,13 among the three regulators indentified within the c - 1027 biosynthetic gene cluster , sgcr3 has been characterized as a tylr - like activator ,14 and sgcr1 and sgcr2 have been proposed to be positive regulators based on bioinformatic analyses . sgcr2 belongs to the arac / xyls activator family ,20 while sgcr1 is a strr - like protein ; the only two studied strr - like regulators , strr ( 36.7 % identity ) 21 and novg ( 35.1 % identity ) ,22 are both activators . based on the premise that all three c - 1027 regulators are potential activators , the three regulatory genes were overexpressed individually under the control of the constitutive erme * promoter on the high - copy - number plasmid pwhm1250 in s. globisporus c - 1027 to generate strains sb1014 ( sgcr1 overexpressing ) , sb1015 ( sgcr2 overexpressing ) and sb1016 ( sgcr3 overexpressing ) . evaluation of the metabolic profiles of each of the recombinant strains revealed that sgcr1 was a particularly effective activator for the production of a heptaene , an early metabolite of the enediyne biosynthetic machineries .11 the sgcr1 - overexpressing strain s. globisporus sb1014 produced 464 mg / l of the heptaene at day 2 , which was about 9-fold higher than in wild - type ( 50.4 mg / l ) , and by day 5 yielded 665 mg / l , which is about 5-fold higher than the 143 mg / l observed in wild - type . mg / l ) were also higher than wild - type at day 5 ( figure 2 ) , supporting a positive regulatory role for all three regulators . the production of c - 1027 in each strain was detected using a bioassay against m. luteus atcc 9431 . in the case of a9 liquid medium , all three regulator - overexpressing recombinant strains produced c - 1027 earlier than did the wild - type control ( figure 3 ) . the s. globisporus wild - type or recombinant strains achieved highest c - 1027 production at day 4 ( sb1016 ) or day 5 ( wild - type , sb1014 and sb1015 ) , and all three recombinant strains exhibited larger inhibition zones than observed with wild - type at their highest titer ( figure 3b ) , confirming the up - regulating characteristics of sgcr1 , sgcr2 and sgcr3 . the sgcr1 - overexpressing mutant sb1014 produced the highest titer of c - 1027 at day 5 , which was 2 to 3 times the c - 1027 titer in wild - type when analyzed by hplc ( figure 3c ) . in the case of isp4 agar medium , sb1015 and sb1016 also produced c - 1027 earlier , but their largest inhibition zones were comparable in size to those of the s. globisporus wild - type ( figure 3a ) . in summary , overexpression of each individual regulator induced similar titer increases for both c - 1027 and heptaene in a9 medium , indicating a common regulatory system controlling the biosyntheses of both compounds . moreover , sgcr1 overexpression was more effective at titer improvement than overexpression of either sgcr2 or sgcr3 , implying that one or more genes controlled by sgcr1 are bottlenecks in c - 1027 production . given that sgcr1 , sgcr2 and sgcr3 behave as activators , we reasoned that their co - overexpression in the s. globisporus wild - type strain could further improve the production of c - 1027 and related compounds . two pwhm1250 - derived constructs , containing sgcr2r3 ( pbs1109 ) or sgcr1r2r3 ( pbs1110 ) in tandem under the control of the erme * promoter , were transformed into s. globisporus wild - type to afford sb1017 and sb1018 , respectively . / l ) at day 5 than sb1015 and sb1016 , but less than sb1014 . to our surprise , sb1018 produced heptaene with an efficiency comparable to that of wild - type ( 121 mg / l ) ( figure 2 ) . for c - 1027 titers in a9 liquid media , sb1017 reached optimum yield at day 4 , and the inhibition zone was larger than those of c - 1027 wild - type . in contrast , the c - 1027 titer in sb1018 was not improved ( figure 3 ) . in the case of isp4 agar media , however , the largest inhibition zones were comparable in size to those found for c - 1027 wild - type . the counterintuitive observation that overexpression of all three activators together in s. globisporus sb1018 did not further improve c - 1027 or heptaene production implies the multifaceted regulation of c - 1027 biosynthesis . due to their low titers and inherent reactivity , hplc analysis of enediyne production is laborious , often requiring a length process of sample preparation , in particularly for the 9 - membered enediynes produced as chromoprotein complexes . although antibacterial bioassays provide a convenient detection method , they are inevitably limited by a lack of specificity as other antibiotics may also inhibit the tested bacterial growth . moreover , some newly discovered enediyne analogs like the sporolides from salinispora tropica have no detectable antibacterial activity ,23 which limits the utility of antibacterial bioassays for discovering novel enediynes . the heptaene metabolite was previously shown to be produced by all 9 - or 10 - membered pkses and their cognate thioesterases thus far tested using in vivo and in vitro approaches .9 - 11 subsequent discovery of this heptaene in fermentations with all enediyne producers inspired its use as a unique and convenient phenotypic indicator for enediyne production .11 since both the heptaene and the final enediyne natural products are biosynthesized by pkses , production of the heptaene indicates that the pkse is functionally expressed and capable of synthesizing the polyketide precursor of the enediyne core . previous work on s. globisporus showed that production of both c - 1027 and heptaene was abolished in a sgce pkse null mutant , but could be restored by complementation with a functional copy of the sgce gene in trans .11 here we demonstrate that in all five s. globisporus recombinant strains , c - 1027 and hepatene production was similarly affected . these data complement previously reported genotypic screenings for new enediyne producers .24,25 more importantly , the use of heptaene production as an indicator of enediyne production presents novel opportunities for fermentation optimization efforts and the identification of cryptic , and otherwise undetectable , enediyne producers . in conclusion , we have demonstrated that , in addition to sgcr3 , the other two regulators , sgcr1 and sgcr2 , identified in the c - 1027 biosynthetic gene cluster also play positive regulatory roles in c - 1027 production . the titers of both c - 1027 and the heptaene metabolite were significantly increased in the sgcr1 - overexpressing s. globisporus strain sb1014 . moreover , data presented here support the application of heptaene production as a convenient phenotypic indicator for enediyne production .\noutput:\n" }, { "from": "agent", "value": "manipulation of pathway regulation is an efficient strategy to increase specific secondary metabolite production . here we successfully improved production of both the enediyne antitumor antibiotic c - 1027 and a heptaebe , an early metabolite of the c - 1027 pathway , by manipulating the three regulatory genes , sgcr1 , sgcr2 , and sgcr3 , within the c - 1027 biosynthetic gene cluster . sgcr3 has previously been established as an activator , and we now propose that sgcr1 and sgcr2 are also positive regulators based on their up - regulation effects on titer and / or timing of heptaene and c - 1027 production in streptomyces globisporus . specifically , overexpression of sgcr1 significantly improved production of the heptaene ( about 5-fold ) and c - 1027 ( 2 - to 3-fold ) compared to the wild - type strain . however , the titers of heptaene and c - 1027 were not increased by overexpressing all three activators together , underscoring the complexity of c - 1027 biosynthetic pathway regulation . the possibility of exploiting the heptaene as a readily identifiable and unique indicator for rapidly detecting enediyne production was also assessed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: postoperative chylothorax is a rare complication in children who have undergone cardiac surgery for congenital heart disease . the general treatment strategy of postoperative chylothorax is conservative , but surgical reintervention may be indicated in refractory cases . lymphatic duct ligation or pleurodesis has been considered as the proper surgical intervention ( 1 , 2 ) . with these surgical treatments , however , problems still remain , and the results are not always satisfactory . furthermore , persistent chylothorax may cause the additional risks to the already compromised patient due to reopening the chest for lymphostasis . therefore , a noninvasive treatment for postoperative chylothorax would be better for the high - risk patients with congenital heart defect . over the last years , an additional conservative treatment option with somatostatin has been introduced as a new modality for treatment of postoperative chylothorax ( 3 - 5 ) . thus far , the results have been mostly reported in the literature as individual case reports on children . in this study , we report our experience in the management of postoperative chylothorax , with emphasis on the efficacy of somatostatin therapy in infant and children with chylothorax after cardiac surgery . from march 2002 to february 2003 , nine patients developed chylothorax following operations for treatment of congenital cardiovascular disease at samsung medical center . chylothorax was diagnosed based on the presence of pleural fluid containing at least one of the following three characteristics : 1 ) milky appearance ; 2 ) pleural fluid triglyceride levels greater than 110 mg / ml ; 3 ) lymphocytic predominance in the fluid cellular component along with sterile cultures ( 6 - 8 ) . the conventional treatment had been undertaken upon recognition of chylothorax in all patients initially . the conventional treatment consisted of drainage of the pleural space by thoracentesis or tube thoracostomy , total parenteral nutrition , enteric rest or diet manipulation such as oral fat intake restricted to medium - chain triglycerides . if the amount of chylous leakage increased in 2 or 3 consecutive days after the conventional treatment , then intravenous somatostatin infusion was instituted . the initial starting dose was 3.5 g / kg / hr and dosage was increased in a stepwise fashion up to 5 , 7 , and 10 g / kg / hr and with a maximum dosage of 15 g / kg / hr . calories , electrolytes , proteins and clotting factors were monitored and replaced as necessary . those patients submitted to cavo - pulmonary procedure ( fontan operation ) were also treated with diuretics , inotropes and vasodilators in order to reduce systemic venous pressure overload . after cessation of the chylous leakage and resumption of normal dietary habits , we initiated a tapering of somatostatin administration by halving the dosage every day over a 3 - day period . side effects of somatostatin such as hypotension , loose stool , and glucose instability were carefully monitored on a regular basis . table 1 shows details of patient , age at time of surgery , the cardiac diagnosis , the type of operation performed , interval to diagnosis of chylothorax after cardiac operation and the maximal drainage volume per day . the maximal daily volume of drainage ranged from 10 to 127 ml / kg per day . the duration of somatostatin therapy varied from 7 to 32 days with a median duration of 18 days . a decrease in drainage was observed at an average of 3.1 days after the initiation of somatostatin , as the dose of somatostatin had increased enough to produce an effect ( fig . all cases of chylothorax were successfully treated with conservative management combined with intravenous infusion of somatostatin . the median duration to reduce to 5 ml / kg per day of lymph drainage was 5 days ( range 1 to 25 days ) . in patient 6 and patient 9 , a rebound phenomenon of chylothoraxwas noted upon the reduction of somatostatin therapy , but the rebound effusion responded promptly when the dose of somatostatin was boosted ( fig . all nine patients had recovered completely from postoperative chylothorax by the use of somatostatin , and could avoid any invasive surgical interventions . a 3 - yr - old girl with a double outlet right ventricle and atrioventricularthe patient was started on somatostatin continuous infusion of 3.5 g / kg / hr when her pleural fluid losses were still 510 ml / day . but the chylous leak was increased for the next 8 days . at that time , her cardiac catheterization showed near complete occlusion of superior vena cava with large thrombus . because the volume of daily leakage was up to 1,000 ml and the patient was in an unstable condition , we decided to attempt an exceptional increase in the somatostatin dose at 15 g / kg / hr before considering the surgical management . superior vena cava syndrome was considered a contributing factor for the prolonged chylous drainage , but the high dose somatostatin infusion was tolerated for 21 days without any apparent side effects ( fig .10 - day - old girl born with transposition of great arteries and ventricular septal defect underwent arterial switch operation and closure of ventricular septal defect . on postoperative day 9 , she had second operation for wound debriment and repair of surgical wound . after that day , drainage from chest tube became large up to 300 ml / day , when her chylothorax was confirmed . her chylous drainage was persistent after conservative managements , so we added infusion of somatostatin . she developed loose stool for 2 days during the infusion of somatostatin , but the diarrhea spontaneously resolved . aside from this , there were no apparent adverse effects of the somatostatin . a 3 - yr - old girl with a double outlet right ventricle and atrioventricular septal defect required a fontan operation . the postoperative course was complicated by chylothorax after 3 days of operation . the patient was started on somatostatin continuous infusion of 3.5 g / kg / hr when her pleural fluid losses were still 510 ml / day . but the chylous leak was increased for the next 8 days . at that time , her cardiac catheterization showed near complete occlusion of superior vena cava with large thrombus . because the volume of daily leakage was up to 1,000 ml and the patient was in an unstable condition , we decided to attempt an exceptional increase in the somatostatin dose at 15 g / kg / hr before considering the surgical management . superior vena cava syndrome was considered a contributing factor for the prolonged chylous drainage , but the high dose somatostatin infusion was tolerated for 21 days without any apparent side effects ( fig .10 - day - old girl born with transposition of great arteries and ventricular septal defect underwent arterial switch operation and closure of ventricular septal defect . on postoperative day 9 , she had second operation for wound debriment and repair of surgical wound . after that day , drainage from chest tube became large up to 300 ml / day , when her chylothorax was confirmed . her chylous drainage was persistent after conservative managements , so we added infusion of somatostatin . she developed loose stool for 2 days during the infusion of somatostatin , but the diarrhea spontaneously resolved . aside from this , there were no apparent adverse effects of the somatostatin . it was estimated to occur at an incidence of 0.25 % to 0.8 % following cardiovascular procedures ( 9 , 10 ) . the standard treatment for postoperative chylothorax includes conservative therapy with pleural space evacuation , enteric rest or fat - free nutrition , and total parenteral nutrition ( 11 ) . if this is not successful , operative treatment such as pleurodesis , ligation of the thoracic duct and pleuroperitoneal shunt is indicated ( 12 , 13 ) . however , these surgical treatments have some limitations . ligation of the thoracic duct may fail as a result of anatomic variations of the thoracic duct or due to a failure for identifying the chylous leakage sites ( 6 ) . there have been several anecdotal reports in the literature related to using somatostatin for treating chylothorax as a complication of thoracic procedures in adults ( 3 - 5 ) . somatostatin is a peptide hormone that acts as a neurohormone as well as a paracrine agent , and it is present in the central nervous system , gastrointestinal tract and pancreas ( 14 ) . the exact mechanisms involved for the drying effect of somatostatin on lymphatic leakage are not wholly understood . the effectiveness of somatostatin may be due to its ability to decrease the hepatic venous pressure gradient , to decrease the intestinal absorption of fats , to decrease the triglyceride concentration in the thoracic duct and to attenuate splanchnic blood flow ( 15 - 17 ) . in addition , it could be that the lymphatic vessels contain somatostatin receptors , like the blood vessels in the splanchnic area , and that their constriction reduces the lymph production ( 18 , 19 ) . in 1998 , rimensberger et al . ( 20 ) reported the successful use of somatostatin in children to control increasing chylous drainage under conservative treatment . in addition , the authors described several pediatric cases of postoperative chylothorax that were treated with somatostatin ( 21 - 23 ) . in our study , 3 patients underwent surgical procedure for their congenital heart disease during the neonatal period . in our cases , no serious complications associated with unabated chylous drainage were encountered , which is in contrast to the previous reports ( 21 , 22 ) . this is probably due to the prompt use of intravenous somatostatin after the diagnosis of chylothorax during the postoperative period . opinions vary in the literature regarding the appropriate dose and type of administration for somatostatin for children with postoperative chylothorax . the starting dose was 3.5 g / kg / hr according to the case report of rimensberger et al . buettiker et al . suggest that chyle production began cessation at a dose of 10 g / kg / hr , but they also tried increasing the dose up to 12 g / kg / hr for chylothorax refractory to the conventional dose ( 21 ) . in our study , we increased the dosage of somatostatin up to 15 g / kg / hr in one case without observing any serious side effects . somatostatin is currently used for the therapy of diverse pediatric diseases such as acromegaly , intractable diarrhea and gastrointestinal bleeding ( 24 - 29 ) . because this therapy is still experimental , further studies that take into consideration the duration and tolerable dosages are necessary to assess the safety of its administration in children . superior vena cava thrombosis is also well known to be a risk factor for the failure of non - operative management of chylothorax ( 1 ) . it is usually recommended that such patients be considered for earlier operative intervention when this complication is associated with chylothorax . in our case , however , the patient 's poor general condition led us to attempt somatostatin trial before any invasive steps . the satisfactory outcome in this patient may be speculated as the results of somatostatin and / or the development of collateral lymphatic channels . the side effect of somatostatin is primarily related to the suppressed actions of gastrointestinal motility and secretion , and this includes hypotension , loose stool , malabsorption , nausea , flatulence , liver dysfunction and hyperglycemia ( 15 ) . in all 9 patients , no significant side effectsthe results of our case series are suggesting the value and safety of somatostatin in pediatric patients with postoperative chylothorax . the continuous infusion of somatostatin may be of particular benefit if the patient is in a poor general condition , and additional risks may be introduced with repeated surgery .\noutput:\n" }, { "from": "agent", "value": "chylothorax is a rare but serious postoperative condition with a high rate of morbidity that may lead to death of children with congenital heart disease . here we reviewed nine consecutive cases with chylothorax in infants and children following cardiac surgery from march 2002 to february 2003 . somatostatin was added to conservative treatment proctocol to increase effectiveness of therapy in all cases . the duration of somatostatin therapy varied from 7 to 32 days . all cases of chylothorax were successfully treated with intravenous infusion of somatostatin as an adjunctive treatment . even though two cases showed rebound phenomena , we avoided any surgical procedure in the nine patients who treated with conservative management combined with somatostatin . no significant side effects of somatostatin were observed . it seems that somatostatin is effective , noninvasive and safe therapeutic modality . it can be used as an adjunctive treatment to conservative management to control postoperative chylothorax in children with congenital heart disease ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: all participants were fully informed of risks and discomforts associated with the experiment before giving informed written consent . the study was approved by the ethics committee in copenhagen county and conducted in accordance with the guidelines of the declaration of helsinki . the diabetic patients were recruited from outpatient clinics and selected by world health organization criteria ( table 1 ) . demographic data for 10 healthy volunteers and 10 diabetic patients data are means se unless otherwise indicated . , the subjects arrived at the laboratory after a light breakfast , refraining from alcohol and caffeine for 12 h. the diabetic subjects maintained their usual antidiabetic treatment . before the trials , bmi and leg mass were calculated from whole - body dual - energy x - ray absorptiometry scanning ( prodigy ; ge medical systems , waukesha , wi ) . the subjects did a pretest of one - legged knee extension ( 24 min ) at 12 w ( 200 g and 60 rotations per min ) to determine the individual rise in leg blood flow ( lbf ) to this workload . after the pretest , catheters were placed into the femoral artery and vein of the experimental leg and into the femoral artery of the nonexperimental leg under local anesthesia ( 5 g / ml lidocain ; region hovedstadens apotek ) . a muscle biopsy was obtained from the middle portion of the vastus lateralis muscle using the percutaneous needle biopsy technique with suction . endothelial function was described by the vasodilatatory response to intra - arterial infusion of acetylcholine ( 10 mg / ml miochol - e ; novartis ) . during this test , the subjects were in a supine position to avoid an effect on cardiac output as a result of reduced preload . an lbf response 1.5 l / min to 320 g / min ( 50 % reduction compared with that in control subjects ) was defined as endothelial dysfunction . one diabetic participant was excluded due to a response higher than 1.5 l / min . after 20 min of rest , the subjects were seated in the one - legged knee - extensor ergometer . in random order , infusions of atp ( a7699 ; sigma ) , utp ( u6625 ; sigma ) , and ado ( item development , stocksund , sweden ) were performed ; all drugs were dissolved in isotonic saline and infused into the femoral artery of the experimental leg . infusion rates were increased until lbf reached a steady state at the target lbf determined during the pretest , and the infusion rate was maintained for 8 min . ultimately , 8 min of one - legged exercise at 12 w was performed . the subjects rested at least 20 min after each intervention . a scheduled test with nitroglycerin had to be renounced due to massive side effects . the infusion rate required to obtain an lbf similar to the exercise - induced lbf resulted in substantial decrease in mean arterial pressure ( map ) and severe headache in the first two subjects studied . for the substances used , we titrated the amount needed to elicit an lbf similar to lbf during exercise ( fig . scatter plots of lbf per micromole of infused atp , utp , and ado , respectively , normalized for leg total mass . infusion rates were carefully titrated to elicit an lbf , similar to lbf during exercise . lbf was measured with ultrasound doppler ( vivid 7 ; ge healthcare ) probe 8c . the two - dimensional frequency was 6.7 mhz and the pulsed wave frequency 5 mhz . during rest , the diameter of the femoral artery was determined under a perpendicular insonation angle as an average of three measurements ( 13 ) . the site of blood velocity measurements in the common femoral artery was distal to the inguinal ligament but above the bifurcation into the superficial and profound femoral branch to avoid turbulence from the bifurcation . at this position , proximal to the exercising muscles , the vessel diameter is unaffected by contraction and relaxation ( 13 ) . all recordings were obtained below an insonation angle of 60 . sample volume was placed in the center of the vessel , adjusted to the width of the diameter , and kept clear of the vessel walls . sample volume varied between 4.4 and 6.3 mm . low - velocity filter ( velocities 1.8 m / s ) rejected noises caused by turbulence at the vascular wall . blood velocity was measured at baseline and after 4 and 8 min of infusion or exercise . lbf was calculated by multiplying the cross - sectional area of the femoral artery with the amplitude , vmean , and the three measurements were averaged . heart rate was recorded with an electrocardiogram , and map was monitored with transducers positioned at heart level ( pressure monitoring kit ; baxter , deerfield , il ) ; data were continuously recorded using a powerlab system ( adinstruments , sydney , australia ) . blood samples were collected at baseline and after 4 and 8 min of exercise or infusion in steady state and at the target lbf . blood samples were obtained from the femoral artery of the nonexperimental leg and with a 5 - s delay from the femoral vein of the experimental leg . blood gases and hemoglobin were measured using an abl725 analyzer ( radiometer , copenhagen , denmark ) . muscle biopsies were separated in two parts : one part was quickly frozen in liquid nitrogen ( 15 s ) and the other part was fixed in tissue - tek ( sakura , torrance , ca ) and carefully frozen in isopentane , placed in a cup in liquid nitrogen . total rna was isolated from 20 mg of muscle tissue by a modified guanidinium thiocyanatephenol - chloroform extraction method adapted from chomczynski and sacchi ( 1987 ) as previously described ( 14 ) . superscript ii rnase h system ( invitrogen , carlsbad , ca ) and oligodeoxythymidylic acids were used to reverse transcribe the mrna to cdna . the cdna samples were diluted in nuclease - free h2o to a total volume of 150 l . the amount of single - stranded dna was determined in each cdna sample using oligreen reagent ( molecular probes , leiden , the netherlands ) as previously described ( 15 ) . the p2y2 mrna content was determined by pcr using the fluorogenic 5 nuclease assay with taqman probes ( abi prism 7900 sequence detection system ; applied biosystems , foster city , ca ) . forward ( 5 cagcacggtgctctgcaa 3 ) and reverse ( 5 cgctgatgcaggtgaggaa 3 ) primers and taqman probe ( 5 tgcgcttcctcttctacaccaacctttactg 3 ) were designed and optimized for the pcr ( 16 ) . the obtained critical threshold values reflecting the initial content of p2y2 mrna in the samples were converted to an arbitrary amount using a standard curve obtained from a serial dilution of a representative pooled sample . for each reverse transcription sample , the cellular localizations were determined on 8 - m transverse sections of frozen skeletal muscle samples , incubated with a rabbit polyclonal p2y2 antibody ( apr - 010 ; alomone laboratories , jerusalem , israel ) . endothelial cells were detected with a primary monoclonal antibody , mouse - cd31 ( clone jc70a ; dako , glostrup , denmark ) and smooth muscle cells with - smooth muscle cell actin ( m3558 ; dako ) and then incubated with either biotin - coupled goat - rabbit ( e0432 ; dako ) or biotin - coupled rabbit - mouse antibody ( e0354 ; dako ) . staining of purinergic receptors , endothelial cells , and smooth muscle cells was performed on serial sections . immunoreactive cells were examined and photographed in a zeiss axioplan microscope ( carl zeiss , jena , germany ) ( 7 ) . cardiac output was calculated from arterial blood pressure using the model flow method ( beat scope 1.1 a ; finapress medical systems bv , amsterdam , the netherlands ) . stroke volume was calculated as the quotient between cardiac output and heart rate . leg vascular conductance ( lvc ) leg oxygen uptake ( vo2 ) was calculated as the product of the arterious - venous ( a - v ) difference of oxygen and lbf . - values of the hemodynamic variables were analyzed by a two - way repeated - measures anova , with nucleotides and control / type 2 diabetes as between - subject factors . if normality or equal variance failed , data were log - transformed . there was no difference in any variable between 4 and 8 min of infusion or exercise ; therefore , only data after 8 min are presented . the significance level was set at p 0.05 . the subjects did a pretest of one - legged knee extension ( 24 min ) at 12 w ( 200 g and 60 rotations per min ) to determine the individual rise in leg blood flow ( lbf ) to this workload . after the pretest , catheters were placed into the femoral artery and vein of the experimental leg and into the femoral artery of the nonexperimental leg under local anesthesia ( 5 g / ml lidocain ; region hovedstadens apotek ) . a muscle biopsy was obtained from the middle portion of the vastus lateralis muscle using the percutaneous needle biopsy technique with suction . endothelial function was described by the vasodilatatory response to intra - arterial infusion of acetylcholine ( 10 mg / ml miochol - e ; novartis ) . during this test , the subjects were in a supine position to avoid an effect on cardiac output as a result of reduced preload . an lbf response 1.5 l / min to 320 g / min ( 50 % reduction compared with that in control subjects ) was defined as endothelial dysfunction . one diabetic participant was excluded due to a response higher than 1.5 l / min . after 20 min of rest , the subjects were seated in the one - legged knee - extensor ergometer . in random order , infusions of atp ( a7699 ; sigma ) , utp ( u6625 ; sigma ) , and ado ( item development , stocksund , sweden ) were performed ; all drugs were dissolved in isotonic saline and infused into the femoral artery of the experimental leg . infusion rates were increased until lbf reached a steady state at the target lbf determined during the pretest , and the infusion rate was maintained for 8 min . ultimately , 8 min of one - legged exercise at 12 w was performed . the infusion rate required to obtain an lbf similar to the exercise - induced lbf resulted in substantial decrease in mean arterial pressure ( map ) and severe headache in the first two subjects studied . for the substances used , we titrated the amount needed to elicit an lbf similar to lbf during exercise ( fig . scatter plots of lbf per micromole of infused atp , utp , and ado , respectively , normalized for leg total mass . infusion rates were carefully titrated to elicit an lbf , similar to lbf during exercise . lbf was measured with ultrasound doppler ( vivid 7 ; ge healthcare ) probe 8c . the two - dimensional frequency was 6.7 mhz and the pulsed wave frequency 5 mhz . during rest , the diameter of the femoral artery was determined under a perpendicular insonation angle as an average of three measurements ( 13 ) . the site of blood velocity measurements in the common femoral artery was distal to the inguinal ligament but above the bifurcation into the superficial and profound femoral branch to avoid turbulence from the bifurcation . at this position , proximal to the exercising muscles , the vessel diameter is unaffected by contraction and relaxation ( 13 ) . all recordings were obtained below an insonation angle of 60 . sample volume was placed in the center of the vessel , adjusted to the width of the diameter , and kept clear of the vessel walls . low - velocity filter ( velocities 1.8 m / s ) rejected noises caused by turbulence at the vascular wall . blood velocity was measured at baseline and after 4 and 8 min of infusion or exercise . lbf was calculated by multiplying the cross - sectional area of the femoral artery with the amplitude , vmean , and the three measurements were averaged . heart rate was recorded with an electrocardiogram , and map was monitored with transducers positioned at heart level ( pressure monitoring kit ; baxter , deerfield , il ) ; data were continuously recorded using a powerlab system ( adinstruments , sydney , australia ) . blood samples were collected at baseline and after 4 and 8 min of exercise or infusion in steady state and at the target lbf . blood samples were obtained from the femoral artery of the nonexperimental leg and with a 5 - s delay from the femoral vein of the experimental leg . blood gases and hemoglobin were measured using an abl725 analyzer ( radiometer , copenhagen , denmark ) . muscle biopsies were separated in two parts : one part was quickly frozen in liquid nitrogen ( 15 s ) and the other part was fixed in tissue - tek ( sakura , torrance , ca ) and carefully frozen in isopentane , placed in a cup in liquid nitrogen . total rna was isolated from 20 mg of muscle tissue by a modified guanidinium thiocyanate phenol - chloroform extraction method adapted from chomczynski and sacchi ( 1987 ) as previously described ( 14 ) . superscript ii rnase h system ( invitrogen , carlsbad , ca ) and oligodeoxythymidylic acids were used to reverse transcribe the mrna to cdna . the cdna samples were diluted in nuclease - free h2o to a total volume of 150 l . the amount of single - stranded dna was determined in each cdna sample using oligreen reagent ( molecular probes , leiden , the netherlands ) as previously described ( 15 ) . the p2y2 mrna content was determined by pcr using the fluorogenic 5 nuclease assay with taqman probes ( abi prism 7900 sequence detection system ; applied biosystems , foster city , ca ) . forward ( 5 cagcacggtgctctgcaa 3 ) and reverse ( 5 cgctgatgcaggtgaggaa 3 ) primers and taqman probe ( 5 tgcgcttcctcttctacaccaacctttactg 3 ) were designed and optimized for the pcr ( 16 ) . the obtained critical threshold values reflecting the initial content of p2y2 mrna in the samples were converted to an arbitrary amount using a standard curve obtained from a serial dilution of a representative pooled sample . for each reverse transcription sample , the cellular localizations were determined on 8 - m transverse sections of frozen skeletal muscle samples , incubated with a rabbit polyclonal p2y2 antibody ( apr - 010 ; alomone laboratories , jerusalem , israel ) . endothelial cells were detected with a primary monoclonal antibody , mouse - cd31 ( clone jc70a ; dako , glostrup , denmark ) and smooth muscle cells with - smooth muscle cell actin ( m3558 ; dako ) and then incubated with either biotin - coupled goat - rabbit ( e0432 ; dako ) or biotin - coupled rabbit - mouse antibody ( e0354 ; dako ) . staining of purinergic receptors , endothelial cells , and smooth muscle cells was performed on serial sections . immunoreactive cells were examined and photographed in a zeiss axioplan microscope ( carl zeiss , jena , germany ) ( 7 ) . cardiac output was calculated from arterial blood pressure using the model flow method ( beat scope 1.1 a ; finapress medical systems bv , amsterdam , the netherlands ) . leg vascular conductance ( lvc ) was calculated as the quotient between lbf and map . leg oxygen uptake ( vo2 ) was calculated as the product of the arterious - venous ( a - v ) difference of oxygen and lbf . - values of the hemodynamic variables were analyzed by a two - way repeated - measures anova , with nucleotides and control / type 2 diabetes as between - subject factors . if normality or equal variance failed , data were log - transformed . there was no difference in any variable between 4 and 8 min of infusion or exercise ; therefore , only data after 8 min are presented . both leg muscle mass and leg total mass were comparable in control versus diabetic subjects ( table 1 ) . in addition , the resting lbf was similar between the two groups ( 0.340.02 vs. 0.270.03 l / min ) ( fig .2 ) as was the flow response to 12 w of workload ( 2.70.2 vs. 2.40.2 l / min ) . however , the increase in lbf per micromole of infused substance was different for control versus diabetic subjects : 27437 vs. 14326 ml / mol atp kg , 49480 vs. 23439 ml / mol utp kg , and 153 vs. 7.50.6 ml / mol ado kg ( fig . , the vasodilator potency was as follows : utp control subjects ( 100 ) atp control subjects ( 55 ) utp diabetic subjects ( 47 ) atp diabetic subjects ( 29 ) ado control subjects ( 3 ) ado diabetic subjects ( 1.5 ) . within the groups , the potency varied with similar order of rank and proportions : utp ( 100 ) atp ( 55 ) ado ( 3 ) for control subjects versus utp ( 100 ) atp ( 61 ) ado ( 3.2 ) for the diabetic subjects . lbf responses showing that lbf was increased during infusions of atp , utp , and ado to match lbf during exercise ( exe ) . the dose needed to elicit the target lbf differed substantially . in the control group ( left panel ) , the mean infusion rates were as follows : atp , 0.8 mol / min ( range 0.41 ) ; utp , 0.5 mol / min ( range 0.21 ) ; and ado , 13.7 mol / min ( range 518 ) . in the diabetic group ( right panel ) , mean infusion rates were as follows : atp , 1.2 mol / min ( range 0.52 ) ; utp , 0.9 mol / min ( range 0.52 ) ; and ado , 19.4 mol / min ( range 1727 ) . map was similar in the two groups at baseline ( 1096 vs. 994 mmhg for control subjects vs. diabetic subjects , respectively ) ( fig . map decreased during all three infusions by 510 mmhg , with the largest decrease during atp infusion . during exerciselocal hemodynamic variables at baseline ; during infusions of atp , utp , and ado ; and during exercise ( exer ) in control ( left panel ) and diabetic ( right panel ) subjects . * p 0.05 compared with control subjects . lvc was similar at baseline ( 3.00.2 vs. 2.70.3 ml min mmhg for control subjects vs. diabetic subjects , respectively ) , during exercise ( 232 vs. 212 ) , and during the three infusions , increasing in the range of 26 to 30 . oxygen delivery to the leg did not differ between the groups at baseline ( 596 vs. 494 ml / min ) or during infusion or exercise ( range 444552 ml / min ) . the a - v o2 difference was larger in the diabetic subjects at baseline ( 785 vs. 1006 ml , there were no differences in the groups , but during exercise , a - v o2 difference was larger in the diabetic group ( 1294 vs. 1426 ml / l ) . the larger a - v difference in the diabetic group compensated for a slightly lower lbf ; both groups had a vo2 of 25 ml / min at baseline and 360 ml / min during exercise . during the three infusions , vo2 ranged between 28 and 45 ml / min with no difference between the groups . mmol / l ) , but there was no difference in the increase during exercise ( 1.6 mmol / l ) or in the decrease during the infusions ( 0.10.3 mmol / l ) . heart rate at baseline tended to be lower for the control group than the diabetic group ( 673 vs. 774 bpm , p = 0.056 ) ( fig . heart rate increased by 5 bpm during infusions , independent of group and nucleotide . during exercise , heart rate increased to similar levels for the two groups ( 925 vs. 955 bpm for control subjects vs. diabetic subjects , respectively ) . systemic hemodynamic variables at baseline ; during infusions of atp , utp , ado ; and during exercise ( exe ) in control ( left panel ) and diabetic ( right panel ) subjects . * p 0.05 compared with control subjects . stroke volume was different at baseline ( 703 vs. 905 ml / beat for control subjects vs. diabetic subjects , respectively ) . the elevation of stroke volume during the infusions was similar in the two groups and increased in the range of 1017 ml / min and was essentially unchanged during exercise . consequently , cardiac output also differed at baseline ( 4.70.2 vs. 6.80.5 l / min for control subjects vs. diabetic subjects , respectively ) . there was , however , no difference in the increase of cardiac output between the two groups during the various interventions , although the small increase in cardiac output during exercise showed a tendency to be higher in the diabetic group ( p = 0.056 ) . p2y2 receptors were located in the endothelium of capillaries and in endothelium and smooth muscle cells of microvessels . the p2x1 receptors were present in the endothelium of capillaries and in the skeletal muscle sarcolemma but not in smooth muscle cells ( fig . b : positive staining for endothelium ( endo ) ( ulex europaeus agglutinin - 1 [ uea - 1 ] ) . c : positive staining for vascular smooth muscle cells ( smc ) ( - smooth muscle cell actin [ m3558 ; dako ] ) . p2y2 purinergic receptors were present in endothelial cells of capillaries and microvessels and in vascular smooth muscle cells , whereas p2x1 receptors were not present in smooth muscle cells . e and f : positive staining for the p2x1 receptor ( apr - 001 ; alomone laboratories ) ( e ) and positive staining for endothelium ( ulex europaeus agglutinin - 1 ) ( f ) on the same section as in e. the p2x1 receptors were present in the endothelium of capillaries and in the skeletal muscle sarcolemma . also , the quantity of mrna for p2y2 receptors was similar in the two groups ( 6915 vs. 7016 arbitrary units for control subjects vs. type 2 diabetic subjects , respectively ) . both leg muscle mass and leg total mass were comparable in control versus diabetic subjects ( table 1 ) . in addition , the resting lbf was similar between the two groups ( 0.340.02 vs. 0.270.03 l / min ) ( fig .2 ) as was the flow response to 12 w of workload ( 2.70.2 vs. 2.40.2 l / min ) . however , the increase in lbf per micromole of infused substance was different for control versus diabetic subjects : 27437 vs. 14326 ml / mol atp kg , 49480 vs. 23439 ml / mol utp kg , and 153 vs. 7.50.6 ml / mol ado kg ( fig . , the vasodilator potency was as follows : utp control subjects ( 100 ) atp control subjects ( 55 ) utp diabetic subjects ( 47 ) atp diabetic subjects ( 29 ) ado control subjects ( 3 ) ado diabetic subjects ( 1.5 ) . within the groups , the potency varied with similar order of rank and proportions : utp ( 100 ) atp ( 55 ) ado ( 3 ) for control subjects versus utp ( 100 ) atp ( 61 ) ado ( 3.2 ) for the diabetic subjects . lbf responses showing that lbf was increased during infusions of atp , utp , and ado to match lbf during exercise ( exe ) . the dose needed to elicit the target lbf differed substantially . in the control group ( left panel ) , the mean infusion rates were as follows : atp , 0.8 mol / min ( range 0.41 ) ; utp , 0.5 mol / min ( range 0.21 ) ; and ado , 13.7 mol / min ( range 518 ) . in the diabetic group ( right panel ) , mean infusion rates were as follows : atp , 1.2 mol / min ( range 0.52 ) ; utp , 0.9 mol / min ( range 0.52 ) ; and ado , 19.4 mol / min ( range 1727 ) . map was similar in the two groups at baseline ( 1096 vs. 994 mmhg for control subjects vs. diabetic subjects , respectively ) ( fig . map decreased during all three infusions by 510 mmhg , with the largest decrease during atp infusion . during exerciselocal hemodynamic variables at baseline ; during infusions of atp , utp , and ado ; and during exercise ( exer ) in control ( left panel ) and diabetic ( right panel ) subjects . * p 0.05 compared with control subjects . lvc was similar at baseline ( 3.00.2 vs. 2.70.3 ml min mmhg for control subjects vs. diabetic subjects , respectively ) , during exercise ( 232 vs. 212 ) , and during the three infusions , increasing in the range of 26 to 30 . oxygen delivery to the leg did not differ between the groups at baseline ( 596 vs. 494 ml / min ) or during infusion or exercise ( range 444552 ml / min ) . the a - v o2 difference was larger in the diabetic subjects at baseline ( 785 vs. 1006 , there were no differences in the groups , but during exercise , a - v o2 difference was larger in the diabetic group ( 1294 vs. 1426 ml / l ) . the larger a - v difference in the diabetic group compensated for a slightly lower lbf ; both groups had a vo2 of 25 ml / min at baseline and 360 ml / min during exercise . during the three infusions , vo2 ranged between 28 and 45 ml / min with no difference between the groups . mmol / l ) , but there was no difference in the increase during exercise ( 1.6 mmol / l ) or in the decrease during the infusions ( 0.10.3 mmol / l ) . heart rate at baseline tended to be lower for the control group than the diabetic group ( 673 vs. 774 bpm , p = 0.056 ) ( fig . heart rate increased by 5 bpm during infusions , independent of group and nucleotide . during exercise , heart rate increased to similar levels for the two groups ( 925 vs. 955 bpm for control subjects vs. diabetic subjects , respectively ) . systemic hemodynamic variables at baseline ; during infusions of atp , utp , ado ; and during exercise ( exe ) in control ( left panel ) and diabetic ( right panel ) subjects . * p 0.05 compared with control subjects . stroke volume was different at baseline ( 703 vs. 905 ml / beat for control subjects vs. diabetic subjects , respectively ) . the elevation of stroke volume during the infusions was similar in the two groups and increased in the range of 1017 ml / min and was essentially unchanged during exercise . consequently , cardiac output also differed at baseline ( 4.70.2 vs. 6.80.5 l / min for control subjects vs. diabetic subjects , respectively ) . there was , however , no difference in the increase of cardiac output between the two groups during the various interventions , although the small increase in cardiac output during exercise showed a tendency to be higher in the diabetic group ( p = 0.056 ) . p2y2 receptors were located in the endothelium of capillaries and in endothelium and smooth muscle cells of microvessels . the p2x1 receptors were present in the endothelium of capillaries and in the skeletal muscle sarcolemma but not in smooth muscle cells ( fig . b : positive staining for endothelium ( endo ) ( ulex europaeus agglutinin - 1 [ uea - 1 ] ) . c : positive staining for vascular smooth muscle cells ( smc ) ( - smooth muscle cell actin [ m3558 ; dako ] ) . p2y2 purinergic receptors were present in endothelial cells of capillaries and microvessels and in vascular smooth muscle cells , whereas p2x1 receptors were not present in smooth muscle cells . e and f : positive staining for the p2x1 receptor ( apr - 001 ; alomone laboratories ) ( e ) and positive staining for endothelium ( ulex europaeus agglutinin - 1 ) ( f ) on the same section as in e. the p2x1 receptors were present in the endothelium of capillaries and in the skeletal muscle sarcolemma . also , the quantity of mrna for p2y2 receptors was similar in the two groups ( 6915 vs. 7016 arbitrary units for control subjects vs. type 2 diabetic subjects , respectively ) . the main findings of the present study are that 1 ) the vasodilatatory response to atp , utp , and ado infusion was lower in patients with type 2 diabetes compared with age - matched control subjects and 2 ) type 2 diabetes does not affect the distribution or the gene expression of p2y2 or p2x1 receptors . nucleotides have been found to play a role in the regulation of skeletal muscle blood flow during hyperemic conditions , including exercise , where shear stress and hypoxia are important stimuli of both atp and utp release from endothelial cells . erythrocytes are proposed to function as oxygen sensors , contributing to the muscle blood flow regulation by the simultaneous release of atp and s - nitrosohemoglobin in proportion to off - loading o2 from the hemoglobin molecule , thereby inducing vasodilation and a consequential rise in oxygen delivery to the tissues in demand ( 17,18 ) . however , erythrocytes from humans with type 2 diabetes , incubated with the stimulating agent mastoparan 7 , released less atp than erythrocytes from nondiabetic subjects ( 6 ) . the vasodilatatory effect of atp , utp , and ado has so far been tested only in young healthy subjects with a normal endothelial function . in the current study , all diabetic subjects had endothelial dysfunction as evidenced by a reduction in lbf during acetylcholine infusion , and needed a higher dose of nucleotides , in general twice as much , to elicit a rise in leg blood flow similar to that achieved during moderate exercise . these findings indicate that type 2 diabetes affects the purinergic system , compromising cardiovascular regulation in diabetic patients . it is , therefore , likely that the reduced exercise capacity of diabetic patients is due partly to less available atp in combination with a reduction in vasodilatatory potency of atp . in young healthy subjects , pharmacological inhibition of both no and pg synthesis during atp infusion has been found to diminish leg blood flow by 40 % , indicating that the vasodilatatory effect of atp is mediated by no and pg but also by additional mechanisms ( 7 ) . similarly , inhibition of both no and pg synthesis during ado infusion has been reported to reduce blood flow by 70 % , with a larger reduction occurring during pg blockade compared with no blockade , suggesting that to a large extent , the vasodilatatory effect of ado is mediated through no and pg and that the increased no formation could be prostaglandin mediated ( 19 ) . several studies show that type 2 diabetes diminishes the bioavailability of no and pg and decreases the half - life and activity of no ( 20,21 ) . consequently , part of the reduced vasodilatatory effect of the infused nucleotides and nucleoside may be attributed to a reduction in availability and activity of no and / or prostaglandins or other mediators . alternatively , the impaired sensitivity to nucleotides could be related to a more extensive formation and action of vasoconstricting compounds . diabetes is known to be associated with increased synthesis of constrictory compounds ( i.e. , prostanoids , endothelin , and angiotensin ii ) ; therefore , a higher constrictory tone might underlie the reduction in vasodilatatory effect of the purinergic agonists ( 3,22 ) . also , type 2 diabetic patients have a higher muscle sympathetic nerve activity and a higher sensitivity to catecholamines ( 21,23 ) . enhanced adrenergic receptor sensitivity might relate to endothelial damage because the intact endothelium attenuates adrenergic reactivity in control arteries , a mechanism that was not present in arteries from diabetic patients ( 24 ) . it was recently demonstrated that atp and utp induce potent vasodilation at rest but also oppose a concomitant increase in sympathetic activity as seen during exercise , indicating that circulating nucleotides may be modulators of sympathetic vasoconstriction during exercise a phenomenon termed functional sympatholysis ( 2527 ) . the phenomenon does not occur during ado or no infusion or during no blockade during exercise , suggesting that other secondary metabolites must be of importance ( 28 ) . despite the reduced vasodilatatory capacity of atp , utp , and ado in the diabetic subjects , the response to exercise was diminished by 10 % in the diabetic group , indicating that none of the infused substances is mandatory to elicit exercise hyperemia . most exercise studies show that blood flow will be reduced but not hindered despite multiple pathway blockades , suggesting that redundancy will occur to sustain exercise performance . in this context , atp is not an obligatory vasodilator in normal or pathological conditions and other systems may be upregulated , exemplified in settings of reduced no availability , for instance , in the endothelial nitric oxide synthase knockout mice , where endothelium - derived hyperpolarizing factor mediated relaxation in resistance arteries is upregulated ( 29 ) . also , greater reliance on k - atp channels may occur ( 30 ) . in studies of young healthy subjects , atp andin contrast , atp and utp did not have equal potency in the present study , either in the control or the diabetic group . first , in vitro inhibition of no - mediated dilatation of atp and utp showed that utp exceeded atp , indicating that utp could be less dependent on no ( 31 ) . moreover , a recent study on the affect of aging on skeletal muscle blood flow found that age - dependent reduction in forearm blood flow is due to a decline in endothelial - derived no ( 32 ) . therefore , it is likely that a decrease in bioavailability and activity of no and pg affects the potency of atp more than the potency of utp , leading to the differences observed in the present study . second , the intact endothelium does not allow intraluminal atp to pass the barrier ( 33 ) , but when endothelial damage occurs , it can not be excluded that intraluminal metabolites , including atp , diffuse to the interstitium , activating extraluminal p2x receptors on vascular smooth muscle cells , thus resulting in a concurrent vasoconstriction . utp does not have this constrictory ability , and endothelial leakage may , in this context , affect the vasodilatatory effect of utp less than atp . also , regarding ado , we found a change in potency in both groups compared with that in other studies of young healthy subjects ( atp : ado = 1:16 in young subjects vs. 1:19 in both groups of the present study ) ( 25 ) . again , because the effect of ado is mediated mainly by formation of pg and no , the impaired no formation accompanying aging may reduce the vasodilatatory effect of ado more than atp and utp , and the further reduction of effect in the diabetic group reflects the supplementary impact of diabetes on the mediators of the vasodilatatory responses . the present study focused on the peripheral aspects of blood flow and infusions were therefore performed in the femoral artery with little effect on systemic hemodynamic parameters . the diabetic subjects had higher stroke volume and cardiac output , but both variables are calculated , and indirect measurements of cardiac output in obese subjects may be overestimated . the trend of a slightly lower lbf in the diabetic subjects during exercise may be the result of a reduced exercise capacity because some diabetic subjects had difficulties fulfilling 8 min of exercise at this modest workload despite the similar supply of oxygen . quantification of the p2y2 receptor did not show differences in the level of gene expression in the two groups , indicating that type 2 diabetes does not affect the rate and way of mrna expression of the p2y2 receptor gene . this does not preclude , however , that p2y2 and p2x1 receptor function could be altered in diabetic patients . it is well known that pathology may induce differences in a transcribed protein , thus modifying the properties of a protein or a receptor after transcription . immunohistochemical analysis revealed that localization of p2y2 and p2x1 receptors was consistent with previous findings in young healthy subjects , allowing us to conclude that the reduction in vasodilatatory potency is not due to changes in receptor distribution . still , the analysis is a qualitative investigation and does not exclude differences in receptor amount and a potential change in function of the receptors ; a profound morphological analysis of receptor amount and quality could elucidate potential differences in function and distribution of the receptors and target proteins . p2x1 especially could be of interest because this receptor is widely distributed in the plasma membrane of skeletal muscle cells . in summary , the present findings demonstrate that the vasodilatatory potency of the purinergic system is attenuated in diabetic patients and of such a magnitude that it could be an important factor for the observed impairment in regulation of vascular tone in diabetic patients . potential explanations for the reduced effect of the purinergic system could be 1 ) less available atp as a result of a decline in release from erythrocytes , 2 ) reduced bioavailability of different mediators , 3 ) an intensified vasoconstrictory counteraction , and 4 ) an increase in sympathetic tone , resulting in impaired functional sympatholysis . the present observations suggest that the purinergic system may be involved in the pathogenesis of endothelial dysfunction and , thereby , underlie the cardiovascular complications associated with diabetes . the attenuation in purinergic receptor responses could , in part , be implicated in capillary rarefaction and impaired regulation of capillary recruitment in skeletal muscle tissue , known to compromise insulin sensitivity and glucose uptake . the current findings , in combination with existing evidence , provide a basis for further studies addressing the mechanisms underlying the reduced vascular function and exercise capacity in diabetic patients .\noutput:\n" }, { "from": "agent", "value": "objectiveextracellular nucleotides and nucleosides are involved in regulation of skeletal muscle blood flow . diabetes induces cardiovascular dysregulation , but the extent to which the vasodilatatory capacity of nucleotides and nucleosides is affected in type 2 diabetes is unknown . the present study investigated 1 ) the vasodilatatory effect of atp , uridine - triphosphate ( utp ) , and adenosine ( ado ) and 2 ) the expression and distribution of p2y2 and p2x1 receptors in skeletal muscles of diabetic subjects.research design and methodsin 10 diabetic patients and 10 age - matched control subjects , leg blood flow ( lbf ) was measured during intrafemoral artery infusion of atp , utp , and ado , eliciting a blood flow equal to knee - extensor exercise at 12 w ( 2.6 l / min ) . resultsthe vasodilatatory effect of the purinergic system was 50 % lower in the diabetic group as exemplified by an lbf increase of 274 37 vs. 143 26 ml / mol atp kg , 494 80 vs. 234 39 ml / mol utp kg , and 14.9 2.7 vs. 7.5 0.6 ml / mol ado kg in control and diabetic subjects , respectively , thus making the vasodilator potency as follows : utp control subjects ( 100 ) > atp control subjects ( 55 ) > utp diabetic subjects ( 47 ) > atp diabetic subjects ( 29 ) > ado control subjects ( 3 ) > ado diabetic subjects ( 1.5 ) . the distribution and mrna expression of receptors were similar in the two groups.conclusionsthe vasodilatatory effect of the purinergic system is severely reduced in type 2 diabetic patients . the potency of nucleotides varies with the following rank order : utp > atp > ado . this is not due to alterations in receptor distribution and mrna expression , but may be due to differences in receptor sensitivity ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: untreated , mortality is 50 % when the central nervous system ( cns ) is involved and 85 % for disseminated infection , with up to 50 % of survivors demonstrating developmental abnormalities . administration of high - dose acyclovir decreases mortality to 4 % for cns and 29 % for disseminated disease . diagnosis of neonatal herpes , however , is challenging : vesicles are absent in nearly 40 % of severe infections ; other early symptoms and signs are nonspecific , and disseminated infection can appear identically to bacterial sepsis . in the usa , this risk is more than 300 times higher when herpes simplex virus ( hsv ) is isolated versus not isolated from the genital tract during labor . more than half of neonatal herpes cases in the usa and europe are associated with maternal acquisition of hsv - 1 or hsv - 2 near the time of delivery and the remainder result from exposure of the baby to reactivating maternal infection . the rate of transmission to the infant is higher ( 2550 % ) in first episode infections than reactivation ( 1 % ) , presumably due to the lack of transplacental transfer of maternal neutralizing antibodies and increased quantity of hsv shed in first episode infections . routine serologic screening of pregnant women for hsv is not recommended in the united states . anti - hsv therapy is recommended for women with a first episode of genital herpes during pregnancy to ameliorate their clinical symptoms . for women with recurrent genital herpes , suppressive therapy at 36 weeks of gestationroutine hsv screening of pregnant women , hsv suppressive therapy near term , and cesarean section for women with genital lesions at delivery are not the standard of care for women with genital herpes in south africa . in south africa , hsv - 2 seroprevalence among women of reproductive age is considerably higher than in the usa ( 3070 % versus 21 % ) . hsv - 2 incidence in southern africa remains high throughout the reproductive years , at 8.8 / 100 person - years among women 1824 years of age and 5.3 / 100 person - years among women 35 years or older . this is higher than the us , where estimated hsv - 2 incidence is 2.25 / 100 person - years among women 2029 years of age and 1.73 / 100 person - years among women age 3039 and where 1.0 % of hsv - 2 seronegative women seroconvert during pregnancy . this suggests that south african women may also be at risk of hsv - 2 infection during pregnancy . however , few case reports of neonatal herpes from developing countries and , to our knowledge , no reports from africa have been published . this may reflect a lower incidence of neonatal herpes or underdiagnosis and underreporting , reflecting the nonspecific symptoms and signs of neonatal herpes , and the expense of laboratory testing for hsv in environments with a high burden of competing infectious diseases . to assess the potential for neonatal hsv transmission in south africa , we performed a prospective cohort study investigating the frequency of hsv - 2 acquisition in late pregnancy and hsv shedding from the genital tract of women during labor . we recruited women in early labor at the chris hani baragwanath maternity hospital in soweto , south africa , including women undergoing induction . entry criteria included women 18 years of age who were expected to have a vaginal delivery , known hiv status or plan for testing prior to delivery , ability to return to clinic in 46 weeks , ability to read and understand the consent form in english , zulu , or sotho , and willingness and ability to give written consent . the protocol was approved by the institutional review boards of the university of the witwatersrand and the university of washington and all participants signed an informed consent . baseline clinical data , including prenatal rapid plasma reagin ( rpr ) result , hiv status , and for , hiv - positive women , the most recent cd4 count and current antiretroviral drugs , were extracted from the participant 's medical record . participants were interviewed regarding history of genital ulcer disease and to confirm their antiretroviral regimen . a swab of the genital skin and mucosa of the vagina , vulva , and perineum was collected with a polyester - tipped applicator . participants were examined for genital lesions and a separate specimen was obtained from any lesions . swabs were placed in a vial containing 1 ml of pcr digestion buffer and stored at room temperature . at the university of washington , dna was extracted from 200 l of buffer with a qiaamp 96 dna blood kit ( qiagen ) following the manufacturer 's recommendations . quantitative real - time pcr was performed ( quantitect multiplex pcr master mix from qiagen ) with a 7900ht sequencing detection system using a validated assay with common primers to the hsvgb region . a positive assay was defined as detection of 150 copies of hsv dna / ml of swab fluid . results were reported according to the manufacturer 's specifications for index value cut - offs : 1.1 was positive , 0.9 was negative , and 0.91.1 was reported as equivocal . the serum was stored at 20c and shipped to the university of washington for confirmatory hsv western blot . delivery data was extracted from participants ' charts . at 1014 days after delivery , participants were contacted by phone to assess the clinical status of the neonate . at the 46 week postpartum visit , the mother was interviewed about the interim medical history of the infant and the infant was examined . women with negative or equivocal hsv - 2 results by the kalon assay at enrollment underwent repeat hsv western blot to evaluate for seroconversion . if a participant did not return for the scheduled postpartum visit , attempts were made to contact the participant by phone ; if unable to reach the participant , in those who had agreed to home visits , staff would visit the participant 's home . participants were classified into the following categories : hsv seronegative , hsv - 1 seropositive only , hsv - 2 seropositive only , and both hsv - 1 and hsv - 2 seropositive . seropositive women , therefore , included women only hsv - 2 seropositive and women both hsv - 1 and hsv - 2 seropositive . seroconversion was defined as a change in hsv status between acute ( delivery ) and convalescent ( postpartum ) sera . for participants with atypical western blot profiles , if no change was demonstrated , the results were considered negative . among women with pre - existing hsv - 1 antibodies who demonstrate hsv - 2 seroconversion between labor and 46 weeks after delivery , most will have acquired hsv - 2 in the last trimester of pregnancy , as 68 % of persons with prior hsv - 1 infection demonstrate hsv - 2 seroconversion within 3 months after hsv - 2 infection . the followup time was selected to capture participants infected with hsv - 2 in late pregnancy rather than in the postpartum period . the primary endpoint was the frequency of hsv acquisition in late pregnancy as determined by hsv shedding from the genital skin and mucosa of women lacking antibodies to the same hsv type , or seroconversion . secondary endpoints were the frequency of genital hsv shedding in women with antibodies to the same hsv type and , among hsv - 2 seropositive women , the risk of hsv - 2 shedding for hiv - positive compared with hiv - negative women . when no events were observed , confidence intervals were determined by the mid - p method . poisson regression with robust variance estimates was used to determine the relative risk of genital hsv shedding for hiv - positive compared with hiv - negative women among those hsv - 2 seropositive , and the relative risk of hsv - 2 seropositivity for hiv - positive compared with hiv - negative women . the following covariates were tested for univariate association with genital hsv shedding and hsv - 2 seropositivity : age , prior pregnancy , cd4 count , highly active antiretroviral therapy ( haart : defined as three antiretroviral drugs ) , and haart regimen containing tenofovir , an antiretroviral that inhibits hsv dna polymerase . backwards elimination was used to remove covariates not significantly ( p 0.05 ) associated with each outcome . the mean quantity of hsv dna for positive samples was compared for hiv - positive and hiv - negative women by t - test . among hsv - 2seropositive women , poisson regression was also used to determine the relative proportion of women reporting a history of genital ulcer disease for hiv - positive compared with hiv - negative women . the same covariates were tested for univariate association with history of genital ulcer disease and variables significant at p 0.2 were included in a multivariate model followed by backwards elimination of nonsignificant ( p 0.05 ) variables . calculations of study precision estimated that between 239 and 474 participants would be required to estimate the proportion of women with recent hsv acquisition ( in the past 3 months ) with 1 % precision , assuming a hsv - 2 seroprevalence of 50 % and an annual hsv - 2 incidence between five to ten cases / 100 person - years . to assess whether hsv - 2 seronegative participants for whom we did not obtain postpartum serum may have been more likely to seroconvert than those for whom we did obtain postpartum serum , we compared baseline risk factors in the two groups . we enrolled 390 women from whom we collected serum for hsv serology and genital swabs for hsv pcr . the median age of participants was 26 ( range , 1844 ) years ; 135 ( 35.4 % ) were primigravid ( table 1 ) . of 387 women with known hiv status , 132 ( 34.1 % ) were hiv - positive ; the median cd4 count ( obtained at a median of 3 months prior to enrollment ) was 321 ( range , 181237 ) cells / l . all but one were receiving antiretroviral therapy , including 52 ( 39.7 % ) who were receiving haart and 78 ( 59.5 % ) who were receiving antiretroviral drugs to prevent mother - to - child transmission . five ( 1.3 % ) of 377 women had a positive rpr during the prenatal period , only one of whom reported a history of genital ulcers ; this participant was also hsv - 2 seropositive . seropositivity , as determined by western blot , was present in 229 women ( 58.7 % ) , including 116 ( 87.9 % ) of 132 hiv - positive and 111 ( 43.5 % ) of 255 hiv - negative women ( table 2 ) . of the 29 women who reported a history of genital ulcers , 22 ( 76 % ) were hsv - 2 seropositive and reported a mean of four ( range , 024 ) episodes in the past year compared to one episode ( range , 02 ) for hsv - 2 seronegative women . reported genital ulcer disease was more common among hsv - 2 seropositive women coinfected with hiv compared with hiv - negative women ( 14.2 % versus 5.5 % ; relative risk , 2.57 ; 95 % ci , 1.046.34 ; p = 0.040 ) . thirteen of 16 hiv - positive / hsv - 2 seropositive women with a history of genital ulcer disease reported a mean of two episodes in the past year compared to nine episodes for six hiv - negative / hsv - 2 seropositive women . genital hsv shedding was detected in none of 161 hsv - 2 seronegative women ( 95 % ci , 01.8 % ) . among hsv - 2seropositive women , genital hsv was detected in 17.2 % ( 39 of 227 ) and was typed as hsv - 2 in all cases ; all but two shedding episodes were subclinical . the risk of hsv shedding among hsv - 2 seropositive women was higher for hiv - positive compared with hiv - negative women ( 22.6 % versus 11.8 % ; relative risk , 1.91 ; 95 % ci , 1.043.53 ; p = 0.038 ) . the mean quantity of hsv - 2 dna was similar among hiv - positive and hiv - negative women ( 4.57 versus 4.42 log10 copies / ml ; p = 0.80 ) . lesions were identified in three ( 2.6 % ) of 116 hsv - 2 / hiv - coinfected compared with four ( 3.6 % ) of 111 hsv - 2 seropositive / hiv - negative women . genital swabs were collected at a median of one day prior to delivery ( range , 050 days ) . subgroup analysis , including only those women for whom swabs were collected within one day of delivery , provided similar results : among hsv - 2 seropositive women , hsv shedding was detected in 23 % of 61 hiv - positive compared with 10 % of 58 hiv - negative women . postpartum serology was available for 91 ( 56.5 % ) of 161 hsv - 2 seronegative women , collected at a median of 42 ( range , 2578 ) days after delivery . we found no significant differences in age , gravidity , parity , or hiv - status at baseline between hsv - 2 seronegative participants who did and did not undergo postpartum hsv serology . ten deaths occurred among infants during the follow - up period including five among liveborn infants within the first 28 days . the neonatal mortality rate of 5 per 394 live births ( 13/1000 ; 95 % ci , 530/1000 live births ) is similar to that estimated for south africa ( 18 - 19/1000 live births ) . three stillborn infants were delivered from hiv - negative women , two of whom were hsv - 2 seropositive and none of whom had hsv - 2 shedding detected ( table 3 ) . five neonates who died were also born to hiv - negative women , three of whom were hsv - 2 seropositive and none of whom had hsv - 2 shedding detected . two infants died after the neonatal period , one at day 35 and one at day 36 of life . both were born to women coinfected with hiv and hsv - 2 , and both women had genital hsv shedding detected . including these two , 27 infants were identified as potentially exposed to hsv during delivery , as they were born to women with hsv shedding detected and were delivered vaginally or by cesarean section after prolonged rupture of membranes ( 4 hours ) . of these 27 infants , ( 7.4 % ) died during the follow - up period . the cause of death was pneumonia in one case and possible pneumonia in the other . it is uncertain if either infant was exposed to hsv during birth , however , as the genital swabs were obtained thirteen and five days , respectively , prior to the delivery date . for the other 25 potentially exposed neonates ,13 were healthy at the postpartum visit , six additional neonates were doing well on follow - up phone call ( range , 1021 days after delivery ) , and six were lost to follow - up . our study demonstrates that prior hsv - 2 infection is frequent among pregnant women in south africa , as is genital hsv shedding during labor , especially among hiv - positive women . among hsv - 2seropositive women , the shedding frequency is similar to women in the usa during labor , where genital hsv was detected in 30.8 % of hiv - positive and 9.5 % of hiv - negative women . our study suggests that the lack of published reports of neonatal herpes in south africa is not due to infrequent exposure to hsv - 2 during birth . while we did not identify any cases of overt neonatal herpes , the study was not powered to estimate the frequency of neonatal herpes . the two infants born vaginally to women with hsv - 2 reactivation at enrollment ( five and thirteen days prior to delivery ) were unlikely to be infected with hsv . while pneumonia can be a feature of disseminated hsv infection , this typically occurs at days 1012 of life . a systematic evaluation of acutely ill neonates , with diagnostic testing by hsv pcr or viral culture , would be required to accurately estimate the incidence of neonatal herpes in developing countries . we collected genital specimens from women thought to be in early labor , but only half of women are known to have delivered within one day of genital swab collection . for the 119 hsv - 2seropositive women who delivered within one day of sampling , the hsv - 2 shedding rate was 17 % , the same as the larger cohort . thus , it is clear that exposure to hsv - 2 during birth occurs frequently in infants in south africa . our ability to determine which neonates were at greatest risk for neonatal herpes due to contact with hsv - 2 during delivery was limited . in immunocompetent persons , with daily swab collection , subclinical shedding episodes last a median duration of only 2 days ( iqr , 1.03.5 ) . studies with more frequent sampling ( four times daily ) in hiv - positive and immunocompetent persons have suggested that half of episodes may be 12 hours in duration . the low rate of hsv - 2 detection among hsv - 2 seropositive women with genital lesions in our study suggests that rapid clearance of hsv - 2 by pregnant women may be common . to more accurately assess which neonates are at greatest risk for neonatal herpes , genital swabs for hsv pcr would need to be collected closer to the time of delivery in a larger cohort of women . although 41 % of participants were hsv - 2 seronegative at enrollment , we did not detect any episodes of hsv - 2 acquisition in late pregnancy : no women seroconverted and hsv - 2 shedding was detected in no hsv - 2 seronegative women . in neighboring zimbabwe , the incidence of hsv - 2 seroconversion was 1.8 % between 36 weeks of gestation and 6 weeks after delivery and among hiv - positive women , 17.3 % seroconverted between delivery and 6 weeks after delivery . these rates are considerably higher than in the usa , where between the first prenatal visit and delivery ( median interval of 6.5 months ) the hsv seroconversion rate is 1.3 % , with 1.0 % developing hsv - 2 antibodies . although we have complete data on genital hsv - 2 shedding in hsv - 2 seronegative women , the expected shedding rate with recent hsv - 2 acquisition is less than 50 % ; first episode infections in late pregnancy , therefore , may not have been captured by detection of genital hsv shedding alone . our incomplete follow - up , however , limits the number of women evaluated for seroconversion . with an estimated hsv - 2 incidence of 510 % , only 1.3 to 2.5 % of the study populationwould be expected to have acquired hsv - 2 in the past three months . while no participants seroconverted , the 95 % confidence interval ( 03.2 % ) includes the percentage of women expected to seroconvert if annual hsv - 2 incidence was 10 % and remained unchanged in late pregnancy . despite the limitations in detecting hsv - 2 acquisition in late pregnancy , this study demonstrates a high rate of genital hsv - 2 shedding during labor in hsv - 2 seropositive women in south africa . while the risk of neonatal transmission for women with hsv reactivation is thought to be 1 % due to protection by maternal neutralizing antibodies , 2050 % of neonatal herpes cases in the usa and europe are associated with hsv - 2 reactivation due to the high prevalence of hsv - 2 relative to the low incidence of hsv - 2 in late pregnancy . if the absence of published reports of neonatal herpes from south africa reflects decreased neonatal infection with hsv , as opposed to decreased identification and reporting , given the high genital shedding rate that we have found among hsv - 2 seropositive women , there may be differences in the transmissibility of hsv - 2 to the neonate due to virologic , host , or iatrogenic ( e.g. , decreased use of invasive fetal monitoring devices ) factors . studies investigating hsv - 2 shedding patterns , genetic differences in hsv - 2 strains , and immunologic differences between south african and usa mother - infant pairs may provide insights into the pathogenesis of neonatal hsv .\noutput:\n" }, { "from": "agent", "value": "background . despite high herpes simplex virus type 2 ( hsv - 2 ) incidence and prevalence among women in africa , we are unaware of published neonatal herpes reports . to assess neonatal hsv transmission potential in south africa , we investigated the frequency of the strongest risk factors : hsv acquisition in late pregnancy and hsv shedding during labor . methods . women admitted in early labor to a hospital in soweto underwent hsv serologic testing and genital swab collection for hsv pcr . hsv - 2 seronegative women were assessed for seroconversion 46 weeks after delivery . results . of 390 women enrolled , 229 ( 58.7 % ) were hsv - 2 seropositive . genital hsv - 2 was detected in 17.2 % of hsv - 2 seropositive women , including 26 of 115 hiv - positive and 13 of 110 hiv - negative women ( 22.6 % versus 11.8 % ; rr , 1.91 ; 95 % ci , 1.043.53 ; p = 0.038 ) , but in none of 161 hsv - 2 seronegative women . among the 91 hsv - 2 seronegative women followed after delivery , none seroconverted . conclusions . hsv - 2 reactivation is common among south african women during labor , especially those with hiv coinfection . to determine the epidemiology of neonatal herpes in south africa and to investigate whether the lack of reported cases is due to alterations in immune control or hsv - 2 virulence , studies evaluating acutely ill neonates for hsv and studies of maternal hsv - 2 shedding patterns are needed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pregnancy is the most important physiological phenomenon which ends with childbirth , associated with the fear and worries . therefore , mother and child health system is a sensitive and important health care issue in all communities ( with or without concern of cesarean delivery ) . although cesarean has had an important role in reducing the complications of childbirth as well as mortality and morbidity of mother and fetus in past centuries ; however , the present concern is the high rate of cesarean . world health organization ( who ) has predicted the rate of cesarean delivery about 10 - 15 % of total deliveries ; however , this rate varies in different parts of the world ; and indeed it is increasingly rising . the cesarean rates differ from 5 - 25 % during the last 20 years which was different at the national and international levels as well . for example , cesarean rates ranged from 4.5 % to 38 % of all births in the united states from 1970 to 2007 . based on the 2004 report of who , the rate is approximately 20 - 25 % in canada , 32.6 % in india , 21 % in uk , 10.7 % in sweden , almost 10 % in united arabic emirates and 35 % in iran . in 2007 , the cesarean rate of iran was 42.3 and about 50 - 65 % of all deliveries were cesarean in 2010 . even , in chaharmahal and bakhtiari province , a relatively small province in southwest of iran , the cesarean rate was 44 % of total deliveries . many factors can lead to cesarean section such as medical problems ; however , nowadays the most common non - medical reason which may increase the rate of cesarean is maternal request , despite its huge cost for families as well as potential problems of personnel and medical supplies for hospitals . according to lewis theory , pain and fear associated with cesarean section could affect mother 's decision , because they think that they will experience less pain in cesarean delivery . in a study conducted by rayding on swedish women , 36 % of them had a fear of labor pain which was their main reason to have a cesarean delivery . in addition , zafarghandi and colleagues reported the higher prevalence of childbirth 's fear ( about 59 % ) as well as anxiety among women who had requested a cesarean section compared to those who chose natural childbirth . in fact , many women are afraid of labor pain and they think that its pain is out of their capability to deliver a baby naturally as well as their concerning about their health ; if the mother feels to have enough ability to cope with stress as well , she will be protected from adverse impacts of stress on her health . training and giving guidelines to pregnant women can indeed help them through rising their awareness about childbirth and the related psychological readiness improvement to cope with labor pain ; which , in turn , is important to choose the best delivery method ; and may reduce the unnecessary cesarean sections which is usually done by health educators . the self - efficacy could be the most important prerequisite for behavior in stressful situations . for example , bandura , a psychologist , expressed self - efficacy in his social learning theory which states that self - efficacy includes self - assessment of one 's own ability to cope with stressful situations . in fact , a relationship between fear of childbirth , self - efficacy and natural childbirth may exist ; if a pregnant woman thinks that she can not control labor situation , her fear and anxiety will lead her to choose cesarean delivery without medical reasons . moreover , due to the importance of self - efficacy in controlling fear and pain of labor and suitable delivery method , educational intervention strategies designated to increase self - efficacy could reduce the fear and may enhance the ability of mothers to overcome the pain of labor and cesarean cut . therefore , the aim of present study was to find out the effect of educational intervention based on self - efficacy on the delivery choice among pregnant women in shahrekord city , iran in 2013 . the participants were 130 randomly selected pregnant women of 24 - 32 weeks of gestation referred to the urban health centers . using stratified random sampling , pregnant women referring to all eight urban health centers of shahrekord city were randomly classified into two groups ( intervention and control ) and based on the population distribution of each center were randomly divided into two equal groups ( n = 65 for each group ) . inclusion criteria was all pregnant women at 24 - 32 weeks of pregnancy , centers who were willing to participate in the study . exclusion criteria included medical indications for cesarean section ( previous cesarean , dystocia , embryonic distress and breech view ) and the cases of premature delivery or emergency caesarean delivery and cases who did not want to cooperate . two of the mothers in the intervention group were excluded from the study due to premature birth . this proposal was approved by the research council of isfahan university of medical sciences in terms of ethical points and all mothers entered the study filled a consent form . also the questionnaires were given anonymously in order to assure confidentiality . we used a questionnaire which its validity and reliability of self - efficacy questionnaire has been examined and verified by khorsandi and colleagues . in another study , the validity and reliability of the questionnaire titled childbirth fear were also examined and verified by khorsandi and colleagues . then the educational intervention was conducted in the intervention group and the control group received routine care during pregnancy . the questionnaire administered consisted of three parts : demographic information ( age , age at marriage , education , occupation and history of cesarean among relatives ) , questions related to childbirth fear and questions about the self - efficacy of delivery . the questionnaire titled withdelivery self - efficacy questionnaire itself consisted of two parts : the first part with 17 questions on outcome expectation and the second part on expected delivery self - efficacy with another 17 questions . validity and reliability of self - efficacy questionnaire has been examined and verified by khorsandi and colleagues in iran . in another study , the validity and reliability of the questionnaire titled childbirth fear were examined and verified by khorsandi and colleagues in iran . outcome and self - efficacy expectations could be considered as a belief on that the expected behavior would result in special outcome and a belief that one enables to do necessary behaviors in special situations , respectively . the intervention group participated in three 60 - 90 min sessions during a week ( including 8 - 10 persons in each session ) which in sessions , they have received extra education ( more than routine prenatal care they usually received ) . educational content was developed based on strategies of self - efficacy increase ( success in performance , replace experience , verbal persuasion and physiological or emotional states ) . in first session , mothers were introduced to each other , and each of the mothers were allowed to talk about the causes of childbirth fear as well as their maternity imagination and also the reason of program and panel discussion and the participants were given equal opportunity for free expression of their ideas and their viewpoints . after collection of childbirth fear causes , the educational content was prepared based on it . at second session , by inviting a successful normal ( vaginal ) birth delivered mother to express her experience , the participants were practically familiar with the normal method . then , the training were continued with explaining maternal anxiety and its effects on the fetus , stating the benefits of natural childbirth , cesarean side - effects , reasons for emergency caesarean section and kegel exercise training ; pelvic floor exercise , or kegel exercise , consists of repeatedly contracting and relaxing the muscles that form part of the pelvic floor , now sometimes colloquially referred to as the kegel muscles . finally , at third session , the kegel 's exercises were illustrated to ensure that it is perform in a correct way . full interpretation of natural childbirth , labor characteristics , childbirth stages and effective actions during these stages and natural childbirth education using instructional videos were also applied . at the end of each training session , it has been given enough time to mothers to answer their questions . in addition , the educational pamphlets about the characteristics of the labor and natural delivery process were placed at mother 's disposal . after the above mentioned three sessions , through two further telephone conversations , mothers were given some tips about doing kegel exercises and mothers were encouraged to do exercises 2 - 3 times a day and their potential questions were answered . information about the actual method of delivery was collected by calling mothers in both groups . data analysis was performed using spss 16 software ( chicago , spss inc . ) by using descriptive statistics ( mean , frequency and standard deviation ) and inferential statistics such as independent t - test , paired t - test , chi - square and mann whitney tests . the participants were 130 randomly selected pregnant women of 24 - 32 weeks of gestation referred to the urban health centers . using stratified random sampling , pregnant women referring to all eight urban health centers of shahrekord city were randomly classified into two groups ( intervention and control ) and based on the population distribution of each center were randomly divided into two equal groups ( n = 65 for each group ) . inclusion criteria was all pregnant women at 24 - 32 weeks of pregnancy , centers who were willing to participate in the study . exclusion criteria included medical indications for cesarean section ( previous cesarean , dystocia , embryonic distress and breech view ) and the cases of premature delivery or emergency caesarean delivery and cases who did not want to cooperate . two of the mothers in the intervention group were excluded from the study due to premature birth . this proposal was approved by the research council of isfahan university of medical sciences in terms of ethical points and all mothers entered the study filled a consent form . also the questionnaires were given anonymously in order to assure confidentiality . we used a questionnaire which its validity and reliability of self - efficacy questionnaire has been examined and verified by khorsandi and colleagues . in another study , the validity and reliability of the questionnaire titled childbirth fear were also examined and verified by khorsandi and colleagues . then the educational intervention was conducted in the intervention group and the control group received routine care during pregnancy . the questionnaire administered consisted of three parts : demographic information ( age , age at marriage , education , occupation and history of cesarean among relatives ) , questions related to childbirth fear and questions about the self - efficacy of delivery . the questionnaire titled withdelivery self - efficacy questionnaire itself consisted of two parts : the first part with 17 questions on outcome expectation and the second part on expected delivery self - efficacy with another 17 questions . validity and reliability of self - efficacy questionnaire has been examined and verified by khorsandi and colleagues in iran . in another study , the validity and reliability of the questionnaire titled childbirth fear were examined and verified by khorsandi and colleagues in iran . outcome and self - efficacy expectations could be considered as a belief on that the expected behavior would result in special outcome and a belief that one enables to do necessary behaviors in special situationsthe intervention group participated in three 60 - 90 min sessions during a week ( including 8 - 10 persons in each session ) which in sessions , they have received extra education ( more than routine prenatal care they usually received ) . educational content was developed based on strategies of self - efficacy increase ( success in performance , replace experience , verbal persuasion and physiological or emotional states ) . in first session , mothers were introduced to each other , and each of the mothers were allowed to talk about the causes of childbirth fear as well as their maternity imagination and also the reason of program and panel discussion and the participants were given equal opportunity for free expression of their ideas and their viewpoints . after collection of childbirth fear causes , the educational content was prepared based on it . at second session , by inviting a successful normal ( vaginal ) birth delivered mother to express her experience , the participants were practically familiar with the normal method . then , the training were continued with explaining maternal anxiety and its effects on the fetus , stating the benefits of natural childbirth , cesarean side - effects , reasons for emergency caesarean section and kegel exercise training ; pelvic floor exercise , or kegel exercise , consists of repeatedly contracting and relaxing the muscles that form part of the pelvic floor , now sometimes colloquially referred to as the kegel muscles . finally , at third session , the kegel 's exercises were illustrated to ensure that it is perform in a correct way . full interpretation of natural childbirth , labor characteristics , childbirth stages and effective actions during these stages and natural childbirth education using instructional videos were also applied . at the end of each training session , it has been given enough time to mothers to answer their questions . in addition , the educational pamphlets about the characteristics of the labor and natural delivery process were placed at mother 's disposal . after the above mentioned three sessions , through two further telephone conversations , mothers were given some tips about doing kegel exercises and mothers were encouraged to do exercises 2 - 3 times a day and their potential questions were answered . information about the actual method of delivery was collected by calling mothers in both groups . data analysis was performed using spss 16 software ( chicago , spss inc . ) by using descriptive statistics ( mean , frequency and standard deviation ) and inferential statistics such as independent t - test , paired t - test , chi - square and mann whitney tests . the mean age of mothers were 26.724.61 and 27.725.81 year in intervention and control groups , respectively [ table 1 ] . the mean marriage age , pregnancy number and gestational age in intervention group were 22.574.31 year , 1.380.65 times and 28.042.91 week , respectively . the figures in control group were 22.353.91 year , 1.450.77 times and 29.032.89 week , respectively , with no significant difference ( p 0.05 ) . education of most of women in both groups were university level ; however , for husbands , the university level of education was more in control group ( p 0.05 ) . most of the mothers in both groups had cesarean history in relatives , no history of delivery and belonged to urban area . main characteristics of participants most of intervention group mothers desired to deliver through cesarean [ table 2 ] . they had more fear ( p 0.001 ) but lower childbirth expectation ( p 0.05 ) and self - efficacy ( p 0.001 ) than those who chose normal method . distribution of mother 's delivery in both groups table 3 demonstrates the comparison of baseline mean scores on fear of childbirth , childbirth expectation and childbirth self - efficacy in both intervention and control groups with two delivery methods . while there was no difference in delivery method and mean scores of childbirth expectation in both groups ( p 0.05 ) ; there was a statistically significant difference in mean scores of fear of childbirth and childbirth self - efficacy in both groups with delivery method ( p 0.001 ) . comparison of baseline ( before intervention ) fear of childbirth , childbirth expectation and childbirth self - efficacy mean scores and delivery method in both groups there was a significant difference between two groups in terms of childbirth fear , childbirth expectation and childbirth self - efficacy after ( p 0.001 ) but not before intervention ( p 0.05 ) [ table 4 ] . there was a statistically significant difference before and after intervention only in intervention group ( p 0.001 ) but not in control group ( p 0.05 ) . comparison of fear of childbirth , childbirth expectation and childbirth self - efficacy mean scores before and after the educational intervention this study showed 71.4 % of mothers in the intervention group and 53.8 % of control group mothers used nvd [ table 5 ] . comparison of fear of childbirth , childbirth expectation and childbirth self - efficacy mean scores before and after the educational intervention table 6 shows the mean scores of childbirth fear , childbirth expectation and childbirth self - efficacy between mothers with natural and cesarean delivery . our findings showed that the childbirth fear mean score of women who chose natural childbirth was less than in those who have had a cesarean section in both groups ( p 0.05 ) while the higher self - efficacy was observed in the mean scores ( p 0.05 ) . comparison of fear of childbirth , childbirth expectation and self - efficacy mean scores with final delivery method selection in both intervention and control groups after educational intervention based on the results , only 23.4 % of women said they would choose cesarean delivery next time , as there was no significant difference between intervention and control groups [ table 7 ] . our study showed a significant difference between intervention and control groups in terms of mean scores of childbirth fear , childbirth expectation and childbirth self - efficacy after the intervention . in addition , more mothers in intervention group than mothers in control group had a natural delivery which represents the effectiveness of our educational intervention to encourage women to have natural childbirth . our results are similar to the findings of the study of khorsandi and colleagues who reported a decrease in delivery fear after intervention in intervention group . ghaffari also found that the higher self - efficacy mean score of intervention group in comparison with control group is due to the educational intervention effect . in addition , rahimikian and fathian reported that the effectiveness of an educational intervention on reducing cesarean rates as well . similarly , ajh and colleagues found that the cesarean section rate in the intervention group was 16.7 % and 60.5 % in the control group , which proves the effectiveness of training in reducing caesarean section selection . however , chularat howharn indicated that the impact of training on self - efficacy may increase for both intervention and control groups . moreover , the results of khani and colleages also showed that 44.8 % of intervention group mothers and 46.6 % of the control group mothers had cesarean delivery , indicating no effect of the educational intervention on reducing cesarean section . we found that there is a significant difference between maternal desire for the delivery method at the beginning and the delivery method they chose at the end of study and cesarean delivery rate in the intervention group was less than the control group . this finding is similar to the study of tofighi and colleagues who reported that 61.8 % of mothers chose natural delivery versus cesarean section before training which changed to 80.6 % after training and only 57.6 % of them were successful in natural delivery at the end . furthermore , lashkari reported that 40 % of intervention and control group mothers preferred cesarean section and no significant difference was observed between groups . our study indicated lower childbirth fear and higher self - efficacy scores in women with natural delivery but the childbirth expectation scores had no significant differences . we also found that mothers who were able to distinguish between the concept of self - efficacy and outcome of labor , a well as having similar thoughts about the benefits of the treatment , would cope with labor pain during childbirth much better than the others , the finding which is similar to the results of australian and chinese women . khorsandi and colleagues found no significant difference between nulliparous and multiparous women , a result similar to the findings of intellectual property and sinclair . dilks and colleagues concluded that women who choose cesarean delivery repeatingly have lower self - efficacy score . zamani and colleagues reported that self - efficacy mean score in natural delivery group was higher than women who choose the cesarean delivery with a statistically significant difference . in katri nieminen 's study , having cesarean section was associated with childbirth fear and mothers who had a cesarean section , had higher levels of fear of childbirth . in another study , negahban reported that the occurrence rate of emergency cesarean was higher among those who had had higher fear level . bagheri also showed that the fear of labor is an important factor in encouraging women choosing cesarean section . these results are also consistent with the findings of a ryding and jane drummond 's study . in a study conducted by moeni ,74.4 % of mothers in the elective cesarean group , 26.7 % in cesarean section for medical reasons group and 7.9 % in the vaginal delivery group stated that cesarean delivery would certainly be their selection next time . the results of chong 's study indicated that only 2 % of the mothers demonstrated that they will recommend cesarean delivery to friends after their childbirth . one limitation of the present study was that the choice of delivery is not merely a personal matter and other factors , including doctor opinion , hospitals and social conditions and influential people as well as the opinion of husband may affect on the rise of caesarean sections , which are recommended to be considered in future studies . since each self - efficacy program along with position analysis is more efficient , it is recommended to be considered in future studies . however , due to the low sample size and lack of evaluation of pregnant women living in rural areas , it would be more useful and extensile to study a larger sample size and adding the pregnant women in rural area to the sample . as a conclusion , the results of this study confirms the role of self - efficacy as a key element in the choice of childbirth method and natural childbirth fear control and may illustrate the effectiveness of an educational intervention based on self - efficacy in reducing cesarean section in the intervention group after the end of the study . therefore , the broad educational interventions based on self - efficacy can be effective in encouraging mothers to natural childbirth .\noutput:\n" }, { "from": "agent", "value": "background : nowadays , there has been a growing trend of caesarean sections in iran . one reason would be the mother 's desire . increased maternal self - efficacy can be an important step to reduce percentage of cesarean . this study aimed to determine the effectiveness of training - based strategies to increase the self - efficacy for choosing delivery method among pregnant women in shahrekord city.methods : this quasi - experimental study was conducted on 130 pregnant women who attended urban health centers in shahrekord city in 2013 . intervention was applied in the experimental group in three sessions in about 60 - 90 min while control group did not receive any intervention . fear of childbirth and self - efficacy questionnaire was completed before and after training.results : while mean scores of the fear of childbirth , expectations and childbirth self - efficacy before the intervention between the two groups were not significantly different ( p > 0.05 ) , mean scores of childbirth in intervention group was reduced and expectation and childbirth self - efficacy had a significant increase after intervention ( p < 0.05 ) . in this study , 71.4 % of mothers in intervention group and 53.8 % of control mothers naturally delivered their children . most of intervention group mothers desired to deliver through cesarean and had more fear ( p < 0.001 ) but lower childbirth expectation ( p > 0.05 ) and self - efficacy ( p < 0.001 ) than those who chose normal method.conclusions : our findings showed that training - based self - efficacy procedure has been effective in encouraging mothers to choose natural childbirth . therefore , the design and implementation of curriculum - based strategies for increasing self - efficacy is suggested for pregnant women ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a total number of 100 hypospadias repair with preputioplasty have been done over a period of 5 years from 2004 to 2009 . the age range was 1 year to 5 years with a mean age of 2.7 years . the patients with severe chordee , torsion as well as those patients with narrow urethral plate were not considered for this type of repair . a vertical stay suture was taken on the tip of glans with prolene 5 - 0 . two stay sutures were taken at the edge of the prepuce on lateral most part . u-shaped incision was given around the meatal opening and extended on either side along the edge of the prepuce . cases where the perimeatal skin is thin and hypoplastic , u - shaped incision was taken , which starts from skin over normal ventral spongiosum so as to avoid damage to the underlying urethra . ventral skin was dissected proximally till we see the normal spongiosum . in cases where urethra was thin and hypoplastic , it was cut till normal urethra with normal corpus spongiosum . then ventral dartos fascia was dissected on lateral aspect from the buck 's fascia and was left with the outer skin [ figure 1 ] . corpus spongiosum which was splayed on either side [ figure 2 ] was dissected laterally from the buck 's fascia so as to get easy approximation of the corpus spongiosum in the midline . keeping close to the margin of the urethral plate , ventral dartos fascia was dissected splayed corpus spongiosum on either side stay suture was taken on either side of the urethral plate about 5 mm proximal to distal end of urethral plate [ figure 3 ] . this helps to stretch urethral plate on either side and is also a marker for distal limit to construct urethral tube . with the knife a midline incision is taken on the urethral plate . stay taken on urethral plate about 5 mm proximal to distal end of urethral plate we start approximating corpus spongiosum in midline , starting few millimeters proximal to urethral meatus ( to avoid narrowing of normal urethra at this level , midline urethral plate incision is extended within the normal urethra ) . while approximating corpus spongiosum in the midline with 6 - 0 polyglycolic acid continuous and locking sutures , edges of the urethral plate gets inverted . special care was taken to avoid going through the edges of urethral plate [ figure 4 ] . corpus spongiosum is approximated in the midline till 5 mm proximal to distal end of urethral plate [ figure 4 ] . spongioplasty by avoiding to go through the edges of urethral plate glansplasty was done in two layers . initially distal stitch was taken and its knot is tied with left over suture of urethral plate . second layer of glansplasty done with vertical mattress sutures using 6 - 0 polyglycolic acid . proximally raised glans wings were fixed from inside laterally on either side with corporal body , while taking this stitch , ventral dartos fascia is put within the proximal glans . this will avoid the retraction of glans and will take care of the bleeding from the raised glans wings . after doing glansplasty preputial skinfirst inner prepuce was sutured in the midline by subcuticular continuous suture ; then outer prepuce was approximated in the midline . ventral dartos fascia was sutured in the midline to cover the urethral repair , which will act as a barrier layer to prevent fistula formation . finally ventral penile skin is sutured in the midline , tourniquet was released . at the end , reconstructed prepuce was retracted over the glans , in case of difficulty in retracting the prepuce over glans , dorsal midline vertical skin incision was taken and then it was sutured transversely [ figure 5 ] . dorsal midline incision taken and sutured transversely compression dressing using elastoplast was given for 10 days . dressing and catheter removed on 10 postoperative day . after removing the dressing , preputial edema becomes more in first week and then generally subsides by second week . once edema subsided parents are advised to retract the prepuce slowly over the glans . over the period of timea vertical stay suture was taken on the tip of glans with prolene 5 - 0 . two stay sutures were taken at the edge of the prepuce on lateral most part . u-shaped incision was given around the meatal opening and extended on either side along the edge of the prepuce . cases where the perimeatal skin is thin and hypoplastic , u - shaped incision was taken , which starts from skin over normal ventral spongiosum so as to avoid damage to the underlying urethra . ventral skin was dissected proximally till we see the normal spongiosum . in cases where urethra was thin and hypoplastic , it was cut till normal urethra with normal corpus spongiosum . then ventral dartos fascia was dissected on lateral aspect from the buck 's fascia and was left with the outer skin [ figure 1 ] . corpus spongiosum which was splayed on either side [ figure 2 ] was dissected laterally from the buck 's fascia so as to get easy approximation of the corpus spongiosum in the midline . keeping close to the margin of the urethral plate , ventral dartos fascia was dissected splayed corpus spongiosum on either side stay suture was taken on either side of the urethral plate about 5 mm proximal to distal end of urethral plate [ figure 3 ] . this helps to stretch urethral plate on either side and is also a marker for distal limit to construct urethral tube . with the knife a midline incision is taken on the urethral plate . stay taken on urethral plate about 5 mm proximal to distal end of urethral plate we start approximating corpus spongiosum in midline , starting few millimeters proximal to urethral meatus ( to avoid narrowing of normal urethra at this level , midline urethral plate incision is extended within the normal urethra ) . while approximating corpus spongiosum in the midline with 6 - 0 polyglycolic acid continuous and locking sutures , edges of the urethral plate gets inverted . special care was taken to avoid going through the edges of urethral plate [ figure 4 ] . corpus spongiosum is approximated in the midline till 5 mm proximal to distal end of urethral plate [ figure 4 ] . spongioplasty by avoiding to go through the edges of urethral plate glansplasty was done in two layers . initially distal stitch was taken and its knot is tied with left over suture of urethral plate . second layer of glansplasty done with vertical mattress sutures using 6 - 0 polyglycolic acid . proximally raised glans wings were fixed from inside laterally on either side with corporal body , while taking this stitch , ventral dartos fascia is put within the proximal glans . this will avoid the retraction of glans and will take care of the bleeding from the raised glans wings . after doing glansplastyfirst inner prepuce was sutured in the midline by subcuticular continuous suture ; then outer prepuce was approximated in the midline . ventral dartos fascia was sutured in the midline to cover the urethral repair , which will act as a barrier layer to prevent fistula formation . finally ventral penile skin is sutured in the midline , tourniquet was released . at the end , reconstructed prepuce was retracted over the glans , in case of difficulty in retracting the prepuce over glans , dorsal midline vertical skin incision was taken and then it was sutured transversely [ figure 5 ] . dorsal midline incision taken and sutured transversely compression dressing using elastoplast was given for 10 days . dressing and catheter removed on 10 postoperative day . after removing the dressing , preputial edema becomes more in first week and then generally subsides by second week . once edema subsided parents are advised to retract the prepuce slowly over the glans . over the period of time , it gives an appearance of normal , uncircumcised prepuce [ figure 6 ] . the follow - up period is between 3 months and 4 years ( 3 months to 48 months , average 23 months ) . in one casefistula has developed in seven patients ( sub glanular - 1 , sub coronal - 3 , mid penile - 3 ) who required operative closure . in three patients , these were the cases , which were done in earlier period of the experience when we did not make the dorsal slit incision . a total of 38 patients required steroid ointment application containing hydrocortisone ( 1 % ointment ) . whenever the urinary stream was thin , parents were asked to do meatal calibration with the infant feeding tube by a size less than what was used for urethral tubularization . cosmetic appearance was acceptable . in patients with dorsal slit after a follow up of 6 months , a dorsal slit is visualized as a minor cleft dorsally in the prepuce but glans was well covered by prepuce all over giving an appearance of normal prepuce covering glans . since its introduction in 1994 , tubularized incised plate urethroplasty by snodgrass is a most widely done procedure for distal penile hypospadias . we did some modifications in the original procedure reported by snodgrass to address the issue of reported high incidence of meatal stenosis and to have uncircumcised prepuce . it is better to avoid preputioplasty for patients having significant penile torsion , which needs degloving to correct the torsion . while correcting penile torsion it is necessary to deglove the penis till the base ; and after degloving , it is difficult to do preputioplasty and one may face more complications like preputial breakdown . most of the distal hypospadias without chordee can be repaired by the snodgrass technique and also subjected for preputioplasty . in this snodgrass urethroplasty with preputioplasty , there is no dorsal dissection ; hence , dorsal dartos fascia can not be used to cover the urethral repair as a barrier layer to prevent fistula formation . we have experienced meatal stenosis in earlier part of practice where midline urethral plate incision was extended up to the tip of urethral plate . nguyen has addressed this problem by making the tip incision first which is not extended up to the meatus ; he incises that portion of urethral plate which is little narrow . preputioplasty has been done in three to four layers by different surgeons . we have sutured prepuce in two layers with subcuticular sutures of vicryl 6 - 0 . at the end of preputioplasty , if we find difficult to retract newly constructed prepuce over the glans then dorsal midline silt incision is given on the prepuce and it is sutured transversely . some have advocated retraction of prepuce after 3 to 10 weeks depending upon the healing of sutures . application of steroid - based ointment helps to reduce the edema and it also helps to retract the prepuce easily over the glans . we recommend application of steroid - based ointment in all patients after 2 weeks and advocate retraction of prepuce after 3 weeks once preputial edema settles . we feel meatal stenosis can be reduced by : ( 1 ) not extending the midline urethral plate incision up to the distal end of urethral plate , one should never go across urethral plate on to the distal glans . ( 2 ) raising the glans wings only up to the mid glans level . ( 3 ) while converting urethral plate into the tube , stop at least 5 mm proximal from the tip , do not convert urethral plate into a tube up to its distal end . corpus spongiosum being good vascular and thick structure , it is easy to take good suture bites to approximate spongiosum in midline . suturing corpus spongiosum alone without taking edges of urethral plate is enough to roll urethral plate into a tube . by this technique we hadfistula rate comparable to series reported by snodgrass where he has used dorsal dartos fascia to cover urethral repair . midline approximation of corpus spongiosum is enough to convert urethral plate into a tube , without taking actual sutures through the edges of urethral plate . modified tubularized incised plate urethroplasty with preputioplasty effectively gives cosmetically normal looking penis with low complications . however , long - term follow - up and double blind trial will establish the results .\noutput:\n" }, { "from": "agent", "value": "aim : to share our experience of doing tubularized incised plate urethroplasty with modifications.materials and methods : this is a single surgeon personal series from 2004 to 2009 . one hundred patients of distal hypospadias were subjected for snodgrass urethroplasty with preputioplasty . the age range was 1 to 5 year with mean age of 2.7 years . selection criteria were good urethral plate , without chordee and torsion needing complete degloving . main technical modification from original snodgrass procedure was spongioplasty , preputioplasty , and dorsal slit when inability to retract prepuce during surgery.results : average follow - up period is 23 months . seven ( 7 % ) patients developed fistula and one patient had complete preputial dehiscence . phimosis developed in three ( 3 % ) patients and required circumcision . dorsal slit was required in seven patients . one patient developed meatal stenosis in postoperative period . all other patients are passing single urinary stream and have cosmesis that is acceptable.conclusions : modified tubularized incised plate urethroplasty with preputioplasty effectively gives cosmetically normal looking penis with low complications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: inflammatory bowel disease ( ibd ) is a chronic inflammatory disorder of the gastrointestinal tract that includes crohn 's disease ( cd ) and ulcerative colitis ( uc ) . the incidence of ibd is increasing worldwide , including asia , where the incidence rate of ibd was previously reported to be relatively low .1 chronic inflammation is associated with malignancy , and chronic colonic inflammation from ibd increases the risk of colorectal cancer ( crc ) .2,3 the incidence of crc in patients with ibd is reportedly six times higher than that in the general population , and crc accounts for 10 % to 15 % of deaths in patients with ibd .4 in patients with uc , the annual incidence rate of crc was previously reported at 0.3 % , with the cumulative rate being 1.6 % at 10 years , 8.3 % at 20 years , and 18.4 % at 30 years .5 however , in more recent studies , the cumulative rate of crc has decreased to 2.5 % at 20 years , 7.6 % at 30 years , and 10.8 % at 40 years .6 additionally , the incidence of crc in patients with uc has decreased , with the most recent incidence rate being only two to three times higher than that in the general population .7 the korean association for the study of intestinal diseases carried out a nationwide study in korea and reported that the overall prevalence of crc in patients with uc was 0.37 % . the study also reported that the estimated cumulative risk of uc - associated crc for patients who had uc was 0.7 % at 10 years , 7.9 % at 20 years , and 33.2 % at 30 years . the authors concluded that the cumulative incidence of uc - associated crcs in korea was comparable to that in western countries .8 the overall survival rate in ibd is not markedly lower than that in the general population . it is presumed that the factors behind decreases in the cumulative incidence rates of crc include regular colonoscopic surveillance and improved medical therapies to reduce inflammation . in this article , we discuss adequate timing and techniques for screening endoscopy and surveillance colonoscopy as methods to provide an early diagnosis of crc in patients with ibd , in addition to effective biopsy methods , dysplasia treatment , and chemoprophylaxis for preventing ibd - related crc . multiple risk factors for the development of crc in patients with ibd have been identified . persistent inflammation is believed to play a crucial and direct role in the development of crc in patients with ibd ,9 and the degree of endoscopic and histological inflammation correlates with the incidence of crc .10 these observations support the evidence that crc risk increases with disease duration and anatomic extent of colitis , and the risk of ibd - related crc becomes appreciable after 7 years in patients with uc .5 the incidence of crc in patients with extensive colitis is increased by 14.8 times . in patients with left - sided colitis , it is increased by three times , whereas in patients with proctitis , it is similar to that in the general population .11 the concomitant presence of primary sclerosing cholangitis ( psc ) increases the risk of crc in patients with uc , with the cumulative risk of crc reported to be 25 % at 10 years .12,13,14,15 additionally , patients with ibd and a family history of crc are suspected to have a two to five times higher incidence of developing crc than patients without a family history .9 compared with sporadic crc , ibd - associated crc has a few clinical differences . the diagnosis of crc in patients with ibd is made at an earlier age than that in the general population , the median age of diagnosis is the fifth decade , and malignancy is more often found in the proximal colon .16 ibd - related crc has a higher frequency of two or more synchronous crcs , and its characteristically flat and nonpolypoid dysplasia with poor differentiation facilitates the development of diffuse cancer .17 malignancy is difficult to identify by endoscopy in patients with uc because of the inflammation - induced changes in the colonic mucosa ; tumor margins are unclear , and tumors tend to develop in variable forms . some studies have reported no significant difference in mortality between ibd - related crc and sporadic crc ,16,18 but most studies have shown that the mortality rate in patients with ibd - related crc is 1.5 to 2 times higher than that in patients with sporadic crc .19,20,21,22 such a tendency was reportedly more notable in men diagnosed with ibd prior to age 60.20 the goal of most surveillance programs is early detection of crc and mortality reduction in patients with ibd . however , the optimal surveillance strategy in patients with ibd remains controversial . although it is unclear whether regular colonoscopy in patients with ibd can increase survival rates , regular follow - up colonoscopiesare recommended to enable early detection of malignancy .23,24 in all patients with extensive colitis and left - sided colitis , screening endoscopy is recommended 8 to 10 years after diagnosis .3,25,26,27,28,29 however , for those with proctosigmoiditis limited to within 35 cm from the anal verge , the same standard crc screening as implemented for the general population is adequate because the incidence risk is unlikely to increase .27,30 the interval for follow - up surveillance colonoscopy depends on the presence or absence of dysplasia but should be performed at least every 1 to 2 years .3,27,30,31,32 patients with a family history of crc in a first - degree relative younger than 50 years are at high risk for ibd - related crc . in a hospital - based study in korea ,14.3 % of uc patients with psc were diagnosed with crc and died of psc - associated complications .33 patients with a family history of crc or a personal history of psc should undergo surveillance colonoscopy every year starting at the point of diagnosis .29 in patients with cd involving at least one - third of the colon , screening endoscopy , and surveillance colonoscopy should be performed as in patients with uc because dysplasia and crc tend to occur at a similar rate as in patients with uc .3,25,29 because it is difficult to identify dysplasia when colonic mucosal inflammation is severe , in principle , screening and surveillance colonoscopy should be performed when ibd is in remission . however , screening and surveillance colonoscopy should not be unduly delayed if remission can not be achieved .28,29 multiple colon biopsies are often required for crc surveillance because dysplasia in patients with ibd is flat and multifocal , making it difficult to detect grossly . as a standard method for the detection of ibd - related crc , random 4 - quadrant biopsies with regular 10 - cm intervals have been recommended for at least 33 different regions of the entire colon34 in addition to biopsy of areas with mucosal irregularity .35 however , in random biopsies , less than 1 % of the entire mucosal surface of the colon is sampled , leaving a very high sampling error36 and yielding a low positive rate , while also being expensive and time - consuming . chromoendoscopy , a technique that uses dyes such as indigo carmine and methylene blue sprayed on the colonic mucosa , can provide improved visualization of fine mucosal changes when compared with conventional white light endoscopy ( fig . the dysplasia detection rate is reportedly 2.0 % to 8.8 % in conventional white light endoscopy compared with 7.0 % to 16.7 % in chromoendoscopy , indicating that the latter is two to three times better at detecting dysplasia .37,38,39,40,41 although additional time is required for the dye spraying , no time disparities occur between the two methods because of the reduced frequency of biopsies needed with chromoendoscopy relative to the random biopsy approach . the guidelines of the british society of gastroenterology , updated in 2010 , recommend pancolonic dye spraying with targeted biopsies of any abnormal areas .29 ongoing studies aim to validate the effectiveness of new methods , such as confocal endomicroscopy and autofluorescence imaging . chromoendoscopy with confocal endomicroscopy has an intraepithelial neoplasia diagnostic yield that is 2.5 times higher than that of chromoendoscopy alone and 4.75 times higher than that of conventional white light endoscopy .39,42 data from a small study indicate that autofluorescence imaging provides a sensitivity of 87 % to 100 % for detecting dysplastic lesions in patients with ibd . however , possible variability between endoscopists is an issue , and these new procedures can not be fully applied for crc surveillance without securing validation from large - scale investigations . dysplasia detected by surveillance colonoscopy is categorized according to histological findings as high - grade dysplasia , low - grade dysplasia , or indefinite dysplasia .43 it is also divided into two classes based on endoscopic diagnosis : dysplasia - associated lesion or mass ( dalm ) , which can be detected grossly , and flat dysplasia , which is not easily detected grossly but is identified by random blind biopsies .44 if high - grade dysplasia or multifocal low - grade dysplasia is confirmed histologically , a patient is at high risk of synchronous crc and , therefore , should be referred for prophylactic total proctocolectomy .30 patients with indefinite dysplasia are advised to reundergo surveillance colonoscopy 3 to 6 months after completing treatment for active inflammation .26 however , no consensus exists regarding the treatment of unifocal low - grade dysplasia ; some studies claim that in cases where only unifocal low - grade dysplasia was found , 20 % of colectomy patients had already developed cancer ,45 others suggest that merely 2 % to 10 % of patients develop cancer after a 10 - year follow - up .46 recently , more frequent surveillance colonoscopy was recommended for patients with unifocal low - grade dysplasia when proctocolectomy was unacceptable or not feasible .27 dalms are often categorized as adenoma - like or nonadenoma - like . evidence indicates that because adenoma - like dalms tend to have a lower risk of malignancy than nonadenoma - like dalms , they may be treated with endoscopic resection and continued regular follow - up if the lesion has been excised completely and no flat dysplasia is seen elsewhere in the colon .47 complete proctocolectomy is proposed for nonadenoma - like dalms because synchronous crc has been reportedly found in up to 50 % of cases ( fig .2 ) .48,49 with endoscopy , adenoma - like dalms grossly appear as well - circumscribed , polypoid , and sessile lesions that do not usually accompany hemorrhage , ulceration , or necrosis , conversely , nonadenoma - like dalms appear as irregular and ill - circumscribed lesions , usually accompanied by hemorrhage , ulceration , or necrosis .50 however , it is not always easy to distinguish between these two lesions by gross examination ; therefore , resection and intense colonoscopic surveillance are advisable when no flat dysplasia is detected surrounding the lesion .51 interest in pharmacotherapy for crc prevention has increased because ibd - related crc is difficult to detect early and often carries a poor prognosis even if detection is possible . sporadic crc passes through the adenoma - cancer pathway , whereas ibd - related crc passes through the inflammation - dysplasia - cancer pathway .2 accordingly , the possibility of preventing crc via reducing chronic inflammation is suggested . one of the first drugs studied in the chemoprevention of ibd - related crc was 5 - aminosalicylate ( 5 - asa ) , which activates the peroxisome proliferator - activated receptor - pathway by reducing inflammation , thereby inhibiting the excessive turnover of epithelial cells and maintaining the balance of physiological apoptosis in tumor cells .52 furthermore , 5 - asa may reduce microsatellite instability by preventing cellular oxidative damage and interfering with subsequent dna mutational processes in the intestinal mucosa .53 the drug is also expected to inhibit the progression to crc by inhibiting lipoxygenase , cyclooxygenase mediators , and interleukins .54 most relevant studies show that 5 - asa reduced the incidence of ibd - related crc ,7,55,56,57 and the effect was most pronounced when a 1.2 g / day dose was administered .58,59 in a few studies , however , 5 - asa treatment had no impact on reducing crc occurrences ,60,61 and cancer incidence even increased according to some data .10,62 although well - designed , prospective , randomized trials are necessary , 5 - asa is now widely used to maintain remission in patients and is recommended for the chemoprevention of crc .63,64 in patients with psc and uc , excessive bile secretion makes it impossible for the small intestine to sufficiently absorb the bile acid , thereby irritating the proximal colon mucosa and exacerbating existing inflammation .65 ursodeoxycholic acid ( udca ) inhibits such disproportionate bile secretion and has a preventive effect on ibd - related crc . in one meta - analysis , subjects were divided by udca dose into a low - to - medium dose group with 25 mg / kg / day and a high - dose group with 25 mg / kg / day . udca had a preventive effect on crc in the low - to - medium dose group , whereas the incidence of crc increased in the high - dose group .66 therefore , it is recommended that patients with uc and psc take udca at a dose 25 mg / kg / day to prevent crc . immunomodulators , such as azathioprine , 6 - mercaptopurine , and methotrexate , are known to inhibit chronic inflammation and are expected to have a crc - preventive effect in patients with ibd . data from one group of studies indicate no significant effect of immunomodulators on ibd - related crc incidence ,10,58,67,68 but a few studies , including a recent prospective study , reported that immunomodulator use did enhance crc prevention .55,69,70,71 it should be noted that long - term use of these drugs is reportedly associated with an increased incidence of lymphoma .72 inflammatory cytokines , including tumor necrosis factor - ( tnf - ) , may have an important role in the initiation , promotion , and progression of ibd - related crc . tnf - blocking agents such as infliximab and adalimumab are known to be effective for active ibd , with rapid onset of mucosal healing and maintenance of remission . also , blocking tnf - resulted in significantly decreased colonic neoplasm development in animal models .73 these experimental data have not yet been validated in clinical trials , but it is expected that tnf - blocking agents can be used in chemoprevention of ibd - related crc . folic acid deficiency is understood to be one cause of sporadic crc , but its supplementation did not lead to effective prevention of ibd - related crc .74,75 in a population - based case - control study , statin use was shown to reduce the incidence rate of crc in both the non - ibd and ibd patient populations ,76 but further studies that include ibd patients are required . with the rapidly growing incidence of ibd , the overall occurrence of ibd - associated crc may be growing . screening and surveillance colonoscopy in patients with ibd is thought to enable early detection of dysplasia and cancer , making it possible to improve the prognosis of ibd - related crc by providing patients with proactive treatments . although controversy remains regarding adequate endoscopic intervals and methods for effective screening and surveillance , it is generally recommended that all patients with ibd receive screening endoscopy 8 to 10 years after diagnosis , followed by surveillance colonoscopy according to each patient 's risk level . efficient biopsy methods using new technologies , such as chromoendoscopy , are expected to increase the diagnosis rate of dysplasia in patients with ibd . however , what is most needed to improve the diagnosis rate of ibd - related crc is for physicians to take the time to monitor each patient and perform thorough biopsies of the indicated areas .\noutput:\n" }, { "from": "agent", "value": "patients with inflammatory bowel disease ( ibd ) have an increased risk of developing colorectal cancer ( crc ) . accordingly , the duration and anatomic extent of the disease have been known to affect the development of ibd - related crc . when crc occurs in patients with ibd , unlike in sporadic crc , it is difficult to detect the lesions because of mucosal changes caused by inflammation . in addition , the tumor types vary with ill - circumscribed lesions , and the cancer is difficult to diagnose and remedy at an early stage . for the diagnosis of crc in patients with ibd , screening endoscopy is recommended 8 to 10 years after the ibd diagnosis , and surveillance colonoscopy is recommended every 1 to 2 years thereafter . the recent development of targeted biopsies using chromoendoscopy and relatively newer endoscopic techniques helps in the early diagnosis of crc in patients with ibd . a total proctocolectomy is advisable when high - grade dysplasia or multifocal low - grade dysplasia is confirmed by screening endoscopy or surveillance colonoscopy or if a nonadenoma - like dysplasia - associated lesion or mass is detected . currently , pharmacotherapies are being extensively studied as a way to prevent ibd - related crc ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: lipemia retinalis is an unusual retinal manifestation of hyperlipidemia and is thought to be directly correlated with the serum triglyceride level . this paper discusses the case of a 55 - year - old patient with lipemia retinalis , which deteriorated his visual acuity . the patient had an extremely high serum cholesterol level ( 1053 mg / dl ) and a very high level of triglycerides ( 1513 mg / dl ) . the normalization of serum lipids , reversion of retinal vessels alterations and visual acuity improvement was achieved after an intensive statin lipid - lowering therapy . pathological changes of the patient s retina , connected with lipemia retinalis , disappeared completely . hyperlipidemia can cause lipemia retinalis , which is characterized by the hyperlipidemic vascular lesions - whitish color of vessels , lipid infiltration into the retina and decrease of visual acuity . the lipid - lowering therapy may lead to the normalization of the appearance of the fundus and restore the visual acuity . hyperlipidemias manifest themselves mainly by increased blood serum concentrations of cholesterol or triglycerides and the disturbances in ldl or / and hdl cholesterol . the consequences of hyperlipidemia are multiorgan and include premature atherosclerosis with all its effects , lesions of the digestive system ( liver and pancreas ) , skin and sometimes ocular changes . retinal vessels become cream colored due to the scattering of light by the triglyceride - laden chylomicrons . very high levels of triglyceridesare required ; hypercholesterolemia alone does not produce this vascular appearance . in clinical practice , elevated serum triglycerides are most often observed in persons with metabolic syndrome , despite the fact that secondary or genetic factors can heighten triglyceride levels . we report the case of a 55 - year - old patient treated for age - related macular degeneration who had exudative form in the right eye and non - exudative in the left eye for 2 years , and presented a deterioration of vision in his left eye . for this reason , he had also a history of lipid disorder ( high serum cholesterol and dyslipidemia in anamnesis ) . the visual acuity in his right eye was counting fingers at 2 m and acuity in his left eye decreased from 0.7 to 0.5 . eye fundus examination revealed lipemia retinalis ; the hyperlipidemic vascular lesions had whitish - colored vessels and lipid infiltration into the retina and age - related macular degeneration in both eyes . we found an extremely high serum cholesterol level ( 1053 mg / dl [ normal desirable 200 mg / dl , borderline high 200239 mg / dl , high 240 mg / dl ] ) , very high level of triglycerides ( 1513 mg / dl [ normal 200 mg / dl ] ) and dyslipidemia characterized by very high ldl cholesterol level ( 722 mg / dl [ normal range 60130 mg / dl ] ) and low concentration of hdl cholesterol ( 29 mg / dl [ normal 40 mg / dl ] ) . additionally , a higher activity of aminotransferases was observed aspat ( 169 u / l [ normal subsequently , considering the lipid disturbances , the patient was referred to the department of internal medicine to perform further diagnosis and treatment . during hospitalization , the medical diagnosis was made on the basis of medical history , medical examination and diagnostic investigations . the patient suffered from coronary disease , hypertension , hyperlipidemia , hepatic lesion and alcoholic dependence . the normalization of serum lipids and reversion of retinal vessels alterations was achieved after an intensive statin lipid - lowering therapy ( atorvastatin 40 mg daily for 8 weeks ) ( figures 3 , 4 ) . after the treatment , the visual acuity of right eye did not change , but the left eye improved to 0.7 . it was impossible to achieve significant improvement of visual acuity in the right eye because of the severe form of macular degenerations . endothelial damage in atherosclerosis is characterized by abnormal vascular functionality . despite the fact that alterations in the cardio - vascular system , skin changes and digestive symptoms are well known and expected , the ocular lesions in hyperlipidemia are often forgotten . however , there are reports describing the ocular lesions in hyperlipoproteinemia , such as xanthelasma ( a deposition of lipid the in eyelid ) , lipid keratopathy ( corneal arcus ) , retinal artery and vein occlusions , ischemic optic neuropathy , cataract and even dry eye . the third report of the national cholesterol education program ( ncep ) expert panel on the detection , evaluation , and treatment of high blood cholesterol in adults ( adult treatment panel iii ) defines lipemia retinalis as one of the outcomes of hypertriglyceridemia . according the ncep , optimal serum ldl cholesterol level should be below 100 mg / dl ( ldl above 190 mg / dl is classified as very high ) . as it is a rare entity , we found it interesting to present the case , in which the markedly elevated serum concentrations of triglycerides , total cholesterol and ldl cholesterol altered the retinal vessels as lipid infiltrated the small vessels walls . according to nagra et al . typically , the retinal findings do not occur until the triglyceride level reaches 2500 mg per deciliter . the findings can fluctuate widely from day to day , depending on the triglyceride level . patients with lipemia retinalis in typical cases maintain good vision , and fundus changes resolve when serum lipid levels are reduced . however , it was shown in a rabbit model of hypercholesterolemia that normalization of serum cholesterol levels was not enough to reverse cholesterol - induced vascular damage to the choroid and retinal vessels . these vascular changes could be compatible with a chronic ischemia that could produce retinal degeneration . it is interesting that in the described patient , lipemia retinalis was observed at concentrations of triglycerides below 2500 mg per deciliter . we believe that in the presented case an extremely high serum cholesterol level and dyslipidemia could contribute to the vascular changes . in the case of our patient , hyperlipidemia was secondary to a lipid - rich diet , excessive use of alcohol and lack of physical activity . it should be stressed that a lipid disorder resulting in lipemia retinalis causes a risk of life - threatening atherosclerotic disease and other severe complications like acute pancreatitis . moreover , characteristic retinal findings may be the only sign of lipid disturbances ( which are often asymptomatic ) . after 2 months of lipid - lowering therapy , the serum cholesterol and triglyceride levels returned to normal . pathological changes in the patient s retina , connected with lipemia retinalis , disappeared completely ; however , the macular lesions remained . such intensity of age - related macular degeneration at a relatively young age could be caused by irreversible , microscopic damage to choroid and retina . lipid - lowering treatment of lipemia retinalis with statin and improvement in vision has not been reported thus far in the medical literature . lipemia retinalis , which is characterized by hyperlipidemic vascular lesions with whitish - colored vessels , lipid infiltration into the retina and decreased visual acuity . lipid - lowering therapy may lead to the normalization of the fundus appearance and restoration of visual acuity .\noutput:\n" }, { "from": "agent", "value": "summarybackgroundhyperlipidemia is an identified factor of premature vessel atherosclerosis . lipemia retinalis is an unusual retinal manifestation of hyperlipidemia and is thought to be directly correlated with the serum triglyceride level.case reportthis paper discusses the case of a 55 - year - old patient with lipemia retinalis , which deteriorated his visual acuity . the patient had an extremely high serum cholesterol level ( 1053 mg / dl ) and a very high level of triglycerides ( 1513 mg / dl ) . the normalization of serum lipids , reversion of retinal vessels alterations and visual acuity improvement was achieved after an intensive statin lipid - lowering therapy . pathological changes of the patient s retina , connected with lipemia retinalis , disappeared completely.conclusionshyperlipidemia can cause lipemia retinalis , which is characterized by the hyperlipidemic vascular lesions - whitish color of vessels , lipid infiltration into the retina and decrease of visual acuity . the lipid - lowering therapy may lead to the normalization of the appearance of the fundus and restore the visual acuity ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: abdominal subcutaneous adipose tissue was obtained from 51 different subjects by needle biopsy ( n = 45 ) or bariatric surgery ( n = 6 ) . subjects were between 28 and 69 years of age and had a bmi ( mean se ) of 28.82.2 kg / m ( range 19.354.8 ) . adipose tissue was digested with collagenase as previously reported and cell size measured ( 19 ) . the medium under the isolated adipocytes was collected and centrifuged for 10 min at 200 g . / l nh4cl for 5 min before seeding the cells in a 55 - cm petri dish . after 3 days , when the cells had started to proliferate , the progenitor or inflammatory cells were isolated with magnetic immune separation . the remaining cells were then cultured at 37c with dulbecco 's modified eagle 's medium ( dmem ) and ham 's f12 ( 1:1 ) with 10 % fetal bovine serum ( fbs ) , 2 mmol / l glutamine , 100 units / ml penicillin , and 100 g / ml streptavidin . after 2 weeks cells were trypsinized and any remaining inflammatory cells removed by magnetic immune separation of cd14 - and cd45 - positive cells ( miltenyi biotech , bergisch gladbach , germany ) . the remaining preadipocyte fraction was seeded ( 10,000 cells / cm ) and cultured in six - well plates ( nunc , roskilde , denmark ) . cells were left untreated or grown in the presence of 5 ng / ml tnf - , 20 ng / ml il - 6 , 50 ng / ml resistin , or 10 ng / ml lipopolysaccharide for 10 days . in some experiments ,300 mol / l oleic acid was added to the medium for 48 h after 10 days of culture . differentiation of the preadipocytes was induced with a differentiation cocktail consisting of 850 nmol / l insulin , 10 mol / l dexamethasone , 0.5 mmol / l ibmx ( isobutylmethylxanthine ) , 10 mol / l pioglitazone , 33 mol / l biotin , and 17 mol / l pathenonate in dmem / f12 supplemented with 3 % fbs ( vol / vol ) , 2 mmol / l glutamine , and antibiotics . after 3 days , the medium was changed to a medium containing only insulin , dexamethasone and pioglitazone in dmem / f12 , 10 % fbs with glutamine , and antibiotics . the cells were then left to differentiate for another 18 days with medium changed every other day . in some experiments 5 ng / ml tnf - , 20 ng / ml il - 6 , 50 ng / ml wingless - type mmtv ( mouse mammary tumor virus ) integration site family , member 3a ( wnt3a ) , or 50 ng / ml resistin was added to the differentiation medium . to determine lipid accumulation , cells cultured in six - well plateswere fixed with 10 % formalin for 20 min and then stained with oil red o for 60 min . optical density for oilred o was determined by washing the stained cells carefully , and , after removal of all water , 1 ml isopropanol was added to each well . the absorbance of cells that had undergone differentiation was then related to that of undifferentiated cells ( = 1 ) . after trypsin treatment , the total number of cells were counted in a hemocytometer and then labeled and isolated with magnetic beads against cd133 . rna was isolated with rneasy ( qiagen , hilden , germany ) , and 10 ng total rna was used for cdna synthesis using a high - capacity cdna reverse - transcription kit ( applied biosystems , foster city , ca ) . an abi prism 7900 sequence detection system ( applied biosystems ) was used to analyze gene expression . on - demand primers and probes ( applied biosystems ) or custom - designed reagentsthe sequences are available on request . for real - time pcr , 10 ng cdna , 100 nmol / l probes , and 200 nmol / l of both reverse as well asrelative quantification of mrna levels was plotted as the fold change compared with the basal state , using 18s rrna as endogenous control ( applied biosystems ) . secreted cytokines and chemokines ( il - 1 , il - 6 , il - 8 , and monocyte chemoattractant protein [ mcp ] - 1 ) were determined in the cell culture medium by enzyme - linked immunosorbent assay ( elisa ) techniques according to the manufacturer 's instructions ( biosource , carlsbad , ca ) . secretion of granulocyte - macrophage colony - stimulating factor ( gm - csf ) , serum amyloid a ( saa ) , and intercellular adhesion molecule ( icam ) was measured by multiplex electrochemiluminescence using meso scale discovery technology ( gaithersburg , md ) , and levels of tnf - were measured by high - sensitivity human tnf - quantikine elisa ( r & d systems , minneapolis , mn ) . cells were washed with pbs and incubated with medium containing 10 g / ml dil - ac - ldl ( invitrogen , carlsbad , ca ) for 4 h at 37c . after incubation , cells were washed with pbs and fixed with 3 % formalin for 10 min . wilcoxon 's nonparametric test for paired observations was used to evaluate differences between the different conditions . adipose tissue was digested with collagenase as previously reported and cell size measured ( 19 ) . the medium under the isolated adipocytes was collected and centrifuged for 10 min at 200 g . / l nh4cl for 5 min before seeding the cells in a 55 - cm petri dish . after 3 days , when the cells had started to proliferate , the progenitor or inflammatory cells were isolated with magnetic immune separation . the remaining cells were then cultured at 37c with dulbecco 's modified eagle 's medium ( dmem ) and ham 's f12 ( 1:1 ) with 10 % fetal bovine serum ( fbs ) , 2 mmol / l glutamine , 100 units / ml penicillin , and 100 g / ml streptavidin . after 2 weeks cells were trypsinized and any remaining inflammatory cells removed by magnetic immune separation of cd14 - and cd45 - positive cells ( miltenyi biotech , bergisch gladbach , germany ) . the remaining preadipocyte fraction was seeded ( 10,000 cells / cm ) and cultured in six - well plates ( nunc , roskilde , denmark ) . cells were left untreated or grown in the presence of 5 ng / ml tnf - , 20 ng / ml il - 6 , 50 ng / ml resistin , or 10 ng / ml lipopolysaccharide for 10 days . in some experiments , 300mol / l oleic acid was added to the medium for 48 h after 10 days of culture . differentiation of the preadipocytes was induced with a differentiation cocktail consisting of 850 nmol / l insulin , 10 mol / l dexamethasone , 0.5 mmol / l ibmx ( isobutylmethylxanthine ) , 10 mol / l pioglitazone , 33 mol / l biotin , and 17 mol / l pathenonate in dmem / f12 supplemented with 3 % fbs ( vol / vol ) , 2 mmol / l glutamine , and antibiotics . after 3 days , the medium was changed to a medium containing only insulin , dexamethasone and pioglitazone in dmem / f12 , 10 % fbs with glutamine , and antibiotics . the cells were then left to differentiate for another 18 days with medium changed every other day . in some experiments5 ng / ml tnf - , 20 ng / ml il - 6 , 50 ng / ml wingless - type mmtv ( mouse mammary tumor virus ) integration site family , member 3a ( wnt3a ) , or 50 ng / ml resistin was added to the differentiation medium . to determine lipid accumulation , cells cultured in six - well plates were fixed with 10 % formalin for 20 min and then stained with oil red o for 60 min . optical density for oilred o was determined by washing the stained cells carefully , and , after removal of all water , 1 ml isopropanol was added to each well . the absorbance of cells that had undergone differentiation was then related to that of undifferentiated cells ( = 1 ) . after trypsin treatment , the total number of cells were counted in a hemocytometer and then labeled and isolated with magnetic beads against cd133 . rna was isolated with rneasy ( qiagen , hilden , germany ) , and 10 ng total rna was used for cdna synthesis using a high - capacity cdna reverse - transcription kit ( applied biosystems , foster city , ca ) . an abi prism 7900 sequence detection system ( applied biosystems ) was used to analyze gene expression . on - demand primers and probes ( applied biosystems ) or custom - designed reagentsthe sequences are available on request . for real - time pcr , 10 ng cdna , 100 nmol / l probes , and200 nmol / l of both reverse as well as forward primers were used and the procedure was performed as recommended by the manufacturer . relative quantification of mrna levels was plotted as the fold change compared with the basal state , using 18s rrna as endogenous control ( applied biosystems ) . secreted cytokines and chemokines ( il - 1 , il - 6 , il - 8 , and monocyte chemoattractant protein [ mcp ] - 1 ) were determined in the cell culture medium by enzyme - linked immunosorbent assay ( elisa ) techniques according to the manufacturer 's instructions ( biosource , carlsbad , ca ) . secretion of granulocyte - macrophage colony - stimulating factor ( gm - csf ) , serum amyloid a ( saa ) , and intercellular adhesion molecule ( icam ) was measured by multiplex electrochemiluminescence using meso scale discovery technology ( gaithersburg , md ) , and levels of tnf - were measured by high - sensitivity human tnf - quantikine elisa ( r & d systems , minneapolis , mn ) . cells were washed with pbs and incubated with medium containing 10 g / ml dil - ac - ldl ( invitrogen , carlsbad , ca ) for 4 h at 37c . after incubation , cells were washed with pbs and fixed with 3 % formalin for 10 min . wilcoxon 's nonparametric test for paired observations was used to evaluate differences between the different conditions . we plated the remaining stromal - vascular cells after the cd14 - and cd45 - positive inflammatory cells had been removed by magnetic immune separation . after addition of the differentiation cocktail , the cd14 - and cd45 - negative cells accumulated lipids , and the expression of adiponectin and glut4 was increased ( fig . . a : mrna expression of glut4 and adiponectin ( apm1 ) before ( = 1 ) and after ( ) adipocyte differentiation . b : oil red o staining ( absorbance ) of primary human preadipocytes differentiated for 21 days from two different donors with varying percentage of differentiation . c : bmi of the preadipocyte donor is significantly and inversely correlated to the degree of preadipocyte differentiation ( r = 0.59 , p = 0.006 ) . d : correlation between preadipocyte differentiation and mean adipocyte size of the donors ( r = 0.69 , p 0.001 ) . e : the relative number of cd133 - positive cells in the stromal vascular fraction is positively correlated with bmi of the donor ( r = 0.51 , p 0.01 ) . f : mrna levels of map4k4 in cultured preadipocytes in relation to bmi of the donors ( r = 0.42 , p 0.05 ) . g and h : correlation between map4k4 mrna levels in isolated mature adipose cells and bmi ( r = 0.41 , p 0.04 ) ( g ) or waist - to - hip ratio ( whr ) ( h ) of the donors ( r = 0.67 , p = 0.002 ) . the number of preadipocytes that differentiated varied markedly between the patients and ranged from 20 to 90 % ( fig . interestingly , there was a highly significant negative correlation between bmi of the donor and number of preadipocytes differentiating to adipocytes , as reflected by oil red o accumulation ( fig .1 c also included five type 2 diabetic individuals , the results were virtually identical when these were excluded from the analyses ( r = 0.594 , p 0.01 , n = 20 , vs. r = 0.549 , p 0.01 , n = 15 ) . negative correlation was also found between preadipocyte differentiation and average adipocyte size of the donors ( fig .1 d ) , which in turn is a marker of insulin sensitivity ( 58 ) . the negative correlation between bmi , cell size , and number of preadipocytes able to differentiate can either be attributable to a reduced number of preadipocytes in the abdominal adipose tissue in obesity and / or to an impaired ability of these cells to differentiate . one reason could be fewer progenitor cells , including mesenchymal stem cells , which undergo commitment to preadipocytes in vivo . to address this , we isolated cd133 - positive cells because we ( unpublished data ) and others ( 26,27 ) have shown that this population contains pluripotent cells that can be differentiated to adipose , bone , and muscle cells . interestingly , the relative number of cd133 - positive cells in the stromal vascular fraction was positively correlated with bmi ( r = 0.7141 , p = 0.01 , n = 10 ) ( fig . this positive correlation seemed to plateau at higher bmi because we also studied an individual with bmi 66 kg / m in whom 1.8 % of the cells were cd133 positive . thus , it appears that the pool of early adipocyte precursor cells is not reduced but , rather , that commitment is impaired and / or committed preadipocytes from obese individuals have an impaired ability to differentiate to the adipocyte phenotype . we examined the expression of several different genes in the undifferentiated preadipocytes from obese versus nonobese individuals and found that expression of map4k4 in the preadipocytes was positively correlated with bmi ( r = 0.647 , p 0.05 ) ( fig . this kinase has previously been shown to impair adipogenesis , to be induced by tnf - , and to inhibit ppar - expression ( 24,25 ) . to examine whether this increase was induced by the culture proceduremap4k4 was also increased in these cells and the expression correlated with both bmi ( fig .1 g ) and the waist - to - hip ratio of the donor ( fig . waist - to - hip ratio is a well - established marker of the metabolic complications of obesity , including insulin resistance ( 58 ) . thus , increased map4k4 seems to be an intrinsic property of the ( pre ) adipocytes in obesity characterized by enlarged fat cells . when tnf - was added , the cd14 - and cd45 - negative stromal vascular cells became more densely packed , suggesting a proliferating and / or antiapoptotic effect of tnf - ( fig .2 b ) , and this was also supported by the lack of induction of mrna of the differentiation markers adiponectin and glut4 ( fig . similar to tnf - , addition of the wnt ligand wnt3a completely prevented the differentiation of these cells ( fig . b : the presence of either tnf - ( 5 ng / ml ) or wnt3a ( 50 ng / ml ) completely prevented normal adipocyte differentiation , as shown by oil red o staining . c : mrna expression of glut4 , adiponectin ( apm1 ) , and wnt10 after adipocyte differentiation for 21 days in the absence ( ) or presence of tnf - ( 5 ng / ml ) ( ) . d : oil red o staining of human preadipocytes differentiated for 21 days with or without preincubation with tnf - ( 5 ng / ml ) for 10 days . addition of tnf - to undifferentiated 3t3 - l1 cells has been shown to activate the wnt pathway and wnt10b expression ( 18,28 ) . we also found in human preadipocytes that wnt10b was increased in the presence of tnf - ( fig . in contrast to tnf - , addition of either il - 6 or resistin did not prevent normal differentiation of the cells or increase gene expression of wnt10b ( data not shown ) . thus , of the tested cytokines , tnf - alone completely prevented the normal differentiation of human preadipocytes , activated wnt10b expression , and , probably as a consequence , also seemed to enhance the proliferation of these cells . we then asked whether the inhibitory effect of tnf - was transient or whether an associated activation of the wnt pathway could contribute to a long - term inability of the preadipocytes to become adipose cells and thus explain this negative correlation with bmi . tnf - was removed from the incubation medium after 10 days and differentiation induced with the normal cocktail . however , the effect of tnf - seems to be rapidly reversible because the cells accumulated lipids to a similar degree as the control cells , which had not been exposed to tnf - ( fig . furthermore , they started to express differentiation markers as rapidly as the control cells , albeit at a lower level ( data not shown ) . we next examined the gene expression of undifferentiated preadipocytes that had been exposed or not exposed to tnf - , il - 6 , or resistin for 10 days . in the presence of tnf - , the cells assumed a marked proinflammatory phenotype associated with increased expression of cytokines and chemokines ( tables 1 and 2 ) . most importantly , genes that were not expressed or only expressed at very low levels in the basal state became activated by tnf - . these included gm - csf , il - 1 , mip - 1 , tnf - itself , cd68 , and matrix metalloprotease 3 ( mmp3 ) ( table 1 ) . significant upregulation was also seen of proinflammatory molecules already expressed in the preadipocytes , like il - 6 , il - 8 , mcp - 1 , saa , icam , mmp7 , and toll - like receptor ( tlr ) - 2 , but not tlr4 ( table 2 ) . again , neither il - 6 nor resistin induced any significant changes in these genes ( tables 1 and 2 ) . effect of tnf - , il - 6 , and resistin on mrna levels of macrophage - related genes in preadipocytes data are means se where basal is set to 1 . human preadipocytes in the stromal vascular fraction were cultured for 10 days with or without 5 ng / ml tnf - , 20 ng / ml il - 6 , or 50 ng / ml human resistin . effect of tnf - , il - 6 , and resistin on gene expression in undifferentiated human preadipocytes data are means se where basal is set to 1 . we also measured the secretion of several cytokines and chemokines and found increases in secretion that paralleled the gene expression pattern ( fig . again , il - 1 , which was not secreted , and gm - csf , which was secreted at very low levels in the nonstimulated cells , were clearly induced by tnf - ( fig .3 ) . tnf - also increased the secretion of il - 6 , il - 8 , mcp - 1 , saa , and icam . however , we found no consistent secretion of tnf - itself , as measured in the medium of cells where tnf - had been removed from the medium after 10 days ( data not shown ) , indicating a lack of activation of tace ( tnf - converting enzyme ) . human preadipocytes assume a macrophage - like phenotype in the presence of tnf - . levels of secreted inflammatory molecules by human preadipocytes untreated ( ) or treated with tnf - ( 5 ng / ml ) ( ) , il - 6 ( 20 ng / ml ) ( ) , or human resistin ( 50 ng / ml ) ( ) for 10 days . we also tested whether lipopolysaccharide can alter the phenotype of these cells and found , in general , similar changes as with tnf - . there were no additive effects of combining lipopolysaccharide and tnf - , suggesting that they influenced the same pathways ( data not shown ) . however , we were unable to see the induction of a phagocytotic potential ( data not shown ) . although acetylated ldl uptake was slightly increased by the presence of tnf - , only a few cells ( 5 % ) were positive for ldl uptake . thus , a complete transdifferentiation of the cells into macrophages , including phagocytotic potential , secretion of tnf - , and expression of the scavenger receptor , was not seen . because tnf - did not alter tlr4 expression , we asked whether the addition of fatty acids to the medium a normal component in vivoaddition of 300 mol / l oleic acid to the medium for 48 h increased lipid droplet formation in the cells but did not further alter the pattern of transdifferentiation seen in the presence of tnf - alone ( data not shown ) . we plated the remaining stromal - vascular cells after the cd14 - and cd45 - positive inflammatory cells had been removed by magnetic immune separation . after addition of the differentiation cocktail , the cd14 - and cd45 - negative cells accumulated lipids , and the expression of adiponectin and glut4 was increased ( fig . . a : mrna expression of glut4 and adiponectin ( apm1 ) before ( = 1 ) and after ( ) adipocyte differentiation . b : oil red o staining ( absorbance ) of primary human preadipocytes differentiated for 21 days from two different donors with varying percentage of differentiation . c : bmi of the preadipocyte donor is significantly and inversely correlated to the degree of preadipocyte differentiation ( r = 0.59 , p = 0.006 ) . d : correlation between preadipocyte differentiation and mean adipocyte size of the donors ( r = 0.69 , p 0.001 ) . e : the relative number of cd133 - positive cells in the stromal vascular fraction is positively correlated with bmi of the donor ( r = 0.51 , p 0.01 ) . f : mrna levels of map4k4 in cultured preadipocytes in relation to bmi of the donors ( r = 0.42 , p 0.05 ) . g and h : correlation between map4k4 mrna levels in isolated mature adipose cells and bmi ( r = 0.41 , p 0.04 ) ( g ) or waist - to - hip ratio ( whr ) ( h ) of the donors ( r = 0.67 , p = 0.002 ) . the number of preadipocytes that differentiated varied markedly between the patients and ranged from 20 to 90 % ( fig . interestingly , there was a highly significant negative correlation between bmi of the donor and number of preadipocytes differentiating to adipocytes , as reflected by oil red o accumulation ( fig .1 c also included five type 2 diabetic individuals , the results were virtually identical when these were excluded from the analyses ( r = 0.594 , p 0.01 , n = 20 , vs. r = 0.549 , p 0.01 , n = 15 ) . negative correlation was also found between preadipocyte differentiation and average adipocyte size of the donors ( fig .1 d ) , which in turn is a marker of insulin sensitivity ( 58 ) . the negative correlation between bmi , cell size , and number of preadipocytes able to differentiate can either be attributable to a reduced number of preadipocytes in the abdominal adipose tissue in obesity and / or to an impaired ability of these cells to differentiate . one reason could be fewer progenitor cells , including mesenchymal stem cells , which undergo commitment to preadipocytes in vivo . to address this , we isolated cd133 - positive cells because we ( unpublished data ) and others ( 26,27 ) have shown that this population contains pluripotent cells that can be differentiated to adipose , bone , and muscle cells . interestingly , the relative number of cd133 - positive cells in the stromal vascular fraction was positively correlated with bmi ( r = 0.7141 , p = 0.01 , n = 10 ) ( fig . this positive correlation seemed to plateau at higher bmi because we also studied an individual with bmi 66 kg / m in whom 1.8 % of the cells were cd133 positive . thus , it appears that the pool of early adipocyte precursor cells is not reduced but , rather , that commitment is impaired and / or committed preadipocytes from obese individuals have an impaired ability to differentiate to the adipocyte phenotype . we examined the expression of several different genes in the undifferentiated preadipocytes from obese versus nonobese individuals and found that expression of map4k4 in the preadipocytes was positively correlated with bmi ( r = 0.647 , p 0.05 ) ( fig . this kinase has previously been shown to impair adipogenesis , to be induced by tnf - , and to inhibit ppar - expression ( 24,25 ) . to examine whether this increase was induced by the culture proceduremap4k4 was also increased in these cells and the expression correlated with both bmi ( fig .1 g ) and the waist - to - hip ratio of the donor ( fig . waist - to - hip ratio is a well - established marker of the metabolic complications of obesity , including insulin resistance ( 58 ) . thus , increased map4k4 seems to be an intrinsic property of the ( pre ) adipocytes in obesity characterized by enlarged fat cells . when tnf - was added , the cd14 - and cd45 - negative stromal vascular cells became more densely packed , suggesting a proliferating and / or antiapoptotic effect of tnf - ( fig .2 b ) , and this was also supported by the lack of induction of mrna of the differentiation markers adiponectin and glut4 ( fig . similar to tnf - , addition of the wnt ligand wnt3a completely prevented the differentiation of these cells ( fig . b : the presence of either tnf - ( 5 ng / ml ) or wnt3a ( 50 ng / ml ) completely prevented normal adipocyte differentiation , as shown by oil red o staining . c : mrna expression of glut4 , adiponectin ( apm1 ) , and wnt10 after adipocyte differentiation for 21 days in the absence ( ) or presence of tnf - ( 5 ng / ml ) ( ) . d : oil red o staining of human preadipocytes differentiated for 21 days with or without preincubation with tnf - ( 5 ng / ml ) for 10 days . addition of tnf - to undifferentiated 3t3 - l1 cells has been shown to activate the wnt pathway and wnt10b expression ( 18,28 ) . we also found in human preadipocytes that wnt10b was increased in the presence of tnf - ( fig .2 c ) , whereas wnt3a was not expressed ( data not shown ) . in contrast to tnf - , addition of either il - 6 or resistin did not prevent normal differentiation of the cells or increase gene expression of wnt10b ( data not shown ) . thus , of the tested cytokines , tnf - alone completely prevented the normal differentiation of human preadipocytes , activated wnt10b expression , and , probably as a consequence , also seemed to enhance the proliferation of these cells . we then asked whether the inhibitory effect of tnf - was transient or whether an associated activation of the wnt pathway could contribute to a long - term inability of the preadipocytes to become adipose cells and thus explain this negative correlation with bmi . tnf - was removed from the incubation medium after 10 days and differentiation induced with the normal cocktail . however , the effect of tnf - seems to be rapidly reversible because the cells accumulated lipids to a similar degree as the control cells , which had not been exposed to tnf - ( fig . furthermore , they started to express differentiation markers as rapidly as the control cells , albeit at a lower level ( data not shown ) . we next examined the gene expression of undifferentiated preadipocytes that had been exposed or not exposed to tnf - , il - 6 , or resistin for 10 days . in the presence of tnf - , the cells assumed a marked proinflammatory phenotype associated with increased expression of cytokines and chemokines ( tables 1 and 2 ) . most importantly , genes that were not expressed or only expressed at very low levels in the basal state became activated by tnf - . these included gm - csf , il - 1 , mip - 1 , tnf - itself , cd68 , and matrix metalloprotease 3 ( mmp3 ) ( table 1 ) . significant upregulation was also seen of proinflammatory molecules already expressed in the preadipocytes , like il - 6 , il - 8 , mcp - 1 , saa , icam , mmp7 , and toll - like receptor ( tlr ) - 2 , but not tlr4 ( table 2 ) . again , neither il - 6 nor resistin induced any significant changes in these genes ( tables 1 and 2 ) . effect of tnf - , il - 6 , and resistin on mrna levels of macrophage - related genes in preadipocytes data are means se where basal is set to 1 . human preadipocytes in the stromal vascular fraction were cultured for 10 days with or without 5 ng / ml tnf - , 20 ng / ml il - 6 , or 50 ng / ml human resistin . effect of tnf - , il - 6 , and resistin on gene expression in undifferentiated human preadipocytes data are means se where basal is set to 1 . we also measured the secretion of several cytokines and chemokines and found increases in secretion that paralleled the gene expression pattern ( fig . again , il - 1 , which was not secreted , and gm - csf , which was secreted at very low levels in the nonstimulated cells , were clearly induced by tnf - ( fig .3 ) . tnf - also increased the secretion of il - 6 , il - 8 , mcp - 1 , saa , and icam . however , we found no consistent secretion of tnf - itself , as measured in the medium of cells where tnf - had been removed from the medium after 10 days ( data not shown ) , indicating a lack of activation of tace ( tnf - converting enzyme ) . thus , these partially transdifferentiated preadipocytes still lack endogenous tnf - secretion . human preadipocytes assume a macrophage - like phenotype in the presence of tnf - . levels of secreted inflammatory molecules by human preadipocytes untreated ( ) or treated with tnf - ( 5 ng / ml ) ( ) , il - 6 ( 20 ng / ml ) ( ) , or human resistin ( 50 ng / ml ) ( ) for 10 days . data are the means se from six different subjects . * p 0.05 ; * * * p 0.001 . we also tested whether lipopolysaccharide can alter the phenotype of these cells and found , in general , similar changes as with tnf - . there were no additive effects of combining lipopolysaccharide and tnf - , suggesting that they influenced the same pathways ( data not shown ) . however , we were unable to see the induction of a phagocytotic potential ( data not shown ) . although acetylated ldl uptake was slightly increased by the presence of tnf - , only a few cells ( 5 % ) were positive for ldl uptake . thus , a complete transdifferentiation of the cells into macrophages , including phagocytotic potential , secretion of tnf - , and expression of the scavenger receptor , was not seen . because tnf - did not alter tlr4 expression , we asked whether the addition of fatty acids to the medium a normal component in vivoaddition of 300 mol / l oleic acid to the medium for 48 h increased lipid droplet formation in the cells but did not further alter the pattern of transdifferentiation seen in the presence of tnf - alone ( data not shown ) . many studies have shown that the secretion of il - 6 , mcp - 1 , and other cytokines / chemokines by human adipose tissue mainly emanate from the stromal vascular cells ( 29,30 ) . the finding that macrophages infiltrate the adipose tissue in obesity has led to the conclusion that these cells are the main source of cytokine / chemokine secretion ( 8,9 ) , although recent studies have shown that mature adipose cells also secrete il - 6 and mcp - 1 ( 11,29 ) . the role of the inflammatory cells has been supported by reports that different markers of macrophages , such as cd68 , are highly prevalent ( up to 50 % of the cells in the adipose tissue expressing this marker ) and positively related to the size of the adipose cells ( 8 ) . cd68 and mip - 1 have been used in many studies to indicate the number / presence of macrophages in the adipose tissue , and a negative correlation between cd68 mrna expression and insulin sensitivity in vivo has been found in humans ( 31 ) . thus , it appears that cd68 expression and other markers of macrophages in the adipose tissue also reflect the associated clinical phenotype of the individuals . however , the current study clearly shows that cd68 , mip - 1 , or other commonly used markers can not be considered dependable indicators of the number of macrophages , but rather that they reflect the degree of inflammation in the tissue . in this context , it should be added that it is highly unlikely that any macrophages were present in the cultures as a confounding factor . first , we initially removed the cd14 - and cd45 - positive cells through magnetic immune separation of the cells , and , second , it is highly unlikely that any macrophages would have survived the culture procedures in this medium extending , in total , 34 weeks . we examined the ability of human preadipocytes , obtained from the abdominal subcutaneous tissue of different individuals , to differentiate to adipose cells and the role of tnf - , il - 6 , and resistin on differentiation and phenotypic development . the salient findings were that 1 ) there was a very large interindividual difference in the number of cells capable of differentiating into adipocytes , and the differentiation capability was negatively correlated with bmi as well as the average adipocyte size of the donors and , thus , insulin sensitivity ; 2 ) map4k4 expression in adipocytes and cultured preadipocytes was positively correlated with bmi ; 3 ) tnf - , but not il - 6 or resistin , completely prevented the normal differentiation of the preadipocytes into adipose cells ; and 4 ) tnf - promoted a partial transdifferentiation of the preadipocytes to assume a macrophage - like phenotype . this effect , at least under the short - term conditions used , was reversible and dependent on the continuous presence of tnf - because the cells were not induced to secrete tnf - themselves . lipopolysaccharide also prevented the normal differentiation , as also previously reported ( 21 ) , but lipopolysaccharide does not contribute above and beyond the effect of tnf - . this latter point was also supported by our findings that activation of tlr4 with oleic acid ( 32 ) did not further enhance the tnf - induced partial transdifferentiation . our finding of a reduced number of preadipocytes in abdominal subcutaneous adipose tissue in obesity is in agreement with recent work by permana et al . these latter authors ( 34 ) also identified and quantified preadipocytes in the stromal - vascular cells through the positive expression of ap2 , or fabp4 ( fatty acid binding protein 4 ) , but negative expression of cd68 . using these markers in freshly isolated cells , it was reported in a small study ( n = 3 ) that obese individuals may have up to a 50 % reduction in the apparent number of preadipocytes in the abdominal subcutaneous adipose tissue , but this was not seen in a peripheral ( lateral thigh ) depot ( 34 ) . however , a problem with the interpretation of these data are the exclusion of cd68 - positive cells , which would also exclude potential preadipocytes , which are inhibited by the proinflammatory environment . thus , it is still an open question whether the number of preadipocytes is reduced in abdominal subcutaneous adipose tissue in obesity or whether the negative correlation with bmi and adipocyte size that we found mainly reflects an inability of the preadipocytes to undergo normal differentiation when the adipose cells expand in obesity . it should be emphasized that we cultured the preadipocytes in the presence of thiazolidinediones to fully promote adipogenesis . thus , the differences in ability to differentiate can not be related to lack of endogenous ligand formation . in contrast to the reduced apparent number of preadipocytes , we found that the pool of potential precursor cells , identified through magnetic immune separation with the cd133 marker ( 26,27 ) , was positively correlated to bmi . this suggests that there is a specific problem for preadipocytes in abdominal subcutaneous adipose tissue to differentiate into normal adipocytes and / or for the commitment of progenitor cells to preadipocytes . this is a very intriguing finding that could explain why there is differential lipid partitioning and also why abdominal obesity is closely linked to insulin resistance and the accumulation of ectopic fat in the liver and expanded fat depots in the epicardial and visceral depots ( rev . in ( 35 ) . our results also suggest that this inability is not attributable to the inhibitory effect of tnf - per se on differentiation because we found that this effect is rapidly reversible and dependent on the continuous presence of tnf - secreted by the macrophages . however , it may well be that chronically elevated tnf - levels ( or other unknown molecules ) in the adipose tissue in obesity can , for instance , via map4k4 and / or wnt signal activation , lead to a complete transdifferentiation or dedifferentiation of the preadipocytes to another phenotype , including inflammatory cells . interestingly , we found that cultured preadipocytes from obese individuals had higher expression of map4k4 , a kinase induced by tnf - that inhibits the induction of ppar - as well as adipogenesis ( 24,25 ) . it is indeed intriguing that preadipocytes from obese individuals maintain elevated map4k4 expression , despite the long culture period . interestingly , map4k4 expression in freshly isolated adipose cells was also positively related to bmi as well as the waist - to - hip ratio a well - known marker of the metabolic abnormalities associated with obesity ( 57 ) . thus , this seems to be an intrinsic effect in adipose tissue in obesity and involves both preadipocytes and mature adipose cells . the enlarged adipose cells in obesity become dysregulated ( 14,16 ) with reduced expression of many ppar - regulated genes , including glut4 and adiponectin . instead , inflammatory genes are increased . this dysregulated state may be a consequence of reduced ppar - activation , including the transrepression of proinflammatory genes . we do not currently understand the molecular mechanisms for this apparent partial loss of ppar - activation , but ongoing studies where map4k4 is knocked down in human preadipocytes may shed new light on these intriguing findings . an additional possibility that needs to be considered is that there is a slow , continuous turnover of adipose cells ( 10 % per year ) ( 12 ) and that this depletes the number of available preadipocytes in the adipose tissue in obesity . however , this would seem to be particularly important for obesity characterized by hyperplastic adipose tissue , and this is usually not associated with abdominal adipose cell enlargement , insulin resistance , and inflammation . we have previously described in 3t3 - l1 preadipocytes that tnf - completely prevents the normal differentiation and that it is associated with an activation of wnt 10b and the wnt signaling cascade ( 18,36 ) . similar to the current study , we did not find any effect of resistin or mcp - 1 on wnt signaling in 3t3 - l1 cells ( 36 ) , and thus this seems to be specific for tnf - . a direct activation of the tcf / lef ( t - cell specific transcription factor / lymphoid - enhancer binding factor ) nuclear receptor by tnf - has also recently been reported ( 28 ) . thus , tnf - maintains preadipocytes in an undifferentiated state while , concomitantly , it is able to drive the cells toward a macrophage - like phenotype . intriguingly , we found that tnf - induced the expression and secretion of molecules that were not expressed or secreted by the preadipocytes , such as gm - csf and il - 1 . in addition , the cells assumed a marked proinflammatory phenotype with the induction of both markers ( saa and icam ) and effectors ( il - 6 , mcp - 1 , and il - 8 ) of inflammation . overall , the cells became highly macrophage - like , with the exception of phagocytotic capacity , expression of the scavenger receptor , or secretion of tnf - itself . thus , the partially transformed and proinflammatory preadipocytes would seem to be an important source for maintaining , and enhancing , inflammation both in the adipose tissue in obesity as well as systemically because many of the secreted molecules are released to the bloodstream ( saa , icam , il - 6 , il - 8 , and mcp - 1 ) . furthermore , the undifferentiated preadipocytes / macrophage - like cells started to induce and secrete gm - csf . thus , infiltrating macrophages can both drive inflammation in the adipose tissue / preadipocytes and also induce a milieu whereby bound monocytes will undergo differentiation to macrophages in the tissue . to evaluate the potential quantitative importance of the undifferentiated human preadipocytes for mcp - 1 secretion by the adipose tissue , we compared our results with those reported in the literature . ( 11 ) to 23 ng / g tissue h or 23 ng / 10 cellsh , assuming an average cell size of 0.8 g / cell . in the current study , the secretion of mcp - 1 by preadipocytes cultured in the presence of tnf - was 200 ng / 2.510 cells 48 h or 17 ng / 10 cells h. thus , activated preadipocytes may indeed be the major source of mcp - 1 secretion by adipose tissue . again , using the results reported by dahlman et al . ( 11 ) , it is clear that mature adipose cells only account for 25 % of the mcp - 1 produced by adipose tissue . published data ( 29,30 ) for il - 6 and -8 secretion by adipose tissue also lead to the conclusion that undifferentiated preadipocytes can be the major source of secretion of these cytokines . in conclusion , these findings underscore the importance of partially transdifferentiated preadipocytes as generators of inflammation in obesity . these effects appear to be specific to tnf - ; at least they are not shared by il - 6 , mcp - 1 , or resistin . furthermore , obesity with subcutaneous abdominal adipose cell enlargement is characterized by a reduced number of preadipocytes that can undergo differentiation . understanding the mechanisms for this and the cross - talk between tnf - and wnt signaling is a priority because it may open up new possibilities to treat obesity with regards to inflammation , preadipocyte recruitment , and insulin sensitivity .\noutput:\n" }, { "from": "agent", "value": "objectivewe examined preadipocyte differentiation in obese and nonobese individuals and the effect of cytokines and wingless - type mmtv ( mouse mammary tumor virus ) integration site family , member 3a ( wnt3a ) protein on preadipocyte differentiation and phenotype.research design and methodsabdominal subcutaneous adipose tissue biopsies were obtained from a total of 51 donors with varying bmi . after isolation of the adipose and stromalvascular cells , inflammatory cells ( cd14 - and cd45 - positive cells ) were removed by immune magnetic separation . cd133 - positive cells , containing early progenitor cells , were also isolated and quantified . the cd14 - and cd45 - negative preadipocytes were cultured with tumor necrosis factor ( tnf ) - , interleukin ( il ) - 6 , resistin , or wnt3a with or without a differentiation cocktail.resultsthe number of preadipocytes able to differentiate to adipose cells was negatively correlated with both bmi and adipocyte cell size of the donors , whereas the number of cd133 - positive cells was positively correlated with bmi , suggesting an impaired differentiation of preadipocytes in obesity . cultured preadipocytes , like freshly isolated mature adipocytes , from obese individuals had an increased expression of mitogen - activated protein 4 kinase 4 ( map4k4 ) , which is known to inhibit peroxisome proliferator activated receptor - induction . tnf - , but not il - 6 or resistin , increased wnt10b , completely inhibited the normal differentiation of the preadipocytes , and instead induced a proinflammatory and macrophage - like phenotype of the cells.conclusionsthe apparent number of preadipocytes in the abdominal subcutaneous tissue that can undergo differentiation is reduced in obesity with enlarged fat cells , possibly because of increased map4k4 levels . tnf - promoted a macrophage - like phenotype of the preadipocytes , including several macrophage markers . these results document the plasticity of human preadipocytes and the inverse relationship between lipid storage and proinflammatory capacity ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the high prevalence of alcohol use disorders ( aud , i.e. alcohol abuse or dependence ) among patients with schizophrenia is now well established : in the koskinen et al. meta - analysis of 60 studies , the median current rate of aud was 9.4 % and median of lifetime aud prevalence 20.6 % ( koskinen et al . , 2009 ) . the high comorbidity of aud and schizophrenia may be related to male gender , younger persons ( cantor - graae et al . , 2001 ) , availability of drugs ( dixon , 1999 ) , increased vulnerability to the effects of alcohol in patients with schizophrenia ( d'souza et al . , 2006 ; krystal et al . , 2006 ) , or neurobiological factors ( chambers et al . , 2001 ) . the high prevalence of substance abuse in patients with schizophrenia has sometimes been interpreted as self - medication for negative symptoms , anhedonia , depression or neuroleptic side effects , but no convincing evidence supports this idea ( mueser et al . , 1998 ; d'souza et al . ,2006 ) . in non - schizophrenic subjects , high levels of impulsivity ( evenden , 1999 ; moeller et al . , 2001 ; de wit , 2009 ; dick et al. , 2010 ) and sensation seeking ( crawford et al . , 2003 ; dom et al . , 2006a , b ) have been found to be associated with aud , but this has been little studied in patients with schizophrenia . we previously found that high levels of impulsivity and sensation seeking , particularly regarding the disinhibition dimension , were associated with substance abuse in patients with schizophrenia ( dervaux et al . however , this was not specifically studied with regard to the different substances of abuse .1990 ) stressed the need to assess the abuse of specific classes of substances and analyze the data accordingly . liraud and verdoux ( 2000 ) found that a lifetime history of alcohol misuse was independently associated with higher total scores on the sensation seeking scale ( sss ) , on the experience - seeking and disinhibition sub - scores of the sss and on the motor impulsivity subscale of the barratt impulsivity scale ( bis ) in subjects with psychotic and mood disorders . however , their study included a limited number of patients with schizophrenia ( n = 24 ) and other non - affective psychotic disorders , delusional disorder , psychotic disorders ( n = 21 ) , and included few schizophrenia patients who engaged in alcohol abuse ; they were not analyzed separately ( liraud and verdoux , 2000 ) . to our knowledge , no study has assessed impulsivity and sensation seeking specifically in patients with schizophrenia and aud . our objective was to compare impulsivity , sensation seeking , and anhedonia in a sample of schizophrenia patients with and without lifetime alcohol abuse or dependence . all consecutive patients over 18 years with dsm - iii - r criteria for schizophrenia or schizoaffective disorder treated in a psychiatric department in south suburbs of paris during 2 years , were enrolled in the study . inclusion criteria for participation in the study were age 18 years or older and willingness to provide consent to participate in the study . the method is described elsewhere ( dervaux et al . , 2006 ) . briefly , all subjects were assessed by a senior psychiatrist ( alain dervaux ) using the composite international diagnostic interview ( cidi ) for dsm - iii - r diagnoses of abuse or dependence on alcohol , cannabis , amphetamines , sedatives , opioids , cocaine , hallucinogens , phencyclidine , and inhalants ( robins et al . , 1988 ) . current psychotic symptomatology was assessed using the positive and negative syndrome scale ( panss ) ( kay et al . , 1987 ) . impulsivity was assessed using the bis 10 ( patton et al . , 1995 ) , a 34 - item self - report ( scores from 0 to 136 ) . the bis includes three component subscales found in the french translation ( bayl et al . , 2000 ) : ( 1 ) motor impulsivity ( 2 ) cognitive impulsivity ( 3 ) non - planning . sensation seeking was assessed using the sss form v by zuckerman ( sss , zuckerman , 1978 ) , a 40 - item self - report ( scores from 0 to 40 ) . the sss includes four components found in the french translation ( carton et al . ,1990 ) : ( 1 ) disinhibition ( 2 ) thrill and adventure seeking ( 3 ) experience seeking ( 4 ) boredom susceptibility . anhedonia was assessed using the chapman physical anhedonia scale ( pas , chapman et al . , 1976 ) , a 61 - item self - report ( scores from 0 to 61 ) . the data obtained during the interview were supplemented by information from relatives , clinicians , and medical records . the study was approved by the local ethical committee and all subjects provided their informed consent . impulsivity , sensation seeking and anhedonia were compared in a group of schizophrenia patients with lifetime alcohol abuse or dependence , and in a group without lifetime aud . the quantitative variables were studied using analyses of covariance ( ancova ) adjusted on the basis of age and gender , since these variables could be confounding factors . all the tests were two - tailed , with alpha - risk set at 0.05 . one hundred and fifteen patients with schizophrenia ( n = 106 ) or schizoaffective disorder ( n = 9 ) according to dsm - iii - r criteria were included in the study . since 15 patients with cannabis , stimulant , sedative , or opiate abuse or dependencewere excluded , the study finally included 100 subjects including a first group of schizophrenia patients with lifetime aud ( n = 34 , alcohol abuse : n = 4 ; alcohol dependence : n = 30 ) and a second group without any lifetime psychoactive substance abuse ( n = 66 ) . twenty - four ( 20.9 % ) patients presented aud within the 6 months prior to the assessment . among patients with aud ,85.3 % were male ( n = 29 ) compared to 62.1 % in the other group ( n = 41 ) ( = 5.73 , df = 1 , p = 0.02 ) . the patients with aud had a higher mean number of hospitalizations ( mean = 7.3 , sd = 10.6 vs mean = 4.4 , sd = 4.3 , ancova f = 5.39 , df = 1.96 p = 0.02 ) . there were no significant differences between the two groups for age ( patients with aud : mean age = 34.1 years , sd = 7.7 , patients without substance abuse : mean age = 37.0 , sd = 12.7 , anova f = 1.95 , df = 1.98 p = 0.16 ) , marital status ( never married : patients with aud : 73.5 % , subjects without substance abuse : 68.2 % of the subjects , = 0.31 , df = 1 , p = 0.58 ) , level of education ( completed high school : patients with aud : 40.0 % , patients without substance abuse : 49.2 % , = 0.70 , df = 1 , p = 0.40 ) , mean age of first psychiatric treatment ( patients with aud : mean = 23.7 years sd = 5.7 % , patients without substance abuse : mean = 25.2 , sd = 8.3 , ancova f = 0.08 , df = 1.97 p = 0.77 ) , mean scores on the panss ( patients with aud : mean = 79.6 , sd = 10.2 % , patients without substance abuse : mean = 79.7 , sd = 14.4 , ancova f = 0.03 , df = 1.97 p = 0.86 ) . the mean total scores for bis and sss were higher in the group with aud compared to the group with cannabis use without aud ( table 1 ) . all mean scores on the bis and sss subscales were higher in the group with aud than in the group without aud , except the sss experience - seeking subscale ( table 1 ) . in contrast , there was no significant difference between the two groups for physical anhedonia scale mean score ( table 1 ) . impulsivity and sensation seeking score ratings in schizophrenia patients with lifetime aud ( alcohol abuse or dependence ) or without substance abuse . among patients with aud , 85.3 % were male ( n = 29 ) compared to 62.1 % in the other group ( n = 41 ) ( = 5.73 , df = 1 , p = 0.02 ) . the patients with aud had a higher mean number of hospitalizations ( mean = 7.3 , sd = 10.6 vs mean = 4.4 , sd = 4.3 , ancova f = 5.39 , df = 1.96 p = 0.02 ) . there were no significant differences between the two groups for age ( patients with aud : mean age = 34.1 years , sd = 7.7 , patients without substance abuse : mean age = 37.0 , sd = 12.7 , anova f = 1.95 , df = 1.98 p = 0.16 ) , marital status ( never married : patients with aud : 73.5 % , subjects without substance abuse : 68.2 % of the subjects , = 0.31 , df = 1 , p = 0.58 ) , level of education ( completed high school : patients with aud : 40.0 % , patients without substance abuse : 49.2 % , = 0.70 , df = 1 , p = 0.40 ) , mean age of first psychiatric treatment ( patients with aud : mean = 23.7 years sd = 5.7 % , patients without substance abuse : mean = 25.2 , sd = 8.3 , ancova f = 0.08 , df = 1.97 p = 0.77 ) , mean scores on the panss ( patients with aud : mean = 79.6 , sd = 10.2 % , patients without substance abuse : mean = 79.7 , sd = 14.4 , ancova f = 0.03 , df = 1.97 p = 0.86 ) . the mean total scores for bis and sss were higher in the group with aud compared to the group with cannabis use without aud ( table 1 ) . all mean scores on the bis and sss subscales were higher in the group with aud than in the group without aud , except the sss experience - seeking subscale ( table 1 ) . in contrast , there was no significant difference between the two groups for physical anhedonia scale mean score ( table 1 ) . impulsivity and sensation seeking score ratings in schizophrenia patients with lifetime aud ( alcohol abuse or dependence ) or without substance abuse . our results indicate that in a group of patients with schizophrenia , mean scores on the bis and sss are higher in patients with lifetime aud ( alcohol abuse or dependence ) than in patients without aud . the results of the present study are consistent with those of our previous studies assessing impulsivity and sensation seeking in two independent samples of schizophrenia patients with substance abuse disorders , including alcohol , cannabis , opiates , and cocaine use disorders ( dervaux et al . , 2001 ; gut - fayand et al . ,2001 ) and with previous studies in alcohol or drug abusing patients with severe mental illness , including affective disorders ( liraud and verdoux , 2000 ; bizzarri et al . , 2009 ) . our results are also consistent with studies which found higher impulsivity and sensation seeking scores in non - schizophrenic patients with aud ( dick et al . , 2010 ) or other drug use disorders ( pedersen , 1991 ; luthar et al . , 1992 ; kosten et al . , 1994 ; scourfield et al . , 1996 ) , compared to subjects without substance use disorders . since the present study was cross - sectional , it is not possible to determine the causal relationship between impulsivity or sensation seeking and aud . the developmental studies referred to earlier suggest that impulsive tendencies lead to alcohol use ( dom et al . , 2006b ) . moreover , in our previous study in schizophrenia patients , we found higher bis scores in the past substance abuse or dependence sub - group , suggesting that impulsivity is not induced by alcohol or drugs . nevertheless , we can not exclude impulsivity or sensation seeking reflecting the behavioral consequences of alcohol use ( lawrence et al . , 2009 ) . a prospective longitudinal follow - up of a cohort of young subjects , studying the occurrence of impulsivity , sensation seeking , substance abuse , and / or schizophrenia , would be more reliable but hardly feasible . as suggested by liraud and verdoux ( 2000 ) , impulsivity or sensation seeking may favor substance use disorders in a non - specific way . these personality dimensions are linked to substance abuse in several psychiatric disorders ( moeller et al . , 2001 ) . for instance , bis scores were also found to be increased in patients with bipolar disorder and substance abuse ( swann et al . , 2004 ) . in line with previous studies , the absence of any link between physical anhedonia scores and cannabis use or aud does not support the self - medication hypothesis of alcohol abuse in schizophrenia ( mueser et al . first , the patients included are not necessarily representative of all patients with schizophrenia , although the exhaustive recruitment limits the selection bias . secondly , as in any retrospective study , the prevalence of lifetime alcohol abuse may have been under - estimated . however , certain authors have stressed that structured interviews are more sensitive for the diagnosis of lifetime substance abuse in patients with schizophrenia than toxicology tests ( albanese et al . , 1994 ) . ( 2006 ) found that self - reports of substance use showed good reliability with drug screens in a subsample of a cohort of patients with recent - onset psychosis ( cohen 's kappa = 0.90 ) . finally , the limited size of this sub - group does not permit a definitive conclusion to be reached . increased impulsivity or sensation seeking may be a link between schizophrenia and alcohol abuse or dependence . however , the role of impulsivity or sensation seeking may not be specific to aud . further studies will be needed to fully understand the relationship , particularly the addition of risk factors , between alcohol abuse or dependence and schizophrenia . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "objective : some studies have found that high levels of impulsivity and sensation seeking , particularly disinhibition are associated with substance abuse in patients with schizophrenia , as in the general population . however , no study has assessed impulsivity and sensation seeking specifically in schizophrenia patients with alcohol abuse or dependence . materials and methods : we compared impulsivity and sensation seeking in a group of schizophrenia patients ( dsm - iii - r criteria ) with lifetime alcohol abuse or dependence ( n = 34 ) and in a group without lifetime substance abuse or dependence ( n = 66 ) . the patients were assessed using the composite international diagnostic interview ( cidi ) for dsm - iii - r disorders , the positive and negative syndrome scale ( panss ) , the barratt impulsivity scale ( bis ) , the zuckerman seeking sensation scale ( sss ) , and the physical anhedonia scale ( pas ) . results : the mean scores for impulsivity and sensation seeking were higher in the group with lifetime alcohol abuse or dependence than in the group without substance abuse or dependence ( bis : 63.4 18.7 vs 51.3 14.2 respectively , anova : f = 11.12 , p = 0.001 ; sss : 17.6 5.9 vs 13.5 6.7 respectively , anova : f = 7.45 , p = 0.008 ) . there was no significant difference between the two groups on pas score . conclusion : increased impulsivity or sensation seeking may be a link between schizophrenia and alcohol abuse or dependence ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: its most serious acute metabolic complications include the two hyperglycemic emergencies ; diabetic ketoacidosis ( dka ) and hyperosmolar hyperglycemic state . dka is a frequently encountered hospital emergency and is associated with significant morbidity and mortality . according to the american diabetes association , dka mortality outcome has been reported to be 5 % in treatment - experienced centers of america , europe , and asia . in africa , mortality from hyperglycemic emergencies is not well documented but comparatively high in published studies . there are a number of factors that have been found useful in predicting the outcome of dka in different clinical setups worldwide . for instance , mortality as a major adverse outcome has been associated with a number of factors such as diabetic foot , advanced age , sepsis , hypertension , and hypokalemia . describing the clinical characteristics and outcome predictors in dka patientsis useful in guiding clinicians to manage some poor prognostic indicators more aggressively to improve outcome . the aims of this study were to establish the clinical characteristics of dm patients that were admitted with dka , to describe the predictors of clinical outcomes , and to ascertain the prognostic value of coma . this study was conducted at the medicine department of the university teaching hospital ( uth ) in lusaka , zambia . uth is zambia 's national referral hospital , which also acts as a teaching hospital for the university of zambia school of medicine and several nursing colleges in zambia . this was an analytical cross - sectional study that was conducted from october 2013 to july 2014 . consenting dka patients who were 16 - year - old and above were recruited and followed up throughout their hospital stay . comatose patients were only enrolled if their next of kin consented to participation in the study . dka was diagnosed when the patient had an admission random blood glucose of 13.9 mmol / l , ketonuria of 2 + or more on urine dipstick , with evidence of acidosis demonstrated by 1 or more of the following ; ph 7.3 , hco3 18 meq / l , and a high anion gap ( 12 ) . the operational definition of coma was an admission glasgow coma scale ( gcs ) of between 3 and 8 . exclusion criteria were recent alcohol binge in the last 36 h ( males 10 units in 2 h , females 8 units in 2 h ) , history of poisoning with salicylate , ethylene glycol , paraldehyde , methanol , isopropanol or propylene glycol , and pregnancy . a full history was taken by either the attending physician or the researcher in patients who met the diagnostic criteria . a physical examination was then done on the recruited participants and included blood pressure , heart rate , respiratory rate and type , urinalysis and determination of ketonuria , and temperature . in addition , a vigorous effort to identify possible infection sources and sites was undertaken . the researchers had to verify the accuracy of the history and physical examination findings before recruitment into the study if they were done and recorded by a non - member of the study team . about 4 ml of blood was drawn from each patient to measure glucose , ph , sodium , potassium , chloride , and bicarbonate levels in the laboratory . each participant was followed up until the end of hospitalization ( defined either as death of a patient or discharged alive ) . data were collected on a hard copy using a structured data collection sheet and later stored and analyzed in statistical package for social sciences version 20 ( ibm corp . all baseline biochemical and clinical variables were analyzed to identify variables that potentially had a significant association with primary outcome ( mortality ) . all variables with a p 0.20 were further subjected to binary logistic regression using backward wald algorithm to determine adjusted odds ratios and independent predictors of mortality . their ages ranged from 16 to 85 - year - old , and the mean age of the patients was 43.73 ( standard deviation 15.61 ) years . the most common identifiable risk factor for development of dka was nonadherence to prescribed anti - diabetic treatments ( 42.5 % ) . of the 58 patients who were previously diagnosed with diabetes , only 32.8 % reported strict adherence to their treatments . the infections associated with the development of dka in decreasing order of magnitude were urinary tract infection , pneumonia , diabetic foot and other infected wound and upper respiratory tract infections . of the 10 study subjects with infected wounds , diabetic foot was the most common ( 70 % ) while the remainder had decubitus ulcers ( 30 % ) . comorbidities included hypertension ( 36.25 % ) , tuberculosis ( 2.5 % ) , prostate cancer ( 1.25 % ) , and hiv infection ( 15 % ) . the median gcs for comatose patients was 7 while that of their noncomatose counterparts was 15 . comatose patients were younger ( 30.0 vs. 42.5 years , p = 0.005 ) and had lower baseline blood pressure readings than their counterparts . they also had a higher respiratory rate and blood glucose levels at baseline . as expected , the comatose patients also had higher median blood sodium levels . there was no statistically significant difference in hospital length of stay between the two groups [ table 1 ] . bio - demographic baseline data of the participants clinico - laboratory derangements of dka there were statistically significant differences in the presence of both systolic and diastolic shock between comatose and noncomatose patients , with a larger proportion of comatose patients having a shock on admission . serum potassium , serum sodium , and serum chloride were also significantly higher in comatose patients compared to noncomatose patients [ table 2 ] . as shown in figure 1 , a number of complications were recorded in a quarter of the study participants . complications during hospitalization for diabetic ketoacidosis there were no obvious complications detected in 75 % of the patients . hypoglycemia accounted for 7.5 % of the complications reported during treatment and this was corrected with intravenous dextrose infusion and all affected were eventually discharged . ten percent developed acute renal failure while 1.25 % developed adult respiratory distress syndrome , 5 % had aspiration associated with comatose state , and a single participant ( 1.25 % ) had a seizure . table 3 shows that there were statistically significant associations between mortality outcome and each of the following variables ; altered mental status , pneumonia diagnosis at baseline , renal failure , cerebrovascular accident ( cva ) , and development of aspiration [ table 3 ] . risk factors of mortality all variables in table 3 with a p 0.20 were submitted to binary logistic regression using backward wald algorithm , and renal failure was found to be an independent predictor of mortality is presented in table 4 . there was a very wide confidence interval for the only independent predictor of mortality which suggests that this was very likely a pure chance finding . although , the study found an association between altered mental status and mortality outcome , coma as a feature at admission was neither predictive of nor associated with an increased risk of mortality . their ages ranged from 16 to 85 - year - old , and the mean age of the patients was 43.73 ( standard deviation 15.61 ) years . the most common identifiable risk factor for development of dka was nonadherence to prescribed anti - diabetic treatments ( 42.5 % ) . of the 58 patients who were previously diagnosed with diabetes , only 32.8 % reported strict adherence to their treatments . the infections associated with the development of dka in decreasing order of magnitude were urinary tract infection , pneumonia , diabetic foot and other infected wound and upper respiratory tract infections . of the 10 study subjects with infected wounds , diabetic foot was the most common ( 70 % ) while the remainder had decubitus ulcers ( 30 % ) . comorbidities included hypertension ( 36.25 % ) , tuberculosis ( 2.5 % ) , prostate cancer ( 1.25 % ) , and hiv infection ( 15 % ) . the median gcs for comatose patients was 7 while that of their noncomatose counterparts was 15 . comatose patients were younger ( 30.0 vs. 42.5 years , p = 0.005 ) and had lower baseline blood pressure readings than their counterparts . they also had a higher respiratory rate and blood glucose levels at baseline . as expected , the comatose patients also had higher median blood sodium levels . there was no statistically significant difference in hospital length of stay between the two groups [ table 1 ] . bio - demographic baseline data of the participants clinico - laboratory derangements of dka there were statistically significant differences in the presence of both systolic and diastolic shock between comatose and noncomatose patients , with a larger proportion of comatose patients having a shock on admission . serum potassium , serum sodium , and serum chloride were also significantly higher in comatose patients compared to noncomatose patients [ table 2 ] . as shown in figure 1 , a number of complications were recorded in a quarter of the study participants . complications during hospitalization for diabetic ketoacidosis there were no obvious complications detected in 75 % of the patients . hypoglycemia accounted for 7.5 % of the complications reported during treatment and this was corrected with intravenous dextrose infusion and all affected were eventually discharged . ten percent developed acute renal failure while 1.25 % developed adult respiratory distress syndrome , 5 % had aspiration associated with comatose state , and a single participant ( 1.25 % ) had a seizure . table 3 shows that there were statistically significant associations between mortality outcome and each of the following variables ; altered mental status , pneumonia diagnosis at baseline , renal failure , cerebrovascular accident ( cva ) , and development of aspiration [ table 3 ] . risk factors of mortality all variables in table 3 with a p 0.20 were submitted to binary logistic regression using backward wald algorithm , and renal failure was found to be an independent predictor of mortality is presented in table 4 . there was a very wide confidence interval for the only independent predictor of mortality which suggests that this was very likely a pure chance finding . although , the study found an association between altered mental status and mortality outcome , coma as a feature at admission was neither predictive of nor associated with an increased risk of mortality . the study showed that mortality outcome was high compared to statistics from advanced treatment centers in other parts of the world . although , altered sensorium was found to have a statistically significant association with mortality outcome , the study findings suggest that comatose state on admission did not necessarily increase the risk of mortality . development of renal failure during hospitalization was found to be an independent predictor of mortality outcome in this study . although , there was no statistically significant difference , the median age of those who died during hospitalization for dka was equally younger compared to those who were eventually discharged . this contrasts findings in other studies in both advanced and resource challenged settings including sweden , nigeria , and libya where mortality outcomes were higher in patients older than 65 years . several other studies have shown that advanced age is associated with poorer outcomes of dka . a possible explanation is that younger patients in the study may have had severe insulin deficiency and hence suffered more adverse outcome compared to their older counterparts who may have had relatively higher insulin reserves with preserved beta cell function associated with type 2 diabetes . in addition , older patients may have chronically been on some form of diabetes treatment compared to younger patients who may have been more recently diagnosed and presenting with increased morbidity and mortality risk . in the face of the severe insulin deficiency that afflicts the generally younger patients with type 1 diabetes , the younger population may have also succumbed more to adverse outcome as there were insulin administration interruptions that affected most of the patients due to frequent stock - outs of essential monitoring tools and manpower shortages . older patients who were more likely to have had type 2 dm may have been able to tolerate insulin dose omissions better as long as they were getting some rehydration . in addition , according to welch and zib in 2004 , development of dka is rare in type 2 diabetes compared to type 1 which afflicts younger patients mostly . the higher prevalence of dka in younger patients statistically increases their risk of mortality from dka . the factors which were associated with development of dka in this study were treatment noncompliance , infection , and new onset diabetes . the leading precipitant of dka was identified as nonadherence to prescribed anti - diabetic drugs . majority of the 58 participants who were already diagnosed ( 93.1 % ) had been on anti - diabetic medications . two of these participants reported having been exclusively on lifestyle modification strategies as advised at their primary health care clinics . they , however , recovered without complications and were later discharged from in - hospital treatment . compliance was poor in more than half ( 58.6 % ) of the previously known diabetics but there was no significant difference between the comatose and noncomatose groups . this situation may be as a result of a weak primary health care establishment and lack of basic health information . nearly a third of the participants ( 27.5 % ) were previously unaware of their diabetes , and this was the second leading risk factor identified in the study . the third highest identified risk factor for development of dka was infection at 22.5 % while 7.5 % of the participants did not have an obviously identifiable precipitant . the predominant identifiable infections in decreasing order of magnitude were urinary tract infections , pneumonia , infected wounds , and upper respiratory tract infections . forty percent of the study participants had preexisting hypertension , and the prevalence was similar in the comatose and noncomatose groups . this was a rather high prevalence when the median ages are considered ( 30.0 vs. 42.5 years for comatose and noncomatose groups respectively ) but the study did not investigate for possible secondary causes especially in patients younger than 40 as that was beyond the scope of the study . in addition , two subjects ( of 10 ) who were older than 65 years had ischemic cvas over 3 weeks prior to admission and this was confirmed on the brain computed axial tomography ( cat ) scan . there may have been overlap of the symptoms , signs , and laboratory profiles with dka , but this could not be certainly established . as described by jovanovic et al . , cva may have actually led to the development of dka , although , the patients had this complication for a relatively long duration . two patients were on consolidation phase of anti - tuberculosis therapy , and both reported marked recovery from their pulmonary tuberculosis symptoms at the time of admission with dka . the total prevalence of hiv infection was 15 % , and this is lower than the reported district prevalence of 20.8 % as published by central statistics office . furthermore , there was no statistically significant difference between the coma groups ( comatose 20 % vs. noncomatose 14.3 % [ p = 0.851 ] ) . three patients declined the test while the remaining five were affected with either test reagents stock outs or nonresponse from trained hiv counselors to test the patients before hospital discharge . as expected , comatose patients were noted to have significantly worse clinical and biochemical profiles than noncomatose patients at baseline . comatose patients had lower baseline blood pressures , higher prevalence of systolic shock , and higher respiratory rates at baseline . comatose participants also had a higher prevalence of hypokalemia , hypernatremia , and hyperchloremia than their noncomatose counterparts . in a similar study by otieno et al . , altered consciousness was associated with systolic hypotension and severe metabolic acidosis . for instance , a low prevalence was described in a study done in a multicenter retrospective cross - sectional study at emergency departments in the united states with a sample size of 155,000 adults diagnosed with dka . a nigerian study by ogbera et al . reported a much higher prevalence ( 35 % ) than our findings . the common complication encountered was acute renal failure followed by hypoglycemia , aspiration , seizures , and adult respiratory distress syndrome . renal failure may have been due to prolonged prerenal volume contraction from late hospital presentation and inadequate intravenous fluid infusion . it was also noted that there were delays in infusing prescribed intravenous fluids upon admission that affected 78.7 % of all the participants . aspiration while in hospital was found in 66.7 % of those who eventually died during hospitalization . all affected patients had altered mental status . some measures such as head elevation and nasogastric tube insertion which may have helped to prevent aspiration were not readily available for deserving patients at all times . the patient had not been stable enough to be transported for a brain cat scan as the machine was located far from the admission area . the imaging would have helped in assessing for cerebral edema , a rare complication of dka in adults which is associated with a mortality of 2040 % . although this patient had severe metabolic acidosis with a ph of 6.90 and severe pneumonia , etiology of the seizures was not fully investigated , and consent for postmortem was declined by the family . the mortality rate was high at 7.5 % compared to that reported in advanced treatment centers ( 5 % ) by american diabetes association . it was however noted to be lower than the observations made in earlier african studies in kenya ( 29.8 % ) , democratic republic of congo ( 27.5 % ) , south africa ( 11.9 % ) and libya ( 14.4 % and 11.9 % ) . there were gaps in monitoring and management that may have contributed to this high mortality rate . most of our patients had limited access to optimum care prescribed on admission and beyond . there was erratic administration of prescribed insulin and fluid replacements in about 78.7 % of subjects enrolled into the study . this was particularly observed at the beginning of the study when the nursing staffing had declined as a result of an industrial strike action . regular monitoring was hampered by frequent stockouts of basic equipment such as point - of - care blood glucose monitoring kits , urinalysis strips , laboratory biochemistry reagents , and appropriate intravenous fluids at times . currently , there is no point - of - care blood gas analyzer readily available to the department for regular monitoring to allow timely interventions . risk factors associated with mortality outcomes included admission with pneumonia , development of aspiration , development of renal failure , and altered mental status . although , there was no statistically significant difference , these patients who died had a higher prevalence of hypernatremia , hypokalemia , high baseline blood glucose levels 30in a similar study done in kenya , mortality was high , and all patients who died had altered mental status on admission . in our study , the total prevalence of altered mental status on admission was 51.3 % , and the mortality prevalence among the patients with altered mental status was 14.3 % . development of renal failure was found to be the only independent predictor of mortality . due to the small number of subjects with this primary outcomewe , therefore , propose that a larger prospective study with active investigation for complications and full daily laboratory assessment to study the disease course during dka admission should be done in future . aspiration , development of renal failure , altered sensorium , cvas , and pneumonia at baseline are associated with an increased risk of mortality . there is a need to sensitize dm patients to take their medications regularly , return for follow - up as required by their clinicians , and seek medical attention when they notice any diabetic complications and possible signs of infection . there is also a need for regular primary health care screening so as to avoid acute presentations such as dka . this work is an output from a project funded by the welcome trust through southern africa consortium for research excellence for capacity building for the benefit of developing countries . this work is an output from a project funded by the welcome trust through southern africa consortium for research excellence for capacity building for the benefit of developing countries .\noutput:\n" }, { "from": "agent", "value": "background : diabetic ketoacidosis ( dka ) is one of the commonly encountered diabetes mellitus emergencies.aim : this study aimed at describing the clinical profiles and hospitalization outcomes of dka patients at the university teaching hospital ( uth ) in lusaka , zambia and to investigate the role of coma on mortality outcome.materials and methods : this was a cross - sectional analytical study of hospitalized dka patients at uth . the data collected included clinical presentation , precipitating factors , laboratory profiles , complications , and hospitalization outcomes . primary outcome measured was all - cause in - hospital mortality.results : the median age was 40 years . treatment noncompliance was the single highest identified risk factor for development of dka , followed by new detection of diabetes , then infections . comatose patients were significantly younger , had lower baseline blood pressure readings , and higher baseline respiratory rates compared to noncomatose patients . in addition , comatose patients had higher baseline admission random blood glucose readings . their baseline sodium and chloride levels were also higher . the prevalences of hypokalemia , hypernatremia , and hyperchloremia were also higher among comatose patients compared to noncomatose patients . development of aspiration during admission with dka , pneumonia at baseline , development of renal failure , and altered mental status were associated with an increased risk of mortality . development of renal failure was independently predictive of mortality.conclusion : the mortality rate from dka hospitalizations is high at uth . treatment noncompliance is the single highest identifiable precipitant of dka . aspiration , development of renal failure , altered sensorium , and pneumonia at baseline are associated with an increased risk of mortality . development of renal failure during admission is predictive of mortality ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: metabolic and electrolyte abnormalities , including hypokalemia , hyperglycemia and lactic acidosis , are associated with theophylline overdose . we herein report the first case , to our knowledge , of sinus tachycardia , lactic acidosis , hypokalemia and hyperglycemia associated with the usual theophylline dose in a patient with asthma . two days before , she was diagnosed with mild persistent asthma for the first time in our allergy clinic . at that time , biochemistry results were sodium 138 meq / l , potassium 4.8 meq / l , chloride 108 meq / l and glucose 103 meq / l and an electrocardiogram ( ecg ) showed normal sinus rhythm at 80 beats / min . she did not have acute and chronic hepatic dysfunction , cardiac decompensation , cor pulmonale and febrile illness . she began to take asthma medications , including sustained - release theophylline ( 200 mg twice a day ) , pranlukast hydrate ( 112.5 mg twice a day ) , salmeterol xinafoate inhaler ( 25 mg twice a day ) and fluticasone propionate ( 250 mg twice a day ) . she took a total of three doses of the medication before her visit to the emergency room . two hours later , she inhaled 5 consecutive puffs of salbutamol , a short acting 2 - agonist , regarding the palpitation as one of asthma symptoms and the palpitation continued for 3 hr before presentation . on physical examination , she was awake and alert , although restless . blood pressure was 120/80 mmhg , pulse was regular at 126 beats / min , respirations were 20 / min and temperature was 36.7 c . forced vital capacity and forced expiratory volume in one second were 3.59 l ( 108 % of predicted value ) and 3.23 l ( 111 % ) , respectively . arterial blood gas analysis on room air revealed a mixed metabolic acidosis and respiratory alkalosis with a ph of 7.46 , pco2 of 19.3 mmhg , po2 of 96.7 mmhg and bicarbonate of 13.4 mmol / l and biochemistry results were sodium136 meq / l , chloride 99 meq / l , potassium 1.9 meq / l and glucose 204 mg / dl . serum theophylline concentration measured at 13 hr after admission was 8.64 mg / ml . intravenous administration of normal saline with potassium replacement was done . the rate of potassium infusion was 1.8 meq / hr and the potassium deficit was corrected rapidly after 5 hr . heart rates on ecg monitoring were gradually decreased and returned to normal at approximately 10 hr after admission . the abnormal bicarbonate , pco2 and serum lactate levels returned to near normal 5 days after admission . although the serum theophylline level was within therapeutic range , a possibility of theophylline - associated sinus tachycardia , lactic acidosis , hypokalemia and hyperglycemia was considered . because she was afraid of the possible symptoms , she refused a challenge test with theophylline . instead , after getting approval from the institutional review board and her informed consent , the same asthma medications as before , except theophylline , were given again at 6 days after admission . measurements for arterial blood gas , serum electrolytes and serum lactate at 5 days after the medications showed no abnormal findings . at two months after discharge , her asthma has been well controlled with regular medications , including pranlukast hydrate ( 112.5 mg twice a day ) , salmeterol xinafoate inhaler ( 25 mg twice a day ) and fluticasone propionate ( 250 mg twice a day ) , without adverse effects . in our case , it is most likely that theophylline was the culprit for our patient s sinus tachycardia , lactic acidosis , hypokalemia and hyperglycemia , in view of the time course of events and absence of occurrence of these metabolic abnormalities after taking the other asthma medications , except theophylline . possible concurrent drug ingestion contributing to the acidosis was excluded by the scrupulous history taking , although not demonstrated by negative toxicology screen . it is known that toxic ingestions of theophylline cause elevated blood levels of the catecholamines , epinephrine and norepinephrine . this may lead to lactic acidosis , as has been described in pheochromocytoma , hyperglycemia and hypokalemia . on the other hand , studies on normal volunteers given therapeutic doses of theophyllinehave shown concentration - related changes in plasma glucose , free fatty acids and insulin and increases in plasma catecholamines . it is possible that our patient s sinus tachycardia and metabolic abnormalities associated with the usual theophylline dose may be mediated in part by stimulation of the sympathetic nervous system . also , the short acting 2 - agonist , misused for palpitation control in our case , may aggravate the abnormalities . unfortunately , the serum theophylline concentration was measured at an inappropriate time because we did not expect the theophylline - associated tachycardia and metabolic disturbances . it is likely that the serum theophylline level was beyond the therapeutic range , although our patient took the usual dose of theophylline . on the other hand , a possibility of theophylline drug intolerance might be considered if the earlier measurement showed that the serum theophylline level was within therapeutic range . this unusual case suggests that a possibility of theophylline - associated metabolic abnormalities be considered when an asthmatic patient , given the usual dose of theophylline , presents with lactic acidosis , hypokalemia and hyperglycemia of unknown etiology .\noutput:\n" }, { "from": "agent", "value": "metabolic and electrolyte abnormalities , including hypokalemia , hyperglycemia and lactic acidosis , are associated with theophylline overdose . however , we report an unusual case of sinus tachycardia , lactic acidosis , hypokalemia and hyperglycemia associated with the usual theophylline dose in a patient with asthma . the theophylline dose was 200 mg orally twice daily . three hours after administration of the third dose , the patient experienced palpitation . an electrocardiogram showed a sinus tachycardia . arterial blood gas analysis revealed a mixed metabolic acidosis and respiratory alkalosis . serum lactate level was 51 mmol / l ( normal 0.72.1 mmol / l ) . biochemistry results were sodium 136 m eq / l , chloride 99 m eq / l , potassium 1.9 m eq / l and glucose 204 mg / dl . our case suggests that a possibility of theophylline - associated metabolic abnormalities should be considered when an asthmatic patient given the usual theophylline dose presents with lactic acidosis , hypokalemia and hyperglycemia of unknown etiology ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: squamous metaplasia of the stomach is a relatively unusual clinical condition that has been occasionally described . it can occur during healing of inflammatory conditions ,1 tuberculosis ,2 or even with an aberrant pancreatic tissue .3 so far , only several cases have been reported referring the endoscopic findings of gastric squamous metaplasia .4,5 and in all cases , the metaplastic lesions were observed as pale area that had a look of esophageal mucosa . herein we report a case of gastric squamous metaplasia which was found incidentally on surveillance endoscopy after endoscopic treatment for gastric adenoma . a 79 - year - old man had undergone an endoscopic submucosal dissection for a gastric adenoma with low grade dysplasia 3 years ago . however , at the third visit , a conventional endoscopy revealed a whitish flat lesion in the lesser curvature of cardiac region of the stomach ( fig .1 ) , the lesion which was away from the scar area which occurred after the endoscopic resection of the adenoma . in addition , the whitish lesion was distinctly away from the normal esophageal mucosa , but its appearance looked like normal esophageal mucosa . therefore , chromoendoscopy using lugol 's iodine solution was performed to make sure whether the lesion was squamous mucosa or not . when lugol 's iodine solution was applied , the lesion was stained brown in the same way as normal esophageal mucosa ( fig . normal gastric columnar epithelium generally appears pink and normal esophageal squamous epithelium appears white on endoscopy . therefore , if the squamous metaplasia was present in the stomach , it would appear as a whitish lesion . in addition , after spraying lugol 's iodine solution , the lesion would be stained brown like normal esophageal mucosa . actually in a previous report ,4 the squamous metaplasia appeared as a whitish patch in the lesser curvature of the cardiac region of the stomach and it was stained positively with lugol 's iodine solution as our present case . squamous cell metaplasia may affect the lesser curvature of the stomach preferentially , if it does not spread into the entire stomach .5 therefore , squamous metaplasia should be included as differential diagnosis when a whitish lesion of irregular shape is seen in the cardia during endoscopic examination . lugol 's iodine staining interacts with carbohydrate containing structures inside the cell and color of the mucosa changes changes into brown color . lugol 's iodine spraying causes dark brown staining of nonkeratinized squamous epithelium , while decrease or absence of dye uptake is seen in conditions , such as esophagitis , squamous cell dysplasia , or carcinoma , which result from depletion of glycogen in squamous cells .6 therefore , the practical use of this staining is to detect abnormal squamous mucosa including high grade dysplasia and early squamous cell carcinoma of the esophagus .7 on the contrary , this staining can be adopted to detect squamous epithelium in the gastrointestinal tract . therefore , if the whitish lesion is observed during endoscopy , an iodide spraying would be helpful for the diagnosis of squamous metaplasia . the pathogenesis of squamous metaplasia in the stomach remains obscure .8 however , it has been thought that it is associated with chronic inflammation resulting from environmental stimuli . in our case , the pathogenesis of squamous metaplasia was uncertain , but we presumed that some inflammatory responses might have affected the metaplastic change . the squamous epithelial cells develop as descendants of multipotent stem cells .9 it seems that squamous metaplasia occurs accidentally , motivated by repeated detriment on gastric mucosa . although it is unknown whether gastric squamous metaplasia leads to squamous carcinoma or not , it could sometimes give rise to squamous cell carcinoma of the stomach in some reports .1,5,10 accordingly , endoscopic surveillance is essential for patients with gastric squamous metaplasia . in summary , if a whitish lesion is observed in the lesser curvature of the cardiac region of the stomach and if it appears a normal esophageal mucosa , application of lugol 's iodine solution is helpful in distinguishing squamous metaplasia from other whitish mucosal lesions such as gastric adenoma or early gastric cancer .\noutput:\n" }, { "from": "agent", "value": "intestinal metaplasia of the stomach is a common metaplastic lesion associated with chronic gastritis and mucosal atrophy . however , squamous metaplasia is a comparatively rare condition . on endoscopy , squamous metaplasia is usually observed as a whitish mucosal lesion in the lesser curvature of the cardiac region of the stomach . when lugol 's iodine solution is applied , the lesion stains brown in the same way as normal esophageal mucosa . we report a case of 79 - year - old man with a whitish flat lesion in the lesser curvature of the cardiac region on surveillance endoscopy after endoscopic treatment of gastric adenoma . the endoscopic biopsy showed stratified squamous epithelial mucosa ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: infection with human t - cell lymphotropic virus type - 1 ( htlv - 1 ) is a growing medical problem , with over 20 million estimated infections worldwide . htlv - 1 has been identified as the etiologic agent of two distinct human diseases : adult t - cell leukemia ( atl ) and a chronic , progressive demyelinating disorder known as htlv -1-associated myelopathy / tropical spastic paraparesis ( ham / tsp ) . the virus has also been associated with a number of autoimmune diseases , including sjgren 's syndrome , uveitis , and an inflammatory arthropathy . the regions of htlv - 1 endemicity , with proportionately higher rates of infection , are clustered in southern japan , the caribbean , south america , the southern united states , equatorial africa , and northeastern iran . three major routes of htlv - 1 transmission are mother to child via breast milk , sexual intercourse , and blood transfusion . otherwise , htlv - 1 is not easily transmissible , since cell - to - cell contact is presumably required . retroviruses can employ a variety of different cell surface proteins as receptors for binding and entry into host cells . entry involves an interaction between the surface protein ( su ) of the virus envelope glycoprotein ( env ) and the cellular receptor with subsequent fusion of the cellular and viral membranes mediated by the transmembrane ( tm ) region of env . according to current diagnostic criteria , immunoreactivity with p24 and one of the envelope proteins ( usually gp46 ) is considered diagnostic of htlv - i or htlv - ii infection ; however , this immunoreactivity pattern still results in a significant proportion of false negative . mta - 1 peptide from the htlv - 1 gp46 region demonstrated the highest percentage of reactivity with htlv - i positive sera , particularly among subjects of japanese ancestry . there are some reports that a higher percentage of iranian htlv - 1 infected patients showed no seroreactivity with mta - 1 peptide , while htlv - 1 infection of patients had been confirmed by pcr detection methods or elisa kits containing a cocktail of htlv - 1 specific peptides . some of these discrepancies could be explained by variation in immune response at different population . the other cases may be as a result of truncation of gp46 region in htlv subtybes . previously , it has been demonstrated that point mutations or deletion of glycosylation sites can result in a nonfunctional env protein . this report describes experiments designed to determine whether some discrepancies between elisa and pcr results could be due to truncation of immunodominant epitopes using immunoassay method . to prepare mta - 1 insert dna , primers were chosen based on their locations within the prototype htlv - 1 genomic sequence available in the gen - bank database with accession number af .33817 . in order to put sticky end intoblunt - ended amplified molecule , the sequences of restriction enzymes nde i and not i were incorporated into the 5 ends of forward and reverse primers , respectively , with regard to cloning site of pet - 22b ( + ) vector ( novagen , madison , wi , usa ) , and restriction sites flanked by 3 spacer nucleotides at the 5 end to allow for efficient digestion . the pcr amplification of dna fragment of interest was performed for 35 cycles at the following temperatures : 10 cycles ; 1 minute at 94c , 45 seconds at 55c , 2 minutes at 72c , and 25 cycles ; 45 seconds at 94c , 1 minute at 65c and 2 minutes at 72c with a final extension of 20 minutes at 72c in a dna thermal cycler ( perkin - elmer 480 ) . final composition of the reaction was 100 ng of pool of four dna samples , 20 pmole appropriate primers , 1.5 mm dntp mixture , and one unit ( u ) of pfu dna polymerase in the buffer containing mgso4 in 25 l reaction volume . forward primer : 5 - gcgcatatggctccaggatatgaccccatc - 3 . reverse primer : 5 - atagcggccgcggagcgggatcctagggtg - 3 . expected product size of 455 bp fragment was amplified , gel purified using coreone gel extraction kit . double digestion of plasmid dna ( 5493 bp ) was performed using not i and nde i restriction enzymes at 37c , overnight . the modified and digested pet - 22b ( + ) plasmid was gel purified prior to ligation with the insert . the appropriate amount of insert used in the ligation assay was calculated using the following equation : [ ( amount of vector , ng ) ( size of insert , kb ) / ( size of vector , kb ) ( molar ratio of insert / vector ) ] = ng of insert dna . pet - 22b ( + ) / mta - 1 constructed by ligating mta - 1 sequence into the pet - 22b ( + ) expression vector via not inde i sites , and the reactions were carried out by t4 dna ligase enzyme in 10 l volume . t4 dna ligase was then inactivated by heat treatment for 20 minutes at 65c to increase the efficiency of transformation . plasmid carrying the gene was used to transform bacterial cells ( e. coli dh5a ) using inoue transformation method . the cells were grown overnight at 37c on sob plates containing 50 g / ml ampicillin . plasmid dna was extracted using bioneer plasmid extraction kit ( bioneer , korea , usa ) ; screening was performed using pcr colony with insert - specific pcr primers , and restriction analysis and recombinant plasmid sequenced . for protein analysis , a recombinant pet - 22b ( + ) / mta - 1 plasmid was transformed into expression host e. coli bl21 ( de3 ) strain containing a chromosomal copy of the gene for t7 rna polymerase . preparation of recombinant cells was followed by induction and optimization of expression of target protein using a range of iptg concentration from 0.1 mm to 1 mm added to a growing culture . cells were collected from the growth medium by centrifugation , 14000 - rpm , 1 minute , at room temperature . the pelleted cells were resuspended in extraction buffer ( 50 mm potassium phosphate , ph 7.8 , 400 mm nacl , 10 % glycerol , 100 mm kcl , and 0.5 % triton x-100 ) and subjected to centrifugation at 14,000 rpm for 20 minutes . supernatants were removed ; 250 l 2x sds / page sample buffer was added to cells and equal volumes of supernatant mixed with 2x sample buffer , incubated at 95c for 5 minutes and subjected to reducing sodium dodecyl sulfate sds - polyacrylamide gel electrophoresis ( page ) . pet - 22b ( + ) vectors were chosen as a convenient and powerful system for cloning and expression of recombinant protein in e. coli . extraction of plasmid , digestion , isolation , ligation , transformation , identification , and pcr were performed as described previously . the conditions of the ligation reactions were first subjected to a number of optimizations for various parameters . the temperature of 16c resulted in desirable result . in the experimental sets focusing on the amount of t4 dna ligase , both 10 and 20 units of enzyme gave high efficiency . the time of the ligase reaction was influential as 4 - hour ligation reaction resulted in a high number of recombinant plasmids than the overnight ligation . one of the strategies for high - efficiency cloning of sticky - end dna molecules involves dephosphorylation of vectors with calf intestinal phosphatase ( cip ) , which catalyses the hydrolysis of 5 - phosphate groups from dna . treatment with cip also increased the ligation efficiency of the pcr - amplified inserts . using these strategies as well as the optimized ligation conditions , three different molar ratios of insert to vector dnasthe ratios of 1 : 1 gave significantly low transformation efficiency , while the insert to vector ratio of 3 : 1 resulted in the highest number of transformants . as shown in figure 1 , lanes 2 and 4 showed digested plasmid from transformed clones with no insert using alw 441 restriction enzyme . one of three transformed clones ( lane 3 ) contained recombinant pet - 22b ( + ) carrying a 455 bp fragment . the presence of this fragment changed alw 441 restriction map of recombinant pet - 22b ( + ) ( figure 1 , lane 3 ) in comparison with nonrecombinant pet - 22b ( + ) ( figure 1 , lane 5 ) . sequencing analysis showed an insertion of a cytosine in position 271 causing a frame shift and stop codon in protein translation ( gen - bank accession no . all four dna samples used in this study send for sequencing and showed the same results . for further investigation , sds - page analysis was performed to detect potential mta - 1 protein . however , this analysis failed to reveal the presence of the desired protein band 37 kda . it is likely that the mta - 1 truncated protein resulted from 271insc mutation is an unstable and degradable protein giving no band in sds - page . screening for htlv - 1 has become routine in blood banks in the most developed nations . the screening process is initiated with an htlv -1-specific enzyme - linked immunosorbent assay ( elisa ) . samples which are found to be repeatedly positive by elisa are confirmed through a pcr assay or , more commonly , a commercially available western blot assay . the standardized elisa assay incorporates viral proteins obtained from a number of recombinant htlv - 1 glycoproteins , which are included to increase the sensitivity and specificity of the assay . in a significant number of cases , which can be demonstrated throughout the world , the causative agent ( s ) and medical significance of the htlv - 1 seroindeterminate status are unclear . a number of potential explanations have been provided for this serological finding , including ( i ) infection with a truncated or deleted form of htlv - 1 , ( ii ) infection with a novel retrovirus bearing significant homology to htlv - 1 , and ( iii ) infection with prototype htlv - 1 at viral loads which are below the range of current methods of detection . the presence of truncated form of htlv - 1 gp46 protein could have been implicated as potential agents of disease in a number of cases . such truncated form of htlv - 1 could theoretically account for an incomplete banding pattern on an htlv -1-western blotting due to absence or alteration of crucial immunodominant viral epitope . the 271insc mutation in mta - 1 envelope genomic sequences causing a truncated protein can explain the seronegative ( elisa negative ) htlv - 1 infected individuals who are htlv - 1 pcr positive . although samples found to be repeatedly negative by htlv -1-elisa , htlv - 1 genomic sequences were readily detectable by pcr in the peripheral blood lymphocytes of these infected individuals ( figure 3 ) . therefore , in addition to variation in immune response at different population , some of the discrepancies between pcr detection methods and elisa kits containing mta - 1 peptide from the htlv - 1 gp46 region could be explained by truncation of gp46 region in htlv subtybes . in consistent with this notion , it has been demonstrated that point mutations or deletion of glycosylation sites can result in a nonfunctional env protein .\noutput:\n" }, { "from": "agent", "value": "htlv - 1 causes adult t - cell leukemia ( atl ) and htlv - 1 associated myelopathy / tropical spastic paraparesis ( ham / tsp ) . recombinant envelope glycoprotein is used in production of diagnostic enzyme - linked immunosorbent assay ( elisa ) kit . there are some reports that a significant percentage of iranian htlv - 1 infected patients showed no seroreactivity with mta - 1 peptide , while htlv - 1 had been confirmed by pcr detection methods or elisa kits containing a cocktail of htlv - 1 specific peptides . this report describes experiments designed to determine whether some discrepancies between elisa and pcr results could be due to truncation of immunodominant epitopes using immunoassay method . we have cloned the mta - 1 epitope of env gene from htlv - 1 in noti / ndei sites of pet22b ( + ) expression vector . sequencing analysis of recombinant plasmids revealed an insertion of a cytosine in position 271 causing a stop codon in the mta - 1 protein translation . sds - page analysis also failed to reveal the presence of the desired protein . subjects with a mutant htlv - 1 env gene were shown to be seronegative using elisa , but positive with pcr ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in 2012 , the court of appeal of leeuwarden , the netherlands dealt with the case of s.h . , a young woman who is accused of suffocating her four newborn children , during or shortly after birth by covering their nose and mouth and / or throat with a pillow . subsequently , she would have put the babies in litterbags which she left in a suitcase in the attic of her parents ' house . a first instance court presumed that she took the decision to kill the children out of fear of discovery of her pregnancies . the first instance court imposed a prison sentence of 12 years because of infanticide : three times murder and once manslaughter of the four newborn children . when the case is with the court of appeal , the defendant agrees , after having refused this until then , to be examined by a psychiatrist , a psychologist and a behavioral neurologist . in the decision , the court of appeal quotes part of the conclusions of the experts which add a neurobiological perspective to the case : thereby it is established that the defendant has a personality disorder which is associated with or is ( co ) - determined by cerebral organic damage in the sense of a frontal syndrome and that this disorder has restricted her to a considerable extent , compared to a healthy person , in overseeing the problems which she faced and in making choices to solve these problems . as a result of this disorder , the experts believe that the accountability of the defendant for the crimes is substantially reduced . in addition , they say that to prevent criminal recidivism , prolonged treatment and counseling is needed . taking into account these expert reports , the court of appeal , in contrast to the first instance court , finds that it can not be proven that the accused had already decided to kill the children before the births . the court of appeal sentences s.h . for four times manslaughter with a tbs order with mandatory hospitalization and a prison sentence of three yearsthe tbs order ( terbeschikkingstelling , entrustment order , art 37a criminal code ) can be imposed upon mentally disordered adult offenders who are considered not responsible or of diminished responsibility for their offense ( s ) , and who are perceived as a severe danger to others or society . this case illustrates how the information of the experts , about damage to the frontal brain and its presumed cognitive and behavioral consequences , is used by the court to help answer the judicial question of accountability and to determine a sentence . researchers in the usa report already for some time about the use of neuroscientific information in criminal justice practice . the number of criminal cases in the database westlaw in which the judge mentions neuroscientific evidence in his or her opinion has allegedly increased from 112 in 2007 to more than 1500 in 2011 . , neuroscientific information and techniques have found their way into the courts of the netherlands as well . furthermore , following a penalty reduction for a mentally ill offender in an italian case because of ato gain more insight in the ways neuroscientific and behavioral genetic information are used in criminal justice practice in the netherlands , wodc systematically collects dutch criminal cases in which neuroscientific or behavioral genetic information is introduced . in this paper , we describe types of criminal cases ( eg types of offenses , expert assessments , and penalties ) , and subsequently explore for which judicial questions neuroscientific information is sought , and whether it is used in a mitigating or aggravating way . for each judicial question , two prominent ones are pre - frontal brain damage in relation to criminal responsibility and recidivism risk , and diverging views of the implications of the growing knowledge about neurocognitive deficits in addiction for judging criminal responsibility . the cases also illustrate the role of neuropsychological methods in criminal cases , whereas in contrast in the neurolaw literature the emphasis is often on imaging techniques . it is concluded that there is a clear need of practice oriented instruments and guidelines . first however , the methods used for finding , selecting , and analysing the case law are described . furthermore , in the appendix , we give background information about numbers of criminal cases and publication practice with respect to case law in the netherlands , and its consequences for the quantity and quality of the case law data used in this paper . decisions in criminal cases published in the years 200012 were searched in the dutch case law database of rechtspraak.nl . this database is operational since 2000 and has been progressively filled each year since then . in the netherlandshowever only a small proportion of the total number of criminal cases that come before the courts each year are published , and this is not necessarily a representative set of the total number of cases ( see appendix for more details on this matter ) . this means that , although we analysed all available published cases in the netherlands in which neuroscientific or behavioral genetic information is introduced , which is a valuable source of qualitative information , we can not draw general , quantitative conclusions on the basis of our dataset about how neuroscientific information is used in dutch courts . this is because we do not know how many unpublished cases there are that would fit our selection criteria , or whether our dataset is representative of the total number of criminal cases in which neuroscientific or behavioral genetic information is introduced . mri , ct - scan , pet - scan , electro - encephalogra * , maoa . from the cases found ( table 1 ) , those were selected in which neuroscientific or genetic information is introduced with respect to the suspect / defendant , and ( 1 ) neuroscientific or ( 2 ) genetic information is raised in relation to ( a ) behavior ( eg aggression , violence , addiction ) , ( b ) brain function ( eg memory , perception , cognition , self - control ) , or ( c ) mental state ( eg consciousness , automatism , psychosis ) . searching and selecting criminal cases in which neuroscientific or behavioral genetic information is introduced . the total number of criminal cases published on rechtspraak.nl contains both crimes ( misdrijven ) and less serious offenses ( overtredingen ) , although in practice mostly the more serious and complex cases are published ( see text for criteria for publication in rechtspraak.nl ) . furthermore this total number of criminal and offense cases contains not only first instance court cases but also cases of the courts of appeal and of the supreme court of the netherlands . two extra cases found with other search terms : arousal , and aangeboren ( inborn ) were also included . considered as neuroscientific information is information from ( 1 ) assessment of the brain with imaging techniques ( such as mri , spect , pet ) or eeg , neuro - endocrinological assessment ( eg hormones , neuropeptides ) , ( 2 ) neuropsychological assessment , or ( 3 ) referring to a certain neurobiological predisposition or damage of the brain . considered as behavioral genetic informationis information from ( 1 ) heritability assessment , eg assessment of specific genes or ( 2 ) referring to a genetic predisposition or a family history that seems to indicate a biological origin of a particular behavior . it was coded to what extent the neuroscientific or genetic information affected the decision of the court about criminal responsibility of the defendant . yes , the neuroscientific or genetic information was decisive ( for instance the court mentions neuroscientific information as a basis for acquittal or no accountability for the offense ) ; partly , the neuroscientific or genetic information affected the decision partly ( for instance neuroscientific information is mentioned by the court as a basis for the decision together with other factors such as a psychiatric interview that reveals a personality disorder ) ; no , the neuroscientific or genetic information did not affect the decision ( for instance there was a neurobiological problem but this was not treated by the court as relevant for the decision about accountability for the offense ) ; not applicable , for cases where the question of criminal accountability is not central ( for instance in some of the supreme court cases that focus on a judgment of the work of the court of appeal ) . information about the subjects mentioned above was extracted from each case using a scoring instruction . in order to ensure consistency of scoringbehavioral genetic information is involved in 14 cases , and in another 10 cases neuroscientific information as well as behavioral genetic information is involved . of the 231 cases found , 178 were first instance court cases , and there were 45 court of appeal cases , and eight supreme court cases . a minority of cases ( 22 ) concerned the continuation or termination of a tbs - or an isd - order . serious offenses and long sentences are at issue , although a wide range of offenses and penalties occur ( tables 2 and 3 ) . in the majority of cases , a prison sentence and / or a measure for high - risk offenders ( tbs , isd or pij ) is imposed . in 191 of the 231 casesthe remaining cases consisted of supreme court cases ( n = 8 ) , extension or termination of a tbs - or isd - order ( n = 22 ) , cases in which the offense was declared not proven ( n = 5 ) , suspension of prosecution : ( n = 2 ) , or other cases ( n = 3 , see legend of table 3 ) these cases concern respectively : rejection of a claim for cancellation of parole , founded statement of objection , and an interlocutory judgment . it is understandable that neuroscientific information is mainly ( but not only ) introduced in cases with a serious violent or sexual offense and with severe penalties at stake , because in such cases it is likely that a report of a behavioral expert on the mental capacities of the defendant will be requested . in 175 of the cases found , two or more behavioral experts reported to the court . we found no cases in which an mri - scan was shown in court in relation to the brain and behavior of the defendant or was central in the reasoning about this . we know however that mri - scans are often part of the interdisciplinary examination of the defendant in cases where pre - frontal damage , for instance pre - frontal dementia is suspected . furthermore , it has been estimated that in assessments of suspects of serious offenses by the netherlands institute of forensic psychiatry and psychology ( nifp ) , an mri - scan is made in about half of the cases . typically in the serious violent or sex offense cases we found , the neuroscientific information provided is part of a larger picture about the defendant to which experts of several disciplines contribute , usually psychiatry , ( neuro ) psychology , the probation service , and other disciplines such as neurology if considered necessary . different methods are used to gain insight in the person of the defendant and his mental condition at the time of the offense depending on the case , for instance psychiatric interviews , psychological and neuropsychological tests , collateral reports , and neurological investigation . in the criminal cases found , neuroscientific or behavioral genetic information is introduced with respect to a variety of judicial questions , in fact all the main questions that have to be addressed subsequently in the dutch criminal trial and sentencing ( table 4 ) . neuroscientific information is most often used for the question whether the defendant can be considered of diminished accountability for the offense ( 72 cases ) . such cases typically concern serious violent offenses and defendants who may have a mental disorder or defective development . in 15 cases , neuroscientific information is subsequently used to help answer the question to what extent the defendant is a risk to society . the next largest categories are cases in which neuroscientific information is used in the context of the question whether the defendant intended the unlawful act ( 20 cases ) , or if the unlawful act was due to guilt / negligence of the offender ( 14 cases ) . in other cases , a traffic accident had happened that was possibly due to a temporary loss of consciousness of the defendant . in smaller numbers of cases , neuroscientific information is brought up in relation to the question whether there is sufficient evidence to prove beyond reasonable doubt that the defendant committed the offense , whether the defendant was competent to stand trial , if the defendant was subject to duress or excessive self - defense , or whether the defendant premeditated the offense . in the following , judicial questions with respect to which neuroscientific or behavioral genetic information is introduced . a criminal case is only included with respect to a specific judicial question if in the description of the case neuroscientific information is explicitly linked to answering the same judicial question . because this may concern more than one judicial question per casenot in all the case descriptions an explicit association can be found between the neuroscientific or behavioral genetic information introduced and the answering of one of the specific legal questions mentioned in table 4 . neuroscientific information is used to describe the etiology of a disorder ( n = 15 ) ; it is stated that further neuroscientific assessment is needed or should have been conducted ( n = 18 ) ; no information is given in the description of the case about the results of the neuroscientific assessment mentioned ( eg there is a reference to a neurological report , but without information on the content , and no information about the legal question for which the information is sought ( n = 14 ) ) ; no aberration or indication for an aberration was found in the neuroscientific assessment , and it is not clear from the case description for which legal question , if any , the information is used ( n = 22 ) ; the neuroscientific assessment indicates an aberration ( eg a stroke several years ago ) , but the aberration is not considered in relation to the criminal behavior of which the person is accused , and the information is not used with respect to any legal question in the case ( n = 4 ) ; the neuroscientific information relates to a statement or a defense that does not lead to any further investigation or any conclusions in the case concerned ( n = 17 ) . in some cases , references to neurological symptoms are used in the context of the reliability of evidence that the defendant has committed the offense , for instance the reliability of statements . an example concerns a woman accused of attempted manslaughter of her partner whom she stabbed in the face after a quarrel between them . the defendant argues that she was confused during her interrogation by the police , due to a mild concussion , and that she therefore made false statements . the court finds this statement not relevant for its judgment , and argues that there was no indication that the defendant was so distraught during questioning that she was not able to make any useful statement . nevertheless , cases where the effect of brain damage on the reliability of statements is at issue in a more substantial way form an interesting category . in an unpublished criminal case described by jelicic and merckelbach , a woman in her 30s falls down the stairs after a quarrel with her boyfriend . the boyfriend states that he went to bed earlier than his girlfriend and woke up from the noise of her falling . it is not clear if she lost consciousness after the fall , but during the first days in hospital she is disoriented and does not understand where she is and why . according to the authors , this and the fact that she later remembers little of her hospital period are indications of post - traumatic amnesia . furthermore , the woman suffers from retrograde amnesia : she can not remember events that happened shortly before she fell . months later she complains about loss of the sense of smell , and about continuing problems with imprinting new information , although she scores in the normal range on memory tests . according to her neuropsychologists , these may be lingering signs of her brain contusion . half a year after her hospitalization , the woman ends the relationship with her boyfriend , because it disturbs her that he keeps going out a lot with his friends and frequently comes home drunk . three years after her fall , the woman starts to remember that she did not just fall from the stairs , but was pushed by her boyfriend . his lawyer asks the investigative judge to appoint an expert to investigate the plausibility that the woman can remember being pushed of the stairs by the defendant . the psychologist writes that an emotional event , such as this , is likely to be remembered better than a neutral event . furthermore , because according to the psychologist , the woman showed a relatively fast recovery , as is usual with light brain damage , the psychologist does not consider it peculiar that the memories of the event have come back . however , the lawyer of the boyfriend asks the judge to appoint other experts to look critically at the report of the clinical psychologist . these contra - experts argue that according to doctor 's reports about eeg abnormalities and the amnesia after the fall , the woman did suffer serious brain damage . they state that from a neurobiological perspective , it is unlikely that her retrograde amnesia would have fully recovered . the contra - experts describe that this has to do with the way memories are stored . information is first transferred to the hippocampus , and subsequently from the hippocampus to the brain cortex . the second step is essential for retaining memory information , and takes several minutes to complete . in the case of a blow to the headthe contra - experts state that the judge appointed another expert after them , a professor of neuropsychology , who confirmed their conclusion . although it remains unclear why the woman , three years after the incident , suddenly claimed the retrieval of memories of the event , this case is interesting because it illustrates the potential role of neuropsychological knowledge about the impact of different forms of brain damage on cognitive functioning for answering questions about reliability of statements of witnesses , victims , or defendants with brain damage . neuropsychology does not feature by far as prominently in the literature about neuroscience and law as do neuroimaging techniques . yet , neuropsychology may be helpful to law in several ways . in the last decades , neuropsychological research for instance has indicated deficits in the so - called executive functions in populations with severe ( impulsive ) antisocial behavior . executive functions are important for self - regulation , the ability to direct one 's behavior and thinking . examples of executive functions are : the ability to focus one 's attention , the capacity to control impulses and strong emotions , the ability to plan ahead and to postpone direct satisfaction in order to reach long term goals , flexibility in adapting behavior in reaction to feedback from the environment , and the functioning of short - term memory . deficits in executive functions are associated with a less optimal development of or damage to the pre - frontal brain . furthermore , neuropsychologists have developed a range of tests ( nowadays often computerized tasks ) that are used for the assessment of brain functioning in relation to training and therapy . neuropsychological tests also often have several norm groups to compare individual scores with to assess whether they fall in a range that may be an indication for training or treatment . on the individual level , neuropsychology may at present have more to offer than brain imaging . for instance with respect to development of the adolescent brain , neuroscientists indicate that , although their imaging research helps to show that as a group adolescent brains differ in important aspects from adult brains , mri - scans can not be used in individual cases yet to , for instance , predict which juvenile has an increased chance of high - risk behavior on the basis of his or her brain development . neuroscientific information can also play a role in determining whether the defendant is competent to stand trial . in one case , a neurologist and a neuropsychologist found that the defendant had a range of neurocognitive problems arising from previous cerebral hemorrhage and infarction . this resulted in impairments in orientation , attention , language and speech , memory , executive control functions , and visual perception . the problems were perceived to interfere with the ability of the defendant to understand the prosecution against him . therefore , the prosecution was suspended . we found only a few cases in which neuroscientific information was introduced in relation to fitness to stand trial , and all of these concern accused persons who were mentally severely handicapped . in these cases , the neuroscientific information appears to support and further strengthen or buttress the evidence about impairments already overly apparent from the person 's behavior . in several of the criminal cases found , neuroscientific information is introduced with respect to legal questions about intent or guilt . in most of these cases , to shed more light on the question whether the defendant was aware of committing the act in question . in one case , a woman is suspected of manslaughter because she allegedly shot at someone around 2:30 am during new year 's night . the defendant says she can not remember anything of what happened after she went to bed at 2:00 am . dissociative state . the defendant has been a member of a shooting club for a long time , and claims to have dreamt that she was at the shooting range , aiming at cards with vague images . the psycho - physiologist compares the woman 's case to guidelines for determining the possible role of a sleep disorder in violent behavior . he concludes that it is likely that the defendant has committed the violent act during sleep . he reports inter alia that during the first phase of deep sleep , the activity of the frontal cortex of the brain is greatly reduced and that this was also the case in the defendant during sleep registration . he explains : the disconnection between the frontal cortex and other parts of the brain during deep sleep can lead to automatic behavior . in this statebut because the controlling role of the frontal cortex has been turned off , the person is no longer aware of his own position relative to that environment . at that moment oneit can therefore not be said that someone in a situation of automatic behavior , such as sleepwalking , acts consciously . the defendant is acquitted because the court considers it likely that she acted unconsciously , and therefore intent is not proven . we found one more case in which the defendant appeared to have committed a violent act during sleep . that case concerns a young girl who wounds her friend who sleeps over with a knife . in both these cases , it was not proven beyond reasonable doubt that the defendant intended the act , and the defendant was acquitted . in both cases , the psycho physiological sleep assessment that identified a specific sleep disorder played an important if not crucial role in this conclusion . violence during sleep - casesthere is considerable knowledge about the neurobiological mechanisms that play a role in sleepwalking disorders . in the area of violence during sleepthe guidelines indicate ways to diagnose different sleep disorders that may lead to acting without conscious awareness . furthermore , the guidelines offer ways to recognize whether the behavior at the time of the unlawful act corresponded to what would be expected from a person with a sleep disorder , and how to differentiate this from simulation . guidelines and protocols for the use of neuroscientific information in criminal cases could serve to articulate the state of knowledge , and the ways in which neuroscientific information can and can not be used . they may be advisable in other areas as well where , at least in the netherlands , guidelines or protocols do not yet exist . for instance in the case of a defendant with pre - frontal brain damage , a mental disorder such as schizophrenia , addiction , or learning disabilities . furthermore , several authors state that a protocol could also be helpful to prevent biases in the assessments of experts . merckelbach and merckelbach argue that neurobiological ( eg mri ) assessments by experts in the context of a court are sensitive to the pathology bias ( the inclination of clinicians to see deviance because it is suggested by the context ) , the allegiance bias ( the assessments are biased in a certain direction dependent on the process party that hired the expert ) , and malingering ( for instance the faking of test results by the defendant ) . blinding of the expert to context variables ( for instance about the background of the defendant ) and symptom validity testing ( to assess malingering ) would according to them be essential components of a protocol for the use of neuroscientific evidence in court . in another criminal case , the question is whether the defendant is guilty of a car accident . a man caused a serious accident by driving onto the sidewalk and hitting several pedestrians . however , he does not remember anything about the accident and claims to have had ablack out . he is seen by a neurologist who finds a perfusion defect in the brain that probably was already there at the time of the accident . the court of appeal considers it likely that this defect caused the defendant to lose consciousness for a short period which made him lose control over his car . the court of appeal concludes that it can therefore not be proven that he is guilty of the accident , and the defendant is acquitted . we found several criminal cases in which a car accident had happened , and the question is whether this was caused by a temporary reduced consciousness or lack of consciousness of the defendant . in these cases , the courts appear to apply the so - called culpa in causa principle . if loss of or reduced consciousness during the incident seems to have been likely , the subsequent question is whether the defendant could have known that the risk existed that he would have such aif that is the case , the defendant is considered responsible for taking the risk of an accident that would happen , and it is unlikely that he will be acquitted like in the above case where a previously unknown defect appeared to have caused the black out . in the largest category of the criminal cases found , neuroscientific information is introduced in relation to the question to what extent the defendant can be held accountable for the offense . the consequences of damage to the pre - frontal brain for the behavioral choices the person had at the time of the offense are a theme in several of the cases . an example is a case of a man who is accused of fornication with a neighbor - girl . the abuse took place four or five times when she was about nine years old . the defendant is examined by a neurologist who finds a beginning of front - subcortical dementia in relation to parkinson 's disease . the behavioral choices of the defendant at the time of the offense were according to the neurologist , undoubtedly affected by the organic brain dysfunction . he reports : directly related to the front - subcortical dementia is , in addition to the characteristic cognitive impairments , impulsivity , which occurs particularly in complex situations in which the defendant lacks an overview . as a resultthe defendant lacks the capacity for self - reflection , which prevents him from relating his actions to an appropriate framework of norms and values . in addition he was as a result of his cognitive impairment not able to interrupt his behavior once started . the other behavioral expert , a psychologist reports that the dementia is in an early phase and that the behavior of the defendant shows not a general disinhibition yet . the court adopts the advices of the experts and considers the defendant of diminished accountability for the offense . the verdict is a 297 days prison sentence , of which 60 days conditional and with two years of probation and psychogeriatric treatment as a special condition . the dementia and the cognitive impairments and impulsivity appear to be weighed as a mitigating factor for criminal responsibility in this case , and are also seen as a risk for which supervision and treatment are needed . in a different case , information about pre - frontal brain damage is used to underpin whether or not the defendant premeditated the offense . a man stabs his wife with a knife after which she dies from the wounds . the neurologist reporting in this case concludes that the defendant suffers from a slight frontal syndrome ( damage to the frontal brain ) as a result of which he lacks impulse control and is unable to interrupt his behavior once started . the court argues that normally it could be inferred from a situation like this that the defendant had time and opportunity to reflect on his actions , and that therefore one could conclude that the defendant premeditated the offense . however , the court concludes that because of the slight frontal syndrome , the defendant was probably not capable of such a reflection and therefore premeditation is not proven . in this case , much value is apparently assigned to the neurological information . because of the slight frontal syndrome and its assumed consequences , the defendant is not sentenced for murder but for manslaughter . the court concludes that from expert reports it appears that the defendant should be considered of reduced accountability at the most and imposes a prison sentence of nine years . in conclusion , in most of these accountability - cases the neuroscientific or behavioral genetic information appears to be used as mitigating information . as shown earlier , in 72 cases ( table 4 ) neuroscientific or behavioral genetic information is introduced with respect to the question of accountability of the defendant for the offense . in 67 of these cases , the neuroscientific or genetic information influenced the decision with respect to accountability of the defendant . in the majority of these cases ( 55 ) , the defendant is considered of diminished accountability and in six cases not accountable , based ( in part ) on the neuroscientific information . in another six of the cases , the defendant remains to be considered fully accountable ( partly ) on the basis of neuroscientific information . in eight of the cases not the neuroscientific information , but other factors appear to affect the judgment with respect to accountability of the defendant . in the previous section , it was argued that in most of the cases , we found neuroscientific information to have a mitigating influence with respect to accountability . however , the other side of the coin might be that neurobiological deficits may be considered as contributing to criminal recidivism risk , particularly when they are seen as untreatable . in that casein most criminal cases where a serious crime is at issue , the court considers the criminal recidivism risk of the offender . the behavioral experts who report in such cases , a psychiatrist ( mandatory according to the law ) and usually a psychologist , can be requested to advise about the risk of criminal recidivism . in 15 of the criminal cases , we found , neuroscientific information is explicitly mentioned in relation to the criminal recidivism risk of the defendant . an example is a case of a man who is convicted to a conditional prison sentence of three months because of stalking . he has harassed his former girlfriend repeatedly with emails , phone calls , and unwanted visits because he allegedly had a strong motivation to repair the broken relationship . the report about the mental capacities of the defendant describes a personality change due to brain damage . according to the behavioral expertthe court decides that the accountability of the defendant for the stalking is strongly diminished , but argues that because of the impaired ability of impulse control , the risk of recidivism is substantial . therefore , treatment and supervision to prevent recidivism is urgently needed according to the court . the court takes into account that no violence was used and imposes a conditional prison sentence of three months with two years of probation . in another case , the defendant had sent letters containing shotgun cartridges and bullets to a large number of prominent persons , such as politicians and television personalities , in which he threatened to kill them and their families . he also possessed fire arms at home , which is generally prohibited in the netherlands . a psychiatrist and psychologist report to the court about the defendant . according to them , brain damage as a result of a traffic accident 19 years ago strongly affected his behavior at the time of the offenses . the organic damage leads to increased irritability , impulsivity , and an inability to weigh the consequences of behavioral choices . the behavioral experts reason that because the organic brain defects will remain stable , there is a risk of renewed threatening behavior . however , they consider the risk that the threats will amount to actual physical aggression to be very small , because the defendant is avoidant of direct personal contact and conflicts . in this case , the experts see the organic brain defects as untreatable . they however do see chances for improvement via supervision and medication of the general condition and behavioral regulation of the defendant in such a way that the recidivism risk may be reduced . these two cases are interesting because they illustrate that although the brain damage and cognitive deficits are seen as unchangeable and as the source of criminal recidivism risk , the behavioral experts and the court nevertheless see opportunities for improvement that may lead to a reduction of the recidivism risk . double edged sword , mitigating with respect to the accountability of the defendant but aggravating with respect to sentencing because of the perceived untreatable recidivism risk , is thus at most partly confirmed in these cases . for courts in the netherlands , the most common way to look at offenders who committed their offense while intoxicated by alcohol or other addictive substances is indicated by the culpa in causa principle . , culpa in causa is used in criminal law to indicate that someone ended up in a situation that results in an unlawful act because of his or her own fault and therefore is responsible for it . whereas in the criminal law sector addiction seems to be seen more as a choice , in the medical sector addiction is seen as a ( brain ) disease . according to the brain disease model , chronic drug use induces enduring changes in brain function that impair the person 's ability to control drug use . for instance only a minority of the people who start using drugs or alcohol develop an addiction , and a subset of people more likely to become addicted can be identified on the basis of genetic risk factors . furthermore , neuroimaging studies have revealed structural changes in the reward circuitry of the brain of addicted persons and in brain circuits that are implicated in cognitive control , compared to non - addicted persons . according to the brain disease model , these brain changes explain the maladaptive cognitive processes seen in addicted persons , such as heightened attention to the addictive substance , impaired ability to control strong emotions or inhibit intentional actions , and problems in making adaptive decisions . although the culpa in causa principle prevails , the neuroscientific knowledge about addiction that has developed during the last decades appears to be affecting the way addicted offenders are perceived by actors in dutch courts , mainly by the behavioral experts . it seems that the neurobiological knowledge is triggering questions and discussion about the consequences of addiction and long - term substance abuse for brain functioning and behavioral choices of the defendant . a practical example is a case of a defendant who committed murder during an amphetamine psychosis . the psychiatrist who reports to the court argues : the accused was free to choose or not choose to start with amphetamine long ago . however , generally a long existing addiction has irreversible effects on the brain that limit the freedom to determine one 's will to use substance . for this reason , the psychiatrist advises the court to consider the defendant of diminished criminal responsibility . the accused should have known amphetamine can lead to a psychosis , and advises the court to consider the defendant completely responsible . the court of appeal leeuwarden adopts the reasoning of the first expert . but in the final judgment in this case the court of appeal arnhem to which the case has been sent by the supreme court after the latter quashed the verdict of court of appeal leeuwarden , says that the defendant should have known that amphetamine could have consequences to his psychological well - being . because the defendant voluntary started to use and continued using the drug , the court of appeal arnhem does not consider him of diminished responsibility for his criminal acts because of the amphetamine psychosis ( although he is considered of partly diminished responsibility because of a narcissistic personality disorder ) . neuroscience may help criminal law practitioners to understand better the mechanisms of obstacles to self - control in addicted persons . furthermore , as kennett points out , neuroimaging and neuropsychological testing may provide objective measures of for instance hyper - responsiveness to substance - related stimuli , impairments in self - control , and decision - making . such instruments may ( eventually ) help identify those addicts who have such severe problems with self - control and decision - making that they should be considered of diminished responsibility . at present , researchers work on a range of neurocognitive instruments . , , an indication that these may be promising for the criminal justice context too , is that in clinical practice , neurocognitive measures have shown to be better able to identify addicted persons with a high risk of relapse than do traditional clinical instruments such as questionnaires or structured interviews . , , in a minority of the criminal cases found , information about head injury or brain damage is used to argue that the defendant was extra vulnerable to duress . in some cases , it is argued in the context of self - defense that because of a head injury or brain damage the defendant may be extra vulnerable for a state in which strong emotions prevail ( hevige gemoedstoestand ) , and may therefore be more likely to use excessive self - defense . the defense argues that there was excessive self - defense because the defendant suffered a concussion due to a blow to his head ( from the later victim ) and subsequently came into athese arguments of the defense do however not convince the court of appeal of the existence of a strongly emotional mental state and increased vulnerability for excessive self - defense of the defendant at the time he hit the victim . another example concerns a defendant with brain damage , presumably due to prolonged abuse of alcohol and drugs . the defendant has inter alia memory problems , a low frustration tolerance and poor control of his emotions . the defendant is accused of manslaughter of a man after a fight between the two of them . the defense lawyer argues that the defendant used ( excessive ) self - defense due to physical and mental vulnerability and impaired impulse control in combination with the threatening situation . the defendant allegedly came into a state of reduced consciousness and would subsequently out of fear have acted impulsively . the court does not accept the reasoning of the defense lawyer because the court 's analysis of the subsequent events during the fight does not confirm the arguments of the defense . to summarize , in a few cases , we found information about assumed neurocognitive deficits of the defendant was brought up as mitigating information by the defense in the context of extra vulnerability to duress and ( excessive ) self - defense of the defendant . one reason for that appears to be that the claims that the defendant was extra vulnerable for a strong emotional state or ( excessive ) self - defense do not seem to be substantiated further by tests of mental capacities of the defendant or other evidence . as mentioned earlier , the majority of the cases found are cases in which neuroscientific information is introduced . behavioral genetic information is involved in 13 cases , and in another 10 cases neuroscientific information as well as behavioral genetic information is involved . inmost of these cases , the only reference to behavioral genetic information is a mentioning of the role of heritable factors in the etiology of mental disorders , such as schizophrenia or psychoses ( seven cases ) , autism spectrum disorders ( two cases ) , or personality disorder ( three cases ) . the experts in most of these cases ( usually a psychiatrist and psychologist ) use the information about heritable factors ( and other factors , such as problematic family conditions ) merely to explain how the disorder and the problematic behavior may have come about , and the court does not mention this information in its argumentation . nevertheless , there are also a number of cases in which the behavioral genetic information is used to help answer judicial questions . in one case , the defendant has a heritable neurological disorder , huntington 's disease , which is known to be caused by an aberrant gene on the fourth chromosome . the defendant is accused of setting fire to the house of his girlfriend , bringing the lives of several people into danger . huntinton 's disease is the cause of neuropsychological problems and dementia which make it difficult for him to deal with daily life and with problem situations . in such situationsthe defendant is considered completely unaccountable by the court for his crimes . however , the neuropsychological problems and their worsening because of the expected progression of the disease are likely to enhance the risk of criminal recidivism , according to the behavioral experts reporting to the court . therefore , the court orders that the defendant be committed to a psychiatric hospital , a measure that can be continued as long as the person is a risk to others . in this case , the genetic defect and the knowledge about its course and effects on the cognitive capacities and the behavior do not lead to any optimism by the experts about opportunities for reduction of criminal recidivism risk . addiction often runs within families , and genetic studies have shown that heritable factors account for 4060 per cent of the risk to develop an addiction . in six of the cases , we found , experts mention a heritable factor which makes the addicted defendant involved more inclined than an average person to develop substance dependence . in one of these cases , the psychiatrist reports that in developing alcohol dependence , a genetic factor via father and a contextual factor seem to have played a role . the psychiatrist considers the offense as mainly related to alcohol dependence , and states that the defendant is fully criminally responsible . the court , however , does not adopt the reasoning of the psychiatrist but argues that the genetic component indicates that it can not be completely excluded that the defendant did not commit the offenses voluntarily ( reduced free will ) , and therefore the presence of criminal responsibility is questionable . in this case , the court uses thegenetic component and its presumed consequences : limiting the behavioral choices of the defendant , as an argument to consider the defendant of diminished responsibility for his crimes . the reasoning in this case appears to be comparable to that of the court in a recent italian criminal case where the influence of the maoa - gene on aggressive behavior played a role . in the first case , a male who had been diagnosed with schizophrenia had stabbed another man to death . the defendant had not been taking his medication and was actively psychotic during the offense . he was found guilty by a first instance court and was given a reduced sentence of nine years because of his mental disorder . the court of appeal subsequently reduced the sentence to eight years based on the fact that the defendant tested positively for genetic variants that made him prone to aggression under stressful circumstances . several authors have criticized the basing of the judgment of criminal responsibility and the sentence ( partly ) on genetic characteristics of the defendant . , morse for instance argues that evidence of a causal relationship between a genetic variant and an elevated proneness to for instance impulsive aggression should not be equaled to an excusing condition . only if independent evidence would show that for instance the ability of the defendant to control strong emotions is compromised and that this influenced the offense , could there be an excusing condition . morse points out that an individual should not be judged on the basis of risk factors for developing a certain behavior , but on the basis of his mental capacities at the time of the offense . empirical findings nevertheless indicate that the latter can be closely related to genetic characteristics . in two cases , we found it is mentioned that pedophilia isinborn . in one of these cases , the defense lawyer states that the pedophile orientation of the defendant leads to strong emotions and a heavy pressure to view child pornography that is extremely hard for him to resist and that he should not be held responsible for . the defense lawyer also asks the question whether a pedophile can be held morally responsible for his sexual orientation , when you realize that it originated from a genetic background and atypical brain development , citing a professor whose name is not mentioned in the case . the court , more in line with the reasoning by morse than the court in previous case , does not accept this argumentation and concludes that , although the defendant may not be held responsible for his pedophile orientation , this does not imply that he can not be held responsible for his pedophile actions : gathering and spreading child pornographic materials , and molesting a very young child . in addition , the court mentions that two behavioral experts report that the defendant has normal abilities of impulse control . another context in which genetic factors are mentioned is that of personalized treatment . in one of the cases foundis a particular gene ( maoa - gene ) mentioned in relation to treatment of aggressive behavior . this concerns the case of a tbs - patient who is detained in a so - called long - stay unit within a forensic psychiatric detention center , a unit for patients who the center considers to have no perspective of successful treatment to reduce their risk of criminal recidivism . the patient has attacked three members of the staff with a pair of scissors that he had especially prepared for this goal . behavioral experts , a psychiatrist and a psychologist , report that the patient has severe antisocial and narcissistic personality disorder and cocaine dependence in remission . they consider aggression regulation a severe problem in this patient , with respect to reactive as well as instrumental aggression . the experts advise to place the patient in a high - security prison unit , since the tbs - treatment has led to no improvement . they also advise to investigate if in that setting the difficult to treat aggression regulation problems can be influenced pharmacologically . the psychiatrist is quoted saying : if it appears that the patient has a reduced expression of the maoa - gene ( the so - called warrior - gene ) a pharmacological treatment with depakine could be started . the court adopts the expert 's advice and sentences the patient to nine years imprisonment . depakine ( valproate ) is one of the most prescribed medications for epilepsy . because valproate has a mood - and impulse - stabilizing effect , it is also prescribed in some cases by psychiatrists to reduce aggressive behavior . researchers expect that subtyping of groups of addicted patients on the bases of genetic , neurobiological , and clinical variables will become more important for effective ( personalized ) treatment and risk assessment , which is also relevant for the judicial context . searching the years 200012 in the database of dutch case law on rechtspraak.nl yielded 231 criminal cases that met the selection criteria that neuroscientific or genetic information is introduced with respect to the suspect or defendant and in relation to behavior , brain function , or mental state . in the cases that were found , neuroscientific information is part of a more comprehensive examination of the mental capacities of the defendant . the neuroscientific information is typically one of the components of a larger picture , in addition to for instance psychiatric and psychological examinations and reports from the probation service . in the cases found , defendants inter alia suffer from diverse neurobiological phenomena : eg frontal dementia , addiction , epilepsy , and sleep disorder . mri , eeg , neuropsychological tests , and physiological sleep examination are techniques employed for gathering neuroscientific information in the cases found . in some cases , the role of neuroscientific information with respect to the decision of the court is quite large , for instance in the case where the defendant was considered of reduced accountability for his crimes partly on the bases of neurobiological information , or in the case the defendant was acquitted largely on the basis of physiological sleep assessment . in other cases , it is only small . neuroscientific information is introduced with respect to all of the judicial questions that are addressed in the dutch criminal trial and sentencing . a limitation is that our research is based on published cases and that we do not know whether they form a representative subset of all relevant cases ( including the unpublished ones ) . in the majority of the cases found , neuroscientific information is introduced as mitigating information in sentencing . in such cases , there is often a presumption that the defendant has a mental disorder or defective development that may have limited his responsibility for his criminal actions , and in which neurobiological aspects may play a role . although the information is considered as mitigating , it is mentioned in the literature that neuroscientific information may also function as adouble edged sword . on the one hand , it may be considered mitigating information with respect to accountability , and may therefore contribute to the underpinning of a reduction of the sentence . on the other hand , neuroscientific information can contribute to the extent to which a defendant is perceived as a risk for society , for instance when neurobiological damage is perceived as untreatable . in the latter case , this may although the defendant can be considered diminished or not responsible for the crime , in practice lead to a longer sentence , such as a tbs - hospital order that can be periodically extended . some of our cases seem to confirm this line of reasoning ( such as the huntington 's disease case ) . however , others nuance it , for instance the cases of a stalker where the behavioral experts see room for improvement and reduction of recidivism risk , despite untreatable neurobiological deficits that are assumed to contribute to recidivism risk . a difference with the huntington 's disease case is that in these latter cases the experts thought that the risk of threatening behavior was high , but the chance of direct personal violence was small . the double edged sword - effect may be most prominent in cases with a high risk of severe violence . some of the ways neuroscientific information is used in criminal cases in other countries were not found in any dutch cases . this concerns for instance physiological lie - detection or fmri - lie detection . the scientific base for using these methods as evidence in court is considered too weak . in some cases in the usa , the involvement of information about theseveral criminal cases were found in which neurobiological or behavioral genetic aspects of addiction were discussed . however , in contrast to for instance canada , no cases were found in the netherlands with a defendant who was diagnosed with the fetal alcohol syndrome . although the number of cases is expected to grow by some ( see introduction ) , in only one of the dutch cases found , a candidate gene for aggression ( eg maoa - gene ) was mentioned in relation to medical treatment of impulsive aggression . in contrast to countries like italy , in none of the dutch cases found defendants appeared to have been tested for the mao - gene or other candidate genes . nevertheless , the impact of heritable factors on the behavioral choices of the defendant is a question that is addressed in several of the cases found . clearly , the actors , behavioral as well as judicial , in criminal cases in the netherlands ask questions about what the implications of neuroscientific factors are for criminal responsibility , recidivism risk , or the best choice of treatment in the case of their defendant . the cases also show that views on the impact that neuroscientific information could or should have can be far apart , for instance in cases where the impact of genetic factors is an issue , or with respect to questions about criminal responsibility in relation to the impact of neurobiological damage in an addicted defendant . one area in which neuroscience may help to gain more insight is the impact of age , mental disorders , personality disorders , and addiction on the capacity to make decisions . neuropsychological tests and neuroimaging may provide objective measures for instance for attentional bias , impairments in self - control , and problems with decision - making in for instance addicted persons , and may in time help identify those addicts who have such severe problems with self - control or decision - making that they should be considered of diminished criminal responsibility . the development of guidelines and protocols for the use of neuroscientific information in criminal court ( as in physiological sleep disorder assessment ) may be advisable for other phenomena , such as pre - frontal brain damage , learning disabilities , or mental disorders such as schizophrenia as well . not only because they could serve to articulate the state of the knowledge and ways in which neuroscientific information can and can not be used , but also because they could be helpful to prevent biases to which neuroscientific evidence in the judicial context is vulnerable . an issue in the netherlands is that the pool of experts who report to the criminal courts about neuroscientific information is rather small . for instance , in the majority of cases in which neurological information was reported in relation to aggressive behavior , the samebehavioral neurologist was consulted . for the growth of expertise in this area , it is important to have more professionals . the pool of neuropsychologists appears to be somewhat larger , since in the cases found , more different neuropsychologists reported . another important area for judicial practice is risk assessment . in several of our cases , a modest number of empirical studies are beginning to show how neuroscientific information can have an additive value for assessment of criminal recidivism risk . , , furthermore , research indicates that neurobiological factors may help predict who may and may not profit from cognitive behavioral treatment for antisocial behavior . although much is still unknown about the relation between neurobiological factors and behavioral choices , neurolaw is an area of research that offers chances to develop instruments to help answer judicial questions in criminal cases , that have an additive value with respect to practice as usual . to develop such instruments , practice oriented research is needed , as well as a dialog between researchers and legal practitioners .\noutput:\n" }, { "from": "agent", "value": "in this contribution an empirical approach is used to gain more insight into the relationship between neuroscience and criminal law . the focus is on case law in the netherlands . neuroscientific information and techniques have found their way into the courts of the netherlands . furthermore , following an italian case in which a mentally ill offender received a penalty reduction in part because of a genetic vulnerability for impulsive aggression , the expectation was expressed that such genetic defenses would appear in the netherlands too . to assess how neuroscientific and behavioral genetic information are used in criminal justice practice in the netherlands , we systematically collect dutch criminal cases in which neuroscientific or behavioral genetic information is introduced . data and case law examples are presented and discussed . although cases are diverse , several themes appear , such as prefrontal brain damage in relation to criminal responsibility and recidivism risk , and divergent views of the implications of neurobiological knowledge about addiction for judging criminal responsibility . whereas in the international neurolaw literature the emphasis is often on imaging techniques , the dutch findings also illustrate the role of neuropsychological methods in criminal cases . finally , there appears to be a clear need of practice oriented instruments and guidelines ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: rheumatoid arthritis ( ra ) is a chronic inflammatory disease associated with accelerated atherosclerosis and increased incidence of cardiovascular ( cv ) events . besides a genetic component and classic ( traditional ) cv risk factors , chronic inflammation plays a pivotal role in the development of atherogenesis in patients with ra . . macrovascular endothelial dysfunction , an early stage in atherosclerosis , can be detected by brachial ultrasonography as the result of impaired flow - mediated endothelium - dependent vasodilatation ( fmd ) . carotid ultrasound studies are also useful to disclose the presence of subclinical atherosclerosis . by this technique , morphological changes such as abnormally increased carotid artery intima - media wall thickness ( imt ) and carotid plaques can be observed . a number of studies have shown short - term improvement of endothelial function in ra refractory to disease modifying antirheumatic drugs ( dmards ) following anti - tnf - alpha therapy . however , carotid ultrasound studies in patients with ra undergoing anti - tnf - alpha therapy have yielded contradictory results in terms of reduction or progression of carotid imt . nevertheless , from a clinical point of view , anti - tnf - alpha therapy has been associated with a decrease in the incidence of cv events in patients with ra . in thisregard , results from the british society for rheumatology biologics register showed that the risk of myocardial infarction was markedly reduced in ra patients who responded to anti - tnf - alpha therapy by 6 months compared with nonresponders . also , in a study that included 10156 ra patients enrolled in the consortium of rheumatology researchers of north america , individuals using a tnf - alpha antagonist experienced a reduced risk of the primary composite cv endpoint compared with users of nonbiological dmards . in keeping with these observations , data from a recent systematic review confirmed that anti - tnf - alpha therapy was associated with a reduced risk for all cv events , myocardial infarction , and cerebrovascular accidents . meta - analysis of randomized controlled trials also yielded a point estimate indicating a lower risk of cv events in patients undergoing anti - tnf - alpha therapy . taking these observations together , in an attempt to further investigate the potential beneficial effect of tnf - alpha antagonist therapy on subclinical atherosclerosis in ra , we sought to determine whether adalimumab therapy might yield persistent improvement of endothelial function and no morphological progression of subclinical atherosclerosis measured by the determination of carotid artery imt in ra patients with severe disease , refractory to dmards , who were prospectively followed over 1 year period . a series of consecutive ra patients that fulfilled the 1987 american college classification criteria for ra , attending hospital outpatient clinics from hospital xeral - calde ( lugo , nw spain ) , who were switched from standard dmard therapy to anti - tnf - alpha - adalimumab treatment between april 2008 and may 2009 because of severe and active disease ( das28 greater than 5.1 ) , were assessed before the onset of adalimumab therapy and then prospectively until 1 year after the commencement of treatment with this therapy . for the purpose of this study , ra patients seen during the period of recruitment with diabetes mellitus , current smokers , history of coronary heart disease , heart failure , stroke , peripheral arteriopathy , estimated pulmonary artery systolic pressure greater than 35 mmhg , mitral , aortic , tricuspid , pulmonary valve involvement ( regurgitation or stenosis ) , pericardial effusion in an echocardiography study performed at the time of recruitment , or body mass index less than 20 or greater than 35 kg / m were excluded . based on the inclusion and exclusion criteria , we recruited 34 ra white patients ( 30 women , 28 ( 82.4 % ) of them rheumatoid factor positive ) . the median age at the time of disease diagnosis was 50.1 ( interquartile range ( iq ) 41.355.9 ) years . the delay to the diagnosis of ra from the onset of symptoms was 0.5 ( iq range 0.31.6 ) years . the age at the onset of adalimumab therapy was 54.9 ( iq range 47.563.0 ) years . at the commencement of adalimumab ,26 patients were on methotrexate ( mtx ) therapy ( median 15 mg / week ) and 14 on leflunomide ( 20 mg / day ) , some of them receiving combination therapy with these two dmards . six of the 34 patients were also receiving hydroxychloroquine ( median 200 mg / day ) . twenty - four patients were on prednisone ( median 5 mg / day ) . however , in each case appropriate control of blood pressure was achieved following treatment with antihypertensive drugs . adalimumab therapy ( 40 mg ) was subcutaneously administered every 2 weeks over the period of study . patients received adalimumab therapy 40 mg every other week by subcutaneous injection from day 0 ( onset of study ) to month 12 ( end of the study ) 1 year after the initiation of adalimumab therapy . in each patient , a das 28 ( 010 ) ( determined in each patient by the same rheumatologist throughout the study ) using erythrocyte sedimentation rate ( esr ) as the laboratory datum was assessed at day 0 ( two hours before the first administration of adalimumab ) , at day 14 ( two hours before the second administration of adalimumab ) , and at month 12 ( two hours prior to adalimumab administration ) . systolic and diastolic blood pressure , c - reactive protein ( crp - immunoturbidity method ) , esr ( westergren ) , and serum creatinine were also determined at day 0 ( two hours before the first administration of adalimumab ) , at day 14 ( two hours before the second administration of adalimumab ) , and at month 12 ( two hours before adalimumab administration ) . furthermore , total cholesterol , triglycerides , ldl cholesterol , hdl cholesterol ( fasting overnight determinations ) , and total cholesterol / hdl ratio ( atherogenic index ) were assessed at day 0 , and at month 12 . endothelial function was assessed before the first administration of adalimumab ( two hours before ) at day 0 at day 14 ( two hours before the second administration of adalimumab ) , and at month 12 ( at the end of the study , two hours before adalimumab administration ) . carotid artery imt was measured before the first administration of adalimumab ( two hours before ) and at month 12 ( at the end of the study ) . flow - mediated endothelium - dependent vasodilatation ( postischemia ) fmd and independent vasodilatation ( postnitroglycerin ) ntg were measured by brachial ultrasonography . brachial artery diameter and flow were determined as previously described . b - mode scan of the right brachial artery , in a longitudinal section 2 to 12 cm proximal to the antecubital fossa , was performed in supine subjects using a philips ie33 ( philips healthcare , da best , the netherlands ) with a 11 mhz linear transducer . the anterior and posterior media - intima interfaces were used to define the baseline artery diameter , calculated as the average of measurements made during four cardiac cycles at end diastole . the forearm blood pressure cuff was inflated on the ipsilateral wrist to 50 mmhg above resting systolic blood pressure for 5 minutes and then released . fmd ( an increase in brachial artery diameter ) was measured from 30 to 60 seconds after cuff release . to assess ntg endothelium - independent vasodilatation , we used 400 g of sublingual nitroglycerin , which acts directly on vessel smooth muscle to cause vasodilatationassessment of carotid artery imt was performed as previously described in recent studies from our group . the study was performed using high - resolution b - mode ultrasound ( philips ie33 ; philips healthcare , da best , the netherlands ) with an 11 mhz linear transducer . for the purpose of the present study , qlab 's imt - quantification software measurement plug in ( philips healthcare , da best , the netherlands ) was used to increase the consistency and reliability of imt measurements , reduce the effort required to successfully carry out imt measurements , and minimize the time needed to complete an imt study . the reproducibility of the imt measurements was evaluated in 10 patients within 1 week of the first ultrasound examination . in all cases a cardiologist ( cg - j ) analyzed ultrasound data offline and he was blind to the clinical information and study date . . measurements of fmd and ntg represented the maximal increase in brachial diastolic artery diameter and were expressed as percentage of change ( % ) from baseline . equality of values at day 0 versus day 14 and at day 0 versus month 12 was tested using the wilcoxon matched - pairs signed - rank test . figures on the evolution from day 0 on ( onwards ) were obtained via locally weighted regression ; its results were displayed with three curves representing the central estimate and lower and upper limits for confidence bands . the use of anti - tnf - alpha - monoclonal antibody - adalimumab yielded clinical improvement in this series of ra with severe disease refractory - to - conventional dmard therapy ( figure 1 ) . das28 values at month 12 were significantly reduced ( mean sd : 3.31.5 ; median : 3.3 ) when compared to those observed before the onset of adalimumab therapy at day 0 ( mean sd : 5.90.7 ; median : 5.9 ; p 0.001 ) ( table 1 ) . moreover , a significant reduction in the serum levels of crp was achieved following the administration of adalimumab at day 14 ( median : 4.9 mg / l ) compared to baseline levels observed at day 0 ( median : 9.1 mg / l ; p = 0.008 ) ( table 1 ) . however , no statistically significant differences were found when total cholesterol , hdl - cholesterol and ldl - cholesterol , levels observed at month 12 were compared with those found at day 0 . as previously described in ra patients with long - standing disease , this series of ra patients also had endothelial dysfunction prior to the onset of adalimumab therapy as the mean and median fmd percentage values were lower than 7 % . in addition , the present study confirmed a short - term rapid and significant improvement of endothelial function following the first administration of adalimumab . in this regard , at day 14 , values of fmd percentage were significantly higher ( mean sd : 6.13.9 % ; median : 5.7 % ) than those observed at day 0 ( mean sd : 4.54.0 % ; median : 3.6 % ; p = 0.03 ) ( table 1 ) . moreover , persistent improvement of endothelial function was observed at the end of the study ( figure 2 ) . with respect to this , values of fmd percentage at month 12 ( mean sd : 7.42.8 % ; median : 6.9 % ) were significantly higher than those observed at day 0 ( p 0.001 ) ( table 1 ) . however , no statistically significant differences were achieved when ntg percentage values observed at day 0 were compared with those obtained at day 14 or at month 12 ( table 1 and figure 2 ) . no statistically significant changes were found when carotid artery imt results obtained at month 12 ( mean sd : 0.690.21 mm ; median : 0.68 ) were compared with those obtained at day 0 ( mean sd : 0.650.16 mm ; median : 0.64 ; p = 0.30 ) ( table 1 ) . therefore , no significant morphological progression of subclinical atherosclerosis was observed in this series of adalimumab - treated ra patients . the present study shows persistent improvement of endothelial function following the tnf - alpha antagonist adalimumab in a cohort of patients with ra refractory to conventional dmard therapy . also , unlike our previous observations on patients with severe disease undergoing treatment with the chimeric anti - tnf - alpha monoclonal antibody - infliximab , a recent study on 8 early ra patients ( disease duration 1 year ) , treated with adalimumab during 6 months , showed significant improvement of endothelial function that inversely correlated with crp levels . sidiropoulos et al . also demonstrated an improvement of endothelial function after 18 months therapy with infliximab or adalimumab . in keeping with these observations , we observed that adalimumab therapy yielded improvement of endothelial function after 12 months of therapy . however , the beneficial effect on endothelial dysfunction does not seem to be specific of anti - tnf - alpha drugs as therapy with rituximab , a monoclonal antibody that selectively targets cd20 positive b cells , demonstrated in two different studies an early and sustained favorable effect on endothelial function in ra patients refractory to tnf - alpha blockers . in a former study of our group , we demonstrated that in long - term anti - tnf - infliximab - treated ra patients , the intravenous infusion of this monoclonal antibody yielded a significant rapid but transient improvement of endothelial dysfunction . in thisregard , following infusion of the drug , a dramatic and rapid increase in the percentage of fmd was observed . in all patients , percentages of fmd were greater than those observed 2 days before infusion . however , of fmd percentage values returned to baseline by 4 weeks after infusion of the drug . therefore , we think differences in the bioavailability of the different tnf - blockers may be a possible explanation for the persistent positive effect of adalimumab on endothelial function in long - term ra patients when compared with data obtained in long - standing ra patients following a single infusion of infliximab . a result derived from the present study is that the improvement of endothelial function in ra seems to be independent of the effect of these biologic agents on the lipid profile . in this regard , although dyslipidemia is also closely linked to the development of endothelial dysfunction and atherosclerosis , short - term infliximab therapy was associated with significant increase of both total cholesterol and hdl cholesterol levels , plasma total cholesterol concentrations , ldl cholesterol concentrations , and also the atherogenic index increased after 1 year from the start of this therapy . in accordance with these observations , in our study we did not observe a significant change in the atherogenic index when results obtained at month 12 were compared with baseline results . atherosclerosis is increasingly considered to be an immune system - mediated process of the vascular system and the inflammatory process taking place in the arterial wall as part of atherosclerosis disease . the actual evidence suggests that proinflammatory cytokines and metabolic abnormalities associated with systemic inflammation may be implicated in the development of endothelial dysfunction in ra . the chronic inflammation may lead to endothelial dysfunction , subsequent atherosclerosis , and cardiovascular events in ra . adalimumab , infliximab , or rituximab ) , improvement of endothelial dysfunction has been demonstrated in ra patients that exhibit low levels of inflammation and clinical remission . in this regard , ra patients withearly diagnosed disease treatment with adalimumab yielded improvement of endothelial function that was significantly related to clinical remission . in keeping with that , although in our study reduction of blood pressure following 12 - month adalimumab therapy did not reach statistical significance , it is remarkable to see that both the mean systolic and diastolic blood pressure were reduced in adalimumab - treated patients when compared with baseline results of blood pressure obtained at the onset of this biologic therapy . to the best of our knowledge , this reduction of blood pressure levels in long - term adalimumab - treated patients has not previously been reported . whether the reduction of blood pressure levels following 12 - month adalimumab therapy is the consequence of the decrease of the systemic inflammatory burden is a question that still remains unanswered . carotid imt is a useful surrogate marker of subclinical atherosclerosis and a predictor of cv events in patients with ra . due to this , as discussed before , another important result derived from the present study was the lack of significant increase of the carotid imt following 12 months of adalimumab therapy . previous studies on high resolution b - mode ultrasound of the common carotid artery disclosed a strong correlation between the carotid imt and markers of systemic inflammation in both controls and patients with ra . studies that addressed the effect of the control of cv risk factors on the progression of atherosclerosis , as measured by carotid imt , used the concept of change in the progression of imt because progression in the measurements of carotid imt is expected with time / age and because a reduction in this progression should be of great clinical significance . with respect to this , anti - tnf blocking agents , but not mtx , have been found to reduce carotid imt in patients with ra . in line with these studies , no progression in the carotid imtwas found in our series of adalimumab - treated patients . however , despite having a reduction in markers of inflammation , we could not disclose a decrease in the carotid imt in our series . nevertheless , the absence of carotid imt progression enhances the potential usefulness of the tnf - alpha blocker therapy to decrease the accelerated atherosclerosis observed in patients with ra . twelve - month adalimumab therapy reduces mechanisms implicated in the increased risk of cv death observed in patients with ra .\noutput:\n" }, { "from": "agent", "value": "to determine whether treatment with the anti - tnf - alpha blocker adalimumab yields persistent improvement of endothelial function and prevents from morphological progression of subclinical atherosclerosis in patients with rheumatoid arthritis ( ra ) refractory to conventional therapy , a series of 34 consecutive ra patients , attending hospital outpatient clinics and who were switched from disease modifying antirheumatic drug therapy to anti - tnf - alpha - adalimumab treatment because of severe disease , were assessed by ultrasonography techniques before the onset of adalimumab therapy ( at day 0 ) and then at day 14 and at month 12 . values of flow - mediated endothelium - dependent vasodilatation at day 14 and at month 12 were significantly higher ( mean standard deviation ( sd ) : 6.1 3.9 % ; median : 5.7 % at day 14 , and mean sd : 7.4 2.8 % ; median : 6.9 % at month 12 ) than those obtained at day 0 ( mean : 4.5 4.0 % ; median : 3.6 % ; p = 0.03 and p < 0.001 , resp . ) . endothelium - independent vasodilatation results did not significantly change compared with those obtained at day 0 . no significant differences were observed when carotid artery intima - media wall thickness values obtained at month 12 ( mean sd : 0.69 0.21 mm ) were compared with those found at day 0 ( 0.65 0.16 mm ) ( p = 0.3 ) . in conclusion , anti - tnf - alpha - adalimumab therapy has beneficial effects on the development of the subclinical atherosclerosis disease in ra ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tween 80 ( polyoxyethylene sorbitan monooleate ) was purchased from merck ( schuchardt , hohenbrunn , germany ) . water was taken from milli - q water purification system ( millipore , billerica , ma ) . all other components used for the formulation of nanoemulsion were pharmaceutically acceptable for oral administration . the silymarin nanoemulsion was prepared by spontaneous emulsification method ( aqueous phase titration method ) . detailed description of their preparation , physical stability , characterization , and optimization is given in our previously published article . an optimal stable nanoemulsion formulation of silymarin ( 20 mg / kg body weight p.o . ) was developed containing sefsol - 218 as an oily phase ( 5 % w / w ) , 35 % w / w of smix ( mixture of tween 80 as a surfactant and ethanol as a co - surfactant in the ratio of 2:1 ) , and double distilled water as an aqueous phase ( 60 % w / w ) . this formulation was optimized on the basis of visual observation , optimum globule size , and minimum polydispersity index . the formulation of silymarin dosage form may lead to a decrease in the assay of silymarin due to mechanical stress , compression , manufacturing processes , excipients , storage conditions , heat , moisture , and alkaline ph . stability studies on optimized nanoemulsion were performed by keeping the sample at refrigerator temperature ( 5c ) and room temperature ( 25c ) . nine batches of the selected formulation were prepared out of which three batches of nanoemulsion formulations were subjected to accelerated stability conditions . the formulation was taken in glass vials and kept at three different temperatures ( 40 + 2c ) ( stability chamber ) , 25 + 2c ( room temperature ) , and 5 + 2c ( refrigerator ) at ambient humidity . samples were withdrawn periodically at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) and evaluated for any physical change in the formulation and drug content . analysis was carried out at each time interval by taking 1.0 ml of each formulation and diluting it to 5.0 ml with methanol and quantified by reported high performance thin layer chromatography ( hptlc ) method . the sample was applying on hptlc plate and the content of silybin was quantified using solvent chloroform : acetone : formic acid ( 9:2:1 , v / v / v ) ( rf of silybin 0.460.05 ) in the absorbance mode at 296 nm . the amount of drug degraded and the amount remaining at each time interval was calculated . arrhenius plot was constructed between log k and 1 / t to determine the shelf life of optimized nanoemulsion formulation . the degradation rate constant at 25c ( k25 ) was determined by extrapolating the value of 25c from arrhenius plot . the shelf life ( t0 .9 ) for each formulation was determined by using the formula : silymarin was provided from ranbaxy ( gurgaon , india ) and sefsol 218 ( propylene glycol - monocaprylic ester ) from nikko chemicals ( tokyo , japan ) as gift samples . tween 80 ( polyoxyethylene sorbitan monooleate ) was purchased from merck ( schuchardt , hohenbrunn , germany ) . water was taken from milli - q water purification system ( millipore , billerica , ma ) . all other components used for the formulation of nanoemulsion were pharmaceutically acceptable for oral administration . the silymarin nanoemulsion was prepared by spontaneous emulsification method ( aqueous phase titration method ) . detailed description of their preparation , physical stability , characterization , and optimization is given in our previously published article . an optimal stable nanoemulsion formulation of silymarin ( 20 mg / kg body weight p.o . ) was developed containing sefsol - 218 as an oily phase ( 5 % w / w ) , 35 % w / w of smix ( mixture of tween 80 as a surfactant and ethanol as a co - surfactant in the ratio of 2:1 ) , and double distilled water as an aqueous phase ( 60 % w / w ) . this formulation was optimized on the basis of visual observation , optimum globule size , and minimum polydispersity index . the formulation of silymarin dosage form may lead to a decrease in the assay of silymarin due to mechanical stress , compression , manufacturing processes , excipients , storage conditions , heat , moisture , and alkaline ph . stability studies on optimized nanoemulsion were performed by keeping the sample at refrigerator temperature ( 5c ) and room temperature ( 25c ) . nine batches of the selected formulation were prepared out of which three batches of nanoemulsion formulations were subjected to accelerated stability conditions . the formulation was taken in glass vials and kept at three different temperatures ( 40 + 2c ) ( stability chamber ) , 25 + 2c ( room temperature ) , and 5 + 2c ( refrigerator ) at ambient humidity . samples were withdrawn periodically at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) and evaluated for any physical change in the formulation and drug content . analysis was carried out at each time interval by taking 1.0 ml of each formulation and diluting it to 5.0 ml with methanol and quantified by reported high performance thin layer chromatography ( hptlc ) method . the sample was applying on hptlc plate and the content of silybin was quantified using solvent chloroform : acetone : formic acid ( 9:2:1 , v / v / v ) ( rf of silybin 0.460.05 ) in the absorbance mode at 296 nm . the amount of drug degraded and the amount remaining at each time interval was calculated . arrhenius plot was constructed between log k and 1 / t to determine the shelf life of optimized nanoemulsion formulation . the degradation rate constant at 25c ( k25 ) was determined by extrapolating the value of 25c from arrhenius plot . the shelf life ( t0 .9 ) for each formulation was determined by using the formula : the silymarin nanoemulsion formulation was prepared successfully by spontaneous emulsification method using sefsol - 218 and smix ( mixture of tween 80 and ethanol ) and double distilled water . the droplet size of the formulation was 41.220.00314 nm with a polydispersity index of 0.165 . stability of the drug or a formulation is the extent to which a product retains , within the specified limits , throughout its period of storage and use , the same properties and characteristics possessed at the time of its packaging . stability testing evaluates the effect of environmental factors on the quality of the drug substance or a formulated product , which is utilized for prediction of its shelf life , determine proper storage conditions , and suggest labeling instructions . moreover , the data generated during the stability testing are an important requirement for regulatory approval of any drug or formulation . therefore , optimized nanoemulsion formulation was characterized by droplet size , viscosity , and refractive index for the period of 3 months . during stability studiesdroplet size , viscosity , and refractive index were determined at two different temperatures of 5c and 25c . these parameters were determined at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) . no drastic change was observed in the values of droplet size , viscosity , and refractive index at refrigerated and room temperature indicated that optimized formulation is stable and suitable for oral delivery of silymarin . accelerated stability was checked when the formulation were kept at three different temperatures ( 40 + 2c , 25 + 2c , and 05 + 2c ) . the drug concentration remaining was quantified at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) where zero time sample was taken as control ( 100 % ) . the percentage of undecomposed silymarin remaining in the nanoemulsion formulations was 208.17 g / ml , 208.11 g / ml , and 206.67 g / ml at 5c , 25c , and 40c , respectively , after 90 days of storage . stability studies of silymarin nanoemulsion at 5c stability studies of silymarin nanoemulsion at 25c stability studies of silymarin nanoemulsion at 40c to check the order of degradation of silymarin , natural ( ln ) of percent drug remaining when plotted against time gave the straight line , which signifying that the degradation of silymarin in nanoemulsion formulation followed first order kinetics [ figure 1a c ] . from degradationconstant ( k ) values obtained from figure 1a c , half - life and the shelf life of the formulation prepared were calculated [ table 4 ] . it was seen that the shelf life of the formulation was 3.8 years when stored at refrigerator temperature . arrhenius plot was constructed by plotting ln k versus reciprocal of absolute temperature ( 1 / t ) [ figure 2 ] . the slope obtained from plot gave the energy of activation of silymarin in the nanoemulsion formulation . first order degradation kinetics of nanoemulsion formulation at ( a ) 5c ; ( b ) 25c ; ( c ) 40c half - life and shelf life of nanoemulsion at different temperatures arrhenius plot between log k and 1 / t to determine the shelf life of silymarin nanoemulsionthe silymarin nanoemulsion formulation was prepared successfully by spontaneous emulsification method using sefsol - 218 and smix ( mixture of tween 80 and ethanol ) and double distilled water . the droplet size of the formulation was 41.220.00314 nm with a polydispersity index of 0.165 . stability of the drug or a formulation is the extent to which a product retains , within the specified limits , throughout its period of storage and use , the same properties and characteristics possessed at the time of its packaging . stability testing evaluates the effect of environmental factors on the quality of the drug substance or a formulated product , which is utilized for prediction of its shelf life , determine proper storage conditions , and suggest labeling instructions . moreover , the data generated during the stability testing are an important requirement for regulatory approval of any drug or formulation . therefore , optimized nanoemulsion formulation was characterized by droplet size , viscosity , and refractive index for the period of 3 months . during stability studiesdroplet size , viscosity , and refractive index were determined at two different temperatures of 5c and 25c . these parameters were determined at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) . no drastic change was observed in the values of droplet size , viscosity , and refractive index at refrigerated and room temperature indicated that optimized formulation is stable and suitable for oral delivery of silymarin . accelerated stability was checked when the formulation were kept at three different temperatures ( 40 + 2c , 25 + 2c , and 05 + 2c ) . the drug concentration remaining was quantified at predetermined time intervals ( 0 , 15 , 30 , 45 , 60 , and 90 days ) where zero time sample was taken as control ( 100 % ) . the percentage of undecomposed silymarin remaining in the nanoemulsion formulations was 208.17 g / ml , 208.11 g / ml , and 206.67 g / ml at 5c , 25c , and 40c , respectively , after 90 days of storage . stability studies of silymarin nanoemulsion at 5c stability studies of silymarin nanoemulsion at 25c stability studies of silymarin nanoemulsion at 40c to check the order of degradation of silymarin , natural ( ln ) of percent drug remaining when plotted against time gave the straight line , which signifying that the degradation of silymarin in nanoemulsion formulation followed first order kinetics [ figure 1a c ] . from degradationconstant ( k ) values obtained from figure 1a c , half - life and the shelf life of the formulation prepared were calculated [ table 4 ] . it was seen that the shelf life of the formulation was 3.8 years when stored at refrigerator temperature . arrhenius plot was constructed by plotting ln k versus reciprocal of absolute temperature ( 1 / t ) [ figure 2 ] . the slope obtained from plot gave the energy of activation of silymarin in the nanoemulsion formulation . first order degradation kinetics of nanoemulsion formulation at ( a ) 5c ; ( b ) 25c ; ( c ) 40c half - life and shelf life of nanoemulsion at different temperatures arrhenius plot between log k and 1 / t to determine the shelf life of silymarin nanoemulsionthe slight decrease in the assay of silymarin was observed in the formulations stored at different temperatures . lt was concluded that the degradation of silymarin in nanoemulsion formulation follow first order kinetics . the shelf life of nanoemulsion formulation was 3.8 years , which could be achieved only with formulation stored in the refrigerator .\noutput:\n" }, { "from": "agent", "value": "background : silymarin , a flavonolignan from milk thistle ( silybum marianum ) plant is used almost exclusively for hepatoprotection . because of its low bioavailability , it was incorporated into a nanoemulsion formulation . the aim of the present study was to check the stability of silymarin nanoemulsion at different temperatures for 3 months.materials and methods : the oil - in - water based nanoemulsion formulation was prepared by titration method . silymarin nanoemulsion was characterized by droplet size , viscosity , and refractive index . droplet size , viscosity , and refractive index were determined every month . the shelf - life of silymarin nanoemulsion was determined by accelerated stability testing.results : it was found that there was no significant change in the droplet size , viscosity , and refractive index at refrigerator and room temperature during the period of 3 months . the half - life of the optimized nanoemulsion formulation was found to be 4.74 years at room temperature.conclusion : these results indicated that stability of silymarin can be enhanced in nanoemulsion formulation using tween 80 as a surfactant ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: coronary heart disease ( chd ) is the second leading cause of death among chinese adults now - a - day . health - related quality of life ( hrqol ) is useful for assessing the socio - economic impact and burden of illness , effectiveness of interventions and treatments , and long - term mortality among patients after a cardiac event . so far , only a few studies assessed the hrqol of chinese chd patients , yielding inconsistent results . the purpose of this study was to evaluate hrqol outcomes of chd patients in china using european quality of life 5 - dimensions ( eq - 5d ) questionnaire and identify important hrqol factors for this special population . this was a cross - sectional study conducted from august to october , 2010 in rural communities of fangshan district , beijing , china , using a stratified cluster sampling technique . eligible subjects are native residents aged 40 years or older living locally for at least 5 years , with a confirmed diagnosis of myocardial infarction or angina by a class - two or higher hospital with electrocardiography findings , or a surgical history of coronary revascularization , coronary artery bypass or coronary stent implantation . subjects who were unable to answer the questionnaire and take part in physical examination personally were excluded . all questionnaires were administered through personal interview , information collected on socio - demographic characteristics ( age , sex , marital status , educational level , the family 's population , household income per month ) , lifestyle factors ( physical activity , cigarette smoking and alcohol consumption ) and comorbidities , including hypertension , type 2 diabetes mellitus ( t2 dm ) and stroke . marital status is divided into married and unmarried ( including single , divorced or widowed ) . past smokers were those who had smoked more than 100 cigarettes in the past but had quit smoking during the last month . current smokers were those who had smoked at least 100 cigarettes and had smoked during the last month . past drinking was defined as consuming alcohol at least once a week in the past but not in the previous month . current drinking was defined as drinking at least once per week and still drank at that frequency in the previous month . the average daily intake of current drinkers was calculated by dividing the total weekly amount of pure alcohol by 7 days . according to the daily intake of alcohol , current drinkerswere categorized into four groups : low , moderate , high , and very high group ( for men 40 , 4160 , 61100 and 100 g / d , for women 20 , 2140 , 4160 and 60physical activity was defined as performing physical exercise for at least 30 min at least once per week during the previous 6 months , not including housework or job - related work . the frequency of physical activity was measured as : rarely / never , 14 times / week or 5 times / week . household income per month ( in renminbi , rmb ) was classified as 3000 rmb or higher , 20002999 rmb , 15001999 rmb , and 1500 rmb for first - to fourth - class rural areas , respectively . classification for body mass index ( bmi ) was : underweight as bmi 18.5 , normal weight as bmi 18.524.9 , overweight as bmi 25.029.9 and obesity as bmi 30.0 . subjects were defined as having hypertension if they were taking antihypertensive medications and / or having systolic blood pressure ( bp ) 140 mmhg , or diastolic bp 90 mmhg . subjects were considered as having t2 dm if they had been diagnosed as t2 dm in hospitals , or self - reported current treatment with insulin or oral hypoglycemic drugs . subjects were defined as having a stroke if they had a history of language or physical dysfunction continuing for more than 24 h and diagnosed using computerized tomography or magnetic resonance imaging . body weight was measured without heavy clothes and shoes to the nearest 0.1 kg by a calibrated weighing scale and height was measured barefoot using a fixed stadiometer to the nearest 0.1 cm . bmi is calculated as the ratio of weight to height squared ( kg / m ) . health - related quality of life was measured by the eq - 5d scales , developed by the euroqol group ( www.euroqol.org ) , well - validated and reliable in different cultures and various diseases including cardiac disease . the eq - 5d descriptive system consists of five dimensions of health on mobility , self - care , usual activities , pain / discomfort , and anxiety / depression . each dimension has three levels of response ( no problems , moderate problems , and severe problems ) , level 1 ( no problems ) was coded as a 1 and level 2 ( moderate problems ) was coded as a 2 and level 3 ( severe problems ) was coded as a 3 . for example , state 11111 indicates no problems on any of the 5 dimensions . the eq - 5d index score was generated by applying societal preference weights to each of the above five health dimensions according to a japan population - based time trade - off model and was calculated by adding up the weighted scores for all five dimensions . european quality of life 5 - dimensions also includes a separate 20 cm eq visual analog scale ( eq - vas ) to measure self - assessed health status . respondents were asked to indicate how good or bad his / her own health state on the day of assessment on a 100 - point scale , the end - points of which were labeled best imaginable health state and worst imaginable health state anchored at 100 and 0 ( rather like a thermometer ) , respectively . this information can be used as a quantitative measure of health as judged by the individual respondents . the compliance with drug treatment was evaluated in chd patients by the morisky - green test , which is a 4 - item medication adherence questionnaire ( maq ) containing the following questions : ( 1 ) have you ever forgotten to take your medicines ? ( 2 ) were you careless at times about taking your medicines ? ( 3 ) when you felt better , did you sometimes stop taking your medicines ? ( 4 ) sometimes , if you felt worse , did you stop taking your medicines ? score 1 for answering no to each of four questions and 0 for choosing yes . score equal to four points means good compliance and score less than four points means poor compliance . health quality was measured by eq - 5d index and eq - vas scores and compared using one - way anova or t - test among groups defined by sex , age , education level , marital status , household income per month , family 's population , bmi , physical activity , smoking status , drinking status , comorbidities , compliance with drug treatment and the five dimensions of eq - 5d . the dimensions of eq - 5d were dichotomized as no problems versus moderate / severe problems . continuous variables were presented as the means with standard deviations , and categorical variables were presented as percentages . stepwise multiple linear regression and unconditional logistic regression were used to explore the determinants of health quality using sex , age , education level , marital status , monthly household income , family 's population , bmi , physical activity , smoking status , alcohol drinking , comorbidities , compliance with drug treatment and duration of chd as independent variables . odds ratios ( ors ) and 95 % confidence intervals ( cis ) were obtained from logistic regression analysis . analyses were performed using spss version 22.0 ( ibm corp . , armonk , ny , usa ) , a p 0.05 as statistically significant . this was a cross - sectional study conducted from august to october , 2010 in rural communities of fangshan district , beijing , china , using a stratified cluster sampling technique . eligible subjects are native residents aged 40 years or older living locally for at least 5 years , with a confirmed diagnosis of myocardial infarction or angina by a class - two or higher hospital with electrocardiography findings , or a surgical history of coronary revascularization , coronary artery bypass or coronary stent implantation . subjects who were unable to answer the questionnaire and take part in physical examination personally were excluded . all questionnaires were administered through personal interview , information collected on socio - demographic characteristics ( age , sex , marital status , educational level , the family 's population , household income per month ) , lifestyle factors ( physical activity , cigarette smoking and alcohol consumption ) and comorbidities , including hypertension , type 2 diabetes mellitus ( t2 dm ) and stroke . marital status is divided into married and unmarried ( including single , divorced or widowed ) . past smokers were those who had smoked more than 100 cigarettes in the past but had quit smoking during the last month . current smokers were those who had smoked at least 100 cigarettes and had smoked during the last month . past drinking was defined as consuming alcohol at least once a week in the past but not in the previous month . current drinking was defined as drinking at least once per week and still drank at that frequency in the previous month . the average daily intake of current drinkers was calculated by dividing the total weekly amount of pure alcohol by 7 days . according to the daily intake of alcohol , current drinkers were categorized into four groups : low , moderate , high , and very high group ( for men 40 , 4160 , 61100 and 100 g / d , for women 20 , 2140 , 4160 and 60physical activity was defined as performing physical exercise for at least 30 min at least once per week during the previous 6 months , not including housework or job - related work . the frequency of physical activity was measured as : rarely / never , 14 times / week or 5 times / week . household income per month ( in renminbi , rmb ) was classified as 3000 rmb or higher , 20002999 rmb , 15001999 rmb , and 1500 rmb for first - to fourth - class rural areas , respectively . classification for body mass index ( bmi ) was : underweight as bmi 18.5 , normal weight as bmi 18.524.9 , overweight as bmi 25.029.9 and obesity as bmi 30.0 . subjects were defined as having hypertension if they were taking antihypertensive medications and / or having systolic blood pressure ( bp ) 140 mmhg , or diastolic bp 90 mmhg . subjects were considered as having t2 dm if they had been diagnosed as t2 dm in hospitals , or self - reported current treatment with insulin or oral hypoglycemic drugs . subjects were defined as having a stroke if they had a history of language or physical dysfunction continuing for more than 24 h and diagnosed using computerized tomography or magnetic resonance imaging . body weight was measured without heavy clothes and shoes to the nearest 0.1 kg by a calibrated weighing scale and height was measured barefoot using a fixed stadiometer to the nearest 0.1 cm . bmi is calculated as the ratio of weight to height squared ( kg / m ) . health - related quality of life was measured by the eq - 5d scales , developed by the euroqol group ( www.euroqol.org ) , well - validated and reliable in different cultures and various diseases including cardiac disease . the eq - 5d descriptive system consists of five dimensions of health on mobility , self - care , usual activities , pain / discomfort , and anxiety / depression . each dimension has three levels of response ( no problems , moderate problems , and severe problems ) , level 1 ( no problems ) was coded as a 1 and level 2 ( moderate problems ) was coded as a 2 and level 3 ( severe problems ) was coded as a 3 . for example , state 11111 indicates no problems on any of the 5 dimensions . the eq - 5d index score was generated by applying societal preference weights to each of the above five health dimensions according to a japan population - based time trade - off model and was calculated by adding up the weighted scores for all five dimensions . european quality of life 5 - dimensions also includes a separate 20 cm eq visual analog scale ( eq - vas ) to measure self - assessed health status . respondents were asked to indicate how good or bad his / her own health state on the day of assessment on a 100 - point scale , the end - points of which were labeled best imaginable health state and worst imaginable health state anchored at 100 and 0 ( rather like a thermometer ) , respectively . this information can be used as a quantitative measure of health as judged by the individual respondents . the compliance with drug treatment was evaluated in chd patients by the morisky - green test , which is a 4 - item medication adherence questionnaire ( maq ) containing the following questions : ( 1 ) have you ever forgotten to take your medicines ? ( 2 ) were you careless at times about taking your medicines ? ( 3 ) when you felt better , did you sometimes stop taking your medicines ? ( 4 ) sometimes , if you felt worse , did you stop taking your medicines ? score 1 for answering no to each of four questions and 0 for choosing yes . score equal to four points means good compliance and score less than four points means poor compliance . health quality was measured by eq - 5d index and eq - vas scores and compared using one - way anova or t - test among groups defined by sex , age , education level , marital status , household income per month , family 's population , bmi , physical activity , smoking status , drinking status , comorbidities , compliance with drug treatment and the five dimensions of eq - 5d . the dimensions of eq - 5d were dichotomized as no problems versus moderate / severe problems . continuous variables were presented as the means with standard deviations , and categorical variables were presented as percentages . stepwise multiple linear regression and unconditional logistic regression were used to explore the determinants of health quality using sex , age , education level , marital status , monthly household income , family 's population , bmi , physical activity , smoking status , alcohol drinking , comorbidities , compliance with drug treatment and duration of chd as independent variables . odds ratios ( ors ) and 95 % confidence intervals ( cis ) were obtained from logistic regression analysis . , armonk , ny , usa ) , a p 0.05 as statistically significant . there were 1989 eligible chd patients , of whom 1928 completed the questionnaires , aged 4088 ( mean age 61.649.24 ) years , 29.4 % men and 70.6 % women , and were enrolled for further analysis , with a response rate of 96.9 % . duration of chd ranged from 1 to 44 ( median 3 , 2575 percentiles 27 ) years . the mean score of eq - 5d index was 0.8890.172 , eq - vas score 71.5617.65 . among the five domains of hrqol , anxiety / depression problem occurred in the lowest proportion of 7.9 % patients , whereas pain / discomfort problem took the largest proportion of 24.3 % . study variables and the hrqol scores of chd subjects were presented and compared as shown in table 1 . although sex , comorbidity of hypertension , and compliance with drug treatment had no association with either eq - 5d index or eq - vas scores ( p 0.05 ) , significant associations were observed among other demographic and related variables ( p 0.05 ) . relationship between study variables and hrqol of chd patients * p 0.05 ; p 0.01 ; p 0.001 . bmi : body mass index ; hrqol : health - related quality of life ; chd : coronary heart disease ; eq - 5d : european quality of life 5 - dimensions ; sd : standard deviation ; eq - vas : european quality of life visual analog scale . multiple linear regression results in table 2 show that older age and stroke were negatively associated with a low eq - 5d index . physical activity , household income per month , alcohol drinking , and family 's population were positively related to high eq - 5d index . being married , physical activity , alcohol drinking , and family 's population were positively relevant with improving eq - vas scores . stepwise multiple linear regression analysis for the determinants of hrqol in chd patients * p 0.05 ; p 0.01 ; p 0.001 . b : standard error of regression coefficient ; hrqol : health - related quality of life ; chd : coronary heart disease ; eq - vas : european quality of life visual analog scale ; eq - 5d : european quality of life 5 - dimensions . logistic regression was performed for the five dimensions of eq - 5d to determine dimension - specific factors related to hrqol . ors , 95 % ci and p values are presented in table 3 . compared to patients of age 50 years , patients of age 80 years had more problems in mobility ( or = 3.236 ) , usual activities ( or = 3.440 ) , pain / discomfort ( or = 2.802 ) , and anxiety / depression ( or = 6.935 ) . patients aged 7079 years met with more problems in usual activities ( or = 2.151 ) , whereas patients of 5059 or 6069 years experienced more problems in anxiety / depression ( or = 2.934 and or = 3.379 , respectively ) . compared to patients with normal weight , obese patients ( bmi 30 kg / m ) had more problems in mobility ( or = 1.632 ) and pain / discomfort ( or = 1.633 ) , whereas underweight patients ( bmi 18.5 kg / m ) had more problems in pain / discomfort ( or = 2.431 ) . patients with stroke were more likely to exhibit problems in self - care ( or = 2.121 ) , usual activities ( or = 1.976 ) and mobility ( or = 1.465 ) , whereas patients with diabetes mellitus were more likely to have problems in anxiety / depression ( or = 1.774 ) . physical activity had positive effects on mobility ( 14 times / week : or = 0.462 ; 5 times / week : or = 0.495 ) , self - care ( 14 times / week : or = 0.457 ; 5 times / week : or = 0.354 ) , usual activities ( 14 times / week : or = 0.332 ; 5 times / week : or = 0.475 ) and pain / discomfort ( 14 times / week : or = 0.517 ; 5 times / week : or = 0.760 ) . patients living with 2 , 35 or 6 family members experienced less problems in mobility ( or = 0.505 , or = 0.318 and or = 0.424 , respectively ) . past smoking had negative effects on mobility ( or = 1.983 ) , self - care ( or = 2.592 ) , usual activities ( or = 2.613 ) and pain / discomfort ( or = 1.971 ) . low - , medium - , and high - alcohol drinking were associated with less problems in mobility ( or = 0.373 , or = 0.286 and or = 0.097 , respectively ) . past and medium alcohol drinkers had less problems in self - care ( or = 0.276 and or = 0.193 , respectively ) . high education level was protective factors for self - care ( or = 0.575 ) . compared to patients with monthly household income 1500 rmb , patients with 20002999 or 3000 rmb reported less problems in usual activities ( or = 0.505 and or = 0.430 , respectively ) , those with 20002999 rmb suffering less pain / discomfort ( or = 0.544 ) . logistic regression analysis for dimension - specific factors related to hrqol in chd patientshrqol : health - related quality of life ; chd : coronary heart disease ; bmi : body mass index ; or : odds ratio ; ci : confidence interval . several studies indicated that smoking , increasing age , lower education level , less household income , and comorbid stroke or diabetes mellitus were related to deteriorated hrqol of chd patients , which was similar to our study . this is inconsistent with previous studies which showed worse hrqol of female chd patients compared to male patients and may be partly due to a skewed sex ratio ( male 29.4 % , female 70.6 % ) in our study population , as a result of most skilled men working away in other cities , which is a common phenomenon in rural china . so far , the relationship between bmi and quality of life in patients with chd has not been particularly well - illustrated . several studies have shown that being overweight or obese ( bmi 25 kg / m ) was associated with greater survival in coronary artery disease patients compared to normal or idealkg / m ) had more problems in mobility ( or = 1.632 , p = 0.014 ) and pain / discomfort ( or = 1.633 , p = 0.006 ) , similar to previous reports which suggested that hrqol was impaired in chd patients with obesity compared to patients with a normal bmi . our results also indicated that underweight patients ( bmi 18.5 kg / m ) reported more problems in pain / discomfort ( or = 2.431 , p = 0.022 ) and exhibited the worst eq - 5d index in comparison to normal and overweight patients . this discrepancy may be attributed to different body composition among the study population , as well as effects of body fat and fat - free mass on hrqol . previous studies have demonstrated a j - or u - shaped association between alcohol drinking and the risk of chd . however , not all the studies replicated such type of association . in our study , certain alcohol drinking was related to better hrqol , as patients with medium or high drinking had less problems in mobility , self - care and usual activities , consistent with previous reports . a recent study revealed that moderate alcohol intake related to improved hdl - cholesterol , fibrinogen and markers of glucose metabolism , implicating reduced chd risk of moderate drinkers . heavy and binge drinking were also associated with favorable levels of chd biomarkers , and this may be a possible explanation for the negative relationship between alcohol drinking and chd risk . first , the study used a cross - sectional design and could not show the effects of changes in demographic and related factors over time on hrqol and provide causal information . we focused on the quality of life of chd patients and a control group without chd was not included . second , because of data availability , we were unable to obtain treatments received for chd , cardiac function , revascularization method and other clinical factors that may influence hrqol . third , there are more women than men in our study and selection bias may occur since generally men are affected more by chd than women . the strength of our study lies in its focus on the hrqol of chd patients in china and was carried out in representative residents of the rural northern han chinese . our data will be useful for future research in this field , and may provide more valuable information on hrqol in patients with chd when combined with other questionnaires , for example , questionnaires of seattle angina questionnaire , social support scale , and self - rating depression scale . in summary , this study suggests that older age , comorbid diabetes mellitus and stroke , obesity , underweight , less income , living alone , smoking , less physical activity , and lower education level are negative correlates of impairment of hrqol in chd patients . being married , having more physical activity , moderate alcohol drinking and big family are protective factors for hrqol in chd patients . clinicians could pay more attention to chd patients with these characteristics so as to optimize care and improve quality of life in this special population . further large - scale cohort studies should be conducted to confirm our results in the future .\noutput:\n" }, { "from": "agent", "value": "background : although coronary heart disease ( chd ) is one of the major cardiovascular diseases , risk factors associated with the health - related quality of life ( hrqol ) of chd patients remain unclear . the present study was designed to determine the profile and significant factors of the hrqol in chd patients.methods : a cross - sectional study was conducted in rural communities of fangshan district , beijing , china . socio - demographic , lifestyle , and comorbidity information of chd patients were collected by a structured questionnaire and medical records . hrqol was measured using european quality of life 5 - dimensions ( eq - 5d ) scale and eq visual analog scale ( eq - vas ) . multiple linear and logistic regressions were performed to explore the association of potential risk factors with hrqol scores and each eq - 5d , respectively.results : totally , 1928 chd patients ( mean age 61.64 9.24 years ; female : male = 2.4:1 ) were enrolled in the study . the mean score of eq - 5d index and eq - vas were 0.889 0.172 and 71.56 17.65 , respectively . multiple linear regression revealed that marital status , physical activity , moderate alcohol drinking , and family 's population were positive independent correlates of eq - vas , whereas diabetes mellitus and stroke were negative independent correlates ( all p < 0.05 ) . age and stroke were negatively while physical activity , moderate alcohol drinking , family 's population and household income were positively correlated with eq - 5d index ( all p < 0.05 ) independently . in addition , each of the five hrqol dimensions had various specific determinants , including obesity , underweight , smoking or education.conclusions : findings of the study highlight certain socio - demographic , lifestyle factors , and comorbid stroke or diabetes mellitus as correlates of hrqol in chinese chd patients . large - scale cohort studies should be carried out to confirm our results in the future ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in conventional pig production , pigs are usually kept without litter on slatted or at least partially slatted floors . these housing systems providing hygienic and economic benefits are often characterized by a barren environment with scant opportunities for playing or exploring and thus often not fulfilling natural behavioural needs of pigs . furthermore , group compositions may change for several times in pig 's life , and the social structure is disrupted . this procedure usually happens for the first time when piglets are weaned , a very stressful process , which can be accompanied by reduced well - being and health problems . after separating from the sow , unacquainted piglets of similar weight from different litters are mixed , and naturally they will fight to establish a novel social hierarchy . in order to avoid or reduce aggressive actions after weaning and mixing , several measures were already tried , such as odour masking agents , sedatives , regrouping pigs in darkness , or equipping the pen with a hiding place . most of these methods led only to a postponement of aggressive behaviour after mixing , without reducing it significantly . however , it was shown that environmental enrichment has the potential to reduce aggressive behaviour in groups of pigs and to avoid behavioural disorders . a novel topic of research in this context is environmental enrichment based on cognitive challenges . intentioned enrichment methods contain goal - directed learning behaviour and are carried out using aversive or rewarding reinforcers . these methods are expected to have immensely sustained potential to bring alternation as well as distraction and therefore to reduce boredom and abnormal behaviour , excitement , and fear behaviour . especially , enrichment devices which offer extrinsic reinforcement ( food , social access , etc . ) as a reward have proved to be effective . furthermore , cognitive tasks can lead to positive emotions , because of a controllability and predictability of the environment . especially the successful coping with challenges induces positive experience and can improve animal welfare . in addition , cognitive enrichment methods could be useful tools for an improved behavioural management having the potential to reduce unwanted behaviours and to reinforce desired behaviours . the mentioned methods are already applied for a long time in zoos to train animals for a better handling and to bring variety in animals ' daily life . furthermore , cognitive enrichment achieved positive results in studies with dogs . for farm animals , there are several investigations concerning learning behaviour in various farm animal species using , for example , acoustic cues to bring a desired reaction . moreover , there are already simple forms of learning in farm animal housing systems where animals have to differentiate between the functions of various areas of their environment or to remember the location of food . these specific behaviours can be quickly internalized , and the animals perform the required reaction automatically . concerning the cognitive abilities and learning behaviour of pigs , it was shown that the foraging behaviour is a very useful issue to study links between sensory abilities , cognitive challenges , and motivational processes . pigs ' auditory acuity is better than that of humans ; thus , acoustic signals can serve as discriminative stimuli , or as secondary or conditioned reinforcers . furthermore , pigs seem to like sweet tastes ; therefore , sweets are well suited as a reward for some challenges . in our study , we intended to investigate the suitability of cognitive enrichment based on a sound signal followed by a food reward for young piglets in order to reduce aggressive behaviour after weaning in conventional pig rearing systems . we used a feeder giving an acoustic signal to announce a reward in form of sweets , and suckling piglets were trained during 8 days before weaning to react on that sound . since we worked with young animals , the reward used in the training should be attractive to suckling piglets , should be practical to be applied under farm conditions , and should be based on previous behavioural experiments in piglets and grown pigs ; therefore , we used chocolate candies . piglets were expected to learn to respond to the sound , to stop their current activity , and to collect the food reward . using this method , an attempt was made to interrupt occurring fights between two piglets in resident - intruder confrontations by distracting the animals from aggressive behaviour . thus , our main approach was to study whether cognitive enrichment applied to young suckling piglets could be able in principle to enhance management and animal welfare in later production stages by reducing excessive aggression after mixing . the experiment was divided in two parts . in the first part of the study , suckling piglets were trained to react to the activation of an electronic dog feeder ( mannersminder - pet premier , llc ) . the piglets had to learn the link between a sound given by the feeder and a feed reward in form of chocolate candies during a training period of eight days . in the second part of the study , the potential of the learned behavioural responses to break or reduce aggressive behaviour between weaned piglets was tested using resident - intruder confrontations . four rounds of experiment were conducted at the research farm ruthe of the university of veterinary medicine hannover , foundation , germany . in the research farm , a total of 90 sows were kept , and every 2 weeks five to six sows gave birth to piglets . for our study , we used the piglets of two litters per round . in total ,78 mixed sex suckling piglets of the german national breeding programme ( bhzp ) in eight entire litters with eight to 12 piglets each were studied from july 2011 to august 2012 . in the beginning of the experiment , piglets were 25 days old with an average weight of 7 kg 1 kg . the suckling piglets were kept and trained in conventional farrowing pens ( 2.30 m 2.00 m ) with partially slatted floor where the sows were placed in farrowing crates as shown in figure 1 . in the beginning of the experiment , all piglets were weighed and individually marked using standard colour stock marker . the training consisted in the use of an electronic dog feeder that played a beep sound and dispensed chocolate candies after the sound . this equipment works based on a remote - controlled reward system that uses positive reinforcement for training dogs to behave appropriately at home and perform better in competitions . by rewarding desired behaviours , the system helps redirecting a dog 's focus away from barking at the door , jumping on guests , or begging at the table . in our study , the equipment was used in principle to arouse piglets ' curiosity and to train them to react on a sound followed by feed dispersion during a training period of 8 days . the feeder was placed on the wall of a farrowing pen with height of 0.6 m from the ground ( figure 1 ) . the feeder was activated by a remote control , and the observer stood outside the room to limit the contact with the animals . the training started when the pigs were 25 days old and ended the day before weaning at the age of 34 days , giving a total training period of 8 days with 2 days of weekend in between . training took one hour per day ( 10:0011:00 am ) , and during this time the electronic feeder was activated every 10 minutes , so that training was performed 5 times per day . all the training sessions within the 8 days of training were video recorded from a top view of the pen using two cameras , a guppy f - 080c ( allied vision technologies , germany ) with a sv - 035143.5 mm lens ( vs technology , tokyo , japan ) with resolution of 1032778 pixels and a guppy gc1350 ( allied vision technologies , germany ) with a pentax 4.8 mm lens ( pentax corporation , tokyo , japan ) and a resolution of 13601024 pixels . both cameras were connected to a computer with labview software ( 8.6 , national instrument , tx ) that recorded synchronised videos in mjpeg format with variable frame rates between 10 and 20 images per second . the computer 's processor was intel ( r ) core ( tm ) 2 quad cpu q9300 @ 2.50 ghz with 6 gb of physical memory . the second part of the study was conducted in the rearing pens after weaning of trained piglets . after 8 days of training , the animals were weaned , moved to the rearing house , and mixed in groups of 12 piglets balanced by weight and sex . per round , the mean weaning weight of all piglets was 9 kg 1 kg , with an average weaning age of 35 days . the animals were kept without litter on totally slatted floor ( 0.38 m per animal , animal : feeding place ratio 1.5 : 1 ) separated from other piglet groups by solid pen walls . three days after weaning , the reaction of piglets on the use of the electronic feeder was tested during aggressive interactions , such as fighting , biting , and mounting , in a resident - intruder test . for this test , an arena was formed by partitioning a portion ( 1.0 m 1.8 m ) of the home pen ( 1.85 m 1.8 m ) of a group of 12 trained piglets by using a black board made of strong plastic . the electronic feeder used during the training of suckling piglets was placed on the wall of the test arena ( figure 2 ) . the tests began at approximately 10:00 h in the morning , and the piglets were tested in a random order . the intruder piglet which came from another group of trained piglets was then collected from its home pen and placed into the test arena already containing the resident piglet . the observer stood nearby in a support at a higher level , so it was possible to see the whole area of the arena . the start of the test was defined as the time when the intruder was placed inside the arena , and it took on average 7 minutes of observation . if an attack occurred , the electronic feeder was activated in order to break the aggressive interaction . if no attack occurred within 7 minutes , the test was finished and the pairs were changed . in all other cases , the test was endedeither when an escalated attack occurred that could not be broken by the activation of the electronic feeder or after 5 minutes of aggressive interactions broken by the activation of the feeder . an escalated attack was defined as a sudden rapid sequence of bites delivered by one or both pigs . such attacks were quite distinctive , involving characteristic rapid movements of the head , and often the front legs would lift momentarily as the attacking pig 's rear legs accelerated it forward . single bites or head knocks did not lead to the end of a test , especially if they were broken by the activation of the feeder . at the end of a testthe 12 resident piglets were tested once a day with different partners for three days . all the encounters were recorded for later analysis using two cameras guppy ( described previously ) placed 2.0 m central above each pen in order to have a top view perspective . both cameras were connected to a computer with labview software ( 8.6 , national instrument , tx ) that recorded synchronised videos in mjpeg format with variable frame rates between 10 and 20 images per second . all recorded videos were analysed using the software labelling tool developed in matlab ( r2009a , the mathworks inc . , ma , usa ) . the analysed behaviour was the interest of the piglets towards the training commands , and for this reason , the number of piglets around the electronic feeder was registered 2 , 5 , 15 , 30 , 45 , and 60 seconds after the activation of the feeder . when analysing the resident - intruder test , from 82 recorded videos and a total of 268 episodes of interactions between two piglets , the observer identified which piglet started the aggressive interaction and as a consequence which piglet was the receiver . furthermore , it was analysed if they responded to the activation of the feeder or not , if a fight could be stopped or not , and which piglet responded first or if both or none of them responded . statistical analysis was carried out using the statistical software package spss , version 20 for windows . the univariate procedure in spss was used to assess data for normal distribution . when analysing the training data , anova analyses and post hoc tests according to student - newman - keuls test were conducted in order to find significant differences between the tested parameters . the data of resident - intruder test were compiled in frequency tables and contingency tables , and to identify significant differences , the chi - square test was used . table 1 shows the results of different training days concerning the reaction of the piglets after 2 , 5 , 15 , 30 , 45 , and 60 seconds of the activation of the feeder . in the first column , the reaction of the piglets towards the training is expressed as the mean percentage of piglets around the feeder after 2 seconds of feeder activation . although there was a significant difference between the second , the fifth , and the last day of training , the percentage of piglets around the feeder was not higher than 38 % on the eighth day of training . in contrast , 5 seconds after the feeder activation , we found a higher percentage of piglets around the feeder on all training days . there was a significant difference between the first day , the second day , and the eighth day of training with the highest percentage of piglets around the feeder on the eighth day of training ( 63 % ) . after 15 seconds of the activation of the feeder , the percentage of piglets around the feeder increased reaching a maximum of 67 % , and after 30 seconds of the activation of the feeder , the percentage of piglets around the feeder also increased going up to 69 % .45 seconds after feeder activation , the percentage of piglets around the feeder was lower than the seconds before , reaching a maximum of 61 % on day 3 .60 seconds after feeder activation , the number of piglets around the feeder was between 39 % on day 5 and 52 % on day 3 , showing a decrease of interest in the feeder during the last observation . for the reaction after 60 seconds , no significant difference throughout the training daysthe last line of table 1 shows the average result for the reactions of piglets in different seconds after feeder activation , independent of the training day . it can be seen that generally the number of piglets around the feeder waiting for chocolate candies increased from 2 seconds ( 29.56 % ) to 15 seconds ( 57 % ) after the feeder activation . after 15 sec , the percentage of piglets around the feeder decreased , and 60 sec after feeder activation , there were still 44 % of piglets around the feeder . in the resident - intruder test , piglets played different roles by being aggressors or receivers during a certain confrontation . in figure 3 , the kind of reaction was divided into none , stopped , and not stopped aggressive interactions , and it was noticed that , from the total number of 268 encounters , 79.5 % of the aggressive interactions could be stopped by the activation of the feeder . in figure 4 , it can be observed that in 99 % of cases only one piglet reacted first to the feeder activation , from 213 aggressive interactions that could be stopped . when we verified the aggressive interactions that could be stopped when the aggressor or the receiver reacted to the activation of the feeder , we observed that when the receiver responded , around 93.1 % of aggressive interactions were stopped , and when the aggressor responded , 96.7 % of fights were interrupted . in 6.9 % of cases , fighting did not stop although there was a reaction of the receiver to the sound signal , and in 3.3 % of the cases , the aggressor reacted on feeder activation ; however , piglets continued fighting ( figures 5 and 6 ) . furthermore , the reaction of the aggressor and of the receiver towards the feeder activation and also the amount of no reaction , meaning that the piglets engaged in a fight or there was neither an aggressive interaction nor a fight , was analysed . it was observed that the aggressors tended to react slightly more than the receivers related to the total number of interactions ( 45 % versus 38 % , figure 7 ) as well as those related to the total number of stopped fights ( 55 % versus 45 % , figure 8 ) . according to puppe et al . , foraging behaviour of pigs is a very useful issue to study links between sensory abilities , cognitive challenges , and motivational processes . additionally , it was already shown that pigs can differentiate an individual tone which is associated with a locally changing feeding site being able to remember a certain combination . the suitability of the use of an acoustic signal followed by a food reward for conditioning of piglets was also confirmed in our study . in contrast to other studies , where older pigs were trained , we used young suckling piglets , which were still in the farrowing crates with their mother sows , and we showed that even at this young age a food rewarded training was possible . for the training , similar results obtained by laughlin and mendl confirm the need for at least 10 days of training for 16 large white x landrace male pigs which were 1012 weeks old to remember some training commands and to display working behaviour related to these commands with a high successful rate . when analysing the different training days , we found that specifically from the third day of training , the piglets showed significant improvement regarding their response towards the training commands , and it continued until the end of the training , on the eighth day . usually , pigs need a certain time to get accustomed to a novel object or a change in their routine , so it is plausible to believe that , after the period of habituation , the piglets relaxed and learned quicker , presenting themselves in a higher percentage around the feeder . when mendl et al . trained eight large white landrace male pigs of 48 kg for performing a foraging task , they reported that cases of defecation , a possible indicator of fearfulness , were observed for maximum of 2 - 3 days after the training started . nevertheless , there were never 100 % of piglets of a litter around the feeder at the same time . as the piglets in our experiment were 2.5 weeks old when training started , they were still initiating with rooting behaviour and not very familiar with solid food . for this reason , the sow represented the most important food resource at that moment , having a bigger influence on the piglets ' behaviour than dry feed itself . it was already shown that even though creep feed was provided ad libitum , piglets relied mainly on the sow 's milk , which provides them not only nutrients but also immunoglobulins , bioactive proteins , and peptides stimulating the development of the stomach and small intestine . by the fact that the piglets were trained in the presence of the sow , it can possibly be explained why the percentage of the piglets around the feeder was not higher than 69 % in total . although the training was done in the morning when piglets were more active , 2 secondsafter the sound was played , that is , at the moment of the food release , the percentage of piglets around the feeder was not higher than 38 % . one possible reason for this result can be simply the amount of time that the piglets needed to approach the feeder because , on the other hand , after 5 , 15 , and 30 seconds after the activation of the feeder , the percentage of piglets around the feeder was much higher with 63 % , 67 % , and 69 % , respectively . another possibility can be the amount of time which was necessary to make the connection between the sound and process the information . when puppe et al . evaluated the learning behaviour of 112 castrated german landrace male pigs starting at the age of 7 weeks , they found that the animals , after 20 weeks of training , had a success rate of 80 % and the time spent from an acoustical signal to the release of food by a. worked with 24 german landrace pigs at the age of 16 weeks and reported the same time of 15 seconds from the time of the call until the pigs approached the feed , dispensed by an automatic feeding station , even after 7 weeks of training . in addition , croney found that pigs performed better on discrimination learning tasks when olfactory rather than visual stimuli were used . in this sense , a farm environment can be disturbing when taking into account the hearing of the animals , by the fact that equipment and other animals are emitting sounds at the same time . after 45 and 60 seconds of feeder activation , the number of piglets around the feeder decreased , which can be explained by the fact that chocolate candies were lacking and piglets lost interest at that latest moment of observation . also , held et al . . found that , generally , pigs are highly motivated if food is introduced as enrichment ; however , this motivation can vary when the level of competition is high and a constant amount of food is not maintained . the food release caused also competition between the piglets with the stronger piglets having privileged access to food . weaker piglets could probably only reach the food , when most chocolate candies were already eaten by stronger piglets . for technical reasons andbecause of lack of space , we could not offer a trough where all piglets were able to eat at the same time without disturbing each other . nevertheless , good training results were obtained , which were confirmed by a high efficiency of the feeder in interrupting aggressive interactions during the resident - intruder test . we showed that even under field conditions with limited space allowance in a conventional farrowing crate , it is possible to offer cognitive enrichment and to train young piglets to react on certain stimuli . to induce aggressive behaviour among two piglets and to act on individual animals , the method of resident - intruder confrontationwas chosen permitting a good overview and control of two interacting animals . using a resident - intruder situation , the training commands were proven to have positive effects during aggressive interactions since 79.5 % of all fights could be stopped by the activation of the electronic feeder , showing that cognitive enrichment is generally suitable to influence aggressive behaviour in piglets . from earlier studies , it is known that aggressive behaviour can be affected in principle by environmental enrichment . schaefer et al . showed the effectiveness of environmental enrichment in reducing total aggression and the improvement of animal growth by testing different materials such as car tires , sugar - mineral blocks , or teeter - totter . o'connell and beattie also verified significant less fights between animals raised in environments provided with straw . olsson et al . , who tried a different approach in their experimental design by providing sand to piglets in the farrowing unit in order to reduce aggressive interactions during resident - intruder confrontations , found that piglets raised in environments with no bedding materials inflicted more wounds on each other during dyadic confrontations . furthermore , the establishment of social dominance relationships was impaired in these animals compared to pigs from enriched rearing conditions . however , all of these methods of environmental enrichment have something in common which is that they were not using cognitive challenges and thus are different from our own study which is , to our best knowledge , the first study investigating the efficiency of cognitive enrichment to influence aggressive behaviour in pigs . regarding the number of piglets going to the feeder after the activation , we found that in 99 % of cases only one piglet responded immediately to the sound so that fighting stopped . this piglet could be the aggressor or the receiver , since we found no significant difference between the percentages of reaction of aggressor or receiver when an aggressive interaction was stopped by feeder activation ( 55 % versus 45 % ) . also regarding the total number of encounters , there was no significant difference between the number of reactions of aggressor or receiver ( 45 % versus 38 % ) . we found only a tendency for aggressors to react slightly better to the activation of the feeder in a resident - intruder situation than the receivers . however , if the aggressor or the receiver reacted was not important for the effectiveness of feeder activation on the interruption of fights . we saw similar high values of stopped fights when the aggressor or the receiver reacted ( 96.7 % versus 93.1 % of fights were stopped ) . in principle , our hypothesis was that the most aggressive pigs would probably be the best to react to the activation of the feeder , by the natural motivation of pigs for competing for resources , in our case , the chocolate candies . however , from our results , we conclude that it is not essential to influence the piglet that starts fighting in order to stop the aggressive behavior ; it can also be useful to act on the piglet that is attacked to interrupt a fight . thus , it was shown that the role that each piglet performed , as aggressor or as receiver , did not influence its response to the feeder activation , but it was also demonstrated that cognitive enrichment could have a high potential to interrupt fighting between two piglets . regarding aggressiveness in resident - intruder situations , several studies were already carried out ; however , no information was found concerning the reactions of piglets on different actuators during fighting . when erhard and mendl and d'eath tested piglets in resident - intruder situations , they could not find any connection between being the resident or intruder during a confrontation and its aggressive score , as well as no connection regarding sex , age , and body weight . from these results , it can be concluded that the performed behaviour in a resident - intruder confrontation is mainly caused by individual differences in aggressiveness expressed by different piglets . individual differences in aggressiveness were already reported in other studies searching for behavioural parameters related to aggression . d'eath and burn , who analysed the performance of piglets in a backtest , could not find a connection between being high or low resistant and individual aggressiveness . however , when erhard et al . and bolhuis et al . evaluated high or low resistant pigs after mixing , high resistant pigs were shown to be more aggressive towards their penmates . spake et al . tested whether there was a correlation between the backtest performance as an indicator of aggressive behaviour in a resident - intruder test and the connection between fear / curiosity in response to a novel object test . neither the backtest nor the novel object test performances were behavioural indicators for aggressiveness in a resident - intruder test . individual differences in coping style towards a certain situation may also explain why in our study no relationship between being aggressor or receiver , and the reactions to feeder activation were found . in this study , it was shown that cognitive enrichment based on connecting a sound signal to a food reward applied in young suckling piglets can be used to influence aggressive behaviour in resident - intruder confrontations after weaning . we showed that it is possible to train piglets under practical conditions in their farrowing crates to react on a sound signal which can be used after weaning , to influence their behaviour , particularly during aggressive interactions . thus , we conclude that cognitive enrichment is generally suitable for pigs even at a very young age having the potential to affect behaviour in later production stages . further research is needed to investigate if this kind of enrichment can also be used to interrupt aggressive interactions of pigs kept in groups , and thus , could attain practical relevance .\noutput:\n" }, { "from": "agent", "value": "it is known that pigs raised in enriched environments express less aggressive behaviour . for this reason , a new method of cognitive environmental enrichment was experimented at the university of veterinary medicine hannover , germany . in the first phase , 78 suckling piglets were trained to learn the link between a sound given by an electronic feeder and a feed reward in the form of chocolate candies during a period of 8 days . in the second phase , the same piglets were used in resident - intruder tests to verify the potential of the feeding system to interrupt aggressive behaviour . the analysis of all training rounds revealed that piglets learned the commands during 8 days of training and the interest of the piglets increased within training days ( p < 0.05 ) . in the resident - intruder test , 79.5 % of aggressive interactions were broken by feeder activation . in interactions where either the aggressor or the receiver reacted , a high number of fights were stopped ( 96.7 % versus 93.1 % ) indicating that it was not relevant if the aggressor or the receiver responded to the feeder activation . we conclude that the electronic feeding system has the potential to be used as cognitive enrichment for piglets , being suitable for reducing aggressive behaviour in resident - intruder situations ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the discipline of endogenous morphine research has experienced a prolonged gestational period of nearly four decades , often marked by skepticism and prejudicial disregard from a significant portion of the scientific community . within the last decade , however , a wealth of complementary biochemical , molecular , and physiological studies emanating from major independent laboratories has provided indispensable self - validating , foundation data sets to solidify the status of endogenous morphine research as a vital component of the biological sciences . briefly , indisputable q - tof tandem mass spectrometry has confirmed the presence of low steady - state levels of chemically authentic morphine in diverse animal cells and organ systems . biochemical studies have characterized multiple enzyme - catalyzed reactions and chemically defined intermediate precursor molecules within a regulated biosynthetic pathway that display striking similarities to the plant biosynthetic scheme previously established in papaver somniferum . preclinical and clinical studies have demonstrated regulated expression of endogenous morphine upon physiological demand in normative regulatory processes and in dysregulatory disease states . as a unifying principle , our laboratory has identified and characterized a cellular morphinergic signaling pathway functionally linked to constitutive nitric oxide production and mediated by cognate mu3 and mu4 opiate receptors . in light of the above , we engage the privilege of historical hindsight to propose that clinical observations stemming from widespread employment of restorative l -3,4-dihydroxyphenylalanine ( l - dopa ) therapy for management of dyskinesia in parkinson s disease ( pd ) patients implicate a regulatory role for endogenous morphine in central nervous system ( cns ) dopamine ( da ) neurotransmission . reciprocally , it appears that restorative l - dopa administration has provided us with a compelling in vivo pharmacological model for targeting peripheral sites involved in endogenous morphine expression in human subjects . it is twenty years since the publication of a clinical report indicating an approximate 20 fold enrichment of morphine , codeine , and the benzylisoquinoline ( biq ) alkaloid tetrahydropapaveroline ( thp , also called norlaudanosoline ) in the urine of parkinson s disease ( pd ) patients receiving l - dopa replacement therapy , as compared to naive healthy controls . the study was closely followed by a 1993 case report that quantified thp concentrations in the urine of 3 pd patients treated with l - dopa - carbidopa formulated as sinemet . in confirmation of the earlier report , the second study demonstrated marked increases in urinary thp concentrations that were roughly correlated with low , medium , and high administered dosages of l - dopa - carbidopa . these collected results provide putative evidence that endogenous morphine and codeine are synthesized in vivo utilizing l - dopa and / or da via the well characterized pictet - spengler condensation product thp as an early intermediate precursor molecule . a later report demonstrated stereoselective expression of the ( s ) enantiomer of thp in human brain , thereby providing additional support for a regulated pathway of de novo synthesis of endogenous morphine via enzymatic o - and n - methyl transferase conversion of ( s ) - thp to ( r ) - reticuline . interestingly , the reports cited above are also confirmatory of a 1987 preclinical study demonstrating dramatic increases in rat brain concentrations of thp subsequent to peripheral co - administration of l - dopa and ethanol . despite an excessively high concentration of ethanol ( 3 g / kg ) that was administrated via the intraperitoneal route , it is apparent that a rapid synthesis of thp was accomplished over a 12 hour time frame . a first approximation of the rate of conversion of administered l - dopa to thp yielded a value of approximately 0.1 % . of equal importance , a compartmental model emerges whereby thp is rapidly synthesized at peripheral sites , followed by rapid blood brain barrier transport into the cns . at this time , a cogent mechanism of peripheral thp biosynthesis in the presence or absence of ethanol has not been elucidated . retrospectively , the contention of prominent scientists in alcohol addiction research that thp represents an aberrant and biologically deleterious da derivative that is markedly enhanced by ethanol , an ethanol metabolite such as acetaldehyde , or an enzyme involved in ethanol metabolism , i.e. , acetaldehyde dehydrogenase appears to be critically flawed by the presence of thp in the urine of healthy , alcohol nave , subjects . furthermore , the reluctance of alcoholism researchers to embrace thp as a naturally occuring morphine precursor is saliently at odds with preclinical studies demonstrating marked reductions of alcohol intake by opiate antagonists such as naloxone and naltrexone and widespread clinical employment of naltrexone as a frontline pharmacotherapy for treatment of alcohol dependence . in contrast to alcoholism research , there appeared to be a greater depth of critical thinking among pd researchers that pertained to positive and negative biological effects of thp and related tetrahydroisoquinoline alkaloids subsequent to l - dopa administration . despite a series of preclinical studies drawing a functional association between aberrant da metabolism , cellular expression of thp and related tetrahydroisoquinoline alkaloids , and the etiology of pd , select clinical studies were supportive of positive therapeutic effects of pharmacologically administered morphine for treatment of pd dyskinesias . of potentially greater significance , a small body of biochemical and pharmacological studies demonstrated normative expression of thp and related tetrahydroisoquinoline alkaloids within the adrenal medulla and their associated regulatory activities on catecholamine synthetic and metabolic enzymes . spector s laboratory was the first to quantify relatively high concentrations of chemically authentic morphine and codeine in rat adrenal gland . interestingly , levels of the penultimate morphine precursor codeine were found to be greater than those of morphine , suggesting a precursor to product biosynthetic relationship of the two opiate alkaloids in this glandular tissue . relatively recently , our group has provided extensive empirical evidence supporting the role of the adrenal medulla as a major pheripheral site of endogenous morphine expression and physiological hot spot for opiate regulation of adrenergic sympethetic activities . based on the collective complementary lines of evidence presented above , we propose that restorative l - dopa therapy for chronic management of pd patients represents an in vivo substrate loading model of rapid thp synthesis within peripheral sites , notably the adrenal medulla . consistent with previous biochemical analyses , thp is further converted to key intermediate precursors within the morphine biosynthetic scheme , i.e. , reticuline and salutaridine , at additional peripheral sites such as the liver , or is rapidly transported into the cns . in support of these contentions , a prior clinical report has monitored relatively high concentrations of morphine and codeine in the cerebrospinal fluid ( csf ) of healthy , opiate nave , human volunteers and implicates a regulatory role for endogenous morphine in normative cns da neurotransmission and as a potent restorative agent expressed from pharmacological administration of l - dopa to pd patients . historically , the identification of thp as a biologically active pictet - spengler condensation product of da and 3,4 - dihydroxyphenylacetaldehyde ( dopal ) preceded the identification of low steady - state levels of immunologically detectable morphine in several species of mammalian brain . a similar enzymatic step in papaver somniferumis mediated by the biosynthetic enzyme nococlaurine synthase that catalyzes an asymmetric pictet - spengler condensation of da and 4 - hydroxyphenylacetaldehyde to yield ( s ) - norcoclaurine , the plant equivalent of thp ( figure 1 ) . de novo biosynthesis and utilization of endogenous morphine by animal systems is governed by a complex set of regulatory controls that reflect both evolutionary conservation and divergent adaptation of biochemical , molecular , and cellular processes required for the emergence , elaboration , and maintenance of da - ergic and related catecholaminergic signaling systems . morphine , da , and catecholamine synthesis and metabolism share a similar set of l - tyrosine - related substrates and enzymes activities . the role of endogenous morphine as an evolutionary model in the adaptation and maintenance of da and catecholamines as predominant signaling molecules in relatively simple and complex nervous / cns structures defines its biological presence as an autocrine / paracrine regulator of cellular homeostasis . the biological activities underlying endogenous morphine expression and its interaction with its major precursor da strongly suggest that endogenous morphine systems are reciprocally dysregulated in pd .\noutput:\n" }, { "from": "agent", "value": "summaryclinical observations stemming from widespread employment of restorative l -3,4-dihydroxyphenylalanine ( l - dopa ) therapy for management of dyskinesia in parkinson s disease ( pd ) patients implicate a regulatory role for endogenous morphine in central nervous system dopamine neurotransmission . reciprocally , it appears that restorative l - dopa administration has provided us with a compelling in vivo pharmacological model for targeting peripheral sites involved in endogenous morphine expression in human subjects . the biological activities underlying endogenous morphine expression and its interaction with its major precursor dopamine strongly suggest that endogenous morphine systems are reciprocally dysregulated in pd . these critical issues are examined from historical and current perspectives within our short review ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: osteoarthritis ( oa ) is a common degenerative joint disorder associated with chronic pain and disability at older age . in recent years , peripheral and central sensitizationshave been suggested as two of the underlying mechanisms of pain in osteoarthritis1 , 2 . it is known that patients with osteoarthritis experience nociceptive and neuropathic pain to varying degrees1 , 3 . furthermore , addition of molecules targeting neuropathic pain to conventional therapy has been shown to improve treatment response in the management of osteoarthritis4 . the paindetect questionnaire does not require a clinical examination and has been shown to be more sensitive and specific compared with other questionnaires5 . it has been used in most of the studies investigating neuropathic pain ( np ) in patients with osteoarthritis . the paindetect scale was demonstrated to be an important tool for evaluation of a pain phenotype associated with augmented central pain perception3 . studies examining np in patients with osteoarthritis have often utilized neuropathic pain questionnaires and quantitative sensory testing for pressure - pain thresholds ( ppts ) 2 , 3 , 6 . no study was identified in the literature that used an electrical pain threshold for quantitative sensory testing in patients with knee osteoarthritis . furthermore , femoral condylar cartilage thickness has been shown to be an important parameter for monitoring patients with knee osteoarthritis7 . to the best of our knowledge , there is no study in the literature that has explored the association between neuropathic pain and femoral cartilage thickness ( fct ) assessed by ultrasound ( us ) . in the present study , we aimed to evaluate the neuropathic component of pain in patients with knee oa using the paindetect questionnaire , electrical sensory threshold , and electrical pain threshold . additionally , we sought to determine the association of neuropathic pain with several parameters including femoral cartilage thickness , radiological grade , pain severity , functional state , depression , anxiety , and quality of life . the study enrolled 60 patients over the age of 40 who were admitted to our physical therapy outpatient clinics with knee pain and diagnosed with knee oa according to the american college of rheumatology ( acr ) criteria . patients with a history of trauma or surgical operation in the knee region , inflammatory rheumatic disease , central or peripheral neurological disorder , diabetes mellitus , or severe cardiac , pulmonary , or malignant disease were excluded from the study . demographic characteristics including age , gender , height , body weight , body mass index ( bmi ) , and duration of symptoms were recorded for all patients . patients were asked to score the severity of their current knee pain on a 10 - cm visual analogue scale ( vas ) . radiographic grading of oa was performed using the kellgren - lawrence ( k - l ) grading system and anterior - posterior x - ray views of the knee8 . the presence of neuropathic pain in study patients was assessed using the paindetect questionnaire . the paindetect total score is obtained by summing the scores for 7 pain symptom items with the scores for the pain course pattern item and the pain radiation item . a score between 012 indicates that a neuropathic pain component is unlikely , a score between 1318 indicates that the result in ambiguous , and a score between 1938 indicates that a neuropathic pain component is likely . validity and reliability of a turkish version of the paindetect questionnaire were demonstrated by alkan et al9 . functional state of the participants was assessed using the western ontario and mcmaster universities osteoarthritis index ( womac ) . the womac consists of 24 questions that assess pain , stiffness , and problems with physical activities . the patient answers all questions on a 5 - point likert - type scale , and the total score ranges from 0 and 96 . validity and reliability of a turkish version of the index were demonstrated by tuzun et al10 . psychological state of the patients was evaluated using the hospital anxiety and depression scale ( hads ) . the hads is a 14 - item scale ; seven of the items relate to symptoms of anxiety , and seven relate to depressive symptoms . each item in the questionnaire is scored from 0 to 3 , and a person can score between 0 and 21 for either anxiety or depression . validity and reliability of a turkish version of hads were demonstrated11 . the subscales are vitality , physical functioning , bodily pain , general health perceptions , physical role functioning , emotional role functioning , social role functioning , and mental health . a score of 0 is equivalent to maximum disability ( poor quality of life ) , and a score of 100 is equivalent to no disability ( good quality of life ) . validity and reliability of a turkish version of the sf - 36 were demonstrated by kocyigit et al12 . electrical sensory threshold and electrical pain threshold measurements were obtained using a compex - 3 electrical stimulator for all patients . during measurement , a rectangular current pulse with a pulse duration of 1 millisecond was used for electrical stimulation13 . measurements were obtained from the medial compartment of both knees using the first dorsal interosseous muscle of both hands as the control point . a passive 55 cm electrode and an active pen electrode were used for measurement . the strength of stimulation was gradually augmented until the patient reported sensation , and the lowest strength at which the patient reported sensation was recorded as the electrical sensory threshold ( est ) in milliamperes ( ma ) . then , the current strength was increased , and the strength at which the patient reported pain was taken as the electrical pain threshold ( ept ) . measurements were repeated three times at an interval of 20 minutes at each site , and averaged values were analyzed . the thicknesses of the medial femoral condyle , intercondylar , and lateral femoral condyle cartilages were measured in both knees using a mindray dc - t6 us device ( mindray , shenzhen , pr china ) and a linear 510 mhz probe . subsequently , recorded video images of all patients were interpreted by the same person , and cartilage thickness values were obtained . measurements were repeated three times for both knees , and averaged cartilage thickness values ( in millimeters ) were analyzed . statistical analyses of study findings were performed using ibm spss statistics for windows version 19.0 . for analysis of study data , descriptive statistical methods ( mean , median , standard deviation , minimum - maximum ) were used , as well as student s t - test for between - group comparisons of normally distributed quantitative data and the mann - whitney u test for between - group comparisons of non - normally distributed quantitative data . correlations between paindetect scores and other parameters were explored using spearman s correlation analysis . results were interpreted at a 95 % confidence interval with the significance level set at p 0.05 . the mean ( sd ) age of the 60 patients was 62.910.5 years . demographic data such as gender distribution and mean body mass index are shown in table 1table 1 . characteristics of the study participantscharacteristic ( n = 60 ) valueage , years62 .910.5 gendermale14 ( 23.3 % ) female46 ( 76.7 % ) bmi , kg / m29 .64.9 duration of symptom , years4 .5 ( 120 ) pain ( vas ) 6.11.9 paindetect score11 .76.6 womac total score51 .219.4 depression score6 .43.6 anxiety score7 .74.6 kellgren lawrence grade2 ( 24 ) median ( minimum maximum ) . bmi : body mass index ; vas : visual analog scale ; womac : western ontario and mcmaster universities osteoarthritis index . paindetect scores were 13 or greater in 28 patients and ranged between 0 and 28 . the mean womac , depression , and anxiety scores are presented in table 1 . bmi : body mass index ; vas : visual analog scale ; womac : western ontario and mcmaster universities osteoarthritis index correlation analyses conducted for all 60 patients with gonarthrosis showed that paindetect scores were strongly positively correlated with vas and womac scores ( p = 0.000 ) . however , paindetect scores negatively correlated with sensory threshold and pain threshold measurements of the knees . pain duration , radiological grade , and femoral cartilage thickness values did not show significant correlations ( table 2table 2 . relations between paindetect score and other parameterspaindetect correlation coef . pain duration0 .014 coef . : coefficient ; fct : femoral cartilage thickness ; k - l : kellgren - lawrence ; st : sensorial threshold ; pt : pain threshold ; vas : visual analog scale ; womac : western ontario and mcmaster universities osteoarthritis index ) . . coef . : coefficient ; fct : femoral cartilage thickness ; k - l : kellgren - lawrence ; st : sensorial threshold ; pt : pain threshold ; vas : visual analog scale ; womac : western ontario and mcmaster universities osteoarthritis index patients were divided into two groups based on their paindetect scores ; patients with a score of 13 or greater were considered to have neuropathic pain , and those with a score of less than 13 were considered to have no neuropathic pain . based on this classification , there were 28 ( 46.7 % ) patients in the neuropathic pain group and 32 ( 53.3 % ) patients in the non - neuropathic pain group . the two groups did not differ with respect to mean age , gender distribution , body mass index , and radiological grade ( table 3table 3 . comparison of patients with or without neuropathic paincharacteristicswith neuropathic pain group ( n = 28 ) without neuropathic pain group ( n = 32 ) age , mean ( sd ) , years62 .59.663.311.2 gender ( female ) , n ( % ) 21 ( 75 % ) 25 ( 78.1 % ) bmi , mean ( sd ) , kg / m29 .84.629.45.3 duration of pain , mean ( sd ) , years5 ( 115 ) 4 ( 120 ) radiological grade , n ( % ) grade 21723grade 367grade 452pain ( vas ) , mean ( sd ) 7.11.35.31.9 ** womac , mean ( sd ) 63.710.140.718.7 *** depression score , mean ( sd ) 7.63.85.33.2 * anxiety score , mean ( sd ) 9.55.16.13.7 * knee st , mean ( sd ) , ma11 .82.815.15.1 * knee pt , mean ( sd ) , ma25 .66.331.18.8 * fctmedial , mean ( sd ) , mm1 .70.201.70.16 fctintercondylar , mean ( sd ) , mm1 .90.141.90.19 fctlateral , mean ( sd ) , mm2 .00.141.90.18 median ( minimum maxsimum ) . * bmi : body mass index ; fct : femoral cartilage thickness ; ma : miliampere ; mm : milimeter ; pt : pain threshold ; sd : standard deviation ; st : sensorial threshold ; womac : western ontario and mcmaster universities osteoarthritis index ) . the neuropathic pain group was found to have greater mean vas , womac , and depression , and anxiety scores compared with the non - neuropathic pain group . however , the neuropathic pain group had lower sensory and pain threshold values on average in both knees in comparison with the other group ( p 0.05 ) . medial femoral , intercondylar , and lateral femoral cartilage thickness values did not differ between the two groups ( table 3 ) . bmi : body mass index ; fct : femoral cartilage thickness ; ma : miliampere ; mm : milimeter ; pt : pain threshold ; sd : standard deviation ; st : sensorial threshold ; womac : western ontario and mcmaster universities osteoarthritis index table 4table 4 . comparison of sf - 36 scores between groupswith npwithout npsf - 36 subscalemedian ( min max ) median ( min max ) physical functioning20 ( 090 ) 40 ( 090 ) * role physical0 ( 0100 ) 25 ( 0100 ) bodily pain32 ( 1074 ) 52 ( 3184 ) ** vitality35 ( 1080 ) 45 ( 10100 ) general health55 ( 1577 ) 67 ( 2092 ) * social functioning37 .5 ( 12.5100 ) 62.5 ( 12.5100 ) role emotional33 .3 ( 0100 ) 66.7 ( 0100 ) mental health60 .0 ( 2088 ) 72 ( 2096 ) * physical component28 .5 ( 15.148.1 ) 36.9 ( 18.352.2 ) * mental component41 .5 ( 22.562 ) 50.3 ( 19.466 ) * p 0.05 ; * * p 0.01 . np : neuropathic pain ; sf - 36 : short form - 36 shows comparison of the two groups with regard to scores for the sf - 36 quality of life scale . the neuropathic pain group had lower scores in physical functioning , bodily pain , general health perceptions , mental health , and physical component scores compared with the non - neuropathic pain group . no significant difference was found between the two groups in the scores for other sf - 36 subscales ( table 4 ) . * p 0.05 ; * * p 0.01 . in contrast to nociceptive pain , neuropathic pain is characterized by burning , stabbing , and throbbing pain and can not be treated adequately with conventional pain management modalities . a significant association was not found between the severity of radiological joint damage and disease symptoms in patients with osteoarthritis14 . thus , it was suggested that some mechanisms other than nociceptive mechanisms may be involved in pain formation in oa patients2 . studies have shown evidence of central pain sensitization in patients with knee osteoarthritis2 , 3 . paindetect scores of 13 or greater were demonstrated in only 8.6 % of patients by soni et al. 15 and 20.6 % of patients by ohtori et al16 . hochman et al . reported neuropathic symptoms in 34 % of patients with knee osteoarthritis17 . . found that 25 out of 50 patients with knee osteoarthritis ( 50 % ) had paindetect scores of 13 or greater1 . means of quantitative sensory testing are available that examines pain threshold values obtained by application of heat , pressure , and electrical stimulation for assessment of central sensitization13 , 18,19,20 . according to finan et al . . these results are consistent with our findings showing lower est and ept values in the knee region . there is no study available in literature that has used ept for quantitative sensory testing in patients with knee osteoarthritis , so we could not directly compare our findings with any other study . showed that heat , pain , and mechanical pain sensitivity were associated with paindetect scores15 and moreton et al . detected a correlation between lower ppt and higher paindetect scores in patients with knee oa3 . our results showed that increased pain severity was associated with an increase in the neuropathic pain component . this finding is also consistent with literature data showing that increased pain severity correlates with higher neuropathic pain scores as assessed by questionnaires1 , 16 , 17 , 21 . higher womac scores observed in patients with neuropathic pain in our study are also consistent with the literature1 , 16 , 17 . to the best of our knowledge , there is no study in the literature that has explored the association between neuropathic pain and femoral condylar cartilage thickness assessed by ultrasound . in a study by roubille et al . , no difference was found between patients with our without neuropathic pain with respect to cartilage volumes as detected by magnetic resonance imaging scans1 . this finding is consistent with our results , which showed no association between femoral cartilage thickness and paindetect scores . our finding of no association between neuropathic pain and radiological oa severity was similar to the result of ohtori et al16 . in the current study , ohtori et al . also reported no association between paindetect scores and age or duration of disease16 . based on our findings , quality of life decreases with increased neuropathic pain scores in patients with knee osteoarthritis . hyperalgesia and poor quality of life were shown to be associated in patients with knee osteoarthritis6 . there are other studies that have reported an association between higher paindetect scores and decreased quality of life in patients with osteoarthritis22 . the presence and severity of neuropathic pain are known to have an adverse effect on the quality of life in several conditions aside from rheumatic diseases23 . while there are no studies that have adequately examined the association of neuropathic pain with mood in patients with knee osteoarthritis , it is well known that greater pain severity is associated with depressive symptoms2 , 24 . the findings of hochman et al . , which showed an association between depression and neuropathic pain , support our result21 . according to nielsen et al . , pain modulation is impaired in patients with knee osteoarthritis due to dysfunctional endogenous pain inhibiting mechanisms25 . it has also been reported that peripheral nociceptors may be sensitized by , for example , an inflamed synovium and damaged subchondral bone and that chronic nociceptive stimulations may drive central sensitization and neuropathic pain26 . in conclusion , in light of our findings and published literature data , there seems little doubt about the existence of a neuropathic component of the pain associated with knee osteoarthritis . neuropathic pain appears to occur predominantly in patients with severe pain and reduced functional capacity and to be not associated with radiological grade , cartilage thickness , or disease duration . it is obvious that quality of life is impaired and mood is adversely affected in patients with neuropathic pain from knee oa . for this reason , treatment approaches focusing on the neuropathic pain component should not be overlooked while treating knee osteoarthritis .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] the aim of this study was to investigate whether neuropathic pain is associated with femoral condylar cartilage thickness , electrical pain threshold , and clinical parameters in patients with knee osteoarthritis . [ subjects and methods ] sixty patients over the age of 40 diagnosed with knee osteoarthritis were enrolled . the paindetect questionnaire , western ontario and mcmaster universities osteoarthritis index , hospital anxiety and depression scale , and short form - 36 questionnaire were completed for all patients . electrical sensory threshold and electrical pain threshold measurements were obtained . femoral condylar cartilage thickness was determined by means of ultrasound . [ results ] paindetect scores of 13 or greater were observed in 28 ( 46.7 % ) patients , indicating the presence of neuropathic pain . these patients were found to have greater average pain severity , western ontario and mcmaster universities osteoarthritis index , and depression and anxiety scores and lower short form - 36 scores than patients without neuropathic pain . patients with neuropathic pain showed lower knee electrical sensory threshold and pain threshold values on average than patients without neuropathic pain . femoral condylar cartilage thickness was not different between the two groups . [ conclusion ] neuropathic pain is associated with increased pain severity and decreased functional capacity and adversely affects quality of life and mood in patients with knee osteoarthritis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: depression and inflammatory biomarkers have both been proposed as novel coronary heart disease ( chd ) risk markers . evidence suggests that their cooccurrence is not random , but is driven by depression as a risk factor for the occurrence and progression of chd . this link is thought to be due , in part , to the impact that depression has on neuroendocrine pathways that influence the pathogenesis and progression of coronary atherosclerosis and subsequent heart disease . these include inflammatory markers , particularly high - sensitivity c - reactive protein ( hs - crp ) . some studies suggest that the existence of a possible psychoneuroimmune link between negative affectivity ( depression , anger and anxiety , poor subjective wellbeing ) , inflammatory markers , and the development and progression of chd . several behavioral and psychosocial factors , particularly depression , appear to increase the risk for acute coronary syndrome events independent of traditional risk factor status . a meta - analysis of 11 cohort studies suggests that depression , assessed by self - reported symptoms or by formal psychiatric evaluation , significantly predicts risk for first chd events independent of established chd risk factors . similarly , elevated inflammatory biomarkers , hs - crp in particular , have been established as risk markers for incident chd events , and there are reports describing the underlying cellular and molecular mechanisms by which these biomarkers facilitate the development of atherosclerosis . although depression and hs - crp are both associated with chd events , less is known about their possible association with each other . a review of nhanes iii data indicated that a history of major depression was associated with a 64 % increase in the risk of having an elevated hs - crp level . however , the association between depression and hs - crp was much stronger among men than among women , an observation also reported in europe and israel . the goal of the present study was to analyze the relationship between hs - crp and depression scores in healthy adults using longitudinal analysis , and to examine potential gender differences . this is important because , as pointed out by shimbo and colleagues , cross - sectional data can not determine the temporal nature of the relationship . we utilized available data from the seasonal variation in blood cholesterol levels ( seasons ) study , which was designed to describe and prospectively delineate the nature and causes of seasonal variation in blood lipids , and is described in detail elsewhere . the seasons database provides a unique opportunity to examine the relationship of depression and hs - crp in healthy adults by gender over a one - year time period , while controlling for a variety of socio - economic , anthropometric , physiologic , dietary , physical activity , and psychosocial factors . the seasons study population consisted of 641 healthy adults , aged 20 to 70 years , enrolled at the fallon healthcare system , a health maintenance organization in central massachusetts . eligible subjects , ( 1 ) were not taking cholesterol - lowering medications ; ( 2 ) were not following a lipid - lowering or weight - control diet ; ( 3 ) were not working night shifts ; ( 4 ) were free from possible causes of secondary hypercholesterolemia ( e.g. , hypothyroidism , pregnancy ) ; ( 5 ) did not have a chronic life - threatening illness ( e.g. , cancer , renal disease , or heart failure ) , and did not have evidence of clinical atherosclerotic disease such as coronary disease , stroke , or peripheral vascular disease . subjects were followed prospectively for one year , during which time quarterly measurements were made of their serum lipids , hs - crp , diet , physical activity , anthropometric measures , light exposure , and psychosocial factors . subjects were recruited between december 1994 and february 1997 and enrollment occurred throughout the calendar year . the institutional review boards of the fallon healthcare system and the university of massachusetts medical school approved all subject recruitment and data collection procedures . during each visit , a 12 - hour - fasting blood sample was collected between 7 and 10 am . nader rifai 's laboratory , in boston , ma , and hs - crp was measured using latex - enhanced immunonephelometric assays on a bn ii analyzer described previously . inter - assay and intra - assay coefficients of variation for hs - crp were in compliance with cdc - accepted ranges . in addition , we excluded 66 ( 3 % of total ) crp values greater than 10 mg / l from this analysis because such elevated values are likely to be caused by acute infection or underlying medication problemsthe bdi is a questionnaire developed to measure the intensity , severity , and depth of depressive symptoms . it is composed of 21 questions , each designed to assess a specific symptom common among people with depression . bdi items assess mood , pessimism , sense of failure , self - dissatisfaction , guilt , punishment , self - dislike , self - accusation , suicidal ideas , crying , irritability , social withdrawal , body image , work difficulties , insomnia , fatigue , appetite , weight loss , bodily preoccupation , and loss of libido . items 1 to 13 assess symptoms that are psychological in nature , while items 14 to 21 assess more physical symptoms . each response is assigned a score ranging from zero to three , indicating the severity of the symptom and the overall score is calculated from the sum of responses to each item . a cut - off score of 21 or higher represents clinically - significant depressive symptomatology . the bdi was self - administered at baseline ( upon study enrollment ) and every 3 months thereafter for 12 months , for a total of five measurement points over one year of study participation . serial 24 - hour dietary recall interviews ( 24hdr ) , three in each quarter of followup , were performed on randomly selected days ( two weekdays and one weekend day ) by trained registered dieticians in order to quantify dietary changes over the week . the 24hdr data were collected using the nutrition data system ( nds ) data entry and nutrient database software developed and maintained by the nutrition coordinating center at the university of minnesota , minneapolis . data collection for physical activity patterns also occurred at the time of the 24hdr . subjects were asked to recall the amount of time they spent in light , moderate , vigorous , and very vigorous activities in household , occupational , and leisure - time activity domains . estimates of physical activity energy expenditure in metabolic equivalent task hours ( met - hours ) were calculated according to methods developed by ainsworth and colleagues . results obtained were comparable to published data from other short - term activity assessments employing the beck questionnaire and activity monitors as criterion measures . detailed demographic , anthropometric , and blood lipid data collection methods are described elsewhere in our previous publications . briefly , demographic data including gender , age , race / ethnicity , educational level , occupational category , and so forth , were collected by a self - report questionnaire at baseline . self - reported smoking status was ascertained at baseline and again at each quarter of followup by additional self - administered questionnaires . height was measured at baseline , and body weight was measured at each clinic visit , with the subject removing their shoes and extra layers of clothing . subjects were classified as overweight if their bmi was equal or greater than 25 kg / m and as obese if their bmi was equal or greater than 30 kg / m . fasting ( 12 hours ) venous blood samples ( 10 mls ) were obtained after sitting for 15 minutes at each clinic visit . blood plasma was harvested by low - speed centrifugation at 4c , aliquoted into individual tubes , and quickly frozen to 70c . on a regular basis , plasma samples were packed in dry ice and shipped for analysis via overnight service to the centers for disease control standardized laboratory at the university of massachusetts at lowell . assays for total cholesterol , hdl - c and triglycerides were done in this laboratory . ldl - c was calculated by the friedewald formula ( ldl - c = total cholesterol { triglycerides / 5 + hdl - c } ) . when triglycerides exceeded 400 mg / dl , gender differences in demographic characteristics were assessed using two - group t - tests for continuous variables and chi - square tests for categorical variables . linear mixed models with a random intercept for each subject and unstructured within - subject correlation were used to assess the association between depression scores and hs - crp levels . with this model , we examined both ( 1 ) the cross - sectional association ( between - subject , i.e. , the subject - specific average ) between depression and hs - crp and ( 2 ) the longitudinal association ( within - subject , i.e. , quarterly differences from the subject - specific average ) between depression and hs - crp . this method has been used in our previous analyses of the association between dietary carbohydrates and body weight and blood lipids , and the association between dietary fiber and hs - crp . the models were also adjusted for variables known to affect hs - crp ( e.g. , bmi , smoking , and infection ) and were repeated using either the raw values or logarithmic scales of both hs - crp and beck depression scores . dietary and physical activity variables were considered in the multivariable linear mixed models , but they were not significantly related to hs - crp when multiple variables were considered , and so they were not included in the final models . of the 641 participants in the seasons study , 508 ( 79 % ) had at least two visits yielding both bdi score and hs - crp values , and data derived from these individuals were included in the analyses . of these 508 subjects , over 55 % had paired bdi and hs - crp data for 4 or more data points throughout the year , and 30 % had all 5 measures . study participants were primarily middle - aged , white , well - educated , employed , nonsmoking , and generally overweight or obese ( table 1 ) , and approximately half ( 49 % ) were women . compared to women , men were more likely to be married or living with a partner , to have had a college education , to be employed full - time , and to be either overweight or obese ( 72 % versus 53 % for men and women , men also reported significantly higher levels of caloric intake and physical activity as compared to women . blood pressure was higher , and resting - heart rate was lower among men . compared to men , women had significantly lower levels of triglycerides , higher levels of hdl - cholesterol , and a higher prevalence of minor inflammatory or infectious problems ( table 1 ) . mean bdi score was 5.8 ( standard deviation ( sd ) 5.4 ) ; median 4.3 ; range from 0 to 33 with only 2 % of participants presenting scores above 21 , suggestive of clinically significant depressive symptoms ( 1.2 % of men and 2.8 % of women , p = .10 ) . only 13 participants reported taking antidepressant medication , with 10 reporting taking antidepressants throughout the year . the limited number of participants taking antidepressant drugs precludes any meaningful subgroup - analyses for this characteristic . there were significant gender differences in average bdi scores : 5.2 ( sd 4.8 ; median 4.0 ) among men and 6.5 ( sd 6.0 ; median 4.6 ) among women , p .005 . overall average serum hs - crp was 1.8 mg / l ( sd 1.7 ; median 1.2 ) , with no statistically significant gender differences . using the average values of five hs - crp and depression measures from each individual , bdi scores and hs - crp were positively correlated as depicted in figure 1 . results from the multivariable linear mixed models , controlling for age , bmi , resting heart rate , hdl - cholesterol , smoking status , and reports of minor infection or inflammation , suggest that individuals with higher depression scores tended to have higher hs - crp levels ( = 0.03 , p .05 ) however , we failed to observe a significant longitudinal effect ( table 2 ) . analyses stratified by gender suggest that an independent association between depression score and hs - crp is present among women ( = 0.028 , p .05 ) , but not among men ( = 0.024 , p .05 ) . overall , other factors significantly and positively related to hs - crp included bmi , age , resting - heart rate , and report of minor infection / inflammation process . repeating multivariable analyses using log transformation for hs - crp and bdi score , independently and together , showed similar results to that of the analyses using raw values ( data not shown ) . however , they also suggested an inverse longitudinal relationship between bdi score and hs - crp among women , that is , women , whose bdi score increased over the year showed a decline in levels of hs - crp , and this was not related to weight loss . findings from this longitudinal study are consistent with the results of prior cross - sectional studies suggesting that depression is cross - sectionally associated with higher hs - crp levels in a population without evidence of a chronic life - threatening illness ( e.g. , cancer , or renal or heart failure ) . among our sample of adults not reporting clinically significant depressive symptomatology , depression score appears to be independently and positively correlated to hs - crp . after controlling for potentially confounding factors , analysis by gender revealed that this association persisted only among women . the disappearance of this relationship among men after controlling for potential confounders , suggests that factors such as bmi , age , and resting heart rate ( a marker of physical fitness ) may confound this association among men . these factors also appear to mediate the relationship among women , but to a lesser extent . previous studies suggest that some types of depression are associated with weight gain which in turn may exacerbate inflammation by inducing leptin expression and increasing synthesis of inflammatory cytokines by adipose tissue . thus , the relationship between depression and hs - crp may , at least partially , be mediated by weight gain . while our participants were , on average , not in the clinically depressed range , our findings suggest that the range of depressive symptomatology may be important , with low levels of depressive symptomatology having significance in these associations . the proposition that elevated depressive symptomatology leads to weight gain , and increase in body weight leads in turn to an increase in hs - crp , would be a plausible explanation for our observation of the attenuation of the relationship between depression and inflammation among women , and the disappearance of the effect among men , after controlling for bmi . the psychoneuroimmune link theory as an explanation of the relationship between the range of depressive symptomatology and hs - crp can not be confirmed from the observations in this study ; however , our findings support an independent association between depression scores and hs - crp observed in women . on the other hand , among women , the observation of an independent and inverse relationship between depression scores and hs - crp , over time , suggests that the relationship is complex and might be mediated mostly by behavior , since depression is related to changes in appetite and body weight , in either direction . our results are in contrast with reports from the nhanes iii survey , which found that the relationship between hs - crp and depression is stronger among men than in women . however , those reports used major depression diagnosis in contrast to depressive symptom scores as used in this analysis . the association between hs - crp and depression was not observed in a recent study from adolescents aged 1316 years old . differences in population characteristics and in the confounders controlled , also could account for some of the inconsistent results . first , we collected detailed longitudinal data on a quarterly basis over the course of one year in various domains , including demographic , psychosocial , dietary , and physical activity . second , our study controlled for potential confounding factors for the depression and hs - crp relationship , which previous studies had not included . third , the study population is relatively healthy ; subjects with diabetes and other chronic diseases were excluded as these conditions have been associated with both depressive symptoms and hs - crp levels and may thus confound the bdi and hs - crp relationship . fourth , our data came from a study of seasonal variation in blood lipids , therefore patients planning to use or are using lipid medications and hormone therapy were excluded . consequently , any effect of using statins and female hormones on hs - crp concentrations was eliminated . finally , use of a continuous measure of depressive symptomatology ( bdi scores ) allowed analyses across the continuum of depressive symptom severity . the study sample had a reduced range of depression scores , which limits our capacity to draw conclusions for individuals in the clinical - depression range . although , the finding of a positive association between depressive symptom score and hs - crp among adults who were on average not clinically depressed is also of interest , because it suggests that the entire range of depressive - symptomatology may be associated with health risks . on the other hand , participants in this study were predominantly white , well - educated and employed therefore , caution should be taken when generalizing to populations that have different demographic characteristics or depression scores differing from the range found in this study . finally , as with many studies that require a strong commitment on the part of the participants , selection bias is always possible . in conclusion , multivariable longitudinal analyses suggest that an independent association between depression scores and hs - crp is present among women , but not among men . other factors that were significantly and positively related to hs - crp included body mass index , age , resting - heart rate , and concurrent minor infection / inflammation process . further studies are required to elucidate the biological mechanisms of these associations and their implications .\noutput:\n" }, { "from": "agent", "value": "objective . depression has been associated with increased cardiovascular disease risk , and a depression - related elevation of high sensitivity c - reactive protein ( hs - crp ) has been proposed as a possible mechanism . the objective of this paper is to examine association between depression and high sensitivity c - reactive protein ( hs - crp ) . methods . subjects consisted of 508 healthy adults ( mean age 48.5 years ; 49 % women , 88 % white ) residing in central massachusetts . data were collected at baseline and at quarterly intervals over a one - year period per individual . multivariable linear mixed models were used to assess the association for the entire sample and by gender . results . the mean beck depression inventory score was 5.8 ( standard deviation ( sd ) 5.4 ; median 4.3 ) , and average serum hs - crp was 1.8 mg / l ( sd 1.7 ; median 1.2 ) . results from the multivariable linear mixed models show that individuals with higher depression scores have higher levels of hs - crp . analyses by gender show persistence of an independent association among women , but not among men . body mass index ( bmi = weight ( kg ) / height ( m ) 2 ) appears to be a partial mediator of this relationship . conclusion . depression score was correlated to hs - crp levels in women . further studies are required to elucidate the biological mechanisms underlying these associations and their implications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: there are many studies confirming the presence of helicobacter pylori in the saliva , oral cavity , nose , and mucus of the sinuses , middle ear , dental plaques , tonsils , and adenoid glands . h. pylori has the potential to induce systemic inflammatory reactions through the immunological processes leading to the development of pharyngitis . moreover , zhang et al . in their study have clearly shown the absence of h. pylori in the pharyngeal region of healthy people and concluded that chronic pharyngitis might be associated with h. pylori infection . bacterial infections of the tonsils and adenoids are treated with various antibiotics and surgical removal is considered in situations resistant to medical therapy or in frequently recurrent infections . as h. pyloridoes not respond to routine antibacterial drugs that are used for chronic tonsillitis , diagnosis of h. pylori as a causative agent of chronic tonsillitis may play a role in the decision - making for the treatment of patients . the helicobacter is a small coma - shaped , gram - negative , and microaerophilic organism , with a number of species differentiated based on the genetic analysis of 16s rrna , cellular fatty acids , and the presence of polar flagella . this bacterium produces great amounts of urease and has a widespread distribution in the world . previous studies have shown that h. pylori has the potential to invade and colonize the stomach , gastric juice , oral mucus , and saliva of patients . the transmission route of this organism is not well known , but the presence of this microorganism in drinking water is reported through epidemiological studies . there are several methods to identify the presence of h. pylori in clinical samples and the most important ones are the rapid urease test ( rut ) , conventional polymerase chain reaction ( pcr ) , and real - time pcr . the studies carried out concerning the involvement of h. pylori in tonsillitis are highly controversial , as in some studies the reports are indicative of the successful isolation of h. pylori from tonsillar specimens in the culture media , while in other investigations , attempts to isolate this organism from similar samples were unsuccessful . in several studies , it has been mentioned that the application of the rut is an appropriate method to detect the presence of h. pylori . however , the sensitivity and specificity of this test in identifying this organism , in samples obtained from the tonsil and throat , is reported to be insufficient . likewise , the pcr technique is described by some authors to be a sensitive test in detecting h. pylori , whereas , in other reports pcr is demonstrated to fail identifying this microorganism in similar clinical specimens . considering the above - mentioned controversies and with none of these methods being regarded as the gold standard in detecting h. pylori in tonsillar samples , and also taking into account the bulk of publications regarding the high sensitivity and specificity of both real - time pcr and scorpion real - time pcr in the detection of various infectious agents , the current study has attempted to investigate the degree of agreement between these three tests in identifying h. pylori in the tonsillar biopsy of patients with chronic tonsillitis . this was a comparative study , in which 103 tonsil biopsy samples obtained from chronic tonsillitis patients , with chronic inflammation of the throat , cervical dysphagia , and permanent rough voice , for greater than three months . these patients had undergone the adenotonsillectomy operation at the rhinolaryngoscopy ward of qods hospital ( qazvin university of medical sciences ) during 2010 . the rut was immediately performed in all samples according to the manufacturer 's instruction ( rut chem . enzyme , tehran , iran ) and the biopsies kept in paraffin blocks until use . following the collection of all clinical specimens , deoxyribonucleic acid ( dna ) extraction was carried out using a commercial extraction kit ( roche , germany ) . the amount of extracted dna from 20 mg of each sample was 20010 ng . the rut was performed using a commercial kit obtained from rpt chem . enzyme ( tehran , iran ) . for positive control of the rut , pcr , and real - time pcr , a standard strain of h. pylori , atcc 26695 , was used , and distilled water was employed as the negative control . dna amplification was performed using a h. pylori detection kit ( cinnagen , iran ) in a final volume of 30 l , with the cycling program of the pcr instrument ( applied biosystem , usa ) , which consisted of a cycle of 72c / 30 seconds , 50c / 20 seconds , and 94c / 45 seconds , followed by 30 cycles of 72c / 30 seconds , 50c / 20 seconds , and 94c / 20 seconds . a volume of 10 l of the amplified sample was directly electrophoresed on 1.5 % agarose gel . the presence of a 492 - bp dna fragment was indicative of a positive reaction targeting the ure c gene . pcr was performed at a final reaction volume of 25 l , containing 5 l of the biopsy - extracted dna or 1 l of extracted dna from the culture of a standard strain of h. pylori atcc 26695 , as a positive control , with few necessary modifications made to be used in the abi prism 7500 sequence detection system ( applied biosystem , usa ) as follows : denaturation step ( 95c / 15 seconds ) followed by 50 cycles of reactions containing denaturation ( 95c / 15 seconds ) , annealing ( 55c / 34 seconds ) , and extension ( 72c / 20 seconds ) , targeting the peptidyltransferase of 23srrna . the accuracy of extraction was confirmed by the appearance of the associated signal in the vic channel , which amplified a b - globulin gene . the kappa coefficient ( k ) was calculated to assess the degree of agreement between the rut , conventional pcr with urec target , and the scorpion real - time pcr with 23s rrna , by spss 14 . the rut was performed using a commercial kit obtained from rpt chem . enzyme ( tehran , iran ) . for positive control of the rut , pcr , and real - time pcr , a standard strain of h. pylori , atcc 26695 , was used , and distilled water was employed as the negative control . dna amplification was performed using a h. pylori detection kit ( cinnagen , iran ) in a final volume of 30 l , with the cycling program of the pcr instrument ( applied biosystem , usa ) , which consisted of a cycle of 72c / 30 seconds , 50c / 20 seconds , and 94c / 45 seconds , followed by 30 cycles of 72c / 30 seconds , 50c / 20 seconds , and 94c / 20 seconds . a volume of 10 l of the amplified sample was directly electrophoresed on 1.5 % agarose gel . the presence of a 492 - bp dna fragment was indicative of a positive reaction targeting the ure c gene . pcr was performed at a final reaction volume of 25 l , containing 5 l of the biopsy - extracted dna or 1 l of extracted dna from the culture of a standard strain of h. pylori atcc 26695 , as a positive control , with few necessary modifications made to be used in the abi prism 7500 sequence detection system ( applied biosystem , usa ) as follows : denaturation step ( 95c / 15 seconds ) followed by 50 cycles of reactions containing denaturation ( 95c / 15 seconds ) , annealing ( 55c / 34 seconds ) , and extension ( 72c / 20 seconds ) , targeting the peptidyltransferase of 23srrna . the accuracy of extraction was confirmed by the appearance of the associated signal in the vic channel , which amplified a b - globulin gene . the kappa coefficient ( k ) was calculated to assess the degree of agreement between the rut , conventional pcr with urec target , and the scorpion real - time pcr with 23s rrna , by spss 14 . out of 103 samples from patients with clinical symptoms of chronic tonsillitis , 50 samples showed positive rut , whereas , 53 samples demonstrated negative results . when conventional pcr was used to detect h. pylori in biopsy specimens of a total of 103 samples , as the present study was performed on paraffinized biopsies , there was no possibility of testing the samples by culture and recommended routine diagnostic tests . initially , the scorpion real - time pcr was performed on h. pylori atcc 26695 . of the total of 103 samples ,21 biopsies were found to be positive for h. pylori by the scorpion real - time pcr , whereas , 82 samples showed negative results . among samples with a positive scorpion real - time pcr test , 17 samples were also rut positive and four samples had rut negative test results . the results of rut , conventional pcr , and scorpion real - time pcr are demonstrated in tables 13 . agreement rate between rapid urease test and conventional pcr results agreement rate between rapid urease test and scorpion real - time pcr results agreement rate between conventional pcr and scorpion real - time pcr our results showed a weak degree of agreement between the rut , pcr , and scorpion real - time pcr with kappa values of 0.269 and 0.249 , respectively [ tables 1 and 2 ] . a strong degree of agreement between pcr and the scorpion real - time pcr with a kappa value of 0.970 was demonstrated [ table 3 ] . when the degree of agreement between pcr and scorpion real - time pcr in samples with negative rut results was calculated , the agreement was complete ( kappa = 1 ) , but when the results on the degree of agreement between pcr and scorpion real - time pcr in samples with positive rut was compared , the agreement was demonstrated to be strong , but not complete ( kappa = 0.955 ) . out of 103 samples from patients with clinical symptoms of chronic tonsillitis , 50 samples showed positive rut , whereas , 53 samples demonstrated negative results . when conventional pcr was used to detect h. pylori in biopsy specimens of a total of 103 samples , 20 produced positive pcr results , and 83 were negative for h. pylori . as the present study was performed on paraffinized biopsies , there was no possibility of testing the samples by culture and recommended routine diagnostic tests . initially , the scorpion real - time pcr was performed on h. pylori atcc 26695 . of the total of 103 samples ,21 biopsies were found to be positive for h. pylori by the scorpion real - time pcr , whereas , 82 samples showed negative results . among samples with a positive scorpion real - time pcr test , 17 samples were also rut positive and four samples had rut negative test results . the results of rut , conventional pcr , and scorpion real - time pcr are demonstrated in tables 13 . agreement rate between rapid urease test and conventional pcr results agreement rate between rapid urease test and scorpion real - time pcr results agreement rate between conventional pcr and scorpion real - time pcr our results showed a weak degree of agreement between the rut , pcr , and scorpion real - time pcr with kappa values of 0.269 and 0.249 , respectively [ tables 1 and 2 ] . a strong degree of agreement between pcr and the scorpion real - time pcr with a kappa value of 0.970 was demonstrated [ table 3 ] . when the degree of agreement between pcr and scorpion real - time pcr in samples with negative rut results was calculated , the agreement was complete ( kappa = 1 ) , but when the results on the degree of agreement between pcr and scorpion real - time pcr in samples with positive rut was compared , the agreement was demonstrated to be strong , but not complete ( kappa = 0.955 ) . our findings showed that there was a strong agreement between the scorpion real - time pcr and pcr , in the detection of h. pylori dna in the tonsillar specimens of chronic tonsillitis patients , but its technical advantage over the conventional pcr assay , made the scorpion real - time pcr an appropriate laboratory test to investigate the presence of h. pylori in the tonsillar biopsy specimens of patients suffering with chronic tonsillitis . the mucous membrane of the upper digestive - respiratory tract is an extension of the digestive tract . there are several studies confirming the colonization by h. pylori of the adjacent sites of the intestinal cavity , with or without stomach bacteria . among these anatomic sites , this organism is independent of the stomach , capable of living in the oral cavity , including beyond the digestive tract , it may be assumed that h. pylori can colonize in areas within the larynx and pharynx . considering the ability of urease production by other bacterial residents of the mouth , throat , and tonsils , the rut for the detection of h. pylori is of low specificity . , confirm the ability of urease production by other bacterial populations in such anatomical areas . moreover , the urec gene target in conventional pcr , which identifies the presence of the urease enzyme is also of inadequate specificity . above all , the negative culture result seen in the h. pylori - infected tonsillar samples , is regarded as another hampering factor in the application of rut and conventional pcr as the standard tests . hence , it seems that the scorpion real - time pcr technique , in which the pcr and probing are performed simultaneously , through targeting the peptidyltransferase of the 23srrna gene , and thus avoiding repeated manipulations while accelerating the performance of the test , will be an ideal method for diagnosis of h. pylori , in the biopsy samples . however , the correlation between the scorpion real - time pcr and the two more convenient - to - perform techniques of conventional pcr and rut has to be investigated . the findings of the present study revealed the presence of a poor agreement between the rut and conventional pcr , and also rut and the scorpion real - time pcr . these results are consistent with those reported by jabbari - moghaddam et al . , in which a low efficacy of rut in detecting h. pylori in tonsillar biopsy specimens was obtained . in addition , our data regarding the existence of a strong agreement between the conventional pcr and scorpion real - time pcr are also in harmony with the results described by burucoa et al . , liu et al . , ben mansour et al . , and qiu et al . all indicating a high potential of scorpion real - time pcr in identifying h. pylori in the biopsy specimens . considering the presence of a strong agreement between the results obtained by the scorpion real - time pcr and conventional pcr , and also the advantage of simultaneous probing and identification , the application of scorpion real - time pcr as an appropriate method to detect h. pylori in the biopsy samples of patients with chronic tonsillitis is suggested .\noutput:\n" }, { "from": "agent", "value": "background : helicobacter pylori is capable of inducing systemic inflammatory reactions through immunological processes . there are several methods to identify the presence of h. pylori in clinical samples including rapid urease test ( rut ) , conventional polymerase chain reaction ( pcr ) , and the scorpion real - time pcr.aim : the aim of the present study is to compare the agreement rate of these tests in identifying h. pylori in tonsillar biopsy specimens collected from patients with chronic tonsillitis.materials and methods : a total of 103 tonsil biopsy samples from patients with clinical signs of chronic tonsillitis were examined with rut , pcr , and scorpion real - time pcr . the degree of agreement between the three tests was later calculated.results : there was a poor degree of agreement between rut and pcr and also rut and scorpion real - time pcr ( kappa = 0.269 and 0.249 , respectively ) . in contrast with rut , there was a strong degree of agreement between pcr and scorpion real - time pcr ( kappa = 0.970 ) . conclusion : the presence of a strong agreement between the scorpion real - time pcr and pcr as well as its technical advantage over the conventional pcr assay , made the scorpion real - time pcr an appropriate laboratory test to investigate the presence of h. pylori in tonsillar biopsy specimens in patients suffering from chronic tonsillitis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: neurofibroma is a benign peripheral nerve sheath tumor arising from the schwann cells and perineural fibroblasts . oral involvement is noted in 3.4 - 92 % of adults and 40 % of children with nf1 . a 28 - year - old male patient reported [ figure 1 ] with the chief complaint of a painless swelling in the right upper back tooth region since 3 years . history revealed swelling was of insidious in onset , which increased to attain the present size . family history revealed the patient 's father [ figure 3 ] also had multiple swellings all over the body and face . on general examination , multiple swellings all over the trunk region and arms were observed [ figure 2 ] . solitary well - defined oval shaped swelling [ firm in consistency and nontender on palpation figure 4 ] approximately 4 cm 3 cm was present in the right maxillary posterior region extending from distal aspect of maxillary first premolar to mesial aspect of third molar . . however , multiple , discrete , sessile cutaneous masses which had started appearing since childhood were observed . histopathological examination of incisional biopsy of the oral lesion showed spindle cells with elongated wavy nuclei . the lesional area was separated from the overlying epithelium by mature fibrous connective tissue [ figure 5 ] . cutaneous neurofibroma over the trunk patient 's father with cutaneous neurofibroma gingival neurofibroma h and e stained section of the lesion under , 40neurofibromatosis type 1 is due to alteration of nf1 gene , which is a tumor suppressor gene located in the long arm of chromosome 17 . the clinical criterion for the diagnosis of nf1 encompasses presence of six or more cafau lait spots ( 5 mm in children or 15 mm in adults ) , two or more cutaneous or subcutaneous neurofibromas or one plexiform neurofibroma , freckles in the axilla or groin optic glioma , two or more lisch nodules ( pigmented hamartomas of the iris ) , bony lesion with sphenoid wing dysplasia or bowing of the long bones with or without pseudoarthrosis , and / or first degree relative with nf1 . other features that have been described to occur variably in individuals with nf1 include short stature , large head size , failure to gain weight , precocious puberty , vascular disease including childhood hypertension , neural problems secondary to the spinal cord involvement , headaches , cognitive problems , stroke , brain tumors , and rarely tumors such as pheochromocytoma , and juvenile chronic myeloid leukemia . common sites of the oral solitary neurofibromas include tongue ( 26 % ) , buccal mucosa ( 8 % ) , alveolar ridge ( 2 % ) , labial mucosa ( 8 % ) , palate ( 8 % ) , gingiva ( 2 % ) , nasopharynx , paranasal sinuses , larynx , floor of the mouth and salivary gland . this patient reported with gingival localization of neurofibroma , which is extremely rare and unique . gingival neurofibromas can cause periodontal disease , as tissue growth is an obstacle in carrying out routine oral hygiene measures . oral radiographic findings unique to nf include lengthening , narrowing and rarefaction of coronoid and articular process , deepening of sigmoid notch , an enlarged mandibular canal , mandibular foramen and mental foramen . other findings are shortening of the ramus , notching of the inferior border of the mandible . in the caseusually , the prognosis for solitary neurofibroma is extremely good , with only rare instances of recurrence . the present case was kept under observation and was recalled every 3 months for a period of 1 year and showed no signs of recurrence . malignant transformation of neurofibromas with nf1 into neurogenic sarcomas bears a very bad prognosis with a 5 years survival rate of just 15 % . long - term review of patients and genetic counseling is recommended owing to the likelihood ( 50 % ) of vertical transmission . it is imperative for the general physicians and dermatologists to be aware of the oral manifestations of nf1 considering the risk of malignant transformation and the poor prognosis .\noutput:\n" }, { "from": "agent", "value": "neurofibroma is a benign peripheral nerve sheath tumor and is the most frequent tumor of neural origin . its presence is one of the clinical criteria for the diagnosis of neurofibromatosis type 1 ( nf1 ; a common hereditary disease occurring in one out of every 3000 births ) . the diagnosis can sometimes be made at birth , while in others the diagnosis is made later in life after the appearance of additional clinical criteria . majority of the solitary neurofibromas are sporadic , while a few are associated with nf1 syndrome . oral hard and soft tissue are affected by the tumor ; however , the tongue is the most affected site . gingival neurofibroma is an uncommon oral manifestation of nf . here , we report a rare case of gingival neurofibroma in nf1 patient . one of the most feared complications of nf1 is its transformation into neurofibrosarcoma , which bears a very poor prognosis . treatment of neurofibroma is surgical resection ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the collection of serum samples from police dogs in the present study was consented by owners of dogs , and all police dogs were handled in strict accordance with good animal practice according to the animal ethics procedures and guidelines of the people 's republic of china .\noutput:\n" }, { "from": "agent", "value": "in recent years , worldwide surveys of toxoplasma gondii infection in dogs have been reported . however , only limited surveys of t. gondii infection in police dogs have been available , including china . in the present study , we report the seroprevalence of t. gondii in police dogs in shenyang , northeastern china . sera from 291 police dogs were examined for t. gondii antibodies with the modified agglutination test ( mat ) , and 30.9 % animals were tested seropositive . the results of the present study indicated a relatively high prevalence of t. gondii infection in police dogs in shenyang , china ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the cleaning and disinfection role of the irrigating solutions in the complex protocol of the endodontic therapy is essential for treatment success . as mccomb and smith10 ( 1975 ) demonstrated the presence of a dentin layer attached to the root canal walls , the irrigating solutions should act on both organic and inorganic compounds . among the irrigants used for removal of inorganic compounds are the chelating agents and inorganic acids represented by ethylenediaminetetraacetic acid ( edta ) and citric acid , respectively7 ,10,11,13 . the biocompatibility of citric acid and edta in the pulp and periapical tissues induces an inflammatory response of variable intensity and depth depending on the methodology used . cotton and siegel5 ( 1978 ) and baumgartner , et al. 3 observed no severe or irreversible damage on the human dental pulp . sterrett , et al. 12 ( 1993 ) and malheiros , et al. 8 ( 2005 ) stated that the effects observed on the human dentin may vary according to the concentration and application time . mcinnes - ledoux , et al. 9 ( 1985 ) reported that , in monkeys , 1 % citric acid showed severe effects on the pulpal tissues . leonardo , et al. 6 ( 1984 ) observed a good tolerance of the periapical tissues to edta on dog 's teeth , while zina , et al. 15 ( 1981 ) using trisodium edta in dog 's teeth did not observe any damage on the healing process of the pulp stump and periapical tissues . chan , et al. 4 ( 1999 ) observed that in human pulp cell cultures , the toxicity of 0.5 % and 1 % citric acid is proportional to the concentration and exposure time , whereas other studies observed in rats that citric acid was less irritating than edta and ethyleneglycol - bis ( 2 - aminoethoxy ) - tetraacetic acid ( egta ) 14 . amaral , et al. 1 ( 2007 ) observed that both edta and citric acid showed cytotoxic effects on macrophages , though citric acid produced less cytotoxic . malheiros , et al. 8 ( 2005 ) demonstrated in cultured fibroblasts and in rats ( rattus novergicus ) in vivo , respectively , that , if applied at high concentrations , citric acid leads to a delay in cell growth and has an irritating effect in vivo . based on the endodontic biologic principles , the purpose of this study was to evaluate , histopathologically , the periapical tissue response of dog 's teeth submitted to root canal therapy with two demineralizing chemical substances : 1 % citric acid and 17 % trisodium edta salt . three different solutions were used in this study : 17 % trisodium edta salt ( , ph 8.0 ; chemical lab . ucpel , pelotas , rs , brazil ) , 1 % citric acid ( ph 2.0 ; curativa pharmacy , pelotas , rs , brazil ) and saline ( texon co. , rs , brazil ) as the control . six adult dogs from the central laboratory of ufpel were selected as the biological model of the study . the experimental sample comprised 56 roots of mandibular molars ( first and second ; n = 13 ) and premolars ( first , second and third ; n = 22 ) . the animals were sedated with an intravenous injection of 2 % virbaxyl ( virbac co. , sp , brazil ) and then anesthetized with thiopental ( cristlia chemical products , sp , brazil ) . after oral asepsis with 0.12 % chlorhexidineaccess to the pulp chamber was gained with # 1012 , 1015 and 1016 diamond burs ( kg sorensen , so paulo , sp , brazil ) and the convenience shape was given with an endo z bur ( dentsply - maillefer , ballaigues , switzerland ) . pulpectomy was performed with a hedstren file and the working length was determined 1 mm short of the radiographic apex with k - files ( dentsply - maillefer ) . root canals were instrumented with four k - files ( dentsply - maillefer ) of greater sizes than that of file used for root canal length determination . during biomechanical preparation , the number of irrigations and volume of the irrigating solution were standardized in 16 ml for premolars and 32 ml for molars with the aid of disposable syringes and 303 , 304 and 305 hypodermic needles ( becton - dickinson , so paulo , sp , brazil ) . in all phases of biomechanical preparation , either one of the test or the control substances were used as auxiliary irrigant . when instrumentation was completed , the root canal was filled with the test solution for 5 minutes to allow an intimate contact . after drying , the canal entrance was sealed with disinfected gutta - percha followed by composite prisma aph ( dentsply ind . ltda , petrpolis , rj , brazil ) below the occlusion line . after 24 and 48 hours of the treatment , the animals were euthanized and the teeth removed and fixated in 10 % formalin solution . thereafter , the teeth were decalcified by immersion in 1:1 formic acid and sodium citrate solution followed by 5 % nitrate acid . the specimens were embedded in fused paraffin histosec ( merck kgaa , darmstadt , germany ) , cut with a microtome at the apical foramen in serial 6 - m - thick sections , which were stained with hematoxylin and eosin and mounted on glass slides . the sections that best represented the area of pulp - periodontium communication were selected and examined with a light microscopy at 100 magnification . the histologic analysis considered the occurrence of an acute inflammatory response , so the presence of swelling , vasodilatation and inflammatory cells was evaluated and the degree of inflammation was determined for each case . for systematic examination of the specimens , a squared and numbered ( with 100 indexed crosses ( + ) of equal dimension ) eyepiece grid ( ne21 mm ; graticules ltd , kent , uk ) , was introduced into one of the eyepieces of the microscope . of the total of 100 crosses that composed the net , approximately 50 would cover the periodontal space , being the remainder occupied by the root , dental canal and alveolar bone , which were excluded from the analysis . three fields of the periodontal ligament were evaluated : its most central area in relation to the apical foramen and two lateral margins . for each evaluated field , we considered the number of points coinciding with the occurrence of the three primary events of inflammatory reaction : swelling , vasodilatation and presence of inflammatory cells . the following criteria were used : mild inflammation - when each parameter was coincident with a maximum of 4 crosses ; moderate inflammation - when at least 2 parameters were coincident with at least 5 and at most 9 crosses ; severe inflammation - when at least 2 parameters were coincident with 10 or more crosses . chi - square test could have been used to assess differences in the efficacy of the three substances . however , as the expected frequencies for a few cells were less than 5 , chi - square test was not deemed appropriate . alternatively , fisher 's exact test was used to overcome the problem due to small cell frequencies because it requires a non - zero frequency in each cell . hence , the category \" severe \" was eliminated because there was no observation for that level . the resulting contingency table was used for fisher 's exact test is reproduced as table 2 and 4 . the data were analyzed with a confidence interval of 95 % ( p 0.05 ) using the spss software ( spss 14.0 , spss inc . , the two tailed p value generated by fisher 's exact test for the above contingency table was 0.482 ( for the 24 - hour exposure time ) and 0.377 ( for the 48 - hour exposure time ) . as both p values were greater than 0.05 , the null hypothesis of independence was accepted , which means that the three substances did not have different efficacy at the either of the study intervals . the results of the histologic analysis of the inflammatory response observed in dogs ' teeth after contact with edta , citric acid and saline , after 24 and 48 hours , are presented in the tables 1 and 2 . in order to provide the necessary adjustment for the statistical analysis , the scores 1 , 2 and 3 were attributed to the mild ( figure 2 ) , moderate ( figure 3 ) and severe ( figure 4 ) inflammation degrees , respectively , which differ from the normal aspect ( figure 1 ) . there was no significant difference in the inflammation degree among the tested substances within the 24 hour ( p = 0.482 ) or 48 hour ( p = 0.377 ) periods . in the present study , the sample comprised the roots instead of molar and premolar teeth because , after pulpectomy , the surgical wounds behave independently even if submitted to the same treatment . the 24 - and 48 - hour periods were established because , though presenting a relative antimicrobial activity , the tested substances , are not indicated for this use and after longer observation periods there would be the risk of bacterial contamination , especially in the control group . the method proposed for inflammation degree evaluation consisted of using a net of eyepiece reticular scale adapted to the ocular of the microscope , which allowed the quantification of the events composing the inflammatory process , i.e. , swelling , vasodilatation and presence of inflammatory cells in the apical region . therefore , the classification of the inflammatory response in mild , moderate and severe was determined by the counting . the results obtained with edta in relation to the control group demonstrated a good tolerance by the periapical tissues . similar findings have been reported by zina , et al. 15 ( 1981 ) and leonardo , et al. 6 ( 1984 ) , the latter evaluating the tissue response in dogs ' teeth . the statistical analysis showed that even though there was a severe degree inflammation within 48 hours , there was no significant difference between both periods . citric acid showed a similar behavior as that of edta and saline at both periods and , though not statistically significant , it showed a higher degree of inflammation at 48 hours compared to the shorter period . this result differs from those of previous studies that used citric acid for cavity cleaning5 ,9 and evaluated the response to pulp tissues instead of to periapical tissues . the findings of the present study and of other authors1 ,8 disagree from those reported by chan , et al. 4 ( 1999 ) who observed an increase in the inflammation degree with a longer exposure time in cell cultures . citric acid is an organic acid that takes part in the krebs cycle in the human cells , being therefore biologically acceptable . the results of the control group showed that an inflammatory response is a natural consequence of pulpectomy . comparison of the substances in both studied periods ( 24 and 48 hours ) did not show statistically significant differences . this fact indicates that , although these two substances have a low superficial tension , even in multiple foramen conditions , other factors referring to their physicochemical properties and the site of application , control their diffusion . regarding edta , its activity is limited by the presence of organic material2 , in addition to promoting the coagulation of proteins , which form of a mechanical barrier that avoids its diffusion towards the periapical tissues . citric acid has the property of not promoting collagen selling , which occurs with most acids . this justifies its use for histological preparations in the form of sodium citrate , in demineralization processes . this aspect could allow a higher diffusion of this substance , but its acidic characteristics provide cauterizing properties , due to its low ph . both edta and citric acid compared to the control group showed a potential for a mild inflammation , with no statistically significant difference to each other . the clinical use of either edta or citric acid should be done with caution to prevent their extrusion to the periapical tissues . citric acid showed similar conditions for clinical use as those of edta , as it has similar characteristics regarding the property as an inorganic solvent , removal of smear layer , improvements in naocl properties when associated to it and a satisfactory tissue tolerance . under the tested conditions , under the experimental conditions of this study , the obtained results showed that 17 % edta and 1 % citric acid caused inflammatory responses in dog 's periapical tissues with no significant differences from saline within the evaluated time periods ( 24 and 48 hours ) .17 % edta and 1 % citric acid produced similar inflammatory reaction to each other at both the shorter and the longer time period . it may be concluded that the inflammatory response to the tested substances was of mild intensity .\noutput:\n" }, { "from": "agent", "value": "the purpose of this study was to analyze the inflammatory response of dog 's periapical tissues to 17 % trisodium edta salt ( ph 8.0 ) and 1 % citric acid ( ph 2.0 ) . saline was used as a control . six adult dogs were used as the biological model of the study . the experimental units comprised 56 roots of mandibular molars ( first and second ) and premolars ( first , second and third ) . after coronal opening , pulpectomy and root canal instrumentation were performed using the above - mentioned irrigating solutions . after 24 and 48 hours , the animals were euthanized and the teeth and their supporting tissues were removed and histologically processed . the sections were stained with hematoxylin and eosin and analyzed histopathologically with a light microscope at x100 magnification . the histological analysis focused on the occurrence of acute inflammatory response . the presence of swelling , vasodilatation and inflammatory cells were evaluated and the degree of inflammation was determined for each case . data were analyzed by fisher 's exact test using the spss software with a confidence interval of 95 % ( p < 0.05 ) . 17 % edta and 1 % citric acid caused inflammatory responses in dog 's periapical tissues with no significant differences to each other or to saline ( control ) at either the 24 - hour ( p = 0.482 ) or 48 - hour ( p = 0.377 ) periods . it may be concluded that the inflammatory response was of mild intensity for the tested substances ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: health care personnel and specially physicians in almost all countries , regardless of the level of development , work in more than one job or sector ( 1 , 2 ) . the practice has been mentioned in a number of studies as common and ubiquitous among physicians and other health staff ( 15 ) . dual practice ( dp ) , dual job holding , moonlighting , multiple job holding , dual employment , multiple employment , dual working , double work , and pluri employment are different terms that has been used in the literature for describing this phenomenon . in addition , there has been a great diversity in the literature in approaching the issue . health professionals with multiple specialization ( e.g. cardiology and internal medicine ) , working within different paradigms of health ( e.g. allopathic medicine combined with traditional medicine ) , combining different forms of health - related practice ( e.g. clinical activities with research , teaching or management ) , combining professional health practice with an economic activity not related to health ( e.g. agriculture ) , and multiple health - related practices in the same or different sites or sectors , are various concepts that has been considered in different studies in this field around the world ( 3 ) . among all , health professionals engaging in multiple health related practices is one kind of the phenomenon that has more implications for various aspects of service delivery and has been regarded by the majority of researchers in this subject ( 3 , 69 ) . garcia - prado and gonzalez classified different forms of this kind of dual practice based on two variables : the nature of the two jobs ( public versus private ) , and the contractual arrangement in place . according to this classificationthere are three types of dual practice ( public on public dp , private on private dp , and public on private dp ) which the last one ( public on private dp ) has being conducted in four forms ( regular public post and private side practice , regular public job and private office , part - time public and part - time private , regular full - time private work and a part - time public post ) ( 5 ) . the third type ( public on private dp ) , is the most prevalent form of dual practice in many countries and has potentially adverse welfare implications ( 5 ) . therefore , most of the researchers have focused on this particular form of dp and have conducted studies on different aspects of the issue . to our knowledge , there has not been a study , which comprehensively reviews and categorizes studies in physician dual practice field in the last 10 years . in this paper , we aimed to review studies in this subject and categorize them in order to their main objectives and purposes . we hope this study could describe a map of the knowledge about the phenomenon and highlight gaps in this field . comprehensive literature searches were undertaken in order to obtain main papers and documents in dual practice field . after that , descriptive mapping review methods were utilized to categorize eligible studies in this area . search strategy for electronic databases was as follows : search dual practice [ t / a ] or dual practitioner [ t / a ] or multiple job * [ t / a ] or dual job * [ t / a ] or moonlight * [ t / a ] ormoonlighting [ t / a ] or dual worker * [ t / a ] or public sector job [ t / a ] or private sector job [ t / a ] or multiple employmen * [ t / a ] or dual worker [ t / a ] or additional income [ t / a ] or public sector employment [ t / a ] or private sector employment [ t / a ] . search health worker * [ t / a ] or health professional * [ t / a ] or physician * [ t / a ] or doctor * [ t / a ] or nurs * [ t / a ] or clinician * [ t / a ] or health staff [ t / a ] or medic * [ t / a ] or dent * [ t / a ] or medical specialist * [ t / a ] or surgeon * [ t / a ] orgeneral practice [ t / a ] or gp [ t / a ] or health [ t / a ] or healthcare [ t / a ] . search # 1 and # 2 search dual practice [ t / a ] or dual practitioner [ t / a ] or multiple job * [ t / a ] or dual job * [ t / a ] or moonlight * [ t / a ] ormoonlighting [ t / a ] or dual worker * [ t / a ] or public sector job [ t / a ] or private sector job [ t / a ] or multiple employmen * [ t / a ] or dual worker [ t / a ] or additional income [ t / a ] orhealth professional * [ t / a ] or physician * [ t / a ] or doctor * [ t / a ] or nurs * [ t / a ] or clinician * [ t / a ] or health staff [ t / a ] or medic * [ t / a ] or dent * [ t / a ] or medical specialist * [ t / a ] or surgeon * [ t / a ] or general practitioner * [ t / a ] or general practice [ t / a ] or gp [ t / a ] or health [ t / a ] or healthcare [ t / a ] . we also ran general searches for dual practice into some search engines like google and google scholar in order to find reports and related documents in this field . all of the designs such as cross sectional , qualitative , modeling , surveys , etc . were recognized eligible for inclusion . studies that were reported in other languages except for english or persian , or did not include clinical professionals were excluded from the analysis . two authors ( jm and aas ) screened the titles and abstracts of all obtained articles independently and excluded the papers that obviously did not meet the inclusion criteria . after that , full texts of all potentially relevant articles selected by either of the authors were retrieved . the two authors then independently assessed studies that if they met our inclusion criteria or not . disagreements between the two review authors were resolved through discussion and consensus . the following elements abstracted independently from each study by the authors : study references first author and date of publication.document typethe journal or institution where published the study.location of the study.aims and purposesmethods study designparticipantsmain results study references first author and date of publication.document typethe journal or institution where published the study.location of the study . comprehensive literature searches were undertaken in order to obtain main papers and documents in dual practice field . after that , descriptive mapping review methods were utilized to categorize eligible studies in this area . search strategy for electronic databases was as follows : search dual practice [ t / a ] or dual practitioner [ t / a ] or multiple job * [ t / a ] or dual job * [ t / a ] or moonlight * [ t / a ] ormoonlighting [ t / a ] or dual worker * [ t / a ] or public sector job [ t / a ] or private sector job [ t / a ] or multiple employmen * [ t / a ] or dual worker [ t / a ] or additional income [ t / a ] orpublic sector employment [ t / a ] or private sector employment [ t / a ] . search health worker * [ t / a ] or health professional * [ t / a ] or physician * [ t / a ] or doctor * [ t / a ] or nurs * [ t / a ] or clinician * [ t / a ] or health staff [ t / a ] or medic * [ t / a ] or dent * [ t / a ] or medical specialist * [ t / a ] or surgeon * [ t / a ] or general practitioner * [ t / a ] or general practice [ t / a ] or gp [ t / a ] or health [ t / a ] or healthcare [ t / a ] . search # 1 and # 2 search dual practice [ t / a ] or dual practitioner [ t / a ] or multiple job * [ t / a ] or dual job * [ t / a ] or moonlight * [ t / a ] ormoonlighting [ t / a ] or dual worker * [ t / a ] or public sector job [ t / health professional * [ t / a ] or physician * [ t / a ] or doctor * [ t / a ] or nurs * [ t / a ] or clinician * [ t / a ] or health staff [ t / a ] or medic * [ t / a ] or dent * [ t / a ] or medical specialist * [ t / a ] or surgeon * [ t / a ] or general practitioner * [ t / a ] or general practice [ t / a ] or gp [ t / a ] or health [ t / a ] or healthcare [ t / a ] . we also ran general searches for dual practice into some search engines like google and google scholar in order to find reports and related documents in this field . all of the designs such as cross sectional , qualitative , modeling , surveys , etc . were recognized eligible for inclusion . studies that were reported in other languages except for english or persian , or did not include clinical professionals were excluded from the analysis . two authors ( jm and aas ) screened the titles and abstracts of all obtained articles independently and excluded the papers that obviously did not meet the inclusion criteria . after that , full texts of all potentially relevant articles selected by either of the authors were retrieved . the two authors then independently assessed studies that if they met our inclusion criteria or not . the following elements abstracted independently from each study by the authors : study references first author and date of publication.document typethe journal or institution where published the study.location of the study.aims and purposesmethods study designparticipantsmain results study references first author and date of publication.document typethe journal or institution where published the study.location of the study . electronic searches in the mentioned databases provided us with 522 papers . eliminating for duplicates ,367 remaining titles were screened by the authors and unrelated ones were missed out from the list . after that , authors examined 166 remaining abstracts independently and again omitted the studies , which clearly did not have the inclusion criteria . latter , adding 37 other studies , which obtained from the web search , 81 full texts were retrieved and have been read by both authors . finally , there were only 24 studies which be considered as related to our inclusion criteria ( fig. 1 ) . all of the studies in this group are article , and in terms of method , they applied quantitative ( two studies ) , qualitative ( two studies ) , and mixed method - both quantitative and qualitative - ( one study ) approaches ( table 1 ) . motivation , reasons and forces behind dual practice what south african medical specialists find satisfying about working in the public and private sectors how to better incentivize retention in the public sector . although there are strong financial incentives for specialists to migrate from the public to the private sector , public work can be attractive in some ways . for example , the public hospital sector generally provides more of a team environment , more academic opportunities , and greater opportunities to feel needed and relevant . public specialists suffer under poor resource availability , lack of trust for the department of health , and poor perceived career opportunities . these non financial issues of public sector dissatisfaction appeared at least as important as wage disparities . for assistant physicianshigher wages at public hospitals affect negatively both the decisions to earn income externally , and level of income once active . for consultant physiciansfew respondents said that money is the dominating objective , in that they would gladly give up the private practice in exchange for a pay rise in the nhs . private practice was seen as offering an increase in strategic influence , clinical autonomy , and realization of individual aspirations as a clinician . commitment to government services was found to be greater among doctors in primary health care who reported they would give up private practice if paid a higher salary . among doctors in secondary and tertiary care , the propensity to give up private practice was found to be low . doctors have adopted individual strategies to accommodate the advantages of both government employment and private practice in their career development , thus maximizing benefit from the incentives provided to them e.g. status of a government job , and minimizing opportunity costs of economic losses e.g. lower salaries . the two outstanding reasons why they engage in their various side activities were to meet the cost of living , and to support the extended family .40 percent of participants reported that the median equivalent of one month 's public sector salary could be generated by 7 hours of private practice , but being a civil servant was important in terms of job security , and credibility as a doctor . also the social contacts andpublic service gave access to power centers and resources , through which other coping strategies could be developed . six studies were related to this category ( 1 , 8 , 1417 ) . all of the studies in this group are article - except for the reference ( 17 ) which is a report - , and in terms of method , they applied modeling ( four studies ) , review ( one study ) , and quantitative ( one study ) approaches ( table 2 ) . the consequences of dual practice dual and single practitioners did not differ significantly in terms of the average length of work week , participation in non mandatory activities or duties outside normal working hours , including duties accepted with short notice and their preferences for working hours or turnover intention . some of the effects depend on assumptions that are undermined in the broader literature ( e.g. the intention to maximize income ) allowing moonlighting always enhances aggregate consumer welfare , but equilibrium public - care quality may increase or decrease . unregulated moonlighting may reduce consumer welfare as a result of adverse behavioral reactions , such as moonlighters shirking more and dedicated doctors abandoning their sincere behavior . price regulation in the private market limits such adverse behaviors in the public system and improves consumer welfare . crowds out public provision , and results in lower overall health care provision . while the health authority can mitigate this effect by offering a higher wage , a ban on dual practiceis more efficient if private sector competition is weak and public and private care are sufficiently close substitutes . on the other hand , if private sector competition is sufficiently tough , a mixed system , with physician dual practice , is always preferable to a pure nhs system . physician will have incentives to over - provide medical services when he uses his public activity as a way of increasing his prestige as a private doctor . physicians dual practice can be either welfare improving or reducing , depending on the treatment policy that the health authority wants to implement ( if the priority is to contain costs , then the doctor s dual activity is negative . if the priority is to minimize patients health losses , his dual practice affords the objective at a lower cost ) . governments can meet the participation constraint of physicians without paying salaries commensurate to physicians abilities because physicians also value the non salary benefit of the opportunity to earn significant private practice revenues . if dual - practitioner differentially refer higher income patients to private practice , public funding becomes more effectively targeted on the poor . however , physician incentives to concentrate inducement on those most responsive to inducement - often the poor and uneducated may act counter to such a social objective . in the next step , we categorized these 24 studies into four groups according to their main objectives ( tables 14 ) . policies and regulations about dual practice and their impacts the need for increasing the share of healthcare budget from the gross domestic product ( gdp ) , inefficient tariff and payment system , and difficulty in obtaining collaboration with other stakeholders are the main challenges of full - time practice program in iran . inappropriate implementation of this program might lead to unexpected transfer of the experienced and high skilled physicians from public hospitals . to analyze and compare some of the most common regulations in dual practice . to investigate whether regulations that are optimal for developed countries are adequate for developing countries as well . forbidding dual practice is seldom optimal , as it usually expels valuable professionals from the public system . results offer theoretical support for the desirability of different regulations in different economic environments . in developed countriesthe key factor is the potential negative effect of dual practice on public performance : when this effect is low the best option is not to intervene ; when it is sufficiently high the best option is to impose a limit on physician involvement . for developing countries , the design of the optimal policy is more complex as it also depends on the attractiveness of the private sector . when this attractiveness is very high the best option is not to intervene and thereby avoid an exodus of highly skilled physicians from the public sector . finally , if the potential gains from private practice are low , the optimal intervention is either to limit dual practice ( if the associated costs are low ) or to ban it ( if such costs are high ) . there is not any scientifically rigorous study in this field ( rcts , nrcts , cba or its designs ) . allowing dual practice can improve welfare even when physicians have homogeneous quality / morality . when information is asymmetric among physicians , patients and the planner , dual practice can be conceived as a tool to improve welfare in two ways : first , resource allocation within the hospital is more efficient ; second , allowing dual practice can save salary expenditure for the public hospital . people with high opportunity cost ( high income ) in switching providers will be more likely to go to the hospital while people with low opportunity cost in switching providers ( low income ) will visit the gp first . hence , after allowing dual practice , rich patients with mild cases are more likely to be induced to private clinics from the hospital . low income patients , or patients with serious conditions , are more likely to be treated in the hospital . therefore , physician dual practice can also be interpreted as an alternative instrument for sorting in terms of both illness severity and switching costs . under some conditions , allowing dual practice can lead to a second - best improvement in efficiency , compared with a situation in which dual practice is not allowed . there are wide variations in how governments tackle this issue . banning dual practice , enforcing restrictions on private practice earnings of physicians , offering exclusive contracts in the public sector , encouraging public doctors to develop their private practice in public facilities , raising public sector salaries , and self - regulation are six mechanisms which have been used by different countries . it causes dual practitioners to either move out of the province or stay and just shirk in effort . these physicians , who want to dual practice but now is unable to , lowers the aggregate welfare of patients in the public sector by constantly maintaining low quality service rather than trying to improve the service . allowing dual practice without restrictions is unlikely to result in an improvement in the social welfare of patients . the social welfare of people in canada s mixed health care system will be better off where restrictions on dual practice are present ( both exclusive contracts and price ceiling allow physicians to still use the over - providing strategy if they choose to dual practice , while also keeping public physicians in the public sector ) . dual practice can be a possible system solution to issues such as limited public sector resources , low regulatory capacity , and the interplay between market forces and human resources . this paper offers some supports for policies that allow for the official recognition of such activity and embrace a degree of professional self regulation in highly resource constrained settings ( because evidence shows that dp is typically poorly regulated in these countries . regulations are either lacking , or when they exist , are vague or poorly implemented because of low regulatory capacity ) . dual practice could be found almost in all countries ( it is wide spread in many developing countries ) . economic motives are not the only reason why physicians engage in dp . other non - pecuniary factors such as job complementarities , and institutional , professional , structural and personal variableswhile dual providers may be tempted to skimp on time and effort in their main job , to induce demand for their private services , or to misuse public resources , the legalization of dual practice may also contribute to recruit and retain physicians with less strain on the budget and improve access to health services , especially in developing countries . the article provides some qualified support for the use of rewarding policies to retain physicians in the public sectors of more developed countries , while limiting policies are recommended for developing countries - with the caveat that the policies should be accompanied by the strengthening of institutional and contracting environments dual practice is widespread and well - accepted . however , broad macroeconomic influences on dual practice such as the oversupply of medical services , the deregulated nature of this market , and the economic crisis throughout the country were also importantpolicy responses to dual practice involve tighter controls on the supply of medical practitioners , alleviation of financial pressures brought by macro - economic conditions , and closer regulation of such activities to ensure some degree of collective action over quality and the maintenance of professional reputations . to provide a summary and comparison of five models of dual practice , including one we have developed based on total compensation theory and contracting limitations . to discuss whether theoretical predictions are consistent with empirical evidence from developed and developing countries . all theories to date suggest that the impact of dual practice on public service quality is ambiguous . the social trade - off between the benefits and costs of dual practice hinge on the quality of a country s contracting institutions . allowing dual practice may improve social welfare and the quality of public services , under specific circumstances . the evidence does not support the perception that full - timers embody greater commitment and contribution to public sector provision . dual practice is approached in the literature with great diversity : health professionals with multiple specialization , working within different paradigms of health , combining different forms of health - related practice , combining professional health practice with an economic activity not related to health , and multiple health - related practices in the same or different sites or sectors . typologies of dp : in terms of sector location , dual practice may be public on public , public on private or private on private . dual practice is probably present in all countries regardless of income , even in settings such as china where there are major regulatory restrictions . negative impacts are predatory behavior ( self gain is preferred to the interests of others ) , conflict of interest ( lower the quality in the public sector to advertise for the private sector ) , brain drain ( to other countries , private sector , or urban areas ) , competition for time and limits to access , outflow of resources and corruption ( illegal use of public resources for private patients ) ; positive impacts : it 's ability to generate additional income for health workers , and higher professional satisfaction . the extent of dual practice seems to vary according to urban or rural residence , according to professional group , according to specialty or occupation . this evidence suggests that dual practice depends not so much on the personal , social ( marital status ) and professional characteristics of health workers , but on factors that are manageable . adequate responses imply the identification of the main underlying reason for the observed dual practice . governments have a wide range of responses to it based mostly on assumption , anecdote , and etc . increasing income is likely to be the main reason for engaging in dp , but job complementarity , institutional and professional factors ( the desire to interact among professionals in the practice site , to secure approval from peers , and to influence fellow professionals and ... ) are probably also important . efforts to address mjh should consider what could be done about both the systemic causes of mjh and its program and worker specific manifestations . all mjh is not of equal importance for health outcomes and making services work for the poor . governments should set priorities carefully , understand causes and effects , and engage in collaborative process with health workers to find solutions which are both acceptable to them and improve system outcomes . governments should increase the benefits and reduce the costs ( negative effects ) in relation to government objectives through the best possible design of incentives and regulations to affect the behavior of health care workers given their demand for mjh ( banning mjh is not really a feasible and effective strategy in most countries , because they lack the capacity to enforce it , and these regulation are often not seen as legitimate by the health workers , their supervisors , and general population ; also removing the conditions creating the demand for mjh among health workers is rarely viable , because it needs sufficient resources and contractual and monitoring capacities which are not present in many countries ) . dual practice was very low among physicians , less than twice a month . on average physiciansmost doctors ( 85.6 % ) think dp is acceptable and that it should be legal . about 70 % of respondents think that dp activities will result in negative influences in their hospital . the level of awareness of the relevant regulation on dp amongst doctors was low , at 24.4 % . over 70 % of doctors complained that their income was lower than that in other comparable occupations , while 55 % of patients think doctors income is quite high compared with other jobs in current chinese society ) . different specialties have different opportunities to undertake dp : surgeons have more scope for dp than physicians . all of the studies in this group are article - except for the references ( 20 ) and ( 22 ) which are thesis - , and in terms of method , they applied modeling ( three studies ) , review ( three study ) , and quantitative ( one study ) approaches ( table 3 ) . this category refers to the documents , which considered more than one area of dp . six studies fell into this category ( 2 , 3 , 5 , 2426 ) . all of the studies in this group are articles - except for ( 25 ) and ( 26 ) which are reports - , and in terms of method , they applied review ( four studies ) , qualitative ( one study ) , and a combination of quantitative and qualitative ( one study ) approaches ( table 4 ) . all of the studies in this group are article , and in terms of method , they applied quantitative ( two studies ) , qualitative ( two studies ) , and mixed method - both quantitative and qualitative - ( one study ) approaches ( table 1 ) . motivation , reasons and forces behind dual practice what south african medical specialists find satisfying about working in the public and private sectors how to better incentivize retention in the public sector . although there are strong financial incentives for specialists to migrate from the public to the private sector , public work can be attractive in some ways . for example , the public hospital sector generally provides more of a team environment , more academic opportunities , and greater opportunities to feel needed andrelevant . public specialists suffer under poor resource availability , lack of trust for the department of health , and poor perceived career opportunities . these non financial issues of public sector dissatisfaction appeared at least as important as wage disparities . for assistant physicians higher wages at public hospitalsaffect negatively both the decisions to earn income externally , and level of income once active . for consultant physiciansfew respondents said that money is the dominating objective , in that they would gladly give up the private practice in exchange for a pay rise in the nhs . private practice was seen as offering an increase in strategic influence , clinical autonomy , and realization of individual aspirations as a clinician . commitment to government services was found to be greater among doctors in primary health care who reported they would give up private practice if paid a higher salary . among doctors in secondary and tertiary care , the propensity to give up private practice was found to be low . doctors have adopted individual strategies to accommodate the advantages of both government employment and private practice in their career development , thus maximizing benefit from the incentives provided to them e.g. status of a government job , and minimizing opportunity costs of economic losses e.g. lower salaries . the two outstanding reasons why they engage in their various side activities were to meet the cost of living , and to support the extended family .40 percent of participants reported that the median equivalent of one month 's public sector salary could be generated by 7 hours of private practice , but being a civil servant was important in terms of job security , and credibility as a doctor . also the social contacts and public service gave access to power centers and resources , through which other coping strategies could be developed . all of the studies in this group are article - except for the reference ( 17 ) which is a report - , and in terms of method , they applied modeling ( four studies ) , review ( one study ) , and quantitative ( one study ) approaches ( table 2 ) . the consequences of dual practice dual and single practitioners did not differ significantly in terms of the average length of work week , participation in non mandatory activities or duties outside normal working hours , including duties accepted with short notice and their preferences for working hours or turnover intention . some of the effects depend on assumptions that are undermined in the broader literature ( e.g. the intention to maximize income ) allowing moonlighting always enhances aggregate consumer welfare , but equilibrium public - care quality may increase or decrease . unregulated moonlighting may reduce consumer welfare as a result of adverse behavioral reactions , such as moonlighters shirking more and dedicated doctors abandoning their sincere behavior . price regulation in the private market limits such adverse behaviors in the public system and improves consumer welfare . allowing physician dual practicecrowds out public provision , and results in lower overall health care provision . while the health authority can mitigate this effect by offering a higher wage , a ban on dual practiceis more efficient if private sector competition is weak and public and private care are sufficiently close substitutes . on the other hand , if private sector competition is sufficiently tough , a mixed system , with physician dual practice , is always preferable to a pure nhs system . physician will have incentives to over - provide medical services when he uses his public activity as a way of increasing his prestige as a private doctor . physicians dual practice can be either welfare improving or reducing , depending on the treatment policy that the health authority wants to implement ( if the priority is to contain costs , then the doctor s dual activity is negative . if the priority is to minimize patients health losses , his dual practice affords the objective at a lower cost ) . governments can meet the participation constraint of physicians without paying salaries commensurate to physicians abilities because physicians also value the non salary benefit of the opportunity to earn significant private practice revenues . if dual - practitioner differentially refer higher income patients to private practice , public funding becomes more effectively targeted on the poor . however , physician incentives to concentrate inducement on those most responsive to inducement - often the poor and uneducated may act counter to such a social objective . in the next step , we categorized these 24 studies into four groups according to their main objectives ( tables 14 ) . policies and regulations about dual practice and their impacts the need for increasing the share of healthcare budget from the gross domestic product ( gdp ) , inefficient tariff and payment system , and difficulty in obtaining collaboration with other stakeholders are the main challenges of full - time practice program in iran . inappropriate implementation of this program might lead to unexpected transfer of the experienced and high skilled physicians from public hospitals . to analyze and compare some of the most common regulations in dual practice . to investigate whether regulations that are optimal for developed countries are adequate for developing countries as well . forbidding dual practice is seldom optimal , as it usually expels valuable professionals from the public system . results offer theoretical support for the desirability of different regulations in different economic environments . in developed countriesthe key factor is the potential negative effect of dual practice on public performance : when this effect is low the best option is not to intervene ; when it is sufficiently high the best option is to impose a limit on physician involvement . for developing countries , the design of the optimal policy is more complex as it also depends on the attractiveness of the private sector . when this attractiveness is very high the best option is not to intervene and thereby avoid an exodus of highly skilled physicians from the public sector . finally , if the potential gains from private practice are low , the optimal intervention is either to limit dual practice ( if the associated costs are low ) or to ban it ( if such costs are high ) . there is not any scientifically rigorous study in this field ( rcts , nrcts , cba or its designs ) . allowing dual practice can improve welfare even when physicians have homogeneous quality / morality . when information is asymmetric among physicians , patients and the planner , dual practice can be conceived as a tool to improve welfare in two ways : first , resource allocation within the hospital is more efficient ; second , allowing dual practice can save salary expenditure for the public hospital . people with high opportunity cost ( high income ) in switching providers will be more likely to go to the hospital while people with low opportunity cost in switching providers ( low income ) will visit the gp first . hence , after allowing dual practice , rich patients with mild cases are more likely to be induced to private clinics from the hospital . low income patients , or patients with serious conditions , are more likely to be treated in the hospital . therefore , physician dual practice can also be interpreted as an alternative instrument for sorting in terms of both illness severity and switching costs . under some conditions , allowing dual practice can lead to a second - best improvement in efficiency , compared with a situation in which dual practice is not allowed . there are wide variations in how governments tackle this issue . banning dual practice , enforcing restrictions on private practice earnings of physicians , offering exclusive contracts in the public sector , encouraging public doctors to develop their private practice in public facilities , raising public sector salaries , and self - regulation are six mechanisms which have been used by different countries . it causes dual practitioners to either move out of the province or stay and just shirk in effort . these physicians , who want to dual practice but now is unable to , lowers the aggregate welfare of patients in the public sector by constantly maintaining low quality service rather than trying to improve the service . allowing dual practice without restrictions is unlikely to result in an improvement in the social welfare of patients . the social welfare of people in canada s mixed health care system will be better off where restrictions on dual practice are present ( both exclusive contracts and price ceiling allow physicians to still use the over - providing strategy if they choose to dual practice , while also keeping public physicians in the public sector ) . dual practice can be a possible system solution to issues such as limited public sector resources , low regulatory capacity , and the interplay between market forces and human resources . this paper offers some supports for policies that allow for the official recognition of such activity and embrace a degree of professional self regulation in highly resource constrained settings ( because evidence shows that dp is typically poorly regulated in these countries . regulations are either lacking , or when they exist , are vague or poorly implemented because of low regulatory capacity ) . dual practice could be found almost in all countries ( it is wide spread in many developing countries ) . . other non - pecuniary factors such as job complementarities , and institutional , professional , structural and personal variables play a relevant role . while dual providers may be tempted to skimp on time and effort in their main job , to induce demand for their private services , or to misuse public resources , the legalization of dual practice may also contribute to recruit and retain physicians with less strain on the budget and improve access to health services , especially in developing countries . the article provides some qualified support for the use of rewarding policies to retain physicians in the public sectors of more developed countries , while limiting policies are recommended for developing countries - with the caveat that the policies should be accompanied by the strengthening of institutional and contracting environments dual practice is widespread and well - accepted . however , broad macroeconomic influences on dual practice such as the oversupply of medical services , the deregulated nature of this market , and the economic crisis throughout the country were also important . there were some support among doctors for tighter regulation . policy responses to dual practice involve tighter controls on the supply of medical practitioners , alleviation of financial pressures brought by macro - economic conditions , and closer regulation of such activities to ensure some degree of collective action over quality and the maintenance of professional reputations . to provide a summary and comparison of five models of dual practice , including one we have developed based on total compensation theory and contracting limitations . to discuss whether theoretical predictions are consistent with empirical evidence from developed and developing countries . all theories to date suggest that the impact of dual practice on public service quality is ambiguous . the social trade - off between the benefits and costs of dual practice hinge on the quality of a country s contracting institutions . allowing dual practice may improve social welfare and the quality of public services , under specific circumstances . the evidence does not support the perception that full - timers embody greater commitment and contribution to public sector provision . dual practice is approached in the literature with great diversity : health professionals with multiple specialization , working within different paradigms of health , combining different forms of health - related practice , combining professional health practice with an economic activity not related to health , and multiple health - related practices in the same or different sites or sectors . typologies of dp : in terms of sector location , dual practice may be public on public , public on private or private on private . dual practice is probably present in all countries regardless of income , even in settings such as china where there are major regulatory restrictions . negative impacts are predatory behavior ( self gain is preferred to the interests of others ) , conflict of interest ( lower the quality in the public sector to advertise for the private sector ) , brain drain ( to other countries , private sector , or urban areas ) , competition for time and limits to access , outflow of resources and corruption ( illegal use of public resources for private patients ) ; positive impacts : it 's ability to generate additional income for health workers , and higher professional satisfactionthe extent of dual practice seems to vary according to urban or rural residence , according to professional group , according to specialty or occupation . this evidence suggests that dual practice depends not so much on the personal , social ( marital status ) and professional characteristics of health workers , but on factors that are manageable . adequate responses imply the identification of the main underlying reason for the observed dual practice . governments have a wide range of responses to it based mostly on assumption , anecdote , and etc . increasing income is likely to be the main reason for engaging in dp , but job complementarity , institutional and professional factors ( the desire to interact among professionals in the practice site , to secure approval from peers , and to influence fellow professionals and ... ) are probably also important . efforts to address mjh should consider what could be done about both the systemic causes of mjh and its program and worker specific manifestations . all mjh is not of equal importance for health outcomes and making services work for the poor . governments should set priorities carefully , understand causes and effects , and engage in collaborative process with health workers to find solutions which are both acceptable to them and improve system outcomes . governments should increase the benefits and reduce the costs ( negative effects ) in relation to government objectives through the best possible design of incentives and regulations to affect the behavior of health care workers given their demand for mjh ( banning mjh is not really a feasible and effective strategy in most countries , because they lack the capacity to enforce it , and these regulation are often not seen as legitimate by the health workers , their supervisors , and general population ; also removing the conditions creating the demand for mjh among health workers is rarely viable , because it needs sufficient resources and contractual and monitoring capacities which are not present in many countries ) . dual practice was very low among physicians , less than twice a month . on average physiciansmost doctors ( 85.6 % ) think dp is acceptable and that it should be legal . about 70 % of respondents think that dp activities will result in negative influences in their hospital . the level of awareness of the relevant regulation on dp amongst doctors was low , at 24.4 % . over 70 % of doctors complained that their income was lower than that in other comparable occupations , while 55 % of patients think doctors income is quite high compared with other jobs in current chinese society ) . different specialties have different opportunities to undertake dp : surgeons have more scope for dp than physicians . all of the studies in this group are article - except for the references ( 20 ) and ( 22 ) which are thesis - , and in terms of method , they applied modeling ( three studies ) , review ( three study ) , and quantitative ( one study ) approaches ( table 3 ) . this category refers to the documents , which considered more than one area of dp . six studies fell into this category ( 2 , 3 , 5 , 2426 ) . all of the studies in this group are articles - except for ( 25 ) and ( 26 ) which are reports - , and in terms of method , they applied review ( four studies ) , qualitative ( one study ) , and a combination of quantitative and qualitative ( one study ) approaches ( table 4 ) . we conducted a comprehensive search and assessed several articles , reports and other documents in the field of physician dual practice . the results of the study yielded 24 published works , which had our inclusion criteria . considering that the fourth category ( other studies ) is related to studies , which focused on more than one aspect of dp , in this section we reported and interpreted the results of this group in the appropriate areas . although almost there was not any study with the primary aim of assessing the extent of physician dual practice , some evidence showed that this phenomenon is common and ubiquitous among physicians and other health staff in all countries more or less ( 15 ) . physicians engage in dual practice to accommodate the benefits of both government employment and private practice in their career development ( 4 ) . financial incentives seems to be the most important determinant of physician dual practice ( 35 , 1012 , 24 , 25 ) . also non pecuniary factors like status and recognition , strategic influence , control over work and professional opportunities ( 13 ) , strengthen cooperation with other hospitals ( 26 ) , using more academic opportunities and greater opportunities to feel needed and relevant ( 11 ) , job complementarities and institutional , professional , structural and personal variables like interactions among professionals and secure approval from peers ( 5 , 25 ) have been stated as other main determinants of this phenomenon . furthermore some studies have shown that specialization , level of care , and location ( urban or rural ) have significant effect on both the decision and extent of moonlighting among physicians ( 3 , 4 , 26 ) . evidence indicated that it helps physicians to boost their income ( 3 ) , increase their professional satisfaction ( 3 ) , improve access to health services ( 5 , 17 ) , improve the quality in public sector ( 1 ) , and reduce the financial burden on governments to retain high quality physicians in the public sector ( 5 , 17 , 23 ) . on the other hand , for example , it crowds out public provision and also could results in lower overall health care provision ( 15 ) , predatory behavior and induce demand ( 3 , 5 ) , conflict of interest and reducing the quality in the public sector ( 3 ) , brain drain ( 3 ) , competition for time and effort which may lead to absenteeism , tardiness , inefficiency and lack of motivation in the public sector ( 3 , 5 , 9 ) , and outflow of resources from public to private sector and corruption ( 3 , 5 ) . however , one should consider that most of the mentioned effects are based on assumptions which are undermined in the broader literature ( 8 ) . in addition , some evidence showed that there is not any significant difference between the performance of dual practitioners and full timers ( 2 , 14 ) . evidence showed that there is not a single recipe about managing physician dual practice for different countries , and governments have adopted a broad range of responses toward it ( 2 , 3 , 5 , 7 , 25 ) . these responses comprise banning dual practice on one side of the spectrum to allowing it without any restrictions on the other side ( see reference ( 6 ) in table 4 ) . although there is not any rigorous empirical study about the effects of these policies and interventions ( 9 , 25 ) , most of the related documents support allowing dp with restrictions ( 2 , 5 , 7 , 20 , 22 , 23 ) . gonzalez showed that among all limiting strategies , limiting involvement is always more effective than limiting income ( see reference ( 7 ) in table 4 ) . almost all of the studies concluded that the policy of banning dp is seldom optimal , as it could lead to leakage of high skilled physicians from public sector and worsen the quality and social welfare in public hospitals ( 7 , 22 , 23 ) . first , we considered only studies , reported in english or persian because of practical reasons such as time and financial limitations . although authors tried to capture relevant studies through searching in the reference lists of important papers and googling in the search engines , these limitations might lead to missing some related documents . the reason behind this decision was the nature of dual practice field which does not yet have a well - developed scientific literature ( 19 ) . to our knowledge , this was the first study , which reviewed and categorized the literature in physician dual practice field in the last 10 years . it seems that there is a paucity of scientifically reliable evidence in some areas of dp , like dp prevalence , the consequences of dp , and effects of the related interventions . the present study showed that there has been a propensity to over reliance on methods like modeling in predicting the effects and consequences of this phenomenon . however studies showed that almost all of these models are based on assumptions which are undermined in the broader literature ( 8 ) . as a result , government s responses to dp have been based on these assumptions and anecdotal evidence ( 25 ) . furthermore , the effects of these governments responses and interventions in dp ( 9 ) , and also their cost effectiveness have not been examined rigorously so far . therefore , it is not clear that whether we need any intervention in this area , and which kind of policy is more appropriate and cost effective for countries in different levels of development . we therefore suggest that meticulous empirical studies should be designed to detect the real consequences of dp . in addition , it is recommended that rigorous evaluative studies should be planned to assess the effects of interventions and regulations which governments have implemented in this field . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and / or falsification , double publication and / or submission , redundancy , etc ) have been completely observed by the authors .\noutput:\n" }, { "from": "agent", "value": "background : physician dual practice is a common phenomenon in almost all countries throughout the world , which could potential impacts on access , equity and quality of services . this paper aims to review studies in physician dual practice and categorize them in order to their main objectives and purposes.methods : comprehensive literature searches were undertaken in order to obtain main papers and documents in the field of physician dual practice . systematic searches in medline and embase from 1960 to 2013 , and general searches in some popular search engines were carried out in this way . after that , descriptive mapping review methods were utilized to categorize eligible studies in this area.results : the searches obtained 404 titles , of which 81 full texts were assessed . finally , 24 studies were eligible for inclusion in our review . these studies were categorized into four groups - motivation and forces behind dual practice , consequences of dual practice , dual practice policies and their impacts , and other studies - based on their main objectives . our findings showed a dearth of scientifically reliable literature in some areas of dual practice , like the prevalence of the phenomenon , the real consequences of it , and the impacts of the implemented policy measures.conclusion : rigorous empirical and evaluative studies should be designed to detect the real consequences of dp and assess the effects of interventions and regulations , which governments have implemented in this field ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 50 - year - old male patient visited our pain clinic and complained of right posterior auricular pain , which began 4 days prior . the patient started driving a taxi 2 months ago , and his pain was initiated by rotating his head to the right side to give the taxi fare change to a passenger . the first visual analog scale ( vas , 0 to 10 ) was 5 but aggravated to 8 . the pain occurred unpredictably several times per hour with the duration of a few seconds each time without any triggering factor . his psychological state was very unstable and hostile , but the patient did not experience sleep disturbance from the pain . the patient had no medical history of infection , trauma , or drug use , although 1 year ago was admitted to the neurology department because of a similar pain , diagnosed with glossopharyngeal neuralgia , and was transferred to a pain clinic for a glossopharyngeal nerve block . at that time , his imaging study , including c - spine radiography and neck and brain mri , did not reveal any pathologic findings , and because the patient was a truck driver , his symptoms improved after he quit his job and resolved a family problem . upon physical examination , there was a limited range of motion of approximately 20 % when rotating his head to the right . the patient 's pain was reproduced by pressing and squeezing several points in his right sternocleidomastoid ( scm ) muscle ( fig .1 ) , thus , a trigger point injection ( tpi ) was performed with 0.25 % lidocaine , and a 3.8 cm , 25 g needle ( kovax - needle , korea vaccine co. , ltd . , seoul , korea ) . after injection , the vas was lowered from 2 to 3 but returned to 8 after 2 hours . however , the patient complained again of pain via telephone a few hours later and doubted our treatment and the possibility of a full recovery . afterwards , tpi was performed twice per week with 0.125 % bupivacaine ; however , the pain recurred within 2 hours after injection . medication comprising 1,300 mg acetaminophen and 5 mg diazepam 3 times per day was not effective . because tpi caused temporary pain relief , the authors decided to continue tpi treatment , and hypothesized that a few psychological factors may possibly be affecting the persistence and recurrence of the severe pain . after further interview , the authors determined that the patient had gotten into a very stressful psychological family situation ( e.g. , family affair ) approximately 2 months before the initiation of the pain . one year ago , the same symptom occurred when he was frustrated by family problems and job loss , and the pain disappeared after resolution of the problems . the authors suggested that psychological factors had been contributing to trigger , prolong , and intensify the patient 's pain ; therefore , an attempt was made to help the patient understand the relationship between his pain and his psychological problems . despite the author 's recommended psychological supportive therapy , the patient 's rejection of therapy was strong , stating that his pain was real and that he was not an insane person . finally , the patient agreed after he was reminded of the first episode 1 year ago , which was influenced by psychological factors . in addition , an accessory nerve block , superficial cervical nerve plexus block , and transcutaneous electric nerve stimulation ( tens ) were included in the treatment plan . however , the effect of these therapies did not continue for more than 2 to 3 hours before receiving psychological therapy . on the third day after psychological therapy , the vas was lowered to 5 , and the pain frequency was reduced to 3 times per hour , with a duration of 0.5 seconds per incidence . as time progressed , pain relief increased to the patient 's satisfaction . forty days after the onset of pain , the vas score was lowered to 2 , and the pain frequency was once per day , with a duration of 0.5 seconds per incidence . the tpi and nerve block were continued , because the pain did not completely subside . obtaining a thorough patient history and physical examination is important in diagnosing posterior auricular pain for a number of reasons . except for otologic problems , neuropathic conditions in the occipital , trigeminal , and glossopharyngeal nerves , arthropathy in the temporomandibular and upper zygoappophyseal joints , c2 radiculopathy , and muscle - originated pain , including muscle trigger points , can induce peri - or posterior auricular pain , which has similar but different symptoms and signs . in the present case , the patient described the pain character as ' piercing ' and ' electric shock - like ' , which can be indicative of trigeminal neuralgia or glossopharyngeal neuralgia . however , there was no triggering stimulus , such as conversation , chewing , head - washing , teeth brushing , and exposure to cold air or swallowing , which are common in those diseases . glossopharyngeal neuralgia is a rare condition characterized by short and severe pain around the pharyngeal muscle and submandibular gland and usually occurs in people over 50 years of age . if glossopharyngeal neuralgia is suspected , then local compression by tumors which require surgery must be excluded . in the present study , the first episode of pain ended with a change in the patient 's lifestyle and condition . in the second episode of pain , the patient had no trauma or infection history . however , the obvious presence of a typical palpable tender spot , patient 's pain recognition of the tender spot and following limited range of motion helped the authors decide to manage the patient 's pain with tpi , regardless of the previous pain episode . mps is a very common disease but , in unusual sites , is easily misdiagnosed as other conditions . travell and simons described the myofascial trigger point as a hyperirritable spot , usually within a taut band of skeletal muscle , which is painful on compression and causes referred pain , motor dysfunction , and autonomic phenomena . excessive muscle use , inadequate posture , nutritional disease , metabolic disorder , or emotional distress can cause mps . trigger points may be relieved by noninvasive measures , such as spray , stretch , tens , physical therapy , and massage or invasive treatment , tpi with or without local anesthetics , corticosteroids , or botulinum toxin . psychological factors play a significant role in the experience , maintenance , and exacerbation of chronic and acute pain . the pain physician must consider the contributions of psychological aspects to the effectiveness of pain management . there are no therapeutics guaranteed to treat chronic pain , and perfect remission is rare . psychological therapeutic approaches may be useful complements to chronic pain management , although a patient 's psychological state is usually considered only after pain treatment fails . pain due to emotional distress can be exacerbated by many factors , including fear , inadequate or maladaptive support systems , inadequate personal and material coping resources , treatment - induced ( iatrogenic ) complications , overuse of potent drugs , inability to work , financial difficulties , prolonged litigation , disruption of usual activities , and sleep disturbance . although psychological factors can influence pain , physicians should not conclude that pain unresponsive to treatment is psychogenic without sufficient evaluation and treatment . careful consultation about factors that cause , aggravate , and maintain pain which exists deep inside a patient 's mind , is essential . recommendation of psychological intervention to patients who suffer from severe sustained pain should be proposed cautiously because patients may think , ' the doctor will probably stop my treatment ' or ' the doctor may think of my symptoms as malingering or mental illness ' . the patient in the present case study expressed a strong denial to the proposal of psychological interview . a patient may be frustrated and have a negative response ; thus , sufficient explanation to counter any negative response must be given first . in particular , in patients whose trigger point is activated from a latent state by psychological worries , mps occasionally is misdiagnosed as a psychosomatic disorder . although why the pain recurred 2 hours after tpi and other treatments was not understood , other causes of limited effect were suspected , rather than incomplete removal of the trigger point or other pathologies , because of the patient 's definite twitch responses at tpi . the first and second pain episodes were associated with the patient 's job and stressful family situation , respectively . therefore , an inadequate driving habit was thought to have led to the onset of mps , and the stressful psychological situations aggravated , maintained , and amplify the patient 's pain . emotional instability and anticipatory anxiety due to the sudden onset of pain led to the patient 's restricted outdoor activity and allowed for him to focus on post - auricular pain . the authors hypothesized that the patient did not have an opportunity to vent , which made the pain worse and unresponsive to treatment . pain relief with additional psychological therapy supported this hypothesis . in summary , consideration of psychological factors is important in management of mps that is unresponsive to conventional treatment .\noutput:\n" }, { "from": "agent", "value": "psychological factors play a significant role in the pain mechanism , and psychological approaches may be useful complements to traditional medical and surgical treatments in pain management . the authors report a case of recurrent severe posterior auricular pain caused by trigger points in the right sternocleidomastoid muscle and influenced by stressful psychological situations ( e.g. , family affairs , job loss ) in a 50 - year - old man ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: mycobacterium leprae is an evolutionarily ancient pathogen of historical and worldwide prevalence . identified in 1873 by gerhard armauer hansen as the causative agent of leprosy , these fastidious , intracellular bacilli have been studied extensively for their complex pathogenesis and host interactions . cellular tropisms for m. leprae principally include tissue - resident macrophages , especially in the skin and upper respiratory tract , and schwann cells of the peripheral nervous system . the intricate spectrum of clinical manifestations which exists for the disease is illustrated by two polar responses , tuberculoid or lepromatous leprosy , and various intermediate or borderline forms . the tuberculoid manifestation is typically less severe and is characterized by lower leprosy burden and containment of bacilli by distinct granulomas . this form exhibits few hypopigmented skin lesions and scarce thickening of peripheral nerves , leading to loss of sensation in extremities and the skin . lepromatous leprosy constitutes the opposite polar reaction to infection where high , diffuse bacterial load can cause extensive skin plaques , nodules and thickening , and numerous anesthetic zones due to pervasive peripheral nerve damage . surprisingly little genotypic variation exists between strains of m. leprae , a fact inconsistent with the high degree of variability in virulence and disease penetrance between individuals . this suggests that success of infection and leprosy progression rests in large part upon the patient 's immune response and genetic complement . strikingly , the variable spectrum of leprosy outcome correlates tightly with the balance of t - helper - cell - mediated immunity responding to m. leprae infection . a robust th1 host response , featuring appreciable production of interferon - gamma ( ifn ) and interleukin - 12 ( il - 12 ) along with macrophage and cd4 t cell activation , is typically represented in the contained , tuberculoid form . alternatively a strong th2 response , characterized by an intense but nonprotective humoral reaction , in addition to high il - 4 and il - 10 release , coincides with the lepromatous manifestation . a system of regulation controlling such a delicate balance is certain to be complex , but undoubtedly must begin with pathogen recognition at the sites of host inoculation . the innate immune system provides an immediate means of surveillance for invading microorganisms and importantly , for a disease such as leprosy , plays a key role in initializing the type of adaptive strategy that the host will use to respond to infection . pattern recognition receptors ( prrs ) are pivotal for innate sensing of conserved microbial - associated molecules indicative of infection in the extracellular milieu . amongstthe prrs is a class of type - 1 integral membrane proteins , the ten - member toll - like receptor family , whose extracellular domains recognize a diverse array of such microbial agonists . tlrs are expressed by a variety of leukocytes and solid tissue cell types , with the highest levels primarily displayed by cells of myeloid lineage such as monocytes , macrophages , and dendritic cells . however , tlr subsets are also expressed in lymphocytes , epithelium , endothelium , fibroblasts , and even schwann cells . upon ligandbinding , the tlrs initiate a signal cascade which ultimately activates nfb - regulated genes , most notably encoding proinflammatory cytokine and chemokines , as well as the costimulatory molecules required for t - cell activation . m. leprae and other mycobacterial species such as m. tuberculosis are rich in agonists for several members of the tlr family , including tlr1 , 2 , 4 , 6 , and 9 . genetic association studies have identified a number of single nucleotide polymorphisms ( snps ) in tlr genes which associate with susceptibility or resistance to bacterial and viral infection . due to the high relevance of host genetic factors in the outcome of m. leprae infection , decades of researchhave been devoted to identifying key polymorphisms which associate strongly with the predisposition to clinical leprosy manifestation , spontaneous clearance , and to the spectrum of disease progression . this paper will examine specific tlr polymorphisms which are associated with m. leprae and m. tuberculosis infection , with a focus on the potential mechanistic basis for their effects on pathogenesis and host response . the majority of tlrs ( tlr3 , 4 , 5 , 7 , 8 , and 9 ) signal via homodimerization in the presence of agonist binding . members of the tlr2 subfamily , which includes tlr1 , 2 , 6 , and 10 , are unique in their ability to form heterodimeric complexes which sense an extremely diverse group of microbial molecules . tlr1 heterodimerizes with tlr2 to recognize primarily triacylated lipoproteins displayed by gram - positive , gram - negative , and acid - fast bacteria . this receptor pair is also capable of detecting glycolipids , glycoproteins , lipopeptides , lipoteichoic acids , and fungal cell wall components . interestingly , the cell wall and membrane of mycobacteria are especially rich in tlr1 / 2 agonists . the lipoglycans lipomannan ( lm ) and mannose or arabinose - capped lipoarabinomannan ( manlam and aralam ) are major virulence factors in mycobacterial species . manlam and aralam in particular are potent tlr1 / 2 agonists and have been shown to contribute both to macrophage activation and immunomodulation of host responses . these molecules behave in large part as scavengers of reactive oxygen species deployed by the phagosomal oxidative burst . in addition , stimulation of macrophages with purified m. leprae and m. tuberculosis lam molecules has been shown to decrease ifn - inducible microbial killing by macrophages , reduce t - cell proliferation and activation , and inhibit protein kinase c , a key transduction molecule in ifn and respiratory burst signaling . although tlr2 has the ability to dimerize with multiple tlr coreceptors , tlr1 / 2 heterodimers are the primary sensors by which immune cells recognize mycobacterial lipoproteins . significant examples of such mycobacterial agonists include the m. leprae and m. tuberculosis 19 kda lipoprotein orthologs , ml1966 and lpqh . these membrane - anchored proteins possess adhesin properties and serve as major mycobacterial surface antigens . the impressive ability of these triacylated lipoproteins to deactivate macrophages has been well characterized and shown to be dependent on engagement of tlr2 . the m. leprae annotated genomic sequence predicts 31 different lipoprotein genes , including the enzymatic machinery for ligation of acyl chains . orthologous partners for all of these genes exist in m. tuberculosis , which possesses an additional 60 genes encoding putative lipoproteins . in addition to the well - studied 19 kda antigen , m. leprae also encodes a 33 kda ( ml0603 ) lipoprotein with tlr2 immunostimulatory activity . it is conceivable that many of the triacylated lipoproteins displayed by both leprosy and tuberculosis bacilli could signal via tlr1 / 2 heterodimers and may possess similarly immunosuppressive functions to those of the 19 kda antigen . the 6 kda early secreted antigenic target ( esat - 6 ) of m. tuberculosis is a highly potent cd4 t - cell antigen and is absent in most nontuberculosis complex mycobacteria . a commonly used diagnostic test for tb , approved by the fda in 2005 , is based upon whole blood stimulation with purified esat - 6 in an ifn release assay . unlike classical proinflammatory tlr agonists , it has been shown that esat - 6 engages tlr2 in a way that inhibits myd88 - dependent tlr signaling including activation of nfb and interferon regulatory factors . m. leprae possesses an esat - 6 ortholog with 36 % identity , ml0049 , and both monocytes and t cells from leprosy patients respond to l - esat - 6 by secreting ifn . at this timeno direct evidence is available to support an immunosuppressive role for ml0049 similar to that of esat - 6 . while innate immune responses to both m. leprae and m. tuberculosis rely heavily on tlr1 / 2 stimulation by various cell wall components , tlr4 has also been shown to play a role in detecting mycobacteria . the classical ligand for tlr4 is lipopolysaccharide ( lps ) , derived from the outer cell membrane of gram - negative bacteria . despite the fact that lps is absent from mycobacterial membranes , studies in transfected cells and murine macrophages have shown that m. leprae and m. tuberculosis are both recognized by tlr4 . for m. tuberculosis , this effect was linked to md -2-mediated tlr4 recognition of secreted heat shock protein 65 ( hsp - 65 ) and chaperonin 60 protein . another secreted tuberculosis protein , the adhesin heparin - binding hemagglutinin ( hbha ) , was found to bind tlr4 , induce maturation , and activate proinflammatory cytokine secretion in dendritic cells . m. leprae encodes orthologs of hsp60 , hsp65 , and hbha , but no studies have examined whether these proteins possess similar tlr4 stimulating qualities to those of m. tuberculosis . it has been reported however that lps binding by tlr4 can be blocked with heat - killed m. leprae , inhibiting monocyte secretion of il - 1 and il - 6 . tlr9 mediates recognition of unmethylated cpg elements in viral and bacterial dna , a motif relatively rare in vertebrate genomes . unlike tlr1 , 2 , and 4 , which traffic to the cell surface , tlr9 is predominantly expressed intracellularly in the endoplasmic reticulum . upon pathogen stimulation , tlr9 localizes to endosomal compartments , where the receptor gains access to genomic dna released from the degradation of phagocytized bacteria or internalized virus . primary human monocyte - derived macrophages and murine dendritic cells respond to stimulation with cpg dna derived from various strains of m. tuberculosis ( h37rv and h37ra ) and m. bovis ( wildtype and bcg ) by increasing transcription of tnf and ifn . interestingly , dna from the attenuated strains induces a much more vigorous tnf response than dna from virulent mycobacteria . given the importance of tlrs in mediating host responses to pathogenic mycobacteria , it is not surprising that single nucleotide polymorphisms effecting expression or function of these receptors influences host susceptibility to leprosy and tuberculosis . a snp involving a thymine to guanine transversion ( t1805 g ) in tlr1 results in a nonsynonymous substitution at amino acid position 602 ( i602s ) , a position residing in the cytoplasmic region proximal to the receptor 's transmembrane domain . although western blotting and intracellular staining illustrate equivalent protein expression of each variant , both transfection and primary human monocyte studies reveal a trafficking deficiency for tlr1602s , causing the receptor to be absent from the plasma membrane . in transfected cell lines and monocytes from tlr1602s / s homozygotes , the subsequent lack of surface tlr1602s induces a state of hyporesponsiveness to tlr1 / 2 agonists , including bacterial lipoproteins and synthetic triacylated lipopeptides . these results serve to highlight the importance of tlr localization in receptor function . genetic association studies of leprosy have included dna samples from diverse populations across the world , including individuals of eastern asian , african american , hispanic , nepalese , turkish , and caucasian backgrounds . for example , caucasian individuals possess the 602i allele at ~ 25 % and the 602s allele at ~ 75 % , while african american individuals possess a reciprocal allele frequency of ~ 75/25 percent for i / s . hispanic , turkish , and nepalese individuals have i / s ratios of ~ 70/30 , 57/43 , and ~ 94/6 percent , respectively . the tlr1602s allele appears to be virtually absent in east asian individuals with a 602i allele frequency of 99 % . peripheral blood mononuclear cells from tlr1602s / s individuals were shown to have greatly diminished cytokine production when stimulated with whole irradiated m. leprae and m. tuberculosis , as well as membrane and cell wall fractions . it would therefore be expected that individuals homozygous for tlr1602s would have increased susceptibility to mycobacterial infection . however , several disease association studies have revealed a protective role for the deficient tlr1602s variant against the development of both clinical leprosy and tuberculosis . the study performed by johnson et al . observed that a cohort of turkish leprosy patients had a significantly higher allele frequency for tlr1602i versus healthy controls . conversely , the tlr1602s allele was significantly underrepresented amongst leprosy patients , with an odds ratio for infection of 0.48 ( p 0.05 ) among tlr1602s / s homozygotes . th2 - directed lepromatous or borderline forms of leprosy are potentially unstable disease states and may quickly revert to a th1 type adaptive response during a so - called reversal reaction . this can result in a sudden and exacerbated increase in acute t - cell - mediated immunity and create more intense tuberculoid symptoms along with local tissue damage . observed that the tlr1602s allele confers protection against leprosy reversal reaction ( or = 0.51 , p = 0.01 ) . ma et al . observed a significant increase in the rate of extrapulmonary tb infection in african american patients possessing the 602i / i genotype ( or = 2.5 , p 0.001 ) . striking evidence of this polymorphism 's role in leprosy was established when an extensive and unbiased genome - wide array of 2092 genes in 1500 individuals identified tlr1602s ( or = 0.31 , p 0.001 ) as one of two alleles that afforded the greatest protection against leprosy , the other being the mhcii allele hla - drb1 / dqa1 ( or = 0.43 , p 0.001 ) . a second polymorphism in tlr1 , n248s ( a743 g ) , is in strong linkage disequilibrium with the tlr1602i allele which may explain the finding , observed in a bangladesh cohort of leprosy patients , that m. leprae infection associates with the tlr1248s / s genotype ( or = 1.34 , p = 0.02 ) . an insertion / deletion polymorphism in the tlr2 promoter lies at position 196 to 174 bp upstream of the start codon . this polymorphism has been studied in the context of tlr2 expression in both asthma and hepatitis c infection . an in vitro reporter construct carrying the deletion allele of the tlr2 promoter induces lower luciferase activity than the insertion allele , suggesting that the former possesses inherently reduced transcriptional activity . in addition , primary human monocytes from individuals carrying the deletion allele produce significantly less il - 8 upon stimulation with peptidoglycan . a subsequent disease association study of caucasian ( or = 0.41 , p 0.001 ) and african ( guinea - bissau ) ( or = 0.70 , p = 0.02 ) tuberculosis cohorts revealed protection via homozygosity for the fully functional insertion allele . a microsatellite marker located between 162 and 100 bp in the promoter region of tlr2 contains two adjacent variable number tandem repeats of ct and tg which vary in length between 280290 bp . an investigation of ethiopian leprosy patients by bochud et al . revealed a lower frequency of the 290bp repeat allele in disease cases versus healthy controls ( or = 0.62 , p = 0.02 ) . in addition , a 288 bp allele was observed less frequently in lepromatous versus tuberculoid leprosy patients ( or = 0.49 , p = 0.02 ) . however , this same allele was also shown to greatly increase susceptibility to reversal reaction ( or = 5.83 , p = 0.001 ) in a subgroup of patients which had been followed for 8 additional years . using an in vitro reporter assay , yim et al . revealed that variability in the number of microsatellite repeats effected tlr2 promoter function in response to cytokine stimulation . no phenotypic effects on tlr2 function have been linked to a synonymous snp ( n199n , c597 t ) in the extracellular domain of this receptor . however , the 8 - year leprosy reaction followed up by bochud et al . identified a protective role for tlr2597 t against reversal reaction ( or = 0.34 , p = 0.002 ) . this polymorphism was also shown to be highly relevant in a vietnamese cohort of tb patients where progression of disease was more than twofold higher and dissemination of bacilli to the brain was 3-fold higher in individuals homozygous for the 597c allele . the g2258a snp ( r753q ) in the cytoplasmic domain of tlr2 has been well characterized as a functionally deficient variant with reduced responses to bacterial lipoproteins and synthetic di - and triacylated lipopeptides . most reports on tlr2 r753q have shown inhibition of signaling in response to borrelia burgdorferi lipoproteins , such as ospa and whole cell lysates . one report observed a lower frequency of tlr2753q in lyme disease patients than healthy controls ( or = 0.39 , p = 0.033 ) and an even stronger protective effect was conferred in late stage lyme disease patients ( or = 0.16 , p = 0.018 ) . interestingly , the converse result was obtained when a turkish cohort of tuberculosis patients was genotyped for the tlr2 polymorphism . in this study , the risk of developing tuberculosis was increased over 6-fold for tlr2753q / q individuals and 1.6-fold for heterozygotes . another study of turkish pediatric patients also associated the tlr2 r753q heterozygotes with tb , citing an over 5-fold increased risk of infection ( or = 5.05 , p 0.001 ) . taken together these results indicate that a functionally deficient tlr2 variant plays opposite roles in two different infectious diseases : protection in the context of lyme disease and susceptibility in the context of tb . although no disease association studies have been performed between tlr2 r753q and leprosy , it would be very interesting to see if the results observed in the context of tb would also extend to m. leprae . numerous studies of two tlr4 polymorphisms , d299 g ( g896a ) and t399i ( c1196 t ) , have revealed increased risk of infection with several gram - negative organisms as well as septic shock . these snps , which alter amino acids in the extracellular domain of tlr4 , appear to affect receptor function depending upon the experimental system under investigation . some studies have reported a decrease in lps - induced il - 12 and il - 10 in asthma patients , reduced cytokine secretion in an inhaled lps human model , and inhibited signaling in cell - based transfection models . however , other studies have found no functional deficits exhibited by primary human monocytes and pbmcs obtained from individuals who are either heterozygous or homozygous for these tlr4 variants . similar to tlr2 , deficient tlr4 function is generally associated with increased susceptibility to mycobacterium infection . for example , a significant increase in the frequency of the tlr4299 g allele was observed in pulmonary tuberculosis patients in an asian indian cohort ( or = 2.1 , p = 0.001 ) , with highest bacillary loads observed in homozygous individuals . other studies in hiv / tb coinfected patients indicate that 299 g is a risk factor for active tuberculosis in mediterranean caucasians ( or = 2.0 ) and tanzanian patients ( or = 2.8 , p = 0.06 ) , but at borderline statistical significance . in contrast to m. tuberculosis , a protective role for tlr4 d299 g has been identified in association with m. leprosy infection . examined an ethiopian population and observed lower frequencies of tlr4 d299 g ( or = 0.34 , p 0.001 ) and t399i ( or = 0.16 , p 0.001 ) among leprosy patients . conversely , another investigation found tlr4 d299 g in a malawi cohort of leprosy patients afforded no protection , although their cohort was half the size of the previous study . velez et al . investigated the prevalence of several tlr9 polymorphisms in tuberculosis patients of caucasian , african american , and african ( guinea - bissau ) descent . no functional studies have been performed examining the effects of these polymorphisms on tlr9 signaling . however , two of these gene - flanking polymorphisms , rs352139 and rs5743836 , appear to confer protection to tb . rs352139 was observed less frequently in caucasian ( or = 0.53 , p = 0.017 ) and african american ( or = 0.58 , p = 0.029 ) tb patients , while rs5743836 provided protection in african americans ( or = 0.54 , p = 0.024 ) and in caucasians ( or = 0.50 , p = 0.015 ) . no statistically significant reduction in risk was associated with members of the guinea - bissau cohort . based upon the established role of tlrs in host defense , polymorphisms which negatively affect receptor function would be expected to increase susceptibility and worsen outcomes to infection . this generality holds true for a number of tlr polymorphisms in various infectious disease settings and simply reflects the host 's inability to properly recognize and respond to bacterial agonists . however , a number of functionally deficient polymorphisms in tlr1 and tlr4 have been found to confer protection to mycobacterial infection . this finding suggests that , during the course of evolution , mycobacteria have subverted the tlr system in ways that are advantageous to establishing and maintaining infection . much of the experimental evidence supporting this idea is provided below . several studies have revealed that prolonged mycobacterial stimulation via tlr1 / 2 causes macrophages to become refractory to ifn ( figure 1 ) . ifn , a type - 2 interferon primarily secreted by t cells and natural killer cells , is a th1 - skewing cytokine essential to the containment of mycobacterial infection . this secreted dimeric glycoprotein is a classical activator of innate immune effectors and plays a key role in the induction of macrophage microbicidal functions , including phagolysosome maturation and oxidative burst . in addition , ifn facilitates a priming function by upregulating the cellular machinery required for antigen presentation , phagocytosis , and t - cell costimulation . mice deficient in cytokine production or the ifn receptor develop disseminating and ultimately fatal mycobacterial disease . also , a human mutation linked to ifn signaling associates with susceptibility mycobacterial disease and disseminated infection following vaccination with the calmette - gurin bacillus strain of m. tuberculosis . active nfb provided by tlr ligation on macrophages or dendritic cells induces expression and secretion of il - 12 , a cytokine essential to the th1 skewing of cd4 t - helper cells . once exposed to il - 12 , these cells begin secreting ifn , establishing a positive ifn / il - 12 feedback loop ( figure 1 ) . however , stimulation with the m. tuberculosis 19 kda lipoprotein is sufficient to greatly reduce induction of ifn - regulated genes in many cell types , including murine raw264 .7 cells , mouse bone - marrow - derived macrophages , human thp - 1 cells , and primary human monocytes ( figure 1 ) . microarray analysis has shown an inhibition of ifn - inducible transcription of il - 12 receptor mrna upon stimulation with mycobacterial lipoproteins . further subversion of tlr1 / 2 signaling is illustrated by abrogated ifn - dependent upregulation of macrophage activation markers mhcii , cd64 , and cd86 in cells stimulated with either whole mycobacteria or purified triacylated lipoproteins . mhcii is a receptor essential for the activation of adaptive immunity by professional antigen - presenting cells ( apcs ) . forced downregulation of mhcii by mycobacteria corresponds to reduced antigen processing in murine bone - marrow - derived macrophages and associates with a curtailed ability to activate t cells . phagocyte - expressed cd86 ( b7 .2 ) provides costimulatory signals which , in addition to mhcii , are essential for cd4 t - helper - cell activation and survival . simultaneous inhibition of cd86 and mhcii by tlr1 / 2 activation would impart a major hindrance on recruitment of adaptive help at the site of infection . finally , cd64 ( fcri ) , a key phagocytic receptor specific for igg - opsonized pathogens , facilitates pathogen internalization and induction of the oxidative burst . downregulation of this receptor could potentially reduce phagocytic uptake of mycobacteria by macrophages , dendritic cells , and neutrophils , thereby decreasing pathogen clearance and generation of peptides for antigen presentation . the engagement of tlr2 by esat - 6 inhibits ifn induction of ctiia , the transcriptional coactivator required for mhcii expression . furthermore , the tlr2 - dependent inhibition of ifn signaling by mycobacterial lipoproteins was shown to act through a similar mechanism , whereby inhibition of ciita blocks induction of many macrophage activation markers . another recent tlr2 - dependent immunoregulatory mechanism used by mycobacteria has been identified which affects the macrophage respiratory burst . inducible nitric oxide synthase ( inos ) generates nitric oxide ( no ) , a major component of the phagolysosomal oxidative burst . no reacts with superoxide , a product of nadph oxidase , to generate peroxynitrite , a powerful oxidant capable of damaging diverse biological molecules within phagocytized pathogens . inos requires cellular pools of l - arginine to drive catalysis and the availability of this substrate has been shown to be a rate - limiting step in production of no . arginase - 1 , a metabolic enzyme important in the urea cycle , shares arginine as a substrate . this enzyme participates in the final step of the cycle by metabolizing l - arginine to l - ornithine and urea . curiously , it has been reported that during mycobacterium bovis ( bcg ) infection of j774 .1 mouse macrophages , the levels of urea rise with increasing bacterial replication . a recent study has linked these observations to mycobacterial pathogenesis by showing that stimulation of primary mouse macrophages with bcg upregulates levels of both arginase - 1 mrna and protein . in addition , arginase - 1 knockouts exhibit enhanced no production in bcg - infected macrophages and lower bacterial burdens in an aerosol infection model of m. tuberculosis . another report found that cell supernatants from bcg - infected macrophages are capable of inducing arginase - 1 in uninfected neighboring macrophages , an effect dependent on the production of il - 6 and il - 10 . these data suggest that mycobacterial stimulation of tlr2 induces arginase - 1 , which inhibits the oxidative burst and allows increased survival within the macrophage endosome ( figure 2 ) . similar to the inhibition of ifn signaling , arginase - 1 mediated immunosuppression was found to be dependent on cebp - . colonization of schwann cells by m. leprae is known to stimulate granuloma formation and cell - mediated nerve injury . the influx of numerous adaptive and innate immune cells proximal to an infected peripheral nerve may produce direct schwann cell damage and killing , or indirect death via pressure - induced ischemia . immunohistochemistry of skin biopsies from both lepromatous and tuberculoid leprosy patients reveals tlr1 and tlr2 surface expression by multiple cell types , including schwann cells . schwann cell tlr2 is functional as indicated by the activation of nfb by synthetic bacterial lipopeptides . tlr2 - dependent activation by the 19 kda lipoprotein of m. leprae has also been shown to induce apoptosis in primary human schwann cells . additionally , nerve injury promotes massive upregulation of tlr1 , manyfold over most other schwann cell - expressed tlrs . since m. leprae is capable of activating apoptosis in a tlr2 , and presumably tlr1 - dependent manner , it is possible that upregulation of tlr1 by nerve damage may establish a positive feedback loop for schwann cell deterioration ( figure 3 ) . revealed a tlr2 - dependent induction of apoptosis in monocyte - derived macrophages stimulated with the triacylated lipoprotein . collectively , the above studies convincingly highlight the role of tlr1 and tlr2 in mycobacterial pathogenesis . based on the established immunosuppressive activity of the tlr1 / 2 complex following recognition of mycobacterial agonists , it is not difficult to imagine why a functionally deficient allele of tlr1 would be advantageous . if tlr1602s is unable to gain access to the cell surface , where it is proximal both to its coreceptor and bacterial ligand , immune evasion through the tlr1 / 2 signaling complex would not be achieved by mycobacteria ( figures 1 , 2 , and 3 ) . one could take this a step further to suggest that tlr1602s / s homozygous individuals infected with m. leprae are more likely to develop the less severe tuberculoid form of the disease . it is intriguing to note that similar to tlr1 , but unlike tlr2 , deficient tlr4 functions are generally associated with increased resistance to m. leprae . if the d299 g and t399i snps do indeed confer hyporesponsiveness to tlr4 agonists , the protection to mycobacteria infection is analogous to the trafficking - deficient tlr1 i602s . at this timeno groups have examined the potential for mycobacteria - derived tlr4 agonists to induce immunosuppressive effects similar to those of tlr1 / 2 ligands . such studies could provide a mechanism by which deficient tlr4 signaling provides resistance to mycobacteria . the earliest known human case of leprosy has been traced back to over 4000 years ago from east indian skeletal remains . human infection by m. tuberculosis is arguably even more ancient , as evidenced by 9000 - year - old bone samples from neolithic settlements testing positive for tb dna . the extreme success for a pathogenic organism such as mycobacteria requires either high rates of transmission or powerful immunoevasive strategies . transmissibility for tuberculosis is not particularly profound and only occurs during relatively rare active phases . the likelihood of passing leprosy is equally low ; yet these pathogens are consistently endemic worldwide . over many decades , the exquisite mechanisms by which mycobacteria neutralize and even subvert host defenses have been uncovered , potentially explaining the impressive effectiveness of these pathogens . highlighted in this paper are the tlr - mediated pathways by which m. leprae and m. tuberculosis are recognized by the innate immune system . through many functional and genetic studiesit can be concluded that single nucleotide polymorphisms in tlrs have the ability to both modify receptor function and associate with risk of leprosy and tuberculosis ( table 1 ) . some investigations have identified snps which negatively affect tlr signaling and correspondingly induce hyporesponsiveness in immune cells to these bacteria . in some cases , such as tlr2 in the context of tb and leprosy and tlr4 in the context of tb , this abrogated function correlates unsurprisingly with increased susceptibility of the host to infection . the i602s polymorphism of tlr1 inhibits trafficking of the receptor to the cell surface thereby abrogating innate recognition of mycobacterial agonists . this functional deficiency in tlr1is not associated with an increased risk of infection but instead reduces the likelihood of developing clinical leprosy by over half . in addition , snps which appear to impair tlr4 function ( d299 g , t399i ) reduce the incidence of leprosy infection by over two - thirds . many of the known immunoevasive strategies employed by mycobacteria operate through tlr activation by bacterial components . it is intriguing to imagine that mycobacteria have evolved over the centuries to subvert host responses in a way that have aided them in their obvious success as human pathogens . by creating functionally poor responses to tlr agonists , indeed , the tlr1 - 6 - 10 gene cluster has been identified as a hotspot of strong positive selection . it is of interest to note that the geographic distribution of the tlr1602i allele , which increases susceptibility to m. leprae by 1.5 times , is highest in regions where leprosy is most endemic . such genetic diversity in tlrs is certain to provide further important insights into both pathogenesis and host defense against mycobacteria .\noutput:\n" }, { "from": "agent", "value": "genetic association studies of leprosy cohorts across the world have identified numerous polymorphisms which alter susceptibility and outcome to infection with mycobacterium leprae . as expected , many of the polymorphisms reside within genes that encode components of the innate and adaptive immune system . despite the preponderance of these studies , our understanding of the mechanisms that underlie these genetic associations remains sparse . toll - like receptors ( tlrs ) have emerged as an essential family of innate immune pattern recognition receptors which play a pivotal role in host defense against microbes , including pathogenic strains of mycobacteria . this paper will highlight studies which have uncovered the association of specific tlr gene polymorphisms with leprosy or tuberculosis : two important diseases resulting from mycobacterial infection . this analysis will focus on the potential influence these polymorphic variants have on tlr expression and function and how altered tlr recognition or signaling may contribute to successful antimycobacterial immunity ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: are psychrotrophic bacteria , and they are the main cause for milk spoilage ( reddy et al . , 1969 ) , chicken ( pittard et al . , 1982 ) , fish ( miller et al . , 1973 ) , and meat especially at chill temperatures ( nychas et al . , 2008 ) . in food , they produce special fluorescent green , yellow or bluish compounds ( brown et al . , 1958 ) . moreover , they generate off - odors in the meats by producing prolyitc and lipolyic enzymes ( champagne et al . , 1994 ; sorhaug and stepaniak , 1997 ) . although pseudomonas spp . causes physicochemical changes , microbiological criteria for the bacteria are not established because they are not pathogenic bacteria . in processed meat products , nano2 plays an important role in developing of cured meat color and flavor , retarding lipid autoxidation , and preventing clostridium botulinum germination in anaerobic condition ( pegg and shahidi , 2006 ) . however , nano2 has the potential to produce n - nitroso compounds under acidic conditions in stomach ( sugimura , 2000 ) . n - nitroso compounds have been found to cause carcinogenic activity in many animal models ( cassens , 1995 ) . hence , consumers have low acceptance level for processed meat products . even though processed meat products formulated with low concentrations of nano2 have been developed to avoid potential side effects , but the concern for microbial safety due to lowered concentrations of nano2 has now increased ( sinedlar et al . , 2007 ) . nacl has been used to improve water - holding capacity , fat binding properties , flavor and the inhibition of microbial growth in processed meat products ( gurdia et al . , 2006 ; rhee and zipirin , 2001 ) . however , the high level of nacl intake is related to hypertension ( tobian et al . , 1979 ) , cardiac failure ( frolich , 1999 ) , and stroke ( perry and beevers , 1992 ) . thus , consumers are willing to have the low concentration of nacl in processed meat products , but this low nacl concentration may not inhibit bacterial growth . therefore , the minimum concentrations of nano2 and nacl need to be determined to inhibit bacterial growth and also to meet consumers requirement . thus , the interactive responses for these two ingredients should be considered in order to determine the minimum concentrations . probabilistic model using logistic regression can estimate the probabilities of bacterial growth and interface between growth and no growth of bacteria under various conditions ( lpez - malo et al . ( henry and bessieres , 1984 ; nicke et al . , 2013 ) , but the combination effect of nano2 and nacl on pseudomonas spp . in processed meats has not been fully studied yet . therefore , the objective of this study was to develop probabilistic models to determine the gi time of pseudomonas spp . in combinations with nano2 and nacl concentrations . the isolated colonies of pseudomonas aeruginosa strains ( nccp10338 , nccp10250 , and nccp11229 ) and pseudomonas fluorescens strains ( kacc10326 and kacc 10323 ) in cetrimide agar ( becton dickinson and company , usa ) were cultured in a nutrient broth ( nb ; becton dickinson and company ) at 35 for 24 h. one hundred microliter fractions of the cultures were transferred into 10 ml nb for subculture at 35 for 24 h. after incubation , five strains were mixed and centrifuged at 1,912 g and 4 for 15 min , and cell pellet was washed twice with phosphate - buffered saline ( pbs ; ph 7.4 ; 0.2 g of kh2po4 , 1.5 g of na2hpo47h2o , 8.0 of nacl , and 0.2 g of kcl in 1 l of distilled water ) . the combination of 8 levels ( 0 , 0.25 , 0.5 , 0.75 , 1 , 1.25 , 1.5 , and 1.75 % ) of nacl ( samchun pure chemical co. ltd . , korea ) and 9 levels ( 0 , 15 , 30 , 45 , 60 , 75 , 90 , 105 , and 120 ppm ) of nano2 ( duksan pure chemicals co. ltd . two hundred and twenty five microliters of the medium were placed in wells of 96 - well microtiter plates , and 25 l of inoculum was inoculated into each well . all microtiter plate wells were then incubated at 4 , 7 , 10 , 12 , and 15 for 528 , 504 , 504 , 360 , and 144 h , respectively . growth ( growth initiation ; gi ) or no growth was then determined by turbidity every 24 h. the combinations that became turbid , were considered growth , while the unturbid combination was considered no growth . the growth response was regarded as 1 and no growth response was assigned as 0 ( koutsoumanis et al . , 2004 ) . the growth response data were analyzed with the sas version 9.2 logistic regression analysis ( sas institute inc . logit ( p ) = a0 + a1nacl + a2nano2 + a3time + a4nacl + a5nano2 + a6time + a7naclnano2 + a8nacltime + a9nano2time where logit ( p ) is an abbreviation of ln [ p / ( 1p ) ] , p is the probability of growth within the range of 0 to 1 , ai is the estimates , nacl is nacl concentrations , nano2 is nano2 concentrations , and time is storage time . observed data for pseudomonas spp . the frankfurters and bacon were cut into 7 g and placed into plastic bags ( food saver , rollpack , korea ) . the 0.1 ml portions of the inoculum were inoculated on one side of the sample surface . the inoculated samples were massaged 15 times in order to spread the bacteria and then sealed using a packager ( food guard ; rollpack , korea ) . the samples were then aerobically stored at 4 , 7 , 12 , and 15 for 336 , 312 , 192 , and 120 h , respectively . to quantify bacterial populations , the 30 ml of 0.1 % buffered peptone water ( bpw ; becton dickinson and company ) was added into the sample bag and homogenized using a pummeler ( bagmixer , interscience , france ) for 60 s. the homogenates were serially diluted with 0.1 % bpw , and 0.1 ml of the diluents was surface - plated on cetrimide agar . the plates were incubated at 35 for 24 h , and the typical colonies were manually counted to determine gi time . a growth greater than 1 - log considered growth ( koutsomanis et al . , 2004 ; lee et al . , the observed gi times were then compared to the predicted gi times of pseudomonas spp . the isolated colonies of pseudomonas aeruginosa strains ( nccp10338 , nccp10250 , and nccp11229 ) and pseudomonas fluorescens strains ( kacc10326 and kacc 10323 ) in cetrimide agar ( becton dickinson and company , usa ) were cultured in a nutrient broth ( nb ; becton dickinson and company ) at 35 for 24 h. one hundred microliter fractions of the cultures were transferred into 10 ml nb for subculture at 35 for 24 h. after incubation , five strains were mixed and centrifuged at 1,912 g and 4 for 15 min , and cell pellet was washed twice with phosphate - buffered saline ( pbs ; ph 7.4 ; 0.2 g of kh2po4 , 1.5 g of na2hpo47h2o , 8.0 of nacl , and 0.2 g of kcl in 1 l of distilled water ) . the combination of 8 levels ( 0 , 0.25 , 0.5 , 0.75 , 1 , 1.25 , 1.5 , and 1.75 % ) of nacl ( samchun pure chemical co. ltd . , korea ) and 9 levels ( 0 , 15 , 30 , 45 , 60 , 75 , 90 , 105 , and 120 ppm ) of nano2 ( duksan pure chemicals co. ltd . two hundred and twenty five microliters of the medium were placed in wells of 96 - well microtiter plates , and 25 l of inoculum was inoculated into each well . all microtiter plate wells were then incubated at 4 , 7 , 10 , 12 , and 15 for 528 , 504 , 504 , 360 , and 144 h , respectively . growth ( growth initiation ; gi ) or no growth was then determined by turbidity every 24 h. the combinations that became turbid , were considered growth , while the unturbid combination was considered no growth . the growth response was regarded as 1 and no growth response was assigned as 0 ( koutsoumanis et al . , 2004 ) . the growth response data were analyzed with the sas version 9.2 logistic regression analysis ( sas institute inc . , usa ) to estimate the growth probabilities of pseudomonas spp . logit ( p ) = a0 + a1nacl + a2nano2 + a3time + a4nacl + a5nano2 + a6time + a7naclnano2 + a8nacltime + a9nano2time where logit ( p ) is an abbreviation of ln [ p / ( 1p ) ] , p is the probability of growth within the range of 0 to 1 , ai is the estimates , nacl is nacl concentrations , nano2 is nano2 concentrations , and time is storage time . the frankfurters and bacon were cut into 7 g and placed into plastic bags ( food saver , rollpack , korea ) . the 0.1 ml portions of the inoculum were inoculated on one side of the sample surface . the inoculated samples were massaged 15 times in order to spread the bacteria and then sealed using a packager ( food guard ; rollpack , korea ) . the samples were then aerobically stored at 4 , 7 , 12 , and 15 for 336 , 312 , 192 , and 120 h , respectively . to quantify bacterial populations , the 30 ml of 0.1 % buffered peptone water ( bpw ; becton dickinson and company ) was added into the sample bag and homogenized using a pummeler ( bagmixer , interscience , france ) for 60 s. the homogenates were serially diluted with 0.1 % bpw , and 0.1 ml of the diluents was surface - plated on cetrimide agar . the plates were incubated at 35 for 24 h , and the typical colonies were manually counted to determine gi time . a growth greater than 1 - log considered growth ( koutsomanis et al . , 2004 ; lee et al . , the observed gi times were then compared to the predicted gi times of pseudomonas spp . the estimates of coefficients selected from the logistic regression analysis , using an automatic variable selection option with a stepwise selection method , are shown in table 1 . the estimates were then used to produce interfaces between growth and no growth of pseudomonas spp . at 0.1 , 0.5 , and 0.9 of probabilities with the combination for nano2 and nacl level for each storage temperature ( figs . 1 - 2 ) . nacl , nano2 , and storage time were generally significant ( p 0.05 ) factors for inhibiting pseudomonas spp . however , nano2 and nacl did not have any significant effects on the growth of the bacteria at 15 . moreover , a square function for nacl and nano2 was not observed at 12 and 15 ( table 1 ) . for 4 and 7 , the antimicrobial effect of nano2 on pseudomonas spp . growth slightly increased to 1 % nacl , but the antimicrobial effect dramatically increased to 1.25 % nacl ( figs . 1 and 2 ) . in addition , the combination effect of nacl and nano2 on the inhibition of pseudomonas spp . growth was also observed at 10 , 12 , and 15 ( data not shown ) . according to these results , it is suggested that nacl concentration of ready - to - eat meat products should be at a certain level to have the obvious antimicrobial effect of nano2 on pseudomonas spp .3 , showing that the difference of growth probability among nano2 concentrations became more obvious as nacl concentration increased . ( 1994 ) also showed that the concentration - dependent antimicrobial effect of nano2 on l. monocytogenes in cold - processed salmon in high nacl concentrations when stored at 5 and 10 . shahamat et al . ( 1980 ) and buchanan et al . ( 1989 ) examined the antimicrobial effects of nano2 on l. monocytogenes and suggested that the antilisterial effect is improved with nacl and other factor such as ph , and temperature . ( 2001 ) suggested that even though the specific inhibitory modes of nitrite are not well clarified , its antimicrobial effectiveness depends on several factors including salt concentration , ph , reductants , iron content , and others . the concordance index was used in order to measure the goodness of fit in the developed probabilistic model . the concordance index indicated the degree of agreement between the observations and calculated probabilities . in this study , the concordance index was 94.5 - 98.1 % , while the discordance was 1.9 - 5.3 % , depending on the storage temperature ( data not shown ) . to evaluate the performance of the developed probabilistic models in this study , the predicted gi times calculated by the estimates of the parameters listed in table 1 at the probability level of 0.5 were then compared to the predicted gi times ( table 2 ) . a growth more than 1 - log scale was considered growth . the developments of the growth / no growth model were compared with the observed growth data . the predicted gi times were generally overestimated when compared to the observed values by 58.217.5 % to 79.411 % . initiated to grow earlier in frankfurter and bacon than in broth media by 58.2 - 79.4 % . over - prediction percentages were 79.411 % ( 4 ) , 66.414.6 % ( 7 ) , 58.217.5 % ( 12 ) , and 68.22.1 % ( 15 ) ( table 2 ) . in our study , grew up to approximately 5 - 6 log cfu / ml , and at the point , pseudomonas spp . however , data from ready - to - eat meats were considered as growth if a growth greater than 1 - log was observed . because of this reason , there was a difference between the predicted data and the observed data . therefore , decreased gi time by 58.2 to 79.4 % compared to the predicted gi time from developed probabilistic model should be applied for real processed meat products such as frankfurters and bacon . percentage ( % ) = ( the observed data / the predicted data ) 100 ; values are meansstandard errors . in conclusion , the probabilistic models developed in this study can be used to calculate the gi times of pseudomonas spp . in frankfurters and bacon as a function of nacl and nano2 concentrations , considering the over - prediction percentage , and thus , the probabilistic models can be useful in controlling bacterial spoilage in the processed meats by pseudomonas spp .\noutput:\n" }, { "from": "agent", "value": "this study developed probabilistic models to determine the initiation time of growth of pseudomonas spp . in combinations with nano2 and nacl concentrations during storage at different temperatures . the combination of 8 nacl concentrations ( 0 , 0.25 , 0.5 , 0.75 , 1 , 1.25 , 1.5 , and 1.75 % ) and 9 nano2 concentrations ( 0 , 15 , 30 , 45 , 60 , 75 , 90 , 105 , and 120 ppm ) were prepared in a nutrient broth . the medium was placed in the wells of 96 - well microtiter plates , followed by inoculation of a five - strain mixture of pseudomonas in each well . all microtiter plates were incubated at 4 , 7 , 10 , 12 , and 15 for 528 , 504 , 504 , 360 and 144 h , respectively . growth ( growth initiation ; gi ) or no growth was then determined by turbidity every 24 h. these growth response data were analyzed by a logistic regression to produce growth / no growth interface of pseudomonas spp . and to calculate gi time . nacl and nano2 were significantly effective ( p < 0.05 ) on inhibiting pseudomonas spp . growth when stored at 4 - 12 . the developed model showed that at lower nacl concentration , higher nano2 level was required to inhibit pseudomonas growth at 4 - 12 . however , at 15 , there was no significant effect of nacl and nano2 . the model overestimated gi times by 58.217.5 to 79.411 % . these results indicate that the probabilistic models developed in this study should be useful in calculating the gi times of pseudomonas spp . in combination with nacl and nano2 concentrations , considering the over - prediction percentage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: albert einstein first explained the theory of stimulated emission in 1917 , which became the basis of lasers . lasers were first applied in dentistry for hard - tissue treatments such as caries removal and cavity preparation , as a substitute for mechanical cutting and drilling . after the discovery of ruby laser by maiman , goldman et al . since then , many researchers have investigated the effects of lasers on dental hard tissues and caries using argon , carbon dioxide ( co2 ) , and neodymium - doped yttrium aluminum garnet ( nd : yag ) lasers . however , though indicated , most lasers are unable to effectively cut biocalcified tissues . co2 and nd : yag lasers induce surface changes in enamel , but these lasers tend to cause fissuring , cracking , recrystallization or crateriform foci of melting . some of the lasers are able to ablate carious material , but they can not effectively prepare sound tooth structure and , therefore , are not amenable to cavity preparation . in addition , laser photon energy is complicated by significant elevations in temperature with a potential for deleterious effects on pulpal tissues . some of these shortcomings have been compensated after the introduction of erbium , chromium : yttrium , scandium , gallium , garnet ( er , cr : ysgg ) laser in the field of dentistry . this laser system with a wavelength of 2780 nm , frequency of 20 hz and pulse energy between 0 and 300 mj , has federal drug administration : usa approval for several soft and hard tissue procedures . the laser energy absorbed by water microdroplets is believed to be partially responsible for the hard tissue cutting effects and has been designated as a hydrokinetic system ( hks ) . other points of interest regarding the er , cr : ysgg laser includes the fact that melting enamel with this laser increases resistance to acid demineralization . because of this versatility , the er , cr : ysgg laser is the first all - in - one laser that make the economics of providing laser therapy more feasible . another advantage of using laser energy for tooth preparation is that it does not lead to the formation of smear layer . tooth preparation with rotating instruments leaves a smear layer on the tooth surface which hinders impregnation ( enamel or dentin ) with the adhesive agent and thus prevents adequate adhesion . since the report of buonocore , the standard approach to this problem has been acid etching . laser etching of enamel or dentin has been reported to yield an anfractuous surface and open dentin tubules , both apparently ideal for adhesion . laser radiation of dental hard tissues modifies calcium - to - phosphorus ratio and reduces carbonate - to - phosphate ratio leading to the formation of more stable and less acid - soluble compounds , thus reducing susceptibility to acid attack and caries . although there are many benefits of using laser for etching tooth surface , a different group of lasers alter tooth surface differently and thus affect bond strength in a variety of manner . compared to acid etching , co2 lasershave been reported to increase the bond strength , whereas nd : yag and argon fluoride : excimer devices have been reported to weaken the bond strength between tooth and composite resin . the purpose of this study is to compare the topographic changes over the tooth surface after preparing it with er , cr : ysgg laser and diamond points . another parameter assessed is the bond strength achieved over both the prepared surfaces without any surface treatment and following acid etching treatment . a total of 210 extracted maxillary central incisor teeth devoid of caries and restorations were placed in isotonic saline immediately after extraction and stored at room temperature . the radicular portions of the teeth were boxed in acrylic resin before preparation . for the purpose of standardization , labial surface of the same toothwas divided into two halves arbitrarily with a permanent marker [ figure 1 ] and prepared by two different means as for laminate restoration . right half of the tooth was prepared with diamond bur and the left half with er , cr ; ysgg laser . maxillary central incisor tooth divided into two halves of a total sample size of 210 teeth , following two groups were created : group 1 : tooth surface prepared with laser ( left half of the labial surface ) group 2 : tooth surface prepared with diamond bur ( right half of the labial surface ) . group 1 : tooth surface prepared with laser ( left half of the labial surface ) group 2 : tooth surface prepared with diamond bur ( right half of the labial surface ) . right , half of the tooth was prepared with diamond bur ( ss white burs , inc .1145 towbin avenue lakewood , new jersey ) . facial reduction of 0.30.5 - mm was carried out using standard grit round end diamond and chamfer cervical finish line was given . an er , cr : ysgg hydrokinetic dental laser ( waterlase c - 100 , biolase tech inc . , california , usa ) was used for preparing the other half of the tooth . parameter settings used in the study were : power output at 4 watts , pulse repetition rate of 20 hz and pulse duration of 140 s . laser tip selected was sapphire fiber tip ( c - 6 ) with tip diameter of 600 m and tip length of 9 mm . laser beam was directed toward the tooth surface in a scanning fashion at a distance of approximately 2 mm and at an angle of 45 to the tooth surface . laser beam was directed manually , without the use of a fixed support , to simulate clinical conditions as closely as possible [ figure 2 ] . laser irradiation of the left half of tooth prepared tooth surface a total of 10 tooth samples were selected at random after tooth preparation and examined under scanning electron microscope ( sem ) to compare the surface topography of tooth prepared using laser and diamond bur . the prepared specimens were sputter coated with gold in a vacuum chamber and were viewed in sem machine ( carl zeiss ag , ev0 - 50 series , nts gmbh , oberkochen germany ) at a resolution of 500 . after tooth preparation , the prepared teeth were divided into 4 subgroups of 100 samples each based on the surface treatment procedures they were subjected to [ table 1 ] . table showing the distribution of samples into different groups and their respective bond strength values it was done with 37 % phosphoric acid gel ( swisstec , composite resin , coltene , whaledent , switzerland ) , followed by washing with water after 30 s. tooth surface was air dried for further bonding steps . in this control group , single coating of the bonding agent ( swisstec , composite resin , coltene , whaledent , switzerland ) was applied with the help of applicator tips and cured for 20 s. each tooth received 2 bonded composite resin ( swisstec , composite resin , coltene , whaledent , switzerland ) cylinders , one on each of the prepared surfaces . for uniformity of the size of composite resin cylinders , a plastic tube of 3 mm inner diameter and 5 mm height was filled with composite resin and placed perpendicular to the tooth surface [ figure 4a ] . the composite resin cylinder was subjected to the curing light for 60 s , moving the light to assure uniform curing of the entire cylinder [ figure 4b ] . prepared specimens were stored in distilled water at room temperature for 24 h , followed by bond strength testing . ( a ) resin packed using plastic sleeves , ( b ) bonded resin cylinders samples were tested for shear bond strength with a universal testing machine ( a-271800102 , ogawa seiki co. , ltd , japan ) using a knife - edge bonded cylinder and were at a distance of 1 mm from the tooth surface [ figure 5 ] . tests were performed at a crosshead speed of 1.0 mm / min until the composite cylinder was dislodged from the tooth . the force to dislodge the bond between the composite resin and toothshear bond strength in megapascals ( mpa ) were determined by dividing the peak load by the surface area of each cylinder . the bond strength ( d ) values ( expressed in mpa ) were calculated using the formula : d = l / a , where l is a load ( in n ) , and a is the adhesive area . specimen attached to fixture for bond strength assessment , ( a ) frontal view , ( b ) lateral view bond strength data were analyzed with a 2 - factor analysis of variance , with the level of significance of p 0.05 . post - hoc comparisons of means were performed using t - tests with p values adjusted for multiple comparisons ( bonferroni method ) . right , half of the tooth was prepared with diamond bur ( ss white burs , inc . . facial reduction of 0.30.5 - mm was carried out using standard grit round end diamond and chamfer cervical finish line was given . an er , cr : ysgg hydrokinetic dental laser ( waterlase c - 100 , biolase tech inc . , california , usa ) was used for preparing the other half of the tooth . parameter settings used in the study were : power output at 4 watts , pulse repetition rate of 20 hz and pulse duration of 140 s . laser tip selected was sapphire fiber tip ( c - 6 ) with tip diameter of 600 m and tip length of 9 mm . laser beam was directed toward the tooth surface in a scanning fashion at a distance of approximately 2 mm and at an angle of 45 to the tooth surface . laser beam was directed manually , without the use of a fixed support , to simulate clinical conditions as closely as possible [ figure 2 ] . a total of 10 tooth samples were selected at random after tooth preparation and examined under scanning electron microscope ( sem ) to compare the surface topography of tooth prepared using laser and diamond bur . the prepared specimens were sputter coated with gold in a vacuum chamber and were viewed in sem machine ( carl zeiss ag , ev0 - 50 series , nts gmbh , oberkochen germany ) at a resolution of 500 . after tooth preparation , the prepared teeth were divided into 4 subgroups of 100 samples each based on the surface treatment procedures they were subjected to [ table 1 ] . table showing the distribution of samples into different groups and their respective bond strength values it was done with 37 % phosphoric acid gel ( swisstec , composite resin , coltene , whaledent , switzerland ) , followed by washing with water after 30 s. tooth surface was air dried for further bonding steps . in this control group , no surface treatment was done on the prepared tooth surface . it was done with 37 % phosphoric acid gel ( swisstec , composite resin , coltene , whaledent , switzerland ) , followed by washing with water after 30 s. tooth surface was air dried for further bonding steps . in this control group , no surface treatment was done on the prepared tooth surface . single coating of the bonding agent ( swisstec , composite resin , coltene , whaledent , switzerland ) was applied with the help of applicator tips and cured for 20 s. each tooth received 2 bonded composite resin ( swisstec , composite resin , coltene , whaledent , switzerland ) cylinders , one on each of the prepared surfaces . for uniformity of the size of composite resin cylinders , a plastic tube of 3 mm inner diameter and 5 mm height was filled with composite resin and placed perpendicular to the tooth surface [ figure 4a ] . the composite resin cylinder was subjected to the curing light for 60 s , moving the light to assure uniform curing of the entire cylinder [ figure 4b ] . prepared specimens were stored in distilled water at room temperature for 24 h , followed by bond strength testing . ( a ) resin packed using plastic sleeves , ( b ) bonded resin cylinders samples were tested for shear bond strength with a universal testing machine ( a-271800102 , ogawa seiki co. , ltd , japan ) using a knife - edge bonded cylinder and were at a distance of 1 mm from the tooth surface [ figure 5 ] . tests were performed at a crosshead speed of 1.0 mm / min until the composite cylinder was dislodged from the tooth . the force to dislodge the bond between the composite resin and tooth was recorded as a peak load in newton . shear bond strength in megapascals ( mpa ) were determined by dividing the peak load by the surface area of each cylinder . the bond strength ( d ) values ( expressed in mpa ) = l / a , where l is a load ( in n ) , and a is the adhesive area . specimen attached to fixture for bond strength assessment , ( a ) frontal view , ( b ) lateral view bond strength data were analyzed with a 2 - factor analysis of variance , with the level of significance of p 0.05 . post - hoc comparisons of means were performed using t - tests with p values adjusted for multiple comparisons ( bonferroni method ) . highest bond strength was observed in group 1b ; that is , laser prepared the acid etched group , followed by group 2b , that is , bur prepared , and acid etched the group [ table 1 ] . group 2a , that is , bur prepared the nonacid etched group showed least bond strength . statistical analysis revealed that the difference in the bond strength values in group 1a ( 25.16202.5541 ) and group 1b ( 31.73602.8753 ) was statistically significant ( p 0.05 ) . the mean bond strength in 2a group , that is , tooth prepared using bur with no acid etching treatment was 9.95201.2936 mpa , for 2b group , that is , bur prepared and acid etched group was 30.14102.4256 mpa . the difference in bond strength between these two groups was statistically significant ( p 0.05 ) . the difference in bond strength values between all the groups is significant sparing the group 1b , that is , laser prepared acid etched and 2b , that is , bur prepared acid etched where the difference is found to be insignificant . the sem observation revealed that the laser prepared surfaces were clean and devoid of a smear layer . lased tooth surface was highly irregular ; sharp jagged projections were evident on the laser prepared surface with some evidence of prism structure . scanning electron microscope view of the tooth surface , ( a ) laser prepared , ( b ) bur prepared nonetched bur - cut enamel surfaces were relatively smooth , but they were covered with smear layer . preparation lines created by the movement of bur over the enamel surface are clearly evident . these surfaces fail to show prism structure because of masking by a diffuse smear layer [ figure 6b ] . on laser prepared surface , there is a lack of smooth continuous margin which is evident on the bur prepared surface . presence of this diffuse marginal topography along laser prepared surface might necessitate the use of the bur to define the margins . highest bond strength was observed in group 1b ; that is , laser prepared the acid etched group , followed by group 2b , that is , bur prepared , and acid etched the group [ table 1 ] . group 2a , that is , bur prepared the nonacid etched group showed least bond strength . statistical analysis revealed that the difference in the bond strength values in group 1a ( 25.16202.5541 ) and group 1b ( 31.73602.8753 ) was statistically significant ( p 0.05 ) . the mean bond strength in 2a group , that is , tooth prepared using bur with no acid etching treatment was 9.95201.2936 mpa , for 2b group , that is , bur prepared and acid etched group was 30.14102.4256 mpa . the difference in bond strength between these two groups was statistically significant ( p 0.05 ) . the difference in bond strength values between all the groups is significant sparing the group 1b , that is , laser prepared acid etched and 2b , that is , bur prepared acid etched where the difference is found to be insignificant . the sem observation revealed that the laser prepared surfaces were clean and devoid of a smear layer . lased tooth surface was highly irregular ; sharp jagged projections were evident on the laser prepared surface with some evidence of prism structure . scanning electron microscope view of the tooth surface , ( a ) laser prepared , ( b ) bur prepared nonetched bur - cut enamel surfaces were relatively smooth , but they were covered with smear layer . preparation lines created by the movement of bur over the enamel surface are clearly evident . these surfaces fail to show prism structure because of masking by a diffuse smear layer [ figure 6b ] . on laser prepared surface , there is a lack of smooth continuous margin which is evident on the bur prepared surface . presence of this diffuse marginal topography along laser prepared surface might necessitate the use of the bur to define the margins . though the use of high - speed handpieces and dental burs for tooth preparation save on time , they might lead to increased sensitivity after tooth preparation . furthermore , subsequently they need some sort of surface treatment for bonding between the tooth and composite resin . lasers have been proposed and used for tooth preparation owing to their ability to reduce sensitivity after tooth preparation . it has also been reported that there is a significant decrease in discomfort levels for the laser system at the time of tooth preparation for subjects who declined to receive local anesthetic in comparison to the use of high - speed handpieces and burs . the sem observations of the laser and bur prepared surface revealed that the lased tooth surface was irregular and there was also the absence of a smear layer with some evidence of prism structure ; nonetched bur - cut enamel surfaces fail to show prism structure because of masking by a diffuse smear layer . the topographical features are very much similar to the one observed by lin et al . they compared the cavity preparation using conventional air turbine handpiece and er , cr : ysgg laser powered system using a split - mouth design . the restoration retention was similar between the two treatment groups with added advantage of statistically significant decrease in discomfort levels for the laser system at the time of cavity preparation when performed without the use of local anesthetic . in the present studyhighest bond strength values were seen in laser prepared acid etched group , followed by bur prepared the acid etched group and the differences between them being statistically insignificant . lin et al . found similar results while assessing the shear bond strength of composite bonded to tooth structure treated with an er , cr ; ysgg - powered hks and carbide bur . even they reported no significant differences in shear bond strength between etched bur - cut and etched laser - cut enamel . data obtained from this study is against the results obtained by martnez - insua as they found that adhesion to dental hard tissues after er : yag laser etching is inferior to that obtained after conventional acid etching . the probable reason could be that enamel and dentin surfaces prepared by er : yag laser etching show extensive subsurface fissuring that is unfavorable to adhesion . this difference could be attributed to the difference in the nature of the laser used and thus the effect on the tooth surface . another inference drawn from the present study implies that pretreatment of the tooth surface with er , cr : ysgg laser did not increase the effectiveness of conventional acid etching of enamel . this is the reason why on both laser and bur prepared tooth surfaces which were subjected to acid etching , the difference in bond strength values was insignificant . and they also reported that pretreatment with er , cr : ysgg laser did not increase the effectiveness of conventional acid etching of enamel in sealant bonds . these results disagree with the study of usmez et al . who concluded that surface treatment with er , cr : ysgg laser and 37 % phosphoric acid produce similar bond strength values on the tooth surface . it can be proposed that laser powered hks is an efficient , effective , precise and safe device for the removal of caries and for the preparation of tooth structure for restorations . it also offers an alternative to the vibratory and auditory irritation that attends conventional air turbine / bur . though time taken by laser to complete tooth preparation is much more than high - speed handpiece and bur , they can still be considered as an alternative mode of preparing tooth owing to their desensitizing effect on tooth , reduced need of anesthesia during tooth preparation , no sense of vibration , additional advantage of enhancing the bond strength . use of lasers for tooth preparation can also solve the problem of sensitivity faced while preparing the vital teeth for crown . unlike conventionally used acid etchants , they do not cause surface demineralization which increases the likelihood of caries initiation . in fact er , cr : ysgg laser has been shown to increase acid resistance of enamel and dentin upon irradiation . it is unquestioned that the patient avoidance of restorative dentistry is based upon the perceived association of such procedures with pain . there is a strong argument that laser - assisted tooth preparation , caries control , and bonding techniques will find growing acceptance . further investigations including the effect of thermal cycling and long - term water storage on bond strength assessment needs to be done . furthermore , the effect of exposing tooth surfaces to different laser power settings during etching and tooth preparations needs to be further addressed . the results thus obtained , present a valid premise for further in - vivo studies to evaluate the potential of lasers for tooth preparation and etching . it is unquestioned that the patient avoidance of restorative dentistry is based upon the perceived association of such procedures with pain . there is a strong argument that laser - assisted tooth preparation , caries control , and bonding techniques will find growing acceptance . but no single in vitro test provides an accurate indication of the intraoral environment . further investigations including the effect of thermal cycling and long - term water storage on bond strength assessment needs to be done . furthermore , the effect of exposing tooth surfaces to different laser power settings during etching and tooth preparations needs to be further addressed . the results thus obtained , present a valid premise for further in - vivo studies to evaluate the potential of lasers for tooth preparation and etching . within the limitations of this study , following conclusions were drawn : sem revealed that significant differences exist in topography of bur - and laser - prepared surfaces with laser prepared enamel surface being more irregular and roughthe bond strength value in laser prepared acid etched group was significantly higher than laser prepared nonetched group . similarly among bur prepared surfaces , bond strength was higher in an acid etched grouplaser prepared the nonacid etched group had shown significantly higher bond strength values compared to bur prepared the nonacid etched group , which has shown least mean bond strength of all the study groupshighest bond strength was shown by laser prepared acid etched group , followed by bur prepared acid etched , but the difference here was found to be statistically nonsignificant . sem revealed that significant differences exist in topography of bur - and laser - prepared surfaces with laser prepared enamel surface being more irregular and rough the bond strength value in laser prepared acid etched group was significantly higher than laser prepared nonetched group . similarly among bur prepared surfaces , bond strength was higher in an acid etched group laser prepared the nonacid etched group had shown significantly higher bond strength values compared to bur prepared the nonacid etched group , which has shown least mean bond strength of all the study groups highest bond strength was shown by laser prepared acid etched group , followed by bur prepared acid etched , but the difference here was found to be statistically nonsignificant . it was found in the present study that er , cr : ysgg laser can be used for preparing a tooth . though bond strength value for restorative resins achieved by laser preparation alone without use of any other surface treatment procedure is less than that achieved after acid etching of bur prepared surface , the values are still clinically significant and acceptable .\noutput:\n" }, { "from": "agent", "value": "background : erbium , chromium : yttrium , scandium , gallium , garnet ( er , cr : ysgg ) laser has been successfully used in the ablation of dental hard and soft tissues . it has been reported that this system is also useful for preparing tooth surfaces and etching , but no consensus exist in the literature regarding the advantage of lasers over conventional tooth preparation technique.materials and methods : labial surfaces of 25 extracted human maxillary central incisors were divided into two halves . right half was prepared with diamond bur and left half with er , cr ; ysgg laser and a reduction of 0.30.5 mm was carried out . topography of prepared surfaces of five teeth were examined under scanning electron microscope ( sem ) . the remaining samples were divided into 4 groups of 10 specimens each based on the surface treatment received : one group was acid etched and other was nonetched . composite resin cylinders were bonded on prepared surfaces and shear bond strength was assessed using a universal testing machine.results : the sem observation revealed that the laser prepared surfaces were clean , highly irregular and devoid of a smear layer . bur prepared surfaces were relatively smooth but covered with smear layer.highest bond strength was shown by laser prepared acid etched group , followed by bur prepared the acid etched group . the bur prepared nonacid etched group showed least bond strength.conclusions : er , cr : ysgg laser can be used for preparing tooth and bond strength value achieved by laser preparation alone without surface treatment procedure lies in the range of clinical acceptability ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the structure of layered double hydroxides ( ldhs ) and zinc layered hydroxide ( zlh ) are derived from the structure of brucite , mg ( oh ) 2 . the magnesium ions with a ( 2 + ) charge are centered to six octahedrally hydroxides with a ( 1 ) charge . each hydroxide is bonded to three magnesium atoms , resulting in neutral layers that interact with each other through weak hydrogen bonds .1 the chemical structure of ldhs can be represented by the general formula : 2 and the layered hydroxide salts can be represented as follows : where m is a divalent cation , m is a trivalent cation , and a is an exchangeable anion with a charge ( n ) .3 the flexibility in composition of ldh and zlh , and easily replaced the anions located in the interlayer regions leaded to an increased level of interest in these materials . as a result of the relative ease to synthesize , ldhs and lhss represent inexpensive and versatile compounds that can be used in different advanced applications , such as in a controlled release system for drugs .4 when applying two drugs in a system , the interaction may yield an additive effect , where the total response is the sum of the two drugs individually . in addition , the combination of these two drugs may result in a greater response , which is called a synergistic response . on the other hand , the interaction between the two drugs may also lead to a smaller response , whereby one drug blocks the effects of the other . it is important to note that the synergistic effect of the combination of two drugs against one target has recently been of particular interest .5,6 hippuric acid ( benzoylaminoethanoic acid ) can be obtained from the urine of horses and other herbivores . a biological investigation of hippuric acid shows that it has limited antimicrobial activity at acidic ph values ,7 and has synergistic potentiating effects on the selective toxicity of a mixture of 13 substances within the circulatory system .8 from our previous work , hippurate nanocompsite han has shown synergistic activity with tamoxifen against the hepg2 cell line .9 therefore the aim of this present work is to study the synergistic properties of han when combined with doxorubicin and oxaliplatin against different cell lines ( mda - mb231 , mcf - 7 , and caco2 ) . it should be known that oxaliplatin has been commonly used for chemotherapy in colon cancer ,10 while doxorubicin is the most common treatment for breast cancer .11,12 hippuric acid ( 98 % purity ) was purchased from merck ( darmstadt , germany ) and was used as received . doxorubicin ( 98 % purity ) and oxaliplatin was purchased from sigma - aldrich ( st louis , mo ) . zinc oxide ( zno ) of american chemical society reagent grade was purchased from fisher scientific ( waltham , ma ) , and dimethyl sulfoxide ( dmso ) was purchased from ajax finechem ( thermo fisher scientific , waltham , ma ) and used without further purification . the cell lines mcf - 7 , mda - mb231 , and caco2 were purchased from the american type culture collection . the hippuric acid nanocomposite ( han ) was synthesized by the direct method using zno as the starting material as reported previously ,9,13,14 with minor modifications . the hippuric acid solution ( 0.01 mole ) was prepared using 1.8 g of hippuric acid in 20 ml of dmso , and was adjusted to 50 ml by the addition of deionized water . the zno powder ( 0.2 g ) hippurate solution was added slowly dropwise to the suspended zno , with vigorous stirring until the addition was complete and the solution became clear . mol / l ) to get the white precipitate ; the resulting precipitate was magnetically stirred for 18 hours at 70c . the resulting product was centrifuged , thoroughly washed with deionized water , dried in an oven at 60c overnight , and kept in a sample bottle for further use . breast cancer cell lines ( mcf - 7 and mda - mb231 ) and heterogeneous human epithelial colorectal adenocarcinoma cells ( caco2 ) were seeded into 96 - well plates and kept at 5 % co2 at 37c for 24 hours , at a cell density of 4050 % confluence . the cells were then treated with doxorubicin and oxaliplatin alone , and with an equivalent cytostatic mixture of either hippuric acid or han . after 72 hours of incubation , 20 l of tetrazolium salts ( 3 - ( 4,5 - dimethylthiazol -2-yl ) -2,5-diphenyltetrazolium bromide ) mtt solution ( 5 mg / ml ) was added to each well and incubated for 4 hours . the microplates were turned swiftly to discard the medium , and the formazan precipitate was dissolved in 10 % sodium dodecyl sulfate in dmso containing 0.6 % acetic acid . the microplates were then gently shaken in the dark for 30 minutes , and absorbance at 570 nm and 630 nm ( background ) was measured with a microtiter plate reader . mcf - 7 , mda - mb231 , and caco2 cells were first seeded in six - well plates . after incubation for 24 hours for cell attachment , exponentially growing cells were exposed to doxorubicin ( 0.5 g / ml ) alone , or to oxaliplatin ( 5 g / ml ) and its combination with hippuric acid or han . the plates were incubated at 37c at 5 % co2 for 24 , 48 , and 72 hours . after incubation , the media was aspirated off , washed with cold phosphate buffered saline to get rid of the dead cells , and replaced with 1 ml of 0.05 % ( 2 mg / ml ) trypsin - edta . the plates were incubated at 37c for 1015 minutes , until the majority of the cells had lifted off . the cell suspension was centrifuged at 1000 rpm for 10 minutes , and the supernatant was discarded . twenty l of cell suspension was mixed with 20 l of 0.4 % trypan blue solution . cells were resuspended and dye - excluding viable cells were microscopically counted using a hemocytometer . all data were expressed as the means standard deviation of the values obtained from three replicates . using analysis of variance , powder x - ray diffraction patterns were recorded with a shimadzu xrd - 6000 instrument ( shimazdu corporation , tokyo , japan ) using cuk radiation ( = 1.5418 ) and a dwell time of 4 degrees per minute . cell count was carried out with a neubauer hemocytometer ( weber scientific international ltd , middlesex , uk ) by way of clear field microscopy ( nikon corporation , tokyo , japan ) . hippuric acid ( 98 % purity ) was purchased from merck ( darmstadt , germany ) and was used as received . doxorubicin ( 98 % purity ) and oxaliplatin was purchased from sigma - aldrich ( st louis , mo ) . zinc oxide ( zno ) of american chemical society reagent grade was purchased from fisher scientific ( waltham , ma ) , and dimethyl sulfoxide ( dmso ) was purchased from ajax finechem ( thermo fisher scientific , waltham , ma ) and used without further purification . the cell lines mcf - 7 , mda - mb231 , and caco2 were purchased from the american type culture collection . the hippuric acid nanocomposite ( han ) was synthesized by the direct method using zno as the starting material as reported previously ,9,13,14 with minor modifications . the hippuric acid solution ( 0.01 mole ) was prepared using 1.8 g of hippuric acid in 20 ml of dmso , and was adjusted to 50 ml by the addition of deionized water . the zno powder ( 0.2 g ) hippurate solution was added slowly dropwise to the suspended zno , with vigorous stirring until the addition was complete and the solution became clear . the ph was adjusted to 7.9 using an aqueous solution of naoh ( 0.5 mol / l ) to get the white precipitate ; the resulting precipitate was magnetically stirred for 18 hours at 70c . the resulting product was centrifuged , thoroughly washed with deionized water , dried in an oven at 60c overnight , and kept in a sample bottle for further use . breast cancer cell lines ( mcf - 7 and mda - mb231 ) and heterogeneous human epithelial colorectal adenocarcinoma cells ( caco2 ) were seeded into 96 - well plates and kept at 5 % co2 at 37c for 24 hours , at a cell density of 4050 % confluence . the cells were then treated with doxorubicin and oxaliplatin alone , and with an equivalent cytostatic mixture of either hippuric acid or han . after 72 hours of incubation , 20 l of tetrazolium salts ( 3 - ( 4,5 - dimethylthiazol -2-yl ) -2,5-diphenyltetrazolium bromide ) mtt solution ( 5 mg / ml ) was added to each well and incubated for 4 hours . the microplates were turned swiftly to discard the medium , and the formazan precipitate was dissolved in 10 % sodium dodecyl sulfate in dmso containing 0.6 % acetic acid . the microplates were then gently shaken in the dark for 30 minutes , and absorbance at 570 nm and 630 nm ( background ) was measured with a microtiter plate reader . mcf - 7 , mda - mb231 , and caco2 cells were first seeded in six - well plates . after incubation for 24 hours for cell attachment , exponentially growing cells were exposed to doxorubicin ( 0.5 g / ml ) alone , or to oxaliplatin ( 5 g / ml ) and its combination with hippuric acid or han . the plates were incubated at 37c at 5 % co2 for 24 , 48 , and 72 hours . after incubation , the media was aspirated off , washed with cold phosphate buffered saline to get rid of the dead cells , and replaced with 1 ml of 0.05 % ( 2 mg / ml ) trypsin - edta . the plates were incubated at 37c for 1015 minutes , until the majority of the cells had lifted off . the cell suspension was centrifuged at 1000 rpm for 10 minutes , and the supernatant was discarded . twenty l of cell suspension was mixed with 20 l of 0.4 % trypan blue solution . cells were resuspended and dye - excluding viable cells were microscopically counted using a hemocytometer . all data were expressed as the means standard deviation of the values obtained from three replicates . using analysis of variance , statistical significance was determined . powder x - ray diffraction patterns were recorded with a shimadzu xrd - 6000 instrument ( shimazdu corporation , tokyo , japan ) using cuk radiation ( = 1.5418 ) and a dwell time of 4 degrees per minute . cell count was carried out with a neubauer hemocytometer ( weber scientific international ltd , middlesex , uk ) by way of clear field microscopy ( nikon corporation , tokyo , japan ) . figure 1 shows the powder x - ray diffraction patterns for hippuric acid , zno , and han , respectively , which was reported previously in our work .9 the mechanism of formation of hippurate nanocomposite synthesized by direct reaction of zno in an aqueous environment can be described as follows .15 hydrolyzed zno in an aqueous environment leads to the formation of thin layers of zinc hydroxide ( zn ( oh ) 2 ) on the surface of the solid particles . in addition , zn ions react with hydroxyls , hippurate anions , and water in the solution to form the layered han nanocomposite . figure 1a shows that zno exhibited three intense peaks between 30 and 40 , corresponding to diffractions due to the 100 , 002 , and 101 planes . complete disappearance of the intense peaks of the zno phase and the appearance of a new intense peak at low 2 with a d value of 21.3 indicated that the sample of han is pure phase , and that the zno was completely converted to zlh . in addition , figure 1b shows another four harmonics at 2 = 8.32 , 12.50 , 16.68 , and 20.84 , with d values of 10.70 , 7.10 , 5.30 , and 4.30 , respectively , resulting in an average d value of 21.30 .9 in this work we used breast cancer cells mcf - 7 and mda - mb231 because they retained several ideal characteristics particular to the mammary epithelium .16,17 caco2 was used as an in vitro model for colon cancer , which is the second most common cause of cancer in women , and the third most common in men .18 we found that han could potentiate the killing of breast and colon cancer cells induced by chemotherapeutic agents . in the absence of hippuric acid or han , the doxorubicin suppresses the cells growth of mcf - 7 and mda - mb231 cell lines with ic50 values 0.290.09 g / ml and 0.200.06 g / ml , respectively . in figure 2 and table 1 , the combination of hippuric acid with doxorubicin dose not shown significant reduction in the cell viability ( p 0.05 ) . when closely examining each part in figure 2 , it is apparent that the combination of doxorubicin with han has a higher tumor inhibition efficiency compared to doxorubicin alone , and the ic50 values were 0.19 g / ml 0.15 g / ml and 0.13 g / ml 0.10 for the mcf - 7 and mda - mb231 cell lines , respectively . there was a significant decrease of mda - mb231 and caco2 viability at the combination concentration as low as 0.31 g / ml till 20 g / ml ( p 0.05 , p = 0.01 , respectively ) . this result indicates that the suppression percentage in cells mcf - 7 and mda - mb231 are 34.4 % and 35.0 % , respectively . similarly , the combination of oxaliplatin with han against the caco2 cells shows an suppression efficiency with ic50 of 0.24 g / ml 0.11 compared with 1.48 g / ml 0.10 for oxaliplatin alone . our findings demonstrated that the co - treatment of caco2 cell by oxaliplatin and han mixture shows maximal efficacy , this may be due to effect of the zlh nanolayer , which facilitates the entry of the oxaliplatin drug , as compared to doxorubicine . figure 3 shows the effect of free doxorubicin and oxaliplatin drugs , and the combination of hippuric acid or han with that drugs on the proliferation of mcf - 7 , mda - mb231 , and caco2 cell lines at incubation times ( 24 , 48 , and 72 hours ) . however , doxorubicin and oxaliplatin drugs as well as combination of these drugs with han suppress the proliferation of mcf - 7 , mda - mb231 , and caco2 tumor cells . the combination of these drugs with han are more efficient than the drugs alone against the growth of tumor cells . this result indicates that drug delivery to the tumor cell is noticeably enhanced by nanocomposites containing zlh ; however , in the nanocomposites system , drugs can reach the tumor cell membrane without early decomposition , since the drugs are stabilized and protected in the interlayer space of the zlh layers . these results clearly confirm that the intercalation reaction not only prevents drug denaturation , but it also enhances the permeability of the drug into the target cell without any noticeable side effects .19 supporting to mtt assay , trypan blue exclusion results confirmed that the combination of drugs with han can inhibit the cell proliferation in a time - and dose - dependent manner . in table 2 and after 72 hours exposure , the co - treatment by oxaliplatin with han or doxorubicin with han results in greater antiproliferative effect of drugs . at 48 and 72hours , there appeared to be maximal and significant ( p 0.05 ) effects on cell proliferation , when compared to effects noted at 24 hours . this may be due to induce cell death and increasing of the exposure time . from the results of the trypan blue exclusion assay , increasing exposure time to combination of doxorubicin with han appeared to have a reduction effect on cell proliferation in mda - mb231 more than can be seen in mcf - 7 line under most circumstances . for mcf - 7 cells , antiproliferation decreased at 48 hours ( when compared to 24 hours ) for both free doxorubicin and for the combination of doxorubicin hippuric acid , and then increases at 72 hours , but this effect was not seen for any other cells / drug treatment . this may be attributable to the high resistance of the estrogen receptor - positive breast cancer mcf - 7 cell line to chemotherapy . figure 1 shows the powder x - ray diffraction patterns for hippuric acid , zno , and han , respectively , which was reported previously in our work .9 the mechanism of formation of hippurate nanocomposite synthesized by direct reaction of zno in an aqueous environment can be described as follows .15 hydrolyzed zno in an aqueous environment leads to the formation of thin layers of zinc hydroxide ( zn ( oh ) 2 ) on the surface of the solid particles . in addition , zn ions react with hydroxyls , hippurate anions , and water in the solution to form the layered han nanocomposite . figure 1a shows that zno exhibited three intense peaks between 30 and 40 , corresponding to diffractions due to the 100 , 002 , and 101 planes . complete disappearance of the intense peaks of the zno phase and the appearance of a new intense peak at low 2 with a d value of 21.3 indicated that the sample of han is pure phase , and that the zno was completely converted to zlh . in addition , figure 1b shows another four harmonics at 2 = 8.32 , 12.50 , 16.68 , and 20.84 , with d values of 10.70 , 7.10 , 5.30 , and 4.30 , respectively , resulting in an average d value of 21.30 .9 in this work we used breast cancer cells mcf - 7 and mda - mb231 because they retained several ideal characteristics particular to the mammary epithelium .16,17 caco2 was used as an in vitro model for colon cancer , which is the second most common cause of cancer in women , and the third most common in men .18 we found that han could potentiate the killing of breast and colon cancer cells induced by chemotherapeutic agents . in the absence of hippuric acid or han , the doxorubicin suppresses the cells growth of mcf - 7 and mda - mb231 cell lines with ic50 values 0.290.09 g / ml and 0.200.06 g / ml , respectively . in figure 2 and table 1 , the combination of hippuric acid with doxorubicin dose not shown significant reduction in the cell viability ( p 0.05 ) . when closely examining each part in figure 2 , it is apparent that the combination of doxorubicin with han has a higher tumor inhibition efficiency compared to doxorubicin alone , and the ic50 values were 0.19 g / ml 0.15 g / ml and 0.13 g / ml 0.10 for the mcf - 7 and mda - mb231 cell lines , respectively . there was a significant decrease of mda - mb231 and caco2 viability at the combination concentration as low as 0.31 g / ml till 20 g / ml ( p 0.05 , p = 0.01 , respectively ) . this result indicates that the suppression percentage in cells mcf - 7 and mda - mb231 are 34.4 % and 35.0 % , respectively . similarly , the combination of oxaliplatin with han against the caco2 cells shows an suppression efficiency with ic50 of 0.24 g / ml 0.11 compared with 1.48 g / ml 0.10 for oxaliplatin alone . our findings demonstrated that the co - treatment of caco2 cell by oxaliplatin and han mixture shows maximal efficacy , this may be due to effect of the zlh nanolayer , which facilitates the entry of the oxaliplatin drug , as compared to doxorubicine . figure 3 shows the effect of free doxorubicin and oxaliplatin drugs , and the combination of hippuric acid or han with that drugs on the proliferation of mcf - 7 , mda - mb231 , and caco2 cell lines at incubation times ( 24 , 48 , and 72 hours ) . however , doxorubicin and oxaliplatin drugs as well as combination of these drugs with han suppress the proliferation of mcf - 7 , mda - mb231 , and caco2 tumor cells . the combination of these drugs with han are more efficient than the drugs alone against the growth of tumor cells . this result indicates that drug delivery to the tumor cell is noticeably enhanced by nanocomposites containing zlh ; however , in the nanocomposites system , drugs can reach the tumor cell membrane without early decomposition , since the drugs are stabilized and protected in the interlayer space of the zlh layers . these results clearly confirm that the intercalation reaction not only prevents drug denaturation , but it also enhances the permeability of the drug into the target cell without any noticeable side effects .19 supporting to mtt assay , trypan blue exclusion results confirmed that the combination of drugs with han can inhibit the cell proliferation in a time - and dose - dependent manner . in table 2 and after 72 hours exposure , the co - treatment by oxaliplatin with han or doxorubicin with han results in greater antiproliferative effect of drugs . at 48 and 72hours , there appeared to be maximal and significant ( p 0.05 ) effects on cell proliferation , when compared to effects noted at 24 hours . this may be due to induce cell death and increasing of the exposure time . from the results of the trypan blue exclusion assay , increasing exposure time to combination of doxorubicin with han appeared to have a reduction effect on cell proliferation in mda - mb231 more than can be seen in mcf - 7 line under most circumstances . for mcf - 7 cells , antiproliferation decreased at 48 hours ( when compared to 24 hours ) for both free doxorubicin and for the combination of doxorubicin hippuric acid , and then increases at 72 hours , but this effect was not seen for any other cells / drug treatment . this may be attributable to the high resistance of the estrogen receptor - positive breast cancer mcf - 7 cell line to chemotherapy . the intercalation of hippuric acid into a zinc - layered hydroxide , using a direct method to obtain the han nano - composite , was successfully accomplished . the x - ray diffraction results confirmed the intercalation process in which hippuric acid lies between the interlayers . the mtt assay showed that the combination of han with doxorubicin or with oxaliplatin induced suppression of cell proliferation for the mcf - 7 , mda - mb231 , and caco2 cell lines , as compared to free hippuric acid and free doxorubicin and oxaliplatin , which did not exhibit the same effects . finally , the resulting combination of han with doxorubicin and oxaliplatin induced cytotoxicity in the mda - mb231 , mcf - 7 , and caco2 cell lines .\noutput:\n" }, { "from": "agent", "value": "backgroundthe aim of the current study is to design a new nanocomposite for inducing cytotoxicity of doxorubicin and oxaliplatin toward mda - mb231 , mcf - 7 , and caco2 cell lines . a hippuric acid ( ha ) zinc layered hydroxide ( zlh ) nanocomposite was synthesized under an aqueous environment using ha and zinc oxide ( zno ) as the precursors.methodsthe hippuric acid nanocomposite ( han ) was prepared by the direct reaction of a ha solution with an aqueous suspension of zno.resultsthe basal spacing of the nanocomposite was 21.3 , which is average of four harmonics at 2 = 8.32 , 12.50 , 16.68 , and 20.84 . this result indicates that the hippurate anion was successfully intercalated into the interlayer space of zlh . the combinations of han with chemotherapy ( drugs ) has inhibited the cell growth of the mda - mb231 , mcf - 7 , and caco2 cancer cells when compared to drugs alone . an ic50 value for the combination of han with doxorubicin toward mcf - 7 is 0.19 0.15 g / ml and toward mda - mb231 is 0.13 0.10 g / ml . similarly , the ic50 for the combination of han with oxaliplatin toward caco2 is 0.24 0.11 g / ml . in the antiproliferative results , the equal combination of han ( 0.5 g / ml ) with doxorubicin ( 0.5 g / ml ) has reduced the cell proliferation in mcf - 7 and mda - mb - 231 cells into 37.3 % and 17.6 % , respectively after 24 hours . similarly , the antiproliferation percentage for equal combination han with oxaliplatin ( 5.00 g / ml ) toward caco2 is 72.7 % after 24 hours.conclusionthe resulting combination han with drugs has exhibited higher inhibition in cells growth in all cancer cell lines ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ium - 1381 , ium - 1495 , ium - 2210 , ium - 2235 , ium - 3061 , ium - 3424 , ium - 3514 , ium - 3914 and ium - 3918 strains of pleurotus nebrodensis were used in this study . these strains were obtained from the culture collection of mushrooms ( ccm ) in the department of biology , university of incheon and were collected in various locations of china in different times . five strains of p. nebrodensis such as ay - 581429 , ay - 581430 , ay - 581431 , ay - 581432 and ay - 581433 were used as control strains for the comparative study of our selected strains . genomic dna was extracted according to the procedure of lee and taylor ( 1990 ) with some modifications as follows . fresh mycelia were collected from the 10 days old culture on pda medium and were frozen with liquid nitrogen . frozen mycelia were grounded with sterilized mortar - pestle and kept in 1.5 ml micro tube . as extraction buffer , equal amount of 50 mm tris - hcl ( ph 7.5 ) , 50 mm edta ( ph 8 ) and1 % sarkosyl was added to the micro tube and incubated at 65 for 30 min . after incubation , same amount of pci ( 25 ml phenol : 24 ml chloroform : 1 ml isoamyl - alcohol ) was added , vortexed and centrifuged at 4 , 10 min , 12000 rpm . after wards , only supernatant of upper part was taken in 1.5 ml micro tube , added 1000 l of 99.9 % alcohol and centrifuged at 4 , 5 min , 12000 rpm . in this case , supernatant was removed , added 500 l of 70 % alcohol with precipitated dna , vortexed and centrifuged at 4 , 5 min , 12000 rpm . the its region of the rdna of selected strains of p. nebrodensis was amplified by polymerase chain reaction ( pcr ) using universal primers its1 ( 5 ' - tccgtaggtgaacctgcg - 3 ' ) and its4 ( 5 ' - tcctccgcttattgatatgc - 3 ' ) . amplification reactions were performed in a total volume of 20 l containing 10 pcr buffer 2 l , dntp 1.6 l , 0.5 l of each primer , 0.2 l of taq polymerase , 1 l of genomic dna and 14.2 l of sterilized distilled water . pcr reaction was performed using thermal cycler ( veriti thermal cycler , applied biosystems , usa ) with an initial denaturation stage of 5 minutes at 95 , followed by 35 cycles of denaturation for 30 seconds at 94 , annealing for 30 seconds at 52 , extension for 1 minute at 72 and a final extension for 10 minutes at 72 . amplification products were electrophoresed by a 1.5 % agarose gel with a 1 kb dna ladder as a marker . its sequences were aligned for phylogenetic analysis using the program cluster w ( thompson et al . , 1994 ) . bootstrap analysis was repeated 1000 times to examine the reliability of the interior branches and the validity of the trees obtained ( felsenstein , 1985 ; saitou and nei , 1987 ) . , 1990 ) in which 20 sorts of arbitrary 10 - base oligonucleotide primers ( operon technologies inc . ) were used to produced amplified fragments . rapd - pcr reaction was performed using a thermal cycler with an initial denaturation stage of 5 minutes at 94 , followed by 35 cycles of denaturation for 1 minute at 94 , annealing for 1 minute at 36 , extension for 2 minutes at 72 and a final extension for 7 minutes at 72 . rapd products were electrophoresed on 1.4 % agarose gel in 1 tae buffer for 1.15 hour at 100 v , with a 1 kb dna ladder as a size marker and then stained while agitated in an etbr solution ( 0.5 % g / ml ) . rapd bands were recorded as present ( 1 ) or absent ( 0 ) to generate the data matrix . the similarity coefficients ( s ) were calculated between isolates across bands for all primers using the formula s = 2nxy / ( nx + ny ) , where nx and ny are the number of bands shared by the two strains ( nei and li , 1979 ) . ium - 1381 , ium - 1495 , ium - 2210 , ium - 2235 , ium - 3061 , ium - 3424 , ium - 3514 , ium - 3914 and ium - 3918 strains of pleurotus nebrodensis were used in this study . these strains were obtained from the culture collection of mushrooms ( ccm ) in the department of biology , university of incheon and were collected in various locations of china in different times . five strains of p. nebrodensis such as ay - 581429 , ay - 581430 , ay - 581431 , ay - 581432 and ay - 581433 were used as control strains for the comparative study of our selected strains . genomic dna was extracted according to the procedure of lee and taylor ( 1990 ) with some modifications as follows . fresh mycelia were collected from the 10 days old culture on pda medium and were frozen with liquid nitrogen . frozen mycelia were grounded with sterilized mortar - pestle and kept in 1.5 ml micro tube . as extraction buffer , equal amount of 50 mm tris - hcl ( ph 7.5 ) , 50 mm edta ( ph 8 ) and1 % sarkosyl was added to the micro tube and incubated at 65 for 30 min . after incubation , same amount of pci ( 25 ml phenol : 24 ml chloroform : 1 ml isoamyl - alcohol ) was added , vortexed and centrifuged at 4 , 10 min , 12000 rpm . after wards , only supernatant of upper part was taken in 1.5 ml micro tube , added 1000 l of 99.9 % alcohol and centrifuged at 4 , 5 min , 12000 rpm . in this case , supernatant was removed , added 500 l of 70 % alcohol with precipitated dna , vortexed and centrifuged at 4 , 5 min , 12000 rpm . the its region of the rdna of selected strains of p. nebrodensis was amplified by polymerase chain reaction ( pcr ) using universal primers its1 ( 5 ' - tccgtaggtgaacctgcg - 3 ' ) and its4 ( 5 ' - tcctccgcttattgatatgc - 3 ' ) . amplification reactions were performed in a total volume of 20 l containing 10 pcr buffer 2 l , dntp 1.6 l , 0.5 l of each primer , 0.2 l of taq polymerase , 1 l of genomic dna and 14.2 l of sterilized distilled water . pcr reaction was performed using thermal cycler ( veriti thermal cycler , applied biosystems , usa ) with an initial denaturation stage of 5 minutes at 95 , followed by 35 cycles of denaturation for 30 seconds at 94 , annealing for 30 seconds at 52 , extension for 1 minute at 72 and a final extension for 10 minutes at 72 . amplification products were electrophoresed by a 1.5 % agarose gel with a 1 kb dna ladder as a marker . its sequences were aligned for phylogenetic analysis using the program cluster w ( thompson et al . , 1994 ) . bootstrap analysis was repeated 1000 times to examine the reliability of the interior branches and the validity of the trees obtained ( felsenstein , 1985 ; saitou and nei , 1987 ) . genomic dna was amplified by the rapd technique ( williams et al . , 1990 ) in which 20 sorts of arbitrary 10 - base oligonucleotide primers ( operon technologies inc . ) were used to produced amplified fragments . rapd - pcr reaction was performed using a thermal cycler with an initial denaturation stage of 5 minutes at 94 , followed by 35 cycles of denaturation for 1 minute at 94 , annealing for 1 minute at 36 , extension for 2 minutes at 72 and a final extension for 7 minutes at 72 . rapd products were electrophoresed on 1.4 % agarose gel in 1 tae buffer for 1.15 hour at 100 v , with a 1 kb dna ladder as a size marker and then stained while agitated in an etbr solution ( 0.5 % g / ml ) . rapd bands were recorded as present ( 1 ) or absent ( 0 ) to generate the data matrix . the similarity coefficients ( s ) were calculated between isolates across bands for all primers using the formula s = 2nxy / ( nx + ny ) , where nx and ny are the number of bands shared by the two strains ( nei and li , 1979 ) . to study the genetic variation of selected strains of p. nebrodensis , the its region was amplified using its1 and its4 primers and sequenced . the pcr products of the its region in nine different strains were confirmed to be in the range of 575 to 625 bp ( fig . results indicated that a length polymorphism at the sequence level ranged from 592 to 614 bp . the size of the its1 and its2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp , respectively ( table 2 ) . total c + g and a + t contents of its region varied from 262 to 270 bp and 330 to 368 bp . the dna sequence for multiple alignments including all of the its1 , 5.8 s and its2 regions are presented in fig . sequence analysis showed that the 5.8 s rdna sequence was identical ( 158 bp ) for all of the tested strains of p. nebrodensis . ( 2008 ) reported that the its region consisting of its1 , 5.8 s and its2 range from 633 to 635 bp in the bai - ling - gu and a - wei - mo strains of p. nebrodensis . the size variation was caused by different nucleotide sequences , revealing that these strains were clearly distinguished from each other based on substitution , insertion or deletion polymorphism of the base position except ium - 1381 and ium - 3914 . the phylogenetic tree based on the nucleotide sequence of its region in fourteen different strains of p. nebrodensis was obtained by the neighbor joining methods ( fig .1990 ) reported that its sequences are generally constant , or show little variation within species , but vary between species in a genus . the its region is relatively short and can be easily amplified by pcr using universal single primer pairs . the maximum difference was observed between ium - 3424 and ay - 581433 strains , while maximum similarity ( 99.53 % ) was recorded in between ay - 581431 and ium - 1381 , ium - 1495 and ium - 3914 strains . results on the phylogenetic tree in fourteen strains of p. nebrodensis indicated that nine ium strains were very similar to five ncbi gene bank strains . base sequences of the its region of rdna were variable among the tested strains and can be used to estimate genetic distances and provide information on phylogenetic study . twenty primers were used to amplify the segments of dna in nine different strains of p. nebrodensis . among the 20 primers ,12 primers , opa - 01 , opa - 02 , opa - 3 , opa - 05 , opa - 07 , opa - 09 , opa - 10 , opa - 11 , opa - 12 , opa - 13 , opa - 18 and opa - 20 were found to be efficient for amplifying the genomic dna ( table 3 ) . these 12 primers showed significant band profiles on the tested strains and high possibilities to screening of each strain ( fig . 4 , 5 and 6 ) . the size of these polymorphic fragments was in the range of 0.2 to 2.0 kb . if a certain strain is tested for dna polymorphisms using the same primers , it could be identified whether the strain is the similar or not by consulting table 3 . the dendrogram was made by average linkage cluster analysis with the statistics on the presence or absence of bands by strains in table 3 . the dendrogram based on rapd markers in nine different strains of p. nebrodensis is shown in fig . rapd data indicated that strains 6 ( ium - 1381 ) , 7 ( ium - 1495 ) and 8 ( ium - 3914 ) were very similar with few exceptions compared to others strains . in most of cases , strain 5 ( ium - 3424 ) had different bands compared to all the remaining strains . the results of rapd analysis were almost similar to the results obtained by the analysis of its region sequences . similar results have been reported by ro et al . , 2007 and lee et al . ,1997 in the phylogenetic classification of some strains of pleurotus eryngii and lentinus edodes mushrooms , respectively . to study the genetic variation of selected strains of p. nebrodensis , the its region was amplified using its1 and its4 primers and sequenced . the pcr products of the its region in nine different strains were confirmed to be in the range of 575 to 625 bp ( fig . results indicated that a length polymorphism at the sequence level ranged from 592 to 614 bp . the size of the its1 and its2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp , respectively ( table 2 ) . total c + g and a + t contents of its region varied from 262 to 270 bp and 330 to 368 bp . the dna sequence for multiple alignments including all of the its1 , 5.8 s and its2 regions are presented in fig . sequence analysis showed that the 5.8 s rdna sequence was identical ( 158 bp ) for all of the tested strains of p. nebrodensis . ( 2008 ) reported that the its region consisting of its1 , 5.8 s and its2 range from 633 to 635 bp in the bai - ling - gu and a - wei - mo strains of p. nebrodensis . the size variation was caused by different nucleotide sequences , revealing that these strains were clearly distinguished from each other based on substitution , insertion or deletion polymorphism of the base position except ium - 1381 and ium - 3914 . the phylogenetic tree based on the nucleotide sequence of its region in fourteen different strains of p. nebrodensis was obtained by the neighbor joining methods ( fig .1990 ) reported that its sequences are generally constant , or show little variation within species , but vary between species in a genus . the its region is relatively short and can be easily amplified by pcr using universal single primer pairs . the maximum difference was observed between ium - 3424 and ay - 581433 strains , while maximum similarity ( 99.53 % ) was recorded in between ay - 581431 and ium - 1381 , ium - 1495 and ium - 3914 strains . results on the phylogenetic tree in fourteen strains of p. nebrodensis indicated that nine ium strains were very similar to five ncbi gene bank strains . base sequences of the its region of rdna were variable among the tested strains and can be used to estimate genetic distances and provide information on phylogenetic study . twenty primers were used to amplify the segments of dna in nine different strains of p. nebrodensis . among the 20 primers ,12 primers , opa - 01 , opa - 02 , opa - 3 , opa - 05 , opa - 07 , opa - 09 , opa - 10 , opa - 11 , opa - 12 , opa - 13 , opa - 18 and opa - 20 were found to be efficient for amplifying the genomic dna ( table 3 ) . these 12 primers showed significant band profiles on the tested strains and high possibilities to screening of each strain ( fig . 4 , 5 and 6 ) . the size of these polymorphic fragments was in the range of 0.2 to 2.0 kb . if a certain strain is tested for dna polymorphisms using the same primers , it could be identified whether the strain is the similar or not by consulting table 3 . the dendrogram was made by average linkage cluster analysis with the statistics on the presence or absence of bands by strains in table 3 . the dendrogram based on rapd markers in nine different strains of p. nebrodensis is shown in fig . rapd data indicated that strains 6 ( ium - 1381 ) , 7 ( ium - 1495 ) and 8 ( ium - 3914 ) were very similar with few exceptions compared to others strains . in most of cases , the results of rapd analysis were almost similar to the results obtained by the analysis of its region sequences . similar results have been reported by ro et al . , 2007 and lee et al . , 1997 in the phylogenetic classification of some strains of pleurotus eryngii and lentinus edodes mushrooms , respectively .\noutput:\n" }, { "from": "agent", "value": "the molecular phylogeny in nine different commercial cultivated strains of pleurotus nebrodensis was studied based on their internal transcribed spacer ( its ) region and rapd . in the sequence of its region of selected strains , it was revealed that the total length ranged from 592 to 614 bp . the size of its1 and its2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp , respectively . the sequence of its2 was more variable than its1 and the region of 5.8 s sequences were identical . phylogenetic tree of the its region sequences indicated that selected strains were classified into five clusters . the reciprocal homologies of the its region sequences ranged from 99 to 100 % . the strains were also analyzed by rapd with 20 arbitrary primers . twelve primers were efficient to applying amplification of the genomic dna . the sizes of the polymorphic fragments obtained were in the range of 200 to 2000 bp . rapd and its analysis techniques were able to detect genetic variation among the tested strains . experimental results suggested that ium - 1381 , ium - 3914 , ium - 1495 and ay - 581431 strains were genetically very similar . therefore , all ium and ncbi gene bank strains of p. nebrodensis were genetically same with some variations ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: breast carcinoma in men is uncommon with an incidence report rate of 1.08 per 100,000 . at time of diagnosis , men have a higher median age ; and are more likely to have a more advanced stage of disease and lymph node involvement . forequarter ( interscapulothoracic ) amputation was first performed in 1808 for severe traumatic injuries of the upper extremity . the procedure involves removal of the entire upper extremity with the ipsilateral scapula and total / subtotal clavicle . the first oncological forequarter amputation was reported in 1836 . since then , it has been used for managing high - grade bone and soft - tissue sarcomas of the shoulder girdle in which salvage of the extremity and the aforementioned bones including the shoulder joint would not be feasible . today , it is very rarely used as effective adjuvant chemotherapy with or without radiation therapy combined with limb - sparing surgery in many cases has replaced radical amputation surgeries . although the majority of forequarter amputations are performed for high - grade bone and soft tissue sarcomas or extensive osteomyelitis of the upper extremities , this radical operation may also be indicated for the curative treatment of recurrent breast cancer and for the palliation of locally advanced breast cancer . axillary tumor recurrence may cause significant morbidity due to pain , limb dysfunction , lymphedema , and varying degrees of paralysis and sensory impairment . it may also cause chest wall invasion , and skin ulceration secondary to invasion of the brachial plexus and axillary vessels by the tumor . further morbidity can be caused by perforation of the overlying skin by the tumor causing bacterial or fungal infections , sepsis , or hemorrhage . in those cases with dysfunctional upper extremities , a need fora more radical surgery may arise in order to improve the patient 's quality of life and daily function [ 3,5 - 7 ] . to date , there have only been 20 published cases of forequarter amputations for axillary recurrence of breast cancer . all of the cases were females and only 4 of these amputations were performed primarily for curative purposes . we are hereby reporting a male patient with metastatic breast adenocarcinoma who underwent simultaneous modified radical mastectomy and forequarter amputation . the axillar mass was 127 cm and the mass in the proximal lateral humerus was 65 cm . his symptoms had started a number of years prior . before the initiation of these symptoms , he denied having any significant medical problems . he had been referred to a surgerical clinic three years prior in which he had a biopsy of the tumor reported as mucinous adenocarcinoma . it appears that he had been evaluated only for possible intestinal primaries at that time and having failed to identify the primary , had been sent to receive radiotherapy of unclear dosage . after the recurrence of his tumor , he was referred to the medical oncology department at our hospital with a mass in the left thoracic region and another in the left humerus , visible on x - rays ( fig .1 ) . his examination revealed a mass in his left breast besides the aforementioned ones . his biopsy materials were reevaluated in our pathology department and confirmed to be metastatic adenocarcinoma . the report also indicated that the mass might be breast originated , raising the suspicion towards a possible breast primary . he was then given neoadjuvant chemotherapy consisting of docetaxel and capecitabine for six cycles following the decision of our tumor council . an magnetic resonance imaging ( mri ) scan was obtained following the cessation of his chemotherapy revealing a 14010090 mm lobulated mass in the proximal epiphyses , metaphysis and diaphysis of the left humerus , which was destructing the cortices on multiple sides with a large soft tissue component , and invading and protruding out of the skin ( fig . another mass , 1235474 mm in size , was located in the axillary region adjacent to the thoracic wall infiltrating the skin , surrounded by multiple nodular masses of different sizes . there were other masses also in his pectoral muscle , as well as in his scapular muscles . medullar intensity of the scapula appeared to be normal . computed tomography scans of the chest , abdomen and pelvis and an mri of the brain failed to demonstrate any other metastasic lesions . at the end of the neoadjuvant chemotherapy protocol , he was under a combination analgesic treatment that consisted of ibuprofen ( 3400 mg ) , tramadol ( 450 mg ) and pethidine ( 175 mg ) . his pain scales ( out of 10 ) were 8 to 9 in the mornings and 9 to 10 at night , severe enough to awaken him from his sleep . the status of the patient was discussed amongst the tumor council of our hospital consisting of orthopedic surgeons , radiologists , medical oncologists and radiation oncologists , who decided that amputation would be the best option for the management of the patient 's pain and impaired function . the radical nature of the procedure as well as the risks and benefits were discussed with the patient and his family and the patient consented to undergo the operation . the operation was performed by a team of orthopedic , general and plastic - reconstructive surgeons . the skin incision was marked in close consultation with the general and plastic surgeons ( fig . skins flap were elevated superiorly to the clavicle , inferiorly to the costal arch , and medially to anterior midline . the lateral border of the skin flaps was latissimus dorsi muscle , inferiorly ; and the supero - medial border of the mass , superiorly . dissection of the pectoralis major muscle was started from the medial side at the origin from the sternum as the insertion was also invaded by the mass . dissection was then directed to the thoracic wall to excise all the breast tissue , pectoral muscles and the soft tissues , including the periosteum of the ribs without exposing the tumor . the exposure was continued laterally and posteriorly up to the insertions of rhomboid muscles . finally , the upper extremity , all together with the mastectomy material , was removed including the scapula , inevitably creating a big tissue defect ( fig .4 ) . the defect was closed with full thickness skin graft and application of vacuum assisted closure ( v.a.c . the specimen consisted of 70 cm of upper extremity and scapula and breast tissue attached to it . there was another ulcerated region of 65 cm in the lateral proximal humeral region . the tumor was negative for estrogen receptor , c - erbb2 and gcdfp - 15 , and 1 % positive for progesterone receptor . in fluorescence in situ hybridization ( fish ) studies conducted with dna probes ( repeat - free poseidon fish dna probes , kreatech diagnostics , amsterdam , netherland ) her - 2 gene amplification was not manifested . the patient was monitored in the post anesthesia care unit for a few days until he was stabilized and then transferred to our clinic . in the early post - operative periodhis pain medication was ibuprofen ( 3400 mg ) and tramadol ( 250 mg ) , with the addition of morphine patient controlled analgesia for the first two days . his pain scales , out of 10 , were between 4 to 6 both during the day and at night . he was discharged from the hospital when the wound healed after two weeks ( fig . his outpatient progress was monitored during the first , third , sixth and twelfth weeks post - operatively . in the third and the sixth week controls , the patient reported that he was experiencing reduced levels of pain and had therefore lessened his intake of pain medication ; he was only taking ibuprofen ( 3400 mg ) . in the control during the twelfth week the patient reported that he was almost entirely pain - free . the patient , refusing to receive any further chemotherapy , passed away eleven months after surgery . invasive breast cancer is the most common malignancies among women . although the incidence appears to be on the rise , due to earlier detection and adjuvant therapy , declining mortality ratesthere is a tendency for limited axillary surgery , which may eventually increase the potential risk of future axillary recurrences . a review of the literature reveals only 20 published cases of forequarter amputation for axillary recurrence of breast cancer , most derived from small groups or individual case series . none of these patients were men , and to our knowledge , forequarter amputation as a primary treatment for metastatic and infiltrative breast cancer has never been reported . the status of the disease and possible treatment alternatives were discussed amongst the tumor council at our hospital , which consists of orthopedic surgeons , radiologists , medical oncologists and radiation oncologists . the operation of simultaneous mastectomy , forequarter amputation and skin grafting was performed by a team of orthopedic , general and plastic - reconstructive surgeons . it was well known at the time of treatment that our patient would have a poor short - term prognosis with his extensive metastasis , and the operation was performed with palliative aim , focusing on his quality of life rather than life expectancy . eventually his quality of life improved dramatically after the operation and he lived for eleven more months without suffering from severe pain . similarly , an overall improvement in daily life , physical and emotional well - being and sexual or social life is reported for patients who underwent forequarter amputation for palliation . furthermore , it has also been advocated that local recurrence of breast cancer without a remote metastasis can be an indication for surgery to relieve pain and bleeding , and that in combination with adjuvant therapy the patient 's survival can be prolonged . in conclusion , this case demonstrates that even in grossly advanced stages of breast carcinomas with invasion not only to the chest wall but also to the neighboring axilla and extremity , ablative surgery of a very large magnitude including the excision of the breast and all chest wall muscles as well as the entire shoulder girdle and upper extremity , is not only feasible with a multidisciplinary approach but also advisable in order to decrease patients ' pain and improve the quality of their lives .\noutput:\n" }, { "from": "agent", "value": "although the majority of forequarter amputations are performed for high - grade bone and soft tissue sarcomas or extensive osteomyelitis of the upper extremity , this radical operation may also be indicated for the curative treatment of recurrent breast cancer and for the palliation of locally advanced breast cancer . we report a male patient with metastatic breast adenocarcinoma who underwent simultaneous mastectomy and forequarter amputation for the management of both his primary and metastatic disease ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: adaptive condylar displacement ( cd ) refers to the shift from a seated condylar position or centric relation ( cr ) to a condylar position corresponding to maximum intercuspation ( mi ) . consequently , cd may have diagnostic and clinical implications .1,2,3,4 orthodontists who follow the functional occlusion principles published by roth1 accept that when the normal proportional relation of 0.75 between the posterior cranial base ( sella - articulare ) and ramus height ( articulare - gonion ) increases to a value of 1.0 , the risk of an adapted intra - articular condyle shift increases , making the assessment of the mandibular position clinically pertinent . this is , however , a controversial subject .5 despite the consensus regarding dual bites as an alternative to surgical treatment in adults , for diagnostic and treatment purposes , evaluation of the orthopedic position of cr is the most physiologically appropriate6 ; in fact , it is recommended as the morphofunctional aim of any orthodontic occlusal treatment .1,7 since cr is the most consistent and reproducible positional reference ,8 accurate studies of dental and maxillomandibular relationships are dependent on cr assessment . splint therapy allows stabilization of the condyle in cr for therapeutic or diagnostic purposes , prior to orthodontic treatment .9 in patients with a hyperdivergent facial type , cd represents a mechanism of compensation to posterior - anterior facial imbalance . since the mandible articulates with the cranial base , vertical growth of the anterior face should ideally match posterior facial growth .10 however , if this does not occur , the condyle can rotate in the temporomandibular joint or slide vertically or antero - posteriorly in order to adjust to the imbalance .1,2,3,8,11,12 an increased joint space could lead to articular instability since the articular disc can lose its tight apposition between the condyle and cranial base and easily dysfunction .1 previous studies have shown that posterior mandibular displacement leads to temporomandibular disorders ( tmd ) 6 and morphological changes .13 additionally , studies focusing on the relation between facial configuration and tmd indicate an association of hyperdivergency with tmd .14,15 the assessment of the normal condyle - fossa relationship is also debatable . in normal samples , tomographic imaging reveals a wide variability in condylar position ,16,17 and intra - articular joint damage has been detected in asymptomatic patients .18 more recently , a study analyzing clinical data from magnetic resonance imaging and limited cone - beam computed tomography reported that the variability in cd is limited in normal individuals , and quantitative standards for the clinical evaluation of the condylar position were suggested .19 since the condylar axis can be widely influenced by occlusion ,2,4 it is of paramount importance to determine its displacement in three - dimensional space .20 conventional radiological examinations do not provide accurate and valuable information in this regard ; 16,17 consequently , a mandibular position indicator ( mpi ) and other similar tools have been introduced to allow quantification of the three - dimensional displacement of the condylar axis .3,21,22 the significance and clinical relevance of identifying and integrating cd in orthodontic diagnosis and treatment planning , when it surpasses a threshold of 2 mm in the horizontal or vertical axis has been established .2,4,7 in addition , cd of significant magnitude occurs frequently in the asymptomatic population4 ,23 and represents an attempt to compensate for disproportions . accurate diagnosis requires the assessment of occlusal interferences and skeletal relationships , without the influence of the neuromuscular system . despite reasonable evidence of facial configurations being more prone to articular instability , girardot12 reported a more significant cd in hyperdivergent facial morphologies , whereas burke et al. 24 found diminished upper articular joint spaces in the same facial type . in contrast , hidaka et al. 11 found no relationship between facial type and condylar position . therefore , the aim of this observational study was to clarify the above - mentioned conflicting findings and throw more light on the relationship between facial type and condylar position . therefore , cd was measured in the hyperdivergent facial type and compared with those of the hypodivergent and intermediate types . the hypothesis of this study was that cd was greater and more frequent in the hyperdivergent facial type . the research protocol was reviewed and approved by the ethical committee of the faculty of dental medicine of university of porto ( # 20071210 ) . the study sample comprised 108 caucasian asymptomatic individuals , 81 women and 27 men , aged between 12 and 46.2 years , with a mean age of 20.5 years . data used for the study included information from anamnesis and clinical examinations , lateral cephalograms in mi , study casts and clinical records for cr mounting on a sam 2p semi - adjustable articulator ( figure 1 ) , and complete mpi registrations ( sam ; przisionstechnik gmbh , mnchen , germany ) ( figures 2 and 3 ) . the subjects were selected based on the clinical records of 742 consecutive first presentations at an orthodontic private practice . based on the study criteria , we included individuals , who , during the preceding 5 years , had neither suffered facial trauma nor been subjected to orthodontic treatment . for the selection of asymptomatic individuals , the helkimo index25 was used , and only patients with codes di0 or di1 were chosen . to avoid the effect of distortions related to growth on condylar position registration ,26 patients in stages 4 , 5 , or 6 of skeletal maturation according to the cervical vertebral maturation method27subjects with a negative vertical cd ( z 0 ) on the mpi reading were excluded .8 to classify the subjects into groups based on distinct facial patterns , two matched factors of jarabak 's cephalometric analysis were used .28 subjects with the posterior facial height ( pfh ; sella - gonion ) / anterior facial height ( afh ; nasion - menton ) ratio 59 % and the lower gonial angle ( lga ; nasion - gonion - menton ) 76 were grouped into the hyperdivergent group . the hypodivergent group comprised subjects with the pfh / afh 65 % and lga 69 . in the third intermediate group , the pfh / afh was 59 - 65 % and lga was 69 - 76 . thus , based on the skeletal facial features , 3 matched groups containing 36 individuals each , 27 women and 9 men , were generated . a single operator with 5 years ' experience was involved in all the clinical and laboratory experiments . a single arbitrary face bow and sam 2p articulatorwere used for mounting the stone casts ( velmix ; kerr manufacturing co. , romulus , mi , usa ) with the cr wax records ( delar bite registration wax ; delar corporation , lake oswego , or , usa ) . horizontal and vertical cd were evaluated using a single mpi and mi wax records ( moyco industries inc . , philadelphia , pa , usa ) . the mi records were obtained before cr registration , by asking the patient to bite firmly with the teeth in mi . after being chilled in ice water , record accuracyroth 's power centric technique8 was performed immediately after neuromuscular deprogramming with the patient relaxed and reclined at 45 . two cotton rolls were interposed between the dental arches for a minimum of 10 minutes . the anterior section was obtained by guiding the mandible during closure in order to avoid protrusion . next , the anterior wax was hardened in ice water and then interposed between the arches simultaneously with the posterior softened wax section in order to accomplish the registration . the mandible was guided during closure , and when the anterior teeth fit into the corresponding anterior wax indentations , the patient was asked to bite firmly . with this technique , as the posterior wax section was softened , muscular strength helped to adjust the vertical intra - articular condylar position .29 for wax registration of mi , the corresponding position of the condyle was registered with the mpi , and its accuracy was checked after every 5 registrations . a micrometre ( nr.h 114834 ; carl zeiss ag , oberkochen , germany ) was used to measure the horizontal ( xx ' ) and vertical ( zz ' ) cd components , and each measurement was repeated three times . the methodology applied in this study had been checked at the beginning of data collection , and the lauritzen technique was used to assess the accuracy of cr records and laboratory procedures .28 to evaluate intra - operator error , the reproducibility of cr records , mounting procedures , accomplishment and measurement of mpi registrations , and cephalometric measurements were performed by the same operator during two different sessions that were one - week apart . for these procedures , 5 patients were randomly selected , and the clinical measurements were obtained twice during each session , resulting in the need for two articulator - mounting sets for each subject . during the second session , two new cr records were used to remount the mandibular cast to each previously articulator mounting . , errors were analyzed using the analysis of variance test . according to the following equation , the standard error ( se ) was obtained depending on the sample variance ( sv ) : where n refers to the sample size ; xi , dimension observed for measurement i ; and x , mean value of observations . for indirect measurements , the following equation of error propagation was applied : where xj refers to the dimension measured ( j = 1 , , m ) ; sej , standard error associated with xj ; and x = f ( x1 , x2 , xm ) , dimension based on dimensions of xj . to determine the direction and magnitude of any condylar shift , an initial descriptive study of data was performed , which was followed by a comparative study . a student t - test , with 0.05 level of confidence , was used to analyze the differences in cd along the vertical and horizontal planes among the three groups . for direct measurements , errors were analyzed using the analysis of variance test . according to the following equation , the standard error ( se ) was obtained depending on the sample variance ( sv ) : where n refers to the sample size ; xi , dimension observed for measurement i ; and x , mean value of observations . for indirect measurements , the following equation of error propagation was applied : where xj refers to the dimension measured ( j = 1 , , m ) ; sej , standard error associated with xj ; and x = f ( x1 , x2 , xm ) , dimension based on dimensions of xj . to determine the direction and magnitude of any condylar shift , an initial descriptive study of data was performed , which was followed by a comparative study . a student t - test , with 0.05 level of confidence , was used to analyze the differences in cd along the vertical and horizontal planes among the three groups . analysis of the measurement errors of the different assessments showed an error margin 4.5 % , which is considered acceptable .28 no negative vertical cd ( z 0 ) on the mpi readings was registered . in the total sample ( n = 216 condyles , table 1 ) , horizontal displacement cd - xx ' 2 mm and cd - xx ' -2 mm occurred in 14/216 condyles ( 6.49 % ) , whereas vertical displacement cd - zz ' 2 mm occurred in 60/216 condyles ( 27.77 % ) . therefore , cd - xx ' -2 mm occurred in hyperdivergent and intermediate groups in 2.78 % and 4.17 % of cases , respectively , whereas cd - xx ' 2 mm was more frequent in the hypodivergent group ( 8.33 % ) . the most frequent displacements were observed in a posterior direction in the hyperdivergent and intermediate groups . along the zz ' axis , the frequency of cd - zz ' 2 mm was high in all the groups , with registered values of 34.72 % , 23.61 % , and 25.0 % , respectively , in the hyperdivergent , hypodivergent , and intermediate groups . the values of horizontal displacement ranged from -3.5 mm to 4 mm , whereas vertical displacement ranged from 0 to 4.1 mm ( table 2 ) . to assess the effective magnitude of cd , the displacements along the xx ' axis were summed , and the absolute values were considered ( table 3 ) . a comparison of the magnitude of cd among the three groups showed more extensive cd in the hyperdivergent group ( 118.7 mm ) along the zz ' axis and in the hypodivergent group ( 67.53 mm ) along the xx ' axis . the magnitude of horizontal displacement was approximately similar in all the groups , varying from 53.5 mm in the intermediate to 67.53 mm in the hypodivergent group . results of the t - test showed that vertical displacement was statistically different between hyperdivergent and hypodivergent groups ( p 0.0002 ) and hyperdivergent and intermediate groups ( p 0.0005 ) . no significant difference in horizontal displacement was noted between the groups ( p 0.071 ) . taking into account the obvious differences between the facial groups , the anatomo - physiological features of hyperdivergent facial types may be the reason that condyle function is prone to articular instability . this study aimed to test the hypothesis that cd was greater and more frequent in the hyperdivergent facial type . the three groups examined in this study represented individuals with clear hyperdivergent ( dolicofacial ) features , hypodivergent ( brachifacial ) features , and with intermediate qualities . the clinically significant cd threshold of 2 mm has diagnostic importance ,2,4,7 leading to clinical implications .3 in fact , it is recommended to use this information to convert cephalometric tracings when displacements of 2 mm are found along at least one of the axes . a smaller magnitude of cd yields none or no significant changes in traditional cephalometric measurements .2 in the 216 condyles analyzed in this study , cd 2 mm was found in approximately 30 % of the cases ( cd - zz ' 2 mm in 27.77 , cd - xx ' 2 mm , and cd - xx ' -2 in 6.49 ; table 1 ) . in general , these results are in agreement with those of previous studies , although some discrepancies in frequencies were found .2,4,11,12,23,26 these differences may be related to the criteria used for sample selection , neuromuscular deprogramming methodology , or cr recording techniques . the use of hard anterior stops for cr bite registration can duplicate the frequency of cd 2 mm .4,23 it was suggested that a more efficient deprogramming technique could result in a higher frequency of cd in the three groups . ideally , complete deprogramming should be performed before cr registration ; however , it is not practical in daily orthodontic practice , and the method of interposition of cotton rolls for 10 minutes was used in this study . therefore , the registrations obtained represent the most superior and anterior positions of the condyles in the joint the clinician was able to take during the moment of clinical procedure in the asymptomatic patients . posterior displacement was slightly more frequent ( 43.52 % ) than anterior displacement ( 40.74 % ) . the higher frequency of posterior condylar shift is consistent with previous studies and is related to posterior occlusal prematurity guiding the mandible in this direction .2,3,11,12,23 the analysis of cd and its comparison between the three groups showed that cd was more frequent in the hyperdivergent group , corroborating the initial hypothesis . this group , considering the number of condyles with cd 2 mm , presented a frequency of vertical displacement of 34.72 % , which is higher than the 28.8 % reported by girardot .12 with respect to the absolute values of horizontal displacement , the hyperdivergent group registered 4.17 % in contrast to 24.2 % reported by girardot . the great majority of xx ' displacements were between -2 and 2 mm . therefore , in the hyperdivergent group , 54.17 % of displacements occurred in the posterior direction with magnitudes between -2 and 0 mm . in contrast , hidaka et al. 11 found vertical and horizontal cd 2 mm of 14 % and 2 % , respectively . however , their study sample was inherently different from that of our study . in the hyperdivergent and intermediate groups , high frequencies were recorded in the posterior direction ( 56.95 and 45.84 % , respectively ) ; in contrast , in the hypodivergent group , the higher frequency was in anterior direction ( 54.16 % ) . the frequencies of posterior , anterior , and vertical displacements in the intermediate group were midway between the other two groups . these findings may be related to the differences in facial configurations , i.e. , the distinct patterns of muscle activity and behavior facing fulcrums . in fact , in the hypodivergent biotype , the elevator muscles are stronger and aligned vertically across the first molars , being positioned more anteriorly than those in the hyperdivergent group . the magnitude of means ( absolute values ) along xx ' was 0.84 mm , 0.94 mm , and 0.74 mm ; along zz ' , it was 1.65 mm , 1.05 mm , and 1.61 mm , respectively , in the hyperdivergent , hypodivergent , and intermediate groups ( table 2 ) . girardot12 found mean values of 1.21 mm for hyperdivergent and 0.66 mm for hypodivergent along xx ' and 1.7 mm for hyperdivergent and 1.2 mm for hypodivergent along zz ' . the mean values that closely matched those of our study were those related to the vertical plane and may be related to the method used to record cr . the hard anterior stop used in roth 's power centric technique supports the generation of a more seated condylar position , as it is the internal strength of the masticatory muscles that positions and vertically seats the condyles in the fossae .3,8,29 therefore , the registration of the vertical axis shift is less dependent on individual operator technique . previous studies ,4,23 with deprogrammed subjects , found greater vertical displacements and established that more efficient deprogramming procedures can allow assessment of greater cd mean values , particularly along the vertical axis .26 however , other studies contradicted these results . burke et al. 24 studied the association of condyle features of class ii preadolescent patients with facial configurations and found correlations between diminished superior joint spaces and vertical patterns . these differences may be related to intrinsic variations in the samples and to a lack of functional examination of the subjects . in fact , the neuromuscular system can display two kinds of responses to occlusal fulcrums . one displaces the condyle in the joint to achieve maximal occlusal contact , whereas the other is the appearance of an anterior open bite , characterized by only posterior teeth contacts , with the cd being reduced in this situation . moreover , hidaka et al. 11 did not find any relation between facial patterns and cd . their evaluation was performed using the mandibular plane angle and disregarded the individual 's skeletal maturity and functional examination , which are factors that can strongly compromise condylar shifts . in this study , greater vertical displacement was observed in the hyperdivergent group : cd was found to be 1.57 and 1.42 times greater than that in the hypodivergent and intermediate groups ( table 3 ) . in all the groups , the magnitude of vertical shifts was always higher than that of the horizontal shifts , which is in agreement with the findings of previous studies .2,4,11,12,23,26 this finding shows that , although cd is frequent in all three facial groups , a higher risk of shift is observed in the hyperdivergent group , which is in agreement with girardot 's results .12 it is important to note that both studies reported significant differences in cd along the zz ' axis ( present study : hyperdivergent - hypodivergent groups , p 0.0002 and hyperdivergent - intermediate groups , p 0.0005 ; girardot study : hyperdivergent - hypodivergent groups , p 0.008 ) , but for horizontal displacements only girardot , reported this finding ( hyperdivergent - hypodivergent groups , p 0.0001 ) . in the present study , for xx ' axis displacements , no significant differences were observed , but a trend could be suggested between the hyperdivergent and intermediate groups ( p 0.071 ) . although referring to asymptomatic samples , both studies indicate that the physical features of the hyperdivergent group predispose it to a higher risk of developing tmd .14,15 however , it is important to note that the transverse shift was not considered , despite being recognized as an etiologic factor of tmd .30 therefore , this potential relationship needs to be investigated further . the results of this study suggest that orthodontic treatment planning related to the cr must involve assessment of the condyle shift . however , it is not possible to quantify displacement clinically , directly in the mouth4 ,8,23 or by using mi hand - assembled casts . when detected , occlusal discrepancy provides no information regarding the nature of cd .4,17 this study especially emphasizes on the vertical component of cd , which is even more difficult to detect . the mpi instrumentation procedure permits easy and accurate3 ,8,21,22 quantification of cd and allows taking this data into account when planning treatment , introducing diagnostic clinical implications , and reducing misdiagnosis .2,4 in contrast with mi hand - assembled casts , articulator - mounted cast analysis can display cases with different features and with a distinctly difficult level of treatment . the discrepancy can be altered not only in the sagittal plane , with differences in overjet and molar relationship , but also in the transverse and vertical planes .2,4 the analysis of the initial occlusal contacts can support differential diagnosis of skeletal and dentoalveolar openbite or crossbite . when approaching transversal problem the consideration of interocclusal type of contacts , the cuspid to cuspid or cuspid to inclined slope contact , can help to discard the skeletal nature of malocclusion . additionally , simulation of a true hinge axis ( vertical mandibular autorotation ) can provide information regarding features of the class ii malocclusion . in case of a vertical class ii malocclusion , overjet can be corrected when posterior occlusal interferences are eliminated ; however , in case of a sagittal class ii malocclusion , overjet remains , and a different treatment plan is required . the method described in this study can reveal important information with regard to vertical malocclusion , which is not provided by other diagnostic techniques , causing frequent failure in occluso - functional orthodontic treatment . overall , since a significant magnitude of cd occurs in all the three asymptomatic groups and since it is not possible to predict the condylar position , it is crucial to mount models in cr as a routine diagnostic procedure .2,4 our study clearly shows that in patients with a hyperdivergent facial pattern , the risk of misdiagnosing an orthodontic case is approximately 30 % , when condylar position in not assessed . the findings of this study show that the hyperdivergent group has a significantly greater cd along the vertical axis than do the two other groups . therefore , if cd is not considered during the assessment of orthodontic cases , the risk of misdiagnosis is high for all facial types , being significantly higher in patients with the hyperdivergent facial type .\noutput:\n" }, { "from": "agent", "value": "objectivefacial - type - associated variations in diagnostic features have several implications in orthodontics . for example , in hyperdivergent craniofacial types , growth imbalances are compensated by displacement of the condyle . when diagnosis and treatment planning involves centric relation ( cr ) , detailed knowledge of the condylar position is desirable . the present study aimed to measure condylar displacement ( cd ) between cr and maximum intercuspation in three facial types of an asymptomatic orthodontic population.methodsthe study was conducted in 108 patients classified into three groups of 36 individuals each ( 27 women and 9 men ; mean age , 20.5 years ) , based on the following facial patterns : hyperdivergent , hypodivergent , and intermediate . to quantify cd along the horizontal and vertical axes , the condylar position was analyzed using mounted casts on a semi - adjustable articulator and a mandibular position indicator . the student t - test was used to compare cd between the groups.resultsvertical displacement was found to be significantly different between the hyperdivergent and hypodivergent groups ( p < 0.0002 ) and between the hyperdivergent and intermediate groups ( p < 0.0006 ) . the differences in horizontal displacement were not significant between the groups . in each group , vertical cd was more evident than horizontal displacement was.conclusionsall facial types , especially the hyperdivergent type , carried a significantly high risk of cd . therefore , the possibility of cd should be carefully evaluated and considered in the assessment of all orthodontic cases in order to accurately assess jaw relationships and avoid possible misdiagnosis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the incidence of esophageal involvement by secondary neoplasms has been reported as 3.2 % in autopsy studies of patients with cancer . in most instances , there is direct invasion by the primary tumor from adjacent or contiguous organs .1 metastatic involvement into the esophagus from a distant primary malignancy is rare but may occur from cancers of the lung , breast , skeletal system , and brain .2 papillary thyroid cancer accounts for 80 % of thyroid cancers and has an optimal prognosis . in fact , the 5 - year survival rates ( 90 - 95 % ) are among the highest of any type of cancer . in several studies , aerodigestive tract invasion by papillary thyroid cancersthe sites included all portions of the endolarynx , trachea , esophagus , strap muscles , and recurrent laryngeal nerve .2,3 the patterns of invasion of the tumor are commonly by direct extension of the primary and less commonly by extension of metastatic paratracheal lymph nodes in the tracheoesophageal groove .2 although infrequent , aerodigestive tract invasion is associated with significant morbidity and in some cases death from uncontrolled locoregional disease . invasion of these structures produces symptoms of airway insufficiency , dysphagia , and hemoptysis and may increase morbidity by about 5 times or more .4 recent advancements in endoscopic ultrasonography ( eus ) allow the viewing of detailed structural abnormalities and depth of invasion in various gastrointestinal diseases , especially submucosal tumors . these advancements have also helped in the staging of gastrointestinal cancers and in the examination of the pancreato - biliary region . herewe report a case of papillary thyroid cancer that recurred as an esophageal submucosal tumor in a 75 - year - old woman . the esophageal submucosal tumor - like recurrence of papillary thyroid cancer and the associated eus findings have not been reported previously to our knowledge . a 75 - year - old woman presented to our hospital with a complaint of an increasing palpable central neck mass for 3 months . she had undergone right hemi - thyroidectomy for papillary thyroid cancer 10 years previously at another hospital . at that time , no distant metastasis was observed . three years later , a 1 - cm sized midline hard neck mass came into being and was diagnosed as metastatic papillary thyroid cancer by gun biopsy . she underwent a total thyroidectomy and central lymph node dissection in pusan national university hospital . histological examination showed no tumor cells in the lymph node specimen . also , no distant metastasis was found . since then , she had been taking thyroid hormone replacement . her thyroid hormone level was checked regularly and had been maintained within the normal range . after surgery , the patient did not want to take radioactive iodine therapy . at admission , her blood pressure , pulse rate , and body temperature were 110/70 mmhg , 68 / min , and 36.5 , respectively . laboratory findings revealed the following values : white blood cell count , 4,800 / mm ; hemoglobin value , 12.4 g / dl ; platelet count , 261,000 / mm ; alp , 76 iu / l ; ast , 34iu / l ; alt , 22 iu / l ; total bilirubin , 0.54 mg / dl ; total protein , 7.0 g / dl ; and albumin , 4.3 g / dl . thyroid function tests revealed the following : tsh , 1.18 iu / ml ( normal range , 0.3 - 5.0 iu / ml ) ; t3 , 71.3 ng / ml ( normal range , 80 - 170 ng / dl ) ; and free t4 , 1.53 ng / dl ( normal range , 0.80 - 2.10 ng / dl ) . her thyroglobulin was 398 ng / ml ( normal range , 0.0 - 50.0 ng / ml ) , and the thyroglobulin level had increased after the second operation . computed tomography ( ct ) showed two well - enhanced , ill - defined masses on the anterior aspect of the thyroid bed , which were assumed to be recurrence of thyroid cancer . the ct also showed an approximately 24 - mm sized well - defined mass on the left side of the esophagus ( fig .1 ) . the mass looked like an esophageal submucosal tumor , which differed from typical metastatic papillary cancer . positron emission tomography - computed tomography ( pet - ct ) revealed intense hypermetabolic lesions ( maximum suv : 28.0 ) on both thyroid beds , which were thus thought to be local recurrence of papillary thyroid cancer . the mass on the left side of the upper esophagus also had intense fdg uptake ( maximum suv : 42.4 ) . endoscopy showed a smooth , elevated , cushion sign negative mass covered with intact normal mucosa 2 to 3 cm distal to the upper esophageal sphincter ( fig . eus showed a hypoechoic nonhomogeneous 2.72.4 cm sized mass in the third ( submucosal ) and fourth ( muscularis propria ) layer of the esophagus . these findings suggested the mass to be a gastrointestinal stromal tumor , but the possibility of it being a metastatic malignant mass could not be ruled out , even though rare . a discrete mass of about 1.51.5 cm in size was exposed on the lateral portion of the left thyroid cartilage . it was an esophageal submucosal mass that focally penetrated the esophageal muscle layer , but within the adventitia . the gross examination of the first specimen removed from the thyroid bed revealed two well - encapsulated masses measuring 6.03.53.0 cm . the cut surface was papillary with multiple brownish foci of cystic change in appearance , which is the typical morphology of a papillary carcinoma of thyroid origin .3 a , 3b ) . the other specimen enucleated from the esophageal wall was a 3.02.52.0 cm round mass . microscopically , the tumor was demarcated from the surrounding esophageal muscular layer , but focal muscular invasion was also seen . the tumor cells also showed a papillary pattern in appearance , and the nuclei of the tumor cells also had intranuclear inclusions and groovings ( fig . the patient 's postoperative course was uneventful and she was discharged 12 days after the surgery . she was referred to the endocrinology department for thyroid hormone replacement and has undergone regular check - ups for recurrence of thyroid papillary cancer . well - differentiated thyroid carcinoma ( papillary and follicular subtypes ) infrequently invades the upper aerodigestive tract . however , when invasion occurs , it can be a source of significant morbidity as well as mortality for the patient . when cases of anaplastic carcinoma are excluded , the incidence of invasion into the upper aerodigestive tract by well - differentiated thyroid carcinomas is less than 4 % and is considered a poor prognostic indicator of survival .4,5 esophageal involvement by metastatic tumors may occur by direct tumor extension from contiguous organs , through mediastinal lymph nodes containing tumor , and via hematogenous spread .1 direct extension is the most common route , which is usually seen in tumors of the gastric fundus , hypopharynx , and larynx . involvement of the esophagus by tumor - containing mediastinal lymph nodes is the second most common route of esophageal invasion by metastatic tumors . hematogenous metastases to the esophagus are very rare and may occur from cancers of the pancreas , testis , eye , tongue , bone , liver , kidney , uterus , skin , synovium , and prostate .1 in this case , papillary thyroid cancer recurred as an esophageal submucosal tumor . although direct invasion was not observed during the third operation , it can not be excluded . it is possible that during the first and second operations , the esophageal invasion was not removed and , after that , the remaining tumor cells grew . ct is not suitable for evaluation of soft tissue abnormalities ; thus , it can not completely rule out direct invasion . ohshima et al . reported esophageal invasion of advanced thyroid cancer .6 five patients with advanced thyroid cancer were evaluated by eus , and all cases were detected as hypoechoic and irregular masses . ct and pet - ct are not perfect imaging modalities for the evaluation of soft tissue abnormalities . because of the relative resistance of the esophageal mucosa to invasion , gross intraluminal involvement of the esophagus rarely occurs . however , tumors readily penetrate through the esophageal musculature and cause dysphagia secondary to the compressive effects of the tumor mass on the underlying mucosa .1 corresponding to that , ohshima et al . reported the destruction of the fourth layer of the esophagus close to the thyroid cancer in a case of esophageal invasion of thyroid cancer detected by eus .6 at resection , the tumor was dissected from the underlying mucosa without difficulty by developing a submucosal plane . ct and magnetic resonance imaging are useful methods for evaluating the thyroid and adjacent tissue . however , eus is more suitable than other modalities for detecting the infiltration or metastasis of thyroid cancer .6 recent advances in eus have made detailed evaluation of submucosal tumors of the esophagus possible . in our patient , the mass of the esophagus appeared as a submucosal mass originating from the esophageal wall , but showed several differences in the eus findings from the typical appearance of esophageal submucosal tumors . gastrointestinal stromal tumors are typically hypoechoic lesions with well - defined margins ; they rarely have irregular margins and ulcerations . infrequently , gastrointestinal stromal tumors appear inhomogeneous due to liquefaction necrosis , connective tissue , or cystic and hyaline degeneration . the mass in our case was located in the submucosal and muscularis propria layer , its margin was relatively poorly demarcated , and it appeared more hyperechoic than do ordinary gastrointestinal stromal tumors . one case of esophageal metastasis of thyroid cancer that presented with hematemesis was reported .7 there was also a case of occult papillary thyroid cancer that invaded the trachea and esophagus and was diagnosed by brohchoscopy .8 furthermore , a case of esophageal metastasis of papillary thyroid cancer that presented with progressive dysphagia was also reported .9 in our case , the recurrence of thyroid cancer to the esophagus happened seven years after the total thyroidectomy and it did not induce any symptoms . the patient presented with a palpable neck mass , but that symptom was caused by the masses that recurred on the thyroid bed . to our knowledge , esophageal submucosal tumor - like recurrence of papillary thyroid cancer and the associated eus findings have not been reported previously .\noutput:\n" }, { "from": "agent", "value": "a 75 - year - old woman who underwent a total thyroidectomy for papillary thyroid cancer 7 years previously presented with a palpable neck mass . computed tomography ( ct ) showed two metastatic masses on the thyroid bed and another mass that looked benign originating from the esophageal wall . endoscopic ultrasonography ( eus ) showed a hypoechoic mass in the esophageal wall that looked similar to a gastrointestinal stromal tumor . the mass on the esophagus had intense fluorodeoxyglucose ( fdg ) uptake in positron emission tomography - computed tomography ( pet - ct ) , which suggested the possibility of malignancy . subsequently , after surgery , the mass in the esophagus was confirmed as a metastasis from the thyroid papillary carcinoma . here we report this unusual case of papillary thyroid cancer that recurred as an esophageal submucosal tumor ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: , half will evolve to fibrosis , 1015 % to cirrhosis and 5.4 % to hepatic insufficiency . radiologists must report fatty liver disease because it may have serious long - term consequences if left untreated . we searched our archive retrospectively , reviewed the literature and identified six patterns of liver steatosis : diffuse , geographic , focal , subcapsular , multifocal and perivascular . diffuse forms may be graded subjectively according to severity ( mild , moderate , severe ) or quantitatively with magnetic resonance ( mr ) - based methods . therefore , previous knowledge of their cross - sectional appearance may prevent unwarranted investigations or allow non - invasive diagnosis . ultrasound is the first - line imaging technique for the screening and follow - up of patients with chronic liver disease . it is , therefore , important for radiologists to be aware of patterns of heterogeneous or focal forms of fatty deposition . on ultrasound , fatty liveris hyperechoic compared with renal cortex and spleen , whereas fatty sparing is isoechoic or hypoechoic . on unenhanced computed tomography ( ct ) , liver density less than 40 hounsfield units ( hu ) or a density difference of more than 10 hu between spleen and liver indicates fatty liver . alternatively , liver parenchyma hypodensity relative to vessels establishes the presence of moderate to severe fatty liver disease . on portal phase contrast - enhanced ct with a standardised protocol , a density difference greater than 25 hu between spleen and liver suggests fatty liver deposition . ct with contrast material was previously thought to be less reliable in detecting fatty liver . however , recent data suggest that portal phase contrast - enhanced ct using blood - subtracted hepatic attenuation may have a similar accuracy to or even greater accuracy than unenhanced ct in the diagnosis of fatty liver . mr imaging ( mri ) allows measurement of fat and water proton signals and is considered the most accurate non - invasive technique for hepatic fat quantification . chemical shift gradient - echo imaging is a widely available mri technique for fat detection and quantification . fatty liver shows a signal drop on gradient echo t1 - weighted out - of - phase images compared with in - phase images . the dual - echo method results in underestimation of the fat fraction by only 2.9 % compared with spectroscopy , the non - invasive gold standard . it may have different levels of severity that can be determined by using quantification maps . the presence of diffuse steatosis in a patient with hepatomegaly and an enlarged caudate - to - right lobe ratio should raise the possibility of nash . fig . d severe diffuse fatty liver disease . a ultrasound image in a 58 - year - old man known for intraductal papillary mucinous neoplasm ( ipmn / ipmt ) of the pancreas and alcoholic pancreatitis showing a hyperechoic liver compared with the right renal cortex . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 42 hu ) compared with the spleen ( 113 hu ) ( 25 hu difference ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image . mr images were obtained on a 1.5 - t mri system with tes of 2.2 and 4.5 for in - and out - of - phase images respectively a d severe diffuse fatty liver disease . a ultrasound image in a 58 - year - old man known for intraductal papillary mucinous neoplasm ( ipmn / ipmt ) of the pancreas and alcoholic pancreatitis showing a hyperechoic liver compared with the right renal cortex . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 42 hu ) compared with the spleen ( 113 hu ) ( 25 hu difference ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image . mr images were obtained on a 1.5 - t mri system with tes of 2.2 and 4.5 for in - and out - of - phase images respectively geographic fatty liver disease is a frequently encountered variant . for example , fat accumulation sometimes occurs only in the right lobe ( fig . 2 ) . one hypothesis to explain this distribution is that blood from the superior mesenteric vein containing lipogenic alimentary factors is preferentially distributed to the right lobe of the liver . , fatty liver deposition can be distributed in territories previously affected by cholangitis ( fig . fig . 2a , bgeographic fat accumulation limited to the right lobe of the liver . mri of the liver in a 57 - year - old woman known for multiple focal nodular hyperplasia . a axial t1 - weighted in - phase and b out - of - phase images show an important signal drop in the right lobe of the liver on opposed - phase imagefig . mri of the liver in a 76 - year - old man who had hepatico - jejunostomy for biliary duct trauma and stenosis followed by two episodes of cholangitis in 1997 and 2006 . a axial t1 - weighted in - phase and b out - of - phase images show an important signal drop on the opposed - phase image in a geographic distribution , affecting the hepatic dome more severely . c subtraction confirms severe geographic fatty liver deposition a , bgeographic fat accumulation limited to the right lobe of the liver . mri of the liver in a 57 - year - old woman known for multiple focal nodular hyperplasia . a axial t1 - weighted in - phase and b out - of - phase images show an important signal drop in the right lobe of the liver on opposed - phase image amri of the liver in a 76 - year - old man who had hepatico - jejunostomy for biliary duct trauma and stenosis followed by two episodes of cholangitis in 1997 and 2006 . a axial t1 - weighted in - phase and b out - of - phase images show an important signal drop on the opposed - phase image in a geographic distribution , affecting the hepatic dome more severely . c subtraction confirms severe geographic fatty liver deposition focal fat deposition is slightly less common and can mimic other hepatic benign or malignant lesions on ultrasound and ct ( fig . 4 ) . mri is very useful for making the diagnosis of focal hepatic steatosis , which appears isointense or hyperintense to liver on in - phase images and loses signal on out - of - phase images . fat accumulation does not show diffusion restriction , which may also be useful to differentiate steatosis from other liver abnormalities . moreover , focal fat accumulation tends to show wedge shaped margins , no mass effect on adjacent blood vessels or the biliary tree , sharp boundaries , and lobar or segmental distribution . a ct , axial contrast - enhanced portal phase image in a 58 - year - old woman shows a hypodense , mildly heterogeneous , cuneiform lesion in the posterior aspect of segment iv . mri , b axial t1 - weighted in - phase and c out - of - phase images show a signal drop within this lesion on the opposed - phase image focal fatty liver deposition . a ct , axial contrast - enhanced portal phase image in a 58 - year - old woman shows a hypodense , mildly heterogeneous , cuneiform lesion in the posterior aspect of segment iv . mri , b axial t1 - weighted in - phase and c out - of - phase images show a signal drop within this lesion on the opposed - phase image some regions of the liver are more prone to being affected by focal fat deposition . those are the perivesicular and subcapsular regions abutting the hepatic hilum or falciform ligament in the area drained by the sapey s vein . the classical patterns of focal fatty liver deposition and sparing are linked to vascular anatomical variants that involve capsular veins , peribiliary veins , the cystic vein ( which drains perivesicular areas ) , and the right gastric vein ( which drains the anterior portion of segment i and the posterior portion of segment iv ) . these veins can be the source of an aberrant venous draining system without portal inflow causing local haemodynamic anomalies that may lead to focal fatty liver deposition and sparing . d perivesicular fatty sparing . a ultrasound image in a 77 - year - old woman who had nephrectomy for renal cell carcinoma shows a hyperechoic liver with hypoechoic perivesicular foci . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 57 hu ) in comparison with the spleen ( 135 hu ) with a perivesicular spared zone ( in segments iv and v ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image with the exception of a perivesicular spared zone a d perivesicular fatty sparing . a ultrasound image in a 77 - year - old woman who had nephrectomy for renal cell carcinoma shows a hyperechoic liver with hypoechoic perivesicular foci . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 57 hu ) in comparison with the spleen ( 135 hu ) with a perivesicular spared zone ( in segments iv and v ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image with the exception of a perivesicular spared zone subcapsular fat deposition may present as small fat nodules ( fig . 6 ) or as a confluent peripheral region of fat confined to a subcapsular zone . it may be caused by insulin added to the peritoneal dialysate in certain patients with renal failure and insulin - dependent diabetes . subcapsular hepatocytes are exposed to a higher concentration of insulin than the rest of the liver in those patients . because insulin promotes the esterification of free fatty acids into triglycerides , the peritoneal administration of insulin can result in subcapsular fat accumulation . a axial contrast - enhanced portal phase ct image in a 58 - year - old man with a neuro - endocrine tumour of the pancreas shows two small hypodense subcapsular hepatic lesions in segment v. mri , b axial t1 - weighted in - phase and c out - of - phase images show a drop of signal within the two subcapsular lesions on the opposed - phase image aa axial contrast - enhanced portal phase ct image in a 58 - year - old man with a neuro - endocrine tumour of the pancreas shows two small hypodense subcapsular hepatic lesions in segment v. mri , b axial t1 - weighted in - phase and c out - of - phase images show a drop of signal within the two subcapsular lesions on the opposed - phase image multifocal fatty liver deposition is another unusual pattern that can represent a difficult diagnostic challenge . the differential diagnosis on ct and ultrasound may include metastasis , lymphoma , sarcoidosis , abscesses , candidiasis , haemangiomatosis and biliary hamartomas . d multifocal fatty liver deposition . a ultrasound image in a 39 - year - old woman with lymphoma and malignant thymoma with local pleural recurrence treated with radiotherapy and chemotherapy shows multiple nodular hyperechoic foci throughout the liver . mri , c axial t1 - weighted in - phase and d out - of - phase images show multiple lesions with signal drop on the opposed - phase image a d multifocal fatty liver deposition . a ultrasound image in a 39 - year - old woman with lymphoma and malignant thymoma with local pleural recurrence treated with radiotherapy and chemotherapy shows multiple nodular hyperechoic foci throughout the liver . mri , c axial t1 - weighted in - phase and d out - of - phase images show multiple lesions with signal drop on the opposed - phase image a very unusual pattern of fatty liver disease is perivascular deposition . halos of fat surround the hepatic veins , the portal veins , or both hepatic and portal veins . . it may be difficult to differentiate perivascular fat deposition or perivascular sparing from periportal oedema , passive hepatic congestion and budd chiari syndrome on ct and ultrasound . mri is useful for making this rare diagnosis by showing a signal intensity loss on opposed - phase images compared with in - phase images . a ultrasound image in a 39 - year - old man with a clinical suspicion of non - alcoholic fatty liver disease based on elevated liver enzymes shows a geographic area of fatty sparing parallel to the right hepatic vein . b doppler image shows an absence of mass effect on the right hepatic vein a , b perivascular fatty sparing . a ultrasound image in a 39 - year - old man with a clinical suspicion of non - alcoholic fatty liver disease based on elevated liver enzymes shows a geographic area of fatty sparing parallel to the right hepatic vein . it may have different levels of severity that can be determined by using quantification maps . the presence of diffuse steatosis in a patient with hepatomegaly and an enlarged caudate - to - right lobe ratio should raise the possibility of nash . fig . d severe diffuse fatty liver disease . a ultrasound image in a 58 - year - old man known for intraductal papillary mucinous neoplasm ( ipmn / ipmt ) of the pancreas and alcoholic pancreatitis showing a hyperechoic liver compared with the right renal cortex . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 42 hu ) compared with the spleen ( 113 hu ) ( 25 hu difference ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image . mr images were obtained on a 1.5 - t mri system with tes of 2.2 and 4.5 for in - and out - of - phase images respectively a d severe diffuse fatty liver disease . a ultrasound image in a 58 - year - old man known for intraductal papillary mucinous neoplasm ( ipmn / ipmt ) of the pancreas and alcoholic pancreatitis showing a hyperechoic liver compared with the right renal cortex . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 42 hu ) compared with the spleen ( 113 hu ) ( 25 hu difference ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image . mr images were obtained on a 1.5 - t mri system with tes of 2.2 and 4.5 for in - and out - of - phase images respectivelyfor example , fat accumulation sometimes occurs only in the right lobe ( fig . 2 ) . one hypothesis to explain this distribution is that blood from the superior mesenteric vein containing lipogenic alimentary factors is preferentially distributed to the right lobe of the liver . geographic patterns may be secondary to an insult to the liver parenchyma . for example , fatty liver deposition can be distributed in territories previously affected by cholangitis ( fig . mri of the liver in a 57 - year - old woman known for multiple focal nodular hyperplasia . a axial t1 - weighted in - phase and b out - of - phase images show an important signal drop in the right lobe of the liver on opposed - phase imagefigc severe geographic fatty liver deposition . mri of the liver in a 76 - year - old man who had hepatico - jejunostomy for biliary duct trauma and stenosis followed by two episodes of cholangitis in 1997 and 2006 . a axial t1 - weighted in - phase andb out - of - phase images show an important signal drop on the opposed - phase image in a geographic distribution , affecting the hepatic dome more severely . c subtraction confirms severe geographic fatty liver deposition a , bgeographic fat accumulation limited to the right lobe of the liver . mri of the liver in a 57 - year - old woman known for multiple focal nodular hyperplasia . a axial t1 - weighted in - phase and b out - of - phase images show an important signal drop in the right lobe of the liver on opposed - phase image amri of the liver in a 76 - year - old man who had hepatico - jejunostomy for biliary duct trauma and stenosis followed by two episodes of cholangitis in 1997 and 2006 . a axial t1 - weighted in - phase and b out - of - phase images show an important signal drop on the opposed - phase image in a geographic distribution , affecting the hepatic dome more severely . focal fat deposition is slightly less common and can mimic other hepatic benign or malignant lesions on ultrasound and ct ( fig . 4 ) . mri is very useful for making the diagnosis of focal hepatic steatosis , which appears isointense or hyperintense to liver on in - phase images and loses signal on out - of - phase images . fat accumulation does not show diffusion restriction , which may also be useful to differentiate steatosis from other liver abnormalities . moreover , focal fat accumulation tends to show wedge shaped margins , no mass effect on adjacent blood vessels or the biliary tree , sharp boundaries , and lobar or segmental distribution . a ct , axial contrast - enhanced portal phase image in a 58 - year - old woman shows a hypodense , mildly heterogeneous , cuneiform lesion in the posterior aspect of segment iv . mri , b axial t1 - weighted in - phase and c out - of - phase images show a signal drop within this lesion on the opposed - phase image focal fatty liver deposition . a ct , axial contrast - enhanced portal phase image in a 58 - year - old woman shows a hypodense , mildly heterogeneous , cuneiform lesion in the posterior aspect of segment iv . mri , b axial t1 - weighted in - phase and c out - of - phase images show a signal drop within this lesion on the opposed - phase image some regions of the liver are more prone to being affected by focal fat deposition . those are the perivesicular and subcapsular regions abutting the hepatic hilum or falciform ligament in the area drained by the sapey s vein . the classical patterns of focal fatty liver deposition and sparing are linked to vascular anatomical variants that involve capsular veins , peribiliary veins , the cystic vein ( which drains perivesicular areas ) , and the right gastric vein ( which drains the anterior portion of segment i and the posterior portion of segment iv ) . these veins can be the source of an aberrant venous draining system without portal inflow causing local haemodynamic anomalies that may lead to focal fatty liver deposition and sparing . d perivesicular fatty sparing . a ultrasound image in a 77 - year - old woman who had nephrectomy for renal cell carcinoma shows a hyperechoic liver with hypoechoic perivesicular foci . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 57 hu ) in comparison with the spleen ( 135 hu ) with a perivesicular spared zone ( in segments iv and v ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image with the exception of a perivesicular spared zone a d perivesicular fatty sparing . a ultrasound image in a 77 - year - old woman who had nephrectomy for renal cell carcinoma shows a hyperechoic liver with hypoechoic perivesicular foci . b ct , axial contrast - enhanced portal phase image shows a diffusely hypodense liver ( 57 hu ) in comparison with the spleen ( 135 hu ) with a perivesicular spared zone ( in segments iv and v ) . mri , c axial t1 - weighted in - phase and d out - of - phase images show an important signal drop of the liver on the opposed - phase image with the exception of a perivesicular spared zone6 ) or as a confluent peripheral region of fat confined to a subcapsular zone . it may be caused by insulin added to the peritoneal dialysate in certain patients with renal failure and insulin - dependent diabetes . subcapsular hepatocytes are exposed to a higher concentration of insulin than the rest of the liver in those patients . because insulin promotes the esterification of free fatty acids into triglycerides , the peritoneal administration of insulin can result in subcapsular fat accumulation . a axial contrast - enhanced portal phase ct image in a 58 - year - old man with a neuro - endocrine tumour of the pancreas shows two small hypodense subcapsular hepatic lesions in segment v. mri , b axial t1 - weighted in - phase and c out - of - phase images show a drop of signal within the two subcapsular lesions on the opposed - phase image aa axial contrast - enhanced portal phase ct image in a 58 - year - old man with a neuro - endocrine tumour of the pancreas shows two small hypodense subcapsular hepatic lesions in segment v. mri , b axial t1 - weighted in - phase and c out - of - phase images show a drop of signal within the two subcapsular lesions on the opposed - phase imagemultifocal fatty liver deposition is another unusual pattern that can represent a difficult diagnostic challenge . the foci are usually round or oval and may mimic multiple nodules . the differential diagnosis on ct and ultrasound may include metastasis , lymphoma , sarcoidosis , abscesses , candidiasis , haemangiomatosis and biliary hamartomas . d multifocal fatty liver deposition . a ultrasound image in a 39 - year - old woman with lymphoma and malignant thymoma with local pleural recurrence treated with radiotherapy and chemotherapy shows multiple nodular hyperechoic foci throughout the liver . mri , c axial t1 - weighted in - phase and d out - of - phase images show multiple lesions with signal drop on the opposed - phase image a d multifocal fatty liver deposition . a ultrasound image in a 39 - year - old woman with lymphoma and malignant thymoma with local pleural recurrence treated with radiotherapy and chemotherapy shows multiple nodular hyperechoic foci throughout the liver . mri , c axial t1 - weighted in - phase and d out - of - phase images show multiple lesions with signal drop on the opposed - phase imagehalos of fat surround the hepatic veins , the portal veins , or both hepatic and portal veins . . it may be difficult to differentiate perivascular fat deposition or perivascular sparing from periportal oedema , passive hepatic congestion and budd chiari syndrome on ct and ultrasound . mri is useful for making this rare diagnosis by showing a signal intensity loss on opposed - phase images compared with in - phase images . a ultrasound image in a 39 - year - old man with a clinical suspicion of non - alcoholic fatty liver disease based on elevated liver enzymes shows a geographic area of fatty sparing parallel to the right hepatic vein . b doppler image shows an absence of mass effect on the right hepatic vein a , b perivascular fatty sparing . a ultrasound image in a 39 - year - old man with a clinical suspicion of non - alcoholic fatty liver disease based on elevated liver enzymes shows a geographic area of fatty sparing parallel to the right hepatic vein . fatty liver deposition is a very common finding but it has many atypical patterns of distribution that can represent diagnostic pitfalls . when an atypical form of fatty liver deposition is suspected on ultrasound or ct , mri may be used to confirm the diagnosis because of its ability to break down fat and water signal components .\noutput:\n" }, { "from": "agent", "value": "objectivefatty liver deposition is a very common finding , but it has many atypical patterns of distribution that can represent diagnostic pitfalls . the purpose of this pictorial essay is to review different patterns of fatty liver deposition and sparing.methodswe searched our archive retrospectively , reviewed the literature , and identified six patterns of liver steatosis.resultssteatosis may be diffuse , geographic , focal , subcapsular , multifocal or perivascular.conclusionsprevious knowledge of atypical patterns of steatosis distribution may prevent misdiagnosis of infiltrative disease or focal liver lesions . when an unusual form of fatty liver deposition is suspected on ultrasound or computed tomography , magnetic resonance imaging may be used to confirm the diagnosis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: spontaneous coronary artery dissection ( scad ) is a rare and fatal cause of acute coronary syndrome ( acs ) that has been reported by autopsy in many cases historically .1 ) the clinical diagnosis of scad has increased because coronary angiography ( cag ) and intravascular ultrasound ( ivus ) available for providing detailed morphological information of vessel layers is frequently performed for evaluation of acs . although several modalities including percutaneous coronary intervention ( pci ) , coronary artery bypass graft surgery ( cabg ) and medical therapy have been performed to manage patients with scad , no treatment guideline has yet been established . we report a case of scad which was presented as st - segment elevation myocardial infarction ( stemi ) and treated successfully with medical treatment . a 53 year - old woman was transferred to the emergency department due to chest pain via a district hospital . she denied any prior history of pregnancy , cocaine or amphetamine medication , chest trauma , connective tissue disease and family history of premature coronary artery disease . on arrival , her vital signs were stable except for blood pressure reading of 140/84 mmhg . the physical examination revealed no evidence of tenderness on the anterior chest and no sign of joint swelling or tenderness . the levels of total cholesterol , low density lipoprotein - cholesterol ( ldl - c ) and cardiac enzymes were elevated . the patient 's total cholesterol , triglyceride , high density lipoprotein - cholesterol , and ldl results were 236 mg / dl ( 0 - 200 mg / dl ) , 98 mg / dl ( 0 - 150 mg / dl ) , 41 mg / dl ( 35 - 55 mg / dl ) , 169 mg / dl ( 55 - 155 mg / dl ) , respectively . creatine kinase - mb , and troponine - i levels were 113 ng / ml ( 0 - 2.8 ng / ml ) , and 26 ng / ml ( 0 - 0.045 ng / ml ) . glucose was 95 mg / dl ( 70 - 110 mg / dl ) , and creatinine was 0.81 mg / dl ( 0.7 - 1.4 mg / dl ) . suspecting myocardial infarction , we performed emergent cag . in the examination , a long and smooth lesion from the mid to distal left anterior descending artery ( lad ) ivus confirmed the dissecting flap with intramural hematoma compressing the true lumen at the distal lad ( fig .1 c ) , and ectatic dilatation of the proximal lad ( internal diameter : approximately 6 mm ) . , the patient did not complain of chest pain and all vital signs were stable . because the intramural hematoma was located at distal lad and the thrombolysis in myocardial infarction flow grade was three , we did not conduct any additional interventional treatments for the patient . multi - detector computed tomography ( mdct ) of coronary artery was undertaken three days later using a siemens 64 - slice scanner . we observed a luminal narrowing of the distal lad with a perivascular low attenuation corresponding to hematoma and ectatic change of the left coronary artery ( fig . the patient was treated with aspirin , clopidogrel , bisoprolol , valsartan , and diltiazem , and did not suffer from any discomfort after discharge . follow - up mdct of the coronary artery demonstrated dilatation of lumen size at the distal lad with resolution of perivascular hematoma ( fig . 2c and d ) . it separates coronary arterial layers and formed hematoma between the layers which compress the true lumen of the coronary artery and induce ischemia . the incidence of scad is reported from 0.1 % up to 1.1 % of patients referred for cag .2 ) the etiology is not fully known , but atherosclerosis is considered to be the most common causal factor for scad .3 ) hormonal changes in women who are in peripartum period or taking oral pills , iatrogenic , secondary to chest trauma , connective tissue disease and vasculitis , seem to be related to scad .4 - 6 ) in cases of scad with obscure cag findings , ivus can be helpful by detecting the presence of an intramural hematoma in the outer layer of the media compressing the true lumen .5 ) the detection of intimal tearing flap by ivus is not always available maybe due to spontaneous clotting at the tearing point .7 ) in addition to ivus , according to development of ct spatial resolution , mdct of the coronary artery can visualize the extent and thickness of hematoma in the assessment of scad .5 ) the therapeutic strategy is generally determined by the clinical condition and image findings .3 ) 5 ) if vital conditions are stable and ischemia is not ongoing , scad may be treated medically similar to medical treatment of acs . thrombolytic therapy in scad is not recommended due to the extension of dissection resulting in poor prognosis . cabg can be considered in cases of dissection of left main coronary artery or multivessel involvement . although our patient was presented with stemi , the initial findings of cag and ivus were compatible with scad , and vital signs were stable . we were able to avoid invasive procedures like coronary stenting , and short - term follow - up with mdct resulted in more confidence in the treatment . in addition to follow - up cag , serial check - up using ivus and mdct could clearly assess the resolution of hematoma and the acquisition of the correct true lumen . therefore , we think that ivus and mdct can be useful to diagnose , decide the optimal treatment and identify the progress of disease in the case of scad presented with stemi .\noutput:\n" }, { "from": "agent", "value": "spontaneous coronary artery dissection ( scad ) is an uncommon cause of acute coronary syndrome which may be related to lethal condition . although several modalities including medical therapy have been suggested , agreement on optimal treatment has not yet been determined . we describe a case of scad which was presented as st - segment elevation myocardial infarction , and treated successfully with medical treatment . coronary angiography , intravascular ultrasound and multi - detector computed tomography showed the serial changes of this disease entity ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a common structural motif across electron transfer ( et ) metalloprotein active sites is the presence of an axial metal - thioether bond , where this ligand is provided by an endogenous methionine residue . these are found in the mononuclear type one copper ( t1 cu ) , binuclear cua , and cytochrome ( cyt c and cyt b ) containing et metalloproteins . in t1 cu and cua active sites , the function of the cus ( met ) bond is now well understood : the presence of the axial s ( met ) ligand lowers e due to the stronger stabilization energy ( i.e. , larger axial ligand bond strength ) in the oxidized than in the reduced state , while not greatly affecting the reorganization energy . s ( met ) bond in cyt c is generally thought to be stronger in the reduced ( ferrous ) rather than the oxidized ( ferric ) state . this consideration for cyt c is based on the decrease in e when the fes ( met ) bond is lost , ligand competition and binding , protein folding studies , and the shorter fe ( ii ) - s ( met ) bond ( 2.29 ) relative to fe ( iii ) - s ( met ) ( 2.33 ) from extended x - ray absorption fine structure ( exafs ) . s ( met ) bond in cyt c is also functionally relevant . besides carrying out et , cyt c is also involved in programmed cell death or apoptosis . during this process , s ( met ) bond and the formation of an open coordination sphere for the activation of h2o2 in the peroxidation of cardiolipin . in addition , the fe ( ii ) - s ( met ) bond can be photodissociated , while the fe ( iii ) - s ( met ) bond can not . clearly , the difference in metal ligand bonding , and thus bond strengths for the fe ( ii ) and fe ( iii ) states , is directly related to both functions of cyt c : et and lipid peroxidation . in order to understand these differences in bonding , it is necessary to employ a spectroscopic method that directly probes the electronic structure of the fe site ; however , the highly covalent porphyrin obscures the optical spectral features associated with the fes ( met ) bond . s k - edge x - ray absorption spectroscopy ( xas ) has proven to be a powerful spectroscopic tool to quantitate the covalency of thiolate - metal bonds in proteins and models through the intensity of the pre - edge feature ( i.e. , the 1s 3d transition ( s ) ) . however , the higher zeff of the thioether sulfur relative to a thiolate increases the energy of the pre - edge transition such that it is located within the envelope of the edge transitions ( i.e. , the 1s valence np ) . the direct way to investigate the electronic structure of a heme protein , where the fe is in the highly covalent porphyrin environment , would be to probe the unoccupied valence orbitals of the central fe ion by fe l - edge xas . this is a powerful method to extract the differential orbital covalency ( doc , differences in the covalency of the different symmetry sets of d orbitals ) that is particularly important for heme complexes and enzyme intermediates . however , the fe l - edge excitation energy lies in the soft x - ray energy region ( 710 ev ) , which requires ultrahigh vacuum conditions and generally involves the detection of electrons within 10 of the surface of the sample due to the low electron escape depth . the escape depth can be enlarged to a few micrometers by detecting the fluorescence decay . however , this can suffer from significant self - absorption effects , mainly for the l3 - edge . these restrictions make it challenging to apply high - resolution metal l - edge xas to metalloproteins and enzymes . metal k - edge xas does not have these restrictions due to the high excitation energy in the hard x - ray region ( the fe k - pre - edge is at 7110 ev ) . however , due to the short lifetime of the 1s core - hole , the broadening of the 1s 3d transitions is significantly larger than for the 2p 3d transitions . since the 1s 3d transitions are quadrupole allowed , they often gain intensity from small amounts of 4p mixing into the d orbitals in noncentrosymmetric ligand environments , while 2p 3d transitions are electric dipole allowed and their intensities are a direct probe of the metal d - character in valence orbitals involved in bonding . thus , by going from soft to hard x - rays , one wins on experimental conditions , but loses resolution and insight into bonding . the desired combination of accessible experimental conditions , higher resolution , and d - orbital covalency can be realized by applying k resonant inelastic x - ray scattering ( 1s2p rixs ) . here , a 1s electron is excited into an unoccupied 3d orbital ( 1s 3d ) via a quadrupole transition to a 1s2p3d intermediate state and the subsequent electric dipole allowed decay of a 2p electron into the 1s hole ( 2p 1s ) to the 1s2p3d final state , is detected by its photon emission . thus , l - edge absorption and 1s2p rixs reach the same final state configurations and allow a direct comparison , but with complementary selection rules . varying the incident x - ray energies and collecting the respective emission spectra , allows one to generate the rixs plane . l - edge - like spectra are obtained as vertical cuts through the rixs plane ( i.e. , at fixed k - edge excitation energies ) , providing the energies of the same final state configurations that could be reached through direct l - edge xas , but via an intermediate state . it has been recently shown that the valence bond configuration interaction ( vbci ) model with the same parameters reproduces both l - edge xas and rixs results , but with selection rules involving the intermediate states in rixs , as described by the kramersheisenberg scattering equation .1 where and are the incident and emission energy , respectively , with being the energy transfer , that givesl - edge - like spectra . to investigate the electronic structure of fe in a covalent porphyrin environment , and in particular the fes ( met ) bonding properties of ferrous and ferric cyt c , 1s2p rixs was applied to this protein , which can not be reasonably studied by l - edge xas . parallel rixs data were collected on tetraphenyl porphyrin ( tpp ) complexes with bisimidazole axial ligands ( fetpp ( imh ) 2 . the two main differences in the structures of cyt c and fetpp ( imh ) 2 , include replacement of one axial imidazole ligand with a thioether ( met - 80 ) , and the porphyrin ring is cross - linked to two cysteine derived thioether bonds ( cys - 14 and cys - 17 ) ( see figure 1 ) . here , rixs data on fetpp ( imh ) 2 are correlated to the l - edge xas data and to 1s2p rixs data on ferrous and ferric cyt c , and analyzed using the vbci multiplet model . these results are then used to correlate to dft calculations on large models to distinguish specific contributions to bonding . truncated models , which reasonably represent the large models ( see figure s1 in supporting information ) , are then used to explore the thermodynamic differences between the fethe results of these studies are then related to past experimental results on thioether - fe bonding . molecular structures of ( a ) fetpp ( imh ) 2 , and ( b ) its active side counterpart in cyt c.ferrous and ferric fetpp ( imh ) 2 and cyt c were prepared in - house following standard procedures . three experimental methods have been employed : soft x - ray l - edge xas , as well as hard x - ray k - edge xas and 1s2p rixs . these experiments have been performed at the stanford synchrotron radiation lightsource ( ssrl ) at beamlines 101 ( l - edge xas ) , 73 ( k - edge ) and 62 ( 1s2prixs ) , as well as the advanced photon source beamline 9 - id . all data sets ( l - edge , k - edge , 1s2p rixs ) have been measured at minimum twice to ensure reproducible and reliable data . the pre - edge in a 1s2p rixs experiment includes the tail of the intense 1s 4p excitations at around 15 ev higher energy . this leads to an increase of the pre - edge background and further complicates a direct comparison of l - edge data with constant incident energy ( cie , i.e. , vertical ) cuts through the rixs plane . in order to estimate the rixs intensity from the tail of the rising - edge , the data were carefully fit to extract the true pre - edge region as described in the supporting information and in the literature . to simulate all x - ray spectra , charge transfer multiplet calculations , that properly take the core - hole into account , were performed . covalent mixing of ligand character is modeled using a valence bond configuration interaction ( vbci ) approach , using a three configuration model including a ligand - to - metal charge transfer ( lmct ) configuration dl and a metal - to - ligand charge transfer ( mlct ) configuration dl mixed into the d configuration in the ground state . ( l = ligand with an e hole , l = ligand with an additional electron ) the corresponding charge transfer energies are ( lmct ) and * ( mlct ) . all calculations have been performed in d4h effective symmetry for all four complexes . in the ferrous case , the xy / z energy splitting and covalencies are properly reflected in this approximation . in the ferrous case , the xy / z energy splitting is reflected properly in d4h symmetry . in the ferric case , the covalency value for each of the symmetry blocks was generated via the projection method leading to the differential orbital covalency ( doc ) . ground state dft calculations and geometry optimizations were performed using gaussian 09 for a range of functionals and basis sets . unoccupied metal d - character has been determined by subtracting the sum of their contribution to all occupied orbitals from 100 % . the ligand donor character has been obtained from the occupied fragment orbital character summed over the unoccupied orbitals . figure 2 presents a collection of data sets comparing the 1s2p rixs , l - edge and k - edge xas data . figure 2 ( a ) shows the full 1s2p rixs plane , while figure 2 ( b ) gives the result with the rising edge subtracted as described in the supporting information . the features at an incident energy of 7112 ev and energy transfers of 706.5 and 720 ev reflect excitations into the k - pre - edge . the l3 - and l2 - edge - like features on the energy transfer axis are split by the spinthe intense feature starting at 7115 ev originates from the tail of the strong dipole allowed 1s4p transition at 7130 ev . note that possible shakeup features due to + - donation and - back - bonding could be present at the onset of the main - edge tail that have been neglected in the background subtracted rixs in figure 2 ( b ) . fe ( ii ) tpp ( imh ) 2 : ( a ) full 1s2p rixs plane , ( b ) rising - edge subtracted 1s2p rixs plane , ( c ) comparison of the cee cut through the uncorrected plane ( red line in ( a ) ) with the direct k - edge , ( d ) comparison of the cie cut along the red line in ( b ) with the direct l - edge experimental data . figure 2 ( c ) compares the k - edge xas of the fe ( ii ) tpp ( imh ) 2 model complex with the constant emission energy ( cee ) cut through the rixs plane as indicated by the diagonal red line in figure 2 ( a ) . both spectra show the same structure that is better resolved in the cee spectrum ( this is often also referred to as herfd ) . the peak at 7112.2 ev involves excitation to the 1s3dt2g63deg1 final state , while the second weak peak at 7115.3 ev likely originates from back - bonding . the existence of a small back - bonding contribution ( 10 % ) in the ground state has already been observed in l - edge xas and is present in dft calculations . the x y and z orbitals are separated in energy due to the difference in axial and equatorial bonding , associated with effective d4h symmetry . since the xy and xz / yz orbitals are occupied , the k - pre - edge is dominated by excitations into these empty x y and z orbitals . to estimate the maximum d4h final state splitting , the fe ( ii ) tpp ( imh ) 2 result was compared to the 1s2p rixs of fe ( ii ) - tacn , which has oh local symmetry and thus only one possible k - pre - edge peak ( see figure s2 in the supporting information ) . while no spectroscopic difference is observed between the k - edge xas and cee rixs , this is not the case in comparing the l - edge xas data with a cie cut at h = 7112.2 ev through the rixs plane ( red vertical line in figure 2 ( b ) ) . figure 2 ( d ) presents the fe ( ii ) tpp ( imh ) 2 l - edge xas data together with the cie cut through the main rixs peak . the cie cut shows additional intensity at lower energies for both the l3 - and l2 - like curves ( h = 707.3 and 719.6 ev ) and a reduced relative intensity at the l - edge main peak at h = 708.2 ev . the high energy l3 - edge shoulder in the cie cut at 710.2 ev is also less pronounced compared to the corresponding l - edge feature . similar observations hold true for the l2 - edge energy region , together with the observation of a smaller l3 / l2 peak intensity ratio in comparing the cie rixs cut to the direct l - edge xas for fe ( ii ) tpp ( imh ) 2 . in our earlier 1s2p rixs experiments on oh samples , additional intensity in the cie rixs cuts relative to l - edge xaswas found to originate from electric dipole forbidden excitations that are allowed in 1s2p rixs ( see eq 1 and figure 3 ( a ) ) . in the fe ( ii ) tpp ( imh ) 2 model complex , the fe local symmetry is approximately d4h with an a1 g ground state . in d4h symmetry , the l - edge electric dipole transition operator has a2u and eu symmetry so that only a2u and eu final states are allowed ( figure 3 ( b ) ) . in the 1s2p rixs experiment , one excites via a 1s 3d quadrupole transition , having a1 g and b1 g character , into intermediate states with a1 g ( fe dz ) and b1 gthe 2p 1s decay from these final states again has electric dipole character , thus a2u and eu symmetry , which allows 1s2p rixs intensity to final states with b2u , a2u and eu symmetry ( figure 3 ( b ) ) . final states with eu symmetry can be reached both from a1 g and b1 g intermediate states resulting in different final state energies . thus , the additional intensity found in the 1s2p rixs cuts throughout the main intensity peaks originates from both final states that can not be reached in l - edge xas and also from the splitting of the xpossible excitation pathways for an l - edge and 1s2p rixs experiment of a ferrous low - spin system for ( a ) oh and ( b ) d4h symmetry . the pathways through b2 g and eg intermediate states in ( b ) have been omitted for clarity . figure 4 presents the 1s2p rixs plane of ferrous cyt c. figure 4 ( a ) shows the full rixs plane as measured , while in ( b ) the rising edge has been subtracted . the pre - edge peak structure contains mainly one broad intensity region at the l3 - and l2 - like energies , with an intense tail to higher energies . this tail however is weaker in intensity compared to the ferrous model rixs plane ( figure 2 ( b ) ) . in ( c ) we compare the cee cuts of ferrous cyt c with that of the fe ( ii ) tpp ( imh ) 2 complex . both have very similar pre - edge intensities and peak widths , as well as additional intensity at 7115.3 ev , likely due to back - bonding . however , ferrous cyt c shows a steeper rising edge , which overlays the * region . both curves merge at higher energies , reflecting the common spin and valence state ( see figure s4 in the supporting information ) . a direct comparison of the cie cuts for the fe ( ii ) tpp ( imh ) 2 and ferrous cyt c , is presented in ( d ) . two characteristic changes in spectral features are visible : fe ( ii ) cyt c has lower intensity in the shoulder at 710 ev , but higher intensity in the l2 relative to the l3 - edge . ferrous cyt c : ( a ) full 1s2p rixs plane , ( b ) rising - edge subtracted 1s2p rixs plane , ( c ) comparison of the cee cut through the uncorrected plane ( red line in ( a ) ) with the cee cut of fe ( ii ) tpp ( imh ) 2 , ( d ) comparison of the cie cut along the red line in ( b ) with the cie cut of fe ( ii ) tpp ( imh ) 2 . for quantitative analysis , the experimental data have been simulated using charge - transfer multiplet calculations within the vbci framework . ( see supporting information ) the best fit to fe ( ii ) tpp ( imh ) 2 is shown in figure 5 : ( a ) k - edge and k - edge - like cee cut , ( b ) the 1s2p rixs plane , and ( c ) the l - edge and l - edge - like cie cut . the simulations reproduce the experimental results well for all three experimental methods . in line with the experiment , the simulated 1s2p rixs cut is broader than the l - edge xas simulation . the peak in the l - edge xas simulation at 710 ev is reduced to a shoulder in the rixs cut , and the ratio of the l3 / l2 - peak maxima is lower in the 1s2p rixs cut . the projection of the vbci ground state gives 70.4 % dx y , 77.2 % dz metal , and 8.1 % d * back - bonding character ( table 1 ) . fe ( iii ) tpp ( imh ) 2 simulations : ( a ) comparison of the cee cut along the red line in ( b ) with the simulated k - edge , ( b ) 1s2p rixs plane simulation , ( c ) comparison of the cie cut along the vertical red line in ( b ) with the direct l - edge simulation . from the group theory considerations in figure 3 ( b ) , b2u final states are forbidden in direct l - edge xas . in addition , final states with eu symmetry can be reached through the z and x y intermediate states that are split in energy due to the tetragonal geometry . thus , the eu final states are also split in energy by the crystal field splitting of the d orbitals . to identify all contributions to the 1s2p rixs plane , we separate the excitations into their individual pathways as shown in figure 6 ( b e ) . since intermediate states of different symmetries do not interfere , the full rixs plane is given by a summation of all four pathways , which are compared to the l - edge xas spectral splittings in figure 6 ( a ) . comparison of the final state l - edge xas simulation ( a ) , and the four 1s2p rixs pathways carrying most intensity ( b e ) . pathways through the intermediate state with b2 g and eg are omitted for clarity . notes ( met ) distance constrained at 2.29 ( fe ( ii ) ) and 2.33 ( fe ( iii ) ) , while the truncated model is fully optimized , and that the dz metal d - character includes the influence of both axial ligands . the eu final states contribute at energies above and below the main peak with the excitation through the z ( a1 g ) orbital being lower in energy than through the x y ( b1 g ) orbital , reflecting the ligand field energy splitting of these orbitals with the z being lower in energy . the 1s2p rixs final state splitting however is significantly larger than the ground state energy splitting ( 1.1 ev as compared to 0.4 ev , respectively ) , which results from the strong 2p3d repulsive interaction . the eu core - hole final state has mainly px , py character ( pz is mixed into the wave function through 2p spinorbit coupling ) , which have a lower spatial overlap with the z than with the x y orbital , leading to the increased energy splitting . this is a characteristic of 1s2p rixs , which is inaccessible through l - edge xas due to the large differences in the electric dipole matrix elements for absorption . in direct l - edgexas , the transition matrix element px , y dx y is four times stronger than px , y dz , leading to an intensity distribution mainly at higher energies ( figure 6 ( a ) ) . both the b2u and a2u core - hole final states ( figure 3 ( b ) ) have mainly pz character , which now has stronger spatial overlap with the z orbital . thus , the crystal field and 2p core - hole repulsion influences on the energy oppose each other with the core - hole being dominant , which inverts the excitation energy order relative to the eu states . for ferrous cyt c , simulations of the k - edge , 1s2p rixs , and cie cut comparisons are shown in figure 7 . all relative changes are reproduced , however they are less pronounced than in the experiment . both k - edge simulations have equal peak widths , in line with the experimental result . the cie cuts along the red line in the 1s2p rixs plane in figure 7 ( c ) show slightly higher intensity in the shoulder at 710 ev for the model complex , while the l2 intensity is higher for the ferrous cyt c simulation . ferrous cyt c simulations : ( a ) comparison of the cee cut along the red line in ( b ) with the cee cut of the model complex simulation , ( b ) 1s2p rixs plane simulation , ( c ) comparison of the cie cut along the vertical red line in ( b ) with the cie cut of the model complex simulation . in order to reproduce these spectral differences , the covalent mixing of the dz orbital must be increased in cyt c ( see table s1 ) . this leads to a projection of the vbci ground state of 73.4 % dx y , 70.4 % dz metal , and 7.1 % d * back - bonding character ( table 1 ) . thus , in going from fe ( ii ) tpp ( imh ) 2 to fe ( ii ) cyt c , the dz metal character decreases , while the dx y increases and the back - bonding character slightly decreases due to the normalized wave function . figure 8 presents the experimental results of fe ( iii ) tpp ( imh ) 2 plotted as for the ferrous complexes : figure 8 ( a ) shows the full 1s2p rixs plane , while figure 8 ( b ) is the rising - edge subtracted plane . as a clear difference relative to the ferrous results , a well separated feature is visible at 7111.2 ev incident energy and 706 ev energy transfer in the l3 - edge - like region ( 7111.2 / 718.6 ev in the l2 - edge - like region ) . the high intensity feature around 7112.9 / 708.1 ev ( 7112.9 / 720.6 ev ) is similar to the low - spin ferrous case . figure 8 ( c ) gives a comparison of the direct k - edge xas to the cee cut along the diagonal red line in figure 8 ( a ) . in k - edge xas , the low energy peak at 7111.2 ev appears as a weak shoulder , while two peaks are well resolved in the cee cut . this is an intrinsic advantage of the two - dimensional plane as given by 1s2p rixs and not due to experimental resolution , since the cie integrated rixs plane ( which represents the k - edge ) overlays with the direct k - edge spectrum ( see figure s5 ) . fe ( iii ) tpp ( imh ) 2 : ( a ) full 1s2p rixs plane , ( b ) rising - edge subtracted 1s2p rixs plane , ( c ) comparison of the cee cut through the uncorrected plane ( red line in ( a ) ) with the direct k - edge , ( d ) comparison of the cie cuts along the green and red lines in ( b ) with the direct l - edge experimental data . one of the main advantages of 1s2p rixs is the ability to select a specific incident energy ( i.e. , a specific k - pre - edge transition ) and record the corresponding l - edge - like spectrum associated with this pre - edge peak . when exciting with 7111.2 ev incident energy , the low lying d hole ( in the ferric d configuration ) is probed , while exciting at an incident energy of 7112.7 probes d character in the l - edge - like spectrum . note that due to the weak 1s3d interaction , little mixing occurs and pre - edge peak interpretation in terms of specific d orbital excitations is reasonable , which is not the case for 2p l - edge final states . in figure 8 ( d ) , the direct l - edge xas data are compared to two cie cuts taken through the two features in the rising - edge subtracted rixs plane ( figure 8 ( b ) ) along the green and red lines at 7111.2 ( ) and 7112.9 ev ( character ) , respectively . while the low energy cut aligns well with the lowest energy l - edge xas feature , the higher energy cut has its maximum at a lower transfer energy than the main peak of the l - edge xas spectrum , similar to what was observed above for the ferrous tpp ( imh ) 2 complex . figure 9 ( a ) and ( b ) presents the 1s2p rixs results for ferric cyt c , figure 9 ( a ) gives the full 1s2p rixs plane , while figure 9 ( b ) is the rising - edge subtracted plane . three main differences relative to the ferric tpp ( imh ) 2 model complex rixs data ( figure 8 ) are observed : ( 1 ) the feature at 7111.1 ev incident energy is weaker for the protein ; ( 2 ) the strong feature around 7112.6 ev is shifted down in incident energy by 0.3 ev toward the region ; and ( 3 ) the l2 - like region at 7112.6 / 720.3 ev is higher in intensity relative to the l3 - like region . ferric cyt c : ( a ) full 1s2p rixs plane , ( b ) rising - edge subtracted 1s2p rixs plane , ( c ) comparison of the cee cut through the uncorrected plane ( red line in ( a ) ) with the cee cut of fe ( iii ) tpp ( imh ) 2 , ( d ) comparison of the cie cuts along the green and red lines in ( b ) with the corresponding cie cuts of the ferric model complex . the first two points are also visible in figure 9 ( c ) where the two cee cuts of fe ( iii ) cyt c and tpp ( imh ) 2 are compared . the low energy peak is slightly less intense and the main peak is shifted to lower incident energy . in figure 9 ( d ) , the l - edge - like cuts through the cyt c rixs plane ( solid lines ) are compared to the corresponding cuts through the ferric fe ( iii ) tpp ( imh ) 2 rixs plane ( dashed lines ) . comparing the two cie spectra associated with excitation ( cuts along the green lines in figures 8 and 9 ( b ) ) , three observations can be made : ( 1 ) the peak position of the low energy feature is the same at 706 ev ; ( 2 ) the protein peak is slightly lower in intensity ; and ( 3 ) the shoulder at 708.2 ev is higher in intensity . cie cuts associated with excitation ( cuts along the red lines in figures 8 and 9 ( b ) ) ) reveal two distinct differences : ( 1 ) the fe ( iii ) cyt c cie spectrum is shifted toward lower energies by 0.3 ev at both the l3 - and l2 - edge ; ( 2 ) the l3 / l2 peak intensity ratio is lower for fe ( iii ) cyt c. note that the lower l3 / l2 peak intensity ratio was also found for the fe ( ii ) complexes , while the shift to lower energy of the excitation decay spectrum is only observed in the ferric complex comparison . in parallel to the ferrous case , charge - transfer multiplet calculations within the vbci framework were performed to simulate the above fe ( iii ) experimental data . fock derived values in the initial and to 60 % in the final states due to covalency effects . the difference in ground and final states reduction originates from the effect of the mixing parameters on the electron distribution in the vbci model with and without a 2p core - hole that are thus corrected using the slaterfigure 10 gives the best fits to fe ( iii ) tpp ( imh ) 2 spectra : ( a ) the k - edge and k - edge - like cee cut , ( b ) the 1s2p rixs plane , and ( c ) the l - edge and l - edge - like cie cut . the simulations reproduce the experimental results ( see figure 8 ) for all three methods . the cee cut along the diagonal red line in figure 10 ( b ) ( see figure 10 ( a ) ) shows a higher intensity for the d peak at 7111.2 ev compared to the direct k - edge simulation due to the higher intrinsic resolution of the two - dimensional rixs plane . the d peak at 7113.2 ev appears at 0.3 ev higher energy in the cee cut than the direct k - edge simulation , in line with the experimental result in figure 9 . fe ( iii ) tpp ( imh ) 2 simulations : ( a ) comparison of the cee cut along the red diagonal line in ( b ) with the simulated k - edge , ( b ) 1s2p rixs plane simulation , ( c ) comparison of the cie cuts along the green and red vertical lines in ( b ) with the direct l - edge simulation . the direct l - edge simulation shown in figure 10 ( c ) reproduces the experimental l - edge , but underestimates the intensity of the lower energy peak at 706 ev . the d and d cie cuts ( green and red vertical lines in figure 10 ( b ) , respectively ) follow the experimental results , with the d intensity being slightly overestimated , while the peak width , shape , and energy splitting match the experimental results . the main cie peak at 708.2 ev appears 1 ev lower in energy than the l3 - edge peak , similar to the behavior experimentally observed for fe ( ii ) tpp ( imh ) 2 above and in ferric complexes . a doc quantitative analysis of the vbci ground state reveals 69 % dx y , 67 % dz , 75 % d metal character , and 3 % d * back - bonding into the porphyrin . in figure 11 , best fit simulations of ferric cyt c data are compared to the above simulation results for fe ( iii ) tpp ( imh ) 2 : ( a ) a comparison of the cee cut of ferric cyt c ( along the diagonal red line in figure 11 ( b ) ) with the cee cut of fe ( iii ) tpp ( imh ) 2 ( along the diagonal red line in figure 10 ( b ) ) , ( b ) the 1s2p rixs plane , and ( c ) a comparison of the cie cuts at lowest energy through the d regions ( along the green vertical lines in figures 11 and 10 ( b ) ) , and the cuts at higher energies through the d regions ( along the red vertical lines in figures 11 and 10 ( b ) ) . ferric cyt c simulations : ( a ) comparison of the cee cut along the red diagonal line in ( b ) with the cee cut of the model complex simulation , ( b ) 1s2p rixs plane simulation , ( c ) comparison of the cie cuts along the green and red vertical lines in ( b ) with the cie cuts of the model complex simulation . the cee cuts of the simulated rixs planes for both complexes reproduce the experimental spectral changes well : the intensity of the d peak at 7111.2 ev is decreased for cyt c , while the energy difference between the d and the d peak at 7113.0 ev is 0.2 ev smaller in the ferric cyt c simulations , in line with the experimental results in figure 9 . in the l - edge - like cie cuts through the simulated rixs planes of fe ( iii ) tpp ( imh ) 2 and ferric cyt c ( figure 11 ( c ) ) , three main changes in the spectral shapeare observed : ( 1 ) a slight decrease of the low energy fe ( iii ) cyt c peak intensity at 706 ev with an increase in intensity in the shoulder at 708.2 ev in the cie cut after excitation ( green curves ) ; ( 2 ) a shift by 0.3 ev toward lower energy for the cie cuts after excitation for ferric cyt c ( red curves ) ; and ( 3 ) an increase of the l2 - like intensity . all of these characteristic changes are also observed in the cie cuts through the experimental rixs planes ( figure 9 ( d ) ) . similar to the ferrous case , these changes required an increase in the covalent mixing of the z orbital for ferric cyt c relative to fe ( iii ) tpp ( imh ) 2 , together with a lower crystal field ( 10dq ) and an increased covalent d mixing . this leads to a projection analysis of the vbci ground state doc of 69 % dx y , 64 % dz , 73 % d metal , and 3 % d * back - bonding character in the porphyrin . thus , in going from ferric fetpp ( imh ) 2 to cyt c , the dz and d metal character decrease with the increase of the covalent mixing . as a consequence , the dx y character increases and the back - bonding character slightly decreases due to the normalized wave function . as described above , vbci multiplet calculations reproduce all observed spectroscopic changes in the 1s2p rixs planes when going from both the ferrous and ferric fetpp ( imh ) 2 model complex to cyt c. both the ferrous and ferric complexes require an increase in the covalent a1 g mixing for cyt c resulting in lower dz character ( i.e. , increased covalency ) , while for the d hole present in the ferric case , the eg mixing increases for fe ( iii ) cyt c , leading to a decrease in d character . while vbci simulations are able to reproduce the experimental results due to the full multiplet treatment including the 1s and 2p core - holes , they are unable to distinguish between the two axial ligands and the specific contributions from the porphyrin , as all contribute to the a1 g ( dz ) mixing . dft calculations were performed to obtain a more detailed description of the ground state . the fes ( met ) distance in cyt c was constrained to the crystal structure values of 2.29 ( fe ( ii ) and 2.33 ( fe ( iii ) ) since a fully optimized structure leads to an overestimated fehowever , also the fully optimized structure find a shorter fe ( ii ) - s axial bond length , in - line with the experimental multishell exafs finding and previous dft results . the resulting dft derived charge densities ( orbital differentiated metal d - characters ) are equivalent to the vbci derived doc values and are used to couple the experimental results to the dft calculations . the results for the ferrous calculations are shown in table 1 ( top ) for three functionals : bp86 , bp86 + 10 % hartreefock ( hf ) , and bp86 + 20 % hf ( in the following labeled as b ( xxhf ) p86 ) . all three functionals find unchanged dx y metal d - character in ferrous cyt c compared to fe ( ii ) tpp ( imh ) 2 and a small , reproducible decrease in dz character . these results parallel the vbci simulations of the data , where an increase in a1 g mixing leads to a decrease in dz character . the associated change in dx y and * back - bonding in the vbci simulationsa collection of the various ligand characters for dz binding as derived from a fragment analysis of the dft results is given in table 2 ( top ) . the decrease in dz character is accompanied by a decrease in porphyrin character and an increase in axial ligand character . this is mainly due to the exchange of an imidazole by a thioether , resulting in the ruffling of the porphyrin ( the removing of the cross - links do not significantly contribute to the ruffling and a decrease in the fethe results of the dft calculations for the ferric complexes for all three functionals are given in table 1 ( bottom ) . while both the dx y and * back - bonding covalencies do not change between ferric cyt c and fe ( iii ) tpp ( imh ) 2 , a decrease in dz2 metal character is found , similar to the ferrous case . the d hole that is present in the ferric complexes also shows a decrease in metal character for all functionals as found in the vbci simulations of the 1s2p rixs data . the fragment analysis ( table 2 ( bottom ) ) qualitatively gives the same ligand bonding behavior for the dz orbital in the ferric as in the ferrous case : a decrease in dz and porphyrin ligand character is compensated by an increase in axial ligand character due to the exchange of an imidazole with the more covalent thioether ligand . the d bonding is dominating between the d hole and the filled porphyrin 3eg orbital , where the decrease in metal d character reflects an increase in 3eg that is caused by the ruffling of the porphyrin ring upon the imidazole / thioether exchange . the imidazole bonding character in the d * hole is small and unchanged between the fe ( iii ) tpp ( imh ) 2 and fe ( iii ) cyt c and there is no met contribution present in the * hole in ferric cyt c. truncated models with only the fe - porphyrin ring and two axial ligands ( bis - his and his - met ) were geometry optimized and compared to the results of the larger calculations . the last column in table 2 gives the results on the truncated models for 20 % hf . importantly , the fe covalencies and fragment analyses of the small molecule models quantitatively reproduce those of the large molecule models that contain the propionates and thioether linkages using the same functional and basis set . the small molecule models are thus used below to quantitatively evaluate the thermodynamics of axial ligand metal bonding . in this section , axialligand bond strengths are calculated for both n ( his ) and s ( met ) axial ligands in both fe ( ii ) and fe ( iii ) oxidation states . the bond strength is taken as the difference in energy between the ligand - on and ligand - off forms . calculations do not include dispersion corrections ; however , this should mainly affect the absolute binding energies and not the relative bond strengths . a range of functionals and hybrids was evaluated to best reproduce the proper spin ground state for ligand - on and ligand - off forms for both redox states . the calculated axial ligand bond strengths for s ( met ) and n ( his ) in both fe ( ii ) and fe ( iii ) oxidation states are given in table 3 . the axial ligand fe ( ii ) - s ( met ) bond strength is calculated to be 5.0 kcal / mol ( e ) , while the fe ( ii ) - n ( his ) bond strength is 9.9 kcal / mol ; the axial ligand fe ( iii ) - s ( met ) bond strength is 7.1 kcal / mol , while the fe ( iii ) - n ( his ) bond strength is 16.9 kcal / mol . n ( his ) in both fe oxidation states . interestingly , from the above 1s2p rixs data and the differential orbital covalency , the fefurthermore , the fe ( iii ) - s ( met ) bond is stronger than the fe ( ii ) - s ( met ) bond ( e = 7.1 vs 5.0 kcal / mol , respectively ) . this is consistent with the higher s ( met ) character for fe ( iii ) cyt c from the rixs data / simulations and dft calculations presented above . however , this observation is not consistent with the literature considerations summarized in the introduction . lastly , the difference in fe ( iii ) and fe ( ii ) bond strengths is larger for a n ( his ) axial ligand than for s ( met ) ( table 3 , e = 7.0 vs 2.1 kcal / mol , respectively ; note the g for h2o is also given in table 3 and is referred to in the discussion ) . the stronger bonds to the fe ( iii ) states are generally consistent with this higher degree of covalency than in the corresponding fe ( ii ) states . all energies are in kcal / mol . 6 - 311 + g ( d , p ) basis set for all atoms and pcm corrections ( = 4.0 ) . experimental values corrected for the calculated g of h2o dissociation from fe ( iii ) ( i.e. , 8.1 kcal / mol ) the highly covalent environment in fe porphyrin complexes do not allow for most methods to quantitatively determine the local electronic structure . fe l - edge xas using soft x - rays is a powerful tool to determine the metal d - characters for all orbitals ( i.e. , the doc ) including the ability to separately determine the and donation and back - bonding . the soft x - ray nature of fe l - edge xas leads to a low lifetime broadening and a feature rich spectrum , but requires ultrahigh vacuum conditions and generally involves the detection of electrons within a few of the surface of the sample . the sampling depth can be enlarged to a few micrometers by detecting the fluorescence decay ; however , this can lead to significant self - absorption effects . hard x - rays do not have these restrictions , but give lower resolution spectra due to the short lifetime of the 1s core - hole as observed in fe k - edges .1 s2p rixs combines the advantages of both methods , leading to two - dimensional high resolution spectra for samples in a variety of environments . the same information regarding the doc can be extracted from 1s2p rixs with the advantage of accessing l - edge xas forbidden final states . in complexes with tetragonal symmetry like fetpp ( imh ) 2 , where both l - edge xas and 1s2p rixs have been obtained , the broadening of the l - edge - like ( cie ) rixs cut associated with excitation is further enlarged due to the contribution from the dx y dz orbital energy splitting , while this equatorial vs axial splitting is not accessible in direct l - edge xas due to the dipole selection rule and strong multiplet effects . to access the electronic structure of the heme center in cyt c in its ferrous and ferric form , only 1s2p rixs experiments could be performed ; these were compared to the results from corresponding ferrous and ferric fetpp ( imh ) 2 model complexes . in the ferrous case , two characteristic spectral changes were observed for ferrous cyt c relative to the ferrous bis - imidazole model : a decrease in intensity of the high energy shoulder of the l3 - like peak and an increase of relative intensity of the l2 - like peak in the cie cut associated with excitation ( figure 4 ) . note that these spectral changes can only be quantified by including the whole l - edge - like energy range ; often , only the l3 - like energy region is taken into account , which would not have been sufficient for a unique identification of this increase in z covalency . in the ferric complexes , two cie cuts are required and their comparison between the ferric bis - imidazole model and ferric cyt c defines four characteristic spectral variations : ( i ) the l2 - like relative intensity increases for ferric cyt c in the cie rixs cut associated with excitation , similar to the ferrous case ; ( ii ) the energy positions of the l3 - and l2 - like peaks in the cut are shifted toward lower energies , which is different from the ferrous result ; ( iii ) the main peaks in the cie cut associated with excitation appear at the same energy , but with weaker intensity for ferric cyt c ; and ( iv ) the intensity of the shoulder of the main peak in the cut increases ( figure 8 ) . an increase of z covalency reproduces the increase in l2 - like intensity , parallel to the ferrous case . the shift toward lower energy of the cie cut is due to a decrease of the crystal field strength , 10dq , together with an increase of covalency , reproducing the other three observations . from dft calculations correlated to these data , the increase of z covalency is due to the axial ligand change from imidazole to methionine , as methionine has a stronger donation than imidazole . the increase of covalency is due to the porphyrin ring , which is ruffled due to this ligand exchange , rather than a donation interaction with the methionine ligand . finally , from the quantitative doc s obtained from the vbci fit to the 1s2p rixs data , the axial methionine covalent interaction is found to be larger in ferric than in ferrous cyt c. the experimental rixs data and simulations have indicated that the fehowever , the calculated axial ligand bond strengths in table 3 indicated that the fewithin the framework of perturbation theory , the bond energy ( be ) is proportional to ( hm l ) / , where hml is the resonance integral between the metal and the ligand orbitals and is the difference in energy between these interacting orbitals before bonding . the covalency ( i.e. , the coefficient squared of ligand character in the metal d - orbital , ) is proportional to ( ( hm l ) / ) . thus , the be can be estimated from the covalency scaled by ( i.e. , be = ) . s ( met ) , despite their lower covalencies , can be understood in terms of the difference in their valence donor orbital energies , where the imh donor bond is 1.1 ev lower in energy than the met b1 valence donor orbital . this results in a significantly larger for n ( his ) and thus a stronger mit was found above that the fe ( iii ) - s ( met ) bond is stronger than the fe ( ii ) - s ( met ) bond ( 7.1 vs 5.0 kcal / mol , respectively , table 3 ) . the energy of the axial ligand bond was calculated as the difference in energy between the ligand - on ( s = 1/2 and s = 0 for fe ( iii ) and fe ( ii ) , respectively ) and ligand - off ground states ( s = 3/2 quantum mixed and s = 2 for fe ( iii ) and fe ( ii ) , respectively ) . thus , there can be additional contributions to the calculated bond strengths due to the different spin states involved in ligand loss . these can be taken into account using the potential energy surfaces ( pess ) of ligand binding to the fe ( iii ) and fe ( ii ) states . figure 12 gives the pess for met ligand loss for the ferrous state in the gas phase leading to an s = 0 to s = 2 surface crossing . the gas - phase axial s ( met ) ligand bond strength is 5.6 kcal / mol . note that energies for the corresponding two - box calculations ( i.e. , the prophyrin and axial ligand are calculated separately ) are given in parentheses ( e.g. , 5.8 kcal / mol for the fe ( ii ) - s ( met ) bond strength ) . the energy of ligand loss on the s = 0 surface is calculated to be 12.3 kcal / mol ( figure 12 , right ) . the difference in energy for these two processes of ligand loss is the exchange stabilization energy corresponding to a change in fe ( ii ) spin - state ( i.e. , s = 0 s = 2 ) and is calculated to be 6.2 kcal / mol ( figure 12 ) . ( note that the exchange stabilization energy is taken to be the difference in energy between the s = 0 and s = 2 spin states without an additional axial ligand in order to directly compare to fe ( iii ) case below . ) thus , this exchange stabilization lowers the calculated value for the axial ligand bond strength . analogous calculations for axial ligand loss from the fe ( iii ) - porphyrin site give gas - phase axial ligand bond strengths of 8.1 kcal / mol ( for the s = 1/2 s = 3/2 conversion ) and 17.8 kcal / mol ( for ligand loss along the s = 1/2 surface ) and an exchange stabilization energy of 9.7 kcal / mol . thus , even after correcting the fe ( iii ) and fe ( ii ) axial ligand bond strengths for the different exchange stabilization energies ( 9.7 vs 6.2 kcal / mol , respectively ) , the axial ligand bond in the fe ( iii ) site is still stronger than that for the fe ( ii ) ( 8.1 vs 5.6 kcal / mol , respectively ) . without exchange stabilization , the difference between the fe ( iii ) and fe ( ii ) bond strengths is even larger ( 17.8 vs 12.3 kcal / mol ) . the fact that the fe ( iii ) - s ( met ) bond is stronger than fe ( ii ) - s ( met ) is consistent with the higher degree of covalency , as determined above via the 1s2p rixs data and simulations . dft calculated gas - phase potential energy surfaces of s ( met ) binding to both fe ( ii ) s = 0 ( black line and crosses ) and s = 2 ( red dashed line and crosses ) spin - states . energetics are calculated from the ligand - off form either with the porphyrin and methionine in the same calculation or porphyrin and methionine in separate calculations ( in parentheses ) . values for fe ( iii ) s = 1/2 and s = 3/2 are given in the text . as outlined in the introduction , past considerations have concluded that , in cyt c , the fe ( ii ) - s ( met ) bond is stronger than the fe ( iii ) - s ( met ) bond . one argument for this is the shorter fe ( ii ) - s ( met ) bond ( 2.29 ) relative to fe ( iii ) - s ( met ) ( 2.33 ) bond . however , the bond lengths are not necessarily related to bond strengths , as these are affected differently by the ionic and covalent contributions to bonding . furthermore , for considerations related to the decrease in e upon fes ( met ) bond loss , ligand competition and binding , and protein folding studies , it is essential to define and refer to the reference state ( i.e. , s ( met ) bound vs either n ( his ) , n ( lys ) , or h2o axial ligands ) . importantly , from table 3 , the g for axial ligand binding between fe ( iii ) and fe ( ii ) states for s ( met ) , n ( his ) , and h2o axial ligands is 5.1 , 8.8 , and 8.1 kcal / mol , respectively , and is thus larger for the n ( his ) and h2o axial ligands . this difference results in a decrease in e upon loss of the s ( met ) ligand and replacement with either a nitrogen or oxygen based ligand ( estimated to be 160 mv from the g for s ( met ) vs n ( his ) , table 3 ) . this difference in g also leads to an apparent increase in s ( met ) binding affinity to fe ( ii ) relative to fe ( iii ) , as binding to the fe ( iii ) ( but not fe ( ii ) ) state also involves displacement of an axial h2o ligand . the calculated thermodynamics of ligand loss can be compared to experimental data obtained from the dissociation constants of acmet and imidazole measured for n - acetylmicroperoxidase - 8 ( acmp8 , see table 3 ) . the gs of acmet ligand loss from fe ( ii ) and fe ( iii ) acmp8 are 3.6 and 0.6 kcal / mol , respectively . this would give an apparent g of 3.0 kcal / mol , with acmet binding stronger to fe ( ii ) . however , correcting for water binding / displacement from fe ( iii ) and not fe ( ii ) using the calculated g of 8.1 kcal / mol ( table 3 ) gives an adjusted g of 5.1 kcal / mol . this compares well to the calculated value of 5.1 kcal / mol as given in table 3 . the same analysis can be applied to an imidazole axial ligand ; this results in an adjusted g of 8.3 kcal / mol , which compares well to the calculated value of 8.8 kcal / mol . the difference in the g for s ( met ) vs n ( his ) or h2o ligands can be understood through hard / soft acid / base concepts , where the harder nitrogen - and oxygen - based ligands bind more strongly to the fe ( iii ) than fe ( ii ) oxidation state and while the softer sulfur - based ligand still binds more strongly to fe ( iii ) , it has a higher relative ( to n and o based ligands ) affinity for fe ( ii ) . previous studies have defined the function of the axial s ( met ) ligand in t1 cu and cua . the presence of the axial s ( met ) bond lowers e due to the stronger cu ( ii ) - s ( met ) bond relative to cu ( i ) . this difference in e is relative to the absence of axial ligand binding upon s ( met ) ligand loss . a similar function is found here for cyt c , as the fe ( iii ) - s ( met ) bond is indeed stronger than fe ( ii ) ; however , decreases in e are observed upon ligand loss in cyt c due to its replacement by an endogenous ( n ( his ) or n ( lys ) ) or exogenous ligand ( h2o ) . these ligands have larger gs for fe ( iii ) vs fe ( ii ) binding and thus effectively lower e relative to the s ( met ) . thus , the s ( met ) bond would be subject to ligand loss due to entropic contributions at physiological temperature . this has provided insight into the entatic / rack nature of t1 cu and cua et active sites . similar behavior is found here for cyt c , as the axial ligand bond strengths for both fe ( ii ) and fe ( iii ) are weak ( i.e. , 5 kcal / mol ) and on the order of the ts free energy of bond loss . thus , analogous to t1 cu , the protein matrix of cyt c provides the opposing free energy necessary to keep the axial s ( met ) bond intact . the weaker fe ( ii ) - s ( met ) bond as compared to the fe ( iii ) - s ( met ) bond is also consistent with the observed axial ligand photolysis for fe ( ii ) but not fe ( iii ) cyt c. differentiating bond strength contributions to the photochemistry and photophysics in cyt c is an aim of current studies . this study has employed fe 1s2p rixs to investigate the electronic structure of ferrous and ferric cyt c. new insights were obtained by correlating cyt c to a bis - imidazole porphyrin model complex to experimentally define the differential orbital covalency of the iron site in the highly covalent porphyrin environment . n ( his ) as well as a higher degree of covalency for the ferric relative to the ferrous state . dft calculations correlated to data further allowed for the evaluation of the relative axial ligand bond strengths for s ( met ) and n ( his ) in both fe ( ii ) and fe ( iii ) redox states . furthermore , the fe ( iii ) - s ( met ) bond is stronger than the fe ( ii ) - s ( met ) bond , which provides new insight into the redox and photophyscial properties of this protein . finally , both ( met ) s fe bonds are weak and an important role of the protein is in maintaining these bonds under physiological conditions .\noutput:\n" }, { "from": "agent", "value": "axial cu s ( met ) bonds in electron transfer ( et ) active sites are generally found to lower their reduction potentials . an axial s ( met ) bond is also present in cytochrome c ( cyt c ) and is generally thought to increase the reduction potential . the highly covalent nature of the porphyrin environment in heme proteins precludes using many spectroscopic approaches to directly study the fe site to experimentally quantify this bond . alternatively , l - edge x - ray absorption spectroscopy ( xas ) enables one to directly focus on the 3d - orbitals in a highly covalent environment and has previously been successfully applied to porphyrin model complexes . however , this technique can not be extended to metalloproteins in solution . here , we use metal k - edge xas to obtain l - edge like data through 1s2p resonance inelastic x - ray scattering ( rixs ) . it has been applied here to a bis - imidazole porphyrin model complex and cyt c. the rixs data on the model complex are directly correlated to l - edge xas data to develop the complementary nature of these two spectroscopic methods . comparison between the bis - imidazole model complex and cyt c in ferrous and ferric oxidation states show quantitative differences that reflect differences in axial ligand covalency . the data reveal an increased covalency for the s ( met ) relative to n ( his ) axial ligand and a higher degree of covalency for the ferric states relative to the ferrous states . these results are reproduced by dft calculations , which are used to evaluate the thermodynamics of the fe s ( met ) bond and its dependence on redox state . these results provide insight into a number of previous chemical and physical results on cyt c." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: type 2 diabetes mellitus ( t2 dm ) is a complex disease in which both genetic and environmental factors interact in determining impaired - cell insulin secretion and peripheral insulin resistance . t2 dm is also a metabolic disorder between pro- and anti - inflammatory characterized by chronic hyperglycemia and increased or decreased levels of circulating cytokines . the rise in the proinflammatory cytokines ( e.g. , interleukin - ( il - ) 1 , il - 6 , tumor necrosis factor - ( tnf - ) , c - reactive protein ( crp ) , transforming growth factor - ( tgf - ) , and leptin ) or the fall in anti - inflammatory cytokines ( e.g. , interleukin - 1 receptor antagonist ( il - 1ra ) , il - 4 , il - 10 , il - 13 , and adiponectin ) is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury , oxidative stress , and beta cell apoptosis in t2 dm . these pro- and anti - inflammatory cytokines can enhance insulin resistance directly in adipocytes , muscle , and hepatic cells , leading to systemic disruption of insulin sensitivity and impaired glucose homeostasis . many single nucleotide polymorphisms ( snps ) in various genes including those of pro- and anti - inflammatory cytokines have been reported as a risk for t2 dm . butnot all snps have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups . genetic polymorphisms of c - reactive protein ( crp ) and their association with prediabetes and t2 dm have been widely studied . il - 6 was regarded as a kind of pro- and anti - inflammatory factor ; one of the common polymorphisms in the il - 6 gene promoter ( c - 174 g ) was considered as risk factors for t2 dm development . il - 10 is an anti - inflammatory cytokine protecting against t2 dm and inflammation ; several variants in the il - 10 gene promoter region have been identified and showed the association with the development of t2 dm . it is reported that tnf - is a possible mediator of insulin resistance and diabetes since it inhibits insulin signaling and impairs its secretion . one of the snps in tnf - gene showed a twofold increase in transcriptional activity and an association of tnf - snps with t2 dm . genetic variants in some inflammatory factors associated with t2 dm may provide a rationale for further studying their roles as biomarkers for disease early risk prediction and therapeutic targets for t2 dm and related complications . although accumulating evidences support the pathological role of inflammatory cytokines in t2 dm , most studies only focused on a few specific inflammatory factors and were done in relatively small population groups in a particular ethnic group . in our previous studies , we have explored the associations between few several inflammatory cytokines ( e.g. , crp , immunoglobulin e ( ige ) , chymase , and tryptase ) with prediabetes and t2 dm and concluded that ige and crp are risk factors of prediabetes and t2 dm only based on a small sample of cross - sectional study design . in this study , we extend the analysis of the role of pro- and anti - inflammatory cytokines in prediabetes and newly diagnosed t2 dm based on a larger sample of cross - sectional study design , by measuring the levels of several proinflammatory cytokines ( e.g. , ige , hs - crp , il - 6 , tnf - , and tryptase ) and anti - inflammatory cytokines ( e.g. , il - 4 , il - 10 , and forkhead / winged helix transcription factor 3 + ( foxp3 + ) ) in prediabetes and t2 dm , and correlate them with other laboratory and clinical biochemical indicators . our findings will lend support to the hypothesis that some specific inflammatory factors may play an etiological role in the pathogenesis of t2 dm and also will offer new insights into the potential clinical value of these inflammatory factors as biomarkers for disease early risk prediction and therapeutic targets for t2 dm and related complications . the study is part of the diabetes intervention project ( dip ) started in 2012 from school of nursing and medicine , huzhou university , zhejiang , china . from march to december 2012 , a total of 7054 rural residents aged 5075 years from eight rural communities in the city of huzhou participated in physical examination . based on the criteria of fasting plasma glucose ( fpg ) 5.6 mmol / l , 898 ( 12.73 % ) were classified into prediabetes . during july to august 2013 , after excluding subjects with known dm or receiving hypoglycaemic medications or with cardiovascular disease , cerebrovascular disease , malignant disease , chronic liver disease , or kidney failure , or those under medications , 825 cases of 898 prediabetes subjects and another 300 randomized sampling normal glucose subjects were invited for fpg , 2 - hour oral glucose tolerance test ( 2 h ogtt ) , and haemoglobin a1c ( hba1c ) tests as part of the prediabetes and t2 dm screening . but only 560 subjects would participate in this study , according to the following clinical criteria based on fpg , 2 h ogtt , and hba1c test : 219 ( 39.11 % ) had normal glucose tolerance ( ngt ) , 215 ( 38.39 % ) were diagnosed as prediabetes subjects , and 126 ( 22.5 % ) were diagnosed as t2 dm subjects . this study was approved by the huzhou city ethics committee and all subjects gave written , informed consent prior to participating in the study . trained staff interviewed participants using a self - designed questionnaire to obtain information on demographic characteristics and anthropometric and lifestyle variables . physical activity assessments were performed using self - reported total energy expenditure questionnaire ( teeq ) , a nine - step scale where every step was assigned a fixed value in terms of multiple of metabolic energy turnover ( met ) . anthropometric measurements ( body height and weight , waist circumference ( wc ) , hip circumference , and blood pressure ) were attained at the initial screening visit . two sitting blood pressure measurements were taken for each participant using a mercury sphygmomanometer according to a standard protocol . the biochemical parameters , including fpg , 2 h ogtt , hba1c , fasting insulin , plasma total cholesterol ( tc ) , triglyceride ( tg ) , low - density lipoprotein cholesterol ( ldl - c ) , high - density lipoprotein cholesterol ( hdl - c ) , hs - crp , and ige , were measured in the clinical biochemistry unit of huzhou first hospital , a teaching hospital of huzhou university . the cytokine concentrations , including il - 6 , tnf - , tryptase , il - 4 , il - 10 , and foxp3 + , were measured in patients sera using commercially available elisa double antibody sandwich method assays ( r & d systems ) , performed according to the manufacturer 's instructions . diabetes and prediabetes were grouped according to american diabetes association 2010 ( ada 2010 ) criteria or hba1c - based diagnosed criteria . diabetes was classified with a fasting plasma glucose ( fpg ) 7.0 mmol / l or 2 h ogtt 11.1 mmol / l or hba1c 6.5 % , whereas prediabetes was defined as fpg 5.6 and 7.0 mmol / l or 2 h ogtt 7.8 andsubjects were classified as having a normal glucose profile if fpg 5.6 mmol / l and 2 h ogtt 7.8 mmol / l or hba1c 6.0 % . the mean and standard deviation ( mean sd ) of continuous and normal distributional variables and median and quartile range of continuous but skewed distributional variables were used . body mass index ( bmi ) was calculated as weight in kilograms divided by the square of the height in meters ( kg / m ) . waist - to - hip ratio ( whr ) was calculated as waist divided by hip circumference . homeostasis model assessment - insulin resistance ( homa - ir ) was calculated as value of fpg value of fasting insulin / 22.5 and homeostasis model assessment - cell function ( homa - ) was calculated as 20 value of fasting insulin / ( fpg - 3.5 ) . based on china 2006 blood pressure control criteria and china prevention and treatment classification recommendation on dyslipidemia , hypertension was defined as systolic blood pressure ( sbp ) and / or diastolic blood pressure ( dbp ) 140/90 mmhg or as receiving blood pressure lowering medications ; high tg was defined as a fasting plasma tg 1.70 mmol / l , low hdl - c as a fasting hdl - c 0.9 mmol / l , high tc as tc 5.72 mmol / l , and low ldl - c as a fasting ldl - c 3.64 mmol / l . based on china obesity task group recommendation , overweight was classified when a body mass index ( bmi ) 24 kg / m and obesity was classified when a body mass index ( bmi ) 29 kg / m . in analyzing the relationships of inflammatory cytokines to prediabetes ort2 dm , ige was classified as normal / abnormal according to upper quartiles ( p75 = 34.0 iu / l ) ; crp was classified as normal / abnormal according to upper quartiles ( p75 = 1.0 mg / l ) ; tryptase was classified as normal / abnormal according to upper quartiles ( p75 = 1699.94 ng / ml ) and tnf - was classified as normal / abnormal according to upper quartiles ( p75 = 325.14 pg / ml ) ; il - 4 was classified as normal / abnormal according to upper quartiles ( p75 = 323.91 ng / l ) ; il - 10 was classified as normal / abnormal according to upper quartiles ( p75 = 256.22 ng / l ) ; foxp3 + was classified as normal / abnormal according to upper quartiles ( p75 = 411.17 pg / ml ) . one - way analysis of covariance was used to test for differences in continuous distributional variables between three groups . the nonparametric kruskal - wallis test was used to test for differences in continuous but skewed distributional variables between two groups , and test was used to test differences in proportions between three groups . spearman correlation coefficients were calculated to evaluate associations between inflammatory cytokines and the traditional cardiovascular factors . binary logistic regression model was used to estimate the odds ratios ( ors ) and 95 % cis for prediabetes and t2 dm according to dichotomy of inflammatory biomarkers concentration , using the lower values as the referent category . considering the potential confounding factors , we applied 10 models to assess the association between biomarkers and prediabetes or t2 dm , including unadjusted mode , age and sex - adjusted model , multivariable ( age , sex , bmi , whr , sbp , dbp , tc , tg , level of physical activity , dietary intake , alcohol intake , smoking status , presence or absence of family history of diabetes , hypertension , heart disease , stroke , and hypercholesterolemia ) adjusted model , and multivariable combined with inflammatory biomarkers mutually adjusted model . the descriptive characteristics of 560 study participants were presented separately for participants with normal glucose tolerance , prediabetes , and t2 dm ( table 1 ) . a total of 215 were prediabetes , 126 were t2 dm , and 219 were normal glucose subjects . overall , except smoking status , alcohol use , disease family history , physical activity level , and dietary intake , all traditional vascular risk factors were worse in the pdg or the t2dmg patients than ngg subjects . iu / l ) ( p 0.05 ) and with pdg subjects ( 20 iu / l ) ( p 0.05 ) . median levels of crp in pdg subjects ( 0.8 mg / l ) or t2dmg subjects ( 1.5 mg / l ) were significantly higher compared with ngg subjects ( 0.5 mg / l ) ( p 0.05 ) . mean levels of tryptase in pdg subjects ( mean sd : 1545.36291.45 ng / ml ) or t2dmg subjects ( mean sd : 1524.96286.65 ng / ml ) were significantly higher compared with ngg subjects ( mean sd : 1481.21271.44 ng / ml ) ( p 0.05 ) . mean levels of il - 4 in pdg subjects ( mean sd : 303.7056.84 ng / l ) or t2dmg subjects ( mean sd : 304.4555.87 ng / l ) were significantly higher compared with ngg subjects ( mean sd : 283.4552.50 mean levels of il - 10 in pdg subjects ( mean sd : 244.0353.34 ng / l ) or t2dmg subjects ( mean sd : 265.0440.42 ng / l ) were significantly higher compared with ngg subjects ( mean sd : 229.2346.54 but there were no significant differences in il - 6 , tnf - , and foxp3 + ( table 1 ) . spearman correlation analysis between inflammatory cytokines and the traditional cardiovascular factors indicated that whether , in ngg , the pdg , or the t2dmg , there were significant relationships between most of the traditional cardiovascular factors and between most of inflammatory cytokines . however , there were seldom significant relationships between the traditional cardiovascular factors and inflammatory cytokines ( tables 24 ; tables s1s6 ) ( in supplementary material available online at http://dx.doi.org/10.1155/2016/7965317 ) . after adjusting confounding factors by multivariable combined with inflammatory biomarkersmutually adjusted model , plasma ige was associated with t2 dm compared with ngg ( or ( odds ratio ) : 3.46 ( 1.926.23 , 95 % ci ) , p 0.001 ) or compared with pdg ( or : 2.57 ( 1.544.30 , 95 % ci ) , p 0.001 ) ; plasma crp was associated with pdg ( or : 2.30 ( 1.463.62 , 95 % ci ) , p 0.001 ) or t2 dm ( or : 16.24 ( 7.9933.02 , 95 % ci ) , p 0.001 ) compared with ngg or t2 dm ( or : 5.93 ( 3.2910.72 , 95 % ci ) , p 0.001 ) compared with pdg ; serum il - 4 was associated with pdg ( or : 1.68 ( 1.052.69 , 95 % ci ) , p = 0.031 ) or t2 dm ( or : 1.94 ( 1.103.53 , 95 % ci ) , p = 0.023 ) compared with ngg ; serum il - 10 was associated with pdg ( or : 2.13 ( 1.333.41 , 95 % ci ) , p = 0.002 ) or t2 dm ( or : 8.62 ( 4.5016.49 , 95 % ci ) , p 0.001 ) compared with ngg or t2 dm ( or : 3.04 ( 1.795.13 , 95 % ci ) , p 0.001 ) compared with pdg ( table 5 ) . serum tryptase was associated with prediabetes ( or : 1.53 ( 1.012.32 , 95 % ci ) , p = 0.044 ) before adjustment and ( or : 1.63 ( 1.022.61 , 95 % ci ) , p = 0.041 ) after adjustment by multivariable + il - 4 , compared with ngg . serum il - 6 , tnf - , and foxp3 + were not associated with pdg or t2 dm ( table 5 ) . our data showed increased levels of crp , il - 4 , il - 10 , and tryptase in prediabetes subjects and increased levels of crp , il - 4 , and il - 10 in t2 dm subjects compared with normal glucose subjects . not all inflammatory cytokines in our study were in agreement with previous findings . with the associations between inflammatory cytokines ( e.g. , il - 6 , tnf - , and hs - crp ) and insulin resistance , prediabetes or t2most studies found that subjects with insulin resistance , prediabetes , or t2 dm had increased levels of il - 6 , tnf - , and hs - crp . a study reported that high levels of inflammatory cytokines appeared in early stage of t2 dm and were capable of predicting the development of type 2 diabetes through diminishing insulin sensitivity . but a recent study showed decreased levels of il - 6 and tnf - in t2 dm compared to healthy controls . the author in this paper interpreted that this discrepancy could be attributed to duration of the diseases , small sample size , and the differences in age and sex of the studied groups . elevated plasma levels of hs - crp in prediabetes and t2 dm subjects have been demonstrated in this paper ( tables 1 and 5 ) , our previous studies , and other studies . our data showed that mean levels of tnf - or il - 6 in pdg or t2dmg subjects were higher but insignificant compared with ngg subjects ( tables 1 and 5 ) , which could be explained by the differences of some incompletely measured residual confounding factors or inflammation - related diseases ( e.g. , rheumatoid arthritis ( ra ) or osteoarthritis ( oa ) ) or allergies in the studied groups . it also plays a crucial role in the pathophysiology of t2 dm . this current study demonstrated that plasma ige levels strongly correlated with t2 dm ( table 5 ) , which was in agreement with our previous studies . further large population - based prospective studies are warranted to assess the role of ige in t2 dm . il - 4 was major anti - inflammatory cytokine and had been proposed to play a crucial role in the pathophysiology of t2 dm , and several candidate genes have been identified . our data showed that serum il - 4 was associated with pdg or t2 dm ( tables 1 and 5 ) . il - 10 was anti - inflammatory cytokine and has been shown to improve impaired insulin signaling , prevent the development of il - 6 , inhibit nadph oxidase , prevent pancreatic beta cell destruction , and play an important role in modulation of cardiovascular insulin resistance . two studies indicated that low il - 10 level was associated with high hba1c and serum il - 10 level may be one of the predictors of glycemia . increased level of il - 10 in prediabetes and t2 dm subjects in our study was in disagreement with these findings , which could be explained by high levels of inflammatory cytokines appearing in early stage of t2 dm . t regulatory ( treg ) cells are a unique population of t - cells which play a crucial role in the maintenance of self - tolerance and suppression of potentially inflammatory t - cells . chronic low - grade inflammation in obesity and impaired insulin sensitivity has been associated with fewer tregs in adipose tissue . our study did not prove the associations between foxp3 + with the pds or t2 dm ( tables 1 and 5 ) . mast cell tryptase is an important protease that has been implicated in cardiovascular diseases . our previous study did not demonstrate the association between plasma tryptase with prediabetes or t2 dm . but in this paper , our data indicated that tryptase was mildly associated with prediabetes ( or : 1.63 ( 1.022.61 , 95 % ci ) , p = 0.041 ) after adjustment by multivariable + il - 4 , compared with ngg , which could be explained for the synergistic effect of il - 4 . our data also showed that there were significant relationships between most of the traditional cardiovascular factors and between most of inflammatory cytokines . however , there were seldom significant relationships between the traditional cardiovascular factors and inflammatory cytokines ( tables 24 ; tabless1s6 ) , which indicated that complex interactions could exist between these inflammatory cytokines or between cardiovascular factors . results of our study extend other evidences linking inflammatory cytokines to insulin resistance and risk of diabetes based on a larger sample of cross - sectional study design . our findings further lend support to the hypothesis that some specific inflammatory factors may play an important role in the pathogenesis of t2 dm and also offer new insights into the potential clinical value of these inflammatory factors as biomarkers for t2 dm early prediction and treatment . we assessed the associations between few inflammatory cytokines and prediabetes and t2 dm by means of plasma or serum biomarker only based on cross - sectional study design and can not demonstrate that altered plasma or serum levels of inflammatory biomarkers are predictors of incident diabetes by large prospective cohort study . our comprehensive assessment of diabetes risk factors allowed statistical control for important confounding factors in the pathogenesis of diabetes , but residual confounding could remain in the analysis . in particular , we did not consider potential inflammation - related diseases , such as ra or oa , which widely exist in the senior , or allergies which are also very common among individuals , and these unmeasured residual confounding factors might result in discrepancies . in conclusion , circulating inflammatory mediators , hs - crp , ige , il - 4 , il - 10 , and tryptase , were positively associated with prediabetes or t2 dm . further large prospective studies are warranted to assess a temporal relation between baseline levels of inflammatory biomarkers and incidence of prediabetes or t2 dm and its associated chronic diseases .\noutput:\n" }, { "from": "agent", "value": "this study evaluated the inflammatory markers in prediabetes and newly diagnosed type 2 diabetes mellitus ( t2 dm ) . inflammatory markers levels were analyzed using one - way analysis of covariance and the association with prediabetes or t2 dm risks was examined by logistic regression models . our data showed increased levels of hypersensitivity c - reactive protein ( hs - crp ) , interleukin ( il - 4 ) , il - 10 , and tryptase in prediabetes subjects and hs - crp , immunoglobulin e ( ige ) , il - 4 , and il - 10 in t2 dm subjects . we concluded that hs - crp , ige , il - 4 , il - 10 , and tryptase were positively associated with prediabetes or t2 dm . further large prospective studies are warranted to assess a temporal relation between inflammatory biomarkers and incidence of prediabetes or t2 dm and its associated chronic diseases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: back pain can occur due to excessive lordosis and degeneration and may involve vertebral bodies , intervertebral discs , facet joints including all the spinal elements such as flaval ligaments , interspinous ligaments , and posterior vertebral elements . mechanical pressure to the back can cause repetitive strains of the interspinous ligament with subsequent degeneration and collapse of vertebral body . in addition , degeneration of a specific spinal element or a group of elements can result in further degeneration elsewhere in the spine . correct diagnosis and treatment of spinal pain requires a combination of clinical examination and imaging studies . till date , clinical examination and computed tomography ( ct ) or magnetic resonance imaging ( mri ) were the only tools available to the clinician . now , with the wider availability of positron emission tomography ( pet ) systems , fluorodeoxyglucose ( fdg ) serves as a robust marker to track infection and inflammation . pet / ct combination reveals the source of pain so that proper treatment to be selected . the close approximation of adjacent spinous processes with resultant further degeneration and inflammation was named after christian ingerslev baastrup , a danish radiologist ( 18551950 ) in 1933 . a 66 - year - old adult male presented with renal derangement , anemia , and recent onset of moderate to severe back pain . patient was clinically evaluated and underwent mri of lumbar spine . mri of lumbar spine [ figure 1 ] reported t1 - weighted and t2 - weighted hypointense lesions of lumbar vertebrae along with degenerative changes . based on mri findingspatient was referred for a whole body fdg - pet / ct to rule out multiple myeloma . magnetic resonance imaging ( sagittal view ) of lumbar spineshowed ill - defined t1 - weighted and t2 - weighted hypointense lesions in lumbar vertebrae suspicious for marrow infiltrative disease . cord signal appears normal whole body fdg - pet / ct [ figure 2 ] from head to mid - thigh showed abnormal increased fdg uptake in interspinous ligament between l3 - l4 vertebrae and the l3 - l4 spinous processes ( standard uptake value , max 6.2 ) . fdg uptake is appreciated in the apposing surfaces of the spinous processes on transaxial images that show enlargement , flattening , and sclerosis [ figure 3 ] . degenerative changes of spine were noted apart from the mild irregularity of the spinous process of l3 with minimal enhancement of the interspinous ligament at l3 - l4 level raising the possibility of baastrup 's syndrome . there were no other abnormal sites of fdg uptake in spine , other bones , lymph nodes , and organs . whole body flurodeoxyglucose - positron emission tomography / computed tomography images showed abnormal increased flurodeoxyglucose uptake in interspinous ligament between l3 - l4 vertebrae and the l3 - l4 spinous processes ( standard uptake value , ma 6.2 ) . flurodeoxyglucose uptake is appreciated in the apposing surfaces of the spinous processes on transaxial images that show enlargement , flattening , and sclerosis . degenerative changes of spine were noted apart from the mild irregularity of the spinous process of l3 with minimal enhancement of the interspinous ligament at l3 - l4 level raising the possibility of baastrup 's syndrome . there were no other abnormal sites of flurodeoxyglucose uptake in spine , other bones , lymph nodes , and organs . flurodeoxyglucose - positron emission tomography / computed tomography ruled out any flurodeoxyglucose avid marrow involvement ( a ) high - resolution computed tomography images of the lumbar spine illustrating close approximation and contact of spinous processes at l4 - l5 level with sclerosis , flattening , and enlargement of the articulating surfaces ( white arrow ) . ( b ) axial image in the same patient illustrating normal architecture of l2 spinous process ( white arrow ) baastrup 's disease usually affects elderly , over 70 years of age ; commonly involves the lumbar spine , especially at l4 - l5 level . it usually starts as back pain with midline distribution that worsens during extension , is relieved during flexion and is exaggerated on local application of pressure at the affected spinal level . this disease process usually results from excessive lordosis causing mechanical pressure and repetitive strains of the interspinous ligament with subsequent degeneration and collapse . posterior ligaments are the first to be involved ( sprained ) as a result of extreme forward flexion followed by the interspinous ligaments . there may be spur formation and further inflammation of the adventitious bursa which is present in the interspinous space . pain may be related to the impingement of nerves due to the inflammation and edema . in patients with baastrups disease , fdg uptakemay also be related to the development of highly vascularized granulation tissue / inflammation in response to injury at the junction of the interspinous ligament and spinous process ( due to the inherent active metabolism of this region ) . in 10 % of the patients with symptomatic baastrup 's disease , mri reveal lumbar interspinous bursitis , which is depicted as a fluid - like signal located between the pathological adjacent spinous processes . the hallmark of imaging is the close approximation and contact of adjacent spinous processes , with all the subsequent findings including edema , cystic lesions , sclerosis , flattening and enlargement of the articulating surfaces , and bursitis . the interspinous bursa may extend between the ligamentum flavae in the midline forming an epidural cyst and further contributing to the already existing canal stenosis . our patient showed minimal enhancement of the interspinous ligament at l3 - l4 level on the ct part of pet / ct with corresponding focal fdg uptake suggesting local inflammation ; however , there was no evidence of any localized fluid or cystic collection . our patient underwent a 4 - week trial of a nonsteroidal anti - inflammatory medication and stabilization exercises for the lumbar spine and was symptomatically better at 2 month follow - up . baastrup 's disease may occur in association with other degenerative factors such as loss of disc height , spondylolisthesis , and spondylosis with osteophyte formation . however , baastrups disease as a single entity is also reported in the absence of the predisposing degenerative factors . apart from the conservative management with analgesics and nonsteroid anti - inflammatory drugs , the other therapeutic strategies include percutaneous infiltrations with long - acting corticosteroids mixed to local anesthetics or surgical therapies such as excision of the bursa or osteotomy . specifically for the percutaneous infiltrations , imaging guidance ( pet or fluoroscopy ) ensures accurate needle positioning with resultant increase of technical and clinical efficacy and at the same time decrease of potential complications rate . surgery with either partial or total excision of the spinous processes does not always result in pain alleviation . utility of fdg - pet / ct in inflammatory diseases is well known . here is another case illustrating its additional benefits in identifying back pain due to baastrups disease ; a disease due to close approximation of adjacent spinous processes resulting in inflammation of interspinous ligaments and bursa .\noutput:\n" }, { "from": "agent", "value": "baastrup 's disease is a benign condition , which presents as chronic low back pain . it is also known as kissing spine syndrome and refers to close approximation of adjacent spinous processes producing inflammation and back pain . this condition is often misdiagnosed , resulting in incorrect treatment and persistence of symptoms . diagnosis of baastrup 's disease is verified with clinical examination and imaging studies . conventionally , clinicians resort to magnetic resonance imaging ( mri ) of spine rather than x - ray or computed tomography ( ct ) in the evaluation of back pain . mri can additionally identify flattening , sclerosis , enlargement , cystic lesions , and bone edema at the articulating surfaces of the two affected spinous processes . studies have reported that 18fluorine fluorodeoxyglucose - positron emission tomography / ct ( fdg - pet / ct ) can detect a bursitis or an inflammation as a form of stress reaction despite a negative mri and 99mtc methylene diphosphonate ( mdp ) bone scan . pet / ct is usually not a recommended investigation for this condition . however , this case report highlights the benefit of fdg - pet / ct in identifying the site of inflammatory pathology . it is also known to identify the exact site of inflammation where steroid or local anesthetic injection can be administered to alleviate pain , especially in patients with multilevel vertebral involvement ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: understanding the phylogenetic relationships among living organisms is fundamental to any comparative research in biology .1 in the era of phylogenomics , phylogenetic incongruence has been widely documented in phylogeny construction with a large amount of available low - copy genes and is often ascribed to stochastic error , systematic error , and / or biological factors .25 to overcome phylogenetic incongruence , a practical question is how many genes should be used to generate a robust phylogenetic hypothesis .6 this question has been investigated at various taxonomic levels .713 for example , one notable resampling analysis showed that a minimum of 20 concatenated genes were required to provide 95 % bootstrap support for all nodes by compiling a data set from 106 random orthologous genes for seven saccharomyces species and one out - group species .7 in a recent study , among 59 carefully selected low - copy nuclear genes based on single - gene tree performance , fewer than 50 were enough to solve the deep angiosperm phylogeny .13 nevertheless , few studies have investigated the minimum required numbers of selected genes based on single - gene tree performance at the genus level or lower . primulina , one of the largest genera of the old world gesneriaceae , is a monophyletic group comprising more than 140 species widely distributed throughout southern china and adjacent countries in southeast asia , which is a biodiversity hot spot of the world .14,15 nevertheless , interbreeding through artificial experiments can still succeed among many primulina species pairs ,16 suggesting that the genus has undergone recent rapid speciation or population differentiation . although the entire primulina phylogeny is far from resolved to date , a rough genus framework has been presented with sequences of four loci from 104 primulina species ,17 and the phylogeny of 11 representative primulina species has been fully resolved based on 834 putative single - copy nuclear genes identified from transcriptome data .18 the high species richness and endemism , and low interspecific genetic isolation , together with comparative transcriptomic resources , make primulina an ideal model system to study the gene numbers needed to obtain a robust phylogeny . in this study , we conducted resampling analyses by compiling the previously published transcriptome - based single - copy nuclear gene sequences of 11 representative primulina species18 to determine the minimum numbers of both random and selected genes needed to resolve the phylogeny and to provide a baseline for future sampling strategies of gene numbers in molecular phylogenetic studies of speciose taxa . the aligned sequence data for 830 putative single - copy nuclear genes ( supplementary table 1 ) from 11 primulina species18 were used for analysis , while the other four loci were discarded due to poor alignment performance . to test the utility of individual genes , all single - gene trees were constructed with 1,000 bootstrap replicates based on nucleotide sequences , using the maximum - likelihood ( ml ) method implemented in phyml v3 .0.19 primulina swinglei was chosen as out - group according to the primulina phylogeny .17 the nucleotide substitution model was specified as gtr + i + and the branching - swapping method was set to subtree pruning and regrafting . to consider the limitations of the concatenation approach for phylogenetic inference ,20 the average rank of coalescences ( star ) method21 implemented in the species tree analysis web server straw22was conducted based on the 830 single - gene trees to infer the species tree of the 11 primulina species . those genes based on which the topologies of the 11 primulina species were congruent with the species tree were screened as good genes . to visualize the phylogenetic incongruence among different topologies , splitstree v4 .13.123 was used to infer the consensus network from 830 source single - gene trees with a set of threshold values ( 0.01 , 0.05 , 0.1 , 0.15 , 0.2 , and 0.25 ) . different threshold values were set to control the visual complexity of resulting networks by using only the splits that occurred in more than a given proportion of all trees . to investigate the effect of the number of sampled genes or nucleotides on the probability of the inferred species tree , random resampling without replacement from the original 830 - gene ( 631,686 - nucleotide ) data set was performed with a custom java script . the number of sampled genes started from 25 with increments of 25 , until the percentage of correct trees ( see below ) reached 100 . for each sample , 1,000 replicates were generated and the ml gene trees were inferred by raxml v824 with the model gtr + and 100 fast bootstrap replicates . those trees with the same topology as the species tree and all ml bootstrap values larger than a threshold ( 95 % or 75 % ) were counted as correct trees . gene resampling among the selected good genes was also conducted and started from three with increments of one .1 ) showed the same topology as the previously published primulina topology based on concatenated data18 and all bootstrap values were 100 . only 26 of the 830 single - gene trees exhibited the same topology as figure 1 ( supplementary tables 1 and 2 ) and there were 25 topologies supported by more than three genes ( supplementary table 3 ) , indicative of extensive single - tree phylogeny incongruence , which was also strongly supported by the consensus network constructed from 830 source single - gene trees ( fig . network complexity decreased as increasing threshold values and ended up with a topology identical to that shown in figure 1 when the threshold reached 0.25 , in which all boxes were collapsed . among the 11 species , the triplet of primulina fimbrisepala , primulina dryas , and primulina villosissima was the most difficult clade to resolve . of the 830 single - gene trees , 404 ( 48.7 % ) supported the correct sister relationship between p. fimbrisepala and p. villosissima , while those supporting the alternative sister relationship between p. fimbrisepala and p. dryas or between p. dryas and p. villosissima numbered 206 ( 24.8 % ) and 220 ( 26.5 % ) , respectively ( supplementary table 1 ) , suggesting extremely rapid triplet speciation . these results further support the previously published primulina phylogeny18 and highlight the phylogenetic incongruence of the triplet of p. fimbrisepala , p. dryas and p. villosissima . the resolution performance through resampling by gene or site demonstrated that the probability of getting a solid topology steadily increased with the number of genes or sites sampled ( table 1 ) . using 95 % correct trees with a 95 % bootstrap threshold in 1,000 replicates as the criterion , about 175 genes were needed to resolve all 11 species , and about 75 genes were needed when ignoring the triplet complexity . when resampling by nucleotide site , about 70 kb of nucleotides yielded sufficient resolution , equivalent to 92 sampled genes given the average length of 761 bp per gene , and it took about 30 kb ( about 39 genes ) for the other clades except the triplet . nevertheless , when resampling by gene among the 26 selected genes ( supplementary table 2 ) , only 8 genes were needed to resolve all the clades . as expected , all the counts decreased somewhat when using a bootstrap threshold of 75 % rather than 95 % . under a bootstrap threshold of 75 % , 4 selected genes were sufficient for full resolution , while 125 genes were needed if all 830 random genes were used . as proposed previouly ,68,13 the inferred minimum gene number needed to resolve the phylogeny should be related to bootstrap threshold values to determine a correct tree , topological complexity of sampled species , and selection of source gene sets . the differences caused by the two bootstrap threshold values , 95 % and 75 % , were substantial in this study ( tables 1 and 2 ) . similar to our results , another study found that the gene number dropped from 20 to 8 when decreasing the bootstrap threshold value in a set of eight yeast species .7 nevertheless , the stricter criterion with a 95 % threshold will provide a better estimate of the minimum gene number . as expected , the required gene numbers for the primulina phylogeny fell sharply from 175 to 75 when ignoring the most difficult triplet ( table 1 ) . similarly , the suggested gene number of 20 based on the eight yeast species set7 was unnecessary for fewer taxa .6 in fact , it is difficult to judge whether the test species set in this study is representative for other work , especially when focusing on topological complexity characterized by the number of sampled species ( 11 ) and the pairwise inter - species genetic distances ( ks : 0.0270.064 , supplementary table 4 ) . nevertheless , the required gene number of 75 when ignoring the triplet complexity in this study is still unrealistic for routine laboratory work with large - scale species sampling . although unlinked nucleotide sites could provide more efficient phylogenetic performance than genes in terms of better data independence , as shown in this study ( table 1 ) and the previous studies ,7,11 most experimental data in molecular phylogenetics are still in the form of amplified gene fragment sequences . to minimize the effect of hidden paralogs and to identify the most probable orthologs , one optimized sampling strategy is to select genes by checking single - gene trees , rather than to use all available random genes as in most previous studies .13 in this study , we followed such a gene selection method based on single - gene tree performance13 and found that only 8 of 26 selected genes were sufficient to resolve all 11 primulina species , while 175 genes were needed if all 830 random genes were used ( tables 1 and 2 ) . compared with the two factors discussed above , selection of source gene sets has greater effect on the inferred minimum gene number . based on our results , we strongly recommend the gene selection strategies based on single - gene tree performance of a few representative species with known or well - resolved phylogenies , and the subsequent use of the selected genes for phylogenetic reconstruction with larger scale species sampling . supplementary table 1 . list of alignment lengths , proportions of variable sites , single - gene topologies , and function associations of the 830 genes . list of alignment lengths , proportions of variable sites , and function associations of the selected 26 genes . list of the pairwise interspecies divergence ( ks ) values among the 11 primulina species , estimated by ai et al. 18\noutput:\n" }, { "from": "agent", "value": "the question how many genes are needed to resolve phylogenetic incongruence has been investigated at various taxonomic levels , yet few studies have investigated the minimum required numbers of selected genes based on single - gene tree performance at the genus level or lower . we conducted resampling analyses by compiling transcriptome - based single - copy nuclear gene sequences of 11 species of primulina ( gesneriaceae ) to investigate the minimum numbers of both random and selected genes needed to resolve the phylogeny . only 8 of the 26 selected genes were sufficient for full resolution , while 175 genes were needed if all 830 random genes were used . our results provided a baseline for future sampling strategies of gene numbers in molecular phylogenetic studies of speciose taxa . the gene selection strategies based on single - gene tree performance are strongly recommended in phylogenic analyses ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the species richness of flowering plant lineages shows tremendous variation amongst clades , indicating that certain traits influence speciation and / or extinction rates . in plants , many traits have been associated with evolutionarily success , such as self - incompatibility and floral asymmetry . the reasons why certain traits are associated with increased diversification are often intuitive : some traits inherently encourage speciation via increased genetic diversity ( self - incompatibility ) or an association with increased opportunities for the evolution of specialization ( floral asymmetry ) . while geographical distribution might be also influence diversification rates because speciation may accompany the establishment in new ecozones , the effects of geographical area are far from fully understood . on the one hand , increased geographical extent provides more opportunities for allopatric speciation ( i.e. , the geographical potential for speciation ) . if increased geographical extent is simply caused by high dispersal rates , however , gene flow is maintained and hinders speciation . the optimal conditions of dispersal for speciation appear to be met in island systems , where many classic examples of adaptive radiations are found . recent evidence indicates that island - like systems can also be found in mountainous areas , suggesting that mountain peaks also provide the right balance between dispersal and isolation to accelerate speciation , yet these patterns are not as well characterized . one reason why mountain peaks may differ from true island systems is that speciation may occur between lowland and high elevation bands as well as between isolated mountain peaks . in flowering plants , the gene flow between lowland and high elevation bands may decline because pollinators differ along elevation clines , potentially leading to floral isolation . pollinating fauna exhibit geographical heterogeneity and these differences in composition could play a central role in why angiosperms display such extreme diversity in floral colour and morphology . lineages of flowering plants can evolve floral colours and shapes that encourage visits from the most efficient pollinator , a process that leads to the observation of pollination syndromes . while the absolute nature of pollinator syndromes is debatable andthere are numerous examples of exceptions , the bee functional group is attracted to flowers that are white , yellow , and purple , and birds are noted for their preference for red flowers . because beetles and flies also often visit white and yellow flowers and infringe on the bee portion of the spectrum , the red or reddish hues of the colour palette ( including deep oranges , magenta ) may be perceived as catering to a specialized clientele . the selection pressures that are involved in the evolution of specialization are not currently well characterized nor are the downstream consequences of evolutionary transitions between specialization and generalization . for instance , it has been suggested that hummingbirds are more common at high elevations and this may lead to a speciational pollinator shift accompanied by the transition towards reddish flowers at high elevations . while floral colour is a noted cue to the most common pollinator of a given species , there are other reasons why the evolution of floral colour is observed to be a labile trait . research on the genetic architecture of floral colour indicates that drastic colour shifts can occur with a number of single loss - of - function mutations . macroevolutionary analyses that examine trait conservatism versus node - based shifts in floral colour can shed light on ( 1 ) whether any particular floral colour is associated with increased diversification or ( 2 ) whether shifts in floral colour are involved in the speciation process itself . here , we examine these patterns within the genus mimulus , which comprises approximately 120 species , mostly restricted to north america . it has been previously shown that there have been multiple shifts from bee pollination to hummingbird pollination within the genus . with ample sequences and robust species - level phylogeniesattainable for the genus , the time is ripe for macroevolutionary analysis of diversification patterns in mimulus within a biogeographical context . with a well - resolved phylogenetic tree , mimulus presents an ideal system in which to then test whether ( 1 ) transition rates to red / orange / fuschia ( reddish ) flowers are significantly different from the reverse pathway , ( 2 ) reddish flowers are associated with higher elevations , and ( 3 ) reddish flowers are associated with differences in speciation and / or extinction rates in mimulus . we searched the literature and e - floras ( e.g. , california native plant society ( cnps , ) , calflora , encyclopedia of life ( eol ) , and jepson herbarium ) for qualitative assessments of floral colour of all species of mimulus . where these were not available , we scanned online pictures and made our own qualitative assessments of colour . in most cases , it was a very straightforward exercise to discern whether the floral colour was in what we considered reddish ( ro : red , orange , or fuchsia ) or not ( no - ro ) , in other words , possessing both carotenoids and anthocyanins . quantitative assessments of elevation were obtained from e - floras as well , with the admittedly arbitrary cut - off of being restricted to high elevationsimilarly , e - floras were also used for assessments of distribution ( e.g. , calflora , encyclopedia of life ( eol ) , florabase , united states department of agriculture ( usda ) - natural resources conservation service ) . we compiled the available dna sequence markers for mimulus species on the national center for biotechnology information ( ncbi ) genbank website ( http://www.ncbi.nlm.nih.gov/genbank/ ) . our review showed that there are high numbers of species sequenced for 3 markers : ( 1 ) trnl gene and trnl - trnf intergenic spacer ( trnlf ) ; ( 2 ) the internal transcribed spacer region its1 , the 5.8 s coding region and its2 ( its ) ; and ( 3 ) the external transcribed spacer ( ets ) . the trnl - f marker is located in the chloroplast , and ets and its markers are located in the nucleus . these three markers were used for our phylogenetic analyses , which included 94 mimulus species ( table 2 ) . mohavea breviflora was used as an outgroup for all analyses , as in previous molecular work . dna sequences for ets , its , and trnl - f markers were aligned using mesquite version 2.75 with opal package using default settings . analyses were made with combined nuclear markers ( ets and its ) and for all markers ( ets , its , and trnl - f ) . for partitioned analysis of the combined data , nexus files were manually edited for partition setting , in which each dna marker was set as an individual partition . the three dna markers were analyzed both individually and in combination for phylogenetic reconstruction analyses . rapid bootstrap analysis and search for a maximum likelihood ( ml ) tree were performed with randomized axcelerated maximum likelihood ( raxml ) software version 7.4.2 under the general time reversible ( gtr ) substitution model with gamma rate heterogeneity for all individual and combined data sets . mohavea breviflora was used as an outgroup , and the ingroup was assigned to be monophyletic prior to analysis . hasegawa , kishino , and yano ( hky ) model with gamma site heterogeneity was used as the substitution model due to its general reduction of assumptions . we used the node splitting mimulus from the outgroup mohavea as our calibration point for our phylogenetic tree . in order to take calibration uncertainty into account , we used normal distribution as prior to our calibration node with a mean of 76 ma and standard deviation of 1the rest of the node ages were estimated using uncorrelated lognormal relaxed clock model with the mean distribution prior set to gamma . we selected the yule speciation model with uniform distribution as our tree prior . for the markov chain monte carlo ( mcmc ) analyses , the chain length was set to 10,000,000 and we logged parameters every 1,000 generations ( i.e. , at the end of the run , we had 10,000 samples ) . for runs with combined data sets , trees were generated using treeannotator version 1.7.4 ( part of the beast package ) with the first 50 steps discarded at the start of the run . we used the binary - state speciation and extinction ( bisse ) method implemented in the diversitree package of the r statistical software to examine differences in transition rates between character states as well as differences in speciation rates . we used this method to estimate the following parameters : speciation and extinction rates 0 and 0 of nonred lineages and 1 and 1 of red lineages and two transition rates representing the evolution of red flowers ( q01 ) and the backwards transitions of evolving nonred flowers ( q10 ) , and then compute the likelihood of character states at the tips of our phylogenetic tree , given the maximum likelihood values of speciation , extinction and transition rates ( the unconstrained model ) . we then constrain certain parameters to be equal to each other and test alternative models of evolution against the unconstrained model with likelihood ratio tests . we examined the fit of a model with ( 1 ) equal speciation rates ( 1 = 0 ) , one with equal extinction rates ( 1 = 0 ) , one with equal speciation and extinction rates ( 1 = 0 and 1 = 0 ) , and , finally , one with equal transition / migration rates ( q10 = q01 ) . we further formalize ancestral reconstructions in mesquite version 2.75 to characterize the evolutionary history of mimulus . for the second analysis , we performed ml reconstruction with markov k - state 1 model for standard categorical data . mcc tree obtained from the bayesian analysis with combined dna sequence data is used for both ancestral reconstructions . red ( or reddish ) floral colour is denoted as 1 , and all the other floral colours are denoted as 0 in the character matrix . finally , we established whether the origins of floral colour coincided with entry into specific biogeographical origins using reconstruct ancestral state in phylogenies ( rasp ) version 2.1 beta software . three alternative reconstruction methods were used : ( 1 ) statistical dispersal - vicariance analysis , ( 2 ) bayesian binary method , and ( 3 ) dispersal - extinction - cladogenesis model . four discrete states were used for present - day continental geographical distribution : north america , south america , asia , and oceania ( table 2 ) . analyses were conducted on the maximum clade credibility tree generated on beast using combined sequence data , and the results were summarized as tree graphs and pie charts . the geosse functions within diversitree can be used to test differential speciation and extinction within different geographical regions as well as the speciation that might accompany range shifts . we implemented geosse within diversitree to examine whether clades at high - elevation bands experienced greater speciation . the framework is very similar , but the parameters are speciation within low elevation regions ( with range restricted to 1000 m ; sa ) , speciation within high elevation regions ( with range restricted to 1000 m , sb ) , between - region speciation ( sab ) , extinction from low elevation regions ( xa ) , extinction from high elevation regions ( xb ) , dispersal from a to b ( range expansion , da ) , and dispersal from b to a ( db ) . we coded the species in three categories : a = restricted to low elevations , b = restricted to high elevations , and ab = ranges that span low and high elevation . by setting certain constraints we can test for whether speciation , extinction , or range expansion is different between regions . we also examine the variation in the estimates of these rates with markov models . a final analysis , musse , was run to test whether red flowers are correlated with high elevation zones . in the musse analysis , trait combinations use the following notation : 1 : low elevation , no - ro ; 2 : low elevation , ro ; 3 : high elevation , no - ro ; 4 : high elevation , ro . we test whether the evolution of the ro phenotype depends on the background of elevation ( does 12 differ from 34 or 13 from 24 , etc . ) by constraining transition rates ( q12 = q34 , q13 = q24 , q21 = q43 , and q31 = q42 ) and comparing the likelihood of the tip character states on our phylogeny with log - likelihood tests . we provide the compiled traits of mimulus species in table 2 . we were able to obtain high sampling of sequence data for mimulus , covering 94 of the ~ 120 species ( ~ 79 % of the speciesas well , we had unbiased covering of the species in mimulus ; 10.6 % of the species in our phylogeny are ro , identical to the approximately 10.6 % in the genus as a whole that we estimate to be ro ( see table 2 ) . we had two nuclear markers : ets and its with sequence data for 90 and 91 taxa for these markers , respectively . after the alignment of all the taxa , the total length of the ets and its regions analyzed was 477 and 688 bp , respectively . for the chloroplast marker trnl - f , we had sequence data for 85 taxa . once all the taxa were aligned , the analyzed trnl - f region was 1122 bp long . when we align and combine all three markers ( two nuclear and one chloroplast ) together , the resulting matrix contained 2287 characters , comprising 94 taxa excluding the outgroup . ml and bayesian analyses of the individual dna markers resulted in largely congruent topologies for the genus mimulus ( data not shown ) . when we compare individual marker data with the combined sequence data , combined molecular analysis provided higher resolution and more consistent tree topologies . we used partitioned and nonpartitioned combined data for ml analyses , and they both provided the same tree topology with slightly different likelihood values ( data shown only for nonpartitioned analysis ) . overall , for the combined dna sequence data , mcc tree from the bayesian analysis is largely congruent with the ml analysis ( figure 1 ) , with the bayesian tree having higher resolution ( see supplementary figure 1 in the supplementary material available online at http://dx.doi.org/10.1155/2014/382453 , supplementary figure 2 ) . overall , the phylogeny inferred for mimulus is very similar to the previously published phylogenies using alternative sampling and methods . all three biogeographical origin reconstruction methods show strong support ( 93.83 % ) for the north american origin for the genus mimulus ( see supplementary figure 3 for bayesian binary mcmc analysis ) . both ml and bayesian analyses highly supported the clade with oceanic distribution consisting m. prostratus , m. repens , m. uvedaliae , and m. gracilis , with bootstrap value ( bs ) of 100 % and posterior probability ( pp ) of 1.0 . there is high support for the oceania origin for m. prostratus , m. repens , and m. uvedaliae ( pp : 98.53 % ) , but pp values are not decisive with respect to the origin of the whole clade ( 45.58 % : oceania origin , 30.35 % : north america origin ) . highly supported clade consisting of m. tenellus , m. nepalensis , m. szechuanensis , and m. bodinieri is found in both ml and bayesian analyses ( bs : 92 % , pp : 1.0 ) . bayesian binary mcmc analysis of biogeographic origin strongly suggests an asian origin for this clade ( pp : 93.58 % ) . another species with asian distribution , m. sessiflorus , is not clustered with the rest of the asian taxa in either ml or bayesian analysis , and the position of this species is poorly resolved in both trees . m. depressus , m. cupreus , and m. luteus form a strongly supported clade in both ml and bayesian analyses ( bs : 97 % , pp : 1.0 ) . for this clade , a south american origin was suggested by bayesian mcmc analysis of biogeographic origin ( pp : 82.67 % ) . an alternative to a south american origin , the clade might also have originated in the americas ( north and south america together ) , but the pp values are too weak to support this view ( pp : 13.40 % ) . both mp and ml analysis showed that the ancestor of the genus mimulus was unlikely to have reddish flowers . likelihood values for 1 ( reddish ) is 0.02 and for 0 ( not reddish ) is 0.98 . out of 95 mimulus species , 14 of themthere are 2 major clades with ro flowers : m. bifidus , m. flemingii , m. aurantiacus , m. longiflorus , m. puniceus ( ro ) , and m. clevelandii ( not ro ) form one of the red clades , with a potential ro - flowered common ancestor ( 1 : 0.622 , 0 : 0.378 ) . the other clade with a potential ro - flowered ancestor includes the species m. rupestris , m. cardinalis , m. verbenaceus , m. eastwoodiae , and m. nelsonii ( ro ) and m. lewisii , and m. parishii ( not ro ) ( 1 : 0.628 , 0 : 0.372 ) . according to our ancestral reconstruction analysis , all the ro flowered mimulus taxa have appeared later than 20 ma , which is intriguingly consistent with the approximate time for the hummingbird origins in the americas . we find that specialization , measured narrowly as having the trait state of reddish flowers , is not associated with higher speciation rates ( table 1 ; p = 0.196 ) . ( i.e. , the ability to evolve red flowers ) is different from the rate at which a lineage transitions away from reddish flowers ( table 1 ; p = 0.02895 ) ; that is , losing red coloration happens far more frequently than gaining it . finally , we could not find any evidence suggesting that clades with reddish flowers experience differential extinction rates than those without reddish flowers ( p = 0.7996 ) . , we can reject the model of equal speciation and extinction at different elevational bands , concluding that high elevation regions experience increases in diversification ( figure 2 ; p = 0.002 ) . with this being an intriguing , yet somewhat surprising result , we reran the analyses with a small subset of bootstrap trees and found the result to be robust to phylogenetic uncertainty ( p values ranging from 0.002 to 0.0001 , n = 10 ) . including the between - region mode of speciation does not , however , we also find that high elevation lineages experience increased range expansion into lower elevations more so than the reverse ( figure 2 ; p = 0.02 ) . our musse analysis tested whether certain transitions were more common than others ( e.g. , we can test if ro flowers evolve more often in high elevation environments ) , yet we did not find any evidence that these transition rates were unequal ( p = 0.21 ) in such a way that would result in a disproportionate number of ro - flowered species in high elevation locations ( see figure 1 ) . we hypothesized that red flowered lineages might be restricted to high elevation environments as others have posited and that this might contribute to lower speciation rates . surprisingly , we found no indication that red flowered species are more prevalent at high elevation , yet high elevation bands were actually regions of increased speciation . previous studies have also found that diversification rates increase in mountainous regions and our study in mimulus corroborates these findings . finally , the species that originate in high elevation environments show an increased propensity to experience range expansion into low elevation environments , supporting other studies that suggest that the increased diversification of alpine regions provides a species pump for global species richness . floral colour can be considered as a secondary sexual characteristic in flowering plants , somewhat analogous to exaggerated ornaments in animals . because floral colour provides an important cue for pollinators , differences in colour can translate to attracting an increased number of visits from efficient pollinators , which often results in increased pollen transfer and a reduction in the amount of inbreeding . reddish flowers are typically associated with pollination by birds , though this relationship is far from absolute . in mimulus , a primarily north american lineage , while hummingbird pollination is thought to be an extremely efficient means of dispersing pollen and evolving reddish flowers may be an adaptation for bird pollination , we did not find that the evolution or red / orange flowers was associated with increased speciation rates or decreased extinction rates , and the character state appears to be more ephemeral than a non - ro phenotype . also , ro lineages were not restricted to high elevation environments as has been supposed , yet we find that high elevation environments were hotspots for speciation , possibly due to the topographical heterogeneity presented by isolated mountain peaks . potential reasons for the increased transition rates away from the ro phenotype involve scenarios that incorporate the ease at which a mutant can arise and the probability that such a mutation can fix . one scenario that might be included is that the flowers themselves are costly ( red - hued flowers are associated with hummingbird pollination and these flowers might also be large and nectar rich ) , and so the phenotype is only selected in environments where other pollinators ( e.g. , bees ) are scarce . furthermore , there are many nonpollinator agents of selection as well as genetic arguments that may be responsible for this pattern and the ease of transitions away from an ro phenotype is not devoid of empirical evidence . yellow morphs have been observed to be easily established in more than one population of mimulus cardinalis . while transitions from blue to red have been observed to be more common than the reverse , there has been little work done on the transitions between red and yellow flowers ( the most common alternate floral colour in mimulus ) . transitions from pigmented to nonpigmented flowers are thought to be more common than the reverse generally , and the agents of selection may or may not include pollinators . phylogenetic comparisons in ipomoea revealed that transition rates between the two character states were roughly equal but nonpigmented flowers had lower speciation rates . white flowers are potentially an adaptation for moth pollination , yet might also be selectively favoured if the resources for costly pigments can be coopted for other functions . because mimulus includes few nonpigmented ( white ) flowered species , direct comparisons with previous studies are difficult because yellow flowers still contain flavonol pigments . another potential explanation to why transitions to red flowers are rare in mimulus could be that the hummingbird family ( a potential selective agent ) originated about 20 mya , which is relatively recent when compared to the history of mimulus . in other words , the ecological opportunity for adapting to the hummingbird pollination syndrome was not a possible transition for much of the tree space we analyzed in mimulus . further studies on pollination syndromes that examine transition rates ( and speciation rates ) before and after the origins of hummingbirds with direct observations of pollinator visitation rates might be able to refine the role that the origin of a new mutualist has had on north american angiosperm genera .\noutput:\n" }, { "from": "agent", "value": "the vast diversity of floral colours in many flowering plant families , paired with the observation of preferences among pollinators , suggests that floral colour may be involved in the process of speciation in flowering plants . while transitions in floral colour have been examined in numerous genera , we have very little information on the consequences of floral colour transitions to the evolutionary success of a clade . overlaid upon these patterns is the possibility that certain floral colours are more prevalent in certain environments , with the causes of differential diversification being more directly determined by geographical distribution . here we examine transition rates to anthocyanin + carotenoid rich ( red / orange / fuschia ) flowers and examine whether red / orange flowers are associated with differences in speciation and / or extinction rates in mimulus . because it has been suggested that reddish flowers are more prevalent at high elevation , we also examine the macroevolutionary evidence for this association and determine if there is evidence for differential diversification at high elevations . we find that , while red / orange clades have equivalent speciation rates , the trait state of reddish flowers reverts more rapidly to the nonreddish trait state . moreover , there is evidence for high speciation rates at high elevation and no evidence for transition rates in floral colour to differ depending on elevation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: dry eye is defined by the international dry eye workshop as a multifactorial disease of the tears and ocular surface that results in symptoms of discomfort , visual disturbance , and tear instability with potential damage to the ocular surface . it is accompanied by increased osmolarity of the tear film and inflammation of the ocular surface .1 stress of the ocular surface can lead to activation of the mitogen activated protein kinase and nuclear factor - kappa b signaling pathways .2 chronic inflammation is a key component in the pathogenesis of dry eye as increased levels of cytokines expressed by t cells have been found in tears of patients with both evaporative and aqueous - deficient types of dry eye disease ( ded ) . these inflammatory cascades can then lead to apoptosis of ocular surface cells .3 the treatment of ded with topical anti - inflammatory pharmaceutical medications has been limited to topical cyclosporine 0.05 % for the past few years , until the recent food and drug administration ( fda ) approval of lifitegrast 5 % in july 2016 . it has been studied in 2,000 dry eye patients , ranging in severity from mild to severe , and appears to have a rapid onset of action . the purpose of this review is to discuss the design and clinical data supporting lifitegrast 5 % ophthalmic solution . however , chronic inflammation is at the root of the problem with cd4 t - helper cells intimately involved . therefore , therapies targeting pro - inflammatory t cells are key in the treatment of ded .4 intercellular adhesion molecule - 1 ( icam - 1 ) has been previously shown to be upregulated in the conjunctiva of dry eye patients .5 lymphocyte function - associated antigen - 1 ( lfa - 1 ) is an integrin protein on cd4 lymphocytes . icam - 1 is the ligand to lfa - 1 and is found on the surface of inflamed endothelial and epithelial cells as well as immune cells . when lfa - 1 binds to icam - 1 , t cells are recruited to the inflamed tissues ; specifically , t cells bind to the vascular endothelium and then this interaction further modulates t - cell migration out of the vasculature into the ocular surface tissues . cytokine release stimulates more lymphocytes to the site of inflammation , thereby propagating a chronic inflammatory process .4,68 lifitegrast is a t - cell inhibitor , previously referred to as sar 1118 . specifically , lifitegrast is an lfa - 1 direct competitive antagonist that mimics the binding epitope of icam - 1.4,9 as a result , inflammation is decreased by preventing binding of lfa - 1 to icam - 1 , which in turn reduces the pathogenicity of dry eye .6,7 key mechanisms of lifitegrast are inhibition of adhesion , migration , activation , and recruitment of t cells .7 lifitegrast has high aqueous solubility and demonstrates rapid absorption into the conjunctiva and cornea in animal models .10 it is also rapidly cleared out of the systemic circulation , giving it an overall favorable pharmacokinetic profile .4 for approval , the fda requires two adequate and well - controlled trials that demonstrate statistically significant improvement in both a sign and a symptom of ded . discussed in more detail below , the phase ii trial on lifitegrast achieved statistical significance for corneal staining ( sign ) , and the opus - 1 trial replicated this result . however , efficacy with regard to symptom ( s ) was not demonstrated in these trials . subsequently , opus - 2 showed statistical significance for improvement in eye dryness ( symptom ) , which was confirmed by opus - 3 . at the completion of opus - 3 , both fda criteria for drug approval had been met ( figure 1 ) .6 the phase ii lifitegrast study was a prospective , multicenter , randomized , double - masked , placebo - controlled trial of lifitegrast 0.1 % , 1 % , and 5 % versus vehicle twice daily for 84 days with controlled adverse environment ( cae ) used for patient selection .11 the cae worsens dry eye signs and symptoms due to creation of a negative environment for dry eye with respect to humidity , temperature , airflow , and lighting conditions over a period of 90 minutes . key eligibility criteria included being an adult dry eye patient with unanesthetized schirmer tear test result 1 and 10 mm / 5 min , no active lid margin disease , corneal staining score 2 , and cae - induced increase in inferior corneal staining score ( icss ) as well as increase in ocular discomfort score ( ods ) after exposure . furthermore , patients should not have used topical cyclosporine within 6 weeks of visit 1 , should not have had ocular surgery in the preceding 12 months , and were not allowed to wear contact lenses during the study . enrollment occurred between august 2009 and february 2010 at 5 sites in the united states . the study consisted of 3 periods : day -14 to 0 ( screening ) , day 084 ( treatment ) , and day 8586 ( follow - up phone interview ) . there were a total of 5 study visits : 2 during screening , and 3 during treatment at days 14 , 42 , and 84 . the ocular surface disease index ( osdi ) was completed at each of these visits . the study eye had to have a schirmer tear test result 1 and 10 mm and 1 point increase in icss and ods from baseline at visit 1 post - cae . of note , patients with pre - cae icss and / or ods of 4 ( maximum score ) were excluded . all patients meeting criteria after visit 1 were started on a 2 - week vehicle run - in period until visit 2 ( day 0 ) . vehicle was composed of inactive ingredients which included sodium chloride , sodium phosphate dibasic anhydrous , sodium thiosulfate pentahydrate , sodium hydroxide and / or hydrochloric acid ( for ph adjustment ) , and water . at visit 2 , assessments including cae were repeated ; all patients who still met the criteria were randomized to either lifitegrast 0.1 % , 1 % , 5 % , or vehicle twice daily for 84 days . secondary objective endpoints included schirmer tear test , conjunctival staining score , tear film break up time , and blink rate . secondary subjective endpoints included osdi , ods , and visual analog scale ( vas , 7 item symptom inventory with each on a 0100 scale ) . primary and secondary analyses were intent to treat . in all , 546 patients were screened to achieve 230 enrolled patients ( 51 men , 179 women ) . the average age was 62.3 years ( range 2691 years ) , 78 % were females , and 93 % were white . two hundred and one patients completed the post - study survey , and a total of 29 discontinued . a dose response was observed for icss at day 84 favoring lifitegrast 5.0 % ( p = 0.0566 ) . confirmatory analyses showed dose response for lifitegrast 1.0 % ( p = 0.0433 ) and 5.0 % ( p = 0.0208 ) . an increase in tear production was seen at day 14 for lifitegrast 5.0 % ( p = 0.0392 ) . improvements in osdi scores from baseline to day 14 were observed in all lifitegrast groups ( 0.1 % , p = 0.0390 ; 1 % , p = 0.0137 ; 5 % , p = 0.0341 ) . the visual - related ( vr ) component of the osdi ( osdi - vr ) showed improvements from baseline to day 14 and to day 84 for the lifitegrast 1 % ( p = 0.0231 and 0.0342 , respectively ) and 5 % groups ( p = 0.0465 and 0.0394 , respectively ) . baseline ods showed trends toward improvement for all groups including vehicle . the most commonly reported event was irritation after instillation of the eye drop ; 93 % of these events were reported on day 0 . previous studies had allowed unlimited artificial tear use , which may affect corneal staining results ; thus , tear use was not permitted in this study . also noted is the importance of the run - in period to eliminate patients with a robust placebo effect . in summary , this phase ii study demonstrated a dose - dependent reduction in corneal staining for lifitegrast compared to vehicle . this finding provided statistically significant evidence that lifitegrast effectively improves inferior corneal staining , a sign of ded , but investigators needed to demonstrate replication of this result . the opus - 1 study was a multicenter , randomized , double - masked , placebo - controlled trial of lifitegrast 5.0 % versus vehicle twice daily for 84 days .12 the purpose was to confirm clinically meaningful responses from lifitegrast in a larger dry eye population . the study methods were very similar to the previously described phase ii study with several minor changes . first , the cae was used for patient selection and conducted at visits 1 and 2 but not at visits 35 as in the prior study . furthermore , participants with fixed fluorescein staining or ocular discomfort symptoms despite cae were excluded . lastly , stratification was used to provide balance in the study arms based on prior recent artificial tear use and severity of icss at baseline . in total , 1,016 patients were screened between september 2011 and april 2012 to obtain 588 participants at 13 sites in the united states . mean participant age was 60.6 years ( range 2091 years ) , 76 % of patients were females , and 93 % were white . the primary objective outcome measure was icss change ( sign ) from baseline to day 84 . based on the results of the phase ii study , the co - primary subjective outcome measure was chosen to be vr - osdi ( vision - related subscale score of osdi ) change from baseline to day 84 ( symptom ) . however , complete osdi , vas , and ods inventories were obtained at every visit . the opus - 1 study met the primary objective endpoint , demonstrating that lifitegrast is superior to vehicle at day 84 ( p = 0.0007 ) . specifically , 22.2 % of lifitegrast patients demonstrated 1.0 point reduction in icss versus 13.9 % for vehicle . unfortunately , opus - 1 did not meet the primary subjective efficacy endpoint of improvement in vr - osdi for patients using lifitegrast compared to vehicle ( p = 0.7894 ) . in fact , no significant differences in any osdi parameter were seen at any follow - up visit . as for vas scores , lifitegrast did significantly reduce patients eye dryness score ( eds ) at day 42 ( p = 0.0441 ) and 84 ( p = 0.0291 ) compared to vehicle . on the ods , lifitegrastsignificantly reduced mean ods at day 84 ( p = 0.0273 ) but not at day 14 or 42 . therefore , symptom findings from the phase ii study were not replicated in this phase iii study . there is no validated subjective outcome measure of dry eye symptoms , likely due to low correlation of dry eye signs and symptoms , placebo responses , transient nature of the disease , and issues with patient recall bias . however , based on the findings from opus - 1 , prescreening of patients using the vas and only including patients with a threshold vas score ( at least 40 ) might help bring out symptomatic improvements due to lifitegrast . the above two controlled trials demonstrated a statistically significant improvement in a sign of dry eye , but investigators next set out to design a trial to demonstrate improvement in symptoms of dry eye in order to meet fda requirements . opus - 2 was a phase iii multicenter , randomized , double - masked , placebo - controlled trial of lifitegrast 5.0 % versus vehicle administered twice daily for 84 days .13 based on a post hoc analysis of opus - 1 , the drug effect appeared to be increased for patients with recent artificial tear use and eds 40 . therefore , eligibility criteria for the opus - 2 study were : schirmer tear test result 1 mm and 10 mm / 5 min , no active lid margin disease , corneal staining score 2 , artificial tear use within 30 days ( prior to first screening ) , and eds 40 on the vas ( scale from 0 to 100 ) . of note , eye dryness , and eye discomfort as a secondary outcome measure , were selected because they are the most consistently reported symptoms by dry eye patients . the primary objective endpoint was change in icss from baseline to day 84 , and the primary subjective endpoint was change in eds on the vas from baseline to day 84 . totally , 1,450 patients were screened between december 2012 and october 2013 at 31 community clinics in the united states ; 557 patients failed initial screening and an additional 178 patients failed post vehicle run - in screening . therefore , 718 patients were enrolled with an average age of 58.8 years ( range 1997 years ) ; 77 % were females , 85 % were white , 9 % were black , 5 % were asian . sites randomized patients using stratification by baseline icss ( either 1.5 or 1.5 ) and eds ( either 60 or 60 ) . patients still completed a 14 - day vehicle run - in and were still prohibited from using artificial tears during the study ( but must have used tears in 30 days prior to the study ) . compliance was measured by the amount of used / unused study product in collected vials with 80 % of expected use indicating noncompliance and 120 % of expected use indicating overuse . in this study , lifitegrast patients had a significant improvement in eds compared to vehicle patients ( p 0.0001 , 95 % confidence interval 8.5116.70 ) . specifically , the average decrease in eds for lifitegrast patients was 35.30 compared to 22.75 for vehicle . in addition , post hoc analysis of opus - 2 showed that the improvement in eds occurred as early as the first treatment visit ( visit 3 , day 14 ) . thus , opus - 2 was the first phase iii study to demonstrate a significant decrease in dry eye symptoms ( eye dryness ) due to lifitegrast but did not replicate the previous statistically significant icss ( sign ) data . as a result of the changes made to the eligibility criteria ( namely , the requirement that patients must have an eds 40 on the vas and must have had recent artificial tear use ) , opus - 2 likely enrolled patients with more severe dry eye symptoms . the authors hypothesize that the reason the sign was not replicated in this study may have been related to patients recent artificial tear use which could have made the drug effect more difficult to detect ; alternatively , perhaps , more symptomatic patients have more advanced epithelial disease which makes it more difficult to demonstrate a treatment response . since only one of the co - primary outcome measures was statistically significant , nominal p - values had to be reported for the secondary endpoints . change in eye discomfort score on the vas was statistically significant with 26.46 for lifitegrast patients and 16.73 for vehicle patients ( nominal p 0.0001 ) ; also , average change in ods from baseline to day 84 was 0.91 for lifitegrast compared to 0.57 for vehicle ( nominal p = 0.0005 ) . of note , 29 patients ( 4.0 % of the study population ) had treatment - emergent adverse events ( teaes ) , resulting in discontinuation from the study ; 26 ( 3.6 % ) of these were in the lifitegrast group . teaes were further addressed in the safety of a 5.0 % concentration of lifitegrast ophthalmic solution ( sonata ) safety study , discussed below . at this point , after completion of the phase ii as well as the phase iii opus - 1 and opus - 2 trials , investigators had shown replicated evidence of significant improvement in signs of dry eye due to lifitegrast ( phase ii and opus - 1 ) as well as one trial providing evidence of significant improvement in a symptom of dry eye ( opus - 2 ) . opus - 3 was a multicenter , randomized , double - masked , placebo - controlled trial of lifitegrast 5.0 % versus vehicle twice daily for 84 days .14 patients were recruited from 41 centers in the united states between november 2014 and october 2015 . in all , 1,542 participants were screened , and 711 were randomized ; 637 completed the trial . mean age was 58.7 years ( range 1893 years ) ; 76 % were females , 77 % were white , 13 % were black , 7 % were asian . overall , 97.6 % were compliant with placebo treatment , and 96.5 % were compliant with lifitegrast treatment . to achieve totality of evidence , patients had to meet the following criteria in at least one eye : icss 0.5 and schirmer tear test result 1 mm but 10 mm , artificial tear use within 30 days , and eds 40 on vas . otherwise , this study was conducted identically to opus - 2 with a 14 - day run - in period followed by random assignment to treatment with lifitegrast 5.0 % versus vehicle . randomization was again stratified by baseline icss score ( 1.5 or 1.5 ) and eds ( 60 or 60 ) to provide balance . the primary endpoint of this study was only eds from the vas ( symptom ) . of note , this was the only study with a single primary endpoint design . key secondary endpoints were changes in eds from baseline to days 14 and 42 in order to evaluate timing of symptom improvement . in this study , lifitegrast participants had significantly greater improvement in eds from baseline to day 84 compared to placebo participants ( p = 0.0007 ) ; results were also significant at day 14 ( p 0.0001 ) and day 42 ( p 0.0001 ) . improvements were also observed in symptoms of itching ( nominal p = 0.0318 ) , foreign body sensation ( nominal p = 0.0418 ) , and eye discomfort ( nominal p = 0.0048 ) . ods decreased in both treatment groups , but no significant differences in change from baseline were seen at day 84 ( p = 0.6655 ) , day 42 ( p = 0.1293 ) , or day 14 ( p = 0.8893 ) . safety assessments in opus - 3 included conjunctival redness score , corneal and conjunctival staining scores , schirmer tear test , best corrected visual acuity ( bcva ) , slit - lamp biomicroscopy , and dilated fundoscopy . also , assessments of drop comfort score ( dcs ) were obtained at baseline and subsequent visits for each eye at instillation and 1 , 2 , and 3 minutes after instillation . if dcs was not 3 at 3 minutes , assessment was repeated at 5 , 10 , and 15 minutes and if still 3 at 15 minutes , recorded as an adverse event . more participants in the lifitegrast group ( 48.2 % ) compared to the placebo group ( 24.6 % ) had teaes . also , there were more treatment - related teaes in the lifitegrast group ( 35.3 % ocular , 14.6 % non - ocular ) than in the placebo group ( 13.3 % ocular , 0.8 % non - ocular ) . the most common ocular side effects were instillation site irritation and instillation site reaction , and all cases were mild to moderate in severity . the most common non - ocular side effect was dysgeusia ( n = 46 lifitegrast , n = 1 vehicle ) . twenty one ( 5.9 % ) lifitegrast patients and 9 ( 2.5 % ) placebo patients discontinued the study due to teaes , most commonly instillation site reaction or irritation . eight serious teaes were reported but all were non - ocular and not related to the study drug . with regard to other safety parameters , conjunctival redness score , corneal and conjunctival staining scores , and schirmer tear test , all showed improvement over time in the lifitegrast group compared to vehicle . finally , improvements in dcs at instillation were reported over time ; on days 14 , 42 , 84 , the majority of patients reported dcs 3 at 3 minutes . for participants with dcs 3 at 3 minutes , average dcs in the lifitegrast group was similar to or better than vehicle at 5 , 10 , 15 minutes . in summary , in opus - 3 lifitegrast met the primary endpoint of change from baseline in dry eye symptoms as measured by eds , and benefit was observed as early as 2 weeks . again , the authors noted that , based on the prior 4 studies , improvements in signs of dry eye due to lifitegrast were most notable in patients with mild to moderate ded whereas improvements in symptoms were most dramatic in patients with moderate to severe ded . alongside the clinical trial data outlined above , a safety study was completed to provide further long - term evidence regarding safety of lifitegrast use . sonata was a multicenter , randomized ( 2:1 lifitegrast : vehicle ) , double - masked , placebo - controlled trial of lifitegrast 5.0 % versus vehicle twice daily for 1 year .15 eligibility criteria included schirmer tear test result 1 and 10 mm / 5 min , no active lid margin disease , corneal staining score 2.0 , eds 40 , and use and / or desire to use artificial tears in the past 6 months . totally , 504 patients were screened at 22 sites in the united states between october 2012 and march 2014 ; 331 patients were randomized and followed at 7 visits over 1 year ( day 7 , day 0 , day 14 , day 90 , day 180 , day 270 , and day 360 ) . of note , after day 14 ( visit 3 ) , patients were allowed to resume use of artificial tears ( 4 times daily prn ) , contact lenses ( daily disposable only ) , loteprednol ( for 4 weeks at a time ) , antihistamines , and mast cell stabilizers ; use of these medications was tracked . the primary endpoint was percentage and severity of teaes , which were any adverse events that occurred after the first dose of lifitegrast . secondary endpoints were corneal staining , drop comfort , bcva , slit - lamp bio - microscopy , and intraocular pressure ( iop ) . this study was not powered to determine statistically significant improvement in signs / symptoms of dry eye due to lifitegrast . a higher percentage of patients in the lifitegrast group ( 53.6 % ) had teaes compared to the placebo group ( 34.2 % ) . these were categorized by the investigator as mild , moderate , or severe ; most teaes were mild to moderate in severity . teaes included instillation site irritation ( 15.0 % lifitegrast vs 4.5 % vehicle ) , instillation site reaction ( 13.2 % lifitegrast vs 1.8 % vehicle ) , reduction in visual acuity ( 11.4 % lifitegrast vs 6.3 % vehicle ) , dry eye ( 1.8 % lifitegrast vs 5.4 % vehicle ) , and dysgeusia ( 16.4 % lifitegrast vs 1.8 % vehicle ) ( table 1 ) . of note , the lifitegrast group had nearly twice the frequency of participants with reduced visual acuity than in the placebo group , but mean changes in bcva from baseline to day 360 were minimal in both groups . this visual acuity reduction may have been due to transient alterations in the tear film , which contributes to the refractive properties of the eye . also , it is hypothesized that dysgeusia was likely due to tear drainage through the lacrimal system into the oropharynx and was usually short in duration . a total of 24 participants ( 18 lifitegrast , 6 vehicle ) had 1 ocular teae and 13 ( 9 lifitegrast , 4 vehicle ) had 1 non - ocular teae that resulted in discontinuation . discontinuation due to burning occurred in only 2 lifitegrast patients . fifteen participants had serious non - ocular teaes ( including cardiac arrhythmia resulting in death in one placebo group patient ) , and all non - ocular teaes were considered not related to the investigational drug . the mean iops of both eyes were similar between treatments groups , and no increased incidence of cataract was seen in the lifitegrast group . interestingly , a lower percentage ( 32.8 % ) of patients in the lifitegrast group used artificial tears after day 14 compared to vehicle ( 43.9 % ) , but patients in both groups who used artificial tears had higher rates of teaes ( ocular : lifitegrast 67.2 % vs 45.0 % ; vehicle 44.2 % vs 25.5 % ; non - ocular : lifitegrast 60.9 % vs 42.7 % ; vehicle 44.2 % vs 32.7 % ) . with regard to systemic safety , no immunosuppression was seen in lifitegrast patients based on serum cd3 , cd4 , and cd8 levels , and no opportunistic infections were reported . average plasma lifitegrast concentration at 360 days was undetectable ( 0.500 ng / ml ) . lifitegrast 5 % is the first ophthalmic medication to be approved for the treatment of signs and symptoms of dry eye . based on the phase ii and three phase iii opus studies discussed above , there are reproducible statistically significant data that demonstrate lifitegrast improves icss ( sign ) especially in mild to moderate dry eye patients as well as improves eds ( symptom ) especially in moderate to severe dry eye patients . furthermore , lifitegrast has a favorable safety profile , as demonstrated by the sonata study , with the majority of adverse events being mild instillation site reaction usually early on in therapy . lifitegrast may be used in addition to other conventional dry eye therapies and will hopefully provide clinically meaningful improvement in this disease for many patients in the future .\noutput:\n" }, { "from": "agent", "value": "a new topical ophthalmic medication , lifitegrast 5 % , was recently approved by the us food and drug administration for use in dry eye patients . lifitegrast is an integrin antagonist that decreases inflammation on the ocular surface , thereby improving dry eye disease ( ded ) . through a series of prospective , multicenter , randomized , masked , placebo - controlled studies in > 2,000 patients total , lifitegrast was shown to be effective for improvement in both the signs and symptoms of ded . a subsequent study focused on the safety profile of lifitegrast and demonstrated that the majority of adverse events were mild and resolved over time . lifitegrast is now available for use in clinical practice ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: post - traumatic syringomyelia ( pts ) is a generic term referring to a disorder in which a cyst or cavity forms within the spinal cord after a trauma . pts was rarely reported , and the significance of the past history of spinal trauma was overlooked . symptomatic pts has a reported prevalence of 4 % ,4 ) but the prevalence of asymptomatic pts among patients with spinal cord injuries ( scis ) is estimated at approximately 28 % .9 ) pts generally develops within 5 years after the initial spinal injury , but ranges from 6 months to 25 years .2 ) the pathophysiology of pts is not completely understood . it has been proven that post - traumatic arachnoiditis can cause cavitation in the spinal cord and may also cause syringomyelia . the delayed development of syringomyelia after a severe single spinal trauma that results in contusion of the spinal cord without the complication of arachnoiditis is well - known issue . the purpose of this study was to review the clinical manifestations and surgical treatment results of pts . we excluded patients with congenital anomalies or tumors related to syringomyelia from this analysis . in all nine patients , mri was used to analyze the injury site , craniocaudal extension of the syrinx , the degree of spinal stenosis , and the quality of the subarachnoid spaces around the syrinx . by the late 1990 ' sthe mean follow - up period was 9.3 years ( range , 2 - 17 years ) . the major presenting symptoms or signs were assessed in terms of their improvement , stabilization and deterioration . the patients consisted of nine men who were between 30 and 68 years of age ( mean , 51.2 years ) . the mean age at the time of injury was 27.7 years ( range , 20 - 45 years ) . the mechanisms of injury included a motor vehicle accident in four patients , a fall in four patients , and spinal injury in one patient . spinal fractures occurred in seven patients , spinal dislocation in one patient , and sci in one patient . the time intervals between the initial injury and the onset of new symptoms varied greatly , ranging from 3 to 44 years ( mean , 21.9 years ) . motor weakness in five patients was the most frequent new symptoms , followed by sensory disturbances and pain in four patients , and bladder disturbance in one patient ( table 1 ) . the levels of injury were cervical in four patients , thoracic in two patients , and lumbar in three patients . preoperative mri demonstrated syringes in anywhere from 2 to 16 spinal levels ( mean , 7.8 levels ) . the syrinxes existed at the thoracic levels and extended to the cervical level in three patients and to the lumbar level in one patient . two patients showed syrinxes at the cervical level . in this study , three patients had syrinx extending above and below the site of the original lesion , three patients had syrinx extending above the original lesion , two patients had syrinx extending below the original lesion , and one patient had syrinx at the original lesion . the last patient showed syrinxes at the level of the whole cord ( figure 1 ) . five patients underwent shunt placement ( three syringo - subarachnoid shunts , two syringo - pleural shunt ) . arachnoidolysis and syringes were performed in four patients . in five patients with shunting procedures , postoperative complications occurred in three patients with shunt placement : two patients experienced mechanical shunt failure and one patient had an infection at the operative site ( table 2 ) . at the final follow - up , four patients showed no neurological change , four patients experienced worsening of their neurological symptoms , and one patient slightly improved with regards to trunk hypoesthesia . of the five patients who underwent shunting procedures , two patients stabilized and three deteriorated . of the four patients who underwent arachnoidolysis and duraplasty , two patients stabilized and one deteriorated . one patient underwent further shunt operation 7 years after the initial surgery because of paraparesis and spasticity progression and syrinx re - expansion . the other patient underwent arachnoidolysis and duraplasty as the second operation 12 years after the first shunt placement because of progressive pain and numbness . the patients consisted of nine men who were between 30 and 68 years of age ( mean , 51.2 years ) . the mean age at the time of injury was 27.7 years ( range , 20 - 45 years ) . the mechanisms of injury included a motor vehicle accident in four patients , a fall in four patients , and spinal injury in one patient . spinal fractures occurred in seven patients , spinal dislocation in one patient , and sci in one patient . the time intervals between the initial injury and the onset of new symptoms varied greatly , ranging from 3 to 44 years ( mean , 21.9 years ) . motor weakness in five patients was the most frequent new symptoms , followed by sensory disturbances and pain in four patients , and bladder disturbance in one patient ( table 1 ) . the levels of injury were cervical in four patients , thoracic in two patients , and lumbar in three patients . preoperative mri demonstrated syringes in anywhere from 2 to 16 spinal levels ( mean , 7.8 levels ) . the syrinxes existed at the thoracic levels and extended to the cervical level in three patients and to the lumbar level in one patient . two patients showed syrinxes at the cervical level . in this study , three patients had syrinx extending above and below the site of the original lesion , three patients had syrinx extending above the original lesion , two patients had syrinx extending below the original lesion , and one patient had syrinx at the original lesion . the last patient showed syrinxes at the level of the whole cord ( figure 1 ) . five patients underwent shunt placement ( three syringo - subarachnoid shunts , two syringo - pleural shunt ) . arachnoidolysis and syringes were performed in four patients . in five patients with shunting procedures , postoperative complications occurred in three patients with shunt placement : two patients experienced mechanical shunt failure and one patient had an infection at the operative site ( table 2 ) . at the final follow - up , four patients showed no neurological change , four patients experienced worsening of their neurological symptoms , and one patient slightly improved with regards to trunk hypoesthesia . of the five patients who underwent shunting procedures , two patients stabilized and three deteriorated . of the four patients who underwent arachnoidolysis and duraplasty , two patients stabilized and one deteriorated . one patient underwent further shunt operation 7 years after the initial surgery because of paraparesis and spasticity progression and syrinx re - expansion . the other patient underwent arachnoidolysis and duraplasty as the second operation 12 years after the first shunt placement because of progressive pain and numbness . the most frequent presenting symptoms of pts are pain , numbness or increased weakness , and the reported interval between spinal trauma and the presenting neurological symptoms ranges from 2 months to 36 years .13 ) in this study , most common symptom is the numbness and weakness and the mean interval between the initial injury and the onset of new symptoms was 21.9 years . previous reports showed that syrinx extension may be due to secondary distention of the epidural veins or pressure changes leading to cerebrospinal fluid ( csf ) movement during a valsalva maneuver .8 ) furtheromre , pts most commonly extends above from the injury site ; though , less frequently , it may also have an inferior component .10 ) in this study , syringes usually extended above or above and below from spinal injury sites . syringo - peritoneal shunts and syringo - pleural shunts are commonly used in patients with syringomyelia associated with spinal arachnoiditis because of adhesion in the spinal subarachnoid space .6 ) the placement of all types of shunts may be followed by significant morbidity requiring additional surgical procedures .1,3,5,7,11,12 ) problems specific to the shunt operation include dislodged , blocked , and infected drains . shunting procedures were widely used with encouraging early results , although long - term results has been questioned recently . . a higher rate of shunt failure ( approximately 50 % ) and poor long - term outcomes were reported from various shunting procedures .1,12 ) in this study , we performed shunting procedures in five patients ; two patients stabilized and three deteriorated . the occurrence of pressure differences between the zone above the arachnoiditis and that below seems to be important . permitting free communication among the csf pathwaysso that there are no pressure differentials across the walls of the cord is exxential .14 ) decompressive procedures may have beneficial effects unless the patient shows longitudinally extensive arachnoiditis . the first line of treatment should focus on restoring the normal csf flow at the trauma level and untethering the cord and duroaplasty .12 ) in this study , the post - traumatic tethering , which may lead to a progressive myelopathy , could not be released well . of the 4 patients who underwent arachnoidolysis and duraplasty , two patients showed no neurological changes , one patient improved , and one patient deteriorated . arachnoidolysis and duraplasty had no better long - term results than shunt - ing operations . pts is a rare complication . in patients with a previous spinal injury and newly acquired neurological deficitsalthough we performed surgical interventions , patients with pts demonstrated unfavorable long - term outcomes .\noutput:\n" }, { "from": "agent", "value": "objectivethe purpose of this study was to analyze the clinical manifestations , radiological findings , treatment results , and clinical significance of post - traumatic syringomyelia ( pts ) . methodswe retrospectively reviewed the medical charts of nine surgical patients with symptomatic pts between 1992 and 2012 . resultsthe most common clinical manifestation was development of new motor weakness . the mean interval between the initial injury and the onset of new symptoms 21.9 years . the mean length of the syringes observed on preoperative magnetic resonance images was 7.8 spinal levels . shunting procedures were performed in five patients . four patients underwent arachnoidolysis and duraplasty . patients developed mechanical shunt failure . postoperatively , one patient showed clinical improvement , four patients were stable , and four patients showed deterioration.conclusionpts is a disabling sequelae of spinal cord injury , which develops months to years after spinal injury . we have to consider that patients with pts may have poor long - term outcome ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the public health leadership forum ( may 2014 ) described its vision for 2020 of a high achieving pha and called for new practices and skills that can address the changing circumstances . these circumstances include changing demographic and health care needs , an explosion of health information and data , and a shift in priorities to respond to the increasing prevalence of chronic diseases , often a key to optimizing the health of the public . central to a high achieving pha will be a new generation of information systems with the capacity to examine the range of factors ( figure 1 ) affecting population health , to identify health disparities , and to provide information needed to evaluate public health interventions . at the same time , phas face organizational challenges , wide variations in funding levels , and inconsistent legal statutes defining their mission and services . as a result , phas vary significantly in the services they provide and the health status of communities served . this paper first addresses how public health s guiding principles align in support of an effective , efficient , and continuous learning to become learning public health systems ( lphss ) . with this goal of continuous learning in mind , the paper then explores the complex interdependencies and public health services and systems research ( phssr ) research questions that need to be addressed in key areas such as pha agencies legal authority , funding , structure and organization , and performance . major data sources , data gaps , and strategies for collecting and applying the data that are needed to address critical phssr questions with respect to pha organization , quality , and efficiency are discussed . the institute of medicine ( iom ) published a series of reports on learning health care systems and the necessity for transformational change in health and health care .1 as interpreted by the academic health department learning community ,2 the essential characteristics of an lphs are listed in table 1 with examples of data sources and measures . an essential lphs characteristic is the role of agency leadership in instilling a culture of learning in the organization management research provides insights into leadership styles and actions that support culture change and learning . the common human tendency is to assign blame and then not learn from the failure experience . she concludes that only leaders can create a culture that counteracts blame and makes people comfortable with discussing and learning from failure . the vision of an lphs is for phas to have the organizational capacity to use data and evidence to drive system priorities and to support public health practice with timely information on quality , cost , and population health outcomes . a useful framework for examining organizational capacity and data gaps for phssr is to review the 3 core functions of public health ( assessment , policy development , and assurance ) and the 10 essential services needed to carry out the core functions .6,7 according to the centers for disease control and prevention ( cdc ) , the core functions and essential services provide a foundation for any public health activity ; describe public health at the state , tribal , local , and territorial levels ; and provide structure for national voluntary public health accreditation .8 in an effort to strengthen phas , the public health accreditation board ( phab ) was established . phab s vision , a high - performing governmental public health system that will make the united states a healthier nation , could be supported by the adoption of a culture of continuous learning in phas . such a culture would provide the model for responding to health risks , complex social and environmental factors , and evolving scientific evidence . phab requires the pha to demonstrate its capacity to do the following : ( 1 ) perform a community health assessment , ( 2 ) develop a community health improvement plan , and ( 3 ) develop a 35 year strategic plan . a natural starting point for developing the capacity and the culture of an lphs in a phatable 2 maps these three phab requirements with the essential characteristics of an lphs and the core functions and essential services of a pha . also noted are the activities , associated with each essential service , that involve a major data component . the table depicts the interrelationships between these guiding frameworks , and supports the notion that governmental phas are organized and structured to support the development , use , and application of data . the institute of medicine ( iom ) published a series of reports on learning health care systems and the necessity for transformational change in health and health care .1 as interpreted by the academic health department learning community ,2 the essential characteristics of an lphs are listed in table 1 with examples of data sources and measures . an essential lphs characteristic is the role of agency leadership in instilling a culture of learning in the organization management research provides insights into leadership styles and actions that support culture change and learning . the common human tendency is to assign blame and then not learn from the failure experience . she concludes that only leaders can create a culture that counteracts blame and makes people comfortable with discussing and learning from failure . the vision of an lphs is for phas to have the organizational capacity to use data and evidence to drive system priorities and to support public health practice with timely information on quality , cost , and population health outcomes . a useful framework for examining organizational capacity and data gaps for phssr is to review the 3 core functions of public health ( assessment , policy development , and assurance ) and the 10 essential services needed to carry out the core functions .6,7 according to the centers for disease control and prevention ( cdc ) , the core functions and essential services provide a foundation for any public health activity ; describe public health at the state , tribal , local , and territorial levels ; and provide structure for national voluntary public health accreditation .8 in an effort to strengthen phas , the public health accreditation board ( phab ) was established . phab s vision , a high - performing governmental public health system that will make the united states a healthier nation , could be supported by the adoption of a culture of continuous learning in phas . such a culture would provide the model for responding to health risks , complex social and environmental factors , and evolving scientific evidence . phab requires the pha to demonstrate its capacity to do the following : ( 1 ) perform a community health assessment , ( 2 ) develop a community health improvement plan , and ( 3 ) develop a 35 year strategic plan . a natural starting point for developing the capacity andthe culture of an lphs in a pha would be to tackle these data intensive requirements and apply for accreditation . table 2 maps these three phab requirements with the essential characteristics of an lphs and the core functions and essential services of a pha . also noted are the activities , associated with each essential service , that involve a major data component . the table depicts the interrelationships between these guiding frameworks , and supports the notion that governmental phas are organized and structured to support the development , use , and application of data . the mission , authority , and responsibility of a state pha should be specified in state statutes . yet a study of the status of state laws governing public health functions found great variability in the comprehensiveness of statutes : given the centrality of law to the mission , structure , and workforce in public health , the authors found state public health laws are often antiquated , fragmented , inconsistent , and incomplete .17 this is alarming , given thatlaw is a critical component to each of three elements of the national public health infrastructure : ( 1 ) health data and other factual information , ( 2 ) a competent workforce , ( 3 ) systems and relationships .18 understanding the inadequacies of state statutes , iom in its 2003 report on the future of public health recommended that states use the turning point model public health act ( tpmpha ) to achieve public health law reform by using standard statutory language to reflect the mission and essential services of public health .19 the tpmpha addressed the following : ( 1 ) purpose and definitions ; ( 2 ) mission and function ; ( 3 ) public health infrastructure ; ( 4 ) collaboration and relationships with public and private partners ; ( 5 ) public health authorities and powers ; ( 6 ) public health emergencies ; ( 7 ) declaring a state public health emergency ; ( 8 ) public health information privacy ; and ( 9 ) administrative procedures , civil and criminal enforcement , and immunities . after september 11 , 2001 , the drafting committee took the model state emergency health powers act and folded it into the tpmpha with a few edits to into public health acts .20 subsequent to the 2003 iom recommendation , a study assessed the status of adoption of the tpmpha ,21 including defining the 10 essential public health services in statutes .22,23 although there was progress by 2008 , only 17 of the 50 states had put in place statutes covering 7 or more of the 10 essential services and , notably , only 4 states had codified statutes for all 10 essential services . half ( 46 ) of the essential services were codified by 26 states , and the remaining 7 states codified 3 or fewer . the failure of the majority of states to create statutes for all 10 essential services suggests uncertain commitment to comprehensive services . of the 10 essential services , 3 overlap with core aspects of the lphs : ( 1 ) monitor health status , ( 2 ) evaluate health services , and ( 3 ) conduct research on new insights and innovative solutions to health problems . monitoringhowever , only 18 states had statutes for the evaluation of health services , and only 8 had statutes for research into new solutions for public health problems .24 states reported that many services were provided that were not in statutes ,25 as would be expected . nearly all states ( 49 of 51 including the district of columbia ) reported monitoring behavioral risk factors , infectious diseases , reportable diseases , and vital statistics . similarly , in the essential services categories of evaluation and research , over 90 percent of the states reported analyzing and interpreting data and over 70 percent reported applying the findings to improve practice . over half were involved in research , ranging from developing research and evaluation questions to collaborating with external researchers . on average , states participated or led 32 research or evaluation studies , varying from a high of 217 studies to a low of 2 studies . monitoring activities focused on mortality , morbidity , and state - level behavioral risk factors and may have captured a few health indicators . the capacity of states to rigorously evaluate their own programs and to conduct research on potentially promising interventions was unclear in the association of state and territorial health officials ( astho ) survey , and likely varied widely .26 in table 3 , research questions are proposed related to legal statute and the use of findings from pha program evaluation studies . research questions for phssr related to funding for public health are noted in another paper in this special issue , see corso et al. 27 in 2013 , the institute of medicine ( iom ) report shorter lives , poorer health observed that the united states is one of the wealthiest countries in the world , but not one of the healthiest . when compared with the average of peer countries , americans as a group fare worse in at least nine health areas , including infant mortality and low birth weight , homicides , hiv and aids , drug - related deaths , obesity and diabetes , heart disease , and chronic lung disease . to overcome this u.s . health disadvantage , we will need to sustain and strengthen primary prevention initiatives and focus more resources on secondary prevention ( disease management ) for chronic disorders . however , governmental public health agencies are stretched thin . according to the 2010 astho survey , the priorities in state phas were infrastructure ( 40 states ) ; quality improvement ( qi ) ( 21 states ) ; health promotion ( 18 states ) ; obesity , nutrition , and physical activity ( 14 states ) ; and emergency preparedness ( 14 states ) . only 10 states cited chronic conditions as a priority . to be successful in tackling these complex challenges , stronger partnerships are needed between public health ( population health ) and medical providers ( individual health ) , as well as with community organizations and human service organizations . a growing national movement toward upstream , multisectoral approaches to tackling health challenges is supported by the robert wood johnson foundation s new culture of health strategy , the growing field of health impact assessment , and the increasing urgency to tackle health care costs . integrators , in communities ; achieving public health accreditation and fostering an lphs would be the first steps toward serving in those roles .29,30 the mission , authority , and responsibility of a state pha should be specified in state statutes . yet a study of the status of state laws governing public health functions found great variability in the comprehensiveness of statutes : given the centrality of law to the mission , structure , and workforce in public health , the authors found state public health laws are often antiquated , fragmented , inconsistent , and incomplete .17 this is alarming , given thatlaw is a critical component to each of three elements of the national public health infrastructure : ( 1 ) health data and other factual information , ( 2 ) a competent workforce , ( 3 ) systems and relationships .18 understanding the inadequacies of state statutes , iom in its 2003 report on the future of public health recommended that states use the turning point model public health act ( tpmpha ) to achieve public health law reform by using standard statutory language to reflect the mission and essential services of public health .19 the tpmpha addressed the following : ( 1 ) purpose and definitions ; ( 2 ) mission and function ; ( 3 ) public health infrastructure ; ( 4 ) collaboration and relationships with public and private partners ; ( 5 ) public health authorities and powers ; ( 6 ) public health emergencies ; ( 7 ) declaring a state public health emergency ; ( 8 ) public health information privacy ; and ( 9 ) administrative procedures , civil and criminal enforcement , and immunities . after september 11 , 2001 , the drafting committee took the model state emergency health powers act and folded it into the tpmpha with a few edits to into public health acts .20 subsequent to the 2003 iom recommendation , a study assessed the status of adoption of the tpmpha ,21 including defining the 10 essential public health services in statutes .22,23 although there was progress by 2008 , only 17 of the 50 states had put in place statutes covering 7 or more of the 10 essential services and , notably , only 4 states had codified statutes for all 10 essential services . half ( 46 ) of the essential services were codified by 26 states , and the remaining 7 states codified 3 or fewer . the failure of the majority of states to create statutes for all 10 essential services suggests uncertain commitment to comprehensive services . of the 10 essential services , 3 overlap with core aspects of the lphs : ( 1 ) monitor health status , ( 2 ) evaluate health services , and ( 3 ) conduct research on new insights and innovative solutions to health problems . monitoringhowever , only 18 states had statutes for the evaluation of health services , and only 8 had statutes for research into new solutions for public health problems .24 states reported that many services were provided that were not in statutes ,25 as would be expected . nearly all states ( 49 of 51 including the district of columbia ) reported monitoring behavioral risk factors , infectious diseases , reportable diseases , and vital statistics . similarly , in the essential services categories of evaluation and research , over 90 percent of the states reported analyzing and interpreting data and over 70 percent reported applying the findings to improve practice . over half were involved in research , ranging from developing research and evaluation questions to collaborating with external researchers . on average , states participated or led 32 research or evaluation studies , varying from a high of 217 studies to a low of 2 studies . monitoring activities focused on mortality , morbidity , and state - level behavioral risk factors and may have captured a few health indicators . the capacity of states to rigorously evaluate their own programs and to conduct research on potentially promising interventions was unclear in the association of state and territorial health officials ( astho ) survey , and likely varied widely .26 in table 3 , research questions are proposed related to legal statute and the use of findings from pha program evaluation studies . research questions for phssr related to funding for public health are noted in another paper in this special issue , see corso et al. 27in 2013 , the institute of medicine ( iom ) report shorter lives , poorer health observed that the united states is one of the wealthiest countries in the world , but not one of the healthiest . when compared with the average of peer countries , americans as a group fare worse in at least nine health areas , including infant mortality and low birth weight , homicides , hiv and aids , drug - related deaths , obesity and diabetes , heart disease , and chronic lung disease . to overcome this u.s . health disadvantage , we will need to sustain and strengthen primary prevention initiatives and focus more resources on secondary prevention ( disease management ) for chronic disorders . however , governmental public health agencies are stretched thin . according to the 2010 astho survey , the priorities in state phas were infrastructure ( 40 states ) ; quality improvement ( qi ) ( 21 states ) ; health promotion ( 18 states ) ; obesity , nutrition , and physical activity ( 14 states ) ; and emergency preparedness ( 14 states ) . only 10 states cited chronic conditions as a priority . to be successful in tackling these complex challenges , stronger partnerships are needed between public health ( population health ) and medical providers ( individual health ) , as well as with community organizations and human service organizations . a growing national movement toward upstream , multisectoral approaches to tackling health challenges is supported by the robert wood johnson foundation s new culture of health strategy , the growing field of health impact assessment , and the increasing urgency to tackle health care costs . integrators , in communities ; achieving public health accreditation and fostering an lphs would be the first steps toward serving in those roles .29,30 taken together the goals of lphs , core functions and essential services of pha , context of legal and funding , and local priorities that have been discussed set the stage for future directions and questionsthe following sections explore key research questions , data sources , and next steps for phssr with respect to pha s organization and data infrastructure , performance and quality measurement , and measures of organizational efficiency . pha organization and reporting relationships vary widely across states .31 in 23 states the pha is part of a large umbrella organization . umbrella organizations are ones in which the pha does not stand alone but has been merged with other health agencies under the same leadership . the astho survey reported that , in most cases , when pha is part of a larger umbrella organization it includes long - term care , medicaid and public assistance , and mental - health and substance - abuse services . among states without a large umbrella organization , some non - pha services may be present , including services for the aging and elderly , child and family services , services for individuals with disabilities , and licensure of health professionals and facilities . the implications for pha performance within an umbrella organization , as well as implications for pha leadership needed to grow the culture of an lphs , are not clear . phssr on pha organizational structures has examined three characteristics : differentiation ( the different programs and activities delivered ) , integration ( the extent to which services are provided through relationships with other organizations ) , and centrality ( the concentration or distribution of authority at the state - or local level ) .32 in an analysis of phas with 100,000 or greater population ( 17 percent of all phas ) , phas were found to vary widely in organizational structure , yet could be clustered in seven distinct configurations . examining organizational changes between 1998 and 2006 , many phas were found to have migrated from one configuration to another , changing the mix of differentiation , integration , and centrality in the organization . the research base linking agency structure to pha performance over time , and to health outcomes , is thin but growing .33 in table 4 , research questions are proposed related to organization and the performance of the pha as an lphs . while the explosion of data and data sources over the past few decades is providing new opportunities for public health , they are significant challenges for data users seeking the best data to inform public health surveillance , policy development , and assessment ( evaluation ) . electronic health records ( ehr ) are collecting rich clinical data that are largely free - text and not easily aggregated or analyzed . health interview surveys of the centers for disease control and prevention ( cdc ) national center for health statistics are nationally representative and informative , but sample sizes are insufficient for small area analysis , e.g. , at the county - or zip code levels . the bureau of the census s american community survey has the sample size needed to describe the socioeconomic characteristics of small population groups , but safeguards to protect confidentiality require users to analyze data through government data centers . health insurance claims data provide coded diagnoses , medical procedures , and preventive services for insured population groups but not for the uninsured . timely data is needed to ensure early recognition of emerging health threats , but cleaning of data sets and their availability may lag by months or years . the quality of data , as well as gaps in data , may be of concern . for example , there are few sources for measuring population health status and well - being . much more is known about disease , disability , and death than is known about population health . the importance of data in public health is in its applications for surveillance and health monitoring , for planning community qi initiatives , for intervention evaluation , and for research into innovative solutions for health problems . the development of learning organizations has been actively promoted in public health over the last decade . notably , the robert wood johnson foundation ( rwjf ) funded the common ground project to accelerate the transformation of information systems used in phas .34 the project relied on working groups drawn from participating phas with consultant support to address common core concerns , the standardization of data and data definitions , and key aspects of system redesign . the guiding concept was that all phas face common issues and have similar needs for information to respond to pandemics and bioterrorism , to intervene with chronic diseases , to establish best practices , and to develop training for public health staff . the experience was found to be positive for phas .35 more recently , the academic health department ( ahd ) learning community was established with cdc support and open to all phas . the ahd is meant to enhance public health education and training , research , and service by facilitating collaboration across the academic and practice communities . through this partnership , lphss are being developed and strengthened .36 in a parallel development under the health information technology for economic and clinical ( hitech ) act ,3717 beacon communities38 were funded on a competitive basis to develop models for community - level public health information systems . the beacon focus was on using electronic medical record ( emr ) data as a source of population health indicators , particularly morbidity and receipt of preventive services , which is unavailable in most communities . the program brought beacon communities together to share their learning experiences .39 the need for state - and local - level health data to inform pha priorities and program evaluation is widely recognized . the affordable care act of 2009 made funds available to expand the sample in the national center for health statistics surveys , making state - level estimates feasible . also , the bureau of the census s american community survey ( acs ) provides state - and community - level data on population characteristics . state health access data assistance center ( shadac ) , uses acs data and other sources to make available state - and county - level data on access to care , insurance coverage , and sources of insurance .40 comparable national data on community health status and need for services are not available . for this reason , there is increasing interest in using clinical data from ehrs to meet some of these information needs . the volume of electronic data sent and received by phas is increasing .41 in a recent astho survey , over 80 percent reported exchanging electronic data directly with providers , and 20 percent reported using direct data exchange through an intermediary . more than 90 percent of state agencies exchange information with hospitals , and over 80 percent report electronic information exchange with laboratories , providers , and local health departments . exchange of data with medicaid agencies is reported by over 60 percent , with community health centers by over 50 percent , and with insurers and health plans by over 40 percent . there are recognized limitations and implementation barriers to be considered in using emr for public health purposes . these include the following : ( 1 ) emrs may be missing the desired data , including environmental and psychological factors , and data reliability and validity is uneven ; and ( 2 ) phas may lack staff with necessary skill levels and may lack the resources to build a centralized system .42 building on the lessons learned in common ground and beacon communities , the ahd is supporting a collaborative process for phas to learn how to access and make best use of existing and new data sources in collaboration with academic settings . in addition , phas need timely access to information based on systematic reviews of scientific evidence . in the united states , the responsibility for evidence - based reviews and evidence - based practice guidelines is widely dispersed . this is not true for preventive services where evidence - based reviews are done by the u.s . preventive services taskforce .43 complementing the evidence - based reviews is the work of the community preventive services task force supported by the cdc . it is providing evidence - based reviews on preventive interventions for communities covering 22 major topic areas .44 together , the two taskforces are providing critical systematic reviews of scientific evidence needed by phas . in table 4 , research questions are proposed regarding the organizational and data infrastructure and implications for becoming an lphs . the congressionally mandated report on the national quality strategy states its aim as being to improve the health of the u.s . population by supporting proven interventions to address behavioral , social , and environmental determinants of health in addition to delivering higher quality care .45 the 2013 iom report , toward quality measures in public health46 endorses nine aims for quality improvement in public health systems as proposed by the public health quality forum ( phqf ) .47 a quality public health system should be population centered , equitable , proactive , health promoting , risk reducing , vigilant , transparent , effective , and efficient ( table 5 ) . the definition of quality in public health parallels the definition of quality for medical care : the degree to which policies , programs , services and research for the population increase desired health outcomes and conditions in which the population can be healthy .48 central to measuring quality is the measurement of desired health outcomes within population groups , data that are not generally collected . we rely on scientific studies to provide evidence on the relationship of services and specific outcomes , usually clinical outcomes . outcomes desired by population groups will likely go beyond clinical indicators and will include well - being and functional capacity . if so , additional research will most likely be needed . the nine public health quality aims set out by phqf ( table 5 ) build on donabedian s quality measurement framework of structure , process , and outcome .49,50 they include the six iom quality aims of medical care , and add quality dimensions of phas being proactive , health promoting , and vigilant .51 the 2013 iom public health quality report , gives sample measures for quality in achieving united states health objectives for nutrition , physical activity and obesity .52,53 to be useful for examining population health , the measures must be amenable to distributional analysis and facilitate the identification of disparities across population subgroups . from a systems perspectiveone might ask , does the quality metric need to be adapted for specific pathways or is a comprehensive measure valid , and how can these metrics be used to help understand the pathways that lead to poor nutrition , limited physical activity , and obesity ? how often do poor nutrition , limited physical activity , and obesity co - occur ? are pathways different for those at greater risk of health disparities , e.g. , living in poverty , diagnosed with a serious mental disorder , member of minority group , and less than a high school education ? one potential advantage of pathway - specific quality measures could be the identification of pathway - specific interventions , as well as learning if specific interventions work equally well across multiple pathways . the iom committee on public health quality measures endorsed the use of predictive and system - based simulation models to understand health outcomes and consequences of underlying determinants of health . modeling pathways and transition probabilities could assist in identifying priority targets for intervention , simulating the expected impact of science - based interventions , and estimating the intervention outcomes and cost . the development of simulation models will require analytic work identifying population groups , pathways , and outcomes , and how they vary with individual and community characteristics . once done , many phas and communities may potentially be able to use and adapt validated pathway models to assess their intervention options and expected outcomes . the iom committee provided criteria for selecting conditions and outcomes for public health quality measurement and intervention .54 conditions should be reflective of a high preventable burden , and should be actionable at the appropriate level of intervention . the criteria recommended for choosing quality measures are the following : measures should be timely , usable across various populations , understandable , methodologically rigorous , and accepted and harmonized . putting measurement in a public health framework , measures may be used for assessment at a point in time ; for improvement requiring measurement over time ; and for accountability to demonstrate the value of investments , effectiveness , and efficiency with healthy outcomes ( e.g. , self - reported well - being and quality of life , functional status , mental health , and social engagement ) . since 2010 , cdc s national public health improvement initiative ( nphii ) has funded state - and local health departments to develop their capacity to undertake qi studies .55 qi relies on the application of evaluation methodologies , and organizational commitment to qi studies is a requirement for pha accreditation by the public health accreditation board . accreditation also requires gathering information for a community health assessment and the development of a community health improvement plan . in table 6 , research questions are proposed based on data needs to support quality measurement and assess quality performance . adequacy of resources is and will continue to be a concern in achieving the objective of transforming phas into data and evidence - driven learning public health organizations . per capita expenditures vary widely by state , possibly reflecting variations in the mix of urban and rural populations , the mix of public health services provided , and variation in using other organizations to provide essential services . also , per capita expenditures may reflect variations in health disparities by state and efficiency of the phas . information systems infrastructure needs to be sufficient to support the collection , analysis , and sharing of information across the public health system , including social service agencies and health providers . for example , alameda county social services agency serves 125,000 citizens supported by an interoperable information system fed by core state systems including welfare , employment services , elderly and disabled , school districts , juvenile probation , and oakland housing authority . information is available to every case manager for every client , and the system can be used to identify people receiving or eligible for services across programs and geographic areas . the director , don edwards , stated a primary goal is to help management and staff to do their jobs better and more efficiently .56 improving efficiency requires data on staffing , services , and costs to be routinely collected and examined to understand the flow of resources and to assess the value of programs and services ( value = ( quality or outcomes ) / cost ) . qi methods are useful for evaluating staffing options , technology , and work processes and making choices that improve the value of services . sources of inefficiency may be associated with lack of adequate training of personnel , organizational silos with overlapping responsibilities , and populations served without coordination of services . for example , the coordination of services by sharing information across agencies can reduce duplication , improve follow - up , and ensure the provision of all needed services . follow - back to service recipients and service providers can provide valuable information on the effectiveness of coordination and service quality . there could be benefits for the phas to move toward a uniform set of accounts and report expenditures and income as recommended by the iom .57 uniform accounting reports would facilitate benchmarking costs of essential services . uniform accounting would facilitate making comparisons across phas and would provide an information foundation for phas coming together in learning collaboratives to improve efficiency . in table 7research questions are proposed regarding potential efficiencies to be gained through sharing data systems and implementing uniform accounting systems . organizational capacity and committed pha leadership provide the essential foundation required for an lphs . pha organization and reporting relationships vary widely across states .31 in 23 states the pha is part of a large umbrella organization . umbrella organizations are ones in which the pha does not stand alone but has been merged with other health agencies under the same leadership . the astho survey reported that , in most cases , when pha is part of a larger umbrella organization it includes long - term care , medicaid and public assistance , and mental - health and substance - abuse services . among states without a large umbrella organization , some non - pha services may be present , including services for the aging and elderly , child and family services , services for individuals with disabilities , and licensure of health professionals and facilities . the implications for pha performance within an umbrella organization , as well as implications for pha leadership needed to grow the culture of an lphs , are not clear . phssr on pha organizational structures has examined three characteristics : differentiation ( the different programs and activities delivered ) , integration ( the extent to which services are provided through relationships with other organizations ) , and centrality ( the concentration or distribution of authority at the state - or local level ) .32 in an analysis of phas with 100,000 or greater population ( 17 percent of all phas ) , phas were found to vary widely in organizational structure , yet could be clustered in seven distinct configurations . examining organizational changes between 1998 and 2006 , many phas were found to have migrated from one configuration to another , changing the mix of differentiation , integration , and centrality in the organization . the research base linking agency structure to pha performance over time , and to health outcomes , is thin but growing .33 in table 4 , research questions are proposed related to organization and the performance of the pha as an lphs . while the explosion of data and data sources over the past few decades is providing new opportunities for public health , they are significant challenges for data users seeking the best data to inform public health surveillance , policy development , and assessment ( evaluation ) . electronic health records ( ehr ) are collecting rich clinical data that are largely free - text and not easily aggregated or analyzed . health interview surveys of the centers for disease control and prevention ( cdc ) national center for health statistics are nationally representative and informative , but sample sizes are insufficient for small area analysis , e.g. , at the county - or zip code levels . the bureau of the census s american community survey has the sample size needed to describe the socioeconomic characteristics of small population groups , but safeguards to protect confidentiality require users to analyze data through government data centers . health insurance claims data provide coded diagnoses , medical procedures , and preventive services for insured population groups but not for the uninsured . timely data is needed to ensure early recognition of emerging health threats , but cleaning of data sets and their availability may lag by months or years . the quality of data , as well as gaps in data , may be of concern . for example , there are few sources for measuring population health status and well - being . much more is known about disease , disability , and death than is known about population health . the importance of data in public health is in its applications for surveillance and health monitoring , for planning community qi initiatives , for intervention evaluation , and for research into innovative solutions for health problems . the development of learning organizations has been actively promoted in public health over the last decade . notably , the robert wood johnson foundation ( rwjf ) funded the common ground project to accelerate the transformation of information systems used in phas .34 the project relied on working groups drawn from participating phas with consultant support to address common core concerns , the standardization of data and data definitions , and key aspects of system redesign . the guiding concept was that all phas face common issues and have similar needs for information to respond to pandemics and bioterrorism , to intervene with chronic diseases , to establish best practices , and to develop training for public health staff . the experience was found to be positive for phas .35 more recently , the academic health department ( ahd ) learning community was established with cdc support and open to all phas . the ahd is meant to enhance public health education and training , research , and service by facilitating collaboration across the academic and practice communities . through this partnership , lphss are being developed and strengthened .36 in a parallel development under the health information technology for economic and clinical ( hitech ) act ,3717 beacon communities38 were funded on a competitive basis to develop models for community - level public health information systems . the beacon focus was on using electronic medical record ( emr ) data as a source of population health indicators , particularly morbidity and receipt of preventive services , which is unavailable in most communities . the program brought beacon communities together to share their learning experiences .39 the need for state - and local - level health data to inform pha priorities and program evaluation is widely recognized . the affordable care act of 2009 made funds available to expand the sample in the national center for health statistics surveys , making state - level estimates feasible . also , the bureau of the census s american community survey ( acs ) provides state - and community - level data on population characteristics . state health access data assistance center ( shadac ) , uses acs data and other sources to make available state - and county - level data on access to care , insurance coverage , and sources of insurance .40 comparable national data on community health status and need for services are not available . for this reason , there is increasing interest in using clinical data from ehrs to meet some of these information needs . the volume of electronic data sent and received by phas is increasing .41 in a recent astho survey , over 80 percent reported exchanging electronic data directly with providers , and 20 percent reported using direct data exchange through an intermediary . more than 90 percent of state agencies exchange information with hospitals , and over 80 percent report electronic information exchange with laboratories , providers , and local health departments . exchange of data with medicaid agencies is reported by over 60 percent , with community health centers by over 50 percent , and with insurers and health plans by over 40 percent . there are recognized limitations and implementation barriers to be considered in using emr for public health purposes . these include the following : ( 1 ) emrs may be missing the desired data , including environmental and psychological factors , and data reliability and validity is uneven ; and ( 2 ) phas may lack staff with necessary skill levels and may lack the resources to build a centralized system .42 building on the lessons learned in common ground and beacon communities , the ahd is supporting a collaborative process for phas to learn how to access and make best use of existing and new data sources in collaboration with academic settings . the need for state - and local - level health data to inform pha priorities and program evaluation is widely recognized . the affordable care act of 2009 made funds available to expand the sample in the national center for health statistics surveys , making state - level estimates feasible . also , the bureau of the census s american community survey ( acs ) provides state - and community - level data on population characteristics . state health access data assistance center ( shadac ) , uses acs data and other sources to make available state - and county - level data on access to care , insurance coverage , and sources of insurance .40 comparable national data on community health status and need for services are not available . for this reason , there is increasing interest in using clinical data from ehrs to meet some of these information needs . the volume of electronic data sent and received by phas is increasing .41 in a recent astho survey , over 80 percent reported exchanging electronic data directly with providers , and 20 percent reported using direct data exchange through an intermediary . . more than 90 percent of state agencies exchange information with hospitals , and over 80 percent report electronic information exchange with laboratories , providers , and local health departments . exchange of data with medicaid agencies is reported by over 60 percent , with community health centers by over 50 percent , and with insurers and health plans by over 40 percent . there are recognized limitations and implementation barriers to be considered in using emr for public health purposes . these include the following : ( 1 ) emrs may be missing the desired data , including environmental and psychological factors , and data reliability and validity is uneven ; and ( 2 ) phas may lack staff with necessary skill levels and may lack the resources to build a centralized system .42 building on the lessons learned in common ground and beacon communities , the ahd is supporting a collaborative process for phas to learn how to access and make best use of existing and new data sources in collaboration with academic settings . in addition , phas need timely access to information based on systematic reviews of scientific evidence . in the united states , the responsibility for evidence - based reviews and evidence - based practice guidelines is widely dispersed . this is not true for preventive services where evidence - based reviews are done by the u.s . preventive services taskforce .43 complementing the evidence - based reviews is the work of the community preventive services task force supported by the cdc . it is providing evidence - based reviews on preventive interventions for communities covering 22 major topic areas .44 together , the two taskforces are providing critical systematic reviews of scientific evidence needed by phas . in table 4 , research questions are proposed regarding the organizational and data infrastructure and implications for becoming an lphs . the congressionally mandated report on the national quality strategy states its aim as being to improve the health of the u.s . population by supporting proven interventions to address behavioral , social , and environmental determinants of health in addition to delivering higher quality care .45 the 2013 iom report , toward quality measures in public health46 endorses nine aims for quality improvement in public health systems as proposed by the public health quality forum ( phqf ) .47 a quality public health system should be population centered , equitable , proactive , health promoting , risk reducing , vigilant , transparent , effective , and efficient ( table 5 ) . the definition of quality in public health parallels the definition of quality for medical care : the degree to which policies , programs , services and research for the population increase desired health outcomes and conditions in which the population can be healthy .48 central to measuring quality is the measurement of desired health outcomes within population groups , data that are not generally collected . we rely on scientific studies to provide evidence on the relationship of services and specific outcomes , usually clinical outcomes . outcomes desired by population groups will likely go beyond clinical indicators and will include well - being and functional capacity . if so , additional research will most likely be needed . the nine public health quality aims set out by phqf ( table 5 ) build on donabedian s quality measurement framework of structure , process , and outcome .49,50 they include the six iom quality aims of medical care , and add quality dimensions of phas being proactive , health promoting , and vigilant .51 the 2013 iom public health quality report , gives sample measures for quality in achieving united states health objectives for nutrition , physical activity and obesity .52,53 to be useful for examining population health , the measures must be amenable to distributional analysis and facilitate the identification of disparities across population subgroups . from a systems perspectiveone might ask , does the quality metric need to be adapted for specific pathways or is a comprehensive measure valid , and how can these metrics be used to help understand the pathways that lead to poor nutrition , limited physical activity , and obesity ? how often do poor nutrition , limited physical activity , and obesity co - occur ? are pathways different for those at greater risk of health disparities , e.g. , living in poverty , diagnosed with a serious mental disorder , member of minority group , and less than a high school education ? one potential advantage of pathway - specific quality measures could be the identification of pathway - specific interventions , as well as learning if specific interventions work equally well across multiple pathways . the iom committee on public health quality measures endorsed the use of predictive and system - based simulation models to understand health outcomes and consequences of underlying determinants of health . modeling pathways and transition probabilities could assist in identifying priority targets for intervention , simulating the expected impact of science - based interventions , and estimating the intervention outcomes and cost . the development of simulation models will require analytic work identifying population groups , pathways , and outcomes , and how they vary with individual and community characteristics . once done , many phas and communities may potentially be able to use and adapt validated pathway models to assess their intervention options and expected outcomes . the iom committee provided criteria for selecting conditions and outcomes for public health quality measurement and intervention .54 conditions should be reflective of a high preventable burden , and should be actionable at the appropriate level of intervention . the criteria recommended for choosing quality measures are the following : measures should be timely , usable across various populations , understandable , methodologically rigorous , and accepted and harmonized . putting measurement in a public health framework , measures may be used for assessment at a point in time ; for improvement requiring measurement over time ; and for accountability to demonstrate the value of investments , effectiveness , and efficiency with healthy outcomes ( e.g. , self - reported well - being and quality of life , functional status , mental health , and social engagement ) . since 2010 , cdc s national public health improvement initiative ( nphii ) has funded state - and local health departments to develop their capacity to undertake qi studies .55 qi relies on the application of evaluation methodologies , and organizational commitment to qi studies is a requirement for pha accreditation by the public health accreditation board . accreditation also requires gathering information for a community health assessment and the development of a community health improvement plan . in table 6 , research questions are proposed based on data needs to support quality measurement and assess quality performance . adequacy of resources is and will continue to be a concern in achieving the objective of transforming phas into data and evidence - driven learning public health organizations . per capita expenditures vary widely by state , possibly reflecting variations in the mix of urban and rural populations , the mix of public health services provided , and variation in using other organizations to provide essential services . also , per capita expenditures may reflect variations in health disparities by state and efficiency of the phas . information systems infrastructure needs to be sufficient to support the collection , analysis , and sharing of information across the public health system , including social service agencies and health providers . for example , alameda county social services agency serves 125,000 citizens supported by an interoperable information system fed by core state systems including welfare , employment services , elderly and disabled , school districts , juvenile probation , and oakland housing authority . information is available to every case manager for every client , and the system can be used to identify people receiving or eligible for services across programs and geographic areas . the director , don edwards , stated a primary goal is to help management and staff to do their jobs better and more efficiently .56 improving efficiency requires data on staffing , services , and costs to be routinely collected and examined to understand the flow of resources and to assess the value of programs and services ( value = ( quality or outcomes ) / cost ) . qi methods are useful for evaluating staffing options , technology , and work processes and making choices that improve the value of services . sources of inefficiency may be associated with lack of adequate training of personnel , organizational silos with overlapping responsibilities , and populations served without coordination of services . for example , the coordination of services by sharing information across agencies can reduce duplication , improve follow - up , and ensure the provision of all needed services . follow - back to service recipients and service providers can provide valuable information on the effectiveness of coordination and service quality . there could be benefits for the phas to move toward a uniform set of accounts and report expenditures and income as recommended by the iom .57 uniform accounting reports would facilitate benchmarking costs of essential services . uniform accounting would facilitate making comparisons across phas and would provide an information foundation for phas coming together in learning collaboratives to improve efficiency . in table 7research questions are proposed regarding potential efficiencies to be gained through sharing data systems and implementing uniform accounting systems . the organization of public health agencies , their legal mandates , levels of funding , and provision of the 10 essential services vary widely by state and by individual public health department within the state . variation is fine if the organizational structure , leadership , staffing , and resources match the needs of the populations being served with high quality services at a reasonable cost . variations inconsistent with population needs and unresponsive to disparities should not be acceptable . achieving the goals of public healthis to meet the needs of populations for access to housing , education , income and jobs , health insurance , medical and mental health services , and preventive services and reduction in behavioral health risks . it is likely that the variations found across phas are a combination of variations in levels of need as well as variations in capacity of phas to meeting unmet needs . if the notion of pha leaders as chief health strategists were embraced , public health could lead the charge toward healthier communities by enhancing the effectiveness and efficiency of phas ; fostering innovation in data collection and use ; and driving partnerships with other government agencies , community organizations , businesses , and foundations toward common goals . to be effective , public health needs to collect and analyze data , and to continually evaluate population health needs in collaboration with the community , the services provided , population health , and future priorities . accreditation , leadership , and continuous qi can help public health agencies build and shape the skills needed to become an lphs . by maximizing present opportunities to use new data streams and evaluate innovative new programs , phssr can play a major role in providing the evidence base that is needed to drive and sustain lphs . working with the research community , the time has come for public health agencies to engage in transformational change to improve effectiveness , efficiency , and the health of the nation .\noutput:\n" }, { "from": "agent", "value": "introduction : this paper examines the organization , services , and priorities of public health agencies and their capacity to be learning public health systems ( lphs ) . an lphs uses data to measure population health and health risks and to evaluate its services and programs , and then integrates its own research with advances in scientific knowledge to innovate and improve its efficiency and effectiveness.public health agencies and impact for lphs : public health agencies ( pha ) organizational characteristics vary across states , as does their funding per capita . variations in organization , services provided , and expenditures per capita may reflect variations in community needs or may be associated with unmet needs . the status of legal statutes defining responsibilities and authorities and their relationships to other public and private agencies also vary . little information is available on the efficiency and effectiveness of state and local phas , in part due to a lack of information infrastructure to capture uniform data on services provided . there are almost no data on the relationship of quality of services , staff performance , and resources to population health outcomes . by building a capacity to collect and analyze data on population health within and across communities , and by becoming a continuous learning pha , the allocation of resources can more closely match population health needs and improve health outcomes . accreditation of every pha is an important first step toward becoming a learning pha.conclusions : public health services and systems research ( phssr ) is beginning to shed light on some of these issues , particularly by investigating variation across phas . as this emerging discipline grows , there is a need to enhance the collection and use of data in support of building organized , effective , and efficient lphss with the pha capacity to continually improve the public s health ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we present a unique case of a dual injury , renal as well as ureteric , in a crossed ectopic kidney without fusion that was successfully managed without surgical excision . a 40 - year - old male patient was admitted to the department of urology , calcutta national medical college , with a complaint of clear fluid discharge from an intra - abdominal drain placed on the right side of his lower abdomen . he had a history of an open appendicectomy done at a primary health care center 3 weeks previously for clinically suspected acute appendicitis . according to the operating surgeon 's briefthe surgeon was able to dissect out the appendix with difficulty . during the dissection , the surgeon suspected a ureteral injury but was unable to repair it ; hence , he inserted a drain and referred the patient to us for further management . on examination , the patient was anxious but his clinical parameters , hemogram , renal function tests , and serum biochemistry were normal . there was an output of approximately 500 to 600 ml per day from the abdominal drain . analysis of the drain fluid revealed a high creatinine level , which suggested that the output was urine . the right kidney and ureter were normal on the intravenous pyelogram ( ivp ) but the left kidney was not seen in its anatomical position . on careful examination of the ivp , a faint shadow with areas of contrast excretion could be seen on the right side , especially in late films at the level of the fourth and fifth lumbar vertebrae ( fig .1 a ) . considering the possibility of crossed renal ectopia , contrast enhanced computed tomography ( cect ) was performed , which confirmed the diagnosis ( fig . the ectopic left kidney was small and showed excretion of contrast with evidence of hydronephrosis . a retrograde pyelogram ( rgp ) on the left side showed a hydronephrotic kidney with distorted pelvicalyceal system . there was also an area of narrowing in the ureter suggestive of stricture , which presumably led to the hydronephrosis ( fig . the patient was diagnosed to have a dual injury , renal as well as ureteric . a 5 - fr double j ( dj ) stentwas placed in the ectopic kidney , albeit with some difficulty , under fluoroscopic guidance ( fig . abdominal ultrasound , performed on the fifth postoperative day , did not reveal any abdominal collection . the dj stent was removed in the sixth postoperative week . at the 9 - month follow - up , the patient was doing well . the diethylene triamine pentaacetic acid ( dtpa ) scan performed in the follow - up perioda kidney located on the side opposite of its ureteral insertion is known as crossed ectopia . the anomaly occurs more commonly in males , and left - to - right ectopia is three times as common as right - to - left ectopia . abnormal umbilical arteries , ureteral abnormalities , induction of the contralateral nephronal anlage , malalignment , and abnormal rotation of the caudal part of the fetus have been postulated as possible causes . ninety percent of crossed ectopic kidneys are fused to their ipsilateral uncrossed renal unit . crossed renal ectopia without fusion is rare , with only 62 patients reported to date . the uncrossed kidney is usually normal in size , anatomical position , and orientation , whereas the crossed , ectopic kidney lies inferiorly in a skewed position with an anteriorly placed pelvis . the two renal units are separated from each other by a variable distance , and each unit has its own separate fascia of gerota . it is not unusual for crossed ectopic kidneys to remain undiagnosed throughout the life of a person , because they may function normally . they may be incidentally diagnosed when a patient is being evaluated for unrelated conditions . in some cases , the ectopic kidney may be the cause of pain or urinary problems . diagnosing a disease in such ectopic kidneys is often challenging . ultrasonography , ivp , dtpa , cect , and magnetic resonance imaging may be helpful in the anatomical as well as the functional evaluation of such kidneys . location of the ureteric orifices at cystoscopy supplemented by rgp may also be helpful in confirming the diagnosis . owing to the rarity of this condition , it is not exceptional for a surgeon to be unmindful of this abnormality and to injure it during surgery . the injury may necessitate the removal of the ectopic kidney . ignjatovic et al . also suggested that surgery in ectopic kidneys , if performed , should be done only once and should preferably be a nephrectomy . on the other hand , there are occasional reports of such injuries being managed conservatively . in the case presented above , both the ectopic kidney and the ureter were injured during the appendectomy , leading to hydronephrosis and urinary leakage . to the best of our knowledge , this is the first case report of conservative management of a dual injury in a crossed ectopic kidney without fusion . in conclusion , our case highlights that conservative management is possible in a crossed ectopic kidney without fusion and should be tried before contemplating surgery .\noutput:\n" }, { "from": "agent", "value": "crossed renal ectopia is a condition in which a kidney is located on the side opposite of its ureteral insertion . ninety percent of crossed ectopic kidneys are fused to their ipsilateral uncrossed renal unit . crossed renal ectopia without fusion is rare , with only 62 patients reported in the literature to date . these kidneys may suffer iatrogenic injury during an unrelated surgical intervention . the injury , unless self - limiting , may necessitate the removal of the ectopic kidney . we present a unique case of a dual injury , renal as well as ureteric , in a crossed ectopic kidney without fusion that was successfully managed without surgical excision ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a cross - sectional design was employed and written informed consent was obtained from all the subjects taken up for the study . all asymptomatic hiv patients who were admitted to the hospital at the time of evaluation were included in the study . staging of hiv seropositive cases was carried out as per centers for disease control ( cdc ) classification . although interviewers knew of the seropositive status , they were not aware of the stage of hiv disease prior to the psychological assessment . an equal number of normal persons were selected as controls . the controls were comparable with the cases regarding their age , education , sex , monthly income and occupation . confirmed hiv seropositivityphysically asymptomatic in stage ii or iiiage between 15 and 50 years . confirmed hiv seropositivity physically asymptomatic in stage ii or iii age between 15 and 50 years . confirmed hiv seronegativityage between 15 and 50 yearsphysically asymptomatic at the time of evaluation . confirmed hiv seronegativity age between 15 and 50 years physically asymptomatic at the time of evaluation . past history or presence of central nervous system disordershistory of head injury with loss of consciousnesspast history of psychiatric illnesspatients who qualify acquired immune deficiency syndrome ( aids ) defining criteria . past history or presence of central nervous system disorders history of head injury with loss of consciousness past history of psychiatric illness patients who qualify acquired immune deficiency syndrome ( aids ) defining criteria . after enrolment into the study , a semi - structured proforma was used to record demographic details and assess risk factors for hiv infection . physical examination , mental status evaluation and relevant laboratory investigations ( hemogram , urine routine examination , liver function test , hepatitis b antigen , venereal disease research laboratory and others if required ) were carried out to exclude cases and controls not eligible for the study . psychiatric diagnoses were made as per the icd - 10 classification of mental and behavioral disorders diagnostic criteria for research . all subjects underwent the following psychiatric rating scales : general health questionnaire ( ghq ) mini mental state examination ( mmse ) hospital anxiety and depression scale ( hads ) sensation seeking scale ( indian adaptation ) . general health questionnaire ( ghq ) mini mental state examination ( mmse ) hospital anxiety and depression scale ( hads ) sensation seeking scale ( indian adaptation ) . the socio - demographic characteristics of the group were compared by the chi - square test . for comparing the scores on psychiatric ratingall asymptomatic hiv patients who were admitted to the hospital at the time of evaluation were included in the study . staging of hiv seropositive cases was carried out as per centers for disease control ( cdc ) classification . although interviewers knew of the seropositive status , they were not aware of the stage of hiv disease prior to the psychological assessment . an equal number of normal persons were selected as controls . the controls were comparable with the cases regarding their age , education , sex , monthly income and occupation . confirmed hiv seropositivityphysically asymptomatic in stage ii or iiiage between 15 and 50 years . confirmed hiv seropositivity physically asymptomatic in stage ii or iii age between 15 and 50 yearsconfirmed hiv seronegativityage between 15 and 50 yearsphysically asymptomatic at the time of evaluation . confirmed hiv seronegativity age between 15 and 50 years physically asymptomatic at the time of evaluationpast history or presence of central nervous system disordershistory of head injury with loss of consciousnesspast history of psychiatric illnesspatients who qualify acquired immune deficiency syndrome ( aids ) defining criteria . past history or presence ofcentral nervous system disorders history of head injury with loss of consciousness past history of psychiatric illness patients who qualify acquired immune deficiency syndrome ( aids ) defining criteria . after enrolment into the study , a semi - structured proforma was used to record demographic details and assess risk factors for hiv infection . physical examination , mental status evaluation and relevant laboratory investigations ( hemogram , urine routine examination , liver function test , hepatitis b antigen , venereal disease research laboratory and others if required ) were carried out to exclude cases and controls not eligible for the study . psychiatric diagnoses were made as per the icd - 10 classification of mental and behavioral disorders diagnostic criteria for research . all subjects underwent the following psychiatric rating scales : general health questionnaire ( ghq ) mini mental state examination ( mmse ) hospital anxiety and depression scale ( hads ) sensation seeking scale ( indian adaptation ) . general health questionnaire ( ghq ) mini mental state examination ( mmse ) hospital anxiety and depression scale ( hads ) sensation seeking scale ( indian adaptation ) . the socio - demographic characteristics of the group were compared by the chi - square test . for comparing the scores on psychiatric rating scales the mann - whitney u - test was used . a total of 200 subjects were included in the study of which 100 were cases ( hiv seropositive ) and 100 were controls ( hiv seronegative ) . this selection bias was due to the fact that the hospital catered to predominantly male population . of the hiv seropositive patients 75 were married compared with 73 of the seronegative subjects . the difference was not statistically significant ( = 0.03 ; df = 1 ; p = 0.872 ) . though 75 % of the hiv seropositive subjects were married however , only 5 - 6 % was staying with their spouses due to the nature of their employment . duration of hiv seropositivity was 0 - 6 months in 55 patients ; nine patients each were seropostive for 6 - 12 months , 12 - 18 months and 18 - 24 months ; seven patients each were seropositive for 24 - 30 and 30 - 36 months ; while two patients each were positive for 36 - 42 months and 42 months . the risk factors for hiv infection included heterosexual promiscuity ( n = 85 ) , multiple injections / tattooing ( n = 3 ) , transfusion of unscreened blood ( n = 2 ) , health worker handling infected blood ( n = 1 ) while in nine patients no risk factor could be identified . neither cases nor controls showed any cognitive dysfunction on mmse ( score 24 ) . the observed ghq - 12 caseness ( a cut - off score of 2 ) for hiv and control groups was 49 and 9 respectively [ table 2 ] . the difference was statistically significant ( = 38.85 ; df = 1 ; p 0.0001 ) . all the patients who ultimately were given a psychiatric diagnosis had abnormal scores on ghq . thus in the present study , ghq - 12 had a sensitivity of 100 % and specificity of 92 % for detecting psychiatric morbidity in asymptomatic hiv patients . demographic characteristics of hiv positive and negative subjects results of ghq and hads results of sensation seeking scale psychiatric disorders in asymptomatic hiv subjectthe fundamental premise of modern psychiatry is that emotional life and behaviors have biological underpinnings that develop and are shaped within a broader social context . perhaps that interplay is nowhere more evident than in the psychobiology of hiv infection . the changing face of the hiv pandemic from one of accelerating deterioration to a more chronic course suggests that the role of clinical psychiatry must expand to encompass new populations and to adapt to changing neuromedical aspects of illness . the transition model proposes that adverse psychological phenomenon ( e.g. , adjustment disorders , mood disorders and anxiety disorders ) may be anticipated at key points such as discovery of seroconversion , initiation of anti - retroviral treatment , onset of physical symptoms , advance in hiv related illness stage and hiv related bereavement and that they reflect a breakdown in coping capacities in the face of hiv . various studies have suggested that four factors are important in explaining the increased psychiatric morbidity in hiv patients . they are pre - existing psychiatric morbidity , neurotoxic property of hiv itself , terminal nature of diagnosis and social stigmatization . in the present study , the psychiatric morbidity was assessed in asymptomatic hiv patients ( stage ii and iii of cdc classification ) as psychiatric manifestations in advanced stages , i.e. , aids may be due to opportunistic or central nervous system infections . these guidelines were not followed by many of the studies , which resulted in erroneous observations . some studies have kept sexually transmitted diseases patients as controls in view of similar social stigmatization , others high risk hiv seronegative persons ( homosexuals and iv drug users ) and still others rheumatoid arthritis . control subjects in this study were the normal healthy persons who had the same atmosphere and background as of the cases . normal persons were kept as controls to find out the exact phenomenology of asymptomatic hiv patients and their difference in sensation seeking . most of the studies have assessed one or at the most two of the variables and that too on symptomatic population . the age range of the patients in present study table 1 was on par with other studies . on the other hand , the western studies had higher number of homosexual transmission and intravenous drug abuse . the observed ghq - 12 caseness ( a cut - off score of 2 ) for hiv and control groups [ table 2 ] was within the ranges reported in literature . in the present study , ghq - 12 had a sensitivity of 100 % and specificity of 92 % indicating that it is a good screening test for psychiatric morbidity in asymptomatic hiv patients . the finding of absence of cognitive dysfunction in patients in the present study is in agreement with an earlier study . contrary findings of 10.5 % cognitive impairment in an earlier indian study was probably due to inclusion of symptomatic ( stage iv cdc ) hiv patients in that study . we can conclude from the above observations that asymptomatic hiv patients do not result in any gross cognitive dysfunction . singh et al . studied cognitive function in asymptomatic hiv seropositive individuals by using luria - nebraska neuropsychological battery and reported slower fine motor speed and slower speed of information processing and no difference in any other cognitive domain . this indicates that the utility of mmse as a good screening test for assessment of cognitive dysfunction in asymptomatic hiv patients needs further evaluation . the observation of higher prevalence of anxiety on hads [ table 2 ] in hiv seropositive individuals was similar to earlier studies . the very knowledge of harboring a potentially fatal infection of uncertain prognosis , with bleak treatment prospects and possible suffering and social isolation can be sufficiently stressful to induce anxietythe finding of significantly higher depression on hads [ table 2 ] in hiv seropositive subjects is similar to earlier studies . among hiv patients , clinical depression has been reported frequently , but estimates concerning its prevalence has varied considerably ( 30 - 61 % ) , but always greater than in the general population ( 4 - 40 % ) . it is not yet determined whether hiv itself increases the likelihood of major depressive disorder beyond the expected increases found in other chronic diseases . hiv infection can be associated with anergic - apathetic - fatigue states , presumably mediated by release of somnogenic lymphokines . various studies have brought out factors , which led to higher rates of depression in hiv patients : decline of immunocompetence , adverse life events , pre - existing mood disorder , noting the onset of constitutional symptoms and initiating retroviral therapy . it is imperative that depression in hiv positive patients must be identified and treated because depression has been associated with a lower likelihood of receiving anti - retrovirals and poor adherence , which leads to a worse outcome in hiv infected persons and increased mortality . sensation seeking is a personality factor that could have an important role in hiv risk behavior . sensation seeking focuses on the need for new and varied experiences through uninhibited behavior , these include dangerous activities , a non - conventional life - style and a rejection of monotony . sensation seeking trait was assessed under the four different characteristics in the present study table 3 . thrill and adventure seeking , experience seeking and boredom susceptibility revealed statistically significant higher scores in asymptomatic hiv patients compared with hiv seronegative controls . high sensation seeking trait may play a vital role in engaging in high - risk behavior resulting in this dreaded illness . more complementary studies are needed to identify different aspects of sensation seeking and methods of effective intervention for prevention of hiv . in the present study , hiv seropositive patients had significantly higher incidence of psychiatric disorders including alcohol dependence , adjustment disorder and sexual dysfunction [ table 4 ] . five out of the nine hiv seropositive patients with sexual dysfunction had no concurrent axis 1 diagnosis . impaired sexual functioning contributes to diminished quality of life for seropositive patients , many of whom report this as a significant loss in their lives . the high prevalence of sexual dysfunction in these patients is an important finding given the low base rates of this disorder in male population under age 44 . overall , there was moderate agreement between interviewer 's diagnosis of depression and patient 's self - report of depressive symptoms on an assessment scale in the present study , consistent with the findings of an earlier study . the significantly higher prevalence of alcohol dependence syndrome confirmed the findings by rosenberg et al . who reported alcohol as the strongest predictor of hiv drug risk behaviors , stronger than drug use generally . most patients with substance abuse disorders had developed these disorders before acquiring hiv which is in agreement with earlier report . substance abusers are prone to have high risk sexual behaviors , as there is a higher rate of non - inhibition , impaired judgment and impulsivity . for these same reasons , mounting evidence suggests that these patients have accelerated and more severe neurocognitive dysfunction compared with non - substance - abusing hiv - infected populations . psychiatric morbidity is significantly higher in asymptomatic hiv patients as compared to hiv seronegative controls . among the individual disorders , alcohol dependence syndrome , sexual dysfunction and adjustment disorderhigh sensation seeking and substance abuse found in hiv seropositive patients may play a vital role in engaging in high - risk behavior resulting in this dreaded illness .\noutput:\n" }, { "from": "agent", "value": "background : psychiatric morbidity in human immunodeficiency virus ( hiv ) patients is being studied all over the world . there is paucity of indian literature particularly in asymptomatic hiv individuals.aim : the aim of the following study is to establish the prevalence and the determinants of psychiatric morbidity in asymptomatic hiv patients.materials and methods : a cross - sectional study was undertaken to assess psychiatric morbidity as per icd - 10 dacryocystorhinostomy criteria in 100 consecutive asymptomatic seropositive hiv patients and an equal number of age , sex , education , economic and marital status matched hiv seronegative control . all subjects were assessed with the general health questionnaire ( ghq ) , mini mental status examination , hospital anxiety and depression scale ( hads ) and sensation seeking scale ( sss ) and the scores were analyzed statistically.results : asymptomatic hiv positive patients had significantly higher ghq caseness and depression but not anxiety on hads as compared to hiv seronegative controls . on sss asymptomatic hiv seropositive subjects showed significant higher scores in thrill and adventure seeking , experience seeking and boredom susceptibility as compared to controls . hiv seropositive patients had significantly higher incidence of total psychiatric morbidity . among the individual disorders , alcohol dependence syndrome , sexual dysfunction and adjustment disorder were significantly increased compared with hiv seronegative controls.conclusion : psychiatric morbidity is higher in asymptomatic hiv patients when compared to hiv seronegative controls . among the individual disorders , alcohol dependence syndrome , sexual dysfunction and adjustment disorder were significantly increased compared with hiv seronegative controls . high sensation seeking and substance abuse found in hiv seropositive patients may play a vital role in engaging in high - risk behavior resulting in this dreaded illness ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: conservative projections indicate that brazil will have the sixth largest elderly population in the world by 2020 , with over 30 million people classified as elderly .1,2 recent studies have shown that chronic disease and incapacity are not inevitable consequences of the aging process . prevention is effective in all age groups , even in the latest stages of life .1 therefore , an emphasis on prevention is important in terms of changing the current framework of incapacity and comorbidity . loss of muscle quality and quantity and reduced muscle strength with advancing age contributes significantly to a decline in the performance of activities of daily living ( adl ) , resulting in reduced mobility , slower gait speed , and changes in balance as well as an increased risk of falls . thus , there is an increase in incapacity .2,3 the benefits of exercise in the elderly are well established , and include reduced fragility , increased gait speed , and increased performance of adl . exercise also provides independence and improves quality of life .3 elderly people who undertake a regular exercise program show better balance and have a reduced risk of falling .4,5 adherence is defined as the number of sessions attended divided by the number of sessions offered , and according to the literature , this relationship is frequently very low .6 the evidence suggests that 50 % of people who begin a program of exercise discontinue within 6 months .79 an adherence level of at least 80 % 85 % is recommended if the results of an intervention are to be satisfactory and if the intervention is to have therapeutic value .10 another important concept for exercise intervention is retention . this involves maintenance of the individual bond to a program of exercises as an experimental or clinical model . an individual may be linked to an exercise program throughout the period and without proper frequency , ie , without satisfactory adherence .7 kruger et al evaluated 6,000 elderly subjects and found that only 11 % reported regular participation in a muscle strength training program .11 this study , which included a significant number of participants , showed the difficulties of adherence with exercise programs among the elderly . further , in a study investigating elderly subjects with chronic pain , sluijs et al12 showed that 70 % of participants failed to adhere to a program of therapeutic exercise in the long - term . in addition , taylor et al13 found that rates of adherence with exercise among elderly individuals were approximately 14 % to 17 % . health professionals have made considerable effort to identify factors related to adherence with therapeutic exercise by elderly people , in view of the fact that it could allow for greater success of proposed treatments , maintain patient independence , increase muscle capacity and function , and minimize ongoing use of health care services .14 however , there is no consensus in the literature as to the factors that contribute to adherence with exercise programs in the elderly . in addition , there is a lack of standardized instruments for measurement of compliance .4,6,15 social , economic , and cultural factors may influence adherence , so surveys of adherence should be performed locally . we can not extrapolate the results of international studies to the brazilian population , which exists in a completely different context . further , there have been few studies in which adherence has been a primary outcome and in brazil there is no similar research . the objectives of the present study were to identify rates of adherence and retention in elderly women participating in aerobic exercise or muscle strength training programs and to identify the motivators , barriers , and clinical / functional factors associated with adherence of elderly women with therapeutic exercise programs . this study was approved by the ethical and research committee of the federal university of minas gerais ( etic 38/2010 , with approval of an addendum ) . details of the original project are in the registry of brazilian clinical trials ( rebec rbr9v9cwf ) . our study population comprised a convenience sample of women aged 65 years or older who lived in the community and were recruited by advertising among third - age groups and associations as well as in newspapers . the sample was not randomized , and the study design involved development of two exercise programs at different points in time . the first volunteers were allocated to a muscle strengthening group , and when enough participants had been enrolled in this group , subsequent volunteers were allocated to an aerobic exercise group . we excluded anyone who showed cognitive changes detectable on the brazilian version16 of the mini - mental state examination . we also excluded subjects who had undergone orthopedic leg surgery , those with a history of fracture in the previous 6 months , those with a neurological disorder , and those with clinical or sensory conditions that precluded their participation in an exercise program . we calculated the sample size using the following regression model formula : 10 ( k + 1 ) , in which k represents the number of explanatory variables in the model .16,17 for each intervention group , three models of regression were used to explain adherence or failure to adhere . the ten explanatory variables used for the model , chosen from the theoretical framework , were : the timed up and go test ,18 the sit - to - stand test ,19 habitual gait speed ,20,21 history of falls , presence of pain , number of comorbidities , self - rated health ,22,23 depressive symptoms ,24 self - rated stress ,25 and cognitive capability .16 the other two models were constructed to include 13 motivators and 12 barriers according to the adherence questionnaire developed by researchers . thus , 10 ( 13 + 1 ) = 140 elderly women were necessary for each group . for sample characterization , we obtained sociodemographic data and information relevant to the clinical status of our elderly female study participants using a questionnaire developed by the researchers . folstein et al26 recommended the mini - mental state examination as a useful screening tool for detection of cognitive impairment in both the clinical and research setting . in 1994 , bertolucci et al published a version of the mini - mental state examination adapted for the brazilian population .16 in the present study , we used this tool as a reference for cutoff points , with a score of 13 for illiterate elderly and a score of 24 for educated elderly , given that previous studies have demonstrated this scale to have good reliability .27,28 in the present study , the mini - mental state examination was used for subject exclusion and test scores were used as an explanatory variable in the regression model to evaluate the association between adherence and cognitive capacity in the study subjects .29,30 the geriatric depression scale ( gds ) was used to screen for the presence of depressive symptoms , and was administered by structured interview . the 15 - item gds scale ( gds - 15 ) is a short version of the original scale developed by sheikh and yesavage24 and contains items that are most strongly matched with a diagnosis of depression . previous studies have demonstrated that symptoms of depression can interfere with the undertaking of physical exercise and that elderly people experiencing mood changes and general depressive symptoms are less committed to the intervention and therefore the results are worse . a 14 - item scale of perceived stress was used to evaluate the level of stress in our study participants . this scale evaluated three factors considered to be the main components in the experience of stress , ie , the extent to which individuals rate their lives as unpredictable , uncontrollable , and overloaded .31 henry et al32 found that patients who are asked to perform many exercises do not perform as well in terms of adherence . in addition , a prescription for excessive exercise can negatively affect adherence in elderly women .10,25 self - evaluation of health status was determined by a simple question , in a general way , how do you consider your health ? . the answer to this question is one of the most commonly used indices in gerontological research and is an important indicator of functional decline and consequent restriction of activity .22,23 the literature demonstrates that elderly women with greater adherence are the most likely to get involved in other programs for promoting health , and that this is directly linked to their behavior , perception of their health , motivation , and self - efficacy .30 we selected three tests to evaluate functional capacity , all of which can be carried out simply and rapidly in clinic practice ; these tests are also valid and reliable in the elderly population . we used these tests because elderly people with lower functional performance find it more difficult to develop regular exercise habits .14 we measured walking speed over 10 minutes to evaluate habitual gait speed . pace was registered only in the middle 6 m of a lane , identified by tape markings , to avoid acceleration and deceleration bias .20,21,33 we used the timed up and go test to evaluate mobility . this test records the time taken for a subject to stand up without using their arms from a sitting position in a standardized chair with a seat height of 45 cm , walk 3 m , turn around , and return to the seat and sit down again . this test has high interrater reliability ( intraclass correlation coefficient 0.99 ) and intrarater reliability ( intraclass correlation coefficient 0.99 ) .18,34 to evaluate functional performance in terms of sitting and standing , which is an indirect measure of strength in the legs and is associated with decline of function and capability , we used the sit - to - stand test with a standardized chair of 45 cm and floor height as the reference .19,20 there are no previous examples of adherence questionnaires validated and adapted for an elderly population in brazil .35 therefore , we developed our own adherence questionnaire based on the literature and on the cultural , economic , and social context of brazil . this questionnaire contained questions on the following three components : reasons for lack of attendance at sessions , motivating factors , and barriers to adherence with the different therapeutic exercise programs . as part of the development of this instrument , we trialed the questionnaire in ten elderly subjects participating in a physical exercise program . the necessary adjustments were made until the final version of the questionnaire was ready for use . intraobserver and interobserver variability were assessed by the kappa coefficient and this resulted in excellent intraobserver reliability ( kappa coefficient 0.846 ) and interobserver reliability ( kappa coefficient 0.822 ) . first , the brazilian version26 of the mini - mental state examination was used to exclude elderly women with cognitive impairment . this was followed by a clinical sociodemographic questionnaire in the form of a structured interview for characterization of the sample .16 for the functional tests , all participants were given the same verbal instructions and the investigators demonstrated tests before the participants carried them out . after the initial evaluation , the elderly women were allocated to a therapeutic exercise group , ie , either muscle strength training or aerobic exercise . each program lasted 10 weeks and comprised three sessions weekly , each lasting approximately 50 minutes and guided by physiotherapists and members of the research team . the muscular strength training group carried out leg exercises involving concentric and eccentric contraction with resistance , with the load tailored to meet individual requirements and ability . the load appropriate for each participant was defined by calculation of maximum resistance .36 the aerobic exercise program was based on a protocol recommended by the american college of sport medicine ( 2009 ) for the elderly , and comprised 5 minutes of warming up , 40 minutes of aerobic activity , including exercises for the arms and legs while walking , orthostatic exercise , and a 5 - minute recovery period . before and after each exercise session , blood pressure , and heart rate were measured . in addition , heart rate monitoring was undertaken in participants allocated to aerobic exercise to ensure that the program was safe for them and that their training range was appropriate .37 after completion of the 10 - week training program , the volunteers were re - evaluated using the adherence questionnaire administered by an investigator who had not been involved in the intervention ( to avoid information bias in collection of the data ) . elderly women who had abandoned their allocated program and were otherwise lost to follow - up were also contacted by the team ; a number of these women subsequently visited the federal university of minas gerais to answer the adherence questionnaire . successful intervention programs require an adherence rate of more than 85 % to have satisfactory results and ensure internal validity . therefore , in the present study , elderly women with a participation rate of 85 % or more in the exercise program were considered to have been adherent .31 thus , for a total of 30 sessions , five absences were allowed . those lost to the program comprised elderly women who did not finish the program or those who missed six or more exercise sessions during the 10 - week intervention . three logistic regression models were built for each of the groups to identify factors accounting for adherence of these elderly women with an exercise program . the statistical analysis was blinded , performed without input from the researchers who developed the questionnaire , and without involvement of the study volunteers . the first regression model aimed to identify the contribution of the following explanatory variables : presence of pain , a history of falls , number of comorbidities , self - perception of health , level of stress , cognitive capacity , depressive symptoms , and functional capacity ( measured by gait speed , timed up and go test , and sit - to - stand test ) . the other two regression models assessed the association between 13 motivational items and 12 items that acted as barriers to participation of elderly people in different therapeutic exercise programs . in the three models , the explanatory variables entered into the model were determined by theoretical reference . to define the variables in the model , the enter38 method was used and to define the model as significant was defined as p 0.20 and alpha 5 % . interpretation of the logistic regression analysis was defined , by the odds ratio ( or ) , as a relative risk of nonadherence . the level of statistical significance was set at 5 % for all analyses , which were done using statistical package for the social sciences for windows version 17.0 software ( spss inc , chicago , il , usa ) . our study population comprised a convenience sample of women aged 65 years or older who lived in the community and were recruited by advertising among third - age groups and associations as well as in newspapers . the sample was not randomized , and the study design involved development of two exercise programs at different points in time . the first volunteers were allocated to a muscle strengthening group , and when enough participants had been enrolled in this group , subsequent volunteers were allocated to an aerobic exercise group . we excluded anyone who showed cognitive changes detectable on the brazilian version16 of the mini - mental state examination . we also excluded subjects who had undergone orthopedic leg surgery , those with a history of fracture in the previous 6 months , those with a neurological disorder , and those with clinical or sensory conditions that precluded their participation in an exercise program . we calculated the sample size using the following regression model formula : 10 ( k + 1 ) , in which k represents the number of explanatory variables in the model .16,17 for each intervention group , three models of regression were used to explain adherence or failure to adhere . the ten explanatory variables used for the model , chosen from the theoretical framework , were : the timed up and go test ,18 the sit - to - stand test ,19 habitual gait speed ,20,21 history of falls , presence of pain , number of comorbidities , self - rated health ,22,23 depressive symptoms ,24 self - rated stress ,25 and cognitive capability .16 the other two models were constructed to include 13 motivators and 12 barriers according to the adherence questionnaire developed by researchers . thus , 10 ( 13 + 1 ) = 140 elderly women were necessary for each group . for sample characterization , we obtained sociodemographic data and information relevant to the clinical status of our elderly female study participants using a questionnaire developed by the researchers . folstein et al26 recommended the mini - mental state examination as a useful screening tool for detection of cognitive impairment in both the clinical and research setting . in 1994 , bertolucci et al published a version of the mini - mental state examination adapted for the brazilian population .16 in the present study , we used this tool as a reference for cutoff points , with a score of 13 for illiterate elderly and a score of 24 for educated elderly , given that previous studies have demonstrated this scale to have good reliability .27,28 in the present study , the mini - mental state examination was used for subject exclusion and test scores were used as an explanatory variable in the regression model to evaluate the association between adherence and cognitive capacity in the study subjects .29,30 the geriatric depression scale ( gds ) was used to screen for the presence of depressive symptoms , and was administered by structured interview . the 15 - item gds scale ( gds - 15 ) is a short version of the original scale developed by sheikh and yesavage24 and contains items that are most strongly matched with a diagnosis of depression . previous studies have demonstrated that symptoms of depression can interfere with the undertaking of physical exercise and that elderly people experiencing mood changes and general depressive symptoms are less committed to the intervention and therefore the results are worse . a 14 - item scale of perceived stress was used to evaluate the level of stress in our study participants . this scale evaluated three factors considered to be the main components in the experience of stress , ie , the extent to which individuals rate their lives as unpredictable , uncontrollable , and overloaded .31 henry et al32 found that patients who are asked to perform many exercises do not perform as well in terms of adherence . in addition , a prescription for excessive exercise can negatively affect adherence in elderly women .10,25 self - evaluation of health status was determined by a simple question , in a general way , how do you consider your health ? . the answer to this question is one of the most commonly used indices in gerontological research and is an important indicator of functional decline and consequent restriction of activity .22,23 the literature demonstrates that elderly women with greater adherence are the most likely to get involved in other programs for promoting health , and that this is directly linked to their behavior , perception of their health , motivation , and self - efficacy .30 we selected three tests to evaluate functional capacity , all of which can be carried out simply and rapidly in clinic practice ; these tests are also valid and reliable in the elderly population . we used these tests because elderly people with lower functional performance find it more difficult to develop regular exercise habits .14 we measured walking speed over 10 minutes to evaluate habitual gait speed . pace was registered only in the middle 6 m of a lane , identified by tape markings , to avoid acceleration and deceleration bias .20,21,33 we used the timed up and go test to evaluate mobility . this test records the time taken for a subject to stand up without using their arms from a sitting position in a standardized chair with a seat height of 45 cm , walk 3 m , turn around , and return to the seat and sit down again . this test has high interrater reliability ( intraclass correlation coefficient 0.99 ) and intrarater reliability ( intraclass correlation coefficient 0.99 ) .18,34 to evaluate functional performance in terms of sitting and standing , which is an indirect measure of strength in the legs and is associated with decline of function and capability , we used the sit - to - stand test with a standardized chair of 45 cm and floor height as the reference .19,20 there are no previous examples of adherence questionnaires validated and adapted for an elderly population in brazil .35 therefore , we developed our own adherence questionnaire based on the literature and on the cultural , economic , and social context of brazil . this questionnaire contained questions on the following three components : reasons for lack of attendance at sessions , motivating factors , and barriers to adherence with the different therapeutic exercise programs . as part of the development of this instrument , we trialed the questionnaire in ten elderly subjects participating in a physical exercise program . the necessary adjustments were made until the final version of the questionnaire was ready for use . intraobserver and interobserver variability were assessed by the kappa coefficient and this resulted in excellent intraobserver reliability ( kappa coefficient 0.846 ) and interobserver reliability ( kappa coefficient 0.822 ) . first , the brazilian version26 of the mini - mental state examination was used to exclude elderly women with cognitive impairment . this was followed by a clinical sociodemographic questionnaire in the form of a structured interview for characterization of the sample .16 for the functional tests , all participants were given the same verbal instructions and the investigators demonstrated tests before the participants carried them out . after the initial evaluation , the elderly women were allocated to a therapeutic exercise group , ie , either muscle strength training or aerobic exercise . each program lasted 10 weeks and comprised three sessions weekly , each lasting approximately 50 minutes and guided by physiotherapists and members of the research team . the muscular strength training group carried out leg exercises involving concentric and eccentric contraction with resistance , with the load tailored to meet individual requirements and ability . the load appropriate for each participant was defined by calculation of maximum resistance .36 the aerobic exercise program was based on a protocol recommended by the american college of sport medicine ( 2009 ) for the elderly , and comprised 5 minutes of warming up , 40 minutes of aerobic activity , including exercises for the arms and legs while walking , orthostatic exercise , and a 5 - minute recovery period . before and after each exercise session , blood pressure , and heart rate were measured . in addition , heart rate monitoring was undertaken in participants allocated to aerobic exercise to ensure that the program was safe for them and that their training range was appropriate .37 after completion of the 10 - week training program , the volunteers were re - evaluated using the adherence questionnaire administered by an investigator who had not been involved in the intervention ( to avoid information bias in collection of the data ) . elderly women who had abandoned their allocated program and were otherwise lost to follow - up were also contacted by the team ; a number of these women subsequently visited the federal university of minas gerais to answer the adherence questionnaire . successful intervention programs require an adherence rate of more than 85 % to have satisfactory results and ensure internal validity . therefore , in the present study , elderly women with a participation rate of 85 % or more in the exercise program were considered to have been adherent .31 thus , for a total of 30 sessions , five absences were allowed . those lost to the program comprised elderly women who did not finish the program or those who missed six or more exercise sessions during the 10 - week intervention . three logistic regression models were built for each of the groups to identify factors accounting for adherence of these elderly women with an exercise program . the statistical analysis was blinded , performed without input from the researchers who developed the questionnaire , and without involvement of the study volunteers . the first regression model aimed to identify the contribution of the following explanatory variables : presence of pain , a history of falls , number of comorbidities , self - perception of health , level of stress , cognitive capacity , depressive symptoms , and functional capacity ( measured by gait speed , timed up and go test , and sit - to - stand test ) . the other two regression models assessed the association between 13 motivational items and 12 items that acted as barriers to participation of elderly people in different therapeutic exercise programs . in the three models , the explanatory variables entered into the model were determined by theoretical reference . to define the variables in the model , the enter38 method was used and to define the model as significant was defined as p 0.20 and alpha 5 % . interpretation of the logistic regression analysis was defined , by the odds ratio ( or ) , as a relative risk of nonadherence . the level of statistical significance was set at 5 % for all analyses , which were done using statistical package for the social sciences for windows version 17.0 software ( spss inc , chicago , il , usa ) . a total of 382 elderly community - dwelling women participated in this study , comprising 231 in the aerobic exercise group and 151 in the muscle strength training group . there were no significant differences between the two groups in terms of clinical or demographic profile . the rate of adherence was 49.70 % in the aerobic exercise group and 56.20 % in the muscle strength training group . the rate of retention in the program was 71.40 % for the aerobic exercise group and 66.80 % for the muscle strength training group . the regression model comprising the ten explanatory variables selected from the theoretical framework did not find any statistically significant differences for the aerobic exercise group ( p = 0.947 ) or the muscle strength training group ( p = 0.104 ) . none of the variables included in the regression model were predictors of adherence in either of the exercise programs . the multiple logistic regression model comprising motivators for exercise was significant ( p = 0.003 ) for the muscle strength training group ( r = 0.310 ) . ( p = 0.037 ; or 0.234 , 95 % confidence interval [ ci ] 0.0124.523 ) ; i practice exercises even when i do nt feel like it ( p = 0.004 ; or 0.062 , 95 % ci 0.0090.416 ) ; and companions in the group help me to deal with my problemsthis multiple logistic regression model comprising motivators for exercise was also significant for the aerobic group ( p = 0.008 ; r = 0.154 ) . variables that predicted adherence were exercises increase my concentration ( p = 0.003 ; or 0.598 , 95 % ci 0.0645.622 ) and i practice exercise even when i do nt feel like it ( p = 0.05 ; or 0.471 , 95 % ci 0.1671.329 ) . the third regression model analyzed variables related to barriers to exercise reported by the elderly women . the result was significant only for the muscle strength training group ( p = 0.003 ; r = 0.236 ) . the variable that predicted adherence was the bad weather disrupts the accomplishment of the exercisesalthough the models did not canvass many variables that were predictors of adherence , the results suggest that there are many barriers to adherence with exercise in the elderly . this was seen in the statement if my health was better i would be more active . the second most common barrier was difficulty performing exercise due to pain ; more than half of the elderly who did not adhere to their program agreed with this statement . the least important items for participants who did not adhere to their exercise program were the opportunity to have group companions and consideration of physical exercise as a leisure activity . the low rate of adherence compared with the rate of retention in the present study indicates that the number of absences among participants was very high . although the participants in our study did not abandon their exercise program , they found it difficult to attend often enough to reap the benefits of the proposed intervention . on investigating the reasons for nonattendance in each group , we noticed that changes in state of health was the most frequent reason given by adherent and nonadherent participants in both exercise groups . it is also important to highlight that family problems , lack of motivation , and pain were cited markedly more often by elderly women who did not adhere to the program than by those who did adhere . participants in the present study showed lower adherence rates than those previously recommended to ensure the effectiveness of therapeutic exercise programs . thus , completion of an exercise program , or rate of retention in the program , does not mean good adherence or good results . health services , community centers , and sports centers that implement exercise programs for the elderly should develop strategies to encourage these people to exercise and increase their frequency of exercise . brittle et al39 reported a high 82 % retention rate in exercise programs for the elderly ; however , study participants attended an average of only 43 % of the sessions offered , and only 18 % of the sample participated in all of the sessions prescribed . thus , it is clear that while the elderly seem to enjoy this kind of physical activity , attendance at sessions offered is not guaranteed . in our study , the adherence rate was higher in the muscle strength group than in the aerobic exercise group . this finding is consistent with the results of a meta - analysis of 3,389 elderly subjects by hong et al showing that resistance exercise programs had higher rates of adherence than aerobic exercise programs .7 in elderly populations , the high prevalence of joint diseases , such as osteoarthritis , frequently hampers successful performance of aerobic exercises because many activities cause joint impact . muscle strength training exercises without weight - bearing provide more joint stability .7,10 elderly people tend to participate more effectively at the beginning of exercise programs ; however , adherence diminishes as time passes .10 if health professionals can identify patients at high risk of nonadherence with a proposed treatment , special attention can be given to them during the intervention , and may help to increase their adherence rate .6,10,40 in the present study , none of the explanatory variables selected from the theoretical framework were predictors of adherence in our regression models . heuvelen et al ,6 a higher number of comorbidities and chronic diseases was correlated to lower adherence of subjects ( n = 118 ) to a program of physical exercise . in that study , the participants were divided in two groups , ie , one that carried out physical exercises and another that received a psychological approach . those in the psychological group who recorded only moderate results for adl and habitual gait speed before intervention had the lowest program adherence . in the physical activity group , adherence was low for subjects with low adl scores and modest habitual walking gait scores . worse functional performance is therefore an impediment to adherence with physical exercise programs in the elderly .6 forkan et al5 also found that changes in health state were a frequent reason for low adherence with continuing exercise regimes among the elderly .5 in their study , one of the factors associated with lack of participation ( p 0.05 ) in an exercise program by the elderly was changes in the weather , especially the presence of cold weather . there is no severe winter in brazil ; however , the rainy season brings disruption and we found that this was an important barrier to exercise for participants in the muscle strength training group . this can be explained by the fact that the program was held in the first half of the year when there is a lot of rain , while the aerobic group program was conducted in the second half of the year . with the rain , use of public transport becomes even harder , there is a greater risk of falls , and elderly people struggle with the difficulty of having to walk while holding umbrellas and bags . understanding the benefits of an exercise program was an important motivator in both the muscle strength training group and the aerobic exercise group in this study . these elderly women mentioned that they practiced their exercises even when they were not in the mood , and realized that exercise was necessary regardless of their mood , indicating their belief in the benefits stemming from the practice . therefore , educational initiatives highlighting the importance of exercise need to be promoted .8,41 one important study found that improved concentration acted as a motivator and predicted adherence with exercise programs , and this could be due to increased circulation in the brain . concentration can be explained as intense brain activity and research suggests that physical exercise can increase cognitive control and the capacity to pay attention , resulting in better cognitive function .42 socialization , or the presence of other elderly people , was also a predictor of adherence in the muscle strength training group . exchange of experiences and encountering people with similar problems and similar difficulties , support , listening , and all the other components associated with a group activity are all very important to the benefit of physical exercise in groups . although individual exercise regimes may bring more directed physical benefits , the benefits of group exercise in terms of social and emotional health are critical and should be encouraged .30,43 our results reflect the difficulties associated with adherence . the present study did not show a direct correlation between low self - rated health and low adherence with exercise programs ; therefore , the influencing factors are multifactorial and should be investigated in terms of physical , emotional , and social health . although adherence to both programs was suboptimal in this study , some factors may have contributed to the increased adherence rate in relation to the population in general . the elderly women who participated in this study chose to do so and were active and healthy ; in other words , they were available for and interested in undertaking physical exercise . another limiting factor was the short duration of the study ; this is because it is difficult to maintain an ideal exercise frequency in long - term exercise programs and adherence rates in such programs are even smaller . in addition , a factor that could have contributed negatively to the programs developed for this study is the fact that they constituted general exercises and there was no specific individual objective . preventive exercises are less stimulating than exercises that aim to provide relief for a specific health problem . the scale developed to assess adherence may not have been sensitive enough to identify factors associated with adherence as dichotomous . the volunteer may have answered yes or no without thinking of any particular situation . although adherence to both programs was suboptimal in this study , some factors may have contributed to the increased adherence rate in relation to the population in general . the elderly women who participated in this study chose to do so and were active and healthy ; in other words , they were available for and interested in undertaking physical exercise . another limiting factor was the short duration of the study ; this is because it is difficult to maintain an ideal exercise frequency in long - term exercise programs and adherence rates in such programs are even smaller . in addition , a factor that could have contributed negatively to the programs developed for this study is the fact that they constituted general exercises and there was no specific individual objective . preventive exercises are less stimulating than exercises that aim to provide relief for a specific health problem . the scale developed to assess adherence may not have been sensitive enough to identify factors associated with adherence as dichotomous . future research on adherence with exercise programs for the elderly should incorporate specific strategies ; this will increase recruitment rates and boost adherence and retention of people of different cultures and ethnicities in exercise programs .30 future work in this area should focus on behavioral motivation . it is also important to look more broadly at social and environmental contexts and take into account direct variables , such as those related to commitment to exercise among older women , sedentary people , and patients with multiple diseases and functional deficits .44 we recommend that older people be asked more directly about what influences them , and qualitative studies should be encouraged in this regard .\noutput:\n" }, { "from": "agent", "value": "backgroundparticipation of older people in a program of regular exercise is an effective strategy to minimize the physical decline associated with age . the purpose of this study was to assess adherence rates in older women enrolled in two different exercise programs ( one aerobic exercise and one strength training ) and identify any associated clinical or functional factors.methodsthis was an exploratory observational study in a sample of 231 elderly women of mean age 70.5 years . we used a structured questionnaire with standardized tests to evaluate the relevant clinical and functional measures . a specific adherence questionnaire was developed by the researchers to determine motivators and barriers to exercise adherence.resultsthe adherence rate was 49.70 % in the aerobic exercise group and 56.20 % in the strength training group . multiple logistic regression models for motivation were significant ( p = 0.003 ) for the muscle strengthening group ( r2 = 0.310 ) and also significant ( p = 0.008 ) for the aerobic exercise group ( r2 = 0.154 ) . a third regression model for barriers to exercise was significant ( p = 0.003 ) only for the muscle strengthening group ( r2 = 0.236 ) . the present study shows no direct relationship between worsening health status and poor adherence.conclusionfactors related to adherence with exercise in the elderly are multifactorial ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this cohort study included subjects from two randomized , double - blind , placebo controlled clinical trials , benedict - b ( 10 ) and demand ( 11 ) , designed to evaluate the effect of ace inhibitor therapy on onset and progression of nephropathy in hypertensive type 2 diabetic patients with normo - or microalbuminuria . the two study populations were considered together since they were selected , monitored , and treated according to similar predefined guidelines ( see detailed research design and methods in the supplementary data online ) . in all patients , the gfr was centrally measured at the laboratories of the clinical research center of the mario negri institute for pharmacological research with the iohexol ( omnipaque 300 ; ge healthcare , milan , italy ) plasma clearance technique ( 13,15 ) at baseline and every 6 months thereafter . glucose disposal rate ( gdr ) was assessed at inclusion and at 1 year in a subgroup by the hyperinsulinemic euglycemic clamp ( 16 ) . albumin was measured by nephelometry ( beckman array system ) in three timed overnight urine collections , and hba1c was measured by ion - exchange high - performance liquid chromatography ( normal range : 3.535.21 % ) . other parameters were evaluated with a beckman synchron cx5 instrument and a coulter maxm ( beckman coulter ) . patients who had a measured gfr at inclusion exceeding the upper limit of the normal range ( 120 ml / min / 1.73 m ) were a priori categorized assince the reproducibility range of gfr measurement by the iohexol plasma clearance technique is 6.28 % ( 13,15 ) , a predefined cutoff of 10 % gfr reduction largely exceeding the reproducibility range of the measurement was expected to univocally identify patients with true gfr reductions from those with random data fluctuations related to the variability of the method . thus , among patients who were hyperfiltering at baseline , those with a gfr reduction 10 % at month 6 were considered as patients with ameliorated hyperfiltration . those with smaller reductions were categorized aspredefined end points were 1 ) the rate of gfr decline over time ( gfr slope ) defined as the regression line between repeated gfr measurements and time ( 17,18 ) and 2 ) time to onset of persistent micro - or macroalbuminuria defined as urinary albumin excretion ( uae ) 20 and 200 g / min or 200 g / min , respectively ( 10,11 ) . analyses were performed at the laboratory of biostatistics of the clinical research center by spss 14.0.1 ( chicago , il ) , stata 11.0 , and sas 9.1 ( sas institute , inc . data were expressed as mean sd , median and interquartile range ( iqr ) , or number and percent as appropriate . baseline and follow - up characteristics were compared by paired or unpaired t test , wilcoxon rank sum test , test , or fisher exact test . gfr slope analyses were preplanned for a subgroup of patients from the benedict study ( 19 ) and for all patients from the demand study ( 11 ) who had at least three follow - up gfr measurements in addition to baseline gfr . gfr changes over time were a priori evaluated by a single - slope linear model ( 14 ) and by a two - phase model in which gfr changes from baseline to month 6 and gfr slope from month 6 to study end were assessed separately ( 6,17,20 ) . to test the possibility that gfr reduction at 6 months could be affected by gfr at baseline ( regression to the mean ) , gfr changes at 6 months were a posteriori compared between hyperfiltering and nonhyperfiltering patients after adjusting for baseline gfr values by using an ancova ( 21 ) . the relationships between baseline gfr , or gfr changes from baseline to month 6 , and subsequent gfr decline were evaluated by two multivariable models considering as outcomes the gfr slopes calculated throughout the whole follow - up period ( model 1 ) or from month 6 to study end ( model 2 ) , respectively . to account for possible heterogeneity between studies , we developed a meta - analysis of individual patient continuous outcome data using a random trial effect with patient - level covariates in which the original study and the observation from an individual patient were at the highest and lowest level , respectively ( 22 ) . the possibility of including treatments as a random instead of a fixed effect was eventually assessed by the likelihood ratio test . in additional sensitivity analyses , we further evaluated the bimodal gfr change over time by considering repeated gfr measures as the outcome in a spline function with a knot at 6 months ( 23 ) . in subjects with at least one follow - upmeasurement of albuminuria , we a priori evaluated the association between baseline gfr , or hyperfiltration at inclusion , and the development of micro - or macroalbuminuria by kaplan - meier analysis and log - rank test and by a multivariate proportional hazards model considering time to micro - or macroalbuminuria as the dependent variable . in addition , we included in the model potential confounders with a proven or expected relationship with the outcome , such as age , sex , baseline albuminuria , baseline hba1c , and systolic or diastolic bp , randomization to an ace inhibitor yes or no , and inclusion in the demand or benedict - b trial . the same approach was used in post hoc analyses evaluating progression to micro - or macroalbuminuria in patients with hyperfiltration at inclusion who were persistently hyperfiltering at 6 months , as compared with patients who had their hyperfiltration at inclusion ameliorated at 6 months considered alone or in combination with those who were persistently nonhyperfiltering since inclusion . patients who had a measured gfr at inclusion exceeding the upper limit of the normal range ( 120 ml / min / 1.73 m ) were a priori categorized assince the reproducibility range of gfr measurement by the iohexol plasma clearance technique is 6.28 % ( 13,15 ) , a predefined cutoff of 10 % gfr reduction largely exceeding the reproducibility range of the measurement was expected to univocally identify patients with true gfr reductions from those with random data fluctuations related to the variability of the method . thus , among patients who were hyperfiltering at baseline , those with a gfr reduction 10 % at month 6 were considered as patients with ameliorated hyperfiltration . those with smaller reductions were categorized aspredefined end points were 1 ) the rate of gfr decline over time ( gfr slope ) defined as the regression line between repeated gfr measurements and time ( 17,18 ) and 2 ) time to onset of persistent micro - or macroalbuminuria defined as urinary albumin excretion ( uae ) 20 and 200 g / min or 200 g / min , respectively ( 10,11 ) . analyses were performed at the laboratory of biostatistics of the clinical research center by spss 14.0.1 ( chicago , il ) , stata 11.0 , and sas 9.1 ( sas institute , inc . , data were expressed as mean sd , median and interquartile range ( iqr ) , or number and percent as appropriate . baseline and follow - up characteristics were compared by paired or unpaired t test , wilcoxon rank sum test , test , or fisher exact test . gfr slope analyses were preplanned for a subgroup of patients from the benedict study ( 19 ) and for all patients from the demand study ( 11 ) who had at least three follow - up gfr measurements in addition to baseline gfr . gfr changes over time were a priori evaluated by a single - slope linear model ( 14 ) and by a two - phase model in which gfr changes from baseline to month 6 and gfr slope from month 6 to study end were assessed separately ( 6,17,20 ) . to test the possibility that gfr reduction at 6 months could be affected by gfr at baseline ( regression to the mean ) , gfr changes at 6 months were a posteriori compared between hyperfiltering and nonhyperfiltering patients after adjusting for baseline gfr values by using an ancova ( 21 ) . the relationships between baseline gfr , or gfr changes from baseline to month 6 , and subsequent gfr decline were evaluated by two multivariable models considering as outcomes the gfr slopes calculated throughout the whole follow - up period ( model 1 ) or from month 6 to study end ( model 2 ) , respectively . to account for possible heterogeneity between studies , we developed a meta - analysis of individual patient continuous outcome data using a random trial effect with patient - level covariates in which the original study and the observation from an individual patient were at the highest and lowest level , respectively ( 22 ) . the possibility of including treatments as a random instead of a fixed effect was eventually assessed by the likelihood ratio test . in additional sensitivity analyses , we further evaluated the bimodal gfr change over time by considering repeated gfr measures as the outcome in a spline function with a knot at 6 months ( 23 ) . in subjects with at least one follow - up measurement of albuminuria , we a priori evaluated the association between baseline gfr , or hyperfiltration at inclusion , and the development of micro - or macroalbuminuria by kaplan - meier analysis and log - rank test and by a multivariate proportional hazards model considering time to micro - or macroalbuminuria as the dependent variable . in addition , we included in the model potential confounders with a proven or expected relationship with the outcome , such as age , sex , baseline albuminuria , baseline hba1c , and systolic or diastolic bp , randomization to an ace inhibitor yes or no , and inclusion in the demand or benedict - b trial . the same approach was used in post hoc analyses evaluating progression to micro - or macroalbuminuria in patients with hyperfiltration at inclusion who were persistently hyperfiltering at 6 months , as compared with patients who had their hyperfiltration at inclusion ameliorated at 6 months considered alone or in combination with those who were persistently nonhyperfiltering since inclusion . a total of 4,593 gfrs were measured over a median ( range ) follow - up of 4.0 ( 1.758.11 ) years . baseline measurements were available in 600 subjects , including all 377 patients from demand and 223 of the 281 ( 78.4 % ) subjects from benedict - b ( supplementary fig . of the patients , 90 ( 15 % ) had a gfr 120 ml / min / 1.73 m at inclusion . compared with the 510 with lower gfrs , these 90 patients were younger ; had higher hba1c , blood glucose , and serum triglyceride levels ; and had lower serum creatinine , uric acid levels , gdr , blood pressure ( bp ) , and albuminuria but similar bmi ( table 1 ) . the proportions of patients who were microalbuminuric or were eventually randomized to ace inhibitor therapy were similar between groups . gfr was similar in patients with normo - or microalbuminuria or with or without ace inhibitor therapy ( supplementary fig . baseline characteristics of all study patients considered as a whole , with those who were hyperfiltering or nonhyperfiltering at inclusion considered separately of the 600 included patients , 449 ( 74.8 % ) had at least four gfr measurements , including baseline ( median [ iqr ] : 9 ) , available for gfr slope analyses . of the 151 patients with fewer gfr measurements , 61 and 42 withdrew consent to trial participation or to gfr measurement , respectively . thus , in only 48 ( 8 % ) case subjects were gfr measurements incomplete because of clinical reasons , including death , adverse events , progression to macroalbuminuria , and other reasons ( supplementary fig . characteristics of patients with or without gfr slope data were similar ( supplementary table 1 ) . throughout the whole study period , the decline was similar between patients with normo - or microalbuminuria as well as between those randomized to ace inhibitor or non ace inhibitor therapy , whereas it was faster in subjects who were hyperfiltering at inclusion ( table 2 ) . faster decline was largely explained by a 13-fold larger gfr reduction at month 6 in hyperfiltering subjects ( p 0.0001 vs. nonhyperfiltering ) , whereas the subsequent rate of gfr decline was similar between groups ( table 2 and supplementary fig . d ) . larger short - term gfr reduction in hyperfiltering subjects was unlikely to be explained by regression toward the mean since gfr reduction from baseline to month 6 was significantly different between hyperfiltering and nonhyperfiltering subjects also after adjusting for baseline gfr ( p = 0.018 ) . long - term gfr decline was similar in both groups ( 3.24 [ 5.51.0 ] vs. 3.09 [ 5.40.7 ] ml / min / 1.73 m per year , p = 0.94 ) even when gfr values at 6 months were not considered . short - and long - term gfr changes were similar in micro - and normoalbuminuric patients and in patients with or without ace inhibitor therapy ( table 2 and supplementary fig . gfr changes during the study gfr decline tended to be faster in subjects with persistent hyperfiltration than in those who had their hyperfiltration at inclusion ameliorated at 6 months or who were nonhyperfiltering since inclusion ( 4.19 [ 7.71.6 ] vs. 3.23 [ 5.251.26 ] ml / min / 1.73 m per year , p = 0.09 ) . the difference achieved statistical significance in sensitivity analyses considering the rate of gfr decline in patients with persistent hyperfiltration as compared with that observed in those who had their hyperfiltration at inclusion ameliorated at 6 months ( 4.19 [ 11.31.6 ] vs. 1.72 [ 7.0 to 0.5 ] ml / min / 1.73 m / year , p = 0.01 ) ( fig . percent reduction in mean bp ( 3.15 [ 10.8 to 1.4 ] vs. 10.06 % [ 15.5 to 2.4 ] , p = 0.041 ) , blood glucose ( 0.03 [ 17.023.8 ] vs. 11.26 % [ 25.8 to 0.2 ] , p = 0.030 ) , and gdr ( 13.09 [ 28.4 to 1.06 ] vs. 7.74 % [ 8.4 to 17.3 ] , p = 0.033 ) at month 6 versus baseline was significantly smaller in patients with persistent hyperfiltration than in those who had their hyperfiltration at inclusion ameliorated at month 6 ( fig . the above differences were not explained by baseline characteristics , the proportion of patients allocated to ace inhibitor therapy , and the distribution of antihypertensive and antidiabetic drugs at baseline and on follow - up that were all similar between groups ( supplementary table 2 ) . data were not fully explained by suboptimal metabolic or bp control since in the group with persistent hyperfiltration , blood glucose and hba1c were 125 mg / dl and 6.5 % in 24 and 46.5 % of patients and systolic and diastolic bp were 130 and 80 mmhg in 24.3 and 38 % of case subjects , respectively . percent changes at month 6 vs. baseline in mean arterial pressure ( a ) , blood glucose levels ( b ) , and gdr ( c ) and subsequent gfr decline from month 6 to study end ( d ) in patients with persistent hyperfiltration compared with patients who had their hyperfiltration at inclusion ameliorated at 6 months . patients with short - term gfr reduction 10 % at month 6 compared with patients with smaller reductions had slower gfr decline on subsequent follow - up in the study group considered as a whole ( 2.05 [ 4.470.50 ] vs. 3.90 [ 5.831.56 ] ml / min / 1.73 m per year , p 0.0001 ) as well as in the subgroup of patients without glomerular hyperfiltration at inclusion ( 2.20 [ 4.490.44 ] vs. 3.74 [ 5.781.56 ] ml / min / 1.73 m per year , p 0.0001 ) . independent of gfr changes from baseline to month 6 , patients with hyperfiltration ( gfr 120 ml / min / 1.73 m ) or without hyperfiltration at month 6 showed a similar gfr loss on follow - up ( 4.01 [ 6.60.6 ] vs. 2.26 [ 5.01.3 ] ml / min / 1.73 m per year , respectively , p = 0.30 ) . higher gfr at inclusion ( coefficient [ se ] : 0.006 [ 0.0007 ] ; p 0.0001 ) , in addition to older age and higher systolic bp , predicted a faster gfr decline throughout the whole study period ( supplementary table 4 , model 1 ) . the predictive value of baseline gfr was lost ( 0.0016 [ 0.0008 ] ; p = 0.050 ) when gfr decline from month 6 to study end was considered as an outcome variable ( supplementary table 4 , model 2 ) . when gfr change from baseline to month 6 was considered in the model instead of baseline gfr , the gfr change was the strongest predictor of subsequent slope ( 0.0054 [ 0.0009 ] ; p 0.0001 ) , and a larger reduction from baseline to month 6 was significantly associated with a slower slope on subsequent follow - up independent of concomitant changes in hba1c and bp ( supplementary table 4 , model 2 ) . albuminuria , randomization to ace inhibitor therapy , and treatment arm were not significantly associated with any considered outcome . consistent with results from the benedict and demand trials ( 10,11 ) , the likelihood ratio tests that evaluated the possibility for considering treatments as a random effect were not significant in model 1 ( [ df1 ] = 1.10 , p = 0.57 ) or in both versions of model 2 ( [ df1 ] = 0.43 , p = 0.51 ; and [ df1 ] = 1.54 , p = 0.46 ) . thus , treatments were considered only as a fixed effect ( supplementary table 4 ) . the bimodal gfr change over time was confirmed by sensitivity analyses that through application of a spline function to gfr measurements with a knot at 6 months , showed a significant change of gfr slope across the knot with a negative slope from baseline to month 6 and a positive slope from month 6 to study end ( coefficient [ se ] : 0.63 [ 0.72 ] , p 0.0001 vs. 0.38 [ 0.77 ] , p 0.0001 , respectively ) . of the 600 included subjects , 549 ( 91.5 % ) had at least one follow - up measurement of albuminuria . of these subjects , the event was observed in 11 of the 47 patients ( 23.4 % ) with persistent hyperfiltration as compared with 53 of the 502 patients ( 10.6 % , p = 0.011 ) who were already normofiltering at inclusion or no longer hyperfiltering at month 6 ( log rank : 6.13 , p = 0.013 ) ( fig . changes in gdr were significantly different between groups ( ancova , p = 0.038 ) , and at one year , the gdr was significantly lower in persistently hyperfiltering subjects as compared with all other subjects considered as a whole ( 3.852.17 vs. 5.312.45 mg / kg / min , p = 0.024 ) . the above findings were not explained by the distribution of antihypertensive medications , ace inhibitors , and antidiabetic treatments , which was similar between groups ( supplementary table 1 ) . similar findings were observed at sensitivity analyses considering progression to micro - or macroalbuminuria in patients with persistent hyperfiltration as compared with those who had their hyperfiltration at inclusion ameliorated at month 6 ( data not shown ) . kaplan - meier survival analysis of patients with persistent hyperfiltration at month 6 ( persistently hyperfiltering ) compared with all other patients who were already normofiltering at inclusion or were hyperfiltering at inclusion and had their hyperfiltration ameliorated at month 6 ( others ) ( log rank : 6.13 , p = 0.013 ) . * adjustment for albuminuria at baseline . * * adjustments for age , sex , and albuminuria ; hba1c and systolic bp at baseline ; smoking habit ; known duration of diabetes ; participation in the benedict or demand trial ; treatment arm ; and treatment with an ace inhibitor yes or no . , the risk of micro - or macroalbuminuria was not associated with gfr ( hazard ratio [ hr ] 1.0 , p = 0.97 ) or hyperfiltration ( 1.6 , p = 0.10 ) at baseline , but it was significantly associated with persistent hyperfiltration at month 6 ( fig . the association also was significant after adjusting for predefined baseline covariates , including albuminuria , randomization to ace inhibition , treatment arm , or inclusion in the benedict - b or demand trial ( fig . long - term gfr decline from baseline to study end , short - term gfr changes from baseline to month 6 , and subsequent gfr decline from month 6 to study end were similar when higher gfr cutoff values ( 125 ml / min / 1.73 m ) or gfr values not adjusted for bmi were used to define hyperfiltration . short - term gfr changes and long - term gfr decline were similar when cohorts of patients with at least three , four , or five gfr measurements available for the analyses were considered . of the patients , 90 ( 15 % ) had a gfr 120 ml / min / 1.73 m at inclusion . compared with the 510 with lower gfrs , these 90 patients were younger ; had higher hba1c , blood glucose , and serum triglyceride levels ; and had lower serum creatinine , uric acid levels , gdr , blood pressure ( bp ) , and albuminuria but similar bmi ( table 1 ) . the proportions of patients who were microalbuminuric or were eventually randomized to ace inhibitor therapy were similar between groups . gfr was similar in patients with normo - or microalbuminuria or with or without ace inhibitor therapy ( supplementary fig . baseline characteristics of all study patients considered as a whole , with those who were hyperfiltering or nonhyperfiltering at inclusion considered separatelyof the 600 included patients , 449 ( 74.8 % ) had at least four gfr measurements , including baseline ( median [ iqr ] : 9 ) , available for gfr slope analyses . of the 151 patients with fewer gfr measurements , 61 and 42 withdrew consent to trial participation or to gfr measurement , respectively . thus , in only 48 ( 8 % ) case subjects were gfr measurements incomplete because of clinical reasons , including death , adverse events , progression to macroalbuminuria , and other reasons ( supplementary fig . characteristics of patients with or without gfr slope data were similar ( supplementary table 1 ) . throughout the whole study period , the decline was similar between patients with normo - or microalbuminuria as well as between those randomized to ace inhibitor or non ace inhibitor therapy , whereas it was faster in subjects who were hyperfiltering at inclusion ( table 2 ) . faster decline was largely explained by a 13-fold larger gfr reduction at month 6 in hyperfiltering subjects ( p 0.0001 vs. nonhyperfiltering ) , whereas the subsequent rate of gfr decline was similar between groups ( table 2 and supplementary fig . d ) . larger short - term gfr reduction in hyperfiltering subjects was unlikely to be explained by regression toward the mean since gfr reduction from baseline to month 6 was significantly different between hyperfiltering and nonhyperfiltering subjects also after adjusting for baseline gfr ( p = 0.018 ) . long - term gfr decline was similar in both groups ( 3.24 [ 5.51.0 ] vs. 3.09 [ 5.40.7 ] ml / min / 1.73 m per year , p = 0.94 ) even when gfr values at 6 months were not considered . short - and long - term gfr changes were similar in micro - and normoalbuminuric patients and in patients with or without ace inhibitor therapy ( table 2 and supplementary fig . gfr changes during the study gfr decline tended to be faster in subjects with persistent hyperfiltration than in those who had their hyperfiltration at inclusion ameliorated at 6 months or who were nonhyperfiltering since inclusion ( 4.19 [ 7.71.6 ] vs. 3.23 [ 5.251.26 ] ml / min / 1.73 m per year , p = 0.09 ) . the difference achieved statistical significance in sensitivity analyses considering the rate of gfr decline in patients with persistent hyperfiltration as compared with that observed in those who had their hyperfiltration at inclusion ameliorated at 6 months ( 4.19 [ 11.31.6 ] vs. 1.72 [ 7.0 to 0.5 ] ml / min / 1.73 m / year , p = 0.01 ) ( fig . percent reduction in mean bp ( 3.15 [ 10.8 to 1.4 ] vs. 10.06 % [ 15.5 to 2.4 ] , p = 0.041 ) , blood glucose ( 0.03 [ 17.023.8 ] vs. 11.26 % [ 25.8 to 0.2 ] , p = 0.030 ) , and gdr ( 13.09 [ 28.4 to 1.06 ] vs. 7.74 % [ 8.4 to 17.3 ] , p = 0.033 ) at month 6 versus baseline was significantly smaller in patients with persistent hyperfiltration than in those who had their hyperfiltration at inclusion ameliorated at month 6 ( fig . the above differences were not explained by baseline characteristics , the proportion of patients allocated to ace inhibitor therapy , and the distribution of antihypertensive and antidiabetic drugs at baseline and on follow - up that were all similar between groups ( supplementary table 2 ) . data were not fully explained by suboptimal metabolic or bp control since in the group with persistent hyperfiltration , blood glucose and hba1c were 125 mg / dl and 6.5 % in 24 and 46.5 % of patients and systolic and diastolic bp were 130 and 80 mmhg in 24.3 and 38 % of case subjects , respectively . percent changes at month 6 vs. baseline in mean arterial pressure ( a ) , blood glucose levels ( b ) , and gdr ( c ) and subsequent gfr decline from month 6 to study end ( d ) in patients with persistent hyperfiltration compared with patients who had their hyperfiltration at inclusion ameliorated at 6 months . patients with short - term gfr reduction 10 % at month 6 compared with patients with smaller reductions had slower gfr decline on subsequent follow - up in the study group considered as a whole ( 2.05 [ 4.470.50 ] vs. 3.90 [ 5.831.56 ] ml / min / 1.73 m per year , p 0.0001 ) as well as in the subgroup of patients without glomerular hyperfiltration at inclusion ( 2.20 [ 4.490.44 ] vs. 3.74 [ 5.781.56 ] ml / min / 1.73 m per year , p 0.0001 ) . independent of gfr changes from baseline to month 6 , patients with hyperfiltration ( gfr 120 ml / min / 1.73 m ) or without hyperfiltration at month 6 showed a similar gfr loss on follow - up ( 4.01 [ 6.60.6 ] vs. 2.26 [ 5.01.3 ] ml / min / 1.73 m per year , respectively , p = 0.30 ) . results of univariable analyses are shown in supplementary table 3 . at multivariable analysis , higher gfr at inclusion ( coefficient [ se ] : 0.006 [ 0.0007 ] ; p 0.0001 ) , in addition to older age and higher systolic bp , predicted a faster gfr decline throughout the whole study period ( supplementary table 4 , model 1 ) . the predictive value of baseline gfr was lost ( 0.0016 [ 0.0008 ] ; p = 0.050 ) when gfr decline from month 6 to study end was considered as an outcome variable ( supplementary table 4 , model 2 ) . when gfr change from baseline to month 6 was considered in the model instead of baseline gfr , the gfr change was the strongest predictor of subsequent slope ( 0.0054 [ 0.0009 ] ; p 0.0001 ) , and a larger reduction from baseline to month 6 was significantly associated with a slower slope on subsequent follow - up independent of concomitant changes in hba1c and bp ( supplementary table 4 , model 2 ) . albuminuria , randomization to ace inhibitor therapy , and treatment arm were not significantly associated with any considered outcome . consistent with results from the benedict and demand trials ( 10,11 ) , the likelihood ratio tests that evaluated the possibility for considering treatments as a random effect were not significant in model 1 ( [ df1 ] = 1.10 , p = 0.57 ) or in both versions of model 2 ( [ df1 ] = 0.43 , p = 0.51 ; and [ df1 ] = 1.54 , p = 0.46 ) . thus , treatments were considered only as a fixed effect ( supplementary table 4 ) . the bimodal gfr change over time was confirmed by sensitivity analyses that through application of a spline function to gfr measurements with a knot at 6 months , showed a significant change of gfr slope across the knot with a negative slope from baseline to month 6 and a positive slope from month 6 to study end ( coefficient [ se ] : 0.63 [ 0.72 ] , p 0.0001 vs. 0.38 [ 0.77 ] , p 0.0001 , respectively ) . of the 600 included subjects , 549 ( 91.5 % ) had at least one follow - up measurement of albuminuria . the event was observed in 11 of the 47 patients ( 23.4 % ) with persistent hyperfiltration as compared with 53 of the 502 patients ( 10.6 % , p = 0.011 ) who were already normofiltering at inclusion or no longer hyperfiltering at month 6 ( log rank : 6.13 , p = 0.013 ) ( fig . changes in gdr were significantly different between groups ( ancova , p = 0.038 ) , and at one year , the gdr was significantly lower in persistently hyperfiltering subjects as compared with all other subjects considered as a whole ( 3.852.17 vs. 5.312.45 mg / kg / min , p = 0.024 ) . the above findings were not explained by the distribution of antihypertensive medications , ace inhibitors , and antidiabetic treatments , which was similar between groups ( supplementary table 1 ) . similar findings were observed at sensitivity analyses considering progression to micro - or macroalbuminuria in patients with persistent hyperfiltration as compared with those who had their hyperfiltration at inclusion ameliorated at month 6 ( data not shown ) . kaplan - meier survival analysis of patients with persistent hyperfiltration at month 6 ( persistently hyperfiltering ) compared with all other patients who were already normofiltering at inclusion or were hyperfiltering at inclusion and had their hyperfiltration ameliorated at month 6 ( others ) ( log rank : 6.13 , p = 0.013 ) . adjustment for albuminuria at baseline . * * adjustments for age , sex , and albuminuria ; hba1c and systolic bp at baseline ; smoking habit ; known duration of diabetes ; participation in the benedict or demand trial ; treatment arm ; and treatment with an ace inhibitor yes or no . , the risk of micro - or macroalbuminuria was not associated with gfr ( hazard ratio [ hr ] 1.0 , p = 0.97 ) or hyperfiltration ( 1.6 , p = 0.10 ) at baseline , but it was significantly associated with persistent hyperfiltration at month 6 ( fig . the association also was significant after adjusting for predefined baseline covariates , including albuminuria , randomization to ace inhibition , treatment arm , or inclusion in the benedict - b or demand trial ( fig . of the 600 included patients , 449 ( 74.8 % ) had at least four gfr measurements , including baseline ( median [ iqr ] : 9 ) , available for gfr slope analyses . of the 151 patients with fewer gfr measurements , 61 and 42 withdrew consent to trial participation or to gfr measurement , respectively . thus , in only 48 ( 8 % ) case subjects were gfr measurements incomplete because of clinical reasons , including death , adverse events , progression to macroalbuminuria , and other reasons ( supplementary fig . characteristics of patients with or without gfr slope data were similar ( supplementary table 1 ) . throughout the whole study period , the decline was similar between patients with normo - or microalbuminuria as well as between those randomized to ace inhibitor or non ace inhibitor therapy , whereas it was faster in subjects who were hyperfiltering at inclusion ( table 2 ) . faster decline was largely explained by a 13-fold larger gfr reduction at month 6 in hyperfiltering subjects ( p 0.0001 vs. nonhyperfiltering ) , whereas the subsequent rate of gfr decline was similar between groups ( table 2 and supplementary fig . d ) . larger short - term gfr reduction in hyperfiltering subjects was unlikely to be explained by regression toward the mean since gfr reduction from baseline to month 6 was significantly different between hyperfiltering and nonhyperfiltering subjects also after adjusting for baseline gfr ( p = 0.018 ) . long - term gfr decline was similar in both groups ( 3.24 [ 5.51.0 ] vs. 3.09 [ 5.40.7 ] ml / min / 1.73 m per year , p = 0.94 ) even when gfr values at 6 months were not considered . short - and long - term gfr changes were similar in micro - and normoalbuminuric patients and in patients with or without ace inhibitor therapy ( table 2 and supplementary fig . gfr changes during the study gfr decline tended to be faster in subjects with persistent hyperfiltration than in those who had their hyperfiltration at inclusion ameliorated at 6 months or who were nonhyperfiltering since inclusion ( 4.19 [ 7.71.6 ] vs. 3.23 [ 5.251.26 ] ml / min / 1.73 m per year , p = 0.09 ) . the difference achieved statistical significance in sensitivity analyses considering the rate of gfr decline in patients with persistent hyperfiltration as compared with that observed in those who had their hyperfiltration at inclusion ameliorated at 6 months ( 4.19 [ 11.31.6 ] vs. 1.72 [ 7.0 to 0.5 ] ml / min / 1.73 m / year , p = 0.01 ) ( fig . percent reduction in mean bp ( 3.15 [ 10.8 to 1.4 ] vs. 10.06 % [ 15.5 to 2.4 ] , p = 0.041 ) , blood glucose ( 0.03 [ 17.023.8 ] vs. 11.26 % [ 25.8 to 0.2 ] , p = 0.030 ) , and gdr ( 13.09 [ 28.4 to 1.06 ] vs. 7.74 % [ 8.4 to 17.3 ] , p = 0.033 ) at month 6 versus baseline was significantly smaller in patients with persistent hyperfiltration than in those who had their hyperfiltration at inclusion ameliorated at month 6 ( fig . the above differences were not explained by baseline characteristics , the proportion of patients allocated to ace inhibitor therapy , and the distribution of antihypertensive and antidiabetic drugs at baseline and on follow - up that were all similar between groups ( supplementary table 2 ) . data were not fully explained by suboptimal metabolic or bp control since in the group with persistent hyperfiltration , blood glucose and hba1c were 125 mg / dl and 6.5 % in 24 and 46.5 % of patients and systolic and diastolic bp were 130 and 80 mmhg in 24.3 and 38 % of case subjects , respectively . percent changes at month 6 vs. baseline in mean arterial pressure ( a ) , blood glucose levels ( b ) , and gdr ( c ) and subsequent gfr decline from month 6 to study end ( d ) in patients with persistent hyperfiltration compared with patients who had their hyperfiltration at inclusion ameliorated at 6 months . patients with short - term gfr reduction 10 % at month 6 compared with patients with smaller reductions had slower gfr decline on subsequent follow - up in the study group considered as a whole ( 2.05 [ 4.470.50 ] vs. 3.90 [ 5.831.56 ] ml / min / 1.73 m per year , p 0.0001 ) as well as in the subgroup of patients without glomerular hyperfiltration at inclusion ( 2.20 [ 4.490.44 ] vs. 3.74 [ 5.781.56 ] ml / min / 1.73 m per year , p 0.0001 ) . independent of gfr changes from baseline to month 6 , patients with hyperfiltration ( gfr 120 ml / min / 1.73 m ) or without hyperfiltration at month 6 showed a similar gfr loss on follow - up ( 4.01 [ 6.60.6 ] vs. 2.26 [ 5.01.3 ] ml / min / 1.73 m per year , respectively , p = 0.30 ) . higher gfr at inclusion ( coefficient [ se ] : 0.006 [ 0.0007 ] ; p 0.0001 ) , in addition to older age and higher systolic bp , predicted a faster gfr decline throughout the whole study period ( supplementary table 4 , model 1 ) . the predictive value of baseline gfr was lost ( 0.0016 [ 0.0008 ] ; p = 0.050 ) when gfr decline from month 6 to study end was considered as an outcome variable ( supplementary table 4 , model 2 ) . when gfr change from baseline to month 6 was considered in the model instead of baseline gfr , the gfr change was the strongest predictor of subsequent slope ( 0.0054 [ 0.0009 ] ; p 0.0001 ) , and a larger reduction from baseline to month 6 was significantly associated with a slower slope on subsequent follow - up independent of concomitant changes in hba1c and bp ( supplementary table 4 , model 2 ) . albuminuria , randomization to ace inhibitor therapy , and treatment arm were not significantly associated with any considered outcome . consistent with results from the benedict and demand trials ( 10,11 ) , the likelihood ratio tests that evaluated the possibility for considering treatments as a random effect were not significant in model 1 ( [ df1 ] = 1.10 , p = 0.57 ) or in both versions of model 2 ( [ df1 ] = 0.43 , p = 0.51 ; and [ df1 ] = 1.54 , p = 0.46 ) . thus , treatments were considered only as a fixed effect ( supplementary table 4 ) . the bimodal gfr change over time was confirmed by sensitivity analyses that through application of a spline function to gfr measurements with a knot at 6 months , showed a significant change of gfr slope across the knot with a negative slope from baseline to month 6 and a positive slope from month 6 to study end ( coefficient [ se ] : 0.63 [ 0.72 ] , p 0.0001 vs. 0.38 [ 0.77 ] , p 0.0001 , respectively ) . of the 600 included subjects , 549 ( 91.5 % ) had at least one follow - up measurement of albuminuria . of these subjects , the event was observed in 11 of the 47 patients ( 23.4 % ) with persistent hyperfiltration as compared with 53 of the 502 patients ( 10.6 % , p = 0.011 ) who were already normofiltering at inclusion or no longer hyperfiltering at month 6 ( log rank : 6.13 , p = 0.013 ) ( fig . changes in gdr were significantly different between groups ( ancova , p = 0.038 ) , and at one year , the gdr was significantly lower in persistently hyperfiltering subjects as compared with all other subjects considered as a whole ( 3.852.17 vs. 5.312.45 mg / kg / min , p = 0.024 ) . the above findings were not explained by the distribution of antihypertensive medications , ace inhibitors , and antidiabetic treatments , which was similar between groups ( supplementary table 1 ) . similar findings were observed at sensitivity analyses considering progression to micro - or macroalbuminuria in patients with persistent hyperfiltration as compared with those who had their hyperfiltration at inclusion ameliorated at month 6 ( data not shown ) . progression to micro - or macroalbuminuria . kaplan - meier survival analysis of patients with persistent hyperfiltration at month 6 ( persistently hyperfiltering ) compared with all other patients who were already normofiltering at inclusion or were hyperfiltering at inclusion and had their hyperfiltration ameliorated at month 6 ( others ) ( log rank : 6.13 , p = 0.013 ) . * adjustment for albuminuria at baseline . * * adjustments for age , sex , and albuminuria ; hba1c and systolic bp at baseline ; smoking habit ; known duration of diabetes ; participation in the benedict or demand trial ; treatment arm ; and treatment with an ace inhibitor yes or no . , the risk of micro - or macroalbuminuria was not associated with gfr ( hazard ratio [ hr ] 1.0 , p = 0.97 ) or hyperfiltration ( 1.6 , p = 0.10 ) at baseline , but it was significantly associated with persistent hyperfiltration at month 6 ( fig . the association also was significant after adjusting for predefined baseline covariates , including albuminuria , randomization to ace inhibition , treatment arm , or inclusion in the benedict - b or demand trial ( fig . long - term gfr decline from baseline to study end , short - term gfr changes from baseline to month 6 , and subsequent gfr decline from month 6 to study end were similar when higher gfr cutoff values ( 125 ml / min / 1.73 m ) or gfr values not adjusted for bmi were used to define hyperfiltration . short - term gfr changes and long - term gfr decline were similar when cohorts of patients with at least three , four , or five gfr measurements available for the analyses were considered . serial gfr measurements with gold standard technique in a large cohort of caucasians with type 2 diabetes allowed us to show that glomerular filtration progressively declines in this population , even before the onset of overt renal disease . despite intensified therapy , long - term gfr decline averaged 3 ml / min / 1.73 m per year , a decline three - to five - fold faster than that reported in the general population ( 24,25 ) . we also found that 1 ) 15 % of subjects were hyperfiltering at inclusion ; 2 ) more gfr reduction at 6 months predicted slower gfr decline on follow - up , independently of concomitant therapy with ace inhibitors and level of initial albuminuria ; 3 ) long - term gfr decline and progression to micro - or macroalbuminuria were faster in subjects with persistent hyperfiltration as compared with nonhyperfiltering subjects and with those who had their hyperfiltration at inclusion ameliorated by intensified bp and metabolic control on follow - up ; and 4 ) the above differences in disease outcomes were associated with less effective bp and metabolic control in those with persistent hyperfiltration , despite similar treatment in both groups . our data finding that in most subjects the gfr at inclusion was within the normal range , was in harmony with data from other remarkably smaller series of caucasians with type 2 diabetes ( 5,26 ) and may reflect the good metabolic and bp control in this populationhowever , patients showed a remarkably fast gfr decline in the long - term that was independent of the extent of albuminuria ( normo - vs. microalbuminuria ) and of concomitant treatment with or without ace inhibitors . these findings extend to patients with normoalbuminuria previous evidence of accelerated renal function loss in type 2 diabetic patients with microalbuminuria ( 6 ) and converge to indicate that in this population , hyperglycemia , hypertension , and , conceivably , other abnormalities associated with the diabetes milieu may sustain renal disease progression independent of proteinuria ( 2729 ) . indeed , microalbuminuria is a well - established risk factor for overt nephropathy and cardiovascular events but , unlike overt proteinuria ( 30 ) , has never been associated with accelerated gfr decline in this population . these data also serve to emphasize that early optimized treatment of known risk factors , such as hyperglycemia and hypertension , is likely important to limit renal function loss even before the onset of overt nephropathy . in thisregard , ace inhibitors do not appear to affect the rate of gfr decline in this population ( 11 ) but may serve to prevent progression to more advanced stages of renal disease ( 10,31,32 ) and to achieve regression from micro - to normoalbuminuria , an effect that is associated with reduced cardiovascular morbidity and mortality ( 11 ) . finding that larger short - term gfr reduction was associated with slower gfr decline on subsequent follow - up was also consistent with similar evidence in patients with proteinuric chronic nephropathies ( 17 ) or type 1 diabetes ( 20 ) . it is conceivable that short - term changes in gfr reflected amelioration of glomerular hemodynamics associated with intensified metabolic and bp control , and slowed gfr decline on follow - up reflected the beneficial effect of this hemodynamic response on long - term progression of diabetic kidney disease ( 33,34 ) . finding that subjects who had their hyperfiltration ameliorated during the study had a rate of progression to micro - or macroalbuminuria similar to that observed in nonhyperfiltering subjects provided additional evidence that hyperfiltration may have a role in the pathogenesis of diabetic renal disease and that its amelioration may be renoprotective ( 1,20,35 ) . of note , in our series , persistently hyperfiltering subjects , compared with those who had their hyperfiltration ameliorated at month 6 , had less effective metabolic and bp control despite similar treatment . finding that these patients also had lower gdr at inclusion and worsening gdr on follow - up suggests that they were to some extent less responsive to treatment and predisposed to excess risk of renal disease because of more severe insulin resistance ( 36 ) . addressing whether this was explained by intrinsic patient characteristics or acquired / environmental factors was beyond the purposes of the current study . on the other hand , our present data show that intensified treatment of known risk factors is not sufficient to halt renal function loss in most patients with type 2 diabetes . indeed , a substantial proportion of our patients showed persistent hyperfiltration despite optimized metabolic and bp control . this suggests that mechanisms not appreciably affected by available treatments , such as oxidative stress , endothelial dysfunction , ischemia , accelerated ageing , and probably others , may play a role in progressive kidney dysfunction in this population , even before onset of overt nephropathy ( 30 ) . defining hyperfiltration as a gfr exceedingthe upper limit of the normal range of the iohexol plasma clearance technique was to some extent arbitrary but , as in previous studies with a similar approach ( 37 ) , was aimed to identify a priori a pure population of hyperfiltering subjects for comparative analyses versus subjects with lower gfrs at inclusion . on the other hand , we could not exclude the presence of subjects with relative hyperfiltration within the cohort with baseline gfr 120 ml / min / 1.73 m. finding that the outcomes of the two groups were significantly different , despite the possible dilution effect of these subjects , provided additional evidence of the pathogenic role of glomerular hyperfiltration in this setting . on the other hand , finding that higher gfr also was an independent predictor of accelerated gfr decline when the gfr was considered as a continuous variable , provided the additional information that hyperfiltration was a risk factor throughout the whole range of considered gfr values at inclusion . thus , measuring the gfr , in addition to albuminuria , may help in identifying patients at increased risk because of persistent hyperfiltration despite optimized metabolic and bp control and who might benefit the most from early intervention with novel treatments targeting potential mediators of accelerated renal dysfunction in addition to hyperglycemia and arterial hypertension ( 30 ) . a weakness of the study is that this was a post hoc observational analysis of subjects included in trials originally designed for other purposes . thus , study findings are hypothesis generating and need to be tested in ad hoc prospective studies . by design , our study could not examine hard end points , such as kidney failure or doubling of serum creatinine levels . on the other hand , inclusion of subjects without evidence of overt nephropathy allowed us to evaluate the pathogenic role of renal functional abnormalities in early stages of diabetic renal disease . the number of persistently hyperfiltering patients was relatively small . our present data , however , reflected the relatively small prevalence of persistent hyperfiltration in our population and provided novel information that allows us to weigh up the actual role of hyperfiltration in type 2 diabetes . the major strengths were that our study was remarkably larger and longer than any previous study serially evaluating gfr decline in diabetic populations and that all subjects were prospectively monitored by gold standard procedures . the results may have a large external validity since our study population had clinical characteristics , such as hypertension and normo - or microalbuminuria , that are common to the large majority of type 2 diabetic subjects . moreover , the fact that gfr data were available for all patients from demand and the vast majority of those from benedict allows generalization of the results of slope analyses to the average population of type 2 diabetic patients with normo - or microalbuminuria . data reliability was confirmed by sensitivity analyses showing that study results were independent of the criteria used for the definition of glomerular hyperfiltration and the number of gfr measurements required for patient inclusion in statistical analyses . results of our observational post hoc analyses suggest that in hypertensive type 2 diabetic subjects with normo - or microalbuminuria , persistent hyperfiltration is an independent risk factor for accelerated renal function loss and development or progression of nephropathy , whereas amelioration of hyperfiltration is renoprotective . prospective ad hoc studies are needed to unravel the mechanisms underlying persistent hyperfiltration despite optimized metabolic and bp control and to assess whether and to what extent glomerular hyperfiltration can be a specific treatment target for novel interventions aimed to limit renal function loss in this population . a weakness of the study is that this was a post hoc observational analysis of subjects included in trials originally designed for other purposes . thus , study findings are hypothesis generating and need to be tested in ad hoc prospective studies . by design , our study could not examine hard end points , such as kidney failure or doubling of serum creatinine levels . on the other hand , inclusion of subjects without evidence of overt nephropathy allowed us to evaluate the pathogenic role of renal functional abnormalities in early stages of diabetic renal disease . our present data , however , reflected the relatively small prevalence of persistent hyperfiltration in our population and provided novel information that allows us to weigh up the actual role of hyperfiltration in type 2 diabetes . the major strengths were that our study was remarkably larger and longer than any previous study serially evaluating gfr decline in diabetic populations and that all subjects were prospectively monitored by gold standard procedures . the results may have a large external validity since our study population had clinical characteristics , such as hypertension and normo - or microalbuminuria , that are common to the large majority of type 2 diabetic subjects . moreover , the fact that gfr data were available for all patients from demand and the vast majority of those from benedict allows generalization of the results of slope analyses to the average population of type 2 diabetic patients with normo - or microalbuminuria . data reliability was confirmed by sensitivity analyses showing that study results were independent of the criteria used for the definition of glomerular hyperfiltration and the number of gfr measurements required for patient inclusion in statistical analyses . results of our observational post hoc analyses suggest that in hypertensive type 2 diabetic subjects with normo - or microalbuminuria , persistent hyperfiltration is an independent risk factor for accelerated renal function loss and development or progression of nephropathy , whereas amelioration of hyperfiltration is renoprotective . prospective ad hoc studies are needed to unravel the mechanisms underlying persistent hyperfiltration despite optimized metabolic and bp control and to assess whether and to what extent glomerular hyperfiltration can be a specific treatment target for novel interventions aimed to limit renal function loss in this population .\noutput:\n" }, { "from": "agent", "value": "objectiveto describe the prevalence and determinants of hyperfiltration ( glomerular filtration rate [ gfr ] 120 ml / min / 1.73 m2 ) , gfr decline , and nephropathy onset or progression in type 2 diabetic patients with normo - or microalbuminuria.research design and methodswe longitudinally studied 600 hypertensive type 2 diabetic patients with albuminuria < 200 g / min and who were retrieved from two randomized trials testing the renal effect of trandolapril and delapril . target blood pressure ( bp ) was < 120/80 mmhg , and hba1c was < 7 % . gfr , albuminuria , and glucose disposal rate ( gdr ) were centrally measured by iohexol plasma clearance , nephelometry in three consecutive overnight urine collections , and hyperinsulinemic euglycemic clamp , respectively.resultsover a median ( range ) follow - up of 4.0 ( 1.78.1 ) years , gfr declined by 3.37 ( 5.711.31 ) ml / min / 1.73 m2 per year . gfr change was bimodal over time : a larger reduction at 6 months significantly predicted slower subsequent decline ( coefficient : 0.0054 ; se : 0.0009 ) , particularly among hyperfiltering patients . a total of 90 subjects ( 15 % ) were hyperfiltering at inclusion , and 11 of 47 ( 23.4 % ) patients with persistent hyperfiltration progressed to micro - or macroalbuminuria versus 53 ( 10.6 % ) of the 502 who had their hyperfiltration ameliorated at 6 months or were nonhyperfiltering since inclusion ( hazard ratio 2.16 [ 95 % ci 1.134.14 ] ) . amelioration of hyperfiltration was independent of baseline characteristics or ace inhibition . it was significantly associated with improved bp and metabolic control , amelioration of gdr , and slower long - term gfr decline on follow - up.conclusionsdespite intensified treatment , patients with type 2 diabetes have a fast gfr decline . hyperfiltration affects a subgroup of patients and may contribute to renal function loss and nephropathy onset or progression . whether amelioration of hyperfiltration is renoprotective is worth investigating ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: lymphedema ( le ) is a condition in which lymphatic transport is compromised , allowing lymph fluid to accumulate between tissues . the accumulation causes progressive fibrosis between the skin and subcutaneous tissue , and is characterized by non - pitting swelling . this fibrosis and swelling damage lymphocytes and weaken the immune system , which eventually progresses to chronic inflammation and degeneration in the lymphatic system and peripheral tissues1 . le causes various problems such as pain , tingling sensation , loss of sensation , muscle weakness , stiffness , and reduced joint range of motion ( rom ) 2 . according to previous studies , complex decongestive therapy ( cdt ) for le includes manual lymph drainage , application of a short stretch compression bandage ( sscb ) , reduction of edema , and skin care . however , an sscb does not continuously maintain the pressure and must be rolled back every day6 . if adverse effects on the skin occur and a sscb can not be applied , therapeutic exercises can not be safely performed . after right breast resection on june 2 , 2006 , a 57 - year - old woman underwent axillary lymph node dissection and radiotherapy on october 24 , 2012 . beginning in december 2013 , edema developed in the right upper extremity , for which she presented to the department of rehabilitation . she was diagnosed with le and received treatment of edema three times weekly . on the day of presentation , a physical therapist partially measured the circumference of the upper extremity by using a tape measure as follows : axillary , at 10 cm above the elbow , at the elbow , and at 10 cm below the elbow , wrist , and hand7 . the measurements for the right upper limb were 34 , 28 , 28.5 , 23 , 16 , and 19 cm , respectively . those for the left upper limb were 32 , 25 , 25 , 22 , 16 , and 18 cm , respectively . the moisture ratio between the body water and the intracellular fluid in the upper extremity was measured by performing a biological analysis with inbodys10 ( biospace ltd . , the body water volume in the right arm was 1,550 ml , and the extracellular to total cellular ( e / t ) fluid ratio was 0.384 % . the body water volume in the left arm was 1,390 ml , and the e / t fluid ratio was 0.378 % . furthermore , the patient showed a restricted rom in the right arm as follow 120 flexion , 80 abduction , 15 external rotation , and 15 internal rotation . on the day of evaluation , the treatment was explained to the patient , and the patient underwent cdt and sscb application . on the next treatment day , because of the skin condition , cdt was administered without a sscb three times per week for 14 weeks . after the treatment on march 27 , 2014 , the patient was reevaluated . the measurements of the upper right limb ( axillary , at 10 cm above the elbow , at the elbow , and at 10 cm below the elbow , wrist , and hand ) were reduced to 34.5 , 29 , 24.5 , 25 , 16 , and 18.5 cm , respectively . the body water volume was 1,680 ml ( 10.8 % ) , and the e / t fluid ratio was 0.387 % in the inbody biological analysis . rom improved to 160 flexion , 120 abduction , 40 external rotation , and 35 internal rotation . however , even though the values of the parameters of the right upper extremity were reduced , the le increased . next , the patient underwent pnf d2 flexion and breathing exercises three times a week for 14 weeks ( 36 sessions in total ) . the starting position for the exercise is the supine position , with the shoulder joint in extension , adduction , and internal rotation ; the elbow in extension ; and the forearm , wrist , and fingers in pronation . the shoulder was slowly stretched by flexion , abduction , external rotation , elbow extension , and forearm supination , and the wrist and finger were slowly stretched by extension . the arm and ear were 810 inches apart , and the thumb was pointed toward the floor . the patient stretched her upper extremities as much as possible and maintained the position . at the same time , breathing was stopped and held for 5 seconds . after that , while exhaling , the arm should be slowly returned to the starting position . this treatment is performed for 10 repetitions ( three sets ) , followed by 1 minute of rest . this study conformed to the ethical standards of the declaration of helsinki ( 1975 , revised 1983 ) . the protocol for this study was approved by the institutional review board of hanyang university ( hyi - 15 - 046 - 1 ) . after the pnf d2 flexion and breathing exercises , parameters of the right upper extremity and the body water volume were reduced . moreover , the restricted rom of the right side was improved . in the reevaluation on july 1 , 2014 , the parameters of the right upper extremity ( axillary , at 10 cm above the elbow , at the elbow , and at 10 cm below the elbow , wrist , and hand ) were reduced to 34 , 28 , 24 , 24 , 16 , and 18 cm , respectively . in addition , the e / t fluid ratio was improved to 0.382 % , and rom was improved to 180 flexion , 180 abduction , 80 external rotation , and 45 internal rotation . in this study , the effects of pnf d2 flexion and breathing exercises were studied in a patient with upper extremity le for whom the sscb treatment method could not used . as a result of the intervention , the circumference of the armpit was reduced by 0.5 cm ; that of 10 cm above the elbow , by 1 cm ; that of the elbow , by 0.5 cm ; that of 10 cm below the elbow , by 1 cm ; and that of the back of the hand , by 0.5 cm . a total of 100 ml ( 9.4 % ) of body water volume in the right upper extremity was eliminated , and the e / t fluid ratio was decreased by 0.005 % . in addition , the rom of the extremity was improved to 20 flexion , 60 abduction , 40 external rotation , and 10 internal rotation . this study showed that pnf d2 flexion and breathing exercises were effective in reducing le and improving rom . this study suggests the cdt method and pnf d2 flexion and breathing exercises for patients for who a sscb could not be applied . in addition , it is already known that sscb compression force helps the natural pumping action of the muscle to increase circulation of venous and lymphatic fluid in edematous areas3 . however , in a research by irdesel et al. 8 , comparison between a group that maintained pressure during the exercise and an opposition group did not show a beneficial difference in circulation . previous studies have shown that pnf exercise improves joint mobility and muscle function9 ,10,11,12 . moreover , in a study by sharman et al. 9 , active pnf stretching was found to be the most effective method to improve rom . in addition , in a study by hindle et al. 10 , pnf stretching was found to improve rom , although plyometric , high - intensity , or maximum - intensity exercise reduced muscle consumption . after gonzlez - rav et al. 11 implemented different exercises for 13 weeks and compared overall rom and shoulder rom in pnf groups , rom improved by 5.91 ( 70.9676.01 ) and 5.08 ( 71.8476.88 ) , respectively , in the manual exercise groups but was reduced by 2.57 ( 68.1166.06 ) in the non - exercise group . however , in a comparison between the results of their study and those of previous studies , the same results could not be concluded owing to differences in study subjects . therefore , studies on increasing muscular strength through performance of pnf are needed in order to determine their effect on edema . moseley et al. 13 analyzed breathing and gentle arm exercises , and observing le reduction in the upper extremity by 46 ml ( 5.8 % ) immediately after exercise , 50 ml ( 5.3 % ) after 30 minutes , 46 ml ( 4.3 % ) after 24 hours , and 33 ml ( 3.5 % ) after 1 week . this parameter was remeasured 1 month after exercise and was reported to have decreased by 101 ml ( 9.0 % ) . although their research method differed , they reported a positive effect on le reduction because of the combined effects of breathing and upper extremity exercises . this study is a case report of individual treatment results in one patient , without a control group . because of this limitation , correlation could not be conclusively determined between the effects pnf d2 flexion and those of breathing exercises on le and rom . therefore , the present authors referred to studies such as that by moseley et al. 11 and concluded that pnf d2 flexion and breathing exercises improved le and rom . although this study is a case report of a single patient , its results indicate that these exercises should be studied on a larger scale .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] the aim of this study was to evaluate the effects of proprioceptive neuromuscular facilitation ( pnf ) d2 flexion and breathing exercises in a patient with lymphedema ( le ) . [ subject ] this report describes a 57 - year - old woman with le in whom a short - stretch compression bandage ( sscb ) could not be used for treatment because of skin itching and redness . [ methods ] the patient received complex decongestive therapy without a sscb . next , pnf d2 flexion and breathing exercises were conducted three times per week for 14 weeks ( 36 times ) . [ results ] as a result , the circumference of the armpit was reduced by 0.5 cm ; that of 10 cm above the elbow , by 1 cm ; that of the elbow , by 0.5 cm ; that of 10 cm below the elbow , by 1 cm ; and that of the back of the hand , by 0.5 cm . a total of 100 ml ( 9.4 % ) of body water was eliminated from the right upper extremity , and moisture ratio was reduced by 0.005 % . finally , range of motion was improved to 20 flexion , 60 abduction , 40 external rotation , and 10 internal rotation . [ conclusion ] this study showed that pnf d2 flexion and breathing exercises were effective in reducing le and improving range of motion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: aesthetically , the columella affects the projection of the nasal tip , defines the nasolabial angle , and influences the connection between the nasal base and alar rims . isolated destruction of the columella can be caused by rhinoplasty , trauma , infection , or malignancy . the relative paucity of adjacent tissue available for reconstruction along with the distinctive contour , discrete border , and insufficient blood supply to the columella make this subunit difficult to reconstruct . surgical reconstruction of nasal defects is influenced by the patient 's condition as well as the size and cause of the defect . the nasolabial flap is a regional flap that can be easily used to repair the columellar area . however , the forehead flap is relatively bulky and donor site morbidity is more commonly associated with this type of flap than with the nasolabial flap . forehead flaps are well suited for reconstructing columellar defects when the defect involves the nasal tip subunit , with or without other adjacent subunits , since the flap will cover these areas as it extends onto the columellar subunit . subnasal flaps are used for a one - stage procedure that transfers well - match skin to the columella ; this technique is relatively simple and donor site morbidity is rarely observed . however , the flap should be an adequate size since too much length predisposes the flap to necrosis and occasionally hair growth can develop in this area . nasolabial flaps are relatively long enough to cover the entire columellar area and rarely leave scars . a nasolabial island flap is not as bulky as a forehead flap , and the skin color of the nasolabial area is similar to that of the columella . additionally , hair growth in the nasolabial area is sparse and donor site morbidity is rarely observed . the patient had been involved in a serious accident . due to injuries sustained from the accident , we obtained rib cartilage for dorsal augmentation and extended the columellar strut to raise the nasal tip . the cartilage was cut and used it for dorsal augmentation and to extend the columellar strut . after surgery , the patient was satisfied with the surgical outcomes but 3 days later , the columellar skin color changes occurred in where incisions had been made . we used alprostadil ( eglandin ; mitsubishi tanabe pharma korea , korea ) and hyperbaric therapy to increase the blood supply to the columellar area . a portion of the grafted costal cartilage used for the columellar strut was exposed ( fig .1 ) . we planned to cover the defect with a subcutaneous pedicled local flap harvested from the nasolabial fold area . care was taken to ensure that the suture line was located on the nasolabial fold crease when closing the donor site . while under general anesthesia , the patient was injected with 2 % lidocaine mixed with epinephrine ( 1:200,000 ) around the defect area . we created an ovoid - shaped skin flap on the right nasolabial fold being careful not to include the hair - bearing regions . the subcutaneous pedicle was 1.5 cm in width and 2.5 cm in length ; the pivot point was located lateral to alar rim ( fig . instead , we created a subcutaneous tunnel to move the flap to the upper lip . the elliptic - shaped flap was then pulled through the tunnel and onto the columellar defect . the lateral cheek was undermined in the subcutaneous plane and the donor site was repaired with simple interrupted suture . a leech was applied for 3 days and 10 g of alprostadil ( eglandin ) was administered to the patient every day for 8 days . two years after surgery , the flap was still intact and there was no visible donor site scarring ( fig . creation of nasolabial island flap relies on the subcutaneous and dermal vascular system augmented by these vessels in the base of the flap . ducic and burye described the successful use of pedicle nasolabial flaps for reconstructing various oral cavity defects . nasolabial flaps have also been utilized by several authors as the preferred method for reconstructing isolated columellar defects . compare to the myocutaneous nasolabial flap , the subcutaneous nasolabial flap is relatively thin and can be applied to skin and subcutaneous defects . it is important assess the extent and depth of the defect as well as the remaining tissue that surrounds the defects before performing reconstruction . in this respect , nasolabial island flaps are ideal for reconstructing the columella because these flaps are composed of skin lacking hair , skin that is of a similar color , and are associated with less visible donor site scarring than other types of regional flaps . with larger than 2 cm defects of the nasal dorsum , lateral wall , and columella , it is often necessary to use tissue form area adjacent to the nose for reconstruction . the most widely described method for reconstruction of nasal skin defects greater than 2.5 cm in diameter is the use of a forehead flap . the present case involved a superficial columellar defect affecting only the skin and subcutaneous tissue . additionally , we did not use this flap in order to avoid the development of muscle weakness or facial nerve damage following surgery . musculocutaneous flaps are similar to subcutaneous nasolabial flaps except that underlying muscle is included . although incorporating underlying mimetic muscle enhances the reliability and durability of the flap , allowing it to be transposed along greater distances , musculocutaneous flaps have a bulky pedicle and limited arc of rotation . although the naolabial flap is excellent for reconstructing the columella , a columella reconstructed with a nasolabial flap occasionally deviates to the side of the pedicle as a result of flap contracture during the healing phase . one way to avoid this problem is to create a flap 10 % - 20 % longer than what is actually needed to avoid exerting tension on the pedicle . therefore , we recommend that the nasal tip be raised properly , and , if possible , to use the endonasal approach instead of the transcolumellar approach to do so . if the early signs of columellar skin necrosis ( e.g. , skin color change ) occur , smoking should be stopped , hyperbaric therapy should be administered , and medications for blood supply should be given . in addition , excessive handling of the columellar incision site should be avoided to prevent this drastic complication . in conclusion , our results demonstrated that a nasolabial island flap can be used to effectively reconstruct the nasal columella .\noutput:\n" }, { "from": "agent", "value": "columellar skin defects may be caused by excision of cutaneous malignancy , trauma , or tissue necrosis associated with surgery . although columellar skin necrosis rarely occurs following rhinoplasty , this condition might be more common when using an external approach than a closed approach . columellar skin incision performed with exaggerated tip augmentation may cause columellar necrosis . the nasolabial island flap , used unilaterally to cover columellar skin defects , is used for a single - stage reconstruction procedure and is generally not associated with the need for secondary surgeries . this technique is well suited for repairing columellar skin defects . we experienced a patient with columellar skin necrosis occurring after rhinoplasty which was reconstructed using a unilateral single - stage nasolabial island flap ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this habit can occur during the day and night and it can be conscious or non conscious . the prevalence of bruxism has a wide range because of difficult diagnosis of this parafunctional habit and different methodologies . the etiology of bruxism is multifactorial and the studies concerning this matter could n't gain exact results . however , the discussed causes of bruxism include : local and mechanical factors , systemic factors , neurologic factors , psychological factors and genetics factors . the most common clinical sign of bruxism is abnormal wear of teeth which is caused by periodic clenching or condensation of teeth . other side effects of bruxism are tooth hypermobility , recession and inflammation of the gums , pain and hypertrophy of maseteric muscles , degenerative changes of temporomandibular joint and headache . alert parents ask dentists and physicians about tooth grinding of their children as well as the side effects of it and also how to stop this habit . the aim of this investigation was to determine the prevalence of the bruxism and its etiologic factors to make some helping recommendations to the parents . the awareness of parents about bruxism and its side effects make them keen to contribute in recall sessions ; on the other hand , dentists and physicians will be able to recognize etiologic factors to eliminate them . this cross - sectional descriptive study was done on 6004 - 12 year old children , who were referred to four dental schools of tehran in 2007 - 2008 . after acquiring the parents informed consent , the questionnaire included two sections : the first part contained the information about the age , sequence of birth , medical history and also parents age , education , and job . the second part was questions related to the time of bruxism during the day or night , manifestation of distressing events in the family ( such as parental divorce , birth of new baby , start going to school or death of child 's loved one ) , family history of bruxism , temporomandibular joint disorder , parasomnias , oral habits ( nail biting , pacifier sucking and lip or thumb sucking ) and psychological disorders . temporomandibular joint disorders were considered as jaw clicking , pain or tenderness in muscles and limitation in mouth opening . items related to psychological disorders include irritability , seclusion , sadness , neophobia , crying easily , gazing at one point , hyperactivity , obsession , depression , acrophobia or lygophobia and finally parasomnias items include drooling , sleep talking , sleep walking , mouth breathing and snoring . after collecting information with the questionnaire filled out by parents , the analysis of data to determine the prevalence of bruxism and the percentage of contributing factors in children with or without bruxism was done , and the results of these 2 groups were compared . , fisher test , mann - whitney and t - test were used to analyze the data . our sample was comprised of 600 children , 314 boys ( 52.3 % ) and 284 girls ( 47.7 % ) , with the mean age of 7.42.4 years . based on parent 's report , 157 ( 26.2 % ) children showed bruxism as a parafunctional habit . there was no significant relation between the gender , the sequence of birth , father 's age , and parent 's education and father 's job with the prevalence of bruxism ( table 1 ) . distributaion of frequency of the gender , the sequence of birth and parent 's education and their correlation with bruxism the prevalence of bruxism was 28.7 % in full time mothers , 18.9 % in employed and 9.1 % in self - employed mothers . the analysis of data showed significant difference between the job condition of mothers and the prevalence of bruxism ; the prevalence of bruxism in children with full time mothers was higher ( p = 0.03 ) . also 7.8 % of children had fathers with bruxism history , 6.8 % mothers with bruxism history and 1.3 % of children had both parents bruxism history . the analysis of data showed a significant correlation between the family history of bruxism and the prevalence of it ( p 0.001 ) , which the prevalence of bruxism was 20.8 % in children without family history of bruxism , 51.1 % in children with fathers history of bruxism , 51.2 % in children with mothers history of bruxism and 87.5 % in children with both parents history of bruxism ( table 2 ) . distribution of frequency of family history of bruxism , distresing events and their correlation with bruxism according to parent 's report , 7.6 % of children had a history of distressing events in their life , whereas 87 % of children with bruxism had a history of distressing events in their life , and 13 % of children with bruxism did n't report any history of distressing events in their life . parasomnias were stated by parents in 53.2 % of children , drooling being the most ( 25.8 % ) , and snoring the least ( 4.5 % ) . bruxism was seen in 35.1 % of children with parasomnias and merely in 16 % of subjects without any sleep disorders . there was a significant difference between these 2 groups , and there was a correlation between drooling , sleep walking and bruxism ( p 0.001 ) . frequency of parasomnias and their correlation with bruxism temporomandibular disorder oral habits were reported in 18.8 % of children . thirty - four ( 30.1 % ) of children with oral habits demonstrated bruxism , while this was observed in 25.3 % of other children ; however this was statically not significant ( p = 0.3 ) . in the study of tmd , the frequency of joint click was 1.2 % , facial muscles pain 0.7 % , limitation of opening the mouth 2 % , and pain during opening the mouth 0.7 % . the prevalence of bruxism in children with tmd was 63.6 % and in children without tmd 24.7 % ; the difference was significant ( p 0.001 ) . based on our studythere was no significant relationship between the history of asthma and allergy or systemic disease with bruxism ( table 3 ) . in our study psychological disorders , i.e. irritability ( 47.2 % ) , crying easily ( 38.7 % ) and hyperactivity ( 19.8 % ) were the most frequent ones . there was a significant relationship between depression , acrophobia and lygophobia with the prevalence of bruxism ( table 4 ) . in the present study conducted on 600 children with an average age of 7.42.4 years , the prevalence of bruxism was 26.2 % . cheifetz declared the prevalence of bruxism in children under 17 years old 38 % based on parent 's reports while liu et al stated that bruxism occurred in 6.5 % of 2 - 12 year - old chinese children . also chen and coworkers reported the prevalence of bruxism in 3 - 6 year - old chinese children 36.4 % . reding reported the prevalence of bruxism in 3 - 17 year - old american children 15.1 % . these differences in the prevalence of bruxism are because of difficult diagnosis of bruxism , various methods in collecting data and also diverse samples from different racial origins . in the present study the beginning age of bruxism was 4.92 years . but cheifetz et al reported the beginning age of bruxism to be 3.6 years and also showed that there was a male predilection in acquiring bruxism but they gave no explanation for this . in our studythere was no significant correlation between age , parent 's education and father 's job with the prevalence of bruxism in children and these results were the same as laberge and cheifetz studies . but in this study the difference in the prevalence of bruxism in full time mothers and working mothers was significant which may be to more attention of full time mothers , because they spend more time with their children . one of the etiologic factors assessed in the present study was the occurrence of distressing events in the child 's life and its relationship with the prevalence of bruxism , which was not mentioned in any other study till now . one of these events was divorce of parents , separation of one of the parents for any reason , death of the loved one of the child , birth of a new child , the beginning of kinder care or school , watching terrifying movies , etc . bruxism occurred 2.6 times more in children who had a family history of bruxism ( father - mother ) , compared to children who did not have such a history . the results of our study regarding this matter are in agreement with cheiftez et al . these researchers stated if either parent had a history of bruxism the chance of demonstrating bruxism by their children will be 1.8 times more .25.8 % of children had drooling and 3.2 % of children had sleepwalking which showed a direct relationship with bruxism . weidman et al also showed a significant relation between bruxism and parasomnias and declared that children who had drooling or talking during sleep had more chance to get bruxism . this is in agreement with cheifetz et al study , although in their research , drooling was 33 % and sleep talking 16 % . they expressed that in children who had drooling and sleep talking the bruxism was observed 1.7 and 1.6 times respectively more than in other children . kato et al also confirmed this relationship and explained that bruxism causes to provisionally increase drooling to lubricate the esophagus and oral cavity , thus it is logical to expel the excess of saliva , consequently drooling is more reported in these children . in our studythe most common ( 12.5 % ) oral habit was nail biting , which was reported 33.37 % in bosnyak study , 48 % in egermark study , 51 % in farsi study and 55 % in weideman study . all of these investigations showed a far more prevalence compared to our results but in their studies nail biting had the most frequency . in contrast to our study cheifetz et al declared that the children with bruxism revealed less oral habits but widmalm reported that the bruxism is seen along with other oral habits such as thumb sucking and only in 3.4 % of subjects existed without oral habit . in the present study 3.7 % of children had tmd . this result was similar to those of widmalm , restrepo and winocur but cheifetz found no significant relationship between tmd and bruxism . in our study there was no relation between asthma and allergy with bruxism , which was similar to cheifetz et al . in contrast to our result weideman et al declared that the children with bruxism were even healthier than other children . marks also showed that there was an association between bruxism , headache and allergy . in the study of psychologic disorders of children , hyperactivity , depression , acrophobia and lygophobia revealed a significant relation with bruxism . cheifetz and agargun also confirm the relation between bruxism and psychologic disorders , also the relation between hyperactivity and bruxism . furthermore , our result regarding depression was similar tothat o manfredini . in this descriptive studywe were encountered with limitations such as the credibility and reliability of the parent 's answers to the questionnaire . based on parent 's report , the prevalence of bruxism in 4 - 12 old children was 26.2 % and the average age for beginning of bruxism was 4.92 years . in the study of etiologic factorsthere was a significant relation between bruxism and mother 's job , family history , distressing event in life , parasomnias specially drooling and sleep walking , tmd , hyperactivity , depression , acrophobia and lygophobia .\noutput:\n" }, { "from": "agent", "value": "objectivebruxism is defined as the habitual nonfunctional forceful contact between occlusal tooth surfaces . the aim of this study was to determine the prevalence of bruxism and correlated factors in children referred to dental schools of tehran , based on parent 's report.methodsthis cross - sectional descriptive study was conducted on 600 4 - 12 year - old children with a mean age of 7.42.4 years , who were referred to four dental schools in tehran . after collecting information with questionnaire filled out by parents , 2 , fisher test , mann - whitney and t - test were used to analyze the data.findingsthe prevalence of bruxism was 26.2 % . bruxism begun in average at the age of 4.92 years . also it occurred 2.6 times more in children who had a family history of bruxism ( father - mother ) , compared to children who did n't have such a history . 87 % of children with bruxism had a history of distressing events in their life , and 13 % of children with bruxism did not report any history of distressing events in their life . in this study most common oral habit was nail biting . in study of parasomnias , drooling was the most , and snoring the least reported sleep disorder . bruxism in children with drooling was twice more than in other children . the prevalence of bruxism in children with temporomandibular disorder was 63.6 % and in children without tmd was 24.7 % . conclusionbased on parent 's report , 26.2 % of children showed bruxism and there was a significant relation between bruxism and mother 's job , family history , distressing event in life , parasomnias , especially drooling and sleep walking , tmd , hyperactivity , depression , acrophobia and lygophobia ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .\noutput:\n" }, { "from": "agent", "value": "abstracta general synthetic sequence involving simply prepared starting materials provides rapid access to diverse , novel tricyclic architectures inspired by pleuromutilin . smiimediated radical cyclization cascades of dialdehydes , prepared using a new , onepot , coppercatalyzed double organomagnesium addition to chlorocyclohexenone , proceed with complete sequence selectivity and typically with high diastereocontrol to give analogues of the target core . our expedient approach ( ca . 7 steps ) allows nontraditional , de novo synthetic access to analogues of the important antibacterial that cant be prepared from the natural product by semisynthesis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: c - reactive protein ( crp ) is a multifunctional and evolutionarily conserved plasma protein ( reviewed in ) . through the circulation , crp reaches tissues and is seen deposited at sites of inflammation . human crp is comprised of five identical subunits arranged in a cyclic pentamer . in this paper , we review two recognition functions of pentameric crp which are relevant to cardiovascular disease : the phosphocholine - ( pch - ) binding function of native pentameric crp that has been implicated in acute myocardial infarction and ischemia / reperfusion ( i / r ) injury and the atherogenic low - density lipoprotein - ( ldl - ) binding function of nonnative pentameric crp that has been implicated in atherosclerosis . a major function of crp in its native pentameric form is to bind , in a ca - dependent manner , to molecules and cells bearing exposed pch groups , such as the cell wall of pneumococci and cell membrane of damaged cells . once crp is bound to a pch - containing ligand , it activates the complement system to destroy the ligand . when crp binds to foreign pathogens , it helps in the killing of the pathogen via complement activation . in mouse models of pneumococcal infection , crp has been shown to be protective ; that is , crp decreases bacteremia and increases survival of infected mice ( reviewed in ) . experiments performed in vitro using necrotic and apoptotic cells reveal that the binding of crp to necrotic and apoptotic cells can facilitate the removal of such cells . however , experiments performed in vivo using animal models of i / r injury reveal that the binding of crp to damaged cells is detrimental to the tissue . combined data suggest that the consequences of the binding of crp to damaged cells depend on the tissue . in many places in the body ( skin and subcutaneous tissue , e.g. , ) , it does no harm to bind complement and hasten death of dead tissue . the situation for the organs which are working all the time and do not have the ability to regenerate their tissue ( heart , e.g. , ) is different and hastening removal of dead tissue will be harmful . during myocardial infarction , the ischemic part of the tissue where the damage can be reversed may also be removed by crp , as described previously . thus , the pch - binding function of crp is defensive for the host because it leads to protection against pneumococcal infection and removal of necrotic tissue . on the other hand , the pch - binding function of crp is detrimental for the host when crp binds to reversibly damaged myocardial cells , because it causes more damage to the tissue via complement activation . studies in animals ( mice , rats , and rabbits ) and human specimens have shown that both crp and components of the activated complement system are deposited and colocalized in myocardial infarcts and that complement activation is due to the presence of crp . crp has been shown to exacerbate left ventricular dysfunction and promote adverse left ventricular remodeling after myocardial infarction . mostly by employing animal models of i / r injury , it has been shown that crp enhances the size of myocardial infarcts and also contributes to ischemic tissue damage in intestine , lung , kidney , and brain . in a mesenterici / r model , crp deposition correlated with complement deposition , suggesting a role of crp in complement activation ; in these studies , inhibition of complement activation by using c1 inhibitor reduced the effects of crp on intestinal injury . similarly , inhibition of complement activation by decay - accelerating factor also prevented crp - mediated intestinal injury and remote lung damages following mesenteric i / r . in mice transgenic for human crp , arterial injury resulted in an expedited and higher rate of thrombotic occlusion compared to that in nontransgenic mice . crp - mediated exacerbation of vascular injury involves complement since lowering the biosynthesis of crp prevented complement consumption . these findings indicated that an intact complement system is required for the damaging effects of crp on myocardial injury because lowering of crp level , depleting complement , or blocking crp - mediated complement activation abrogated the effects of crp . the three - dimensional structure of the pch - binding site reveals that glu81 in the pch - binding hydrophobic pocket of crp interacts with the nitrogen atom of choline in pch , that phe66 interacts with the three methyl groups of choline , and that thr76 is critical for creating the appropriately sized pocket on crp to accommodate pch . the phosphate group of pch directly coordinates with the two calcium ions bound to crp . / t76y / e81a , that does not bind to pch and was therefore unable to form complexes capable of activating complement . such a mutant is suitable for use in experiments aimed at defining the contribution of the pch - binding site of crp in deteriorating tissue injury . in another approach , pharmacological inhibition of crp using a pch - based compound reduced the deposition of crp at myocardial infarcts and inhibited complement activation , indicating that the pch - binding site of crp participates in worsening the infarct size and that the inhibition of the pch - binding site is a useful strategy to prevent tissue - damaging conditions . similarly , pharmacological inhibition of biosynthesis of crp also resulted in a reduction of crp - mediated exacerbation of vascular injury . native crp does not bind to native ldl under normal physiological conditions . native crp and native ldl interact with each other only when either one is immobilized , modified , or aggregated , raising the possibility that crp and ldl may interact with each other under pathological conditions . the native pentameric structure of crp can be modified in vitro and we have shown that the recognition functions of nonnative pentameric crp are different from those of native crp : one function of crp in its nonnative pentameric conformation is to bind to atherogenic ldl . two types of ldl are used as models of atherogenic ldl : enzymatically modified ldl ( e - ldl ) and oxidized ldl ( ox - ldl ) . to e - ldl , even native crp binds and the binding is inhibited by free pch . data obtained from pch - inhibition experiments suggest that crp binds to e - ldl through the pch groups in e - ldl and that the binding is mediated by the pch - binding site of crp . however , the amino acids in crp that contact pch are not critical for the binding of crp to e - ldl , indicating that the pch groups present in e - ldl are not the only components in e - ldl through which crp binds to e - ldl . it has been shown that crp binds to e - ldl through cholesterol also and that this binding was also pch - inhibitable . nonnative crp binds to e - ldl more avidly than native crp through an as - yet - undefined mechanism . several investigators have reported that native crp can also bind to ox - ldl through the pch moiety in ox - ldl and several investigators have reported that native crp does not bind to ox - ldl . crp has also been shown to bind to ox - ldl in vivo in diabetes mellitus patients with atherosclerosis and when ox - ldl is complexed with 2 glycoprotein i . we reported that a modification of the native pentameric structure of crp was required for binding to ox - ldl and that crp , in its nonnative pentameric conformation , binds efficiently to ox - ldl . taken together , it seems that the binding of crp to ox - ldl depends on the stringency of the method used to prepare ox - ldl . if the pch groups are exposed to ox - ldl , then native crp would bind , if the pch groups are not exposed to ox - ldl , then native crp would not bind , and nonnative crp would bind to ox - ldl regardless of the extent and nature of oxidation . the mechanism of interaction between nonnative crp and atherogenic ldl , however , has not been elucidated yet . on the ldl molecules , the moieties that could interact with crp include pch , cholesterol , apob , and phosphoethanolamine . in addition , the amyloid - like structures which are induced in ldl by oxidation could also be recognized by nonnative crp . we hypothesize that the ldl - binding site is buried ( or absent ) in native crp and is exposed ( or formed ) in nonnative crp by the loosening up of the pentamer . crp has been found deposited and colocalized with ldl in atherosclerotic lesions in humans and experimental animals , indicating the presence of nonnative crp at the lesions . the recognition function of crp to bind to atherogenic ldl should have an effect on the formation of ldl - loaded macrophage foam cells and also on the proinflammatory effects of foam cells and ldl . the formation of foam cells represents an early step in atherosclerosis and begins when macrophages bind and take up ldl . using immunohistochemical staining of atherosclerotic lesions with antibodies to crp and ldl , the outcome of the interactions among native or aggregated crp , ldl , andmacrophages with regard to the formation of macrophage foam cells has been investigated extensively ; however , a review of the published literature does not provide a clear - cut overall conclusion . similarly , it is also unclear whether both fc receptor cd32 and ldl receptor cd36 on macrophages participate if there is an effect of crp on the uptake of ldl by macrophages . we investigated the effect of crp on the accumulation of lipid droplets made up of cholesteryl esters in e - ldl - treated macrophages and found that , in contrast to e - ldl alone , crp - bound e - ldl was inactive for the formation of foam cells . other consequences of crp - ldl interactions have also been reported . crp reduces the susceptibility of copper - induced oxidation of ldl . crp attenuates adhesion and activation of monocytes via the prevention of binding of minimally modified ldl to monocytes ; this effect was mediated by the binding of crp to monocytes . crp also suppresses the proatherogenic effects of macrophages when bound to lysophosphatidylcholine , a moiety present in oxldl . collectively , these findings suggest that crp , under defined conditions , prevents foam cell formation and reduces proinflammatory effects of ldl and foam cells . to determine the role of crp in the development of atherosclerosis , human native crp has been introduced into three different murine models of atherosclerosis : apoe mice , ldlr mice , and apobldlr mice ( reviewed in ) . crp was found to be neither proatherogenic nor atheroprotective in apoe mice . both passively administered crp and transgenically expressed crp had no effect on the development , progression , or severity of spontaneous atherosclerosis in apoemice . in ldlrmice also , there was no effect of crp on the development of atherosclerosis . in rabbits transgenic for human crp alsohowever , two recent studies indicated atheroprotective effects of crp . in apobldlr mice , crp slowed the development of atherosclerosis . in apoecrp and ldlrcrp mice , the size of atherosclerotic lesions was either equivalent or increased when compared to that of apoe and ldlr mice , suggesting that even mouse crp may mediate atheroprotective effects . these data raise hopes that nonnative crp may be more atheroprotective than native crp considering the difference between the ldl - binding recognition functions of nonnative and native crp . although much more experimentation needs to be done , there are already several lines of evidence to indicate that the ldl - binding function of crp is beneficial and may contribute to atheroprotection . second , crp attenuates monocyte adhesion and activation via the prevention of binding of atherogenic ldl to monocytes . fifth , at least in two in vivo studies , both human and mouse crp showed some atheroprotective effects . crp infused in healthy human adults does not result in any significant clinical , hematologic , coagulative , or biochemical changes or any increase in proinflammatory cytokines or acute phase proteins . in case of acute myocardial infarction in model animals , crp worsens an already existing disease ; crp does what it is programmed to do , that is , to bind to pch and activate complement , and just in this case crp does harm . we conclude that crp is an atheroprotective molecule and , therefore , a host defense protein . crp mutants ( nonnative crp ) capable of efficiently binding to all forms of atherogenic ldl can be evaluated for their effects on the development of atherosclerosis in available animal models to test our conclusion . administration of exogenously prepared crp mutant may be useful to capture atherogenic ldl to prevent atherosclerosis . if it turns out that nonnative crp is indeed atheroprotective , a long - term goal could be to focus on the discovery and design of small - molecule compounds to target crp ( a compound that can change the structure of endogenous crp ) for capturing atherogenic ldl . the purpose of administering a pch - based compound to target crp is to inhibit binding of crp to damaged cells to prevent further damage to myocardial infarcts . as of now , we do not see any need to lower the circulating level of native crp , as we have suggested previously .\noutput:\n" }, { "from": "agent", "value": "c - reactive protein ( crp ) performs two recognition functions that are relevant to cardiovascular disease . first , in its native pentameric conformation , crp recognizes molecules and cells with exposed phosphocholine ( pch ) groups , such as microbial pathogens and damaged cells . pch - containing ligand - bound crp activates the complement system to destroy the ligand . thus , the pch - binding function of crp is defensive if it occurs on foreign pathogens because it results in the killing of the pathogen via complement activation . on the other hand , the pch - binding function of crp is detrimental if it occurs on injured host cells because it causes more damage to the tissue via complement activation ; this is how crp worsens acute myocardial infarction and ischemia / reperfusion injury . second , in its nonnative pentameric conformation , crp also recognizes atherogenic low - density lipoprotein ( ldl ) . recent data suggest that the ldl - binding function of crp is beneficial because it prevents formation of macrophage foam cells , attenuates inflammatory effects of ldl , inhibits ldl oxidation , and reduces proatherogenic effects of macrophages , raising the possibility that nonnative crp may show atheroprotective effects in experimental animals . in conclusion , temporarily inhibiting the pch - binding function of crp along with facilitating localized presence of nonnative pentameric crp could be a promising approach to treat atherosclerosis and myocardial infarction . there is no need to stop the biosynthesis of crp ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: diabetes is a common disease with concomitant oral manifestations that impact dental care . of greater concernis the ability of oral infections to profoundly affect metabolic control of the diabetic state . there is a need for all healthcare providers to know various manifestations in which diabetes mellitus ( dm ) can manifest orally so that they may detect and treat them as well as take positive steps to control the glycemic status of such patients . oral manifestations of dm may be broadly categorized into two types : those affecting the hard tissues and those afflicting the soft tissues of the oral cavity . the present study included 50 cases of dm selected as per american diabetes association criteria who had oral manifestations . the control group comprised 50 age - and sex - matched diabetic patients without any oral complications . nondiabetics , diabetic patients with carcinoma of oral cavity , and those taking tobacco were excluded from the study . the patients were then subjected to the following investigations : complete hemogram , complete urine examination , serum urea and creatinine fbs / ppbs , fasting serum lipid profile , s.g.p.t , micral test , x - ray chest p.a . view , 12 lead e.c.g , fundus examination , 2d echocardiography , and blood culture with special reference to detection of oral manifestations , cardiovascular manifestations , and detection of microvascular and macrovascular complications of diabetes was carried out in both cases and controls . the chisquare test and two sample proportion test were used to calculate the p value . a total of 50 cases of dm with oral manifestations were analyzed ; the majority were observed to have periodontal disease - 34 % , followed by oral candidiasis in 24 % , tooth loss in 24 % , and dental caries in 24 % . other complications included oral mucosal ulcers in 22 % , taste impairment in 20 % , halitosis in 16 % , xerostomia and salivary gland hypofunction in 14 % , and burning mouth sensation in 10 % as shown in table 1 . distribution of oral manifestations in cases of diabetes mellitus on comparison of blood glucose status , it was observed that the fbg as well as ppbg levels were raised in subjects compared to controls . a significant difference was observed between fbg ( p = 0.0031 ) and ppbg values ( p = 0.0003 ) among diabetics with and without oral manifestations [ table 2 ] comparison of blood glucose status in cases and controls cases having complications of diabetes like diabetic neuropathy , diabetic retinopathy , diabetic nephropathy , cardiovascular diseases , dyslipidemia , and sepsis were 68 % , 50 % , 46 % , 40 % , 62 % , and 10 % , respectively [ figure 1 ] . the p values for neuropathy , retinopathy , and dyslipidemia were 0.0156 , 0.0241 , and 0.0278 , respectively which were found to be significant . the p value for nephropathy was 0.68 , cardiovascular disease 0.4047 , and sepsis 0.3149 ; hence no significant association was seen between these complications and oral manifestations of diabetes . microvascular and macrovascular complication was higher among diabetics with oral complication compared to dm without oral complication . chandna et al . also showed periodontitis to be a recognized complication of diabetes and it was more common in individuals with elevated glucose levels . observed hyposalivation as the most common oral manifestation , seen in 68 % , followed by halitosis in 52 % , periodontitis in 32 % , burning mouth sensation in 32 % , candidiasis , and taste alteration in 28 % of cases with controlled dm . in the same study , subjects with uncontrolled dm also presented with these manifestations , with hyposalivation seen in 84 % , followed by halitosis in 76 % , periodontitis in 48 % , taste alteration in 44 % , candidiasis in 36 % , and burning mouth sensation in 24 % . suggest that the incidence and severity of periodontitisare influenced by the presence or absence of dm , as well as the severity of hyperglycemia . these studies also indicate that the existence of severe periodontitis may adversely influence the control of dm . in a study by brian et al . among 2273 diabetics , the prevalence of periodontal disease was found to be 60 % ; the incidence of periodontitis being 2 - 6 fold higher . tsai et al . reported that among 4343 diabetics aged 4590 years , individuals with poorly controlled diabetes had a significantly higher prevalence of severe periodontitis than those without diabetes and its related complications . studied a total of 284 patients with diabetes , out of whom 68 % cases had increased prevalence of periodontal diseases . the present study showed significant association between cases and neuropathy , retinopathy and dyslipidemia . in the study by ashraf et al . , increased prevalence of diabetes - related complications like cardiovascular disease , retinopathy , nephropathy , peripheral , and autonomic neuropathy was observed during a 2 year follow - up period . retinopathy was significantly more common in patients with diabetes along with oral complications ( 40 % ) while microalbuminuria ( 28 % ) and hypertension ( 36 % ) were significantly less common in the study by maike et al . in the present study retinopathy , nephropathy , and hypertension were found to be more prevalent most probably due to the longer median diabetes duration of 7.6 years as compared to 6.8 % in the study by maike et al . . compromised polymorphonuclear leukocyte function resulting from impaired neutrophil adherence , chemotaxis , and phagocytosis prevent destruction of bacteria in the periodontal pocket and markedly enhance periodontal destruction abnormalities of collagen metabolism , impaired proliferation of osteoblasts , and weakened mechanical properties of newly formed bone have been documented in hyperglycemic patients . formation of advanced glycation end - products ( age ) is relatively common in sustained diabetes . age - modified arterial collagen immobilizes circulating low - density lipoprotein leading to atheroma formation . production of age also leads to greater basement membrane thickness of the microvasculature hampering normal homeostatic transport across the membrane and result in higher production of vascular endothelial growth factor , either which add to microvascular complications of diabetes . binding of age to macrophage and monocytes receptors ( rage : receptor for age ) , results in increased production of interleukin - 1 and tumor necrosis factor - a that enhances vulnerability to tissue destruction . high levels of glucose in the gingival crevicular fluid diminish wound - healing capacity of fibroblasts in the periodontium by hindering their attachment and spreading . fbg and ppbg were significantly higher among diabetics with oral manifestations compared to those without . microvascular and macrovascular complications of dm were found to be significantly higher among diabetics with oral diseases . the presence of oral manifestations in patients of dm indicates poorly controlled glycemic status and requires evaluation to detect long - term complications . knowledge of oral comorbidity among people with diabetes is generally poor and suggests the need for appropriate health education and health promotion to improve the oral health of diabetic patients .\noutput:\n" }, { "from": "agent", "value": "background : knowledge of the wide spectrum of the oral markers of diabetes is imperative as one frequently encounters individuals with undetected , untreated or poorly controlled diabetes.objectives : the objective was to study the oral manifestations in type 2 diabetes mellitus ( dm ) and to establish an association between oral manifestations and associated microvascular and macrovascular complications.materials and methods : 50 cases of dm were selected who had oral complications . the control group comprised 50 age - and sex - matched diabetic patients without any oral complications.results : oral manifestations in dm included periodontal disease in 34 % , oral candidiasis in 24 % , tooth loss in 24 % , oral mucosal ulcers in 22 % , taste impairment in 20 % , xerostomia and salivary gland hypofunction in 14 % , dental caries in 24 % , and burning mouth sensation in 10 % cases . fasting [ ( fbg ) ( p = 0.003 ) ] and postprandial blood glucose [ ( ppbg ) ( p = 0.0003 ) ] levels were significantly higher among cases . the p values for neuropathy , retinopathy , nephropathy , cardiovascular disease , dyslipidemia , and sepsis were 0.0156 , 0.0241 , 0.68 , 0.4047 , 0.0278 , and 0.3149 , respectively , which were significant for neuropathy , retinopathy , and dyslipidemia.conclusions : several oral complications are seen among diabetics . association of oral markers in dm and microvascular complications suggests that there is a significant association between the two ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: an 80 - year - old woman with a nodular lesion on her right breast was referred to our outpatient clinic in january 2010 after she had visited a local dermatology clinic . according to the patient , the lesion had existed since her early childhood , and its size had gradually been increasing . a dermatological examination revealed a well - demarcated blue / black colored nodule , measuring 107.0 cm in size , on her right breast ( figure 1 ) . a dermatoscopic examination showed a homogenous blue / black area in the center of the lesion with arborizing telangiectasia in the periphery to the surrounding region ( figure 2 ) . histopathological findings showed tumor masses mostly on the dermis with continuation from the epidermis in some parts . the tumor contained cystic spaces as well as palisading of the basaloid cells at the peripheral sites of the tumor masses and clefts between the stroma and tumor edge , which are often seen in typical basal cell carcinomas ( figure 3 ) . basal cell carcinoma is a slowly growing malignant epithelial skin tumor predominantly affecting middle - aged and fair - skinned individuals . histopathologically , bccs are composed of islands or nests of basaloid cells , with palisading of the cells at the periphery and a haphazard arrangement of those in the centers of the islands . these include solid , micronodular , cystic , multifocal superficial , pigmented , adenoid , infiltrating , sclerosing , keratotic , infundibulocystic , metatypical , basosquamous , and fibroepitheliomatous . criteria that may have value in distinguishing trichoblastomas from bcc include the following : the presence in the former of symmetry , circumscription with smooth margins and shelling out of the normal tissue , follicular and racemiform patterns of lesional cells , or the lack of a clefting artifact between stroma and epithelium that is characteristic of bcc . in the present case , the tumor masses are relatively asymmetrically distributed , and clefts between the stroma and tumor edge are observed . noninvasive procedures have been developed for the diagnosis of skin cancers . among these , dermatoscopy is the most useful diagnostic procedure with the highest clinical impact in dermatologic practice to better differentiate benign from malignant skin lesions and to detect tumors in the early stage . the model for the diagnosis of the pigmented variant of bccis based on the absence of a pigmented network to differentiate it from melanoma and the presence of at least one positive feature including ( 1 ) ulceration ( not associated with a recent history of trauma ) , ( 2 ) multiple blue / gray globules , ( 3 ) leaf - like areas , ( 4 ) large blue / gray ovoid nests , ( 5 ) spoke - wheel areas , and ( 6 ) arborizing telangiectasia . however , bcc may exhibit a large variety of clinical and dermatoscopic characteristics because of its wide range of histopathological features . in the present case , the pigment network was absent and , among the six features , arborizing telangiectasia was present but the other features were not . instead , a homogenous blue / black area was seen in the center of the tumor , which could be distinguished from the large blue / gray ovoid nests . histologically , cystic areas overlay the tumor , which may have been the reason for the homogenous blue / black area . the mechanism of the cyst formation was assumed to be massive cell necrosis in the central part of the tumor , which was caused by the rapid tumor growth . we evaluated 102 cases of bcc diagnosed at our hospital between april 2005 and march 2010 . the cystic type was relatively rare ( 2.9 % ) in the present study ( table 1 ) . among two other cases of the cystic type , in one , the patient did not undergo a dermatoscopic examination . in the other case , multiple blue / gray globules and arborizing telangiectasiawere observed , but there were no homogenous blue / black areas ( figure 4 ) . this may be due to the fact that , unlike the present case , a cystic area existed under tumor masses ( figure 5 ) . in conclusion , we herein reported a cystic bcc showing a blue / black nodule on the right chest wall . dermatoscopy revealed a homogenous blue / black area with arborizing telangiectasia . this rare clinical appearance made it difficult to diagnose ; however , our findings suggest that bcc should be considered when a dermatoscopic examination reveals a cystic lesion with a homogenous blue / black area with arborizing telangiectasia .\noutput:\n" }, { "from": "agent", "value": "basal cell carcinoma ( bcc ) is the most common skin tumor and contains several different histopathological types . here , we report a case of cystic basal cell carcinoma , which is relatively rare and might be clinically misdiagnosed . a dermatoscopic examination of the case revealed a homogenous blue / black area usually not seen in bcc . we reviewed 102 bcc cases resected and diagnosed at sapporo medical university hospital between april 2005 and march 2010 . among them , only three were the cystic type ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: nephropathy has long been recognized as a potential complication of cyanotic congenital heart disease ( cchd ) . many pathological changes can be seen in the renal system due to chd , and are found to be linked to factors like age , blood viscosity or cyanosis ; however , the number of studies studying these factors in children are scarce . truncus arteriosus ( ta ) is a rare congenital cardiac malformation in which a single common artery arises from the heart by means of a single semilunar truncal valve , and supplies the systemic , pulmonary , and coronary circulations.pulmonary arteries originate from the common arterial trunk distal to the coronary arteries and proximal to the first brachiocephalic branch of the aortic arch . truncus arteriosus may be associated with syndromes which also have of renal components , such as , the digeorge or the goltz syndrome . in this study , we have tried to study the renal protein excretion in different types of chds . this article also shows that some chds are associated with severe pulmonary hypertension and cyanosis , and can lead to severe proteinuria in an early age . the inclusion criteria were as follows : filling out of consent forms by parentschildren over one month of age ; no preexisting renal diseases ; diagnosed with chds and some degrees of pulmonary hypertension ; normal ejection fraction ratio ( shortening fraction : 0.28 - 0.4 ; ejection fraction ; 54 - 75 % ) with or without cyanosis . filling out of consent forms by parents children over one month of age ; no preexisting renal diseases ; diagnosed with chds and some degrees of pulmonary hypertension ; normal ejection fraction ratio ( shortening fraction : 0.28 - 0.4 ; ejection fraction ; 54 - 75 % ) with or without cyanosis . patients taking drugs which can affect urine protein output or cause renal structural problems were excluded from the study . the urine samples of the participants were measured for protein to creatinine concentration in urine ( pr / cr ) two weeks after angiography and before the correcting operation , and their serum creatinine was measured and compared with normal values by using the following formula : cr ( mg / dl ) = 0.18 + age ( year ) 0.032 . the demographics ( age and sex ) of the patient , mean pulmonary artery pressure values , results of serum creatinine , hemoglobin levels and hematocrit tests were recorded and have been shown in table 1 . echocardiography was performed to verify the type of structural defects and parameters about shunt characters , regurgitation and their gradients . angiography was used to assess the the left and right ventricle and valvular structures in detail by using a standard left lateral decubitus position by a vingemed system with a 2.5 mhz probe ( ge holten , norway ) in the apical four chambers image . pulmonary hypertension was considered as a disorder characterized by progressive elevation of pulmonary artery pressure ( pap ) and vascular resistance in the absence of left sided cardiac disease , pulmonary vein compression respiratory disorders or thrombo embolic disease . it was defined by a mean pap over 25 mmhg at rest , or over 30 mmhg in exercise , and a pulmonary occlusion pressure ( paop ) of less than 15 mmhg . demographics ( age and sex ) , mean pulmonary artery pressure , results of serum creatinine , hemoglobin and hematocrit tests of the patients included in the studyfourty eight patients affected with congenital heart disease and investigated from 2008 to 2009 were included in the study . the 9 different kinds of congenital heart defects and number of patients in each group in the study can be given as follows : large ventricular septal defect ( vsd ) 11 ; atrial septal defect ( asd ) 5 ; aortic stenosis ( as ) 4 ; truncous arteriosus ( ta ) 4 ; patent ductous arteriosus ( pda ) 5 ; transposition of great arteries ( tga ) 4 ; with or without other anomalies like as pulmonic stenosis ( ps ) ; vsd and single ventricle ; pulmonary stenosis ( ps ) 4 ; tetralogy of fallot ( tof ) 8and , combination of vsd and asd 3 . large ventricular septal defect ( vsd ) 11 ; atrial septal defect ( asd ) 5 ; aortic stenosis ( as ) 4 ; truncous arteriosus ( ta ) 4 ; patent ductous arteriosus ( pda ) 5 ; transposition of great arteries ( tga ) 4 ; with or without other anomalies like as pulmonic stenosis ( ps ) ; vsd and single ventricle ; pulmonary stenosis ( ps ) 4 ; tetralogy of fallot ( tof ) 8 and , combination of vsd and asd 3 . the highest levels of pulmonary pressures were seen in the ta group , and the least were seen in tof and ps groups ( 30 mmhg ) [ figure 1 ] . the highest glomerular filtration rate ( gfr ) was observed in tof and the least in ta ( 140 vs 87 ml / min / 1.73 m ) [ figure 2 ] . in a case affected by tga and ps , there was a high protein excretion and low gfr , and such abnormalities were not seen in other varieties of tga associated with both ps and vsd in one case , and single ventricle in another case . the highest proteinuria measured as urine pr / cr index occurred in ta cases , and the least were observed in ps and as groups ( 4 vs 0.1 . urine pr / cr 0.7 is abnormal at any age ) [ figure 3 ] . the mean age of children in the ta group was 6 months and in the asd group was 66 months . cyanosis was seen frequently in the children of ta ( 3/4 of cases ) , tof ( 7/8 ) and tga ( 4/4 ) groups . pulmonary artery pressure showing a high pressure condition in truncous arteriosus type of cardiac malformation a higher glomerular filtration rate in tetralogy of fallot and in truncous arteriosus in comparison with mean age ( 6 months ) of the patient . gfr is seen to be higher than normal ( normal gfr in 612 months = 7714 ml / min / 1.73 m ) . urine protein to creatinine excretion is significantly higher in cases of truncous arteriosus , and in combination cases of atrial septal defect and ventricular septal defect ( vsd ) , compared to vsd alone caseskrull et al . found that significant proteinuria develops in patients with cchd , mainly of the glomerular origin in the second decade of life akita et al . assessed 16 patients with cchd ( only 1 patient above 20 years of age ) and found proteinuria and albuminuria in the 6 oldest patients . the relation of cchd associated glomerular damage with elevated hematocrit and duration of cyanosis has been studied previously . it seems that the duration of cyanosis and the extent of haematocrit elevation play a major role in the pathogenesis of cchd - related kidney disease . although studies about the effects of chd on the other organs are scarce , another study performed on adults affected by eisenmenger syndrome shows a high rate of proteinuria , especially in cases of vsd , truncus arteriosus and univentricular anomaly . further , a higher incidence of proteinuria was seen in vsd , compared to truncus arteriosus or univentricular heart . though in their study , 74 % of vsd patients and 64 % of truncus arteriosus patients excrete protein between + 1 to + 3 , chronic renal failure was an uncommon finding . our study considered newer aspects besides to traditionally known factors for developing proteinuria , such as , severity of pulmonary hypertension , cyanosis and relation to hematocrit values . it seems that the types of cardiac anomalies have a major role in predicting the development of proteinuria in infants and children , as in our study higher proteinuria could be seen in 3 out of 4 cases of ta group . also , the proteinuria was more severe when associated with tricuspid regurgitation [ table 2 ] . further , cyanosis was common in cases of ta and tof ; however , in the latter , proteinuria was an uncommon finding in spite of their higher mean age ( duration of disease ) which is necessary for formation of glomerolpathy . in simple structure heart diseases like vsd or asd , proteinuria was uncommon ; however , when these disorders were seen together , mean protein excretion increased dramatically [ table 1 ] . different types of truncous arteriosus and severity of proteinuria in the children included in the studythus , as per our study , the type of cardiac anomaly can be a predictive factor for protein excretion ratio , other than pulmonary hypertension and cyanosis in infants and children . ta anomaly is associated with high protein excretion rate in 3/4 of the affected infants , especially if it is associated with severe tricuspid regurgitation . proteinuria was rare in ps and as , and happened infrequently in tof inspite of the fact that the affected children had a long duration of cyanosis , and long - term cyanosis is regarded as a principle cause of progressive nephropathy .\noutput:\n" }, { "from": "agent", "value": "background : there are many studies about the association of nephropathy with congenital heart diseases ( chd ) , and the risk factors such as cyanosis and pulmonary hypertension have been evaluated . in our study , we have considered the relation of chd associated nephropathy with other newer factors and the type of the structural heart defect.materials and methods : a prospective cross sectional study was carried out . 48 children were selected on the basis of specific inclusion criteria , and reviewed over a period of 9 months . nine different simple and complex structural heart defects were evaluated and compared after obtaining the imaging , blood and urine test results.results : significant proteinuria occurred in 8 patients included in the study . more severe forms of pulmonary hypertension were observed in patients suffering from truncus arteriosus ( ta ) ; while the least values were detected in cases of pulmonary stenosis ( ps ) and tetralogy of fallot ( tof ) . the highest values of protein excretion were seen in patients of ta ; and , the lowest values were observed in patients of ps and aortic stenosis ( as ) . renal insufficiency was uncommon in infants and children with chd.conclusion : ta is an important cause of proteinuria among the infants and children suffering from chd , probably because of the associated severe pulmonary hypertension ( ph ) and cyanosis . also , proteinuria occurred at an earlier age in patients of ta as compared to other conditions , and was also found to be more severe if the ta was associated with moderate to severe tricuspid regurgitation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: thus , the way we feel , react , think , or perform varies over time and depends on the state of our brain . behavioral states , global cognitive performance , and alertness can be indexed through speed , memory , or vigilance tasks . although they can provide us with valuable information , they do not give any details about brain activity , which is responsible for how we perform . the development of neuroimaging technologies has been essential to make huge improvements in our understanding of the human brain . functional magnetic resonance imaging ( fmri ) and positron emission tomography ( pet ) are widely used to determine which areas of the brain are active during a specific process or task . another family of neuroimaging modalities includes electrophysiological recordings , namely , electroencephalography ( eeg ) , magnetoencephalography ( meg ) , and local field potential ( lfp ) . these techniques provide direct measures of cortical activity and offer very high temporal resolution but rather low spatial accuracy . in contrast , during sleep , cortical activity is characterized by slower , higher voltage and more synchronized waves . for example , sleep deprivation is associated with a global increase in theta ( 48 hz ) activity and beta ( 1320 hz ) waves . in a similar vein , cognitive brain function also fluctuates over time . under a challenging sleep deprivation paradigm , fmri - derived brain areas associated with a working memory task were recruited selectively as a function of time . these macroscopic observations can be explained by the interaction of two putative processes : sleep homeostasis and circadian rhythmicity . sleep homeostasis follows the same principles as other homeostatic processes , as originally conceptualized by bernard in 1865 . it is characterized by an increase or decrease of sleep pressure as wakefulness extends or sleep progresses , respectively . sleep pressure accumulates or dissipates in a saturating exponential fashion and is almost exclusively dependent on sleep - wake behavior . the second process , the circadian rhythmicity , is an endogenous cycleit provides synchrony between an organism 's internal biological timing and the external passage of day and night . this process is controlled by the suprachiasmatic nucleus ( scn ) , which is located in the anterior part of the hypothalamus . in humans , the circadian clock increasingly promotes wakefulness during the day , opposing the gradual buildup in homeostatic sleep pressure . therefore , this endogenous process is what enables us to have a sleep - wake balance of nearly 8 h16 h. beyond normal sleep time , the circadian signal switches to a sleep - promoting signal , and the organism can no longer fight off sleep as efficiently as it does during the day . throughout sleep , the sleep - promoting signal increases to counter the reduced sleep need . hence , brain function may heavily rely on sleep - wake history and circadian processes . studying the brain is not limited to identifying where and when cortical activity arises . in the last twenty years , much attention has been given to the context - dependent interactions among spatially segregated regions . ( i ) structural connectivity is defined as the anatomical layout of axons and synaptic connections among neurons . ( iii ) effective connectivity designates the direct influence that one region exerts on one another . both functional and effective connectivity are plastic processes ; that is , the communication between distinct cortical areas varies over time . functional connectivity in young adults during rested wakefulness and after a night of sleep deprivation was investigated using fmri . cortical networks , which are functionally connected under well - rested conditions , became less correlated after prolonged wakefulness , suggesting that highly integrated networks become less integrated during sleep deprivation . in addition , stronger anticorrelation among segregated networks was observed in the first hours of wakefulness than during sleep deprivation . thus , highly segregated networks become less segregated in sleep deprived conditions . in a similar paradigm , although these studies are able to identify changes in cerebral communication , they do not explain which source modifies its information flow towards one another . functional connectivity estimates are statistical dependencies among cortical regions but they lack a causal description . experiments focusing on effective connectivity provide insights into which brain areas influence others . to investigate effective connectivity , one often has to define a primary source which is thought to affect others . one way to proceedis to stimulate a specific cortical region by using , for example , transcranial magnetic stimulation ( tms ) . tms is a noninvasive method based on faraday 's law of electromagnetic induction . a brief but strong magnetic pulse ( 1 ms , 1 - 2 t ) is delivered by a coil placed onto the scalp . the rapid change in magnetic field strength induces currents in the brain tissues ( i.e. , eddy currents ) that cause the underlying neurons to be depolarized . the advantage of tms over sensory stimulation is that it bypasses sensory pathways and subcortical structures to directly reach a desired target . tms - evoked responses propagated to connected brain areas were investigated under sleep and wakefulness , thus providing an indirect measure of effective connectivity in humans . the rostral portion of the right premotor cortex was stimulated and simultaneous eeg signals were recorded during rested wakefulness , stage 1 of sleep , and nonrapid eye movement ( nrem ) sleep . tms elicited a time - locked response that dramatically changed from wakefulness to sleep . during wakefulness , an initial high frequency ( 20 to 35 hz ) response at the stimulation targetwas followed by a sequence of lower frequency ( 8 to 12 hz ) waves until 300 ms . one could compare this to a stone thrown in a water milieu , creating multiple ripples spreading around the epicentre . when the participants entered stage 1 of sleep , their eeg recordings showed a tms - evoked response which increased in amplitude . however , subsequent responses were considerably dampened and disappeared after 150 to 200 ms . as soon as they switched to nrem sleep , the initial brain response to tms doubled in amplitude and lasted longer ( ca .150 ms ) . however , cortical activity at the target returned to its baseline , without displaying any further waves . furthermore , the response did not propagate beyond the stimulation zone , as if the water milieu had turned to honey , hampering the propagation of ripples . altogether , these macroscopic observations suggest that the state of cortical circuits undergoes modifications during the sleep - wake cycle . however , changes in power spectrum , cognitive performance , vigilance , and connectivity are only the tip of the iceberg . the next section provides further insights into how the underlying neuronal dynamics evolve over time . until recently , sleep ( low frequency , high amplitude waves ) and wake ( high frequency , low amplitude oscillations ) were considered as two distinct states . however , there is growing evidence that sleep and wake are not completely dissociated . for instance , crochet and petersen recorded low frequency ( 35 hz ) signals in awake immobile mice . as soon as the mice moved , faster waves reappeared , suggesting that oscillatory eeg , which reflects underneath neuronal dynamics , depends on behavioral state but also on whether one is active or not . slow waves are associated with a large number of hyperpolarized down - states whereas fast eeg oscillations are related to more depolarized up - states . the occurrence of up - and down - states is highly correlated with synaptic excitation and inhibition . an increase in excitation is always followed by a rise in inhibition and vice versa . the physiological reason for this equilibrium is to prevent the firing rate of neurons from saturating . it does not mean , however , that excitation and inhibition cancel each other out . excitation is mostly mediated by glutamatergic cells through short - and long - range projections . on the other hand , inhibition is predominantly controlled by gabaergic ( gabaa : gamma - aminobutyric acid - a ) interneurons , which act mostly locally . in essence , excitation and inhibition act concomitantly to generate an action potential , such that a neuron receives massive excitatory signals from glutamatergic cells until it is depolarized . at that point , inhibition inverses the membrane potential curve and the potential drops to a lower value than the equilibrium voltage ( hyperpolarization ) . the neuron then receives some further excitatory inputs to leave the hyperpolarized state . during wakefulness , the number of up - states outnumbers the number of down - states , meaning that the excitation / inhibition balance is in favor of excitation . this balance is reversed during sleep . in rats , cortical neurons fire at a higher frequency after prolonged wakefulness , corroborating a previous study , which highlighted an increase of excitatory glutamate in the extracellular medium . specifically , neuronal firing rate increased during the first three hours of sleep deprivation , before it reached a plateau . the appearance of this plateau may coincide with the higher level of gabaergic inhibition also observed in sleep deprived rats . during the recovery sleep following extended wakefulness , in addition , silencing off periods were longer in early than in late sleep while on periods became longer . off periods recorded by lfpswere associated with slow - wave activity ( swa ) displayed by the eeg . in a subsequent study , neuronal dynamics were probed in sleep deprived rats and some neurons could briefly enter an off period as in sleep . interestingly , these silencing periods could occur simultaneously in distinct regions or in one cortical area only , but most off periods occurred locally . the instances of global and local off periods both increased over the course of sleep deprivation . however , the number of global silencing periods increased faster , thus providing some evidence that as sleep pressure builds up , neuronal activity across different cortical areas becomes more synchronized , similar to a sleep state . moreover , they found that , within a cortical area , some neurons could enter in a sleeplike mode while the others maintained or even intensified their activity . in the following nrem sleep , both global and local off periods decreased , with the former dropping faster than the latter . slow waves and sleep spindles are mainly confined to local regions , particularly in late sleep . furthermore , local activations of the motor cortex have been observed , such that the activation patterns were characterized by an interruption of swa and appearance of fast alpha - beta activity . at the same time , other regions showed features of deep sleep . during extended wake states , local increase in theta activity , prolonged wakefulness exhibits some characteristics also observed during sleep ( i.e. , local silencing periods , breakdown in connectivity ) . in that sense , extended waking might be temptingly seen as an intermediate stage between the alert wake state and sleep . similarly , sleep deprivation induces an increase in cortical excitability , which may contrast this view . the increase in glutamate is counterbalanced by an increase in gaba neurotransmitter levels , as a means to maintain an optimal balance between excitation and inhibition . the mechanisms generating the responses described hitherto are not yet entirely known , but some theories exist . , cell - autonomous synaptic scaling , and the circadian influence . during the day , organisms interact with their environment . the brain is thus intensively exploited to organize actions , remember events , and pay attention to what is around , and so forth . the consequences of this synaptic strengthening are , inter alia , higher energy consumption , a greater demand for the delivery of cellular supplies to synapses , and changes in support cells such as glia . because the organism 's metabolism is tightly controlled by homeostasis , synapses can not continuously be strengthened . the synaptic homeostasis hypothesis ( shy ) suggests that sleep is the price to pay for plasticity . slow waves are often associated with burst firing , which may lead to a long - lasting depression of excitatory postsynaptic potentials ( epsps ) . slow waves also causes a cascade of further changes : net synaptic depression , progressive weakening of synapses , reduction in synchrony and firing rates , and finally a decline in swa . this negative loop proceeds until reaching an equilibrium point where sufficiently low synaptic strength is reached . during wakefulness , the levels of glutamate a1 ( glua1 ) containing - amino -3-hydroxy-5-methyl-4-isoxazolepropionic acid ( ampa ) receptors increase . in drosophila , protein levels of pre - and postsynaptic components , but also the number and size of synapses , are higher during wakefulness . in addition , spine density increases during waking . these changes , among others , participate in what is called synaptic strengthening or long - term potentiation . these phenomena can be indexed through the magnitude of theta power in wake , or nrem swa in the subsequent sleep . if wakefulness is further extended , such as under sleep deprivation , these wake - related synaptic events may be magnified , as indexed by changes in numerous markers of neuronal excitation described in animals and in humans . in figure 2 , we describe some of the key findings over the past years on how synaptic excitability increases under extended wakefulness . when awake , the brain performs multiple tasks demanding energy and cellular supplies . as long as we stay awake , the brain increases its energy consumption and cellular supplies to create new vesicles , for instance . nevertheless , the car starts to get shaky after a while , and the more we drive , the more it shakes . in thisinhibition is what may prevent intoxication of neurons caused by an overload in excitation . inhibition shapes neuronal spike activity and action potentials in conjunction with excitation to ensure optimal neuronal activity in time and space . the concomitant changes in excitation and inhibition to reach a stable state are one of the key assumptions of homeostatic synaptic plasticity view . accordingly , there is strong evidence that synaptic scaling is cell - autonomous . indeed , in vitro experiments where firing rate was blocked led to a scaling up of synaptic strength , while blocking postsynaptic transmission did not have any impact . the scaling up and scaling down of synaptic strengthare regulated by calcium - dependent pathways that control the density of ampa receptors , resulting in a balance between excitation and inhibition ( figure 1 ( b ) ) . although homeostasis is probably involved in synaptic plasticity , it may not be the only mechanism and biological clocks may also have a role . for example , circadian modulation over time has been observed in vertebrate ribbon synapses ( rss ) . in pinealrss , their number and size are higher at night than during the day , independently of the animal 's endogenous wake propensity ( i.e. , diurnal or nocturnal ) . in retinal rss , the reverse pattern has been observed . in drosophila , the motor neuron mn5 has more synaptic buttons in the night than in the day , but their size is larger in the day . furthermore , temperature may explain changes in synaptic strength and morphology , as reported in vertebrate and invertebrate species ( figure 1 ( c ) ) . cortical inhibition in humans , as measured by the duration of cortical silent periods , is higher in the morning than in the evening , irrespective of being measured after a night of sleep or sleep deprivation . the findings indicate that cortical inhibition is linked to time - of - day modulation , which hints at a putative circadian role . disentangling the dual roles of sleep homeostasis and circadian clocks in synaptic strength renormalization is intricate . further studies in animals will allow us to unveil further pieces of this huge puzzle . in humans , however , the portrait is still very blurred . with the exception of pathological cases , such as intracranial eeg recordings in epileptic patients , research in humansis solely based on noninvasive techniques that provide indirect measurements about the activity of brain cells . bridging the gap between microscopic cellular activity and how it is reflected in noninvasive observations is a challenging but essential task . in the next section , we address how in silico computational approaches may offer powerful insights into what is currently unknown on neuronal dynamics . due to the inherent technical and ethical constraints limiting human brain research , further advances rest upon the development of computational models . the idea behind these is to predict the dynamics of group of neurons to better understand macroscopic activity measured by noninvasive imaging modalities . these neuronal dynamics must be appropriately estimated by means of some mathematical techniques , while they have to be properly reflected into neuroimaging data . therefore , to describe neuronal dynamics in a meaningful way , the connections within and between cortical regions must be known . recently , much interest has been given to building detailed descriptions of the brain network , known as structural connectomes . the human connectome is a project which aims to provide a detailed mapping of the brain 's connectivity . the term connectome is derived from the word genome , for which there was also a sequencing project achieved in 2003 . the human brain consists of approximately 10 neurons connected by 10 synapses . in comparison , the human genome comprises around 3.310 base - pairs , demonstrating the huge challenge to achieve the connectome project . structural connectomes studies are usually carried out using diffusion - weighted mr imaging ( dwi ) . dwi with whole brain probabilistic tractography investigates structural connectivity in individuals with different alleles of the brain - derived neurotrophic factor ( bdnf ) gene . moreover , it is also implicated in axonal pruning and maintenance , as it prompts the elimination of synaptically silent axonal terminal arbors . structural connectivity in the forebrain , as well as interhemispheric connectivity , may increase in individuals carrying the met allele in the bdnf gene . therefore , changes in white matter architecture , as inferred in the structural brain connectivity study abovementioned , might be differentially shaped by bdnf genotype . , based on diffusion tensor imaging ( dti ) ( i.e. , an extension of dwi ) , showed that brain networks become more integrated and less segregated with age . besides building structural connectomes , a parallel challenge is to establish a functional brain network and to derive a structure - function mapping , which can be derived from mri or electromagnetic data . recently , the dynamical correlation between dwi - derived structural connectivity and fmri bold signals was analysed using a sliding window approach . in m / eeg studies , functional connectomes rest upon the analysis of the statistical dependencies of time series using independent component analysis ( ica ) or granger causal modelling ( gcm ) ica is a computational method used to separate a mixture of signals into independent subcomponents . the correlation of independent components is then evaluated to obtain a measure of the functional connectivity between source reconstruction - based cortical regions . on the other hand , gcm is based on linear vector autoregressive ( var ) models , where the recorded signals can be explained by their own past as well as the past of other signals . the advantage of gcm over ica is that the former offers a causal description of time series , whereas with ica , the connectivity measures are purely statistical . however , gcm only regards recorded signals to define functional connectivity but there is no neurobiological explanation of the connectivity . hence , it is a phenomenological model , as it forgoes any biological attempt to explain why variables interact the way they do and simply describes their relationship based on observations . to cope with this limitation , functional connectomesdynome focuses on brain rhythms in local structures , without explicitly accounting for the activity at the single - neuron level or individual axons joining cortical areas . dynome operates on a larger scale , the mesoscale ( e.g. , a cortical column ) , as the human brain appears to be built from large populations of neurons performing the same function . they are based on detailed biophysical mechanisms , which are extremely complex as different rhythms can appear in a single cortical region ( i.e. , cross - frequency coupling ) and several neuromodulators can have different effects on frequency bands . the dynome models for different cortical regions and different frequency ranges can then be assembled as building blocks to explain behavior at a macroscopic scale . for example , gamma oscillations in rodents are highly correlated to perisomatic inhibition and are modulated by slower rhythms , including modulation by theta waves . in essence , this cross - frequency coupling of rhythms generates a multiscale timing mechanism between different states of vigilance . a complement approach to dynome is dynamic causal modelling ( dcm ) . despite the similarities , it is not a dynome as such , because it relies on more abstract biophysical models that offer an approximation of the hidden neuronal states . briefly , dcm is an approach to investigate how effective connectivity is affected by context , based on a biologically realistic generative model . dcm has been extensively used in animal and human models , ranging from local field potentials ( lfp ) intracranial recordings to noninvasive approaches , such as hemodynamic or eeg responses . dcm allows for the comprehension of how brain dynamics underscore cognition and different states of consciousness . dynamic causal modelling ( dcm ) is a computational approach that allows one to quantify the effective connectivity between and within brain areas and to investigate how the parameters of effective connectivity are influenced by experimental factors . in other words , dcm probes how a given experimental manipulation affects the strength of cortical connections . dcm was introduced by friston et al . and was first intended for fmri data but was later extended to model electromagnetic time series . the idea is to build a network of nodes ( i.e. , cortical areas ) that interact through extrinsic connections . based on current physiological knowledge about connectivity parameters , this forward model generates realistic electromagnetic data . the recorded and predicted data are then compared and the parameters of the neuronal model are adjusted to improve data prediction . overall , dcm proceeds in a loop between the forward and inverse problems until all the parameters of the forward model have reached values providing an optimal prediction of the data . next , we explain how the forward and inverse procedures are used to obtain the values portraying effective connectivity . finally , we catalogue the different types of dcm analyses and present some dcm applications . each cortical region is identically modelled with a number of interconnected neuronal populations , as originally described by jansen and rit . this model comprises three neuronal populations , albeit the most recent neuronal models contain four populations : ( i ) excitatory spiny stellate cells in granular layer iv , ( ii ) inhibitory interneurons in supragranular layers , ( iii ) superficial pyramidal cells in supragranular layers , and ( iv ) deep pyramidal cells in infragranular layers ( figure 3 ( a ) ) . the four neuronal populations of each cortical column are interconnected through intrinsic connections in agreement with observations in animals . the neuronal dynamics can be described by the mesoscopic properties of the populations ( convolution - based models ) or they can encompass single - cell electrophysiological properties ( conductance - based models ) . this latter class of neuronal model takes into account key ionotropic receptors , such as ampa , gabaa , and nmda ( n - methyl - d - aspartate ) . anatomically , intrinsic connections link neuronal population within the same gray matter region , while extrinsic connections cross white matter to join distinct cortical areas . a further distinction between intrinsic and extrinsic connections lies in the delay of their effect , with intrinsic connections having smaller delays ( 2 ms ) than long - range extrinsic connections ( 16 ms ) . following the concept of hierarchical organization of the cortex formulated by felleman and van essen , extrinsic connections are directed and can be classified as ( i ) forward , ( ii ) backward , or ( iii ) lateral . forward orbottom - up connections originate in agranular layers ( i.e. , supragranular and infragranular layers ) and terminate in layer iv . based on physiological assumptions ( i.e. , priors ) about synaptic parameters , the neuronal model provides an estimation of the direct cortical activity . however , the electromagnetic time series one has at hand is only a reflection of this activity . the observation model provides this conversion by accounting for the propagation of signals through head tissues . altogether , the neuronal and observation models render the forward model and yield a likelihood function , which characterizes how well the predicted data approximate the recorded data . for the forward model to optimally explain the observed signal , the parameters tuning it and the predicted data must be adjusted . during this step , we say that the dcm model is inverted . this inversion is performed in a probabilistic framework , known as bayesian inference . the parameters of the neuronal model are obtained by relying on bayes ' rule : ( 1 ) p y , m = p mpy , mpy m , where , y , and m correspond to the model parameters , the observed data , and the model under consideration , respectively . the posterior distribution p ( y , m ) of the parameters is built upon the likelihood p ( y , m ) , priors p ( m ) , and model evidence p ( ym ) distributions . once the synaptic parameters are adjusted by this update step , a new likelihood function is evaluated in the forward problem , and so forth , until the neuronal parameters reach an optimal solution ( figure 3 ( b ) ) . one may formulate different hypotheses concerning how cortical areas are connected . for example , two regions can communicate through a unique unidirectional connection or they can be linked by bidirectional connections . the model evidence quantifies the properties of a good model , by explaining the data as accurately as possible and with minimal complexity . thereof , different hypotheses , that is , connectivity architectures , can be compared , using bayesian model selection ( bms ) , which selects the most likely model . a palpable example is the perturbation of neuronal dynamics by sensory input among cortical circuits . this information may be relayed through top - down and / or bottom - up connections across frontotemporal regions ( i.e. , primary auditory cortex , superior temporal gyrus , and inferior temporal gyrus ) . by applying bms , it was possible to identify the importance of top - down connections in the predictive coding of sensory information . dcm allows for the analysis of different types of data , including noninvasive eeg and meg time series and intracranial lfp data . currently , four variants of dcm exist to analyse different data or to answer different questions : event - related potentials , steady - state responses , induced responses , and phase - coupling . dcm for event - related potentials ( erp ) is designed for data acquired when a known and deterministic input is applied on specific cortical regions . the input is a stimulus that perturbs the neuronal dynamics and elicits an evoked response . the signals are considered in the temporal domain over typically short time windows ( 1000 ms ) around the event . the second type of dcm analysis is designed for steady - state responses of the brain ; that is , no stimulus is used to trigger a brain response . when one is looking at spontaneous cortical activity , it is more efficient to consider the data in the frequency domain by assessing their power spectrum . this is the approach used in the dcm for cross - spectral densities ( csd ) . it models time - varying frequency power as the response to a stimulus or a task . contrary to the aforementioned dcm flavours , this type of dcm does not rely on a neurophysiological motivated model , but rather on a phenomenological model , where the neuronal parameters are hidden and not explicitly inferred . provided another type of dcm based on the analysis of phase - coupling , where the neuronal dynamics are expressed in terms of neuronal synchronisation processes using weakly coupled oscillators . similar to dcm for induced response , dcm for phase - coupling rests upon a phenomenological model . hereafter , we illustrate how dcm may offer putative insights into hidden neuronal dynamics across different paradigms . an unequivocal aspect of global cortical functioning is the adaptation to changes in the environment , an ability coined as brain plasticity . is learning , which , broadly speaking , may be associated with repetition - dependent plasticity in the brain . these learning - induced changes may impact on intrinsic and extrinsic connections within a cortical network . by applying a dcm for erp associated with a given learning paradigm , brain connectivity has been shown to change as participants heard a repeated acoustic stimuli ( roving mismatch paradigm ) . based on eeg recordings and by applying dcm for erp , the connectivity strength in a network involving the primary auditory cortex and superior temporal gyrus decreased with repetition . plasticity may thus be a key mechanism for adaptation to a specific stimulus across distributed brain systems . an important question in human neuroscience is how discrete synaptic events may underpin different states of consciousness and behavioral states . the former was tested in a dcm study , whereby the effective connectivity between the frontal and parietal cortices was investigated in severely brain - damaged patients . intriguingly , the transmission of information flow ( top - down connectivity ) in the frontoparietal cortex differed between patients in vegetative state and controls . therefore , impairments in the effective connectivity in this brain circuitry might be critical for the perception of consciousness . as mentioned earlier , dcm has been applied in mice to men studies , as a means to infer neuronal states in different experimental settings . one key approach when using dcm is the capacity to infer how specific neuronal parameters encode for changes in eeg spectral oscillations . dcm flavour for such premise and is intended for spontaneous activity and / or pharmacological experiments . a previous in vivo study has shown that ketamine reduces theta activity and increases gamma activity in the hippocampus in mice . with that assumption in mind , neuronal mechanisms underpinning the variations in frequencies in the hippocampus and the prefrontal cortex were investigated in ketamine - doped rats . using dcm for csd , a reduction in top - down connectivity from the medial prefrontal cortex to the dorsal hippocampus was observed under ketamine . the excitatory nmdar - mediated bottom - up connectivity from the prefrontal cortex toin contrast , they noticed an increase in the excitatory ampar - mediated bottom - up connectivity . all in all , this study provides some insights into how ketamine induces a breakdown in corticohippocampal connectivity . in humans , nmdar dysfunction andtheta - gamma rhythm abnormalities play a key role in neuropsychiatric disorders , such as schizophrenia . therefore , the insights provided by this dcm study in rodent models may offer a framework for how aberrant mechanisms of cortical information flow underpin neuropsychiatric ailments . dcm has also been applied to in vivo assays of ongoing synaptic processing underlying human cognition . magnetoencephalographic ( meg ) measurements were acquired from participants during a working memory task , under a pharmacological ( dopaminergic ) challenge . the rationale for this approach is the critical role that the dopaminergic system plays in working memory . in essence , specific synaptic mechanisms , which included synaptic transmission via excitatory ampa and nmda and inhibitory gabaa receptors and glutamatergic inputs to layer iv , may be modulated by l - dopa . thus , changes in these ionotropic receptors may be associated with the synaptic effects of dopamine . importantly , better performance in the working memory task was associated with these changes in dcm - derived ionotropic receptor levels . these results provide a novel framework to noninvasively infer how hidden synaptic events mediate cognitive processes in humans . dcm for csd can also be applied onto recordings of spontaneous activity , without any influence of a drug . it has so far been used predominantly on data acquired in pathophysiological conditions such as epilepsy . an epileptic state arises from a sudden increase in excitation triggered by a deviation of the interaction between pyramidal cells and inhibitory interneurons from its normal regime . a recent study showed that epileptogenesis is also characterized by a slow drift in intrinsic connectivity within and surrounding the ictal zone . using dcm for csd , increased intrinsic connectivity from inhibitory interneurons to superficial pyramidal cells was detected at seizure onset , followed by a gradual decrease thereafter . the activity of neocortical neural circuits is powerfully modulated by subcortical inputs . however , recording subcortical activity using noninvasive eeg recordings is a challenge . spatial eeg sensitivity depends on biological parameters , such as ( i ) distance between neuronal populations and eeg sensors and ( ii ) the complex cellular architecture of deeper sources . however , as subcortical activity influences cortical activity through subcortical - cortical connectivity , its changes may be indirectly inferred from eeg signals . if one uses biophysical models of eeg activity , in which synaptic activity is generated by artificial neural networks , then parameters of subcortical activity can be included in a model as modulating cortical sources , which are those mostly detected at the eeg level . this assumption was highlighted by a study investigating the mechanisms for anesthesia - induced loss of consciousness . by applying dcm for csd to data from wakefulness , mild sedation , and loss of consciousness , spectral changes across all behavioral states involved changes in corticothalamic interactions . compared with wakefulness , mild sedation was accounted for by an increase in thalamic excitability that did not further increase during loss of consciousness . conversely , loss of consciousness was associated with a decrease in backward corticocortical connectivity from frontal to parietal cortices , while thalamocortical connectivity was unaffected . furthermore , dcm for csd data in parkinson patients inferred that connections to and from the subthalamic nucleus were strengthened and promoted beta synchrony , in untreated relative to treated parkinson state . strikingly , much still remains to be known about the hidden neuronal events underpinning different sates of vigilance . to date , our understanding of putative cortical mechanisms accounting for sleep and wakefulness is primarily derived from in vivo studies in animal models ( for a review , see ) and data from epileptic patients ( for a review , see ) . spontaneous activity in sleep and wake may be investigated using dcm for csd as in the previous studies . despite the potential to unveil hidden neural states , as it relies on abstract , neural mass models , it may not accurately reflect biophysical properties critical to some neural computations . chief among these is absence of neuromodulatory factors , including cholinergic , serotoninergic , and dopaminergic activity , that impact on cortical dynamics . another critical aspect is that dcm cellular parameters do not represent single - cell properties , but rather those of a cortical macrocolumnar neuronal network . thus , it is designed to unravel functional dynamic properties of a neuronal ensemble . in itself , this hinders the understanding of single - cell activity , currently inferred only from direct intracranial recordings in epileptic patients . indeed , a key limitation in human neuroscience is the understanding of how brain circuits operate in fine spatial - temporal dynamics in vivo . thus , computational approaches become an attractive choice at hand to explore these latent neuronal dynamics . in this scenario , dcm may offer a unique insight into these dynamics by exploring the effective connectivity within and between cortical regions . in light of the studies illustrated in this sectiondynome and dcm address the same questions , namely , how brain activity is orchestrated among regions and how it varies depending on the context . in kopell et al . although this was true for the earliest models , the latest ones account for subtle features like the presence of four different neuronal populations , the introduction of electrophysiological properties of neurons , and the dependence on space . these ingredients make the latest generative models biologically meaningful . to foster even more their reliability , dcm neuronal models would have to include the role of glial cells , internal ( e.g. , thermal ) noise in neurons , and dendritic backpropagation . regarding the connections between brain nodes , dynome and dcm share the fact that they do not model the brain as an entity ; yet , they are different . in dcm , several sources can be modelled and interact by making connections among them . on the other hand , dynome investigates local networks and treat them as independent building blocks , which is a biological deficiency on its own . in short , , it is hard to say that one is more physiological than the other . notwithstanding their differences , dcm , dynome , and other methodological techniques that use varying temporal scales allow us to better apprehend the rich spatiotemporal landscape of brain dynamics .\noutput:\n" }, { "from": "agent", "value": "functional and effective connectivity of cortical areas are essential for normal brain function under different behavioral states . appropriate cortical activity during sleep and wakefulness is ensured by the balanced activity of excitatory and inhibitory circuits . ultimately , fast , millisecond cortical rhythmic oscillations shape cortical function in time and space . on a much longer time scale , brain function also depends on prior sleep - wake history and circadian processes . however , much remains to be established on how the brain operates at the neuronal level in humans during sleep and wakefulness . a key limitation of human neuroscience is the difficulty in isolating neuronal excitation / inhibition drive in vivo . therefore , computational models are noninvasive approaches of choice to indirectly access hidden neuronal states . in this review , we present a physiologically driven in silico approach , dynamic causal modelling ( dcm ) , as a means to comprehend brain function under different experimental paradigms . importantly , dcm has allowed for the understanding of how brain dynamics underscore brain plasticity , cognition , and different states of consciousness . in a broader perspective , noninvasive computational approaches , such as dcm , may help to puzzle out the spatial and temporal dynamics of human brain function at different behavioural states ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: gynecologic surgeons are often presented with new surgical techniques , procedures , and devices given the rapid advancement of science and technology for minimally invasive surgery . during residency training , new techniques are adopted under the watchful supervision of a faculty member . for practicing surgeons , however , acquiring new surgical skills outside of residency training can become a daunting task ; ultimate skill acquisition is dependent upon the complexity of the surgical technique , the innate ability of the surgeon , and the training of the surgeon .1,2 although medical device manufacturers enlist selected experienced surgeons to perform procedures using new surgical devices within pivotal clinical trials before the devices can be cleared by the us food and drug administration ( fda ) for clinical use , the successful adoption of the device or procedure by practicing surgeons once the device and procedure are cleared for clinical use may vary . in november 2012 , the acessa system ( halt medical , inc . , brentwood , ca , usa ) and procedure were cleared for commercialization in the usa for the treatment of uterine fibroids causing heavy menstrual bleeding , bulk , and pain symptoms . the procedure utilizes laparoscopic , intra - abdominal ultrasound to identify fibroids followed by directed radiofrequency ablation of each targeted fibroid . clearance of the device was based on safety and efficacy results from a clinical trial conducted at carefully selected and monitored sites by 13 experienced minimally invasive gynecologic surgeons .3 in an effort to evaluate how easily minimally invasive gynecologic surgeons without prior acessa experience can operate using the acessa system in terms of surgical time , intraoperative blood loss , and adverse events , we conducted a prospective postmarket analysis of the first procedures performed by a group of community and university physicians during the training period for the acessa technique . the objective of this study was to evaluate the intraoperative and near - term postoperative outcomes from the acessa procedure as conducted by minimally invasive gynecologic surgeons new to the acessa procedure and to report our perspectives regarding our acessa experience during the training period . the current trial is a postmarket , prospective , single - arm , multicenter analysis of operative and postoperative outcomes with 48 weeks follow - up after laparoscopic ultrasound - guided radiofrequency volumetric thermal ablation ( rfvta , the acessa procedure ) of symptomatic fibroids in premenopausal , menstruating women . the study , which was developed in accordance with the us fda , includes outcomes from 10 surgeons who are a subset of investigators and who learned the acessa procedure during the run - in ( training ) phase ( prior to the randomization phase ) of an ongoing and much larger randomized controlled trial in the usa and canada ( trust , clinicaltrials.gov identifiers : nct02163525 for the us trial and nct01563783 for the canadian trial ) . none of the participating surgeons had prior experience with the acessa ablation procedure and only one surgeon had prior experience with laparoscopic ultrasound . the surgeons were selected based on their interest in the trial , comfort with performing laparoscopic surgery , each site s ability to perform the comparative procedures during the randomization phase , and having adequate research study support personnel who comply with the principles of good clinical practice guidelines . the protocol for structured and consistent surgical training in acessa follows that suggested by sachdeva1 and houck et al2 for the successful adoption of the surgical technique . this is followed by hands - on practice with both the intra - abdominal ultrasound and the acessa device in a simulated laboratory environment . once the surgeon is comfortable in the simulated environment , operative cases are then performed in the presence of a trained proctor until both the surgeon and the proctor deem that the surgeon is comfortable and competent to perform the procedure . this analysis spans 17 months with patient treatment for the run - in phase from september 2014 through january 2016 . forty - one women were recruited ; however , one subject did not undergo a surgical procedure due to a positive pregnancy test within 24 hours prior to her surgery . the sites obtained prior local institutional review board approval ( table s1 ) of the trust protocol , which included the run - in ( training / prerandomization ) phase . the study was carried out according to the general ethical principles described in the declaration of helsinki and the us fda regulations concerning the rights and welfare of human subjects taking part in medical research . enrolled women were aged 18 years , were menstruating , had symptomatic uterine fibroids 10 cm in greatest diameter ( as assessed with transvaginal ultrasound ) , and desired uterine - conserving treatment for their fibroids . each enrollee had a normal no untreated cervical malignancy or dysplasia papanicolaou test within the past 36 months . women were excluded from the trial if they were contraindicated for laparoscopic surgery and / or general anesthesia ; were expected to be at high risk for , or known to have significant intra - abdominal adhesions ; required major elective concomitant procedures ; were pregnant or lactating ; had taken any depot gnrh agonist within 3 months of screening ; had an implanted intrauterine or fallopian tube contraceptive device not removed within 10 days of treatment ; had chronic pelvic pain known not to be caused by uterine fibroids ; had or were suspected of having adenomyosis ( as suggested in ultrasound or magnetic resonance images ) or endometriosis stage 3 or 4 ; had a history ( within 5 years ) or evidence of gynecologic malignancy or premalignancy ; had previous pelvic radiation ; had a cervical fibroid , or had 1 completely intracavitary fibroids ( type 0 ) or only type 0/1 submucosal fibroids that are better treated via hysteroscopy . rfvta was performed on an outpatient basis using the acessa system and involved the percutaneous , laparoscopic ultrasound - guided radiofrequency ablation of fibroids using a disposable 3.4 mm probe coupled to a dual - function monopolar radiofrequency generator . detailed descriptions of the device and technology have been reported .310 two minimally invasive gynecologic surgeons performed each procedure : one was primary with the second surgeon assisting . patients were placed in supine position , and a laparoscope was introduced through a 5 or 10 mm umbilical trocar based on the surgeon s standard practice . the primary surgeon then mapped the myomatous uterus using a laparoscopic ultrasound transducer placed through a standard 10 or 12 mm suprapubic trocar and identified the location , size , and number of all fibroids . the acessa handpiece was inserted percutaneously under laparoscopic guidance and advanced into the target fibroid using laparoscopic ultrasound . depending on the size and shape of the fibroid , the electrode array was deployed according to a proprietary treatment algorithm . after verifying in three dimensions with the ultrasound transducer , the correct position of the array within the fibroid capsule , the surgeon initiated ablative treatment . current was delivered to the electrode tip and array ( if the latter was deployed ) , permitting ablation of only the targeted and localized fibroid tissue . a thermocouple in each electrode needle in the array allowed continuous real - time temperature feedback to the surgeon via the generator screen . current was removed via large , temperature - monitored , dispersive pads that were placed on the patient s thighs above the patella . after each ablation , the probe was withdrawn from the fibroid with concurrent coagulation of the probe track . depending on the size and location of the fibroids , multiple fibroids could be ablated through one serosal puncture . after completion of the ablative treatment , the trocar fascial and skin sites were repaired according to the surgeon s standard surgical practice . patients were followed postoperatively for safety and recovery at 2472 hours , 1 week , and 48 weeks . for the purposes of gathering surgeon feedback regarding the acessa system training , surgeons were asked to complete an acessa procedure evaluation form ( figure 1 ) once they felt comfortable with the procedure and could perform it safely after at least two surgical cases as the primary surgeon . all evaluation forms were tabulated to provide an indication of the ease of performing the surgery . exploratory analyses using sas v9 .3 ( sas institute , cary , nc , usa ) were employed to describe patient outcomes and surgeon responses . ten practicing minimally invasive gynecologic surgeons , only one of whom was in fellowship training , completed a total of 40 acessa procedures , with 37 cases proctored ; all procedures were performed on an outpatient basis . five ( 50 % ) surgeons completed evaluation forms after performing two to three cases and five ( 50 % ) after four to five cases ( as the primary surgeon ) . in terms of laparoscopic experience ( excluding that gained during residency or fellowship ) , three ( 30 % ) surgeons had 05 years of experience , three ( 30 % ) had 615 years of experience , and four ( 40 % ) had 15 years of experience . surgeon responses to questions regarding factors affecting the efficiency of the acessa procedure during the run - in cases are provided in table 1 . none of the surgeons found any of the factors inferior or needing improvement , and none experienced any problems with the acessa device . two surgeons provided feedback on possible enhancements to the laparoscopic ultrasound probe as they felt learning the correct orientation of the ultrasound probe was the more technically challenging aspect of the cases . of the 40 patients receiving fibroid treatment , 38 were available for follow - up at 2472 hours , 38 were available for follow - up at 1 week , and 36 patients were available for follow - up at 48 weeks postprocedure ; the mean follow - up for the last visit was 46.421.0 days . the five most predominant presenting complaints were heavy menstrual bleeding ( n = 34 ; 85.0 % ) , pelvic discomfort / pain ( n = 30 ; 75.0 % ) , dysmenorrhea ( n = 25 ; 62.5 % ) , increased abdominal girth ( n = 25 ; 62.5 % ) , and urinary frequency ( n = 22 ; 55.0 % ) . at baseline , patients reported having fibroid symptoms for a mean of 2622 days during the 3 months prior to surgery . the intraoperative , laparoscopic ultrasound assessment of fibroid number , type , and size are presented in table 3 . mean length of procedure ( the time from first incision to the time of skin closure ) was 1.91.0 hours ( n = 36 ) , which was similar to the reported procedure time in the pivotal trial ( 2.11.0 hours3 ) . two patients underwent adhesiolysis , which added ~ 35 minutes to their procedures and increased blood loss . estimated mean blood loss for all patients without missing data was 47137 ml ( median , 10 ml ; range , 0800 ml ; n = 35 ) . mean hospitalization time ( the time from the start of anesthesia to the time of discharge from the hospital ) was 6.83.2 hours ( n = 34 ) . one complication was minor and nondevice - related involving a 1 cm uterine serosal laceration resulting from uterine manipulation . the other complication was considered device related due to inadequate coagulation by the performing surgeon at one of the three probe insertion sites that continued to ooze , ultimately requiring two laparoscopic sutures to obtain hemostasis . the bleeding was compounded by extensive sharp ( noncautery ) adhesiolysis between the rectosigmoid and the posterior uterus in addition to adhesiolysis of the omentum at the anterior wall . g / l , and she did not require transfusion . she was observed for 7 hours postsurgery and was discharged the same day . most women experienced some uterine bleeding ( 67.6 % ) and pelvic pain or cramping ( 67.6 % ) . patients experienced one or more of the following : bloating , gas , and general abdominal discomfort ( 45.9 % ) ; fatigue or general malaise ( 45.9 % ) ; shoulder pain ( 35.1 % ) ; and nausea and vomiting ( 35.1 % ) . at the last follow - up visit between 4 and 8 weeks postprocedure , no patients reported complications , hospitalizations , or reinterventions for fibroid symptoms . advances in minimally invasive surgery have provided practicing gynecologists with alternative surgical options for their patients ; however , learning a new surgical technique outside of residency training can result in variable performance and affect ultimate acquisition of the technique . one promising advance in the minimally invasive treatment of symptomatic fibroids is rfvta ( the acessa procedure ) . our study is the first to describe near - term results of the acessa procedure as conducted by minimally invasive gynecologic surgeons practicing in university and community hospital settings who were new to the procedure and had varying surgical expertise . near - term outcomes for this new group of acessa surgeons during their procedure training phase are comparable to those in the pivotal trial : the mean procedure time ( 1.90.9 hours ) tended to be less than that for the procedures in the pivotal trial ( 2.11.0 hours ) , and a similar number of fibroids were treated per patient ( 4.23.3 versus 5.04.4 , respectively ) .3 we are encouraged by comparable outcomes in operative time and number of treated fibroids . there was one intraoperative device - related event in this study ( 1/40 , 2.5 % ) , which compares with the 3.6 % device - related adverse event rate in the pivotal study .3 although this low rate of adverse events is encouraging given the training of 10 new surgeons , this study is not powered to detect a significant difference . strengths of our study include the patient , surgeon , institutional heterogeneity , and a method of surgical training that was consistent with training procedures defined in the literature .1,2 studies have shown that participation in an animate laboratory and a preceptorship experience may determine the future performance of the surgeon in advanced laparoscopic surgery and that formal training can be a predictive factor for reduced complications and improved laparoscopic surgical skills .2 we feel that the acessa training model contributes to successful acquisition and performance of the procedure . as reflected in the postprocedure evaluation forms , all of the surgeons participating in the study felt comfortable performing the acessa procedure safely and effectively after two to five cases and were confident , in all instances , to discharge their patients the day of surgery . the principal limitations of the study are the small sample size and the lack of long - term follow - up data . the acessa procedure can be safely learned and adopted by minimally invasive gynecologic surgeons under the guidance of an experienced intraoperative proctor after two to five cases . the intraoperative and near - term results for surgeons new to the acessa procedure compare well to those achieved by selected , experienced surgeons in the pivotal trial . future postmarket studies will provide more information on long - term results and on device - related events .\noutput:\n" }, { "from": "agent", "value": "purposesuccessful adoption of a new surgical procedure varies among practicing surgeons , and skill acquisition depends on the surgeon s innate ability , the complexity of the technique , and training . we report intraoperative and near - term postoperative outcomes from the acessa procedure conducted by minimally invasive gynecologic surgeons new to acessa , and report the surgeons experiences during the training period.patients and methodsthe study was designed as a postmarket , prospective , single - arm , multicenter analysis of operative and early postoperative outcomes after proctored surgical training with the acessa device and procedure ( laparoscopic ultrasound - guided radiofrequency volumetric thermal ablation of symptomatic fibroids ) in premenopausal , menstruating women as conducted in community and university hospitals in the usa and canada . surgeons completed evaluation forms once they felt they could safely and comfortably conduct the operations.resultsten gynecologic surgeons without prior acessa experience completed 40 acessa procedures all on an outpatient basis . mean procedure time was 1.91.0 hours and was similar to that reported in the pivotal premarket study ( 2.11.0 hours ) . two intraoperative complications occurred : a 1 cm uterine serosal laceration due to uterine manipulation and blood loss from both the probe insertion site and the lysis of uterine - omental adhesions . no postoperative complications or reinterventions for fibroid symptoms were reported . the surgeons completed the evaluation forms after two to five cases , and none found any factors affecting procedure efficiency to be inferior or needing improvement.conclusionminimally invasive gynecologic surgeons new to acessa can perform the procedure and provide acceptable outcomes after two to five proctored cases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: why do n't health care workers ( hcw ) universally embrace one of the greatest medical advances : vaccination ? poor hcw vaccination rates continue to bewilder health leaders and the public alike ; thus becoming an ongoing quandary , with no obvious solution . bechini and colleagues study of a large sample of hcw in florence , italy demonstrates that reported vaccination coverage for potentially susceptiblekey reported reasons for non - vaccination include lack of offer of immunization ( 22 % to 48 % ) and personal vaccination opposition ( 15 % to 33 % ) . only 16 - 27 % of potentially susceptible hcw agreed that they would undergo vaccination for the vaccine preventable diseases ( vpd ) . moreover , even if those hcw felt at risk for the vpd , still less than half of hcw would get vaccinated . note that these were the attitudes of hcw after a one - day training course aimed at updating knowledge of vpd and strategies to prevent diseases , which included the importance of vaccination . bechini and colleagues propose several practical strategies to promote hcw vaccination uptake , namely ( 1 ) raising awareness and increasing hcw knowledge about vpd , risks of vpd , and benefits of vaccination through training and education , and ( 2 ) ensuring employers and physicians offer and make available vaccines , specifically for new hires and students . we expand on this theme , and suggest that educational institutions have a responsibility to ensure their student trainees have been properly vaccinated for vpd ( i.e. , measles , mumps , rubella , varicella , tetanus , diphtheria , pertussis , hepatitis , meningococcus ) before they engage in their clinical work . health care institutions have a responsibility to know the sero - status of their hcw at the start of their employment and readily provide vaccination where immunity is not found . for more senior hcw , acatch up program can provide recommended adult immunizations that have been missed due to more recent changes in policies or accessibility ( e.g. , measles , tdap ) . by establishing a culture of pro - vaccination , institutions can foster hcw health and safety with the goal of career - long health promotion . while institutional vaccine promotion and hcw knowledge acquisition is likely necessary to improve hcw vaccination coverage , will it be enough ? we are not simply trying to get hcw to engage in an action , we are trying to get hcw to change a behavior . herein lies the complication . vaccination uptake is a complex health behavior , much like any other health behavior ( i.e. , healthy diet and exercise ) . understanding why one engages in any health behavioris complicated and multi - factorial , consisting of internal factors , attitudes , beliefs , motivation , ability , perceived threat , self - efficacy , social norms , and sociocultural contexts to name a few . there is wide - spread agreement among researchers that information and education alone will not translate into behavior change . while knowledge is a necessary first step , it is not sufficient to tip the scales to behavior change . this , in part , can explain why hcw vaccination rates persist to fall below recommended standards despite educational and informational vaccination campaigns with readily accessible and available vaccines . there remain hcw who oppose vaccines regardless of the information , facts , and evidence provided . we need to move beyond education and knowledge acquisition and towards the application of well - validated behavior change theories ( i.e. the health belief model , theory of planned behavior , social cognitive theory ) that have successfully been used to guide other health behavior interventions . much has been studied regarding motivators and barriers to vaccination , especially hcw influenza vaccination uptake . for example , using the health belief model , modifiable attitudes and behaviors were identified that drive hcw influenza vaccine uptake , including ( 1 ) the desire to protect family members and patients , ( 2 ) the belief that vaccination is important even if one is healthy , and ( 3 ) encouragement from supervisors , co - workers , and physicians . theories of behavior change not only help us describe and predict hcw vaccination behavior , but they also provide a framework to plan , guide , and evaluate our interventions . it is health care institutions responsibility to protect their hcw and patients , and it is imperative that they rely on best evidence , including theories and models of behavior change , to design and implement interventions that enhance vaccination coverage among their hcw .\noutput:\n" }, { "from": "agent", "value": "why do n't health care workers universally embrace vaccination to prevent vaccine preventable diseases and protect themselves and their patients ? to address this problem most vaccination campaigns focus on providing education and information to health care workers . while knowledge is a necessary first step , it is likely not sufficient to increase health care worker vaccine uptake . we discuss a novel approach to applying behavior change theories and principles as a framework to plan , guide , and evaluate vaccine promotion interventions , with the goal of enhancing vaccine coverage among health care workers ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: arrhythmogenic right ventricular cardiomyopathy ( arvc ) is an inheritable cardiac muscle disease characterized pathologically by fibrofatty replacement usually but not exclusively - of the right ventricular ( rv ) myocardium . the disease shows a familial pattern in 4070 % of the cases and molecular genetic studies demonstrated that arvc is a desmosomal disease resulting from genetically defective cell adhesion proteins such as plakoglobin , desmoplakin , plaokophillin - 2 , desmoglein - 2 , and desmocollin . clinical manifestations are related to electrical instability , including either ventricular tachycardia of rv origin or ventricular fibrillation , which may lead to sudden cardiac death ( scd ) , mostly in young people and athletes . in rare cases , the progressive loss of ventricular myocardium may lead to right ventricular or biventricular heart failure . arvc had been traditionally associated with the mediterranean region , as many seminal studies had originated from research groups in france , greece , and italy . today , however , numerous arvc registries from all over the world emphasize that the disease does not have a specific racial or geographical predilection . giovanni maria lancisi ( 16541720 ) was an anatomist , clinician , epidemiologist , advisor to pope clement xi and one of the greatest italian physicians of the first half of the 18 century ( figure 1 ) . in his book , de motu cordis et aneurysmatibus , lancisi reported a four generation family with sudden deaths and dilatation and aneurysms of the right ventricle . frank marcus ( university of arizona , united states ) collaborating with a french group of researchers described the disease of right ventricular dysplasia in a series of 24 patients and referred to la salpetrire hospital and jean restand hospital in paris from 1973 to 1980 . the group characterized some of the fundamental clinical elements of the disease including the t wave inversion in the right precordial leads on the surface electrocardiogram ( ecg ) , the left bundle branch block pattern of the qrs complex during spontaneous ventricular tachycardia , and the echocardiographic features of a normal left ventricle with an enlarged and aneurismal right ventricle . in 1986 , protonotarios et al . studied nine cases of palmoplantar keratosis in the greek island of naxos , of which seven showed symptoms and signs of heart disease . three cases had episodes of ventricular tachycardia ( vt ) and a fourth patient died suddenly . all patients with cardiac signs and symptoms showed echocardiographic enlargement of the right ventricle and a right ventricular band . the current concept of the clinical and pathological picture of arvc was established in padua , italy . familial occurrence of arvc with an autosomal dominant pattern and incomplete penetrance was proven by nava et al . in 1988 . furthermore , thiene et al . associated the pathology of arvc with a series of scd in the young ( 35 years ) , mostly during effort . all the cases had t wave inversion on the right precordial surface ecg at rest and left bundle branch block qrs pattern during ventricular tachycardia . this was the first time arvc was acknowledged as a major cause of death in the young . in 1994 , rampazzo et al . from the university of padua , described the first gene locus associated with arvc ( 14q2324 ) . to locate the disease gene , since some forms of hypertrophic cardiomyopathy are due to mutations of the - myosin gene , chromosome 14 was selected as a first candidate for analysis , on the assumption that functionally related genes are often located on the same chromosome . the investigation was also extended to chromosomes 1 , 2 , 6 , 12 , and 17 that were linked to other hypertrophy cardiomyopathy gene mutations . however , in 2000 , the discovery that plakoglobin and desmoplakin gene mutations result in the autosomal recessive cardiocutaneous naxos and carvajal syndromes , respectively , led to the association between arvc and desmosome gene mutation . desmoplakin was the first defective gene to be associated with autosomal dominant arvc in 2002 . today , mutations in desmoplakin , plakoglobin , plakophilin - 2 , desmoglein - 2 , desmocollin - 2 and most recently desmin , have been found in dominant forms of arvc with double and compound heterozygosity commonly reported . this consistent protein alteration coined the concept of arvc as a desmosomal disease in contrast to hypertrophic cardiomyopathy as a sarcomeric disease , and dilated cardiomyopathy as a cytoskeletal disease . the current views concerning arvc have been shaped based on results from vanguard national and international registries . the last three decades have witnessed an exponential increase in the scientific contribution to arvc , not only in the number of published data on arvc , but also on the number of centers involved in the research . today , centers from all corners of the world add significant contribution to the global understanding of the pathology , molecular , genetics , epidemiology , clinical , electrophysiology , imaging , risk stratification and management aspects of arvc . in europe , influential works have been published from france , germany , greece , italy , the netherlands , spain and the united kingdom . data were collected from 130 patients with confirmed arvc from a tertiary center between 1977 and 2000 . the study population characteristics showed male predominance ( 100 men ) and a mean age at onset of symptoms of 31.814.4 years . after a mean follow - up of 8.17.8 years , there were 21 deaths with a cardiovascular origin ( progressive heart failure in 14 patients and sudden death for the remaining 7 patients ) . this shows that the main cause of death in this cohort was not arrhythmic death but rather congestive hf , highly attributable to the adequate implantable cardioverter - defibrillator ( icd ) therapy in france . from germany , wichter et al . published the largest series on pharmacological therapy in arvc , first published in 1992 and updated in 2005 , comparing multiple antiarrhythmic drugs and concluding in their 2005 update that sotalol at a dosage of 320480 mg / d was the most effective drug resulting in a 68 % overall efficacy . the same group in 2004 , concluded from their single - center experience that there is a marked improvement in long - term prognosis with icd therapy in high - risk arvc patients . the greek association between the cutaneous manifestations and the cardiac manifestations in naxos disease had lead to the association of arvc with desmosomal protein abnormalities ( figure 2 ) . in italy , an ecg - based pre - participation screening program for athletes has been going for more than 30 years . this screening program has shown marked efficacy in detecting cardiac pathologies leading to scd in the young , with a drop of mortality rates among athletes in the veneto region from 3.5 / 100,000 in 1979 to 0.5 / 100,000 in 2003 ( figure 3 ) . this impressive drop was largely attributable to the successful detection of arvc and hypertrophic cardiomyopathy among the screened individuals , as early reports accounted arvc as the second most common cause of death in the young in the veneto region . i study recruited 132 arvc patients from 22 institutions in north italy and one in the united states , of whom 80 % received an icd implant for sudden cardiac arrest or sustained ventricular tachycardia . the group demonstrated that 48 % of the patients were saved by at least one appropriate icd intervention during the study period of 3925 months ( figure 4 ) . spanish football fans were overwhelmed with the tragic death of fc sevilla midfielder antonio peurta in 2007 due to arvc ( figure 5 ) . this sad incident reflected the study results on the causes of deaths among athletes in spain from the period 1995 to 2001 , with arrhythmic cardiomyopathies accounting for 16 % of all deaths . a notable paper was published in 2009 on the etiology of sudden cardiac death in athletes in the uk from 1996 to 2008 . it was found that cardiomyopathies are the most common cause of scd in young british athletes accounting for 62 % with arvc attributed to 14 % of deaths . along the mediterranean basin , naxos disease was described in one family in turkey and three arab israeli families . with the increased vigilance and physician awareness , the south african arvc registry started in 2004 , and published its first results in 2009 on the clinical course of patients with arvc and pkp 2 mutations . the characteristics of arvc in south africa are similar to those from the french cohort showing a mean age of presentation of around 40 , with male predominance of about 70 % , and palpitations and syncope being the main presenting symptoms . south african researchers discovered five new pkp2 gene mutations causing arvc ( figure 7 ) . mayosi from the south african group explains this finding as a founder gene effect , attributed most likely to one of the early dutch settlers arriving to the cape of good will . the south african results were in concordance with the results of the dutch paper on the prevalence of pkp 2 mutations in patients with arvc in the netherlands published in 2006 . pkp2 gene mutations were found in nearly half of all dutch patients with established arvc diagnosis . the matching findings of the two studies miles apart highlight the importance of taking into consideration all historical , ethnic and anthropological factors when dealing with a genetically determined disease . moving to the far east , komura andthe study subdivided the patients to a group presenting with vt and another group presenting with congestive hf . the group with congestive hf presented at a later age of 66 and carried a worse prognosis with all three patients dying after only 20 months of follow up . the vt group presented at a younger age of 44 years and carried a better prognosis with only two patients dying after more than 60 months of follow up . also , concerning the management of arvc , patients who were inserted icd 's and were controlled on drug therapy did much better than patients sent for rf ablation , with a higher rate of recurrence of vt within the rf ablation group ( figure 8 ) . a chinese group published a cohort of 39 patients with arvc , sharing almost the same clinical picture as the south african , french , and japanese cohorts also including the same outcome of therapy . of these patients , 33 were males and 6 were females and the age at first presentation was 34.99.8 years . an interesting observation of the chinese cohort was that all seven patients who were inserted an icd had at least one appropriate shock . on the other side of the ocean , a large united states registry on arvc was published in 2005 . with a cohort of 100 patients from the johnshopkins registry , the american working group concluded that arvc patients present between the second and fifth decades of life either with symptoms of palpitations and syncope associated with ventricular tachycardia or with scd . due to genetic heterogeneity , signs and symptoms can widely vary and diagnosis is often delayed . however , once diagnosed and treated with an icd , mortality is low ( figure 9 ) . from ecuador published in 1998 a series of 12 patients presenting with cardiocutaneous syndrome of palmoplanter keratosis and dcm . this is known as carvajal syndrome and it has been associated with desmoplakin mutations and severe left ventricular involvement . the magnetic resonance image ( mri ) picture of carvajal syndrome often mimics that of lv non - compaction . noteworthy , there have been case reports of patients with carvajal syndrome from all over the world which shows that the condition is not exclusive to the south american population ( figure 10 ) . in australia , there is an ongoing major national registry on cardiomyopathies that was initiated in 2009 . it was recently found that this particular australian cattle have the same phenotype of naxos / carvajal disease with woolly hair and biventricular fibrosis and sudden death , representing a natural animal model for further studies on arvc ( figure 11 ) . the need to set up international registries for arvc has been recognized in recent years and many attempts have been accomplished after the publication of the diagnostic task force criteria in 1994 . a multidisciplinary collaborative european study has been designed with the aim to investigate the clinical , pathological and genetic features of arvc . the completed european registry had been coordinated in padua and benefited from the contributions of researchers from france , germany , greece , the netherlands , poland and the united kingdom . the labor of these large registries has bared fruit in the form of the updated modified task force criteria for the diagnosis of arvc , which was published in 2010 . with the international community sharing two decades of knowledge and expertise , the modified task force maintained the approach of classifying the structural , histological , electrocardiographic , arrhythmic , and genetic features of arvc into major and minor criteria . the new modifications emphasized on quantifying the extent of rv dysfunction by echocardiography or mri . moreover , it was also proposed to characterize the tissue of the rv wall by evaluating the residual myocytes by morphometric analysis with less than 60 % of residual myocytes as a major criterion . in addition , definite genetic linkage to arvc by identification of a pathogenic mutation categorized as associated or most likely associated with arvc in the patient under evaluation is now considered a major criterion . in summary , the scientific research on arvc clinical course and management has much progressed over the last 30 years . international collaboration has led to the establishment of diagnostic criteria and a management plan for patients with arvc . however , more national and multinational registries and effective screening programs are still needed to overcome the risk of sudden cardiac death in this globally recognized cardiomyopathy ( figure 12 ) .\noutput:\n" }, { "from": "agent", "value": "abstract : arrhythmogenic right ventricular cardiomyopathy ( arvc ) is a progressive inherited heart disease characterized by ventricular arrhythmias and sudden cardiac death especially in the young . arvc has been traditionally associated with the mediterranean basin , as many seminal studies on the disease have originated from research groups of this region . today , however , numerous arvc registries from all over the world emphasize that the disease does not have a specific racial or geographical predilection . this work provides a review on the global perspective of arvc ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: hiccups , or singultus , are the result of the involuntary myoclonic contracture of the diaphragm .1 in the setting of a closed airway , the contracture causes the peculiar sound typical of the condition .1 hiccups are characterized as intractable when they occur 40 to 100 times per minute for 48 hours .2 the underlying cause of intractable hiccups ( ih ) is broad , ranging from idiopathic to gastrointestinal to central nervous system lesions involving the brainstem .3 we present a case of ih successfully treated by surgical resection of a posterior inferior cerebellar artery ( pica ) aneurysm in a previously healthy 29 - year - old woman . a 29 - year - old woman was admitted with a 2 - week history of hiccups occurring up to 100 times per minute . she was seen by her primary care physician 1 week prior who prescribed thorazine and metoclopramide with no significant improvement . she had no prior medical or surgical history and denied any history of anxiety , depression , or psychosis . a detailed neurologic examination revealed no focal weakness , loss of sensation , or imbalance . chest x - ray , contrast - enhanced computed tomography scan of the chest , abdomen , and pelvis , and upper endoscopy were negative . for 5 days , symptoms had a waxing and waning course on chlorpromazine , metoclopramide , and baclofen . magnetic resonance imaging ( mri ) of the brain demonstrated a partially enhancing 1.31.1 - cm mass within the fourth ventricle causing mass effect on the medulla oblongata ( fig .1 a ) . magnetic resonance angiogram ( mra ) of the cerebral circulation demonstrated that the mass was in fact a partially thrombosed aneurysm ( fig . catheter angiogram confirmed the presence of dolichoectatic aneurysm of the distal left posterior inferior cerebellar artery ( fig . the following day , the patient underwent a midline suboccipital craniotomy with resection of aneurysm and primary anastomosis . ( a ) sagittal contrast - enhanced magnetic resonance imaging and ( b ) axial magnetic resonance angiogram of the brain demonstrate a partially thrombosed posterior inferior cerebellar artery aneurysm within the fourth ventricle ( arrows ) . digital subtraction angiogram in the sagittal projection obtained following contrast injection into the left vertebral artery confirmed a partially thrombosed dolichoectatic aneurysm of the left distal posterior inferior cerebellar artery ( arrow ) . hematoxylin and eosin stained micrograph at 200 magnification shows an organized thrombus within the resected vessel ( arrow ) . this is the third reported case of ih caused by a giant pica aneurysm . the first reported case was in 2007 , of 16 - year - old boy with 1 - day history of ih .4 the other case was reported in 2010 of a 23 - year - old woman who had a 3 - month history of occasional hiccups that suddenly became intractable just before admission .5 all three patients were relatively young , healthy , with nonfocal neurologic exams , yet debilitating ih symptoms refractory to noninvasive therapy . all three were diagnosed following contrast - enhanced mri of the brain that showed a partially thrombosed , unruptured aneurysm of the distal pica occupying the fourth ventricle at the level of the medulla . our patient was the only one who underwent preoperative cerebral angiogram , used to confirm a vascular origin and provide a roadmap before surgical resection . all three patients had complete symptom resolution following surgical resection and primary anastomosis via a suboccipital approach . most are due to gastric distention and / or gastroesophageal reflux .2 ih occurring with systemic illnesses such as sepsis or uremia have been described , in addition to psychiatric disorders such as hysteria , anorexia , or grief .4 infrequently , a peripheral nervous system cause of ih is possible as the result of irritation along the hiccup reflex arch including the thoracic sympathetic chain , phrenic nerve , or accessory respiratory musculature .1 even more rare are lesions of the central nervous system that occur as the result of an insult to the hiccup center in the medulla oblongata .6 ischemia and mass effect from tumors such as cavernoma , ependymoma , or choroid plexus tumor have been described , occurring in higher incidences than aneurysms .56 it is therefore prudent to exclude central nervous system lesions in patients presenting with ih utilizing contrast - enhanced mri with mra .7 given the propensity of aneurysms to thrombose , differentiation from a hemorrhagic mass may be difficult , and confirmation with cerebral angiography should be considered . pica aneurysms make up only 0.6 % of all intercranial aneurysms .8 although ih is an extremely uncommon presentation of a pica aneurysm , it offers a potentially curable etiology and could eliminate the risk for complications of pica rupture such as subarachnoid hemorrhage or infarction of the lateral medulla ( i.e. , wallenberg syndrome ) .9 treatment of ih should begin with vagal maneuvers such as breath holding , immersion in cold water , or application of supraorbital pressure .6 persistent hiccups indicate the use of pharmacologic agents such as chlorpromazine , metoclopramide , gabapentin , orphenadrine , or antidepressants .10 hiccups resistant to noninvasive treatment necessitates a search for an underling cause in which case the possibility of brainstem lesions , including aneurysms , should not be overlooked .\noutput:\n" }, { "from": "agent", "value": "this is the third reported case of a posterior inferior cerebellar artery ( pica ) aneurysm presenting as intractable hiccups ( ih ) . a previously healthy 29 - year - old woman was admitted with a 2 - week history of hiccups occurring > 100 times per minute . symptoms persisted despite numerous noninvasive therapies . magnetic resonance imaging and magnetic resonance angiogram of the brain showed a left pica aneurysm that was confirmed by catheter angiography . symptoms resolved following suboccipital craniotomy and resection . although rare , pica aneurysm is a potentially curable cause of ih ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: papillary cystadenoma of the salivary glands is an uncommon benign neoplasm , which usually occurs in the minor salivary glands , and very rarely in the major salivary glands . extensive oncocytic change may be seen , and these lesions are classified as oncocytic variants . we report three cases of oncocytic papillary cystadenoma ( opc ) arising in the major salivary glands . case 1 was a 38 - year - old man who had had a mass on the right neck for 1 - month . fine needle aspiration ( fna ) was performed , and the cytologic smear showed irregular sheets and papillary clusters of epithelial cells [ figure 1a ] , with rich granular cytoplasm , bland - appearing nuclei , and conspicuous nucleoli [ figure 1b ] . a warthin tumor was suspected based on these findings . computed tomography ( ct ) revealed a cystic mass with a slight enhancement in the right parotid gland , and the patient underwent right superficial parotidectomy . gross examination showed a well - defined 2.5 - cm unilocular cystic mass with multiple papillary projections . microscopically , the epithelial lining comprised cuboidal to low - columnar cells [ figure 1c ] , with abundant granular , eosinophilic cytoplasm , and vesicular nuclei with prominent nucleoli [ figure 1d ] . ( a ) cytologic smear revealing many oncocytic cells in papillary c d clusters ( pap , 100 ) , ( b ) with abundant , granular cytoplasm and prominent nucleoli ( pap , 400 ) , ( c ) histological analysis revealed a multilocular cystic tumor filled with papillary projections ( h and e , 40 ) , ( d ) the papillae were lined by oncocytic cells with eosinophilic , granular cytoplasm ) , ( h and e , 200 ) case 2 was an 84 - year - old man who had had a slow - growing mass on the left neck for 1 - year . palpation revealed a firm , tender mass in the left parotid gland area , 4 cm in size . fna was performed , and the cytologic smear revealed a few scattered foamy macrophages and some inspissated proteinaceous material without epithelial cells , suggesting a cystic neoplasm [ figure 2a and b ] . a ct scan revealed a 3.1 cm 2.7 cm septated cystic mass in the superficial lobe of the left parotid gland . the patient underwent left superficial parotidectomy , revealing a multilocular cystic tumor with papillary projections . microscopically , the tumor appeared as a well - defined cystic mass , with multiple papillary fronds lined by tall columnar cells [ figure 2c ] . the cells had rich granular , eosinophilic cytoplasm , and bland - appearing nuclei with conspicuous nucleoli [ figure 2d ] . ( a and b ) cytology revealed inspissated proteinaceous material without epithelial cells ( a : pap , 100 ; b : pap , 400 ) , and ( c ) histology revealed a cystic mass with papillary projections in the lumen ( h and e stain , 40 ) ; ( d ) the tumor cells were columnar with rich eosinophilic granular cytoplasm ( h and e stain , 200 ) case 3 was a 57 - year - old man who presented with a swelling on the right upper neck , which had slowly increased in size over 1 - year . on palpation , a slightly tender 2 - cm mass was found below the right submandibular angle . fna was performed , and the cytologic smear showed irregular fragments of epithelial cells [ figure 3a ] . the cells had moderate amounts of cytoplasm and bland - looking nuclei with inconspicuous nucleoli [ figure 3b ] . cytologic examination suggested a benign epithelial tumor , and a ct scan revealed a 3 - cm cystic mass containing an inner solid portion . a 2.4 - cm well - circumscribed cystic mass filled with papillary projections was found in the resected submandibular gland . microscopy revealed a unilocular cyst with multiple papillary fronds lined by columnar epithelial cells , which had abundant eosinophilic cytoplasm and prominent nucleoli [ figure 3c and d ] . ( a ) cytologic smear revealed irregular fragments of epithelial cells ( pap , 100 ) , ( b ) the cells had moderate amount cytoplasm and inconspicuous nucleoli ( pap , 400 ) , ( c ) histology revealed a cystic mass filled with papillary fronds ( h and e , 40 ) , ( d ) which were lined by columnar , oncocytic cells with prominent nucleoli ( h and e , 200 ) case 1 was a 38 - year - old man who had had a mass on the right neck for 1 - month . fine needle aspiration ( fna ) was performed , and the cytologic smear showed irregular sheets and papillary clusters of epithelial cells [ figure 1a ] , with rich granular cytoplasm , bland - appearing nuclei , and conspicuous nucleoli [ figure 1b ] . a warthin tumor was suspected based on these findings . computed tomography ( ct ) revealed a cystic mass with a slight enhancement in the right parotid gland , and the patient underwent right superficial parotidectomy . gross examination showed a well - defined 2.5 - cm unilocular cystic mass with multiple papillary projections . microscopically , the epithelial lining comprised cuboidal to low - columnar cells [ figure 1c ] , with abundant granular , eosinophilic cytoplasm , and vesicular nuclei with prominent nucleoli [ figure 1d ] . ( a ) cytologic smear revealing many oncocytic cells in papillary c d clusters ( pap , 100 ) , ( b ) with abundant , granular cytoplasm and prominent nucleoli ( pap , 400 ) , ( c ) histological analysis revealed a multilocular cystic tumor filled with papillary projections ( h and e , 40 ) , ( d ) the papillae were lined by oncocytic cells with eosinophilic , granular cytoplasm ) , ( h and e , 200 ) case 2 was an 84 - year - old man who had had a slow - growing mass on the left neck for 1 - year . palpation revealed a firm , tender mass in the left parotid gland area , 4 cm in size . fna was performed , and the cytologic smear revealed a few scattered foamy macrophages and some inspissated proteinaceous material without epithelial cells , suggesting a cystic neoplasm [ figure 2a and b ] . a ct scan revealed a 3.1 cm 2.7 cm septated cystic mass in the superficial lobe of the left parotid gland . the patient underwent left superficial parotidectomy , revealing a multilocular cystic tumor with papillary projections . microscopically , the tumor appeared as a well - defined cystic mass , with multiple papillary fronds lined by tall columnar cells [ figure 2c ] . the cells had rich granular , eosinophilic cytoplasm , and bland - appearing nuclei with conspicuous nucleoli [ figure 2d ] . ( a and b ) cytology revealed inspissated proteinaceous material without epithelial cells ( a : pap , 100 ; b : pap , 400 ) , and ( c ) histology revealed a cystic mass with papillary projections in the lumen ( h and e stain , 40 ) ; ( d ) the tumor cells were columnar with rich eosinophilic granular cytoplasm ( h and e stain , 200 ) case 3 was a 57 - year - old man who presented with a swelling on the right upper neck , which had slowly increased in size over 1 - year . on palpation , a slightly tender 2 - cm mass was found below the right submandibular angle . fna was performed , and the cytologic smear showed irregular fragments of epithelial cells [ figure 3a ] . the cells had moderate amounts of cytoplasm and bland - looking nuclei with inconspicuous nucleoli [ figure 3b ] . cytologic examination suggested a benign epithelial tumor , and a ct scan revealed a 3 - cm cystic mass containing an inner solid portion . a 2.4 - cm well - circumscribed cystic mass filled with papillary projections was found in the resected submandibular gland . microscopy revealed a unilocular cyst with multiple papillary fronds lined by columnar epithelial cells , which had abundant eosinophilic cytoplasm and prominent nucleoli [ figure 3c and d ] . ( a ) cytologic smear revealed irregular fragments of epithelial cells ( pap , 100 ) , ( b ) the cells had moderate amount cytoplasm and inconspicuous nucleoli ( pap , 400 ) , ( c ) histology revealed a cystic mass filled with papillary fronds ( h and e , 40 ) , ( d ) which were lined by columnar , oncocytic cells with prominent nucleoli ( h and e , 200 ) cystadenoma of the salivary glands is a rare benign tumor , usually presenting as a slow - growing mass . the tumor usually arises in the minor salivary glands ( 0.9 - 2 % of all minor salivary gland neoplasms ) but is extremely rare in the major salivary gland . a review reported only three cases of the tumor arising in major salivary glands , and tsurumi et al . found that all four reported cases of salivary gland cystadenoma , between 1985 and 2003 , had arisen in the minor salivary glands . the latter has well - defined unilocular or multilocular cysts , with intraluminal papillary projections . the lining epithelial cells are cuboidal or columnar , and usually two layers in thickness . oncocytic papillary cystadenoma is often confused with warthin tumor , because of its histologic similarity ; papillary structures , oncocytic cells with rich eosinophilic cytoplasm , and prominent nucleoli . opc may also be misdiagnosed as intraductal papilloma as the latter often has cystically dilated ducts with papillary epithelial projections . however , the papillary cores of intraductal papilloma are more complex and prominent than opc . cystic change may be present in this tumor , but the papillary pattern , typical of opc , is not a feature of oncocytoma . zhang et al . reported diverse cytologic features of two cases of the tumor , one of which showed a cellular smear of oncocytic cells with prominent nucleoli and many histiocytes , and the other showed abundant necrotic debris , and large sheets of polygonal cells with vague papillary features and inconspicuous nucleoli . gupta et al . described somewhat different cytologic findings from two fnas taken from the same opc , with either atypical squamous cells in a necrotic background , consistent with squamous cell carcinoma , or many vacuolated and signet ring cells in a mucoid background . described a case of opc in which the aspirate was insufficient for diagnosis because of paucicellular smear . the first case showed distinct papillary clusters of oncocytic cells and the third case had irregular sheets of epithelial cells without identifiable oncocytic change . these contrast with the second case , in which only proteinous material without epithelial cells was found . it is assumed that the acellular or paucicellular smear of papillary cystadenoma is a result of the dilution of cystic fluid . in summary , opc is extremely rare in major salivary glands and tends to show varied cytologic features . although cytologic diagnosis is challenging , the tumor should be included in the differential diagnosis when oncocytic cells or papillary features are present in cystic tumors of salivary glands .\noutput:\n" }, { "from": "agent", "value": "oncocytic papillary cystadenoma ( opc ) in the major salivary glands is extremely rare . we report three cases of these cystadenomas arising in major salivary glands , with varied cytologic features . case 1 : a 38 - year - old man presented with a right parotid gland mass that showed papillary clusters of oncocytic cells on cytologic examination . case 2 : an 84 - year - old man presented with a left parotid gland mass . cytology revealed an acellular smear . case 3 : a 57 - year - old man presented with a mass in the right submandibular gland . cytology revealed irregular sheets of epithelial cells . histologic diagnoses of opc were made for all three cases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: research on bone tissue regeneration is constantly expanding due to the improved quality of life and the resulting increase in the world population 's life expectancy . the regeneration of lost or injured human osseous components is limited ; when bone is subjected to extensive damage , a graft is required . hydroxyapatite ( ha ) and tricalcium phosphate ( tcp ) are the most common synthetic biomaterials used as bone grafts , especially in the field of oral and craniofacial surgery , due to their similarity to the mineral phase of the bone . there are two major distinct phases of tricalcium phosphate crystals : - tcp and - tcp . in spite of their similar chemical composition , their different crystallographic features result in different resorption patterns : - tcp is obtained by heating above 1170c and is more soluble than - tcp . in addition , - tcp is more stable at room temperature than - tcp , it presents higher solubility than ha and , consequently , can be degraded faster in the body , allowing a desirable gradual replacement by the newly formed bone . due to the - tcp instability in water , the most common method to obtain tricalciumphosphate is the wet precipitation of a calcium - deficient apatite ( cda ) followed by heat treatment in the range of 700 - 1170c . studies concerning - tcp efficiency as a bone graft were already conducted . in vivo studies with - tcp implanted in the rat femoral condyle ( 2005 ) , concluding that - tcp has a good biocompatibility , since both bioresorption and bone formation started at an early phase after implantation . ( 2005 ) also considered - tcp an osteoconductive biomaterial , based on the histological and molecular findings of bone tissue withdrawn from bone defects in rat femurs previously implanted with - tcp granules . synthetic bone grafts are basically made of calcium phosphate ceramics and , nowadays , research is being directed to calcium phosphates partially substituted by several ions in order to improve the material 's properties . among all substituting cations , briefly , it is the fourth most abundant cation in the body , the second most abundant in intracellular medium and the most abundant ( around 6 mol % ) in cartilage and bone tissue during the initial stages of osteogenesis . mg is an essential cofactor in many biochemical reactions involving atp as second substrate . in addition , mg is mitogenic for osteoblasts and its depletion causes inhibition of cell growth in vitro due to the resulting reduction in the synthesis of dna , rna and proteins . dietary mg deficiency is associated with risk of osteoporosis and it also plays an important role in many enzymatic reactions . additionally , mg incorporation into tcp crystal lattice reduces the crystallinity of the material and therefore accelerates the degradation process , which may favor bone formation by the osteoblasts . to date , there are very few biological studies about mg - substituted - tcp , also known as - tcp . sader , legeros and soares ( 2009 ) cultivated human osteoblast cells onto sintered tablets of - tcp and - tcp ( mg / ca = 0.2 mol ) for 4 h , 24 h and 7 days . however , it was recently assumed that part of the mg could be adsorbed onto the material 's surface , since the maximum substitution of mg for calcium ( ca ) in the structure of tcp is 0.15 mol . therefore , the aim of this study was to produce dense granular - tcp and - tcmp ( mg / ca = 0.15 mol ) in order to investigate - tcmp biocompatibility by means of an in vitro cytotoxicity assay that evaluates two different parameters of cell survival and integrity . mg - substituted calcium deficient apatite ( mg - cda ) containing 0.15 mol of mg was synthesized by the wet precipitation method as previously described by sader , legeros and soares ( 2009 ) . ( 96 % pure , merck , darmstadt , germany ) and 0.17 m mgcl2 .6 h2o ( merck ) was simultaneously introduced with a 0.17 m h3po4 ( 85 % pure , merck ) solution into water over 3 h , with constant heating at 39c and ph equal to 9 . the obtained powder and the commercial product tricalcium phosphate ( - tcp , dried extra pure ; merck ) were then uniaxially pressed into cylindrical tablets under a compressive pressure of 216 mpa , followed by sintering at 1000c for 4 h in open air . the tablets were crushed and sieved to select the dense granules in the range of 250 - 500 m . the phases presented in the granular materials were analyzed using an x - ray diffractometer ( xrd ; shimadzu xrd 6000 , japan ) with monochromatized cu ka radiation and operational tube with 40 kv and 30 ma . the resulting trace was analyzed and compared with the standard library of known diffraction patterns ( jcpds ) . louis , mo , usa ) in the proportion of 1:20 were also examined by fourier - transformed infrared spectroscopy ( ftir ; perkinelmer , spectrum 100 , norfolk , va , usa ) in order to identify the vibration modes of the molecules in the range of 500 - 4000 cm . for xrd and ftir analysis , calcium , phosphorus ( p ) and mg contents in both phosphates were determined by inductively coupled plasma optical emission spectroscopy ( icp ; perkinelmer optima 3000 , usa ) . the analysis was performed in triplicate , and the mean values and standard deviations were subjected to one - way anova and tukey 's post - test test ( p 0.05 ) . scanning electron microscopy allowed the morphological characterization of the granules ( sem ; jeol jsm 6460 - lv , japan ) . samples were extracted from culture medium ( 100 mg of tcp granules / ml of dmem ) at 37c for 24 h and the extracts were collected for cytotoxicity assay according to iso 10993 - 12:2007 and 7405:2008 . icp analysis was performed in triplicate to determine the ca and mg content dissolved in the culture medium for 24 h ( biomaterial extract ) . a 1 % phenol solution was used as positive control for cytotoxicity , while untreated cells were used as a negative control ( cultivated with dmem only ) . subsequently , mc3t3 pre - osteoblasts ( crl 2594 - atcc ) were seeded in 96 - well cell culture plates ( 1x10 / well ) and subcultured in dmem containing ampicillin ( 0.025 g / l ) , streptomycin ( 0.1 g / l ) and supplemented with 10 % fetal bovine serum for 24 h at 37c and 5 % co2 / 95 % air . after 24 h of cell exposure to each extract medium , cell viability was evaluated with a commercial kit ( in cytotox , xenometrix , germany ) by two different tests of cell survival and integrity on the same sample : 2,3 - bis [ 2 - methyloxy - 4 nitro - 5sulfophenyl ] - 2h - tetrazolium -5-carboxanilide ( xtt ) and crystal violet dye elution ( cvde ) . the xtt cell proliferation assay is based on the ability of mitochondrial dehydrogenase enzymes to convert the yellow water - soluble tetrazolium salt xtt into orange colored soluble compounds of formazan , measured by their absorbance at 480 nm . the cvde assay evaluates cell density by staining dna and the absorbance at 540 nm is proportional to the amount of cells in each well . the absorbance data were obtained with a microplate uv / vis spectrophotometer ( powerwave ms2 , biotek instruments , winooski , vt , usa ) . mean values and standard deviations were submitted to one - way anova and tukey 's post - hoc test considering statistical significance at p 0.05 . mg - substituted calcium deficient apatite ( mg - cda ) containing 0.15 mol of mg was synthesized by the wet precipitation method as previously described by sader , legeros and soares ( 2009 ) . ( 96 % pure , merck , darmstadt , germany ) and 0.17 m mgcl2 .6 h2o ( merck ) was simultaneously introduced with a 0.17 m h3po4 ( 85 % pure , merck ) solution into water over 3 h , with constant heating at 39c and ph equal to 9 . the obtained powder and the commercial product tricalcium phosphate ( - tcp , dried extra pure ; merck ) were then uniaxially pressed into cylindrical tablets under a compressive pressure of 216 mpa , followed by sintering at 1000c for 4 h in open air . the tablets were crushed and sieved to select the dense granules in the range of 250 - 500 m . the phases presented in the granular materials were analyzed using an x - ray diffractometer ( xrd ; shimadzu xrd 6000 , japan ) with monochromatized cu ka radiation and operational tube with 40 kv and 30 ma . the resulting trace was analyzed and compared with the standard library of known diffraction patterns ( jcpds ) . louis , mo , usa ) in the proportion of 1:20 were also examined by fourier - transformed infrared spectroscopy ( ftir ; perkinelmer , spectrum 100 , norfolk , va , usa ) in order to identify the vibration modes of the molecules in the range of 500 - 4000 cm . for xrd and ftir analysis , calcium , phosphorus ( p ) and mg contents in both phosphates were determined by inductively coupled plasma optical emission spectroscopy ( icp ; perkinelmer optima 3000 , usa ) . the analysis was performed in triplicate , and the mean values and standard deviations were subjected to one - way anova and tukey 's post - test test ( p 0.05 ) . scanning electron microscopy allowed the morphological characterization of the granules ( sem ; jeol jsm 6460 - lv , japan ) . samples were extracted from culture medium ( 100 mg of tcp granules / ml of dmem ) at 37c for 24 h and the extracts were collected for cytotoxicity assay according to iso 10993 - 12:2007 and 7405:2008 . icp analysis was performed in triplicate to determine the ca and mg content dissolved in the culture medium for 24 h ( biomaterial extract ) . a 1 % phenol solution was used as positive control for cytotoxicity , while untreated cells were used as a negative control ( cultivated with dmem only ) . subsequently , mc3t3 pre - osteoblasts ( crl 2594 - atcc ) were seeded in 96 - well cell culture plates ( 1x10 / well ) and subcultured in dmem containing ampicillin ( 0.025 g / l ) and supplemented with 10 % fetal bovine serum for 24 h at 37c and 5 % co2 / 95 % air . after 24 h of cell exposure to each extract medium , cell viability was evaluated with a commercial kit ( in cytotox , xenometrix , germany ) by two different tests of cell survival and integrity on the same sample : 2,3 - bis [ 2 - methyloxy - 4 nitro - 5sulfophenyl ] - 2h - tetrazolium -5-carboxanilide ( xtt ) and crystal violet dye elution ( cvde ) . the xtt cell proliferation assay is based on the ability of mitochondrial dehydrogenase enzymes to convert the yellow water - soluble tetrazolium salt xtt into orange colored soluble compounds of formazan , measured by their absorbance at 480 nm . the cvde assay evaluates cell density by staining dna and the absorbance at 540 nm is proportional to the amount of cells in each well . the absorbance data were obtained with a microplate uv / vis spectrophotometer ( powerwave ms2 , biotek instruments , winooski , vt , usa ) . mean values and standard deviations were submitted to one - way anova and tukey 's post - hoc test considering statistical significance at p 0.05 . as shown in figure 1 , the diffraction pattern of granules obtained from the commercial tcp showed the mean peaks of - tcp or whitlockite ( jcpds 090169 ) ; on the other hand , the diffractogram of granules produced with mg - cda presented the mean peaks of - tcmp or magnesia whitlockite ( jcpds 130404 ) . regarding the morphology of the granules , a lower surface roughness was verified on - tcmp when compared to - tcp granules on sem images ( figure 2 ) . x - ray diffraction ( xrd ) patterns of tricalcium phosphate ( - tcp ) and magnesium - substituted - tcp ( - tcmp ) heat - treated at 1000c in air for 4 h scanning electron microscopy ( sem ) images of tricalcium phosphate granules ( 250 - 500 m ) : - tcp ( a ; b ) and magnesium - substituted - tcp ( - tcmp ) ( c ;d ) the ftir spectra in figure 3 showed phosphate bands at 1126 and 1025 ( n3 ) cm , as well as at 604 and 554 ( n4 ) cm in both materials , which are characteristic of tricalcium phosphates . based on icp results , the ( ca + mg ) / p molar ratio of - tcmp was calculated to be 1.45 , containing 0.14 mol of mg , which is close to the theoretical values [ ( ca + mg ) / p = 1.5 and 0.15 mol of mg ] . ftir spectra of tricalcium phosphate ( - tcp ) and magnesium - substituted - tcp heat - treated at 1000c in air for 4 h in relation to dmem alone , the icp analysis of the - tcmp granule extract medium ( dmem ) showed that there was a significant decrease in the ca concentration in opposition to an increase ( p 0.05 ) in mg ( figure 4 ) . calcium ( ca ) and magnesium ( mg ) contents of - tcp and - tcmp granule extracts or cell culture medium ( dmem ) determined by icp analysis , expressed as means and corresponding standard deviations . bars and asterisks indicate significant differences ( p 0.05 , anova ) the results of in vitro cytotoxicity tests for - tcp and - tcmp granules from xtt and cvde viability assays are in figure 5 . mitochondrial activity was similar in the cells exposed to - tcp and - tcmp extracts and in the untreated cells ( control group ) but , as expected , 1 % phenol abolished all dehydrogenase activity in the treated cells ( positive control ) . similar behavior was observed for the crystal violet test with no statistical difference between the biomaterials , but a strong reduction in the dna content of cells in the phenol - treated group . additionally , the results of both tests reveal that the overall viability of the cells exposed to the biomaterial extracts did not decrease , when compared with the untreated cells . cytotoxicity assay of tricalcium phosphate ( - tcp ) and magnesium - substituted - tcp on mouse osteoblasts , indicated as means and corresponding standard deviations . the asterisk indicates that the phenol group presented a significantly lower absorbance than all other groups ( p 0.05 , anova ) the treatment of large bone fractures still remains a challenge for dental and medical professionals because of many factors such as , biomaterials lacking adequate physicochemical or biological characteristics , e.g. bioresorption , even those of natural origin . recently , research has been performed in the field of engineered polymer scaffolds to be used as structural bone substitutes . the incorporation of calcium phosphate into these scaffolds could improve their efficacy as bone grafts . the slow degradation of calcium phosphate materials compared with a number of polymers should maintain the material 's stability during the bone formation phase , and rapid degradation of the material would be no longer an important issue . in spite of the myriad of materials being developed and tested in the last decades , the ideal biomaterial has not yet been developed , and research must be conducted to investigate physicochemical and biological improvements to the currently available repertoire of biomaterials . in this context , the present work showed the synthesis and characterization of dense granules of - tcmp , a novel biomaterial aiming to associate the osteoconductivity of - tcp and the stimulatory effect of mg on osteoblasts . however , before performing in vivo studies on the impact of such material in bone tissue therapy , an in vitro evaluation of cytocompatibility should be conducted . mg incorporation into tcp granules reflected in the shift of the xrd peaks due to partial mg - for - ca substitution , causing a contraction in the unit cell dimension and stabilizing the structure . this effect is attributed to the smaller ionic radius of mg ( 0.65 ) in relation to ca ( 0.99 ) since substitutions with smaller ions give rise to lattice strain , favoring the contraction and at the same time stabilizing the structure . this was proven when sem images were observed : due to the higher volumetric contraction of - tcmp , a different level of densification was observed , consequently leading to a variation on surface microporosity between - tcmp and - tcp granules , as already reported . the ftir spectra exhibit the characteristic bands of tricalcium phosphate [ ca3 ( po4 ) 2 ] , attesting the accuracy of the biomaterial synthesis . icp analysis showed that there was release of mg and precipitation of ca into the - tcmp granule extract , when compared to the composition of dmem . the material 's solubility is a vital characteristic since in vivo resorption is controlled by two factors : its own dissolution into the medium and cell - mediated degradation . ( 2008 ) immersed - tcmp powders doped with 0 , 2.3 , 4.9 , 7.3 and 10.1 % of mg in a buffer solution of 0.08 m ch3cooh - ch3coona ( ph 5.5 ) at 25c for up to 27 months . it was observed that the reduced solubility of the material with increasing mg content could be attributed to the greater structural stability : the - tcp structure can accommodate ions with an ionic radius in the range of 0.06 - 0.08 nm ( the ionic radius of mg is 0.072 nm ) . biocompatibility is defined as the ability of a biomaterial to perform in the context of a suitable host response in a particular application . hence , metallic ions released in excess by a biomaterial can be toxic if they induce undesirable changes at higher concentrations . ( 2011 ) assessed the number of viable balb / c 3t3 fibroblasts after exposure to several metal - modified apatite extracts for 24 h and concluded that cells respond to the metal that substitutes ca or phosphate ions in the crystal lattice of ha . for that reason , soluble biomaterials such as metallic ion - substituted calcium phosphates must be evaluated in terms of their cytocompatibility before clinical use . the general screening assays for biomaterial testing are divided into four phases : general toxicity ( in vitro cytotoxicity tests ) , local tissue irritation ( animal implantation ) , pre - clinical ( proof of concept in animal model ) and clinical evaluation ( human trials ) . in vitro cytotoxicity assaysprovide a measure of cell death caused by biomaterials or their extracts and it is important to recognize the limitations of each test to formulate an appropriate judgment . for instance , metabolic impairment tests ( xtt ) are more complex and can be biased by bacterial contamination and are prone to overestimating cell viability . on the other hand , the crystal violet assay can stain dead cells that are still attached to the plate . nevertheless , both are important tools to predict cell growth and survival . the xtt result shows that - tcmp granules are cytocompatible . concerning the cvde assay result , still , those cells were in a death process since no metabolic activity was detected by the xtt assay , and yet cv also dyed the dead cells that were still attached to the plate . this reinforces the necessity to analyze more than one aspect of cell survival and integrity before attesting biomaterial cytocompatibility . ( 2008 ) implanted ha granules containing 5.7 % of mg in rabbit femoral bone defects . another study investigated the activity of osteoclasts on 6.8 mol % mg - containing tricalcium phosphate discs in different mg - containing culture media . even 100 ppm of mg ions in the culture medium did not increase osteoclast apoptosis and mg ions in the tcp structure had no effect on osteoclast apoptosis . moreover , an assay using osteoblast culture indicated that the presence of mg in tcp structure stabilized the cell - material interface and consequently enhanced cell attachment and growth . to the best of our knowledge , there are insufficient data in the literature regarding - tcmp granules cytotoxicity assays that allow comparison of the results . however , sader , legeros and soares ( 2009 ) showed that dense - tcmp ( mg / ca = 0.2 mol ) tablets could sustain the adhesion and proliferation of human osteoblast cells in vitro , suggesting that this is a promising biomaterial for bone grafting . conversely , the reported beneficial effect could be due , at least in part , to the mg adsorbed by the granule surface . granular - tcmp ( mg / ca = 0.15 mol ) was successfully produced and the resulting biomaterial was shown to be biocompatible , while being capable of releasing mg in the cell culture medium . these results indicate the suitability of this promising material for further biological in vivo studies on its adequacy as an efficient bone substitute material .\noutput:\n" }, { "from": "agent", "value": "objective : the aim of this study was to produce dense granules of tricalcium phosphate ( - tcp ) and magnesium ( mg ) substituted - tcp , also known as - tcmp ( mg / ca = 0.15 mol ) , in order to evaluate the impact of mg incorporation on the physicochemical parameters and in vitro biocompatibility of this novel material.material and methods : the materials were characterized using x - ray diffraction ( xrd ) , infrared spectroscopy ( ftir ) , electron microscopy and inductively coupled plasma ( icp ) . biocompatibility was assayed according to iso 10993 - 12:2007 and 7405:2008 , by two different tests of cell survival and integrity ( xtt and cvde ) . results : the xrd profile presented the main peaks of - tcp ( jcpds 090169 ) and - tcmp ( jcpds 130404 ) . the characteristic absorption bands of tcp were also identified by ftir . the icp results of - tcmp granules extract showed a precipitation of calcium and release of mg into the culture medium . regarding the cytotoxicity assays , - tcmp dense granules did not significantly affect the mitochondrial activity and relative cell density in relation to - tcp dense granules , despite the release of mg from granules into the cell culture medium.conclusion : - tcmp granules were successfully produced and were able to release mg into media without cytotoxicity , indicating the suitability of this promising material for further biological studies on its adequacy for bone therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: single nucleotide polymorphism array based approach for identifying candidate genes is a cost effective method in consanguineous families with genetically heterogeneous conditions like autosomal recessive congenital recessive ichthyosis . single nucleotide polymorphism array based approach for identifying candidate genes is a cost effective method in consanguineous families with genetically heterogeneous conditions like autosomal recessive congenital recessive ichthyosis . autosomal recessive congenital ichthyosis ( arci ) is a clinically and genetically heterogeneous group of disorders . eleven causative genes have been identified till date for arci . in absence of a genotype - phenotype correlation , it is very time consuming and expensive to sequence all the genes one by one . next generation sequencing based multigene panels for testing all the causative genes at a time are expensive and beyond the reach of most physicians . hence , the approach of narrowing down the candidate gene / genes in the regions of homozygosity by single nucleotide polymorphism ( snp ) array in consanguineous families followed by sanger sequencing of these genes is worthwhile . he was the first child of third degree consanguineous parents , born as a collodion baby . he was delivered by cesarean section at 39 weeks of gestation in view of oligohydramnios and nonprogression of labor . baby cried immediately after birth and weighed 2.9 kg . on examination , he had dry , thick skin with nonbullous generalized erythematous desquamation , bilateral ectropion , eclabium and digital contractures [ figure 1 ] . rest of the examination was unremarkable . clinical diagnosis of nonsyndromic congenital ichthyosis was made and he was managed conservatively . in view of the severe disease , breastfeeding was established , and he was shifted back to referring hospital for primary care on day 15 of life . he developed sepsis after a week and in spite of appropriate treatment , deteriorated and succumbed on day 30 of life . collodion baby with generalized nonbullous , erythematous desquamation , ectropion , eclabium and digital contractures stored dna of the proband was investigated by an snp array that revealed multiple large regions of homozygosity . two candidate genes ( aloxe3 and alox12b ) were identified in these regions of homozygosity known to cause arci . since the baby 's sample was not sufficient for further dna analysis , carrier testing of parents was planned by sequencing of the two candidate genes . after analyzing aloxe3 gene in parents , which did not show any pathogenic variation , sequencing of alox12b gene of parents showed that both parents were carriers for a novel mutation , a heterozygous deletion , c. 1067delt in exon 8 of alox12b gene . this variation shifts the reading frame and terminates translation at residue 25 ( p.i356tfs * 5 ) . the clinical presentation of arci is a continuous spectrum with the most severe harlequin ichthyosis at one end and the milder forms , lamellar ichthyosis ( li ) and congenital ichthyosiform erythroderma at the other . . genes known to cause arci include tgm1 , aloxe3 , alox12b , nipal4 , abca12 , cyp4f22 , pnpla1 , lipn , st14 , arci7 , and cers3 . further heterogeneity is expected as few families do not carry mutations in these known genes . mutations in four genes ( tgm1 , aloxe3 , alox12b , and abca12 ) account for more than 90 % cases of arci . mutations in the gene abca12 are detected only in 5 % cases of arci , but account for more than 93 % cases of harlequin ichthyosis . molecular diagnosis is the most important step for genetic counseling of families with genetic disorders . genetic testing not only helps in confirming the diagnosis , but also in prognostication , management and prenatal diagnosis for the subsequent pregnancies in the family . homozygosity mapping using snp array is a cost - effective and useful tool for consanguineous families with genetically heterogeneous disorders . the presence of candidate gene / genes in large regions of homozygosity offers an accessible approach to these heterogeneous disorders as these genes can be easily analyzed by the reasonably available and affordable conventional sequencing . thus , it helps to avoid the excessive cost and time of sequential gene testing . heredna banking offers a valuable approach of storage of dna and its subsequent use for genetic testing in families . option of dna banking should be discussed with parents of any sick neonate with genetic disorder for future molecular testing as it is not possible to provide proper genetic counseling and prenatal diagnosis in future pregnancies without identification of molecular defect . snp array - based approach for candidate gene search is a useful and cost - effective test in consanguineous families with genetically heterogeneous conditions . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient ( s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . there are no conflicts of interest . c. 1067delt is a novel mutation in alox12b gene that casues autosomal recessive congenital ichthyosisdna bankingshould be offered to sick neonates with severe forms of congenital ichthyosiswhere there is insufficient dna from the proband , homozygosity testing can suggest candidate genes which can then be sequenced in the parents . c. 1067delt is a novel mutation in alox12b gene that casues autosomal recessive congenital ichthyosis dna bankingshould be offered to sick neonates with severe forms of congenital ichthyosis where there is insufficient dna from the proband , homozygosity testing can suggest candidate genes which can then be sequenced in the parents . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient ( s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . there are no conflicts of interest . c. 1067delt is a novel mutation in alox12b gene that casues autosomal recessive congenital ichthyosisdna bankingshould be offered to sick neonates with severe forms of congenital ichthyosiswhere there is insufficient dna from the proband , homozygosity testing can suggest candidate genes which can then be sequenced in the parents . c. 1067delt is a novel mutation in alox12b gene that casues autosomal recessive congenital ichthyosis dna banking should be offered to sick neonates with severe forms of congenital ichthyosis where there is insufficient dna from the proband , homozygosity testing can suggest candidate genes which can then be sequenced in the parents . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient ( s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . there are no conflicts of interest . c. 1067delt is a novel mutation in alox12b gene that casues autosomal recessive congenital ichthyosisdna bankingshould be offered to sick neonates with severe forms of congenital ichthyosiswhere there is insufficient dna from the proband , homozygosity testing can suggest candidate genes which can then be sequenced in the parents . c. 1067deltis a novel mutation in alox12b gene that casues autosomal recessive congenital ichthyosis dna banking should be offered to sick neonates with severe forms of congenital ichthyosis where there is insufficient dna from the proband , homozygosity testing can suggest candidate genes which can then be sequenced in the parents .\noutput:\n" }, { "from": "agent", "value": "in genetically and phenotypically heterogeneous conditions like ichthyosis , it is clinically not possible to predict mutation in a specific gene . sequential testing of all the causative genes is time consuming and expensive . in consanguineous families with autosomal recessive genetically heterogeneous disorders , it is possible to narrow down the candidate gene / genes by recognizing the regions of homozygosity by a single nucleotide polymorphism ( snp ) array . here , we present a fatal case of autosomal recessive severe congenital ichthyosis born to a consanguineous couple . two candidate genes were recognized by snp array on banked dna of the subject . sequencing of these candidate genes in parents found them to be carriers of the same variation , a novel heterozygous deletion of single nucleotide in exon 8 ( c. 1067delt ) of alox12b gene . the present case illustrates the utility of dna banking , snp array and testing of parents to arrive at a definitive molecular diagnosis , essential for genetic counseling , and prenatal testing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: to date , one of the most understudied etiologies of older adults ' survival and longevity has been the role of their cognitive beliefs and worldviews that possibly interact with their functional and mental capacities to endure , challenge , overcome , and survive in the face of the numerous struggles and obstacles in advanced old age . in earlier research on predictors of mortality , the focus has been exclusively on variations in physical health and sociodemographic variables to explain and predict differences in longevity and mortality rates across a wide age range . more recently , studies have explored the relationship between the 5 - factor personality traits and other stress - inducing traits of perfectionism and dysfunctional dependency traits to predict greater longevity or increased risk of mortality . the present study presents a clear departure from earlier studies that have focused on sociodemographic and personality factors to explain and predict differences in all - cause mortality rates in later life . the goal of the present research is to move outside the personality and traits model to other second - order cognitive - behavioral factors to predict differences in all - cause mortality rates in later life . cognitive - behavioral theorists argue on both theoretical and empirical grounds that individuals ' cognitive beliefs exert a great deal of influence on their health , resilience , and longevity and may logically be assumed to be robust predictors of impending mortality or conversely of longevity . however , the ability of cognitive belief systems to predict important health outcomes of survival and longevity has traditionally been questioned because of the putative effects of individuals ' earlier life experiences such as parental loss and divorce . more recent explorations into individuals ' cognitive beliefs have been drawing attention to a cluster of beliefs systems that may counter the effects of earlier negative experiences and may serve as strengthening factors toward enhancing longevity . recent research using more modern concepts of evaluating dominant cognitive beliefs and cognitive perspectives of individuals ( e.g. , beliefs about a just world ( bjw ) for self and others , beliefs about one 's future time , beliefs about one 's self - continuity with the future , and beliefs about social , political , and interpersonal trust ) has provided growing evidence that individuals ' cognitive beliefs and perspectives are indeed related to health - related processes leading to longer survival and longevity as a final health outcome . also , in recent years , the availability of reliable and valid measures of cognitive beliefs of justice and fairness , future time perspectives , and future self - continuity perspectives has increased our understanding of the predictive value of individuals ' cognitive beliefs as strengthening or debilitating factors in health - related outcomes of resilience and longevity . the present study addresses the relationship between newly emerging sets of important cognitive belief systems and the potential for increased longevity . for example , a number of researchers have demonstrated empirically that individuals ' tenacious cognitive beliefs in a just world ( bjw ) society are not only predictive of their subjective well being and resilience , but more importantly drive them toward investment in long - term goals and a commitment to better self - care of health and a longer life . as a result , life - span scholars are now more keenly exploring the proactive role that individuals ' beliefs about a just world ( bjw ) may play in their future well being and healthy physical survival ( see tomaka and blascovitch , 1994 ) , low levels of depression , and less loneliness . other dominant cognitive beliefs which have been seen to be related to healthy survival processes or which present increased risks of mortality include beliefs about interpersonal trust and trust in key institutions . individuals who have strong positive beliefs of trust in the interpersonal and institutional domains are commonly expected to live lives that are more organized and planned , as distinguished from lives of instability , anxiety , and caution . other perspectives and belief systems that are predictive of planned healthy survival include future time perspective ( ftp ) and self - continuity with the future perspective ( fsc ) . the ftp perspective is a measure of individuals ' perceived belief about how much time participants had left in life . according to carstensen , the subjective sense of remaining time has profound effects on basic human processes , including motivation , cognition , and behaviors . with increasing age , constraints on time left shift individuals ' priorities about how remaining time can be protected . along somewhat similar lines , the future self - continuity perspective ( fsc ) indicates that participants ' beliefs about their similarity and connection as well as caring and liking for their future self 10 - , 15 - , or 20 - years from now determine and shift their motivation to protect the potential future person . for purposes of the present study , our underlying conceptual assumption in both these futuristic perspectives is that individuals who perceive their time horizons and their self - continuity with the future as more limited would be more likely to discount the future , and thus more unlikely to plan for self - care and self - management of the future , whereas those who feel the future horizons are more open - ended and expansive are more likely to plan and organize for a secure future . implicit in these perspectives is the prediction that individual differences in the experience of self - continuity could have positive pragmatic consequences for future health care and healthy survival . one logical assumption is that people who experience little or no continuity with the future self may not aspire to control future health - related processes whereas people who experience much similarity or self - continuity with the future self are likely more motivated to work toward shaping a better survival . while previous research has demonstrated empirically the predictive value of the preceding sets of cognitive beliefs and perspectives in regard to well - being and physical and mental health - related processes and outcomes , findings have been drawn from the study of a wide range of ages . thus , there is the question of whether the prognostic value of these belief systems continues into advanced old age . to date , the number of longitudinal studies of cognitive beliefs as predictors of longevity or as risk to mortality in old age is limited . to address this issue , accordingly , the purpose of our current research was to examine longitudinally the extent to which specific and select sets of cognitive beliefs are enabling , strengthening , or disabling with respect to long - term health , resilience , and longevity of older adults and have predictive value for all - cause mortality in advanced old age . the question is of increasing interest to health professionals and gerontologists for both practical and conceptual reasons . in the section which follows , we review briefly the research literature that both explains and extends the assumptions underlying the theory and goals of concepts of bjw , ftp , and fsc and their potential for predicting longer survival / or reduced risk for mortality . the just world hypothesis and how it may relate to health and longevity is easily stated . individuals have a strong need to believe that they live in a world where people generally get what they deserve . the belief that the world is just enables the individual to confront his / her physical and social environment as though they were stable and orderly . without such a belief , it would be difficult for the individual to commit himself / herself to the pursuit of long - range goals or even to the socially regulated behavior of day - to - day life . since the belief that the world is just serves such an important adaptive function for the individual , people are very reluctant to give up this belief , and they can be greatly troubled if they encounter evidence that suggests that the world is not really just or orderly after all . according to lerner and miller 's just - world theory , people who believe that the world treats them fairly may plan confidently for their future , expecting their lives to be orderly , meaningful , and controllable , foreseeing a positive future or viewing one 's living situation as justly deserved and hence fair . in turn , this expectation promotes mental health , meaning that the belief in a just world ( bjw ) can be seen as a positive illusion . indeedresearch links bjw to many indices of subjective well being including a greater purpose in life and commitment to planned healthy survival . there is empirical evidence showing that individuals who strongly believe in a just world have been seen to experience less stress and more positive affect than individuals with a weaker bjw ( e.g. , ) . the preceding conceptual underpinnings and the recent theory and research related to cognitive beliefs of a just world ( bjw ) lend weight to the proposed hypothesis of our present study that strong bjw beliefs about justice for the self portend positive social consequences and health - related benefits for the future . as such , individuals ' strong cognitive beliefs about a just world ( bjw ) may be early predictors of their continued physical and mental well being at later stages of life and would serve to protect them against the stress associated with the challenges of later life . in the current study , we reason that the predictive power of bjw to enhance longevity derives uniquely from perceived justice and bjw beliefs . in light of the preceding discussion , our leading hypotheses for the current study were ( 1 ) that individuals ' beliefs that the world is just to themselves ( bjw - self ) are particularly predictive of their longer term survival and longevity , and ( 2 ) that the associations between cognitive beliefs of a just world would be observed more powerfully among measures of bjw for self only ( as distinguished from bjw for others ) . in essence , we reason that it is the perception of one 's own , more so than other individuals ' , outcomes that would most powerfully predict longevity or possible risks of mortality ; ( 3 ) that individuals ' stronger levels of interpersonal trust and trust in the major communal institutions ( as associated with their perceptions of justice in the bjw beliefs ) are early predictors of their longevity , or conversely stronger levels of distrust in the major communal institutions would be associated with increased risk of mortality . a related second goal of our current study was to examine the predictive value of other related cognitive perspectives such as future time perspectives not previously studied as predictors of mortality and longevity . on the basis of postulates derived from carstensen 's theory on the influence of a sense of time on human development ( also see ) theory on individual differences in future self - continuity , we reason that while time eventually runs out for all individuals , individuals who hold more expansive and open - ended future time horizons or who foresee stronger self - continuity with the future self ( compared to those who hold more limited future time horizons and less self - continuity with the future self ) are less likely to discount the significance of future time and are more invested in self - preservation for the future . accordingly , we hypothesize ( 4 ) that individuals ' varying beliefs about future time left ( ftp ) and their beliefs about their ability to maintain self - continuity with the future ( fsc ) are critical markers or early predictors of longevity and of the risks of mortality . while we acknowledge that the preceding associations between mortality and cognitive beliefs may not have been apparent in early and middle - age adulthood , our expectation is that the associations will be especially observable and relevant in late life functioning and will emerge as early markers or predictors of mortality or longevity . participants for the study were randomly recruited from the registry listings of four branch offices of community services and community organizations for seniors ( ministry of health services and health policy 1992 ) , a governmental organization responsible at the time for social services and health policy in southern alberta . a sampling strategy with proportional stratification in function of geographical zone ( metropolitan , urban , or rural ) was used to ensure that the sample was representative of the general population of older adults living in three big cities and various rural areas in southern alberta . participants came from three mid - sized cities ( populations ranging from 170,000 to 300,000 individuals ) and surrounding suburban and rural areas in southern alberta ( canada ) . it should be noted that various levels of community dwellings ranging from upper middle class private houses to low income apartment housing , and assisted living homes were included in the final recruitment . initially 760 brochures briefly describing the research were mailed on a staggered basis to seniors ' households requesting individuals ' participation with a one - time offer of a $ 30 gift certificate to compensate for their time . the purpose of the study was explained as an attempt to understand older individuals ' beliefs , hopes , expectancies , and planned goals for the foreseeable future . by the end of eight weeksthe remaining 628 individuals were subsequently recontacted by mail , and of these 137 individuals who wanted additional information about the research were contacted by phone . another 333 individuals agreed to participate in response to further advertising and a to a second and third call for participants , made 3 and 4 months later , bringing the total number of willing participants to 470 . eligibility criteria for the selection of participants included ( 1 ) being 65 years or older ; ( 2 ) being able to understand , speak , and write english ; ( 3 ) not having a diagnosis of cognitive dysfunction registered in the medical files ; ( 4 ) being available for baseline assessments ; ( 5 ) able to specify by name , address , phone number , and other relevant details , one or more family members or care - givers willing to serve as informants to the research team ; ( 6 ) willing to sign a consent form . the initial interview with each of the 470 participants and their family members took approximately one - and - a - half hours , with interviews staggered over a period of 16 weeks . the majority of participants were interviewed in their homes in order to obtain baseline information about health status in relation to the chronic condition presented , to obtain participants ' formal consent to participate and to arrange for their family member or primary care giver to contact us periodically concerning the participant 's general progress . we provided informants with postage - paid envelopes to contact us at regular intervals , as stated in the contact form , concerning the participant 's health status ( improving , stable , declining somewhat , seriously declining ) , and in the event of the participant 's death , to provide the exact date of death . within the first four months of the completion of baseline assessments for the study , a total of 30 participants withdrew their participation for a number of reasons , mostly because of the care - givers ' reluctance to cooperate . data are presented for the remaining 440 participants who , following baseline assessments , stayed the entire 6.5 years ' course of the study . we wrote thank you notes and sent gift coupons to care givers at every wave of the study , as a token of appreciation of their continuing participation . there was no further attrition of participants during the course of the next 6.5 years . ascertainment of mortality ( date of death ) was done solely on the basis of report of the informants . family members preferred that we used this follow - up and contact procedure because it was more personal and private . however , as far as possible , we double checked dates of death against easily accessible local / provincial mortuary listings . the study comprised 11 waves of data collection . following a small pilot study , we conducted in 1995 on study procedures and assessment scales , baseline measures ( wave 1 ) were obtained between september and december 2000 in a staggered way , followed by 10 subsequent waves of contacts with informants and / or participants to obtain summary progress data on participants . contacts were made at approximately eight - month intervals ( 240 days apart ) till early december 2007 , approximately 6.5 years after baseline . participants agreed to complete paper - and - pencil tests at their own pace , at home or in their place of study , and approximately 10 percent sought the help of research assistants to record their responses . at baseline , participants completed the following . measure of beliefs of a just world ( bjw ) bjw were assessed with a scale originally developed by lipkus and siegler but further improved by bgue and bastounis , in order to separate items of bjw pertaining to self from items of bjw pertaining to others . participants rated on a scale of 1 ( strongly disagree ) to 6 ( strongly agree ) 8 items of bjw beliefs pertaining to the self . sample items are i feel that the world treats me fairly in life , i feel that i get what i deserve , i feel that when people meet with misfortune , they have brought it upon themselves . scores for bjw ( self ) and scores for the bjw ( others ) ranged from 8 to 48 . we used the option of scoring the bjw - self and bwj - others as continuous scales . cronbach 's alpha were .84 and .74 for the bjw - self and bwj - others , respectively . bjw were assessed with a scale originally developed by lipkus and siegler but further improved by bgue and bastounis , in order to separate items of bjw pertaining to self from items of bjw pertaining to others . participants rated on a scale of 1 ( strongly disagree ) to 6 ( strongly agree ) 8 items of bjw beliefs pertaining to the self . sample items are i feel that the world treats me fairly in life , i feel that i get what i deserve , i feel that when people meet with misfortune , they have brought it upon themselves . scores for bjw ( self ) and scores for the bjw ( others ) ranged from 8 to 48 . we used the option of scoring the bjw - self and bwj - others as continuous scales . cronbach 's alpha were .84 and .74 for the bjw - self and bwj - others , respectively . measure of future time perspective ( ftp ) ftp was assessed with the future time perspective scale developed by carstensen . participants rated on a scale from 1 ( very untrue for me ) to 7 ( very true for me ) the degree with which they agreed with each of 10 items . i have the sense that time is running out , as i get older , i begin to experience time as limited . we used the option of scoring the ftp as a continuous scale in the first instance . participants rated on a scale from 1 ( very untrue for me ) to 7 ( very true for me ) the degree with which they agreed with each of 10 items . sample items are many opportunities await me in the future , most of my life still lies ahead of me , i have the sense that time is running out , as i get older , i begin to experience time as limited . we used the option of scoring the ftp as a continuous scale in the first instance . measure of future self - continuity ( fsc ) fsc was assessed by means of an adapted psychometric measure of future self - continuity originally devised by frederick that used a single - item measure ( i.e. , how similar / connected are you to your past and future self for 5 - , 10 - , 15 - , and 20 - year intervals on a 1100 scale ? ) . to facilitate the comprehension of the concept of continuity , the individual 's endorsement of similarity between present and future selves was presented pictorially by a range of five circles with no overlap to circles with complete overlap . the index of future self - continuity featured two questions on 7 - point scale marked at each point by two circles that ranged from showing no overlap at one end of the scale to depicting almost complete overlap at the other end ( see for circles depicting no overlap to complete overlap ) , thus , making the measuring devise more concretely comprehensible to older adults . participants first selected the pair of circles that best described how similar / connected they felt to the future self 15 years from now , and how much they cared about the future self . subsequently , their responses were invited to two questions : how connected do you feel to your future self 15 years from now ? ( not at all = 0 to very much = 7 ) . how much do you care for your future self ? ( not at all = 0 to very much = 7 ) . we used the option of scoring the fsc scale ( similarity / caring ) as a continuous scale in the first instance . the index score of future self - continuity ranged from 7 to 35 , and caring for the future self ranged from 7 to 35 , assessed in terms of one continuous total index score ranging from 14 to 70 . the high scores represented higher levels of future self - continuity / caring for future self . fsc was assessed by means of an adapted psychometric measure of future self - continuity originally devised by frederick that used a single - item measure ( i.e. , how similar / connected are you to your past and future self for 5 - , 10 - , 15 - , and 20 - year intervals on a 1100 scale ? ) . to facilitate the comprehension of the concept of continuity , the individual 's endorsement of similarity between present and future selves was presented pictorially by a range of five circles with no overlap to circles with complete overlap . the index of future self - continuity featured two questions on 7 - point scale marked at each point by two circles that ranged from showing no overlap at one end of the scale to depicting almost complete overlap at the other end ( see for circles depicting no overlap to complete overlap ) , thus , making the measuring devise more concretely comprehensible to older adults . participants first selected the pair of circles that best described how similar / connected they felt to the future self 15 years from now , and how much they cared about the future self . subsequently , their responses were invited to two questions : how connected do you feel to your future self 15 years from now ? ( not at all = 0 to very much = 7 ) . how much do you care for your future self ? ( not at all = 0 to very much = 7 ) . we used the option of scoring the fsc scale ( similarity / caring ) as a continuous scale in the first instance . the index score of future self - continuity ranged from 7 to 35 , and caring for the future self ranged from 7 to 35 , assessed in terms of one continuous total index score ranging from 14 to 70 . the high scores represented higher levels of future self - continuity / caring for future self . interpersonal and society trust measureindividuals ' degree of interpersonal trust and trust in the surrounding public institutions that are perceived to represent justice and fairness were assessed by means of scale items adapted from the the rotter trust scale . as a first step in adapting the scale , a number of items were written using a 5 - point likert format , ( 1 ) strongly agree to ( 5 ) strongly disagree . an attempt was made to sample a wide variety of social objects so that a subject would be called upon to express his / her trust of outside agents , friends , and family members . sample items include in dealing with strangers one is better off to be cautious until they have provided evidence that they are trustworthy , most elected public officials are not really sincere in their campaign promises ; most friends can be trusted to support you for life ; i am able to share my innermost thoughts and feelings with family because of my trust in them ; i do not like to reveal personal information to outside agents even when they claim to be helping me ; i am a private person and find it hard to trust people i do not know well . in the final form of this scale , the 24 items selected were similarly balanced . twelve items indicated trust for agreeing , and 12 items indicated distrust for agreeing ( with the range of scores for both the trust items and distrust items being 12 to 60 ) . a few filler items were included to disguise the true purpose of the scale . cronbach 's alpha for the trust scale and distrust scale were .77 and .72 , respectively . individuals ' degree of interpersonal trust and trust in the surrounding public institutions that are perceived to represent justice and fairness were assessed by means of scale items adapted from the the rotter trust scale . as a first step in adapting the scale , a number of items were written using a 5 - point likert format , ( 1 ) strongly agree to ( 5 ) strongly disagree . an attempt was made to sample a wide variety of social objects so that a subject would be called upon to express his / her trust of outside agents , friends , and family members . sample items include in dealing with strangers one is better off to be cautious until they have provided evidence that they are trustworthy , most elected public officials are not really sincere in their campaign promises ; most friends can be trusted to support you for life ; i am able to share my innermost thoughts and feelings with family because of my trust in them ; i do not like to reveal personal information to outside agents even when they claim to be helping me ; i am a private person and find it hard to trust people i do not know well . in the final form of this scale , the 24 items selected were similarly balanced . twelve items indicated trust for agreeing , and 12 items indicated distrust for agreeing ( with the range of scores for both the trust items and distrust items being 12 to 60 ) . a few filler items were included to disguise the true purpose of the scale . cronbach 's alpha for the trust scale and distrust scale were .77 and .72 , respectively . spheres of control the scale has little or no conceptual overlap with the bjw scale and , hence , was selected to provide an independent measure of control . the scale is comprised of 30 items with the three spheres of control ( personal efficacy , interpersonal control , and sociopolitical control ) each represented by 10 items each rated on a 5 - point likert scale ranging from disagree to agree . in the present research , we collapsed the scores across these three spheres of control because the results of our hypothesis tests were not affected by distinguishing between them . specimen items for the personal efficacy scale , interpersonal scale , and sociopolitical scale , respectively , includeit 's pointless to keep working on something that is too difficult for me ; i find it easy to play an important part in most group or individual situations . in the long run , we as voters are responsible for bad government on a local or national level ; it is difficult for people to have much control over things politicians do in offices . a total index score for the 30 items was obtained with scores ranging from 30 to 150 . the scale has little or no conceptual overlap with the bjw scale and , hence , was selected to provide an independent measure of control . the scale is comprised of 30 items with the three spheres of control ( personal efficacy , interpersonal control , and sociopolitical control ) each represented by 10 items each rated on a 5 - point likert scale ranging from disagree to agree . in the present research , we collapsed the scores across these three spheres of control because the results of our hypothesis tests were not affected by distinguishing between them . specimen items for the personal efficacy scale , interpersonal scale , and sociopolitical scale , respectively , includeit 's pointless to keep working on something that is too difficult for me ; i find it easy to play an important part in most group or individual situations . in the long run , we as voters are responsible for bad government on a local or national level ; it is difficult for people to have much control over things politicians do in offices . a total index score for the 30 items was obtained with scores ranging from 30 to 150 . measure of self - esteem ( sei : ) this inventory was used to measure self - esteem as a global and stable disposition . this inventory was used to measure self - esteem as a global and stable disposition . physical functionphysical function was assessed by means of a single item taken from the physical function mobility index inquiring about one 's ability ( yes / no ) to climb one flight of stairs without help . this one - item question was intended to seek information on physical fitness.it should be noted that all measures administered to the participants were formatted in terms of language and structure appropriate for adults having a ninth - grade education . all paper - and - pencil tests and self - report measures used in the study were previously piloted on a volunteer group of 20 men and women aged 60 to 80 years . subsequent modifications were made in the instructions and illustrations given for responding to the five - point ratings of test items . this procedure was undertaken to ensure that even those participants who were elderly and had relatively limited education could validly complete the measures . physical function was assessed by means of a single item taken from the physical function mobility index inquiring about one 's ability ( yes / no ) to climb one flight of stairs without help . it should be noted that all measures administered to the participants were formatted in terms of language and structure appropriate for adults having a ninth - grade education . all paper - and - pencil tests and self - report measures used in the study were previously piloted on a volunteer group of 20 men and women aged 60 to 80 years . subsequent modifications were made in the instructions and illustrations given for responding to the five - point ratings of test items . this procedure was undertaken to ensure that even those participants who were elderly and had relatively limited education could validly complete the measures . advanced old age is commonly associated with an increase in disabilities , higher rates of health care use , and higher need for social support . thus , we felt the need to examine further fluctuations in risk of mortality after controlling for health - related covariates , which were assessed as follows : survey of number of visits to health providersas a part of a separate survey , respondents listed the number of visits that they had paid in the previous year to health providers , including visits to family physicians , community health clinics , and emergency health units , including hospital visits . as a part of a separate survey , respondents listed the number of visits that they had paid in the previous year to health providers , including visits to family physicians , community health clinics , and emergency health units , including hospital visits . iadl index of disabilitywe based this index on the self - reported ability for 12 daily living activities included in the iadl . respondents were asked to indicate whether they had experienced limitations in 12 areas of functioning with responses coded ( 1 ) for yes and ( 0 ) for no , for example , able to use a telephone ; boarding a bus without assistance ; lifting or carrying groceries ; personal grooming and personal hygiene care ; doing light house work ; taking medications ; walking one block . all the items were summed to form one index of iadl , with scores ranging from 0 to 12 . we based this index on the self - reported ability for 12 daily living activities included in the iadl . respondents were asked to indicate whether they had experienced limitations in 12 areas of functioning with responses coded ( 1 ) for yes and ( 0 ) for no , for example , able to use a telephone ; boarding a bus without assistance ; lifting or carrying groceries ; personal grooming and personal hygiene care ; doing light house work ; taking medications ; walking one block . all the items were summed to form one index of iadl , with scores ranging from 0 to 12 . measure of satisfaction with family and social supportsocial satisfaction was assessed with 10 items adapted from zimet et al . . participants rated how satisfied they were with their social partners in general , and how satisfied they were with their family and relatives on a rating scale ranging from 1 ( very dissatisfied ) to 3 ( very satisfied ) . participants rated how satisfied they were with their social partners in general , and how satisfied they were with their family and relatives on a rating scale ranging from 1 ( very dissatisfied ) to 3 ( very satisfied ) . we assessed the internal consistency of each trait scale with cronbach 's coefficient alpha and the association of the scales with each other and with other covariates by means of pearson correlation coefficients . for all analyses , differences between survivors and decedents on the date of final censoring were assessed with t - tests and chi - square tests of association . cox proportional hazard models were fitted to estimate the importance of each predictor of mortality . it is important to note that cox regression , or the proportional hazards model , is a well - recognized statistical technique for survival analysis which is concerned with studying the time between entry to a study and a subsequent event such as death , as is the case in the present research . cox regression has the advantage that it allows for the simultaneous exploration of the relationship between survival of persons and several explanatory variables ( in our case variables such as cognitive beliefs , future time perspectives , control and trust , etc . ) . of particular relevance and interest to our research is that the technique allows for age adjustment of the calculated hazard ratios across a wide range of ages , as was the case in our study . , by stephen j. walters , a haywood group plc publication , may 2003 , accessible online at http://www.whatisseries.co.uk/whatis/pdfs/what_is_cox_model.pdf ) ; see also g.d . garson , statnotes , north carolina state university , online at http://faculty.chass.ncsu.edu/garson/pa765/cox.htm ) for details of statistical procedures for achieving adjustment for the effect of age as a covariate . the cox regression model assumes that the death rate of the population depends on a continuous time variable , which in the present study was the interval between the wave 1 assessment and date of death , calculated in terms of total number of days . in the present study , predictor variables included beliefs in a just society ( bjw : self and others ) , future time perspective ( ftp ) , future self - continuity ( similarity / caring ) perspective ( fsc ) , demographic variables , and health and physical functioning variables . the initial risk ratios ( irrs ) ( frequently referred to as hazard ratios ) are calculated by exponentiating the beta weight for the predictor , and regressions are expressed in risk ratios and 95 percent confidence intervals . all cox regression hazard ratios ( irrs ) presented in the present analyses were first adjusted for age . in subsequent analyses , we controlled for three health - related covariates ( see for significance of studying health variables ) . results are reported in two sections corresponding to our two main research questions . in the first section , we examine key differences between survivors and decedents in baseline characteristics of participants . in specific , we conducted cox regression analysis of risk rations of mortality to estimate the relative risk of death and the importance of each predictor of mortality for the whole sample . all variables entered in the cox regression analysis were entered as continuous variables for these analyses . in the second section , we present additional analysis of data where we were unable to derive easily interpretable results from using cox regressions of continuous variable data . subsequently , we analyzed the data using categorical variables that we considered were appropriate for the otherwise continuous variables . four hundred and forty participants were followed starting in december 2000 when baseline assessments were completed . as of december 2007 , after an average of 6.5 years of observation one hundred and forty ( 32 % ) deaths had occurred , and 300 ( 68 % ) survived . table 1 provides crude data at baseline on the two subgroups of decedents and survivors . those who died during the study period were somewhat older . among health - related variables , the respondents in the two groups were quite different with respect to physical function scores , but not with respect to number of medical visits reported at time of baseline assessment , or in respect of number of disabilities reported on the iadl index ( see table 1 ) . survivors compared to decedents had significantly higher scores on measures of beliefs in just world ( bjw - self ) , on the future time perspective ( ftp ) and future self - continuity / caring for the future self ( fsc ) perspective scale . by contrast , decedents compared to survivors had significantly higher scores on the measure of distrust on the interpersonal and society scale and on the control scale . first , we examined the intercorrelations of measures of beliefs in a just world ( bjw ; self and others ) , future time perspective ( ftp ) , future self - continuity perspective ( continuity / caring for future self ) , trust ( agreement with trust items and agreement with distrust items ) and control with one another , and with demographic variables ( age and education ) , and baseline indicators of number of medical visits , iadl disability , and satisfaction with social support . as expected , the two scales of bjw were positively related to each other , with correlations ranging from .41 to .64 ; p .001 . overall , the bjw - self scale , the ftp scale , and fsc scale were positively correlated with one another , with correlations ranging from .34 to .68 ; p .001 . in general , the bjw , ftp , fsc , and trust measures were not correlated significantly with demographic variables of age and education . the one notable exception , however , was that the distrust measure was significantly correlated with age and education , with correlations ranging from .34 to .39 ; p .001 ( note : the detailed table of correlations is available from the authors on request ) . table 2 provides psychometric information on the predictor variables for mortality risks selected for the research . examination of the mean scores for the various scales for which baseline data were obtained shows that the mean score of the control scale ( 80.1 ) was quite elevated when considered within the context of validity norms outlined in paulhus . however , the mean scores for the bjw , ftp , fsc . trust and distrustthe internal consistencies of the various trait measures as reported in table 2 are consistent with and converge appropriately with internal consistencies reported for the various scales elsewhere ( see ) . when cox proportional hazard models adjusted for age were fitted to estimate the relative risk of death and the importance of each predictor of mortality for the whole sample of 440 participants , the findings showed that bjw ( self ) , ftp , and fsc were positively and significantly related to reduced risk of mortality . in other words , scores on these measures were inversely related to risk of mortality , and associated with a significantly reduced risk of mortality . as seen in table 3 , bjw ( others ) , trust , self - esteem , and social support satisfaction were associated with a rather weak or marginal reduction in risk of mortality . by contrastwe conducted a hierarchical regression analysis ( n = 440 ) in order to examine further the relative contribution of the variables to risk of mortality ( table 4 ) . this analysis revealed the ability of bjw - self to predict risks of mortality over and above other predictor variables . as seen in table 4 ( model 1 model 2 ) , results clearly show that adding the cognitive beliefs of bjw ( self ) variable separately contributed to the explanation of variance in mortality risks significantly and uniquely , over and above that offered by the three variables of ftp , fsc , and distrust . in other words , the results in table 4 confirm that bjw ( self ) predicts an association with significant reduction in mortality risks independent of the other predictor variables . this rules out the sceptical view that the ability of bjw - self to predict outcomes is an artifact of correlations with other factors previously associated with outcomes of bjw , for example , control or trust . additionally , we conducted a preliminary examination of how deaths were distributed across low , average , and high trait standard scores . the proportionality assumption is violated when the relative risk of the outcome does not change in the same manner for equivalent changes in the levels of a risk factor or covariate . categorical variables may then be appropriate for an otherwise continuous variable and predictors may be trichotomized based on broad cut - off points . although trichotomization may reduce statistical power , it has the possible advantage that trichotomized domain scores will be more readily interpretable . accordingly , following scores on each of the predictor variables ( converted to standard scores ) , tertiles were computed for each of the predictor variable subscale measures . we plotted survival curves showing specifically and with greater focus on the relationship of predictor variables to mortality , with survival rates plotted for extreme high scorers ( at 67th percentile and above ) and extreme low scorers ( at 33rd percentile and below ) . four survival curves of particular interest and relevance to our research hypotheses are portrayed in figures 1to 3 . figure 1 showing the survival curve for beliefs in a just world ( bjw - self ) suggests that individuals with extreme high scores ( at 67th percentile and above ) on this dimension are at significantly reduced risk for mortality compared to individuals with extreme low scores ( at 33rd percentile and below ) . the percentages for those who survived in the two groups are 79.6 % and 70.7 % percent , respectively , indicating a 9 % difference in mortality . the ratio of fractions of decedents to survivors ( 10.707 ) / ( 10.796 ) = 1.433 ( see figure 1 ) suggests a 43.3 % lower risk of death for extreme high scorers compared to extreme low scorers . the findings from the survival curve presented in figure 1 further confirm the predictive ability of this measure seen earlier in table 3 where bjw - self was used as continuous variable in the cox regression analyses . figure 2 ( a ) showing the survival curve for future time perspectives ( ftps ) suggests that individuals with extreme high scores on this dimension ( at 67th percentile and above ) are at a significantly reduced risk for mortality compared to individuals with extreme low scores ( at 33rd percentile and below ) . the percentages for those who survived in the two groups are 81.6 % and 74.8 % percent , respectively , indicating a 7 % difference in mortality . the ratio of fractions of decedents to survivors ( 10.748 ) / ( 10.816 ) = 1.370 ; ( see figure 2 ( a ) ) suggests a 37.0 % reduced risk of death for extreme high scorers compared to extreme low scorers . the findings from the survival curve presented in figure 2 ( a ) further confirm the predictive ability of this measure seen earlier in table 3 where future time perspective was used as continuous variable in the cox regression analyses . figure 2 ( b ) showing the survival curve for future self - continuity perspectives ( fscs ) suggests that individuals with extreme high scores ( at 67th percentile and above ) on this dimension are at a significantly reduced risk for mortality compared to individuals with extreme low scores ( at 33rd percentile and below ) . the percentages for those who survived in the two groups are 79.6 and 74.1 percent , respectively , indicating a 5.5 % difference in mortality . the ratio of fractions of decedents to survivors ( 10.741 ) / ( 1 - 0.796 ) = 1.267 ( see figure 2 ( b ) ) suggests a 26.7 % reduced risk of death for extreme high scorers compared to extreme low scorers . the findings from the survival curve presented in figure 2 ( b ) further confirm the predictive ability of this measure seen earlier in table 3 where the future self - continuity perspective measure was used as continuous variable in the cox regression analyses . conversely , the survival curve for distrust ( figure 3 ) suggests that individuals with extreme high scores ( at 67th percentile and above ) on this dimension , compared with those with extreme low scores ( at 33rd percentile and below ) , are at a significantly increased risk for mortality . the percentages for those who survived in the two groups are 80.3 % and 74.8 % , respectively , indicating a 5.5 % difference in mortality . the ratio of fractions of decedents to survivors ( see figure 3 ) ( 10.748 ) / ( 10.803 ) = 1.276 suggests a 27.6 % higher risk of death for extreme high scorers on distrust , compared to extreme low scorers . the findings from the survival curve presented in figure 3 further confirm the predictive ability of this measure seen earlier in table 3 where the distrust measure was used as continuous variable in the cox regression analyses . to sum up the results , when the tertile split analysis was done , bjw ( self ) , future time perspectives ( ftps ) and future self - continuity perspectives ( fscs ) were found to be differentially associated with mortality risks . when bjw ( self ) scores , future time perspective scores , and self - continuity or similarity with the future self scores were extremely low ( 33rd percentile and below ) , mortality risk was significantly greater , compared to extremely high scores on these measures ( 67th percentile and above ) . however , the variable of distrust revealed a somewhat contrasting pattern in the tertile analysis . when distrust scores were extremely low ( 33rd percentile and below ) , mortality risk was significantly lower , compared to extremely high distrust scores ( 67th percentile and above ) which were associated with an increase in mortality risk . in a separate set of regression analyses , we explored the influence of three health - related covariates ( table 5 ) . these analyses were intended mainly to see whether differences in cognitive predictors of mortality would be maintained after controlling for three health - related covariates assessed at baseline : ( 1 ) number of visits in the previous year to medical practitioners and health providers , ( 2 ) total index score for the measure of disability ( iadl ) in daily life activities , and ( 3 ) total score for self - rated satisfaction with family and social support . initially , these health - related covariates were controlled for one at a time , using a cox regression analysis procedure . we then re - ran the analysis using multiple regression , adjusting for the covariates ( table 5 ) . as seen in table 5 , the negative beta values for beliefs in a just world , future time perspective , future self - continuity , and social support satisfaction , and the significant f values observed in the multiple regression analysis are consistent with the direction of reduced risk ratios shown in the relative risk ( rr ) and 95 % confidence interval ( ci ) model ( table 3 ) . similarly , after adjusting for the covariates , the positive direction of the beta values and the significant f values for distrust in the multiple regression analyses is consistent with the direction of increased risk ratios for this variable in the relative risk ( rr ) and 95 % ci model . thus , overall , the relationship between cognitive beliefs about a just world , future time perspectives , and risks for mortality were maintained after adjusting for the health - related covariates . in other words , the direction of the association we saw in the earlier cox regression analyses ( table 3 ) between scores on cognitive beliefs , future perspectives , distrust , and risks for mortality remained unchanged after adjusting for the health - related covariates . in further analyses , we found no statistically significant interaction effects among the sociodemographic variables and health variables relating to the prediction of mortality . consistent with our hypothesis , our findings from the cox regression analysis of the predictor variable of bjw revealed that bjw is positively related to survival . additionally , our findings based on a hierarchical regression analysis of a two - model design show that the variable of bjw ( self ) had stronger ability than all other cognitive variables explored in this research to predict mortality risk . these findings lend weight to recent theory and research suggesting that the predictive power of bjw - self seems to derive uniquely from perceived justice and that most persons have a strong need to perceive the world to be just , a belief system that conceivably serves to protect their health and survival . our findings that high levels of beliefs about justice and fairness are early predictors of longer survival are consistent with our hypothesis . these findings advance and extend the assumptions of earlier researchers ' work on perceived justice and fairness as linked to better health and well being . our findings show that individuals ' concern that the world is just to themselves , as distinguished from others , is particularly predictive of their healthy survival . along with earlier researchers , we speculate that bjw for self contributes to a larger extent to individuals ' psychosocial adjustment , providing them with useful resources in times of stress , and correspondingly becomes linked with reduced risks of mortality . in our study , bjw ( others ) was not differentially linked with mortality risks . however , we can not conclude that bjw - self alone generates the link with reduced risk of mortality . consequently , the mortality correlates with bjw in the spheres of self and others remain to be determined more fully . overall we predicted that while time is finite and limited for all , an increased or more expansive or open - ended future time perspective would reduce the risk of mortality , based on a logical assumption that a more expansive view on time left may promote valuation of future plans to safeguard the future self and protect it against risks of mortality . consistent with our hypothesis , our findings from the cox regression analysis ( adjusted for age ) show that an expansive future time perspective is associated with a reduced risk of mortality for our older sample . our findings lend support to earlier postulates that the subjective sense of time plays an essential role in human motivation , and gradually time left becomes a better predictor than a range of other cognitive variables that contribute to behavioral and psychological processes at work in old age . the present direction of findings advances and extends assumptions of future time perspectives proposed by previous researchers ( e.g. , ) according to whom individuals ' perceptions of remaining time to live determines their potential for evaluating and shaping future time and future prospects concerning identity and health . extrapolating from our findings , we speculate that incorporating an expansive time horizon influences individuals to pay relatively greater attention in the time left to make pragmatic and more practical decisions concerning a healthier future life . additionally , we speculate that individuals in our sample who showed more expansive or open - ended time horizons at the time of baseline assessment would have already maximized attempts to preserve and protect future personal health and survival . however , our findings suggest that older adults ' perception of time left is linked rather nonspecifically with risks of mortality . it remains for future researchers to disentangle the specific psychological processes that link limited horizons of time left with increased risk of mortality . overall , we predicted that increased future self - continuity and caring for future self would reduce the risk of mortality , based on a logical assumption that increased future self - continuity perceptions may promote the valuation of future plans to safeguard the future self and to protect it against risks of mortality . consistent with our hypothesis , our findings from the cox regression analysis ( adjusted for age ) show that future self - continuity as a variable is associated with reduced risk of mortality . extreme high scorers on future self - continuity and caring for the future ( i.e. , individuals who perceived greater similarity between their present and future self ) , compared with extreme low scorers ( i.e. , individuals who perceived minimum similarity between their present and future self ) had a significantly reduced risk of mortality ( 37 % ) . although the present results can not specify the causal direction of the association between future self - continuity and reduced risk of mortality nor specify the health - related processes at work to explain this association , the research findings provide initial evidence that high similarity and high self - continuity with future self is a significant predictor of longevity . overall , our findings fit well with the philosophical analysis by parfit that individuals who feel similar to their future selves are more likely to make more prudent decisions for the future , including health - related decisions , because of their perceived close connectedness to the future self . alternatively , we speculate that individuals who perceived their current physical and mental health to be stable at the time of baseline assessments were also able to identify better with their future self as being one of healthy survival and , therefore , worth protecting . of particular interest , in the context of a longitudinal study , is the initial evidence that behavioral differences in longevity are driven differentially by perceived future self - continuity . our findings from the cox regression analysis , showing that high distrust predicted a significantly increased risk of mortality , are consistent with our hypothesis . these findings are not at variance with earlier theoretical proposals suggesting that historically older adults have had difficulty in accepting the status quo as defined by younger authorities in the social system and may tend to be more distrusting of those authorities . our findings suggest that extreme high levels of distrust which typified some individuals in our sample , compared with extreme low levels of trust , increased the risk of mortality by 27.6 percent . overall , the cox regression analysis revealed that distrust is empirically predictive of an increased risk of mortality . we speculate that high levels of distrust may be analogous to a form of pathological social isolation or breakdown in communications that leads to increased risk for physical and psychological disease . conceivably distrust becomes linked with a shorter life span . despite the novelty of our data , and thus the importance of their contribution to cognitive etiology of health - related processes such as survival , mortality , or longevity , our study was subject to the limitation that the sample was a volunteer one . our cognitive scale measures of beliefs in a just world , and other measures exploring individuals ' perspectives on future self - continuity and future time , trust and distrust were self - report measures and subject to the biases associated with self - report measures . the preceding sources of unreliability of measurement could potentially both reduce or increase the proportion of variance in the outcome variables for which our models were able to account . however , we are confident that we had a sufficiently large and representative sample of urban and rural older adults , and the measures we used showed high internal consistency . our study provided novel indications that cognitive belief systems and future time perspectives of older adults may have much to contribute to increased or reduced mortality risks in late life . thus , we suggest that basic cognitive beliefs and future time perspectives that were examined in the present research for their association with increased or reduced risk for mortality are an important direction for future research . it remains for future researchers to try to integrate these various cognitive factors into some kind of theoretical frameworks to gain a precise appreciation of how these factors may be causally linked with longevity . extrapolating from the findings of the study concerning the association between beliefs in a just world and the potentials for a longer survival , it may be reasonable to postulate that the findings have possible implications for clinical practice with older adults who may be dealing with traumatic life events such as life threatening illness , loss of loved ones , and other natural disasters . it is conceivable that these individuals may , as a result of adverse and stressful experiences , feel an abrupt decline in their beliefs in a just world or a decline in their faith or trust in interpersonal connectedness . it is suggested that clinicians be particularly mindful of clients who score extremely low on measures of bjw and future time perspectives . . similarly , those individuals scoring extremely high on measures of distrust and control may be at greater risk of mortality . by exploring with older clients their beliefs about a just world and their trust or faith in interpersonal connectedness , geriatric service providers and psychologists may be able to assist clients to develop a realistic self - profile of their sources of life strengths in relation to self - growth , resilience , and control over every day life situations . thus , clinicians may be able to assist elderly clients to draw on internal sources of strengths , such as reflecting on their beliefs about a just world and their beliefs about trusting others , as a means to strengthening and enhancing future self - continuity . based on our findings suggesting that individuals ' strong beliefs in a just world and positive perspectives regarding future time may possibly protect them against risk to mortality , geriatric service providers are encouraged to engage in a dialogue with their clients on these themes . such dialogues may not only serve to act as buffers for clients against stress and anxiety about the future , but may also assist clients in building up greater motivation for living . from a pragmatic standpoint , we postulate that interventions aimed at strengthening individuals ' beliefs in a just world at an earlier age , and encouraging future - self continuity in the earlier adulthood years , might motivate people to care more for their potential person in the later years , and conceivably keep people healthier longer and thereby reduce risk of mortality . similarly , communication programs that foster interpersonal and institutional trust or help older adults combat high levels of distrust ( which in our research were associated with significantly increased risk of mortality ) may be of value to a longer survival .\noutput:\n" }, { "from": "agent", "value": "on the basis of postulates derived from cognitive - behavioral theory , research and therapy , the authors explored the extent to which older adults ' cognitive beliefs of a just world and their perspectives on future time and similarity or self - continuity with the future self are predictors of long - term survival . after baseline assessment of health and cognitive beliefs and future perspectives of time and self - continuity as predictors of mortality , 440 participants ( ages 65 to 87 ) were followed longitudinally for 6.5 years . consistent with our hypotheses , findings demonstrated that a significantly higher percentage of survivors were individuals who showed higher scores on beliefs in a just world and on both the future time perspective and the future self - continuity perspective at the time of baseline assessments . conversely , mortality risk was much higher for individuals who scored low on these predictor variables , and high on distrust . implications for health and longevity are discussed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: actin - rich membrane protrusions such as filopodia and lamellipodia can guide the convergence of cells during the formation of complex signaling interfaces in vivo , for example , during synaptogenesis in the nervous system or the merging of epithelial cell sheets during development or wound healing ( mattila and lappalainen , 2008 ) . alternatively , extended ( 40 m ) parallel arrays of filopodia termed cytonemes ( cell threads ) observed in the drosophila embryo wing imaginal disk may function as cellularantennae that connect cells over large distances to regulate the detection and transport of morphogen ligands that determine tissue patterning ( ramirez - weber and kornberg , 1999 ) . in 2004 , pioneering video microscopy studies by the gerdes and davis labs revealed a novel variation on this theme : intercellular nanotubular highways . gerdes and colleagues described thread - like ( 50 - nm diameter ) connections linking cultured rat neuron derived pheochromocytoma 12 ( pc12 ) cells formed after the convergence of dynamic filopodia extending from neighboring cells ( rustom et al . they called these structures tunneling nanotubes ( tnts ) based on their apparent capacity to create a continuous channel between two cell cytoplasms , in analogy to plasmodesmata in plant tissues . remarkably , pc12 tnts supported a directional flow of surface - bound molecules , cytoskeletal elements , and even endosomal membranes from cell to cell . soon after , the davis group described similar membrane nanotubes linking cultured primary lymphocytes , including natural killer cells , epsteinunlike tnts , these nanotubes represented residual membrane tethers formed after the disassembly of tight cellcell contacts ( figure 1a , ( iii ) to ( ii ) ) and were proposed to provide motile lymphocytes with a mechanism for maintaining immune signaling over long distances ( onfelt and davis , 2004 ) . consistent with this notion , watkins and salter ( 2005 ) demonstrated functional connectivity between primary dendritic cells ( dcs ) in culture , showing that a calcium signal could be propagated through nanotubes among dcs separated by multiple cell lengths . mechanisms of cell cell nanotube formation , modes of transfer , and proposed roles in tissue homeostasis and the spread of infection . filopodial interplay ( ( i ) to ( ii ) ) involves the convergence of protruding filopodia from neighboring cells , followed by anchoring . dislodgement ( ( iii ) to ( ii ) ) involves the formation of residual tethers after the disassembly of tight cell cell contacts . nanotubes may mediate long - distance signaling or in some instances be precursors to the formation of more complex cell cell interfaces ( ( ii ) to ( iii ) ) . nanotubular linkages can be synaptic in nature and signal through ligand receptor interactions ( i ) or retain connectivity at a gap junction like interface maintained by connexons ( bow ties ) made up of hexamers of connexin proteins . gap junctions regulate a gated flow of ions or small molecules from cell to cell ( ii ) . to exchange larger cargoes , nanotube connections must either be open and membrane continuous ( iii ) or use an alternative mechanism of membrane exchange such as membrane engulfment / phagocytosis ( iv ) . infection and cell stress may signal the up - regulation of adhesive factors at the cell surface , for example , retroviral env glycoproteins ( i ) , that drive the formation of tight cellcell contacts ( e.g. , virological synapses ) or are extended to form nanotubes or filopodial bridges ( ( ii ) and iv ) ) . alternatively ( or possibly in addition to ) , cell signaling through the exocyst complex ( e.g. , in response to hiv - 1 nef expression or cell stress ) can induce the extension of membrane protrusions that reach out to bind neighboring cells ( ( iii ) and ( iv ) ) . induced nanotubular superhighways may function to promote the rapid intercellular spread of infection but could also promote the transit of cell - sustaining signals or cargoes ( iv ) . subsequently , tnts and related structures have been described in diverse ex vivo cell culture systems and implicated in the cell cell exchange of a wide variety of cargoes . attempts have been made to categorize nanotubes based on structure : for example , slender , type i tnts that are 100 nm in diameter and contain actin versus type ii tnts that are larger ( up to 1 - m diameter ) and contain both actin and microtubules ( onfelt et al . , 2006 ) . however , such categorization is now complicated by the broad heterogeneity of described tnt - like structures ( for excellent reviews see kimura et al . , 2012 ; we previously argued that an important distinction be made between structures that are tunneling ( i.e. , open ended and capable of transmitting an intracellular signal ) and linkages that are closed ended and more bridge - like or synaptic in nature ( sherer and mothes , 2008 ; see figure 1b ) . indeed , there is limited ultrastructural evidence that nanotubes are open ended , and a wide - open configuration would pose problems , such as how linked cells prevent cell cell fusion or maintain a cytoskeletal polarity ( cargo transit is frequently unidirectional ) . additional work by the gerdes group may resolve this issue , revealing that tnts formed by dislodgement in cultures of normal rat kidney ( nrk ) cells are , indeed , not open ended but gated ( wang et al . , 2010 ) . these structures accumulated the gap junction ( gj ) protein connexin 43 ( cx43 ) at their bases and , consistent with gj function , supported the transmission of an electrical signal from cell to cell ( figure 1b , ( ii ) ) . by contrast , classic tnts from pc12 cells formed by filopodial interplay did not contain cx43 and did not support electrical coupling . therefore neither nrk nor pc12 tnts are constitutively open - ended structures , and it is important to consider that many ( and perhaps the majority ) of described tnt - like linkages represent extensions of either synapse or gj biology ( e.g. , figure 1b , ( i ) and ( ii ) ) . if nanotubes are not open ended , then how do they support the transfer of bulky intracellular cargoes such as mitochondria and endosomes , as is now apparent in numerous studies ( see marzo et al . , 2012 ) ? indeed , such a process challenges the basic notion of cell autonomy and , if confirmed in vivo , might alter our perception of how tissues are maintained and suggest opportunities to design new cell - based therapeutic strategies . zhang and colleagues recently showed that oxidative stress or serum starvation can trigger selective nanotube formation between stressed and unstressed astrocytes , and they proposed that a nanotube - mediated directional flow of healthyintracellular cargoes from unstressed to stressed cells provided a cell - sustaining effect ( wang et al . while compelling , it is not clear how organelles can successfully breach two apposed plasma membranes . wang and gerdes ( 2012 ) have suggested three potential scenarios : 1 ) a tunnel and toll booth mechanism in which large cargoes await a transient opening of a fusion pore , 2 ) a carrier mechanism in which vesicles are secreted at the nanotube tip and taken up by target cells , and 3 ) a snatch and grab mechanism in which a portion of the nanotube is engulfed and endocytosed . mechanisms 1 and 2 would necessarily invoke novel modes of cell cell fusion and vesicle formation , respectively . mechanism 3 seems most likely , considering the fragile nature of nanotubes , as well as the propensity of cells to pull and tear at tightly apposed membranes ( figure 1b ( iv ) ) . however , a caveat is that endocytosed membrane would have to somehow accomplish back - fusion with the endosome to release its cargo into the cytoplasm . careful live - cell imaging coupled to electron microscopy will be essential to defining the determinants , as well as the frequency and success , of these organelle transplant operations . if nanotubular transport plays a role in tissue homeostasis , the corollary is that this mode of transfer can promote the spread of damaging or infectious cargoes , including prions , viruses , and bacteria . intracellular pathogens often exploit existing cell cell contacts or induce infected cells to form specialized structures in order to favor their cell cell transmission ( figure 1c ) . for example , we demonstrated that retroviruses , including the murine leukemia virus ( mlv ) and the human immunodeficiency virus type 1 ( hiv - 1 ) , drive the formation of nanotube - like filopodial bridges between infected and uninfected fibroblasts that provide for actin - dependent virion trafficking ( surfing ) of virions from cell to cell on the outer surface of membrane ( sherer et al . , 2007 ) . stable bridge formation required specific , high - avidity interactions between viral envelope ( env ) glycoproteins and receptor molecules on apposed cell surfaces . hiv - 1 infects cd4 t - cells and macrophages in vivo , and several reports have demonstrated nanotubes , related actin - rich structures , andvirological synapses that link infected and uninfected lymphocytes and likely contribute to the rapid spread of infection ( e.g. , sowinski et al . , 2008 ; rudnicka et al . , 2009 ; reviewed in sattentau , 2010 ) . that env expression is capable of promoting cell cell connectivity in vivowas emphasized by recent striking intravital multiphoton fluorescence imaging of hiv - 1infected t - cells in humanized mice by mempel and colleagues ( murooka et al . , 2012 ) . infected , motile t - cells in lymph nodes formed dramatic env - dependent membrane extensions connecting cells over distances sometimes 100 m . moreover , env - dependent connectivity was also recently confirmed for mlv - infected b cells and t - cells in living mice ( sewald et al . , 2012 ) . although the resolution of multiphoton microscopy did not discern nanotubes , viral surface glycoproteins are clearly capable of stimulating the formation of complex membrane networking in tissues . therefore the up - regulation of surface adhesion properties may serve as a general mechanism for stimulating nanotube formation during infection or in response to other signaling ( figure 1c , ( ii ) to ( iv ) ) . alternatively , viral infection or cell stress may promote nanotube formation by directly stimulating the extension of filopodial protrusions . for example , hiv - 1 infection induces the formation of filopodial or lamellipodial extensions in t - cells through the activity of the viral nef accessory protein ( nobile et al . , 2010 ; figure 1c ( iii ) ) . of interest , a recent proteomic analysis of nef - associated proteins revealed that nef interacts with several components of the exocyst complex , a cellular machinery that regulates both the secretory pathway and the extension of actin - rich cell surface protrusions ( mukerji et al . , 2012 ) . these findings have striking overlap to the recent identification of the cellular factor m - sec , the first cellular factor demonstrated to induce the de novo formation of nanotubes when overexpressed in cultured cells ( hase et al . , 2009 ) . m - sec activates the exocyst complex through ral gtpase signaling and is highly expressed in both dcs and macrophages . therefore it seems logical to determine whether hiv infection modulates m - sec expression or activity in infected cd4 lymphocytes , as well as to determine the general role of the exocyst pathway to hiv - 1 replication in vitro and in vivo . moreover , the extension of nascent filopodia by astrocytes in response to cell stress conditions ( as discussed earlier ) correlated with an up - regulation of m - sec expression and also required signaling through the tumor suppressor p53 and the akt / pi3k / mtor pathway . thus m - sec and the exocyst complex may be a common target of multiple prominent cell signaling pathways associated with infection , cell stress , and possibly cancer . induced nanotubes in these scenarios could , in theory , serve to rapidly mediate the exchange of either beneficial or detrimental cell cargoes ( figure 1c ( iv ) ) . stress - induced signaling and viral infection should continue to provide tractable systems for dissecting the molecular details underlying filopodial extension , the formation of nanotubular linkages , and how cargoes move from cell to cell . however , a core question remains : do nanotubes really play important roles in tissues in vivo ? nanotube - like structures were described in vivo for the first time relatively recently , originating from stromal dcs within the mouse cornea ( chinnery et al . , 2008 ) . these observations have now been reproduced with additional detail ( seyed - razavi et al . , 2013 ) . in addition , observations of nanotubes connecting cells in solid tumor explants may support the notion that nanotubes can fuel cancer ( lou et al . , 2012 ) . increased visual resolution in tissue preparations , as well as continuing progress in live - cell intravital systems , will be essential to achieving a realistic picture of nanotube structure and function in vivo . also , the identification of cellular factors regulating nanotube formation may provide opportunities for animal studies , for example , in p53 , m - sec , or exocyst - deficient mice . finally , it is important to consider that nanotubes may not be working alone either in vivo or in culture . for example , hiv - 1 nef expression also induces the secretion of nef - containing vesicular structures , including exosomes and microvesicles , likely by stimulating alternative functions of the exocyst complex . indeed , tissues are a sticky proposition ; studies of nanotubular linkages have provided important new concepts toward the goal of understanding the complexity of cell cell signaling in these dynamic environments .\noutput:\n" }, { "from": "agent", "value": "metazoan cells rapidly exchange signals at tight cell cell interfaces , including synapses and gap junctions . advances in imaging recently exposed a third mode of intercellular cross - talk mediated by thin , actin - containing membrane extensions broadly known as membrane or tunneling nanotubes . an explosion of research suggests diverse functions for nanotubular superhighways , including cell cell electrical coupling , calcium signaling , small - molecule exchange , and , remarkably , the transfer of bulky cargoes , including organelles or pathogenic agents . despite great enthusiasm for all things nanotubular and their potential roles in cell signaling and pathogenesis , key questions remain regarding the mechanisms by which these structures regulate directional cell cell exchange ; how these linkages are formed and between which cells and , critically , whether nanotubes are as prevalent in vivo as they appear to be in the incubator ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: orofaciodigital syndrome type - vi ( ofds - vi ) is a very rare autosomal recessive disorder distinguished from other types of ofds by cerebellar dysgenesis and manual central polydactyly with y - shaped central metacarpals . the syndrome was first reported by varadi , et al . in six children in an endogamic gypsy colony of hungary . ofds - vi is currently classified as one of the joubert syndrome - related disorders because of similar clinical presentation and presence of the molar tooth sign ( cerebellar vermis hypoplasia and brainstem anomalies ) on neuroimaging . here , we report , for the first time in india , a case of ofds - vi ( varadi papp syndrome ) with some additional merits like early diagnosis in the neonatal age and presence of several y - shaped meta - carpals . a 17 - day - old girl was admitted with chief complaint of episodic respiratory distress noted since the second day of her life . the baby was born out of nonconsanguinous marriage , by normal delivery at term , to a primigravida mother with an uneventful pregnancy , and cried immediately after birth . after her birth ( weight 2000 g ) in a rural hospital , congenital malformations were first noted . the family history was negative for congenital anomaly and mental retardation . on admission her weight was 1750 g ( sga ) , length 42 cm ( 5 centile ) , ofc 32 cm ( 5 centile ) , and respiratory rate was 42 / min with episodic panting type of respiration , with rate up to 100 / min lasting for 1 - 3 minutes , followed by apnea for 12 - 15 s without bradycardia or cyanosis . in addition , physical examinations revealed posteriorly rotated low set ears , prominent upper forehead , sublingual nodules , bimanual heptadactyly , bilateral hallucal polysyndactyly , and an accessory right postaxial toe , coarse crepitations on the right chest , and generalized hypotonia with diminished deep tendon jerks . the following investigations were done and found to be normal - routine blood and urine , serum crp , blood sugar , blood urea , sgpt , serum calcium , x - rays of pelvis and skull , abdominal ultrasonography , and echocardiography [ figures 1 and 2 ] . x - ray of the hands showed y - shaped right third , left fourth and left fifth metacarpals with bimanual central polydactyly , a right postminimus , and a left postaxial extra digit . x - rays of the feet showed duplication of the first metatarsal and hallucal phalanges , an extra epiphysis in the soft - tissue hallux between normal and accessory bony hallux and syndactyly of first three toes , bilaterally . mri of brain demonstrated a hypoplastic cerebellar vermis with a molar tooth sign ( which consists of deepened interpeduncular fossa , thickened superior cerebellar peduncles and hypoplasia of cerebellar vermis ) on axial image at the level of the isthmus . she was treated conservatively and episodic tachypnea - apnea gradually decreased at 1 month of age . the child was then discharged and advised to seek regular follow - up for further evaluation and possible supportive interventions . although advised , vep and baer test were not carried out . a chromosomal study ( conventional g - banding ) showed a normal karyotype ( 46 , xx ) . at 2 months of age , examination revealed growth failure ( weight 2500 g ) , feeding difficulty , hypotonia , absent social smile , poor visual fixation and occasional episodic tachypnea . x rays of the hands showing y - shaped right third , left fourth , and left fifth metacarpals mri - brain ( t2 flair ) showing cerebellar vermis hypoplasia with the molar tooth signin 1980 , varadi , et al . reported a syndrome of polydactyly , cleft - lip / palate , lingual lump , somatic and psychomotor retardation with autopsy evidence of absent cerebellar vermis in the proband . muenke , et al . , after adding three similar patients , first reviewed and delineated clinical features of ofds - vi . the authors pointed out that cerebellar anomalies ( vermis hypoplasia / aplasia or dandy walker variants ) are consistent findings in varadimanual central polydactyly , defined as a fully formed extra digit arising from an additional central metacarpal or from a bifid / y - shaped , usually , third metacarpal , was considered as the most frequent and specific diagnostic feature . in addition to central polydactyly , both postaxial and preaxial manual polydactyly are common , as are clinodactyly and syndactyly . oral findings commonly include lingual or sublingual - lump / nodules , oral frenula , and highly arched and / or cleft - palate . common facial features are cleft - lip , broad nasal tip / bridge , hypertelorism , epicanthic folds , abnormal eye movements , strabismus , and low set ears . episodic tachypnea , hypotonia and / or ataxia , growth failure , and deafness are often reported . hypogonadism and / or cryptorchidism with micropenis , hypoplastic epiglottis , aortic stenosis , hypothalamic hamartoma , and subcortical - heterotopias are also noted . our patient presented with all features consistent with the diagnosis of ofds - vi . however , orofacial features were minimal with the absence of cleft - lip / palate and abnormal ocular movements whereas the metacarpal findings were remarkable . the presence of several y - shaped metacarpals with a unique combination of involvement of third metacarpal on one hand and fourth and fifth metacarpi on the other was the remarkable feature of the patient . because of phenotypic overlap , pallister hall syndrome ( phs ) is considered as one of differential diagnoses . clinico - radiological features that distinguish the syndromes are bifid epiglottis , imperforate anus , insertional - polydactyly and lethal airway - anomalies in phs , and manual central polydactyly with cerebellar vermis hypoplasia in ofds - vi . moreover , by a molecular cytogenetic test , mutations in the gli3 gene are detected in approximately 95 % patients with phs . although most of the previously described patients with ofds - vi showed normal chromosomal study , recently , mutations in the tmem216 gene have been identified in two cases . oral frenula , lingual / sublingual nodule , and central polydactyly distinguish varadi papp syndrome from other subgroups of joubert syndrome - related disorders . despite the fact that varadipapp syndrome is very rare in india , an early accurate diagnosis is necessary for proper genetic counseling and prognostication . treatments are mainly symptomatic and supportive with reconstructive surgery for correctable malformations . prenatal diagnosis of the pregnancy at risk is possible and advisable , and termination of pregnancy is indicated as the prognosis is almost always poor either early death or survival with psychomotor retardation . orofaciodigital syndrome type - vi , a rare genetic disease with poor prognosis , should always be considered as a differential diagnosis in neonates presenting with episodic tachypnea especially if poly ( syn ) dactyly is present and meticulous orofacial examination should be done . evidence of central polydactyly of the hands and cerebellar anomalies in the presence of minimal orofacial manifestation establishes the diagnosis of the disorder .\noutput:\n" }, { "from": "agent", "value": "orofaciodigital syndrome type - vi ( varadi papp syndrome ) is a rare autosomal recessive disorder characterized by variable orofacial anomalies , central polydactyly of the hands , and cerebellar dysgenesis ( mainly hypoplasia or aplasia of vermis , rarely dandy waker anomaly ) . here a case of varadi papp syndrome with recurrent episodic tachypnea - apnea , minimal orofacial features , several y - shaped metacarpals , and cerebellar vermis hypoplasia , diagnosed in the neonatal age , is reported for the first time in indian literature . the importance of early accurate diagnosis of this rare disease for proper genetic counseling and prenatal case detection of pregnancy at risk is also emphasized as the prognosis is poor in almost all cases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: babesiosis is a tick - borne disease , caused by protozoa of the genus babesia , with a worldwide distribution . babesia are intraerythrocytic , vector - borne organisms with numerous canine babesia species reported in the world , namely , babesia canis , babesia rossi , babesia vogeli , babesia gibsoni , and the microbabesiae babesia microti , babesia vulpes sp . babesia canis , b. rossi , b. vogeli , and b. gibsoni are reported , with no report of the microbabesiae . there also exists one yet unnamed babesia species that was reported in north america . the most common clinical signs associated with babesiosis are anorexia , fever , depression / lethargy , pale mucosae , splenomegaly , and weight loss . clinical presentation of canine babesiosis differs with geographic regions and babesia species involved . unusual clinical presentations of canine babesiosis that include central nervous system associated signs such as seizures have also been reported . in africa , there is limited published data on canine babesiosis and outwith south africa and nigeria there are even fewer published data available . there are numerous factors that affect the prevalence of canine babesiosis , and studies with b. canis have shown that pure - bred dogs , animals under one year of age , and dogs that had previously suffered from babesiosis or have not had prophylactic ectoparasite treatment are more prone . coinfection of babesia with other canine vector - borne diseases occurs and often leads to atypical clinical signs and presentations . clinicopathological pictures in babesia cases include regenerative anaemia , thrombocytopenia , and leukopenia ( neutropenia and lymphopenia ) initially after infection , soon followed by leukocytosis and neutrophilia with a left shift a few days after infection . chronic cases of canine babesiosis tend to present a more obscure range of clinical signs . babesia rossi is hypothesised to have a polymorphic phosphoprotein named the babesia rossi erythrocyte membrane antigen 1 ( brema1 ) gene that may be responsible for virulence . this may explain some of the differences in clinical presentations in dogs infected with this species . imidocarb dipropionate , diminazene aceturate , clindamycin , and doxycycline are efficacious . however , in cases of infection with small babesia species , clinical and parasitological cure are often not attained and relapses are reported frequently . supportive treatment is usually given and includes fluid therapy , anti - inflammatory and antipyretics , gastroprotectants , oxygen supplementation , and blood transfusion . in experimental babesia infection , clinical recovery has been shown with supportive treatment only , highlighting the importance of this aspect of the case management . control involves the use of topically applied acaricides to eliminate the tick vector and may also include novel methods like acaricide - impregnated collars . the prophylactic use of imidocarb when animals move into endemic areas can also be done . vaccination against babesiosis has been developed that induces partial protection against the disease by reducing severity of clinical signs , parasitaemia , or duration of clinical disease . however , as with vaccination , most current prophylactic measures are considered insufficient for complete protection . in zambia , a pilot study was carried out to determine the epidemiology of canine babesia infections in laboratory samples and natural populations ; the study showed that canine babesia is of the large - type and has a mean monthly prevalence of up to 28.6 % and 2.4 % , respectively , with two seasonal peaks in the rainy season and the cool dry season . a recent molecular study in wildlife anddomesticated dogs around wildlife reserves in zambia found babesia species in wild carnivores , but no babesia in domestic dogs . despite the fact that knowledge of the clinicopathological manifestation of a disease such as babesiosis has epidemiological and medical importance , there is no published literature on the clinicopathological presentation of babesia in dogs in central africa . the aim of this follow - up study was to document the clinical signs , haematological profiles , molecular speciation , and case management options in naturally occurring canine babesiosis in zambia . a mixed , retrospective , and prospective study of clinical cases of babesiosis was carried out . cases were conveniently sampled and the inclusion criteria were dogs with complete , well - documented medical records , those that tested positive for babesia on blood smear examination and had complete haematological profile . clinical records from the veterinary clinic , school of veterinary medicine , university of zambia , and two private veterinary practices in lusaka for dogs that met the inclusion criteria were considered in this study . dogs that had other diagnosed concurrent diseases or incompletely documented medical records were excluded from the study . information on signalment , presenting problem , clinical signs , haematological findings , case management / treatment regimens , and case outcomes were documented . data capture forms were filled in by veterinary clinicians for all cases that were clinically suspected to have the canine vector - borne disease commonly diagnosed as tick fever . blood collected by cephalic venipuncture was subjected to laboratory analysis as described previously and dogs were classified as anaemic based on a modification of the classification criteria of reyers et al . dogs with pcv less than 15 % were considered as severely anaemic , and those with pcv 1530 as moderately anaemic , those with pcv 3037 as mildly anaemic , and those with pcv 37 % as nonanaemic . those that were positive on blood smear examination and had complete haematology performed were included in the study . ticks were also collected from each dog , placed in a plain 10 ml serum tube with 70 % ethanol , and identified to genera level using the key by soulsby . sixty - two babesia - positive cases from the prospective study had their blood spotted on whatman fta cards for subsequent dna extraction and babesia species identification by seminested pcr using the method and primers used by birkenheuer et al . . the primary pcr amplified an approximately 340 - base - pair ( bp ) fragment from b. gibsoni ( asian genotype ) and b. rossi . the secondary pcr using the specific internal primers for b. gibsoni ( asian genotype ) ( bgibasia - f ) and b. rossi ( bcr - f ) were paired with the outer reverse primer of the primary pcr to amplify 185 bp and 197 bp amplicons , respectively . pcr products were visualised in a transilluminator after electrophoresis in a 1.5 % agarose gel containing 0.2 g midori green . data were entered into a microsoft excel spreadsheet , verified for correctness , and imported into minitab version 14 for statistical analysis and graphing . from the 412 medical records of cases diagnosed as positive for babesia on blood smear examination , 363 were included in the study having satisfied the inclusion criteria . the others were excluded from the study mostly because they either did not have a complete haematology profile and diagnosis was reached using a blood smear only or had incompletely filled in clinical records or data capture forms . records for 363 patients were analysed and the most represented dog breeds were mongrels ( 32.2 % ) and maltese poodles ( 16.3 % ) whilst the shar pei and boston terrier were the least represented ( table 1 ) . seventeen distinct exotic pure breeds and two other classes ( pure - breed crosses and local breed / mongrels ) were included . thus , the exotic dogs and their crosses put together made up the largest proportion of dogs diagnosed with babesia ( table 1 ) . male dogs made up the majority ( 64.5 % ) of the study subjects ( figure 1 ) . exact age was determined in 89 % ( 323/363 ) of the dogs using the record inoculation card and ranged from two months to eight years ( median age 18 months ) . as shown in figure 1 , dogs between two and five years made up the largest proportion ( 29.47 % ) , followed by those in the six - month to one - year age bracket ( 22.11 % ) . dogs older than 5 years were the smallest group including one male dog that was more than 10 years old . the dogs whose exact ages could not be determined were only classified as adult dogs . the main problems reported by the owners were anorexia ( 65.3 % ) , depression / lethargy ( 65.3 % ) , and weight loss ( 20.4 % ) . the most common clinical signs were fever ( 87.3 % ) , pallor ( 52.3 % ) , and lymphadenopathy ( 47.4 % ) . 37c ) . there was no significant difference in rectal temperature between local breed and exotic dogs ( anova : f1 , 319 = 0.04 ; p = 0.84 ; exotic mean temperature sd = 39.581.04 , mongrel mean temperature sd = 39.620.92 ) . forty - five percent of the dogs were infested with ticks mainly of the genus rhipicephalus . other clinical signs / problems observed included vomiting , splenomegaly , dehydration , jaundice , and ascites . two cases presented with severe epistaxis . only a single case showed seizures with polyuria / polydipsia . there was a weak positive significant correlation between pcv and rectal body temperature ( r = 0.231 , p = 0.017 ) . pcr reaction was able to differentiate b. gibsoni ( asian genotype ) as a single infection in 32.2 % ( 20/62 ) and b. rossi as a single infection in 8 % ( 5/62 ) of the samples . most ( 37/62 ; 59.7 % ) of the other samples had a mixed infection . the most consistent haematological abnormalities were anaemia ( 96.4 % ) , nucleated erythrocytes ( 42.2 % ) , and hypochromasia ( 34.7 % ) . the anaemia was hyporegenerative , normocytic , and normochromic in 65.3 % of the cases ( table 3 ) . overall mean pcv was 18.4 % ( sd , range ; 9.2 , 5.049.0 ) and overall mean hb was 6.4 g / l ( sd , range ; 3.04 , 114.1 ) . severe anaemia was seen in 55.1 % of dogs , whilst 33 % showed moderate anaemia , 8.0 % showed mild anaemia , and 3.6 % were nonanaemic ( figure 3 ) . there were also no differences in proportions of dogs showing severe anaemia by age class ( figure 3 ) . however , only the age groups between three months and two years had some babesia - positive dogs with no signs of anaemia , whilst in the other age groups they were all anaemic ( figure 3 ) . dogs with single infections with b. rossi had lower pcvs and hb levels , followed by those with a single infection with b. gibsoni . dogs with concurrent infection with both b. gibsoni and b. rossi had higher pcvs and hbs than those with single infections of either , but the differences were not significant ( anova : f2 , 60 = 2.03 ; p = 0.15 ; b. rossi mean pcv sd 10.671.53 ; b. gibsoni mean pcv sd 16.116.81 ; mixed infection pcv sd 20.159.94 ) ( figure 4 ) . thrombocytopenia was observed in 17.1 % of the cases . there were no statistical differences in pcv between mongrels and exotic breeds and their crosses ( anova : f1 , 362 = 0.02 ; p = 0.876 ; exotic mean pcv sd 18.288.94 , mongrel mean pcv sd 18.59.62 ) . imidocarb dipropionate together with doxycycline was the most commonly used specific antiprotozoal injectable treatment ( 51.0 % ) followed by doxycycline only ( 24.0 % ) and imidocarb dipropionate only ( 5.5 % ) , and only 0.8 % ( 3/363 ) of cases were managed with diminazene as an antibabesial drug ( table 4 ) . approximately sixty percent ( 219/363 ) were treated with a 1021 - day course of oral doxycycline at 10 mg / kg body weight twice a day . adjunct immunosuppressive treatments were given to some dogs ( a total 37.4 % given dexamethasone injection , 5.1 % ( 20/363 ) via injectable dexamethasone and oral prednisolone , and 1.4 % ( 5/363 ) given oral prednisolone only ) . blood transfusions were performed in 1.9 % ( 7/363 ) of the cases with six of the seven cases being the hospitalised ones . approximately 27 % ( 97/363 ) of the dogs were given topical ectoparasitic treatment that included dipping ( 11.6 % ) , spot - on treatments ( 8.5 % ) , and sprays ( 6.6 % ) . of the dogs diagnosed with babesia , 41.9 % ( 152/363 ) were hospitalised , whilst the rest were treated on an outpatient basis . hospitalisation was on average 1.742.15 days and ranged from mostly overnight observation to a maximum of 21 days . there was no significant difference in the proportion of anaemia and pcv in dogs that were hospitalised and those that were not ( anova : f1 , 362 = 5.25 ; p = 0.030 ; hospitalised mean pcv sd = 15.366.18 , outpatient mean pcv sd = 21.367.60 ) . hospitalised dogs were more likely to be the ones given a blood transfusion than outpatient cases ( = 5.636 , df = 1 , and p = 0.018 ) noting the caveat that the outpatient group only had one blood transfusion case , which is less than the minimum five normally recommended for the chi - square test . the present study describes the clinical signs and case management of naturally occurring babesiosis in zambia . the study represents the first systematic investigation of the clinicopathological presentation of canine babesiosis in this region as well as reporting for the first time the species of babesia found in domestic dogs in zambia in correlation to clinicopathological data . the study presents new information about the clinicopathological presentation of canine babesiosis and the babesia species involved , namely , b. gibsoni and b. rossi . although the lack of positive cases in domestic dogs in a recent molecular survey in zambia may be ascribed to regional differences between the central part of zambia and the eastern and western regions where the recent study was conducted . the aforementioned study also had a sample size of only eight domestic dogs sampled , which may have an effect on the results , taking into consideration the low prevalence of babesia in natural domestic dog populations in zambia of 2.4 % . a similar low canine babesia prevalence of 3.8 % was also reported in cape verde . a more widespread investigation using a larger number of dogs from all around the countrywould be more desirous in order to comprehensively document clinicopathological presentation of this disease and determine if there are regional differences in babesia prevalence that may be ascribed to differences in babesia parasites species or vector distribution as has been shown by other researchers . the most common clinical problems for dogs with babesia in this study were fever , depression , pallor , lymphadenopathy , and the presence of ticks . fever was a consistent finding in dogs with babesia infections in this study with 87.3 % having fever and 47.4 % exhibiting lymphadenopathy . a high proportion of dogs in this study presented with a fever of more than 40c which is similar to the fever of 40.4 c as described by casapulla et al . in a b. gibsoni , who found changes in urine colour and haemoglobinuria , respectively , as being a prominent clinical finding , and the single unusual case by demeter et al . that presented with haemoglobinuria , this study did not have a case presenting with haemoglobinuria . this , however , could be due to the fact that this clinical sign is not commonly seen due to the fact that urine is not passed , neither is it collected at each and every clinical examination . further , most owners may not be very observant or may not see the dog passing discoloured urine and therefore the finding may be underreported . microscopic haemoglobinuria may have also been present in the absence of grossly visible macroscopic haemoglobinuria . most dogs were infested with ticks of the genus rhipicephalus and there were no statistical differences in infestations between male and female dogs . the higher prevalence of genus rhipicephalus is similar to findings by abd rani et al . in india that also has a tropical climate like zambia . notwithstanding this fact , a number of animals presented with babesia without any ectoparasites and a history of consistent tick control . this could be attributed to modified history proffered by owners due to a possible guilt - feeling combined with a possible recent deticking , prior to presentation to a veterinary practice , by the owners when animals appeared to be falling ill . however , a similar finding of approximately only half of the animals being diagnosed with babesia infection being infested with ticks was reported by cardoso et al . in portugal . in a similar vein , in the prospective study , a number of animals that were clinically suspected to have babesiosis by clinicians were microscopically negative for babesia . this could be due to a number of reasons : the inherent low sensitivity of the blood smear microscopy compared to molecular biological tests like pcr ; parasitaemia is also transient in infected animals , particularly early in infection , and low and not detectable in chronic cases . however , since the study was designed to describe the clinicopathological findings in babesia - positive dogs , the only drawback was the reduced sample size due to possible false - negatives arising due to the aforementioned reasons . the use of pcr would have likely led to a larger sample size . anaemia , nucleated erythrocytes , and thrombocytopenia have been demonstrated as consistent laboratory findings in canine babesiosis by numerous researchers and this study also revealed that anaemia is consistent in dogs with babesia but thrombocytopenia was only seen in less than one - fifth of the dogs . overall the clinical - pathological findings from this study are comparable with findings by many researchers such as ruiz de gopegui et al . other than the haemoglobinuria which was not observed as a prominent clinical sign in this study . this study would seem to indicate that single infections with b. rossi or b. gibsoni give more severe haematological results than mixed infection . other researchers have also described babesia species coinfections but also state that it is difficult to ascribe clinical signs to a single specific agent . similar to salem and farag more male dogs than female were captured in this study . differences between local breed dogs and exotics have been demonstrated where the exotics were more prone . this study , however , did not show any differences in clinicopathological findings between the two groups . , this study also found that dogs less than one year were more prone to infection with babesia . our study shows that more animals have coinfection with both b. gibsoni and b. rossi and only a few have a single infection with either species . this is in contrast with findings of coinfection with b. canis and b. vogeli by manzillo et al . in italy and kamani et al . with b. canis and b. rossi in nigeriathe proportion of coinfections in this current study is , however , higher than reported by adamu et al . in nigeria . there was a higher proportion of dogs with b. gibsoni as a single infection than those with b. rossi as a single infection . due to the fact that most animals had coinfections it was difficult to ascribe clinical signs and haematological abnormalities to a single babesia species . other researchers in africa and cape verde did not find b. gibsoni and in south africa it is only reported in an imported dog . babesiosis may be classified as complicated or uncomplicated with complicated babesiosis manifesting as an acute , serious life - threatening disease . the findings from this study , therefore , demonstrate that the canine babesiosis in zambia is less virulent / acute and possibly classified as uncomplicated than that described in south africa . however , the increased trade in dogs originating from south africa increases the possible risk of introduction of more virulent strains of babesia into zambia since travelling dogs have been shown to introduce babesia pathogens in germany and south africa . b. vogeli that has been reported in south africa , egypt , and cape verde has not been reported in zambia . the limiting factor in this study was the fact that the primers used in this study were not specific for b. vogeli . further , the south african study did not report mixed infection between b. rossi and b. vogeli , but our study demonstrated a high proportion of dogs with a mixed infection of b. rossi and b. gibsoni . patterns of drug use also demonstrate changing trends with diminazene that was being used during the earlier part of the decade seldom being used with most practices exclusively using imidocarb dipropionate as the antibabesial drug of choice . no other anti - babesia drug such as clindamycin and quinine , and atovaquone - azithromycin , reported in literature was used in the cases in the study . in conclusion , this study highlights the species of canine babesia present in zambia as well as the clinicopathological findings in canine babesiosis . it also highlights differences between canine babesiosis disease presentation in zambia and other countries in the subregion .\noutput:\n" }, { "from": "agent", "value": "a retrospective and prospective analysis of clinical records of dogs diagnosed with babesia infections was carried out for the years 2000 to 2013 from practices in lusaka , zambia . records of 363 dogs with confirmed babesia infections were analysed using demographic factors including sex , breed , age , and clinical signs in relation to haematological findings and babesia species . the clinical and laboratory findings observed are described as well as babesia species identification . the study included 18 breeds and the highest proportion were mongrels ( 32.2 % ) , males representing 64.5 % of the population . the most common presenting problems were anorexia ( 65.3 % ) and lethargy / weakness ( 65.3 % ) . the most common clinical signs were fever ( 87.3 % ) , pallor ( 52.3 % ) , lymphadenopathy ( 47.4 % ) , and presence of ticks ( 44.9 % ) . anaemia ( 96.4 % ) and nucleated erythrocytes ( 42.2 % ) were the most common laboratory findings . a mixed infection of babesia rossi and babesia gibsoni was present in 59.7 % of dogs , whilst 8 % and 32.2 % had b. rossi and b. gibsoni as a single infection , respectively . case management mainly involved therapy with tetracyclines and imidocarb and was usually accompanied by clinical improvement . this study highlights , for the first time , the presence of b. gibsoni in natural dog populations in zambia , where previously only b. rossi was reported ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the sleep wake cycle is closely linked to the processes of s and c. 1,2 process s maintains sleep homeostasis ; during the wake period , sleep pressure builds up which dissipates during sleep . in contrast , the circadian process c defines the sleep wake boundary based on physiological and environmental cues .1,2 unlike process s , process c occurs independently of prior sleep and waking and is hypothesized to set an upper and lower threshold to process s according to the time of day ,3 so that whenever these processes intersect , a sleep bout is initiated or terminated .4 additionally , the sleepwake process is controlled by cognitive influences , eg , making conscious decisions about bedtimes and wake times .5 both the homeostatic and circadian processes of sleep wake regulation have been investigated under various experimental protocols including sleep deprivation and forced desynchrony .6 remarkably , sleep - deprived individuals are more likely to have a consolidated bout of recovery sleep at night than during the day .7 slow - wave activity , a robust marker of the homeostatic process s , is also lowered during nocturnal sleep after a daytime nap .8 these results give rise to evidence for process s and c and in turn help to better understand the timing and duration of sleep and wake , which may be useful , for instance , in predicting work performance and reducing sleepiness - related accidents following shift work . however , to the authors knowledge , there has been no documentation on how daily sleep duration cycles under normal living conditions . large epidemiological studies have shown that sleep is often delayed and prolonged on weekends compared to weekdays in adolescents and adults .911 extended weekend sleep duration suggests compensation for sleep debt accumulated on weekdays .12 indeed , even patients with chronic primary insomnia demonstrate a rebound in total sleep time ( tst ) following a single night of sleep deprivation .13 hence , sleep rebound is a feature of sleep homeostasis . on the other hand , the delay in weekend sleep phase may result in later bedtimes due to work and / or social commitments followed by sleeping - in the next morning . wake cycle oscillates with periods of approximately 2428 hours ( circadian ) , the nonrapid eye movement sleep and rapid eye movement sleep cycle alternates with periods less than 24 hours ( ultradian ) , while the menstrual cycle has a period length of about a month ( infradian ) .14 many of these rhythms have a genetic basis , but circadian rhythms can be entrained by zeitgebers in addition to being endogenous and controlled by a central oscillator located in the suprachiasmatic nuclei of the hypothalamus .14 research into biological rhythms has practical implications for everyday life and for the understanding and treatment of various disorders .15 given that the circadian timing of sleep and wake is impacted by sleep homeostasis and lifestyle influences , the periodicity of sleep duration is of interest . this study s aim was to investigate habitual sleep duration under spontaneous living in healthy young male adults . it was hypothesized that in normal living conditions , a periodicity exists for sleep duration . sleep data for 13 healthy males aged 1835 years , measured by actigraphy ( act ) , were analyzed . participants had body mass indexes ( bmi ) 30 kg / m , were not on any regular medication , and did not have any self - reported past or current medical conditions of cardiovascular , metabolic , or renal diseases and orthopedic problems , and were without sleep complaints . they were also nonsmokers , nonshift workers , and had not travelled between different time zones in the last 2 weeks . act is a reliable and validated method for estimating sleep in normal healthy adults by detecting movement with an in - built accelerometer .16 nondominant wrist act ( actiwatch - 2 ; philips respironics , murrysville , pa , usa ) data were collected for 14 consecutive days as part of a screening procedure for a larger study . during this period , participants slept at home and were asked to adhere to their normal daily activities and sleep wake schedules . they were also instructed to press an event marker on the act when going to bed and upon waking . act data were retrieved and analyzed with the respironics actiware software ( actiware 5.57 ; philips respironics ) . each 30 - second epoch from the data recorded was defined by the software algorithm as being asleep or awake using the standard default settings .17 act data were supplemented by concomitant completion of a standard sleep diary for the purpose of artifact rejection .16 from this , 24 - hour tst that included daytime naps was obtained over the fortnight period . act was also used to monitor activity level during the daytime , defined as the time from waking in the morning until bedtime . daytime activity count per 30 - second epoch was summed to obtain the total activity count per day . on visual inspection , therefore , the periodicity of the sleep cycles ( tst , including naps for each 24 hours , noon to noon ) was modeled using the cosinor method ,18 previously used to evaluate rhythmic sleep data ,19 to model the sleep cycles for each participant over 14 days : in the equation , t represents time ( measured in days ) , m represents the mean level ( termed mesor ) , a represents the amplitude of the function , represents the frequency ( or period ) , and represents the horizontal shift of the function ( termed acrophase ) . the spectral density function ( window of 512 samples ) was calculated for each tst pattern with the offset removed . the frequency at which the largest peak in the spectra occurred was then used for in the cosinor analysis which optimized the fit using the least squares method . the fit of the model to the data was then evaluated by the normalized root mean square of the difference ( error ) between the two signals . pearson s correlation and linear regression analyses were used to investigate relationships between variables . student spaired t - tests were used to compare tst and the mesor in the model . sleep data for 13 healthy males aged 1835 years , measured by actigraphy ( act ) , were analyzed . participants had body mass indexes ( bmi ) 30 kg / m , were not on any regular medication , and did not have any self - reported past or current medical conditions of cardiovascular , metabolic , or renal diseases and orthopedic problems , and were without sleep complaints . they were also nonsmokers , nonshift workers , and had not travelled between different time zones in the last 2 weeks . act is a reliable and validated method for estimating sleep in normal healthy adults by detecting movement with an in - built accelerometer .16 nondominant wrist act ( actiwatch - 2 ; philips respironics , murrysville , pa , usa ) data were collected for 14 consecutive days as part of a screening procedure for a larger study . during this period , participants slept at home and were asked to adhere to their normal daily activities and sleep wake schedules . they were also instructed to press an event marker on the act when going to bed and upon waking . act data were retrieved and analyzed with the respironics actiware software ( actiware 5.57 ; philips respironics ) . each 30 - second epoch from the data recorded was defined by the software algorithm as being asleep or awake using the standard default settings .17 act data were supplemented by concomitant completion of a standard sleep diary for the purpose of artifact rejection .16 from this , 24 - hour tst that included daytime naps was obtained over the fortnight period . act was also used to monitor activity level during the daytime , defined as the time from waking in the morning until bedtime . daytime activity count per 30 - second epoch was summed to obtain the total activity count per day . therefore , the periodicity of the sleep cycles ( tst , including naps for each 24 hours , noon to noon ) was modeled using the cosinor method ,18 previously used to evaluate rhythmic sleep data ,19 to model the sleep cycles for each participant over 14 days : in the equation , t represents time ( measured in days ) , m represents the mean level ( termed mesor ) , a represents the amplitude of the function , represents the frequency ( or period ) , and represents the horizontal shift of the function ( termed acrophase ) . the spectral density function ( window of 512 samples ) was calculated for each tst pattern with the offset removed . the frequency at which the largest peak in the spectra occurred was then used for in the cosinor analysis which optimized the fit using the least squares method . the fit of the model to the data was then evaluated by the normalized root mean square of the difference ( error ) between the two signals . pearson s correlation and linear regression analyses were used to investigate relationships between variables . student spaired t - tests were used to compare tst and the mesor in the model . the participants ( mean age 25.15.0 years ) habitually went to bed at 00:551:21 hours and woke at 08:041:15 hours . on average , they slept 6.51.0 hours per day and rarely or never napped . the model fitted to each participant s tst cycles over the fortnight is presented in figure 1 . the correlation coefficients ( r ) were 0.59 and the error in the fit was 30 % for all participants ( table 1 ) . the sleep cycles for the group show periodicity with a range of 2.317.7 days , with a cycle peak - to - trough amplitude range of 81208 minutes . the average tst and the mesor in the model were not significantly different ( t = 0.044 ; p = 0.97 ) with a high correlation between the two measures ( r = 0.90 ; p 0.05 ) . the cycling nature ( period or frequency ) of the sleep pattern was not related to any of the other variables ( r 0.20 ; p 0.05 ) . participants with higher bmi tended to sleep earlier ( r = 0.57 ; p 0.05 ) and longer ( r = 0.48 ; p 0.10 ) . those who slept earlier tended to sleep longer with significant correlations between bedtime and the offset ( r = 0.55 ; p 0.10 ) and bedtime and tst ( r = 0.64 ; p 0.05 ) . these individuals also tended to wake up earlier ( r = 0.65 ; p 0.05 ) . the finding of this study indicates that a periodicity exists for sleep duration in healthy males under spontaneous living . sleep duration waxes and wanes with a periodicity that ranges between 2.317.7 days ( figure 1 ; table 1 ) . this periodicity will be discussed in terms of the possible mechanisms that may underlie the study observations . the observed infradian periodicity of sleep duration may be a resultant response of process s , ie , it appears that reduced tst for approximately 218 days brings on sleep recovery . it is possible that variations in sleep amount are accompanied by compensatory adjustments on an ongoing basis in normal life , and that a homeostatic mechanism operates within the normal range of wake or sleep durations , as opposed to requiring a threshold amount of excess wake before a response is initiated . previous authors have noted that interindividual variation in habitual sleep duration may be related to differences in sleep homeostatic responses such as a different rate of build - up or dissipation of sleep need .20 in fact , a study by rusterholz et al revealed interindividual differences in the time constant of build - up of process s ( range of 14.126.4 hours ) following 40 hours of sustained wakefulness , and its decline ( range of 1.22.9 hours ) during recovery sleep in healthy young males .21 purportedly , individuals with slower accumulation and / or faster dissipation of sleep pressure have reduced sleep need ,22 and vice versa , which may in turn define the periodicity of tst . variations in daily sleep duration may also arise from differences in circadian processes ,20 eg , the timing of zeitgebers on a particular day or slight variations in the body clock .23 moreover , there is emerging evidence to suggest that genetic factors may play a role in determining an individual s sleep architecture , as well as their response to sleep perturbation .24 collectively , these effects may contribute to the large range of periodicity of sleep duration observed in the current study . furthermore , the participants demonstrated cycle peak - to - trough amplitudes of 2 hours , and therefore , in practice , an intervention ( investigating sleep ) that falls on the trough of a sleep duration cycle will maximize the sleep duration outcome . the fact that individuals differ in their periodicity of sleep duration suggests that baseline monitoring of such periodicity and testing participants on several nights ( eg , nights falling on a peak or trough ) will reflect a more representative outcome . notably , the participants in the current study habitually slept below the recommended 78 hours .25 the relatively short tst accrued may be due to a delayed bedtime but convenient wake time in this sample , eg , voluntarily staying up late to socialize and / or use of electronic media ,26 but waking up early to fulfill study or professional needs . nevertheless , despite their short sleep ( particularly subjects d , h , i , and j who typically slept less than 6 hours per day ) , a periodicity exists . the observed periodicity was not uniquely different from those who had longer sleep duration , although there were insufficient data points for statistical comparisons . for instance , subject b had a periodicity of less than 3 days whereas subject a had a periodicity of 17.7 days . these subjects also had , on occasions , long sleep ( eg , day four for both ) . additionally , the model did not fit all the participants sleep patterns well , specifically subject i. these points that lay outside the fitted curve may be accounted for by conscious decisions on bedtimes and rising times or possibly further unknown factors that modulate sleep and wake . arguably , daytime behavior such as physical activity may impact on nighttime sleep .27 however , the current analysis of total daytime activity count ( mean total activity count 286,04773,832 ) did not show an association with tst in the corresponding sleep periods , confirming previous observations .28 whether short or long sleepers show differences in the infradian rhythm of sleep duration remains to be investigated . in contrast to earlier findings ,912 average weekend sleep duration for the group was not higher than on weekdays , indicating that weekend sleep in this sample may be largely determined by intrinsic factors rather than by willed behavior . while the rhythmic model seems to fit the majority of the participants ( ten of 13 ) , there were three participants ( subjects b , c , and j ) for which the rhythmic model did not seem to be appropriate despite the cosinor function indicating an amplitude significantly different than zero ( p 0.05 ) for both subjects b and j. this could be due to them having an almost constant tst during the course of the study . in the current study , it was found that higher bmi was positively correlated with sleep duration , thus supporting the results of others .29 the mechanisms behind weight gain and extended sleep duration remain unclear . patel and hu , in their review paper , suggested that weight gain ( particularly obesity ) increases inflammation and release of cytokines which promote longer sleep .30 nonetheless , the current results need to be interpreted with care because unlike the aforementioned study which compared extremely long sleepers with habitual tst of 10 hours to optimal sleepers with habitual tst of 7 hours ,29 the majority of the participants in the current study were short sleepers . moreover , an alternate explanation for longer tst with increased bmi is sleep apnea .31 although this study did not screen for snoring , breathing pauses during sleep , and excessive daytime sleepiness , all of the participants reported no sleep problems . later bedtime has been associated with increased bmi and may be linked to decreased sleep duration ,32,33 but this was not supported by the current data . earlier bedtimes were related to longer sleep durations , perhaps due to an increased opportunity for sleep . several limitations of this study are noteworthy and need to be clarified in future research . the sample size was relatively small with the majority of the participants ( ten of 13 ) being university male students , and hence the results may not be generalizable to other populations . future investigations with a large sample size and longer period of data collection would be needed to adequately model sleep duration periodicity . whilst polysomnography provides more reliable data on sleep measures than act , since social and environmental factors have direct influences on sleep timing , future research is required to reveal the characteristics of tst periodicity under regular sleepwake patterns , supplemented by rigorous documentation of waking behavior , caffeine and alcohol consumption , illness , and factors governing choice of sleep duration . in conclusion , periodicity in sleep duration exists in healthy male adults under conditions of spontaneous living . future studies should aim to investigate the infradian periodicity of sleep duration in short versus long sleepers and how such periodicity may predict work performance , affect and reduce sleepiness - related accidents following shift work , and how it may impact treatment recovery in clinical populations .\noutput:\n" }, { "from": "agent", "value": "the sleep wake cycle is a process not only dictated by homeostatic and circadian factors but also by social and environmental influences . thus , the total sleep time partly reflects sleep need , which is integral to the dynamics of sleep loss recovery . this study explored the nature of the observed oscillations in total sleep time in healthy adults under spontaneous living conditions . actigraph - measured sleep data for 13 healthy young male adults were collected over 14 consecutive days and analyzed for habitual sleep duration . the total sleep time periodicity was modeled using the cosinor method for each individual across the 14 days . the findings confirm the existence of periodicity in habitual sleep duration as there were clear periodic patterns in the majority of the participants . although exclusive to each individual , the observed oscillations may be a resultant response of homeostatic sleep need , circadian timing , and / or social and environmental influences . these findings instigate further indepth studies into the periodicity of sleep duration in healthy individuals to provide a better understanding of sleep need in short versus long sleepers , in predicting work performance , and reducing sleepiness - related accidents following shift work , and how this periodicity may impact sleep treatment outcome in clinical populations ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: nanofluids , proposed firstly by choi , are dispersions of nanoparticles ( metals , oxides , nitrides and carbon materials etc . ) in base fluids ( water , ethylene glycol and engine oil etc . ) . they have wide ranges of applications , e.g. , to enhance heat transfer [ 1 - 11 ] , as magnetic nanofluids and other special applications [ 13 - 18 ] . however , long - term stability of nanofluids is a major concern for the engineering applications . therefore , technique breakthroughs are needed to produce well - dispersed and long - term stable nanofluids . use of functionalized nanoparticles is a promising approach to achieve long - term stability of nanofluid . functionalization of silica nanoparticles has been reported earlier in literature [ 19 - 24 ] . the current authors have reported earlier on effects of nanoparticles in nanofluid on thermal performance in water - cuo system . the present work reports on the synthesis of functionalized silica ( sio2 ) nanoparticles by grafting silanes directly to the surface of silica nanoparticles in original nanoparticle solutions . one was a commercial nanoparticle solution , ludox tm - 40 , purchased from aldrich company in usa . the ludox tm - 40 ( with the silica nanoparticle mass concentration of 40 % in water , the average diameter of nanoparticles of about 30 nm ) contains naoh , surfactants and so on to stabilize the silica nanoparticles in the water solution . the other was a self - made nanoparticle solution prepared by the two - step method . silica nanoparticle powders were firstly dispersed into deionized water , and the suspension was then oscillated in an ultrasonic bath for 12 h. silica nanoparticle powders with an average diameter of about 30 nm were commercial products of gas condensation . two silanes of 2 - [ methoxy ( polyethyleneoxy ) propyl ] trimethoxysilane ( mppts ) and ( 3 - glycidoxylproyl ) trimethyoxysilane ( gps ) were received from gelest company in usa and used without further purification . the synthesis methods using two silanes are described as follows : schematic of the functionalization ( 1 ) mppts - functionalized nanoparticles mppts - functionalized nanoparticles were synthesized simply by grafting directly a certain amount of mppts to silica nanoparticles in silica solutions . as an example , 25 g of ludox tm - 40 was diluted with 50 g deionized water . to the silica suspension ,1.45 g of mppts was added dropwise under vigorous stirring at room temperature . generally , the mass ratio ( defined as the ratio of the mass of the silane to that of the silica nanoparticles in silica solutions ) ranges from 0.1 to 1.0 . the entire mixture was heated to 70c and stirred and oscillated vigorously for 48 h at that temperature . the obtained solution was then dialyzed in the snakeskin dialysis tubing ( 3.5 k mwco , purchased from pierce ) with deionized water as the dialyzate for 48 h and thereafter freeze - dried to give white fine nanoparticle powders . gps - functionalized nanoparticles were synthesized in a similar manner . generally , the mass ratio ranges from 0.1 to 1.0 . as an example , 1.35 g of gps was diluted with 10 g of deionized water , and the ph value of the solution was adjusted to 2 with dilute hcl . after vigorous stirring for 4 h at room temperature , its ph value was adjusted to 10 with dilute naoh . meanwhile , 25 g of ludox tm - 40 was diluted with 40 g of deionized water . the obtained gps solution was then added dropwise to the silica suspension under vigorous stirring and oscillation and kept at 70c for 48 h in an ultrasonic bath . the obtained solution was then purified by dialysis and freeze - dried in the same manner shown earlier . to investigate the reaction degree of the silica and the silane , tga instrument ( ta q5000 ) was used to analyze how many silanes are grafted on the silica nanoparticles . the fine powders of functionalized nanoparticles were burnt at 700c in a tga instrument , and the organic components on the surfaces of the functionalized nanoparticles were burnt away . the tga instrument can record the mass loss of the functionalized nanoparticles during the whole process . table 1 shows the mass loss percentage caused by the organic components for functionalized nanoparticles at different mass ratio . the mass ratio is the ratio of the mass of the reacting silane to that of the reacting silica . the mass loss is the mass loss percentage of the functionalized silica before and after the tga process . results show that the mass loss increases with the increase in the reacting mass ratio . more silanes can be grafted on the silica nanoparticles at larger mass ratios . at the same mass ratio , the nanoparticles functionalized with mppts have a larger mass loss compared to those with gps . mass loss of functionalized nanoparticles after the tga process mass ratio represents the mass ratio of the reacting silane and silica ; mass loss represents the mass loss percentage caused by the organic components after the functionalized nanoparticles are burnt by the tga instrument after the functionalization process , nanofluids were prepared by the two - step method using functionalized nanoparticles and deionized water . functionalized nanoparticles were dispersed into deionized water , and the solution was thereafter vigorously stirred and oscillated in an ultrasonic bath for 12 h at room temperature ( the solution can also be standing for 12 h with the environmental temperature of 50c ) . functionalized nanoparticles can still keep dispersing well after the nanofluid has been standing for 6 months and no sedimentation was observed . the dispersing state of functionalized nanoparticles after 6 months is still under investigation and will be reported later . figure 2a and 2b are the transmisson electron microscope ( tem ) pictures of nanofluids consisting of nanoparticles before and after the functionalizing process ( prepared with ludox tm - 40 and mppts , the mass ratio is 0.123 ) , respectively . figure 2c and 2d are the tem pictures of nanofluids consisting of nanoparticles before and after the functionalizing process ( prepared with self - made nanoparticle solution and gps , the mass ratio is 0.115 ) , respectively . as is shown , functionalized nanoparticles have no aggregation and can disperse well . in the present study , the mass concentration of the functionalized nanofluid ( nanofluids consisting of functionalized nanoparticles ) prepared with commercial silica solution can go beyond 50 % , and the other functionalized nanofluid prepared with self - made silica solution can reach maximally 10 % under the condition that no aggregation occurs . tem pictures of nanofluids consisting of nanoparticles before and after the functionalizing process a nanoparticles in ludox tm - 40 b functionalized nanoparticles prepared with ludox tm - 40 and mppts c nanoparticles in self - made nanoparticle solution d functionalized nanoparticles prepared with self - made nanoparticle solution and gps dynamic light scattering ( dls ) measurement of functionalized nanoparticles was taken using a malvern zetasizer nano particle characterization system . diameter distribution of functionalized nanoparticles ( prepared with self - made and gps , the mass ratio is 0.115 ) is indicated in fig . the average diameter of the functionalized nanoparticles is about 30 nm , which is in consistent with the result shown in fig .2 . diameter distribution of functionalized nanoparticles an applicable prospect of functionalized nanofluids is in the phase - change heat transfer . up to now , almost all phase - change heat transfer studies of conventional nanofluids ( consisting of nanoparticles without functionalization ) reported that nanoparticles fouled on the heated surface after the boiling process . a thin porous layer formed on the heated surface and affected strongly the boiling characteristics . in order to investigate the heat transfer characteristics of functionalized nanofluids in the phase - change heat transfer , a pool boiling experiment using both the conventional nanofluid and the functionalized nanofluid was carried out on a smooth copper surface positioned horizontally . the experimental system andthe experiment was carried out at atmospheric pressure with the fluid temperature of about 100c . the copper surface was kept heating for 3 h with the heat flux of about 500 kw / m . figure 4a shows the sem picture of the heated surface before the boiling experiment . figure 4b and 4c show the sem pictures of the heated surface after the boiling experiment using both the functionalized nanofluid ( consisting of functionalized nanoparticles prepared with self - made nanoparticle solution and gps , the mass ratio is 0.115 ) and the original self - made nanofluid . it was found that no porous fouling layer formed on the heated surface after boiling process using the functionalized nanofluid . the nanoparticles can be easily flushed away by water . however , a fouling layer of nanoparticles forms on the heated surface after the boiling experiment using the original self - made silica solution . the evaporation of nanofluids with subsequent settlement of unfunctionalized nanoparticles initially contained in it could be the reason for the formation of this layer . it is not the case , however , for functionalized nanoparticles since their improved solubility . sem pictures of the heated surface during the boiling experiment a before the boiling experiment b using the functionalized nanofluid c using the conventional nanofluid since no fouling layer exists after the boiling process , the functionalized nanofluid can be applicable in heat pipes that utilize the phase - change heat transfer of working fluids to dissipate heat . this is quite helpful for the long - term stable running of heat pipes since the heated surfaces keep the same and the nanofluid keep dispersing well . further experiment is undergoing for better understanding the application of functionalized nanofluids in heat pipes . in addition , the well - dispersed and stable functionalized nanofluid can be applicable to microchannels in electronic devices and compact cooling modules to dissipate heat more effectively . it is also useful for enhancing the mass transfer , such as the oxygen absorption in chemical and biochemical industry , ammonia absorption in the refrigeration technique . overbeek ( dlvo ) theory of colloid stability is commonly used to describe the particlesubstrate interfacial interactions in the base fluid . in this theory , both an attractive force and a repulsive force existing between particlesthe attractive force , also called the van der waals force , includes attractions between atoms , molecules and surfaces . the repulsive force arises from the overlap of electrical double layers that appear on the surfaces of particles when they are placed into the base fluid . the overlap of their double layers interrupts their own electrostatic stability and the electrostatic repulsion causes the repulsive force , when two particles get too close together . particles in the base fluid can keep stable if the repulsive force is stronger than the attractive force . another theory named as the steric stabilization effect is also a key explanation for the stability of particles in the base fluid . the steric stabilization effect arises from the fact that polymers gathering on the surface of nanoparticles occupy a certain amount of space . if nanoparticles are brought too close together , the space is compressed . an associated repulsive force helps separate nanoparticles from each other and restrains the aggregation of nanoparticles . adding ions to the nanofluid according to the dlvo theorycan enhance the electrostatic repulsion of nanoparticles . adding surfactants to the nanofluid is helpful for the steric stabilization effect . these are ways how ludox tm - 40 is treated to help the silica nanoparticles stabilize in the water solution . in ludoxalso , the steric effect by surfactants may be broken down when the nanofluid is heated or the brownian motion of nanoparticles is extremely strong . a better way , as is indicated in this paper , is to graft polymers onto the surface of nanoparticles . the grafting is achieved with the covalent bonding , which is quite stable and not easy to be broken down . the grafting silanes on nanoparticles have the steric stabilization effect to stabilize nanoparticles . the covalent bondingo si is stable chemical bonding to facilitate the application of functionalized nanoparticles regardless of the working conditions , like the heated case . besides , to achieve a better and larger solubility of nanoparticles in water , silanes containing polar structures are chosen . due to the solubility rule of similarity , the polar structure grafted on the surface of the silica nanoparticles increases the solubility of functionalized nanoparticles in water ( which is also a polar substance ) . the nanofluids with functionalized nanoparticles gain the merits of good dispersing , stable bonding , no surfactants needed and large solubility . similar methods may be used to other nanoparticles for heat transfer applications . the functionalized nanofluid made by commercial product of ludox tm - 40however , using the functionalized nanofluid prepared by the cheap self - made silica solution is a more economic way for industrial application due to its cheap price and large producing capacity . to investigate the reaction degree of the silica and the silane , tga instrument ( ta q5000 ) was used to analyze how many silanes are grafted on the silica nanoparticles . the fine powders of functionalized nanoparticles were burnt at 700c in a tga instrument , and the organic components on the surfaces of the functionalized nanoparticles were burnt away . the tga instrument can record the mass loss of the functionalized nanoparticles during the whole process . table 1 shows the mass loss percentage caused by the organic components for functionalized nanoparticles at different mass ratio . the mass ratio is the ratio of the mass of the reacting silane to that of the reacting silica . the mass loss is the mass loss percentage of the functionalized silica before and after the tga process . results show that the mass loss increases with the increase in the reacting mass ratio . more silanes can be grafted on the silica nanoparticles at larger mass ratios . at the same mass ratio , the nanoparticles functionalized with mppts have a larger mass loss compared to those with gps . mass loss of functionalized nanoparticles after the tga process mass ratio represents the mass ratio of the reacting silane and silica ; mass loss represents the mass loss percentage caused by the organic components after the functionalized nanoparticles are burnt by the tga instrument after the functionalization process , nanofluids were prepared by the two - step method using functionalized nanoparticles and deionized water . functionalized nanoparticles were dispersed into deionized water , and the solution was thereafter vigorously stirred and oscillated in an ultrasonic bath for 12 h at room temperature ( the solution can also be standing for 12 h with the environmental temperature of 50c ) . functionalized nanoparticles can still keep dispersing well after the nanofluid has been standing for 6 months and no sedimentation was observed . the dispersing state of functionalized nanoparticles after 6 months is still under investigation and will be reported later . figure 2a and 2b are the transmisson electron microscope ( tem ) pictures of nanofluids consisting of nanoparticles before and after the functionalizing process ( prepared with ludox tm - 40 and mppts , the mass ratio is 0.123 ) , respectively . figure 2c and 2d are the tem pictures of nanofluids consisting of nanoparticles before and after the functionalizing process ( prepared with self - made nanoparticle solution and gps , the mass ratio is 0.115 ) , respectively . as is shown , functionalized nanoparticles have no aggregation and can disperse well . in the present study , the mass concentration of the functionalized nanofluid ( nanofluids consisting of functionalized nanoparticles ) prepared with commercial silica solution can go beyond 50 % , and the other functionalized nanofluid prepared with self - made silica solution can reach maximally 10 % under the condition that no aggregation occurs . tem pictures of nanofluids consisting of nanoparticles before and after the functionalizing process a nanoparticles in ludox tm - 40 b functionalized nanoparticles prepared with ludox tm - 40 and mppts c nanoparticles in self - made nanoparticle solution d functionalized nanoparticles prepared with self - made nanoparticle solution and gps dynamic light scattering ( dls ) measurement of functionalized nanoparticles was taken using a malvern zetasizer nano particle characterization system . diameter distribution of functionalized nanoparticles ( prepared with self - made and gps , the mass ratio is 0.115 ) is indicated in fig . the average diameter of the functionalized nanoparticles is about 30 nm , which is in consistent with the result shown in fig . an applicable prospect of functionalized nanofluids is in the phase - change heat transfer . up to now , almost all phase - change heat transfer studies of conventional nanofluids ( consisting of nanoparticles without functionalization ) reported that nanoparticles fouled on the heated surface after the boiling process . a thin porous layer formed on the heated surface and affected strongly the boiling characteristics . in order to investigate the heat transfer characteristics of functionalized nanofluids in the phase - change heat transfer , a pool boiling experiment using both the conventional nanofluid and the functionalized nanofluid was carried out on a smooth copper surface positioned horizontally . the experiment was carried out at atmospheric pressure with the fluid temperature of about 100c . the copper surface was kept heating for 3 h with the heat flux of about 500 kw / m . figure 4a shows the sem picture of the heated surface before the boiling experiment . figure 4b and 4c show the sem pictures of the heated surface after the boiling experiment using both the functionalized nanofluid ( consisting of functionalized nanoparticles prepared with self - made nanoparticle solution and gps , the mass ratio is 0.115 ) and the original self - made nanofluid . it was found that no porous fouling layer formed on the heated surface after boiling process using the functionalized nanofluid . the nanoparticles can be easily flushed away by water . however , a fouling layer of nanoparticles forms on the heated surface after the boiling experiment using the original self - made silica solution . the evaporation of nanofluids with subsequent settlement of unfunctionalized nanoparticles initially contained in it could be the reason for the formation of this layer . it is not the case , however , for functionalized nanoparticles since their improved solubility . sem pictures of the heated surface during the boiling experiment a before the boiling experiment b using the functionalized nanofluid c using the conventional nanofluid since no fouling layer exists after the boiling process , the functionalized nanofluid can be applicable in heat pipes that utilize the phase - change heat transfer of working fluids to dissipate heat . this is quite helpful for the long - term stable running of heat pipes since the heated surfaces keep the same and the nanofluid keep dispersing well . further experiment is undergoing for better understanding the application of functionalized nanofluids in heat pipes . in addition , the well - dispersed and stable functionalized nanofluid can be applicable to microchannels in electronic devices and compact cooling modules to dissipate heat more effectively . it is also useful for enhancing the mass transfer , such as the oxygen absorption in chemical and biochemical industry , ammonia absorption in the refrigeration technique . the derjaguin landau verwey overbeek ( dlvo ) theory of colloid stability is commonly used to describe the particlesubstrate interfacial interactions in the base fluid . in this theory , both an attractive force and a repulsive force existing between particlesthe attractive force , also called the van der waals force , includes attractions between atoms , molecules and surfaces . the repulsive force arises from the overlap of electrical double layers that appear on the surfaces of particles when they are placed into the base fluid . the overlap of their double layers interrupts their own electrostatic stability and the electrostatic repulsion causes the repulsive force , when two particles get too close together . particles in the base fluid can keep stable if the repulsive force is stronger than the attractive force . another theory named as the steric stabilization effect is also a key explanation for the stability of particles in the base fluid . the steric stabilization effect arises from the fact that polymers gathering on the surface of nanoparticles occupy a certain amount of space . an associated repulsive force helps separate nanoparticles from each other and restrains the aggregation of nanoparticles . adding ions to the nanofluid according to the dlvo theorycan enhance the electrostatic repulsion of nanoparticles . adding surfactants to the nanofluid is helpful for the steric stabilization effect . these are ways how ludox tm - 40 is treated to help the silica nanoparticles stabilize in the water solution . in ludox tm - 40 , anions ( like oh ) are used to stabilize silica nanoparticles . but nanoparticles may be applied in acidic or neutral conditions . also , the steric effect by surfactants may be broken down when the nanofluid is heated or the brownian motion of nanoparticles is extremely strong . a better way , as is indicated in this paper , is to graft polymers onto the surface of nanoparticles . the grafting is achieved with the covalent bonding , which is quite stable and not easy to be broken down . the grafting silanes on nanoparticles have the steric stabilization effect to stabilize nanoparticles . the covalent bondingo si is stable chemical bonding to facilitate the application of functionalized nanoparticles regardless of the working conditions , like the heated case . besides , to achieve a better and larger solubility of nanoparticles in water , the polar structure grafted on the surface of the silica nanoparticles increases the solubility of functionalized nanoparticles in water ( which is also a polar substance ) . the nanofluids with functionalized nanoparticles gain the merits of good dispersing , stable bonding , no surfactants needed and large solubility . the functionalized nanofluid made by commercial product of ludox tm - 40 can prepare the nanofluid with a higher nanoparticle mass concentration . however , using the functionalized nanofluid prepared by the cheap self - made silica solution is a more economic way for industrial application due to its cheap price and large producing capacity . a method of surface functionalization of silica nanoparticles to prepare a kind of functionalized nanofluid was presented . the nanofluid with functionalized nanoparticles can keep long - term stability and very good dispersing . functionalized nanoparticles can still keep dispersing well after the nanofluid has been standing for 6 months and no sedimentation is found . one unique characteristic of the functionalized nanofluids is that no porous sediment layer forms on the heated surface after boiling process . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author ( s ) and source are credited .\noutput:\n" }, { "from": "agent", "value": "a method of surface functionalization of silica nanoparticles was used to prepare a kind of stable nanofluid . the functionalization was achieved by grafting silanes directly to the surface of silica nanoparticles in silica solutions ( both a commercial solution and a self - made silica solution were used ) . the functionalized nanoparticles were used to make nanofluids , in which well - dispersed nanoparticles can keep good stability . one of the unique characteristics of the nanofluids is that no deposition layer forms on the heated surface after a pool boiling process . the nanofluids have applicable prospect in thermal engineering fields with the phase - change heat transfer ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: alzheimer 's disease ( ad ) is a progressive neurodegenerative disorder that is characterized by neuronal loss , extracellular deposits of amyloid ( a ) and intracellular accumulations of abnormally phosphorylated tau ( p - tau ) protein . these features increase during the course of the disease and can be visualized upon autopsy of the brain . however , indirect evidence of these changes can be acquired while the patient is still alive through brain imaging and cerebrospinal fluid ( csf ) biomarkers . the csf levels of total tau ( t - tau ) and abnormal p - tau protein are increased in ad patients , while levels of csf a42 are decreased . a large number of studies have shown that a profile with pathological levels of these three biomarkers is highly associated with ad and development of ad in patients with mild cognitive impairment ( mci ) . at present , there are insufficient data to evaluate their accuracy in predicting incipient ad in cognitively healthy individuals . the biomarker profile can be used in research to increase the probability that a dementing process is caused by ad , thus adding strength to further disease - specific analyses . apart from the above - mentioned pathological hallmarks , cerebral processes related to inflammation are highly present in ad patients . epidemiological studies have shown delayed onset of ad in subjects using non - steroidal anti - inflammatory drugs . data from ultrastructural studies have shown an association between brain amyloid deposits and microglia as well as astrocytes . microglia are the main phagocytic immune cells in the cns , but their role in relation to ad is not clear . some evidence points towards an important role in the clearance of a , while other evidence suggests that microglia may contribute to the build - up of amyloid plaques . other theories state that microglial activation might mediate the neurodegeneration seen in the brain of ad patients . the recent finding of a missense mutation in trem2 that may render microglia overactive to brain amyloid pathology and increases the ad risk about 4-fold , has raised the interest in the role of microglia in the ad process . in this study , we wanted to investigate the association between ad and three candidate inflammatory csf biomarkers . the enzyme chitotriosidase is secreted by activated macrophages , and patients with gaucher 's disease ( a disease characterized by malfunctioning lysosomal storage ) have increased levels in plasma . csf levels of the enzyme have been assessed in ad patients and nondemented controls , with increased levels found in the former group , although with an overlap between the groups . another inflammatory biomarker is ykl - 40 ( also known as chitinase -3-like protein 1 ) , a glycoprotein that structurally resembles chitotriosidase , and is mainly expressed in astrocytes in the brain . some , but not all , studies have found increased levels of ykl - 40 in ad patients . the monocyte chemoattractant protein - 1 [ mcp - 1 , also known as chemokine cc motif ligand 2 ( ccl2 ) ] can be produced by microglia and is involved in the recruitment of monocytes in the central nervous system . studies measuring the levels of mcp - 1 have given contradictory results with either increased levels in patients with ad and mci or no differences between ad patients and controls . the aim of this study was to quantify these three inflammatory biomarkers in ad patients with a pathological profile of t - tau , p - tau and a42 , and in cognitively healthy controls with a normal csf profile to detect differences between the groups in which the biomarker - supported diagnostics minimises the risk of including preclinical ad patients in the control group and patients with ad - like memory impairment but without ad neuropathology in the ad group . the ad and the control group were selected based on the core csf biomarker profile in accordance with the international work group criteria for the diagnosis of ad to yield highly specific clinical diagnosis with regard to neuropathological characteristics . the ad patients and controls were prospectively recruited from the alzheimer 's disease and other cognitive disorders unit , hospital clinic , barcelona , spain . subjects with a history of stroke or seizure , parkinsonism , epilepsy or other neurological disease were not included in the study . the study was approved by the hospital clinic 's ethics committee , and all participants gave written informed consent to participate in the study . controls were healthy elderly individuals who presented no evidence of cognitive impairment ( below 1.5 standard deviation ) in any of the neuropsychological tests administered , and had a mini - mental state examination ( mmse ) score between 24 and 30 and a clinical dementia rating ( cdr ) scale score of 0 . the ad patients were diagnosed with dementia according to the dsm - iv criteria for dementia and met the criteria of probable ad , as defined by the nincds - adrda criteria . they had a median mmse score of 21 , which indicates mild - to - moderate dementia . patients with ad had a positive csf biomarker profile with low levels of a42 and increased levels of t - tau and p - tau ( a42450 pg / ml , t - tau 500 pg / ml and p - tau 75 pg / ml ) , while the controls displayed a negative profile . demographics and clinical characteristics are given in table 1 . the chitotriosidase activity in csf was measured using an enzymatic assay , as described previously . mcp - 1 levels in csf were measured using the meso scale discovery technique ( msd human mcp - 1 ; meso scale discovery , gaithersburg , md . levels of ykl - 40 were determined using a sandwich enzyme - linked immunosorbent assay ( elisa ) ( r & d systems , minneapolis , minn . , csf a1 - 42 ( called a42 in this study ) was quantified with a sandwich elisa ( innotest - amyloid1 - 42 ; innogenetics , ghent , belgium ) using a monoclonal antibody specific of the 42nd c - terminal amino acid on a for capture and a biotinylated monoclonal antibody specific of the first five n - terminal amino acids for detection , as described previously in detail . csf levels of t - tau were determined with a sandwich elisa using monoclonal capture antibodies ( innotest htau - ag ; innogenetics ) , as presented previously . levels of tau phosphorylated at threonine 181 ( p - tau ) were measured with a sandwich elisa ( innotest phospho - tau [ 181p ] ; innogenetics ) , as described previously in detail . all measurements were performed in one round of analyses using one batch of reagents by board - certified laboratory technicians who were blind to the clinical characteristics of patients and controls . the software sas version 9.3 ( sas institute inc . , cary , n.c . , usa ) was used for statistical analysis and graphs , together with graphpad prism 5 ( graphpad software inc . since data were skewed , group comparisons were made using the mann - whitney u test . receiver operating characteristic ( roc ) curves for the differentiation of ad patients and controls were constructed , and the area under the roc curve ( auroc ) was calculated for the individual markers . the ad and the control group were selected based on the core csf biomarker profile in accordance with the international work group criteria for the diagnosis of ad to yield highly specific clinical diagnosis with regard to neuropathological characteristics . the ad patients and controls were prospectively recruited from the alzheimer 's disease and other cognitive disorders unit , hospital clinic , barcelona , spain . subjects with a history of stroke or seizure , parkinsonism , epilepsy or other neurological disease were not included in the study . the study was approved by the hospital clinic 's ethics committee , and all participants gave written informed consent to participate in the study . controls were healthy elderly individuals who presented no evidence of cognitive impairment ( below 1.5 standard deviation ) in any of the neuropsychological tests administered , and had a mini - mental state examination ( mmse ) score between 24 and 30 and a clinical dementia rating ( cdr ) scale score of 0 . the ad patients were diagnosed with dementia according to the dsm - iv criteria for dementia and met the criteria of probable ad , as defined by the nincds - adrda criteria . they had a median mmse score of 21 , which indicates mild - to - moderate dementia . patients with ad had a positive csf biomarker profile with low levels of a42 and increased levels of t - tau and p - tau ( a42450 pg / ml , t - tau 500 pg / ml and p - tau 75 pg / ml ) , while the controls displayed a negative profile . demographics and clinical characteristics are given in table 1 . the chitotriosidase activity in csf was measured using an enzymatic assay , as described previously . mcp - 1 levels in csf were measured using the meso scale discovery technique ( msd human mcp - 1 ; meso scale discovery , gaithersburg , md . levels of ykl - 40 were determined using a sandwich enzyme - linked immunosorbent assay ( elisa ) ( r & d systems , minneapolis , minn . , csf a1 - 42 ( called a42 in this study ) was quantified with a sandwich elisa ( innotest - amyloid1 - 42 ; innogenetics , ghent , belgium ) using a monoclonal antibody specific of the 42nd c - terminal amino acid on a for capture and a biotinylated monoclonal antibody specific of the first five n - terminal amino acids for detection , as described previously in detail . csf levels of t - tau were determined with a sandwich elisa using monoclonal capture antibodies ( innotest htau - ag ; innogenetics ) , as presented previously . levels of tau phosphorylated at threonine 181 ( p - tau ) were measured with a sandwich elisa ( innotest phospho - tau [ 181p ] ; innogenetics ) , as described previously in detail . all measurements were performed in one round of analyses using one batch of reagents by board - certified laboratory technicians who were blind to the clinical characteristics of patients and controls . the software sas version 9.3 ( sas institute inc . , cary , n.c . , usa ) was used for statistical analysis and graphs , together with graphpad prism 5 ( graphpad software inc . , la jolla , calif . since data were skewed , group comparisons were made using the mann - whitney u test . receiver operating characteristic ( roc ) curves for the differentiation of ad patients and controls were constructed , and the area under the roc curve ( auroc ) was calculated for the individual markers . patients with ad had significantly higher csf levels of chitotriosidase ( 133 % increase ) and ykl - 40 ( 77 % increase ) compared with controls ( table 1 , fig . the significant group differences for chitotriosidase and ykl - 40 remained also when outliers were removed from the groups ( data not shown ) . correlations between biomarkers , age and mmse scores are shown in table 2 . there were significant correlations between mcp - 1 and ykl - 40 in both ad patients and controls ( r = 0.53 , p 0.01 and r = 0.64 , p 0.01 , respectively ) . no biomarker , except for t - tau in controls ( r = 0.40 , p 0.05 ) , correlated significantly with age . the auroc was 0.78 [ 95 % confidence interval ( ci ) 0.65 - 0.91 ] for chitotriosidase , 0.88 ( 95 % ci 0.78 - 0.98 ) for ykl - 40 and 0.61 ( 95 % ci 0.45 - 0.77 ) for mcp - 1 for discriminating ad patients from controls . patients with ad had significantly higher csf levels of chitotriosidase ( 133 % increase ) and ykl - 40 ( 77 % increase ) compared with controls ( table 1 , fig .1 ) . levels of mcp - 1 were not significantly different between groups . the significant group differences for chitotriosidase and ykl - 40 remained also when outliers were removed from the groups ( data not shown ) . there were significant correlations between mcp - 1 and ykl - 40 in both ad patients and controls ( r = 0.53 , p 0.01 and r = 0.64 , p 0.01 , respectively ) . no biomarker , except for t - tau in controls ( r = 0.40 , p 0.05 ) , correlated significantly with age . the auroc was 0.78 [ 95 % confidence interval ( ci ) 0.65 - 0.91 ] for chitotriosidase , 0.88 ( 95 % ci 0.78 - 0.98 ) for ykl - 40 and 0.61 ( 95 % ci 0.45 - 0.77 ) for mcp - 1 for discriminating ad patients from controls . today , there are three csf biomarkers , t - tau , p - tau and a42 , which have proven to be strongly associated with ad . new biomarkers are important to improve the diagnosis and prediction as well as follow - up of ad patients . in this study , we evaluated inflammatory csf biomarkers and found that patients with ad had higher levels of chitotriosidase and ykl - 40 compared with controls , while the levels of mcp - 1 were similar between the groups . even though there was an overlap in the biomarker levels between the groups , it was not as prominent as could be seen in one of the previous studies . this is most likely due to the fact that in the present study , patients were included if having a positive csf ad biomarker profile , which increases the certainty of including patients with ad pathology in the ad group and excluding patients with this pathology in the control group . the approach of biomarker - supported ad diagnostics is also in line with recently proposed revised criteria for ad . two previous studies report elevated csf levels of ykl - 40 in ad patients in early disease stages . inboth of these studies , a42 and t - tau were used for selecting patients . another study found elevated levels in ad patients but not in mci patients with incipient ad . however , upon stratification according to an ad - indicative profile of a42 and t - tau , higher levels of ykl - 40 were found in mci patients who developed ad , compared with stable mci patients with a normal profile . we corroborate these findings by presenting elevated ykl - 40 levels in ad patients . in another study in which biomarker criteria were not applied in the selection of patients , no differences in ykl - 40 levels were found between ad patients and controls . here , ykl - 40 achieved an acceptable auroc of 0.88 . the findings of unaltered mcp - 1 levels in ad patients compared with controls are in line with some earlier findings , while other studies have found increased levels in ad patients . one study found that ad patients had increased levels of mcp - 1 compared with controls , but that the levels correlated with age , and the subjects in the ad group were older than the controls . moreover , when comparing different methods for mcp - 1 , suboptimal correlations have been seen . this could either be an indication that the methods detect different fragments of the protein or that there is a need for harmonization of mcp - 1 methods . however , this probably had no major effect on the results , since no inflammatory biomarker correlated with age . there were no correlations between inflammatory and core ad biomarkers , which indicates that they can provide independent information . one shortcoming of the study was that only patients with ad were included in the disease group . hence , we can not determine the ability of these biomarkers to discriminate ad from other neurodegenerative diseases . patients with ad had higher csf levels of the inflammatory biomarkers chitotriosidase and ykl - 40 compared with controls , while the levels of mcp - 1 were similar between the groups . these findings indicate that chitotriosidase and ykl - 40 may be used for evaluating inflammatory activity in ad patients .\noutput:\n" }, { "from": "agent", "value": "backgroundthe cerebrospinal fluid ( csf ) biomarkers total tau , abnormally phosphorylated tau and amyloid 1 - 42 are strongly associated with alzheimer 's disease ( ad ) . apart from the pathologic hallmarks that these biomarkers represent , other processes such as inflammation and microglial activation are present in the brains of patients with ad . new biomarkers related to these processes could be valuable for the diagnosis and follow - up of ad patients and for the evaluation of inflammation - related pathologies.aimthe aim of this study was to evaluate the association of inflammatory csf biomarkers with ad.methodstwenty - five ad patients and 25 controls who had a pathological and normal csf profile of the core ad biomarkers , respectively , were included in this study . csf levels of chitotriosidase , ykl - 40 ( also known as chitinase -3-like protein 1 ) and monocyte chemoattractant protein - 1 ( mcp - 1 ) were quantified and the levels compared between the groups.resultsad patients had increased csf levels of chitotriosidase and ykl - 40 ( both approximately twice higher than in controls ) , while the levels of mcp - 1 were similar in the ad and control groups.conclusionthe results indicate that chitotriosidase and ykl - 40 may be helpful for the evaluation of cerebral inflammatory activity in ad patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: um bloco de resina composta foi confeccionada na superfcie oclusal de vinte e dois terceiros molars hgidos para facilitar a preparao dos espcimes para o teste de micro - trao . os dentes restaurados foram seccionados com disco diamantado no sentido vestbulo - lingual em fatias de aproximadamente 0,7 mm de espessura . com uma ponta diamantada , foi realizada uma constrio na regio de esmalte da vertente oclusal interna . os espcimes apresentaram aproximadamente 0,5 mmde rea na seco transversal da regio de constrio e foram divididos em 12 grupos ( n = 11 ) . os grupos controles no foram submetidos ao regime clareador e os experimentais foram tratados com gel de cpg 10 % ou com formulaes de cpg 10 % contendo cf ( 0,2 % e 0,5 % ) ou cca ( 0,05 % e 0,2 % ) . os grupos clareadores receberam a aplicao dos cpgs por 6 horas / dia a 37 c , durante 14 dias consecutivos e foram armazenados em saliva artificial ( as ) ou em umidade relativa 100 % ( rh ) , entre as aplicaes do gel clareador . aps o clareamento , os espcimes foram testados atravs do mtodo de micro - trao ( 0,5 mm / min ) . os dados foram analisados pela anova ( 2 fatores ) e teste tukey ( 5 % ) . os espcimes tratados com cpg com cf ou cca apresentaram similar uts aos grupos controles no clareados . previous bleaching methods were more aggressive due to application of 30 to 35 % hydrogen peroxide in combination with a heat lamp or a heating element , microabrasion and etching with 37 % phosphoric acid . home bleaching techniques using 10 % carbamide peroxide gel in a mouthguard have been considered less invasive , safe for soft tissues and an effective method to bleach vital teeth13 . since contemporary concepts in esthetic dentistryrecommend less invasive techniques without tooth damage , the use of home bleaching techniques has become popular for whitening stained and discolored teeth14 ,18 . there is no agreement about the effects of bleaching on enamel , since scanning electron microscopy investigations of bleached enamel surfaces have shown little or no topographic alterations17 ,22 , while surface changes after carbamide peroxide bleaching have been reported . . moreover , chemical composition , mechanical and physical properties of bleached human enamel have also demonstrated conflicting evidences1 ,4,10,11,20,24,25,26 . a study evaluating bleached enamel with carbamide peroxide solution followed by fluoride treatment and enamel did not show resistance to demineralization6 . however , if ions were added during bleaching and ionic exchange , maybe they could be uptaken and increase enamel resistance to demineralization . as both fluoride and calcium ions would increase the saturation of bleaching agent gel , a lower mineral loss would occur during bleachingthus , bleaching gel compositions with addition of fluoride or calcium could reduce or overcome the bleaching adverse effects . the aim of this study was to test the null hypothesis that the ultimate tensile strength ( uts ) of enamel is not altered when exposed to carbamide peroxide - based bleaching agents containing fluoride or calcium . additionally , the tested specimens were analyzed under scanning electron microscope ( sem ) to evaluate the features of fractured surfaces . twenty - two sound , extracted human third molars , stored in 0.1 % thymol solution for no longer than two weeks after extraction were used in this study . the teeth were obtained after informed consent by the patients and under the protocol ( 045/2003 ) that was analyzed and approved by the ethical research committee of piracicaba dental school / unicamp , brazil . the teeth were cleaned of gross debris and placed in relative humidity before beginning the experiment . enamel occlusal surfaces were air - abraded with aluminum oxide ( 50 mm ) , etched with 35 % phosphoric acid for 30 s , air dried and bonded with single bond adhesive system ( 3 m espe , st . bonded surfaces received three layers of tph spectrum resin composite ( dentsply caulk , milford , de , usa ) to build up a \" cube - like \" crown of approximately 6.0 mm in height ( figure 1a ) . each resin layer was light cured for 40 s with a xl 3000 light - curing unit ( 3 m espe , st . paul , mn , usa ) and the restored teeth were stored in relative humidity at 37c . after 24 h , the crowns were vertically , serially sectioned into 0.7 - mm thick slabs with a diamond saw ( isomet 1000 , buehler ltd . , lake bluff , il , usa ) under water lubrication ( figure 1b ) . each slab ( figure 1c ) was trimmed from both sides with a fine diamond bur ( 1040 , kg sorensen ind . ltda , barueri , sp , brazil ) ( figure 1d ) under water lubrication to conform the specimen to an \" hour - glass \" shape and reduce the cross - sectional area of the \" neck \" to approximately 0.5 mm ( figure 1e ) . specimens were prepared from the enamel located at the internal slope of the buccal cusps of teeth7 . from each restored teeth , six slabs were selected based on their integrity after trimming , obtaining one hundred thirty - two trimmed specimens . specimens were randomly assigned to 12 groups ( n = 11 ) as follows : group 1 and 7 - control , no bleaching treatment . unbleached control groups were kept in artificial saliva ( group 1 ) or in 100 % relative humidity ( group 7 ) at 37c for the same time period of bleached groups . for treated groups , the trimmed enamel area was daily exposed to a mixture of 0.1 ml of the respective bleaching agent with 0.05 ml of artificial saliva8for 6 hours , during 14 consecutive days ( figure 1f ) . during the bleaching period , the specimens were placed in 100 % relative humidity at 37 c. after daily bleaching , the specimens were thoroughly rinsed with deionized water for 10 seconds and stored in 0.5 ml of artificial saliva at 37 c ( groups 2 to 6 ) or in 100 % relative humidity at 37 c ( groups 8 to 12 ) , until the next daily bleaching treatment . after the end of the bleaching regimen ( 14day ) , specimens were rinsed and stored in relative humidity for 24 h at 37 c before testing . each specimen was fixed to the \" grips \" of a microtensile testing device with cyanoacrylate glue ( zapit , dva , corona , ca , usa ) and tested in tension in a universal testing machine ( 4411 , instron co. , canton , ma , usa ) at 0.5 mm / min until failure ( figure 1 g ) . after testing , specimens were carefully removed from the fixtures with a scalpel blade and the cross - sectional area at the site of fracture measured to the nearest 0.01 mm with a digital caliper ( 727 - 6/150 , starret , sp , brazil ) to calculate uts expressed in mpa . data were analyzed by two - way ( bleaching treatment and storage factors ) analysis of variance ( anova ) and tukey test at a = 0.05 . tested specimens were allowed to dry in an oven overnight and the fractured edges were sputter - coated with gold ( med 010 , balzers , balzer , leichtenstein ) . sem ( vp 435 , leo , cambridge , england ) photomicrographs of a representative area of the fracture surfaces were taken at 10,000 x . specimens were randomly assigned to 12 groups ( n = 11 ) as follows : group 1 and 7 - control , no bleaching treatment . group 2 and 8 - bleaching with 10 % carbamide peroxide . unbleached control groups were kept in artificial saliva ( group 1 ) or in 100 % relative humidity ( group 7 ) at 37c for the same time period of bleached groups . for treated groups , the trimmed enamel area was daily exposed to a mixture of 0.1 ml of the respective bleaching agent with 0.05 ml of artificial saliva8for 6 hours , during 14 consecutive days ( figure 1f ) . during the bleaching period , the specimens were placed in 100 % relative humidity at 37 c. after daily bleaching , the specimens were thoroughly rinsed with deionized water for 10 seconds and stored in 0.5 ml of artificial saliva at 37 c ( groups 2 to 6 ) or in 100 % relative humidity at 37 c ( groups 8 to 12 ) , until the next daily bleaching treatment . after the end of the bleaching regimen ( 14day ) , specimens were rinsed and stored in relative humidity for 24 h at 37 c before testing . each specimen was fixed to the \" grips \" of a microtensile testing device with cyanoacrylate glue ( zapit , dva , corona , ca , usa ) and tested in tension in a universal testing machine ( 4411 , instron co. , canton , ma , usa ) at 0.5 mm / min until failure ( figure 1 g ) . after testing , specimens were carefully removed from the fixtures with a scalpel blade and the cross - sectional area at the site of fracture measured to the nearest 0.01 mm with a digital caliper ( 727 - 6/150 , starret , sp , brazil ) to calculate uts expressed in mpa . data were analyzed by two - way ( bleaching treatment and storage factors ) analysis of variance ( anova ) and tukey test at a = 0.05 . tested specimens were allowed to dry in an oven overnight and the fractured edges were sputter - coated with gold ( med 010 , balzers , balzer , leichtenstein ) . sem ( vp 435 , leo , cambridge , england ) photomicrographs of a representative area of the fracture surfaces were taken at 10,000 x . two - way anova detected a statistically significant difference among bleaching materials ( p = 0.00002 ) , no significant difference between specimens stored in artificial saliva and relative humidity ( p = 0.738 ) and failed to identify any factor interactions ( bleaching treatment and storage ) ( p = 0.542 ) . tukey test showed that unbleached control groups exhibited higher uts than groups treated with gel formulations containing only 10 % carbamide peroxide . bleaching agents containing 10 % carbamide peroxide with 0.05 % calcium resulted in similar tensile strength for all experimental and control groups tested . sem observations of fractured specimens showed that the fracture mode of unbleached and bleached groups were not similar . unbleached fractured enamel ( groups 1 and 7 ) depicted a compact structure with no clear porosity , showing a typical fractured surface of sound and intact enamel ( figure 2 ) . bleached fractured enamel with 10 % carbamide peroxide ( groups 2 and 8 ) presented prisms dislodged in a cone - like shape and their fractured ends seemed porous ( figure 3 ) . the porosities at prism fractured ends were reduced using carbamide peroxide - based bleaching agents containing fluoride or calcium ( figures 4and 5 ) . the addition of calcium or fluoride in the composition of whitening materials is an alternative to reduce the adverse effects promoted by peroxides during bleaching . studies have shown that enamel alterations are not limited only to the surface and they are also associated with loss of microhardness and strength , inorganic and organic changes1 ,2,10,11,21,23,25,26 . thus , the purpose of formulation of bleaching agent with addition of fluoride and calcium ions would be to increase the saturation of gel , reducing mineral loss and increasing enamel resistance to demineralization caused by peroxides . the gel application composed by only 10 % carbamide peroxide ( groups 2 and 8 ) caused significant decrease in the uts of enamel when compared with untreated groups . the reduction was about 30 % , which was close to that reported by seghi and denry26 ( 1992 ) and cavalli et al. 10 ( 2004 ) . enamel alterations previously described , such as porosites and surface erosion , can be created along the exposed area , which may have acted as stress raisers during testing resulting in premature failures . the shape of specimens in this study formed four ground enamel subsurfaces that are all within 0.35 mm of the center and can increase the changes and damage to enamel promoted by whitening products . clinically , bleaching agents are applied on sound and intact surfaces . however , as enamel presents high permeability to hydrogen peroxide19 , it can penetrate through enamel and dentin due to its low molecular weigth3 ,16 and the entire thickness of the specimen could be modified by prolonged treatments . unbleached fractured enamel showed a typical , transversal fracture pattern of enamel specimens that were stressed in a direction parallel to prismatic orientation7 , and it presented a compact structure without porosities . sem observations of bleached specimens with carbamide peroxide - based agents containing fluoride or calcium showed sound patterns and little difference between groups containing fluoride or calcium and control groups . no major differences were observed among the fluoride and calcium containing - bleaching agents . bleached fractured enamel with 10 % carbamide peroxide ( without fluoride and calcium ) showed cone - like shape prisms with porous fractured ends . this can suggest evidences of the attack of the bleaching agents at the intraprismatic substance ( figure 3 ) . it has been suggested that the porosities tend to be reduced when bleaching agents containing fluoride or calcium were applied ( figures 4and 5 ) . enamel treated with carbamide peroxide - based bleaching agents containing fluoride or calcium did not promote reduction of tensile strength . the presence of calcium and fluoride in peroxide carbamide gel impaired mineral loss usually promoted by bleaching . this fact can be related to supersaturation of the gels with calcium or fluoride . moreoverattin , et al. 5 ( 2003 ) observed that both fluoridated or non - fluoridated gels , at acidic and neutral ph , render the enamel more susceptible to demineralization . the ph was about 6.5 to 7.2 and it is not critical to hydroxyapatite demineralization . indeed , as there was no statistical difference between storage in artificial saliva and 100 % humid atmosphere , it seems that the effects observed were due to calcium and fluoride present in whitening products . some studies proposed fluoride application after whitening procedures4 ,6 , however , if it is possible to prescribe carbamide peroxide and fluoride or calcium in the same vial , it is easier to get better results . the lattice structure observed in the pictures show that maybe fluoride and calcium impaired demineralization or promoted remineralization . it is generally agreed that the major effects of fluoride ion toward enhancing crystal growth and retarding dissolution of dental enamel minerals are derived from the contribution of fluoride ion in the solution phase to increase supersaturation or decrease undersaturation29 . fluoride is important not only to reduce the solubility of hydroxyapatite but also to precipitate products that are relevant on caries development28 . thus , it is pertinent to consider the relative ability of loosely bound fluoride to serve as reservoir sources . the widespread use of bleaching procedures to whiten teeth for esthetic reasons increases the concerns about the safety of peroxide containing tooth whiteners on dental hard tissues . even though no clinical reports about fractures or cracks of bleached dental enamel have been presented in dental literature , this in vitro study showed that a possible reduction in enamel strength might occur after carbamide peroxide bleaching . the clinical implications of carbamide peroxide - based whitening products containing fluoride or calcium must be further investigated . the oxidizing effects of peroxide bleaching gels can render enamel weaker ; however , the whitening treatment with 10 % carbamide peroxide - based bleaching agents containing fluoride or calcium ions did not change the ultimate tensile strength of human enamel .\noutput:\n" }, { "from": "agent", "value": "objective : the aim of this study was to evaluate the effects of carbamide peroxide - based bleaching agents ( cpg ) containing fluoride ( cf ) or calcium ( cca ) on the ultimate tensile strength of enamel ( uts ) . method : a \" cube - like \" resin composite structure was built - up on the occlusal surface of twenty - two sound third molars to facilitate specimen preparation for the micro - tensile test . the restored teeth were serially sectioned in buccal - lingual direction in slices with approximate 0.7 mm thickness . each slice was trimmed with a fine diamond bur to reduce the buccal , internal slope enamel of the cusps to a dumb - bell shape with a cross - sectional area at the \" neck \" of less than 0.5 mm2 . the samples were randomly divided into 12 groups ( n = 11 ) . the control groups were not submitted to the bleaching regimen . specimens were treated with 10 % cpg gel or with 10 % cpg formulations containing cf ( 0.2 % and 0.5 % ) or cca ( 0.05 % and 0.2 % ) . bleached groups received the application of the 10 % cpgs for 6 hours / day at 37 c , during 14 consecutive days and were stored in artificial saliva ( as ) or 100 % relative humidity ( rh ) among each application . after bleaching , specimens were tested with the microtensile method at 0.5 mm / min . data were analyzed by two - way anova and tukey test ( 5 % ) . results : no significant difference was observed between groups stored in as or rh . specimens treated with cf or cca presented similar uts as unbleached control groups.conclusion : either 10 % cpg formulations containing cf or cca can preserve the uts after bleaching regimen ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the incidence rate of this malignancy is steadily rising in developing countries . it is expected to account for 31 % of all new cancer cases among women in usa . in tunisia , the incidence of breast cancer is approximately 19 new cases per 100000 women per year . invasive carcinomas where the basement membrane is totally or partially destroyed represent 7080 % of all breast cancer and include more than 10 different types . among these , infiltrating ductal carcinomas ( idca ) are the most aggressive forms and have a poor prognosis . nowadays , improvement of breast - cancer detection at its early stage through the identification of selective diagnostic biomarkers and targets for therapeutic intervention is of critical importance . alterations that occur in disease versus normal tissues at either the gene or protein level have been regarded as an appropriate way to identify such markers of pathologies . in biomedicine , proteomics , with the recent advances in mass spectrometry , is considered as a powerful analytical method for deciphering protein expression alterations as a function of disease progression . recently , proteomics - based analyses of breast tissue lysates have resulted in the finding of a number of potential tumor biomarkers providing , therefore , a basis for a better understanding of the intracellular signalling pathways leading to breast - cancer development and progression , and eventually serving as diagnostic and prognostic markers . probably the most widely used proteomic technology is the identification of alterations in protein expression between two different samples through comparative two - dimensional gel electrophoresis ( 2 - de ) which provides high - resolution separation of proteins and offers a powerful method for their identification and characterization . actually , there is no universal 2 - de method that can be applied for all types of samples investigated , and protocols must be optimized and adapted according to the types of tissues and proteins of interest . it is also crucial to minimize protein alterations and degradations that could result in artifactual spots and to improve solubilization procedures in order to avoid loss of proteins during extraction . although 2 - de is a laborious method , it is still considered as the principal tool in proteomics since it is able to separate proteins according to two independent physicochemical parameters which are isoelectric point and size , and also it provides the highest resolution in the separation of complex protein mixtures .2 - de remains however , poor resolutive in detecting proteins that are smaller than 10.000 da or are basic in charge . an alternative method for the analysis of basic proteins is found in the application of nonequilibrium ph gradient electrophoresis ( nephge ) , which can provide excellent resolution of basic proteins , offering thus a promising approach for the discovery of tumor - related alterations . in a previous study , we have shown using ief and mass spectrometry that the levels of a number of proteins including fibrinogen - e , which is a potent antiangiogenic factor , were dysregulated in idcas of the breast . in the current report , protein expression profiles issued from breast idcas and their matched surrounding histologically normal tissues were examined by nephge two - dimensional gel electrophoresis and maldi - tof mass spectrometry . using this procedure , we established a nephge -2-de map of proteins altered in idcas of the breast . by comparing 2 - de protein profiles , we report herein the identification of several proteins of interest dysregulated in tumor tissues . these altered proteins belong to multiple cellular pathways and may have a pathological role in breast carcinogenesis . breast tumor samples ( n = 10 ) were selected from patients living in the middle coast of tunisia ( median age at diagnosis of 50 years ) and classified as infiltrating ductal carcinomas . breast tumors were obtained with informed consent according to protocols approved by the institutional review boards of the respective hospitals . carcinomas were pathologically staged according to the tnm ( tumors , nodes , metastasis ) classification system of uicc . all the tumors investigated were classified as t2 / n0 and the grade of the tumors was g3 . breast tumors and surrounding histologically normal tissues were collected at the time of surgery and analyzed by histopathology . the first , middle , and last sections were stained with hematoxylin and eosin , and examined by a pathologist to ensure that at least 70 % of the tissue sections used for the proteomic study contained tumor cells . the nontumor tissues were confirmed by cryostat section before protein extraction . for proteomic analyses , tissue sections verified histologically were suspended and homogenized in 250 l of 2 - de analysis buffer : 7 m urea , 2 m thiourea , 4 % chaps , 0.5 % dtt , and 2 % ampholytes ( 1 part ph 3/10 , 1 part ph 5/7 , 2 parts ph 6/8 ) . the clear supernatant issued after centrifugation of the homogenate at 12500 g for 15 minutes was transferred to a sterile microcentrifuge tube and immediately subjected to 2 - de analysis . protein contents were determined according to the procedure described by bradford and modified by ramagli and rodriguez . equal amounts of proteins ( 100 g ) issued from tumor or nontumor breast tissues were applied to the first dimension and at least three nephge gels were run for each sample . extraction of proteins , solubilization , nephge , and sds - page were carried under similar conditions for the tumor and nontumor tissues . the alterations reported in the current study were retained after 2 - de analysis of protein extracts issued respectively from different frozen sections of the 10 tumor and nontumor samples investigated . the reproducibility was about 85 % or more which reflected the small variances between samples or running . the dye solution contained 17 % ( w / v ) ammonium sulfate , 3 % ( v / v ) phosphoric acid , 0,1 % ( w / v ) coomassie g250 , and 34 % ( v / v ) methanol . the staining solution was changed once after 12 hours staining and the gel slabs subjected to a 24 - hour cycle for increasing dye deposition on low - abundance proteins . the detection was then increased by placing the gel into 1 % v / v acetic acid for producing a better contrast between spots and gel . coomassie stained gels were scanned and spot detection and quantification were carried out using pdquest 2 - d software version 7.2 ( biorad ) . proteins with significant and reproducible changes between tumor and nontumor tissues were considered as differentially expressed . the individual spot volumes were normalized by dividing their optical density ( od ) volumes by the total od values of all the spots present in the gel and expressed as % vol . the significance of expression between tumor and nontumor tissues was estimated by student 's t - test , p .05 . picked spots were washed with 100 l of 25 mm nh4hco3 and dehydrated with 100 l of acetonitrile ( acn ) . this operation was repeated twice and the pieces of gel were dried under vacuum for 10 minutes . reduction was achieved by 1 - hour treatment with 10 mm dtt in nh4hco3 buffer ( 100 l ) at 56c . after discarding the dtt solution , alkylation reaction was performed by the addition of 100 l of 25 mm iodoacetamide in 25 mm nh4hco3 buffer for 1 hour at room temperature , protected from light . finally , the excised gel pieces were again washed 3 times for 5 minutes with 25 mm nh4hco3 and acn alternately . the dried gel volume was evaluated ( about 1 to 2 l ) and 3 volumes of trypsin ( promega , v5111 ) , 12.5 ng / l , in 25 mm nh4hco3 buffer ( freshly diluted ) , were added . afterwards , 5 l of 35 % h2o / 60 % acn / 5 % hcooh were added and the mixture is sonicated for 30 minutes and centrifuged in order to extract tryptic peptides . mass measurements were carried out on a biflex iii maldi - tof ( bruker , daltonics , bremen , ge ) equipped with the scout high - resolution optics with x - y multisample probe and gridless reflector . this instrument was used at a maximum accelerating potential of 19 kv ( in positive mode ) and was operated in reflector mode . a saturated solution of - cyano -4-hydroxycinnamic acid ( sigma , saint louis , mo ) in acetonea first layer of fine matrix crystals was obtained by the spreading and fast evaporation of 0.5 l of matrix solution . on this fine layer of crystals , a droplet of 0.5 l of aqueous hcooh ( 5 % ) solution was deposited . afterwards , 0.5 l tryptic digest were added and mixed to a second dried under vacuum . the sample was washed once by applying 0.7 l of aqueous hcooh ( 5 % ) solution on the target and then flushed after a few seconds . in positive mode , internal calibration was performed with tryptic peptides coming from autodigestion of trypsin , with respectively monoisotopic masses at m / z = 842.510 and m / z = 2211.105 . for the mass measurements , up to 1 missed tryptic cleavage and optional methionine oxidation were considered . in most cases , the mass accuracy was less than 50 ppm , a value which is generally considered adequate for achieving statistically significant results for protein identification . these files were then fed into the search engine mascot ( matrix science , london , uk ) . ihc analysis of - b crystallin was performed on formalin - fixed , paraffin - embedded sections of idca breast tumors . briefly , five - micrometer sections were deparaffinized in toluene and subsequently hydrated with graded ethanol , and rehydrated in water . slides were microwaved in 0.01 m citrate buffer at ph 6.0 for 20 minutes at 750 w. thereafter , sections were rinsed thoroughly with water and placed in a tris buffered saline ( tbs ) solution ( 0.05 m tris - hcl ph 7.6 , 1.15 m nacl ) . endogenous peroxidase activity was blocked with hydrogen peroxide solution for 7 minutes and sections were rinsed gently with tbs . sections were then incubated at 4c overnight with the antibody against - b crystallin ( ab1546 , chemicon ) at a dilution of 1 : 1000 . after rinsing in tbs , sections were incubated with the secondary antibody , dakocytomation envision + dual link system peroxydase ( dakocytomation , glostrup , denmark ) , for 30 minutes . sections were washed 2 times with tbs , followed by application of the diaminobenzidine substrate pack according to the manufacturer 's instructions ( dakocytomation ) , yielding a brown - colored signal . standardization of the incubation and development times allowed an accurate comparison of expression levels in all cases . cases were considered positive if 10 % or more of the tumor cells showed unequivocal immunoreactivity . in the current study , we have used an nephge -2-de protocol for the analyses of basic proteins , and using this procedure established an nephge -2-de map of proteins altered in idcas of the breast . since nephge is stopped before equilibrium is attained , accurate experimental estimation of the pis of the dysregulated proteins can not be made by this method . table 1 depicts the theoretical isoelectric points ( pis ) and molecular weights of altered proteins in tumor tissues , many of which are basic . in our hands , while nephge -2-de allowed the resolution of basic proteins , ief -2-de resulted as expected in the stacking of most of basic proteins at the basic end , even if the ief ph gradient has been extended to higher ph values . in our hands , a comparison of the 2 - de protein patterns obtained at constant voltages of 400 v for 3 hours ( 1200 v - hr ) or 4 hours ( 1600 v - hr ) showed an optimal resolution of basic proteins at 1200 v - hr while preventing basic proteins from running off the basic end of the gels . by using the protein extraction procedure listed in section 2 , an average amount of 100 g of total proteins from each sample was used in 2 - de investigations . figure 1 displays electrophoresis patterns of proteins from tumor and nontumor samples subjected to nephge -2-de electrophoresis . by using this procedure , we have found that the majority of the proteins displayed were not different in abundance between normal and cancer tissues . protein alterations occurring in the tumor and normal tissues are highlighted with arrows ( figure 1 ) . among the proteinsidentified , the levels of 13 proteins were increased in the tumor samples , while 7 proteins were rather observed at higher amounts in the nonneoplastic breast tissues . these alterations were regarded as serious alterations occuring between tumor and nontumor tissues . altered proteins were subsequently excised and subjected to in - gel tryptic digestion and maldi - tof analyses . figure 2 shows an example of maldi - tof peptide mass fingerprints of the tryptic digests corresponding to alpha b - crystallin . a wealth of evidence suggests that most of these dysregulated proteins are closely related to neoplastic transformation . these proteins could be classified on the basis of their functions into stress - related , chaperoning proteins , cytoskeletal - related proteins , metabolic enzymes , and other molecules related to immunological responses . some of these alterations depicted in figure 1 involve co - upregulations of glycolytic enzymes ( enolase1 , spot 8 ; phosphoglycerate kinase 1 , spot 9 ) in tumor tissues , as well as , proteins involved in antioxidation pathways including peptidylprolyl isomerase a ( spots 15 , 16 ) , which has been reported to protect cells against oxidative stress and manganese superoxyde dismutase ( mn - sod , spot 12 ) . two other newly identified proteins related to immunologic responses present at lower levels in tumor tissues include complement component c3c ( spot 1 ) and ighg1 ( spots 26 ) . more interestingly , the levels of raf kinase inhibitor protein ( spot 14 ) were found to be overexpressed in cancer tissues indicating a possible special pathological role for this protein in breast carcinogenesis . other alterations more represented with respect to the idca tissues include heat shock proteins ( hsp27 , spots 18 , 19 ) and - b - crystallin ( spot 13 ) . subsequent immunohistochemical staining against - b - crystallin has also been performed ( figure 3 ) . expression of - b - crystallin was noted in all cases investigated and positivity has been retrieved in 80 to 90 % of tumor cells . the signals detected in tumor cells were strong whereas epithelial cells of the normal tissues express lower levels of this protein . proteomics - based studies are increasingly used to examine cancer - related changes in protein expression . such protein alterations may eventually contribute to increase our understanding of the disease pathogenesis as well as in the development of effective strategies for diagnosis and treatment . the present study aims to investigate protein alterations in idcas of the breast using an nephge -2-de procedure . as shown in this comparative analysis , certain specific proteins were dysregulated in idcas compared with their paired normal samples . these altered proteins were subsequently analyzed by mass spectrometry and unambiguously assigned on the basis of maldi - tof spectra obtained after trypsin digestion ( table 1 ) . the proteins identified span a wide range of functions and may have a value as diagnostic and prognostic biomarkers for breast cancer . among the proteins identified , we established that there is a decreased expression of igg1 and complement component c3c proteins in breast - tumor tissues . these alterations related to immunologic responses constitute novel identifications that were not previously reported as potential markers of idca breast tumors . as shown in figure 1 , the igg1 proteins were observed as multiple protein spots with different isoelectric points and similar molecular weights . as displayed in nephge -2-de gels , these proteins appeared intact as judged by their apparent molecular mass and were closely associated with nonmalignant tissues . consistent with our findings , several studies have shown that malignant diseases of various tissue origin are associated with a shift in the igg subclass distribution . for example , the decrease of igg1 serum levels reported in colorectal cancer has been considered as an early tissue nonspecific indicator of malignant transformation that could be useful in the primary diagnosis of colorectal tumors . such alterations were recently reported to occur in colorectal adenocarcinomas and normal colorectal tissues using suppression subtractive hybridization techniques . a highly reduction of the percent of igg1 in several gynecologic malignant diseases has also been correlated with early carcinoma stages and was found as a reliable marker that discriminates between cancer patients and controls with a specificity ranging between 90 and 100 % . the reduction in igg1 plasmatic levels has also been reported as a highly sensitive tumor marker for detecting primary and metastatic squamous - cell carcinomas of the head and neck , and was significantly correlated with early stages of invasive breast cancer . up to now , such alterations in igg1 levels were found with neoplastic diseases only and may likely reflect changes in the host 's immune system linked to the presence of malignant tumors . recent data unveiled that malignant tumors of various tissues lead to irregularity of the biosynthesis of igg1 and igg2 by affecting their messenger rna levels in b - cell lymphocytes . it has been hypothesized in this context that cancer cells may affect the synthesis of such igg subclasses by acting on the t - helper 1 / t - helper 2 ratio in the host , and , consequently , affect the level of specific cell - derived cytokines implicated in human igg synthesis . our observation of underexpression of igg1 in idcas with regard to nontumor tissues may therefore , indicate a similar tumor - associated mechanism by which cancer cells affect igg1 synthesis . further investigations are needed however , to elucidate how malignant breast tissues may interfere with the t - cell mediated regulation of igg suclasses . interestingly , downregualtion of igg1 levels and concomitant downregulation of complement component c3c were observed in our results . to our knowledge , no studies have yet reported the decreased expression of this protein in idcas of the breast . the differential tissue expression of this complement protein provides evidence for the involvement of anti - inflammatory processes in idca tissues and may indicate a selective adaptation by breast tumors to escape elimination by antitumor immune responses . until recently , several studies with normal and malignant tissues have disclosed the presence of several immune escape strategies by which cancer cells protect themselves from the lytic action mediated by complement . several evasion strategies to complement attackhave been reported in malignant cells and include complement protective proteins ( cd46 , cd55 , cd59 ) , membrane proteases reported to confer complement resistance by removing cell - bound complement components such as c3 and tumor secreted complement inhibitors . such inhibitory mechanisms , often upregulated in tumors , are thought to increase resistance to complement in malignant tissues through inhibition of serum complement activation upon cancer cells . a previous study using a rat model of human breast cancer unveiled that inhibitors of complement activation may facilitate tumor growth and enhance tumorigenicity of breast - cancer cells by inhibiting c3 deposition . the present downregulation of complement c3 component c3c in idcas may , therefore , indicate the involvement in breast tumors of similar complement inhibitory mechanisms . the raf kinase inhibitor protein ( rkip ) known also as phosphatidylethanolamine binding protein - 1 ( pebp - 1 ) is another basic protein that has been described as being a component of the important feedback inhibition in g - protein coupled signal transduction . it is also involved in the regulation of the nf - kappa b pathway and is associated with resistance to tnf - by inhibiting activation of the raf 1 / mek / extracellular signal regulated kinase pathway , jnk , and phosphatidylethanolamine ( pe ) externalization , which is an early symptom of apoptotic cell death resulting in the total loss of asymmetric distribution of aminophospholipids in the plasma membrane bilayer . it has also been reported that overexpressing a new member of the pebp family ( pebp - 4 ) correlates with both a decreased tnf -- induced pe externalization and resistance to tnf -- induced apoptosis . interestingly , recent data revealed that silencing of pebp - 4 expression in mcf - 7 breast - cancer cells promotes tnf -- induced apoptosis , as well as tnf -- induced erk and jnk activation making this pe binding protein as a promising target for the treatment of breast cancer . overall , the present findings in idcas of the breast might reflect the previously reported results for the relation between pe - binding proteins and tnf - related apoptosis pathway . the present increase in rkip may confer breast - cancer cells to an advantage for survival and proliferation . from our results , the high abundance of hemoglobin in breast tumors could not be considered as a reliable parameter for distinguishing between tumor and nontumor tissues . indeed , the relationship between tissue hemoglobin levels and breast tumors appears indirect and indicates rather an enhanced blood supply to the tumor . since tumor angiogenesis is a crucial arbiter of breast - cancer growth / metastasis , this higher level of hemoglobin is consistent with the higher vascular density of growing tumors compared with normal tissues . besides these alterations , the concomitant upregulation of two other stress - related proteins ( peptidylprolylisomerase a , mnsod ) was observed in idcas . the peptidylprolylisomerase a also called cyclophilina ( cypa ) is described as being involved in protein folding and catalyzes the cis / trans - isomerization of peptide bonds preceding a proline residue . it is secreted by cells in response to both inflammatory stimulation and oxidative stress . our observation on the expression of cypa is consistent with the published results from studies on other cancers . overexpression of cypa has been reported in colorectal carcinomas in comparison to normal mucosa and is involved in lung - tumor growth by affecting proliferation and apoptosis . a recent study has shown that both cypa and its receptor cd147 are upregulated in human pancreatic adenocarcinomas compared to normal pancreatic ductal epithelium . these authors pointed that cypa is a promoter of pancreatic tumor growth and is involved in chemotaxis and cell signalling cascades . the present finding reveals a similar correlation , implying that breast carcinomas may share a similar mechanism of cell proliferation mediated by cypa . the mnsod is a mitochondrial enzyme that has been reported to protect cells against oxidative stress by increasing the dismutation rate of superoxide anion ( o2 ) to hydrogen peroxide ( h2o2 ) whichthe role of this antioxidant enzyme in carcinogenesis is still however controversial and unclear . in fact although , it has been reported to suppress apoptosis and protect cells against several insults , under some circumstances , the mnsod may prevent cell proliferation . although further studies are needed , the present elevation of mnsod may indicate that the antioxidant defense system has been stimulated in invasive carcinomas of the breast , highlighting the ability of tumor cells to prevent damage due to reactive oxygen species . interestingly , the co - upregulation of two glycolytic enzymes , enolase 1 and phosphoglycerate kinase 1 ( pgk - 1 ) also occurred in idca tissues . these enzymes are key components of the glycolytic pathway that have shown a prior relationship to cancer . indeed , our observation of increased expression of enolase 1 and pgk - 1 is supported in various tumor tissues and may relate to the increased requirement of both energy and protein synthesis / degradation pathways during carcinogenesis . this increased glycolytic metabolism is also thought to regulate hypoxia - inducible gene expression in solid tumor tissues and participates in angiogenesis . the protein cofilin - 1 also was identified as differentially expressed between tumor and normal tissues . this protein is recruited at the leading edge of cells where its activation is essential for polarized migration . cofilin - 1 is directly implicated in severing actin cytoskeleton filaments and regulates the polymerization / depolymerization of actin during cell migration . it has been recently demonstrated that cofilin expression is required for tumor cell invasion since inhibition of cofilin activity in carcinoma cells inhibits cell motility whereas increased expression correlates with enhanced cell migration . have demonstrated that overexpression of cofilin - 1 is necessary for the activation of the cofilin pathway resulting in cell motility , invasion and metastasis . this protein has also been associated with melanoma cell invasion and migration via its interaction with the v3 integrin . overall , the current findings support the recently identified role for cofilin activity and highlight its involvement in invasive lesions of the breast as a determinant factor required for cell migration and invasion . the molecular chaperone hsp27 and alpha b - crystallin , which is a small heat shock protein ( hsp ) are two other dysregulated proteins in tumor tissues . in a previous investigation , we have reported that three other molecular chaperones ( grp78 , calreticulin , protein disulfide isomerase ) are differentially expressed in breast tumors . the concomitant upregulation of these hsps together with alpha b - crystallin and hsp27 is not surprising since chaperones are thought to work cooperatively to fulfil their functions . due to the capacity of hsps to preventstress - accumulated , unfolded , and nascent protein aggregation , their expression has proven to have important pathological implications such as cell proliferation and disease prognosis . the hsp27 is a molecular chaperone whose rate of synthesis increases many folds in response to environmental stress and during malignant transformation . as shown in figure 1 , this protein exists as two distinct isoforms that were confirmed by mass spectrometry as hsp27 ( table 1 ) . although no evidence of posttranslational alterations was pointed out , these isoforms as reported in renal cell carcinomas might reflect phosphorylation or other posttranslational modifications . in the last years , the role of alpha b - crystallin in cancer pathology has been widely discussed with regard to its potential oncogenic role . previous studies unveiled that this small hsp may constitute a good target for modulating cell death pathways . its expression has been shown to inhibit both the mitochondrial and the receptor death activation pathways of caspase 3 and correlates with trail resistance in a panel of cancer cell lines . this protein may also be an interesting molecular target for exploring the evolution and the origin of breast tumors since higher alpha b - crystallin levels were reported in ductal carcinoma in situ , which is an earliest form of detectable breast cancer . although further studies are needed to answer how this oncoprotein contributes to breast cancer , the data reported herein highlight the importance of this molecular chaperone in invasive carcinomas as a biomarker that may play a distinctive role in the process of carcinogenesis . in summary , our data have shown the value of using an nephge 2 - de based proteomic approach in identifying potential molecular alterations and targets for breast - cancer therapeutics and diagnostics . we have identified a number of tumor - associated proteins including chaperones , energy - producing enzymes , stress - related proteins , proteins involved in apoptosis and cell motility , as well as alterations highlighting changes in the host 's immune system linked to the presence of malignant tissues . these protein variations indicate that multiple cellular pathways are involved in the process of breast carcinogenesis . such alterations may help to better understand the pathology of this disease and may have potential clinical applications as cancer biomarkers .\noutput:\n" }, { "from": "agent", "value": "improvement of breast - cancer detection through the identification of potential cancer biomarkers is considered as a promising strategy for effective assessment of the disease . the current study has used nonequilibrium ph gradient electrophoresis with subsequent analysis by mass spectrometry to identify protein alterations in invasive ductal carcinomas of the breast from tunisian women . we have identified multiple protein alterations in tumor tissues that were picked , processed , and unambiguously assigned identities by matrix - assisted laser desorption / ionization - time of flight mass spectrometry ( maldi - tof ) . the proteins identified span a wide range of functions and are believed to have potential clinical applications as cancer biomarkers . they include glycolytic enzymes , molecular chaperones , cytoskeletal - related proteins , antioxydant enzymes , and immunologic related proteins . among these proteins , enolase 1 , phosphoglycerate kinase 1 , deoxyhemoglobin , mn - superoxyde dismutase , - b - crystallin , hsp27 , raf kinase inhibitor protein , heterogeneous nuclear ribonucleoprotein a2 / b1 , cofilin 1 , and peptidylprolyl isomerase a were overexpressed in tumors compared with normal tissues . in contrast , the ighg1 protein , the complement c3 component c3c , which are two newly identified protein markers , were downregulated in idca tissues ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: pulmonary thromboembolism ( pte ) is among the most common causes of maternal death during pregnancy and puerperium worldwide and is the leading cause of maternal mortality in developed countries . pregnancy could be considered as an example of virchow 's triad : hypercoagulability , venous stasis , and vascular damage . this is the reason that prevalence of thromboembolism in pregnant women is about two , four , or even five times greater than for non - pregnant women of same age group . the greatest risk is in postpartum period , which is increased as approximately 30-fold in comparison to age - matched group . the clinical diagnosis of pte in normal population is usually difficult , but it is more complicated in pregnant patients , because physiologic changes of pregnancy can mimic signs and symptoms of pulmonary embolism confusing clinicians to make decision that in which situation they must pursue a diagnosis of pulmonary embolism and request imaging modalities . apart from this , the wells criteria and genova score used for predicting clinical probability of pulmonary embolism could not be used for pregnant population . to compound this problem , d - dimer which is the most frequent laboratory test in normal population with suspected pte has not acceptable efficacy during pregnancy , because in normal pregnancy d - dimer is usually increased . even though , normal d - dimer levels seems to be rarely expected , especially in late pregnancy , european guidelines asserted that normal d - dimer levels can rule out pte in pregnancy ; however , this is not essentially supported by american thoracic society ( ats ) , concerning a retrospective study and two case reports which found negative d - dimer in confirmed cases of pte which were pregnant . in the same way , although some studies showed 100 % sensitivity for d - dimer in the diagnosis of deep venous thrombosis ( dvt ) in pregnancy , there is one case report of negative d - dimer in acute dvt during pregnancy . moreover , the most important challenge in the pte of pregnancy is that both false - negative and false - positive diagnosis , which are not uncommon , have serious consequences for both mother and fetus . missing the diagnosis of pte carries high mortality rate . as mallick and petkova reported , undiagnosed pte has a mortality rate of 30 % which decreased to 2 - 8 % in diagnosed and properly treated patients . on the other hand , false - positive diagnosis carries potentially side effects and consequences . a diagnosis of pte for a pregnant mother posses some important implications including need for long - term anticoagulation , avoidance of breast feeding if an oral anticoagulants is used , the potential need for prophylaxis during future pregnancies , and concern about future oral contraceptive use . anticoagulation with heparin is the mainstay of treatment in pregnancy ; however , it is not devoid of any side effect . ct pulmonary angiography ( ctpa ) and lung scintigraphy which are the most frequently used imaging modalities have also some related deficit because they expose mother and fetus to potentially risks of radiation and on the other hand diagnostic adequacy of them is lower than in non - pregnant population . these two major problems with imaging modalities are more highlighted concerning the high mortality rate of undiagnosed cases in one hand and serious consequences of false - positive diagnosis of pte for a pregnant woman on the other hand . regarding to these introduced challenges , this article aim to review diagnostic adequacy , pitfalls , related radiation , routes of optimization and recommended protocols for these two modalities , and overall imaging modalities of pte in pregnancy . so , pubmed search with key words of pulmonary , embolism , thromboembolism , pregnancy , scintigraphy , ct angiography , and radiation was performed , with no any date limitation up to may 2012 . at present , there have been no randomized trials or prospective studies in detection of pte in pregnancy ; so , there is currently no specific diagnostic algorithm for suspected pte in pregnant population ; however , different methods , related documents and recommended algorithm are discussed and reviewed as follows . lower limb compression ultrasonography ( cus ) has been proposed as the first - line imaging modality for pregnant women with suspected pulmonary symptoms , suggesting pte . although the benefit of using cus is potential avoidance of next step radiation - associated tests ( in positive cases ) , only small proportion of cus studies are positive , and it is estimated that the number of women need to do test would likely be several - fold higher , due to lower prevalence of pte . in a study by chan et al . , 55 % of pregnant women with suspected pte underwent either cus or impedance plethysmography , but all results were negative . furthermore , cus is problematic in pregnant women due to swollen legs in the absence of dvt . according to evidence - based guidelines , using the grade of recommendation , assessment , development and evaluation ( grade ) system , by multidisciplinary panel of ats , it is recommended that in pregnant women with suspected pte , cus is performed in the presence of signs and symptoms of dvt , and in absence of signs and symptoms of dvt , cus would not be first imaging modality ; however , european society of cardiology ( esc ) advocate cus for all pregnant women with suspected pte and a positive d - dimer test . second - line radiation - associated imaging begins usually with chest x - ray ( cxr ) , but choosing the next step is more debated . both fleischner society and british thoracic society guidelines agree that ctpa is the first imaging test of choice in general population who are suspected to have pte ; however , none of them indicate which technique is preferred in pregnancy . ridge et al . had noticed considerable number of ctpa in pregnant women which had poor quality resulted in inadequacy of test and repetition of examinations . similar findings were also noticed in other studies which dealt with the incidence of diagnostic inadequacy , related causes and modification of techniques . the rate of technical inadequacy of ctpa ranges between 17 to 36 % according to some studies , which was higher than non - pregnant group , but shahir et al . reported that only 5.6 % of pregnant women had poor quality image similar to non - pregnant group . cardiac output increases during pregnancy to about 50 % above non - pregnant levels and this leads to earlier arrival and stronger dilution of contrast material . shortening of start delay against fixed start delay of 20 second , as used , and also bolus triggering will allow better quality of study and this could be highlighted by using contrast agents with higher iodine concentrations ( 350 - 400 mgi / ml ) or increasing flow rate of injection from 4 to 6 ml / s . respiratory physiological changes of pregnancy is other point of notice , leading to more artifactual images in pregnant women and contribute to impairment in good arterial opacification , because deep inspiration in pregnant women may increase influx of non - opacified blood via inferior vena cava into the right heart . this effect can disappear by valsalva maneuver or request the patient to do shallow respiration during exposure . finally , using low kvp ( kilovoltage ) technique has shown to substantially increase contrast enhancement and also the fastest available scanners are recommended to use for pregnant women . regarding to better results of ctpa in more recent studies , and considering modification protocols which could potentially improve the quality of images together with this reality that ct scan also detect other important parenchymal findings , explain patient 's symptoms , ctpa remains the mainstay imaging modality in pregnant women suspected to have pte . on the other hand , lung scintigraphy as another main diagnostic modality for pte evaluation uses a radio pharmaceutical agent to assess pulmonary perfusion and also usually includes a ventilation scan . several studies have focused on value of scintigraphy for evaluation of pte in pregnancy or compared accuracy , diagnostic adequacy and radiation of ctpa , and lung scintigraphy . diagnostic inadequacy of lung scintigraphy reported by ridge et al . also , cahil et al . found that non - diagnostic study is less for scintigraphy compared to ctpa 13.2 % vs 17 which is more highlighted in subgroup with normal cxr ( 5.6 % vs 30 % ) ; however , revel et al . reported no significant difference in the rate of indeterminate findings between these two tests . found equivalent image quality and negative predictive value for these two modalities , and noted that the choice of study should be based on other considerations such as radiation concern , cxr findings , equipment availability , or clinical suspicion for alternative thoracic diagnosis . according to these concepts and evidence - based guidelines , it is recommended to take cxr as the first radiation - associated imaging in the pregnant women with suspected pte ; then , in the patients who have normal cxr , lung scintigraphy is recommended as the next imaging test rather than ctpa ; reversely , in the presence of abnormal cxr , ctpa should be next test rather than scintigraphy . a very important cause of hesitancy about using these radiation - associated modalities and challenge in choosing one of them is the potential risk of radiation and comparison between radiation dosages of both tests . the biological effect of radiation could be dose dependent ( deterministic ) , has a threshold which above it severity is increased , or be non - deterministic ( stochastic ) , which has no threshold . on the whole , in medical imaging like ctpa and lung scintigraphy , deterministic effect is unlikely and the major worry is about stochastic effects including teratogenicity and oncogenicity . fetal radiation by diagnostic imaging modalities causes no measurably increased prenatal death , malformation , or impaired mental development , but carcinogenesis induced by low - level radiation is more considered , despite no direct evidence supporting it . valentine reported that in utero exposure of fetus to 0.01 gy increases the probability of cancer risk in first and second decades of life from 0.03 % to 0.04 % , but radiation exposure by both ctpa and scintigraphy are much lower than this value . on the other hand , the minimum dose required to produce teratogenicityis not known in human being ; however , according to animal and few human studies , 0.1 gy is considered as a level beyond which teratogenic effect could be expected , but similarly mean fetal radiation from ctpa and from scintigraphy are much lower than this value . fetal dose by ctpa is about 0.03 - 0.66 mgy and for lung scintigraphy is more ( about 0.32 - 0.74 mgy ) . this wide range of values is due to variable protocols , different equipments , and size and age of fetus . ctpa has the intrinsic advantage that fetus is not exposed directly , but in lung scintigraphy , radiotracer is injected intravenously and lead to direct fetal exposure , this is the cause that radiation exposure of fetus by lung scan is more than ctpa . other important consideration is mother radiation which is important due to direct radiation to radiosensitive breast tissue which is more serious because the risk of breast cancer is inversely related to woman 's age at the time of exposure , and breast dose is higher by a factor of 2 , more than defined effective dose of each test , because breast tissue is very close to skin . whole body effective dose of a woman who underwent ctpa is 4 - 18 msv and for lung scintigraphy is 1 - 2.5 msv ; however , estimated breast dose from ctpa is 150 times more than scintigraphy . use of breast shields could reduce this dose to about 40 to 55 % or even up to 73 % and may be more considered in future . also , technologist must consider other options which can reduce the amount of radiation such as reducing z axis or manipulating milliampere , kvp , pitch , and rotation time . the risk of fetal exposure to iodinated contrast media has not been fully investigated ; however , there is no report of their teratogenicity in the literature . also , in animal studies , there is no teratogenic effect , so they are classified as category b by federal drug administration ( fda ) . the main potential risk might be due to free iodine and possible secondary neonatal hypothyroidism , which leads to this recommendation that these neonates must be evaluated for thyroid function tests in first week after birth ; however , in a study by bourjeily et al . on 344 pregnant women underwent ctpa , there was no abnormal thyroxin level among their neonates . the more important risk is for gadolinium , which has had teratogenic effect in animal studies , but not approved by few human studies , so it is classified as group c by fda . in general population , there are no sufficient studies to evaluate the role of non - contrast magnetic resonance pulmonary angiography ( mrpa ) for detection of pte , and consequently , in pregnant women , its performance is not yet studied . on the other hand , gadolinium is contraindicated during pregnancy , so contrast - enhanced mrpa which is used in general population with sensitivities ranging from 31 % to 92 % and specificities ranging from 85 % to 100 % to detect pte , is contraindicated in pregnancy . serious consequences of positive or negative false diagnosis in one hand , against potential risk of radiation and also increased rate of test inadequacy , on the other hand , highlight this challenge . in each case , the risks and benefits must compare to make decision , but if clinician is suspicious , the risk of mortality is far overweight the potential radiation exposure risk . if patient has leg symptoms , cus will be the next step , otherwise cxr must be taken . in patients with normal cxr , the next recommended modality would be scintigraphy , but if cxr is abnormal , ctpa is preferred . recommended protocols for improving diagnostic adequacy of these modalities and reducing mother and fetus radiation exposure should also be considered .\noutput:\n" }, { "from": "agent", "value": "pulmonary thromboembolism ( pte ) in pregnancy as a common cause of maternal death has been a challenge for both clinicians and radiologists . choosing the appropriate modality in each case has been under question and there are also related imaging pitfalls and hesitancy about radiation exposure and using contrast media for a pregnant mother . the aim of this article is to review the imaging modalities used to investigate pte in pregnancy , related pitfalls , and recommendations for optimizing them ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: plasmodiophora brassicae ssi e4 and e9 collected as isolates from diseased hosts were identified as race 4 and race 9 , respectively , via inoculation into williams ' differential varieties . these ssis were mass - propagated in the sensitive chinese cabbage cultivar ( black pearl , dongbu hannong co. ) and subsequently used in this study . ( 1994 ) was conducted in a side - by - side fashion to eliminate the impurities , except for resting spores originating from plant tissue . first , the root galls were washed several times with running water to eliminate soil particles and foreign materials , after which the resting spores of p. brassicae were separated after grinding the samples in sterilized water with a homogenizer ( 13,500 rpm / 5minutes ) . plant tissues and impurities of chinese cabbage were eliminated from a suspension prepared from root galls via filtration through sterilized gauze folded eight times followed by 15 minutes of centrifugation at 3,000 rpm , after which the pellet was recovered and subjected to the sucrose method . the concentration of the refined spore suspension was adjusted to 110 spores / ml using a haemacytometer , and 0.5 l of the suspension was then dropped onto a cover slip using a micro - pipette . once the single resting spores were confirmed , two - or three - day - grown seedlings were placed on the cover glass containing the spores and then covered lightly with sterilized fine soil , after which they were planted in pots and covered with vinyl for one day to maintain humidity . the plants were subsequently cultivated for seven to eight weeks at 20 ~ 25 in a greenhouse ( kageyama et al . , 1995 ) . genomic dna of p. brassicae was extracted via the ctab method ( doyle and doyle , 1990 ) . by performing the single spore isolation mentioned above in conjunction with the sucrose method , foreign materials originating from a host plant were removed . the sample was then centrifuged at 3,000 rpm for 15 minutes , after which the pellet was removed and treated with 50 l dnase i ( sigma , d - 4263 ) at 50 unit / ml . next , 300 ppm streptomycin and 100 ppm rifampicin were applied and the sample was incubated at 37 for one hour . to inactivate the dnase i , 5 l of proteinase k ( 25 g / l ) were added to the sample , which was subsequently incubated at 37 for one hour . next , 300 l of 5 mm edta was added and the sample was then treated at 80 in a heating block for 5 minutes . the conidial suspension with inactivated dnase i was then centrifuged again at 4,000 rpm , after which the supernatant was removed and the pellet was freeze - dried and stored until subsequent use . for dna extraction , the pellets were thoroughly ground with 0.2 g glass beads ( 0.09 ~ 0.15 mm diameter ) using a pellet pestle ( sigma ) , after which 400 l of extraction buffer [ 200 mm tris - cl ( ph 8.0 ) , 200 mm edta , 1.4 m nacl , 1 % pvp ] were added . the mixture was then extracted with 600 l of chloroform : isoamyl alcohol ( 24 : 1 ) , after which dna extraction and purification was conducted using a g - spintmgenomic dna extraction kit ( intron biotechnology , korea ) . the purified dna was then eluted in 200 l of h2o in the final step , and the samples were maintained at -20 until subsequent analysis . the primers tested in this study were the 12 urp primers provided in a uniprimertm kit ( seoulin bioscience institute , korea ) , operon 10 - base primer for dna polymorphism analysis ( mller and harling , 1996 ) and the rfm8 - 1 , rfm8 - 2 primer set for race determination ( klewer et al . the effective primers , upr - 3 ( 5 ' - cccagcaactgatcgcacac - 3 ' ) , urp - 6 ( 5 ' - atgtgtgcgatcagttgctg - 3 ' ) and opa - 07 ( 5 ' - agtcagccac - 3 ' ) , were employed in this study . urp - pcr reactions were conducted in a reaction mixture with a final volume of 30 l that contained 5 ng of genomic dna , 100 ng urp primers , 800 m dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd . pcr reactions using opa - 07 were conducted in a reaction mixture with a final volume 50 l that contained 10 ng of genomic dna , 1 m operon 10 - base primer , 2 mm dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd . korea ) ( table 1 ) . for variation analysis in the same generation of p. brassicae , root galls that were obtained from the black pearl cultivar after inoculation with the e4 and e9 isolates were divided into five pieces and the dna was extracted from each piece , after which rapd analysis was conducted using the urp 3 and urp 6 primers to reveal the active polymorphisms between the pathogen isolates . to investigate patterns of longitudinal variation of the pathogen , second and third generations were made through regrowth after single spore inoculation with e4 as an original generation . to determine the genetic stability among generations , rapd analysis was conducted using the urp 3 and opa - 7 primers . the isolate , e4 , was used for this study because it showed the strongest pathogenicity ( jang , 2006 ) and is easy to form the gall by inoculation of single resting spore . plasmodiophora brassicae ssi e4 and e9 collected as isolates from diseased hosts were identified as race 4 and race 9 , respectively , via inoculation into williams ' differential varieties . these ssis were mass - propagated in the sensitive chinese cabbage cultivar ( black pearl , dongbu hannong co. ) and subsequently used in this study . ( 1994 ) was conducted in a side - by - side fashion to eliminate the impurities , except for resting spores originating from plant tissue . first , the root galls were washed several times with running water to eliminate soil particles and foreign materials , after which the resting spores of p. brassicae were separated after grinding the samples in sterilized water with a homogenizer ( 13,500 rpm / 5minutes ) . plant tissues and impurities of chinese cabbage were eliminated from a suspension prepared from root galls via filtration through sterilized gauze folded eight times followed by 15 minutes of centrifugation at 3,000 rpm , after which the pellet was recovered and subjected to the sucrose method . the concentration of the refined spore suspension was adjusted to 110 spores / ml using a haemacytometer , and 0.5 l of the suspension was then dropped onto a cover slip using a micro - pipette . once the single resting spores were confirmed , two - or three - day - grown seedlings were placed on the cover glass containing the spores and then covered lightly with sterilized fine soil , after which they were planted in pots and covered with vinyl for one day to maintain humidity . the plants were subsequently cultivated for seven to eight weeks at 20 ~ 25 in a greenhouse ( kageyama et al . , 1995 ) . genomic dna of p. brassicae was extracted via the ctab method ( doyle and doyle , 1990 ) . by performing the single spore isolation mentioned above in conjunction with the sucrose method , foreign materials originating from a host plant were removed . the sample was then centrifuged at 3,000 rpm for 15 minutes , after which the pellet was removed and treated with 50 l dnase i ( sigma , d - 4263 ) at 50 unit / ml . next , 300 ppm streptomycin and 100 ppm rifampicin were applied and the sample was incubated at 37 for one hour . to inactivate the dnase i , 5 l of proteinase k ( 25 g / l ) were added to the sample , which was subsequently incubated at 37 for one hour . next , 300 l of 5 mm edta was added and the sample was then treated at 80 in a heating block for 5 minutes . the conidial suspension with inactivated dnase i was then centrifuged again at 4,000 rpm , after which the supernatant was removed and the pellet was freeze - dried and stored until subsequent use . for dna extraction , the pellets were thoroughly ground with 0.2 g glass beads ( 0.09 ~ 0.15 mm diameter ) using a pellet pestle ( sigma ) , after which 400 l of extraction buffer [ 200 mm tris - cl ( ph 8.0 ) , 200 mm edta , 1.4 m nacl , 1 % pvp ] were added . the mixture was then extracted with 600 l of chloroform : isoamyl alcohol ( 24 : 1 ) , after which dna extraction and purification was conducted using a g - spintmgenomic dna extraction kit ( intron biotechnology , korea ) . the purified dna was then eluted in 200 l of h2o in the final step , and the samples were maintained at -20 until subsequent analysis . the primers tested in this study were the 12 urp primers provided in a uniprimertm kit ( seoulin bioscience institute , korea ) , operon 10 - base primer for dna polymorphism analysis ( mller and harling , 1996 ) and the rfm8 - 1 , rfm8 - 2 primer set for race determination ( klewer et al . , 2001 ) . the effective primers , upr - 3 ( 5 ' - cccagcaactgatcgcacac - 3 ' ) , urp - 6 ( 5 ' - atgtgtgcgatcagttgctg - 3 ' ) and opa - 07 ( 5 ' - agtcagccac - 3 ' ) , were employed in this study . urp - pcr reactions were conducted in a reaction mixture with a final volume of 30 l that contained 5 ng of genomic dna , 100 ng urp primers , 800 m dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd . pcr reactions using opa - 07 were conducted in a reaction mixture with a final volume 50 l that contained 10 ng of genomic dna , 1 m operon 10 - base primer , 2 mm dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd . for variation analysis in the same generation of p. brassicae , root galls that were obtained from the black pearl cultivar after inoculation with the e4 and e9 isolates were divided into five pieces and the dna was extracted from each piece , after which rapd analysis was conducted using the urp 3 and urp 6 primers to reveal the active polymorphisms between the pathogen isolates . to investigate patterns of longitudinal variation of the pathogen , second and third generations were made through regrowth after single spore inoculation with e4 as an original generation . to determine the genetic stability among generations , rapd analysis was conducted using the urp 3 and opa - 7 primers . the isolate , e4 , was used for this study because it showed the strongest pathogenicity ( jang , 2006 ) and is easy to form the gall by inoculation of single resting spore . because the resting spores of p. brassicae are haploid , single spore isolates propagated from these spores should constitute a genetically homothallic genotype ( voorrips , 1995 ) . however , evidence of this issue has not been clearly demonstrated in most molecular biological studies , including those conducted to analyze genetic polymorphisms of this pathogen due to difficulties in the mass extraction of dna and contamination of foreign materials originating from the host plant . this pathogen can grow only in a host plant ; therefore , it is difficult to obtain a large number of pathogens when compared to other pathogens that can be propagated through pure cultivation in media . dna extraction of p. brassicae includes two complex steps , isolation of resting spores of the pathogen from a host plant and a second step in which dna is extracted from the isolated resting spores . indeed , all procedures involved in the extraction of dna from p. brassicae involve long and complex processes to remove the large amounts of foreign materials that originate from host cells and contamination of the host dna . nevertheless , these processes still result in the loss of target dna . additionally , if the amount of dna recovered using these procedures was small or contaminated with host dna , the rapd and rflp bands will be unclear or indistinct , even though the experiments were properly conducted . thus , the development of an effective dna extraction method , as well as a mass pathogen propagation method within the host plants remains acutely necessary . the mass propagation of an experimental material from single spore isolates might be resolved to some degree by using a susceptible host plant , but isolates demonstrating very little pathogenicity are still being propagated . accordingly , the development of a more effective propagation method independent of the degree of the pathogenicity of the single spore isolate should be resolved in future studies . this study used race 4 ( e4 ) and race 9 ( e9 ) , which are both known as prevalent pathogens in korea , to secure sufficiently propagated single spore isolates as the experimental material ( heo , 2004 ; jang , 2006 ) . additionally , during the dna extraction stage , the extraction efficiency was maximized by a physical grinding method using a glass bead and a pellet pestle . resting spores have a spherical shape , are only 3.8 m in diameter and are composed of hard chitin compounds ; therefore , they are not damaged when they are examined using a ccd phase - contrast microscope ( iponacology , japan ) ( 2,161 ) after treating them with edta or sds . conversely , the method of grinding them with very small glass beads ( 0.09 ~ 0.15 mm diameter ) can damage the resting spores , leading to over 80 % of the spores being destroyed ( jang , 2005 , 2006 ) . variation analysis within a same generation performed using urp 3 and urp 6 revealed nearly no variation in the patterns of bands of e4 and e9 ( fig . 1 , 2 ) . additionally , rapd analysis conducted to investigate the occurrence of longitudinal variation through progeny generations revealed that only the band patterns produced using the urp 3 and 6 primers and opa - 07 primer produced varying patterns . in a previous study , only the three primers out of a group of primers evaluated for their effectiveness for variation analysis and race differentiation using p. brassicae showed a high enough number of bands and differences in band patterns to separate organisms according to race ( heo , 2004 ) . since williams ' differential system ( williams , 1966 ) and the european clubroot differential system ( buczacki et al . , 1975 ) were suggested , an extremely small number of single spore isolates ( ssi ) including only a few races have been reported , and the development of genetic markers has not be progressed because the diversity of ssis has not been fully elucidated . we detected no differences in band types in our variation analysis of the progeny generation using urp 3 and opa 7 primers among generations from the original e4 to the third generation ( fig . thus , the results of this study showed that the ssi of p. brassicae are stably genetically inherited following infection and residence within the host independently , and this occurs via an asexual process . however , to make more accurate conclusions regarding the genetic stability following the growth of this pathogen , the possibility of genetic variation due to combined inoculation of isolates of different races should also be examined .\noutput:\n" }, { "from": "agent", "value": "single spore isolates of plasmodiophora brassicae e4 and e9 obtained from diseased chinese cabbage were identified as race 4 and race 9 , respectively , by the williams ' differential variety set . to confirm the possibility of variation in same generation and progeny of a single spore isolate of p. brassicae , random amplified polymorphic dna ( rapd ) analysis was conducted using the urp 3 , 6 and opa 7 primers . there was no difference in band type at each part of the gall of chinese cabbage obtained by inoculation of e4 and e9 and amplification using the urp 3 and 6 primers when the same generation was analyzed . in addition , the progeny analysis , which was expanded to the third generation and conducted using the urp 3 and opa 7 primers , revealed no differences in the band type of the e4 isolate . based on these results , the single spore isolate of p. brassicae was genetically stable ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ulnar neuropathy is the second most common cause of entrapment neuropathy after carpal tunnel syndrome . the ulnar nerve could be trapped in every part of upper limb including wrist , elbow , or arm . therefore , diagnosing the site of ulnar nerve injury is of great clinical and therapeutic importance . ulnar neuropathy at the elbow ( une ) where the nerve passes through the cubital tunnel is the most common place of the ulnar nerve entrapment . the diagnosis of une is based on obtaining medical history , clinical examination , and electrodiagnostic studies . due to false negative or nonlocalizing results of the electrodiagnostic studies , ultrasonography of the ulnar nerve has been recently recommended as an accurate noninvasive additional tool . however , ultrasonography still has no role in guidelines or practice parameters due to controversial results both in une patients and healthy individuals . on the other hand , magnetic resonance imaging ( mri ) is being increasingly used in the evaluation of ulnar neuropathy . to date , few investigations have targeted at assessing the diagnostic value of mri in une with debatable results . to the best of our knowledge , the diagnostic value of both ultrasonography and mri in une has not been hitherto investigated in a single study . therefore , we aimed at evaluating the diagnostic value of ultrasonography and mri in patients with une and also comparing the ultrasonographic and mri alterations of the ulnar nerve in patients with different grades of une severity determined by electrodiagnostic studies . between august 2010 and january 2012 , twenty - nine elbows of 25 patients with a diagnosis of une were prospectively studied at imam reza hospital , a university - affiliated teaching hospital . the study was approved by the local medical ethical committee of the tabriz university of medical sciences . informed consent was obtained from each subject in patient and control groups prior to the study . inclusion criteria were the age of 1565 years and presence of clinical findings and electrophysiological confirmation of une . the symptoms ( numbness and paresthesia of the fourth and fifth digits of the hand , weakness or clumsiness of the hand muscles innervated by the ulnar nerve , and medial elbow pain ) and signs ( sensory loss in the area of the ulnar nerve and weakness of the ulnar innervated muscles ) constituted the clinical diagnosis of une . moreover , electrodiagnostic criteria for une were based on those proposed by the american association of neuromuscular & electrodiagnostic medicine ( aanem ) ( see below ) . patients were excluded if any of they had history of polyneuropathy , acute trauma , previous trauma in the region of the elbow ( including previous surgery ) , or symptoms of une more than one year . thirty - five elbows of 23 healthy age - group - matched controls with no signs or symptoms of une or had systemic diseases associated with polyneuropathy were recruited for both ultrasonography and mri studied . electrophysiological studies included needle electromyography ( emg ) , and nerve conduction studies of the median and ulnar nerves were performed in all patients . the studies were performed with nicolet viking iv electrodiagnostic system and toeninnies neuroscreen plus equipment . ulnar sensory and motor nerve conduction studies were performed with the elbow flexed at 90 . to evaluate the motor conduction velocity ( mcv ) of the ulnar nerve , surface recording electrodes were located over the motor point of the abductor digiti minimi ( adm ) and first dorsal interosseous ( fdi ) muscles . surface stimulation was performed at the wrist , 4 cm distal to the medial epicondyle ( below elbow ) and 10 cm above this level ( above elbow ) . the sensory conduction studies were done antidromically , stimulating at the wrist and recording from digit 4 or 5 for the ulnar nerve . the severity of une was defined as mild , moderate , and severe based on the following criteria . mild involvement , presence of one of the following : reduced motor conduction velocity ( mcv ) 10 m / s across the elbow ( segment below - above elbow ) , compared with the more distal segment ( wrist - below elbow ) , from the muscle i dorsal interosseus ( idi ) or abductor digiti minimi ( adm ) , plus increased f - wave ( compared with the unaffected side or normative value ) ; reduced amplitude of sensory nerve action potentials ( snaps ) at iv and / or v finger ( compared with the unaffected side or normative value ) . moderate involvement , presence of one of the following : point 1 plus 2 of the previous grade ; motor conduction block from idi or adm at the elbow ; reduced amplitude of proximal compound muscle action potential ( cmap ) across the elbow from idi or adm 20 but 50 % and / or abnormal emg of ulnar hand muscles ( acute and chronic denervation potentials ) and / or snaps absence . severe involvement , presence of one of the following : complete motor conduction block alone across the elbow from idi or adm plus other abnormalities ( point 3 of previous grade ) ; reduced amplitude of proximal cmap across the elbow from idi or adm 50 % ; severe axonal involvement of ulnar nerve with snaps abnormalities and abnormal emg of ulnar hand muscles ( acute and chronic denervation potentials ) . mild involvement , presence of one of the following : reduced motor conduction velocity ( mcv ) 10 m / s across the elbow ( segment below - above elbow ) , compared with the more distal segment ( wrist - below elbow ) , from the muscle i dorsal interosseus ( idi ) or abductor digiti minimi ( adm ) , plus increased f - wave ( compared with the unaffected side or normative value ) ; reduced amplitude of sensory nerve action potentials ( snaps ) at iv and / or v finger ( compared with the unaffected side or normative value ) . reduced motor conduction velocity ( mcv ) 10 m / s across the elbow ( segment below - above elbow ) , compared with the more distal segment ( wrist - below elbow ) , from the muscle i dorsal interosseus ( idi ) or abductor digiti minimi ( adm ) , plus increased f - wave ( compared with the unaffected side or normative value ) ; reduced amplitude of sensory nerve action potentials ( snaps ) at iv and / or v finger ( compared with the unaffected side or normative value ) . moderate involvement , presence of one of the following : point 1 plus 2 of the previous grade ; motor conduction block from idi or adm at the elbow ; reduced amplitude of proximal compound muscle action potential ( cmap ) across the elbow from idi or adm 20 but 50 % and / or abnormal emg of ulnar hand muscles ( acute and chronic denervation potentials ) and / or snaps absence . point 1 plus 2 of the previous grade ; motor conduction block from idi or adm at the elbow ; reduced amplitude of proximal compound muscle action potential ( cmap ) across the elbow from idi or adm 20 but 50 % and / or abnormal emg of ulnar hand muscles ( acute and chronic denervation potentials ) and / or snaps absence . severe involvement , presence of one of the following : complete motor conduction block alone across the elbow from idi or adm plus other abnormalities ( point 3 of previous grade ) ; reduced amplitude of proximal cmap across the elbow from idi or adm 50 % ; severe axonal involvement of ulnar nerve with snaps abnormalities and abnormal emg of ulnar hand muscles ( acute and chronic denervation potentials ) . complete motor conduction block alone across the elbow from idi or adm plus other abnormalities ( point 3 of previous grade ) ; reduced amplitude of proximal cmap across the elbow from idi or adm 50 % ; severe axonal involvement of ulnar nerve with snaps abnormalities and abnormal emg of ulnar hand muscles ( acute and chronic denervation potentials ) . in all the patients and controls , the ulnar nerve at the elbowwas examined by the same radiologist blinded to the study using high - resolution ultrasonography ( medison multifrequency 714 mhz ) . the examinee sat and faced the operator with the examined upper limb and elbow flexed to 90 . using automatic manual tracing method within the echogenic rim , four measurements including at the level of medial epicondyle cross - sectional area ( csa ) - epi , 4 cm proximal to the medial epicondyle ( csa - prox ) , 4 cm distal to the epicondyle ( csa - dist ) , and the maximum cross - sectional area ( csa - max ) of the ulnar nerve found between these points were performed in axial planes . axial , coronal , and sagittal t1 - weighted and fat suppressed t2 - weighted sequences in 3 mm slice thickness through the elbow joint were obtained from all patients and controls using a same 1.5 t magnetic resonance imager ( siemens , usa ) . a single observer who was blinded to the clinical , neurophysiologic , and ultrasonographic findings analyzed the mri findings based on the signal intensity of the ulnar nerve , nerve compression , and nerve swelling . increased signal intensity was qualitatively determined . the caliber of the ulnar nerve was pictured over its 10 cm field of view and any apparent ( or qualitative ) swelling or compression was quantitated using computerized measurements . the caliber of the ulnar nerve was deemed to be abnormal if there was greater than 20 % increase ( defined as nerve swelling ) or decrease ( defined as nerve compression ) in cross - sectional diameter in relation to proximal and distal segments . to reduce false positive rates , the ulnar nerve was assessed in 20 healthy controls who underwent a similar mri study through the radiohumeral joint . data were presented as mean standard deviation or as median ( interquartile range ) . all statistical analyses were performed with statistical package of social science ( spss inc . , chi - square or fisher 's exact tests were used to study the qualitative data , t - test for independent groups to compare quantitative variables , and repeated measures analysis to evaluate the vital indices in both groups . the sensitivity and specificity of ultrasonography and mri were studied by means of a receiver operating characteristic ( roc ) curve . table 1 shows the baseline characteristics of the patients and controls included in this study . the median ulnar nerve csa ( square millimeters ) at all the four levels ( - prox , - epi , - dist , and - max ) was significantly greater in une patients than in controls ( p 0.001 , table 1 ) . the median ulnar nerve csa at all the four studied levels ( - prox , - epi , - dist , and - max ) in the patient group was significantly different between the une severity grades ( p 0.05 , table 2 ) . an roc analysis provided the sensitivity and specificity of the ultrasonographic measurements . the csa - max had the largest area under the curve and the greatest sensitivity and specificity ( table 3 , figure 1 ) . moreover , roc analysis revealed the csa - max cut - off point of 10 mm to define the severe une . the same analysis did not result in significant cut - off values to define mild and moderate une ( p 0.05 ) . nineteen symptomatic patients ( 90.4 % ) and four ( 20 % ) normal volunteers had increased signal intensity of the ulnar nerve . in patients with une , ulnar nerve hyperintensity was followed by ulnar nerve swelling ( 9/21 , 42.8 % ) , combination of ulnar nerve hyperintensity and swelling ( 9/21 , 42.8 % ) , and ulnar nerve compression ( 7/21 , 33.3 % ) . in addition , ulnar nerve hyperintensity showed the greatest sensitivity ( 90 % ) and specificity ( 80 % ) than the other measured mri variables ( table 4 ) . the present study revealed that the ulnar nerve csa at all the four levels ( - prox , - epi , - dist , and - max ) was significantly greater in une patients than in the healthy individuals . these findings are similar to those of the previous studies . however , the median ulnar nerve csa - max of both une patients and healthy individuals in the present study ( 9 and 5 mm , resp . ) is less than that of some similar studies . the indicated values correspond to those of the similar study by mondelli and colleagues . in a recent review , beekman et al . attributed this variation in normal csa values of the ulnar nerve to different factors including selection of controls and use of the unaffected arm of une patients as control . in the present study , we believe that low csa - max values in the une patients might stem from higher number of the cases with mild une ( 45 % of all patients ) compared with moderate and severe cases of une . nevertheless , we do not have an explanation for the low csa - max values in the healthy individuals . in the present study , we found that the cut - off value of 5 mm for csa - prox , - epi , and - dist had sensitivity of 7282 % and specificity of 5171 % in une diagnosis . the study by bayrak and colleagues yielded relatively similar sensitivity and specificity of the csa - prox and - dist ; however , the cut - off values were higher ( 8 and 9 mm ) compared to those of our study . in contrast to the present study , bayrak et al . reported higher sensitivity and specificity ( ~ 82 % ) for csa - epi cut - off value of 10 mm . nevertheless , lower sensitivity ( 46 % ) was indicated for csa at the epicondyle ( csa - epi ) cut - off value of 8.8 mm in the investigation by mondelli and coworkers . they attributed the low sensitivity of csa - epi to recruitment of only electrophysiologically confirmed une patients , the presence of many cases of neurologically mild une , and the measurement of the csa at a fixed point on an axial scan . on the other hand , the diagnostic value of the csa - max in une has been studied in several investigations . the present study showed that the cut - off value of 6 mm for csa - max had sensitivity of 93 % and specificity of 68 % in une diagnosis . these findings are consistent with those of the study by bayrak and colleagues ( sensitivity / specificity : 95 % / 71 % ) for the cut - off value of 11 mm . other studies reported that the cut - off value of 8.310 mm for csa - max had sensitivity of 88100 % and specificity of 8898 % in une diagnosis . the diagnostic value of the csa - max in une has been recently analyzed and readers are referred to the review by beekman and colleagues . as the aforementioned , lower cut - off values of the ulnar nerve csa ( - prox , - epi , - dist , and - max ) in the present study might be attributed to the greater number of the cases with mild une compared with the moderate and severe cases of une as well as to the low csa values in the healthy individuals . the present study also showed that the ulnar nerve enlargement , evaluated by csa at all the four levels ( - prox , - epi , - dist , and - max ) , was significantly linked to une severity . an association between the ulnar nerve and severity of nerve conduction abnormalities in une has been established in some previous studies . however only four investigations reported such an association between the csa and une severity . to the best of our knowledge , the present study is the first investigation yielding the association between csa at all the four levels ( - prox , - epi , - dist , and - max ) and une severity . moreover , our study aimed at determining the csa - max cut - off points discriminating between different grades of une severity . accordingly , csa - max cut - off point of 10 mm defined the severe une cases with sensitivity of 82 % and specificity of 72 % . nevertheless , the present study failed to determine significant csa - max cut - off values to define mild and moderate une cases . among the previous similar trials , only one study was designed to find csa cut - off points defining the severity of une . volpe and colleagues found two csa - max cut - off values of 10 mm and 15 mm for the mild and moderate une diagnosis with a very good diagnostic performance . nonetheless , the cut - off point of 20 mm for the severe une showed sensitivity of 39 % and specificity of 84 % in their study . their findings are in contrast to ours in this regard . in our study , mri analysis revealed that ulnar nerve hyperintensity had greatest sensitivity ( 90 % ) and specificity ( 80 % ) . similarly , high sensitivity of increased signal of the ulnar nerve ( 97 % ) in mri was reported by britz and coworkers . in addition , isolated ulnar nerve swelling and combination of ulnar nerve hyperintensity plus swelling yielded a low sensitivity and high specificity in the present study . in contrast , considering the isolated swelling or combination of ulnar nerve hyperintensity plus swelling , mri had excellent sensitivity and specificity in une diagnosis in the previous studies . altogether , it seems that sensitivity , specificity , and accuracy of the increased signal intensity of the ulnar nerve in this study are higher than those of the ulnar nerve size . this finding is consistent with that of the previous investigations by britz et al . and bumer and colleagues . on the contrary , large number of healthy individuals ( 50 % ) with increased signal intensity of the ulnar nerve raised doubts about the diagnostic value of hyperintensity in mri when compared with the ulnar nerve size or combination of increased size and signal intensity . as only one - fifth of the normal volunteers in our study had increased signal intensity of the ulnar nerve , we believe that increased signal of the ulnar nerve is more sensitive and specific than enlargement of the ulnar nerve in mri . further similar studies with larger sample size would be valuable in definition of both ultrasonography and mri cut - off points discriminating between different une severity grades . furthermore , in some cases of the control group we used both arms as independent observations ( artificial power increase ) . moreover , we did not study underlying abnormalities and anatomical variations in patients with une . in addition , the diagnosis of une based on the electrodiagnostic studies is not an accurate gold standard method ; current methods for diagnosing une are limited . also , our study did not focus on localizing or nonlocalizing abnormalities in the electrodiagnostic studies . on the other hand , the advantage of the current study is that this is the first investigation to assess the diagnostic values of both ultrasonography and mri in une . in conclusion , as a useful complementary tool , ultrasonography of the ulnar nerve using maximum csa ( csa - max ) is both sensitive and specific in une diagnosis and discriminating the severe une cases from the mild and moderate grades . furthermore , ulnar nerve mri particularly targeting at the increased signal of the ulnar nerve can be a useful diagnostic test for evaluation of une , particularly in conjunction with clinical and electrophysiological data .\noutput:\n" }, { "from": "agent", "value": "aim . to evaluate the diagnostic value of ultrasonography and magnetic resonance imaging ( mri ) in patients with ulnar neuropathy at the elbow ( une ) . methods . we prospectively performed electrodiagnostic , ultrasonographic , and mri studies in une patients and healthy controls . three cross - sectional area ( csa ) measurements of the ulnar nerve at multiple levels along the arm and maximum csa ( - max ) were recorded . results . the ulnar nerve csa measurements were different between the une severity grades ( p < 0.05 ) . csa - max had the greatest sensitivity ( 93 % ) and specificity ( 68 % ) . moreover , csa - max 10 mm2 defined the severe une cases ( sensitivity / specificity : 82 % / 72 % ) . in mri , ulnar nerve hyperintensity had the greatest sensitivity ( 90 % ) and specificity ( 80 % ) . conclusion . ultrasonography using csa - max is sensitive and specific in une diagnosis and discriminating the severe une cases . furthermore , mri particularly targeting at increased signal of the ulnar nerve can be a useful diagnostic test of une ." } ]