Datasets:

LA1512

/

pubmed-val-1K

like 0

recently , there has been a growing worldwide interest in marathon running due to recognition of the positive effects of endurance exercise on health and physical strength . in particular , an increasing number of amateur runners are participating in recreational 10- and/or 21-km marathons , because the physiological demand is lower than for full or ultramarathons1 . however , while regular moderate exercise has beneficial effects on health , it has been reported that irregular strenuous exercise could exert a negative effect on health2,3,4 . oxygen intake through respiration is involved in various metabolic processes as an essential factor for producing atp , an energy source . however , incomplete reduction of oxygen during metabolic processes results in partial changes in the structure of the oxygen molecules in the body , to produce reactive oxygen species ( ros ) , which can show toxicity in the body by inducing excessive oxidative stress5 . oxidative stress is generated by the disruption of homeostasis when oxidation reactions become dominant in the redox reaction , through which balance is maintained between oxidants and antioxidants6 . thanks to the antioxidant defense mechanisms of the body , resting ros production in a healthy person is within the capability of the antioxidant defense system . however , in a situation that demands several to dozens of times greater oxygen supply , as during strenuous exercise , ros production increases drastically7 , 8 . in particular , prolonged endurance exercise , such as marathon running , increases oxygen intake by the human body by more than 1015 times compared with resting oxygen intake , and such increased use of oxygen can result in excessive production of ros at a ratio that exceeds the human body s ability to recover the normal ratio8,9,10 . excessively produced ros in turn can cause dna damage and alterations . if there is failure to repair damaged dna , consequent genomic and chromosomal aberrations can alter the activities of genes / proteins and thereby can lead to aging , cancer , arteriosclerosis , neuropathy , and inflammation11 . on the other hand , endurance exercise without a break previous studies13,14,15 suggested that competitive exercise resulted in an increase in creatine kinase ( ck ) and lactate dehydrogenase ( ldh ) , which are important indices of the extent of skeletal muscle cell damage , and that running distance is associated with muscle damage . despite the fact that strenuous endurance exercise can have a negative effect on health as described above , long - distance running is increasing in popularity . the effect of long - distance running on health can vary , depending not only on personal physical strength and health but also on exercise intensity including running distance and duration . to reduce the adverse effect of exercise and maximize its positive effect on health , it is essential to understand the physiological response according to exercise intensity and to select a proper exercise method according to personal physical status . therefore , the purpose of the present study was to investigate the impact of different marathon running distances ( 10 km , 21 km , and 42.195 km ) on muscle and oxidative dna damage by analyzing lymphocyte dna , serum ck , and serum ldh in amateur marathon runners . the subjects were recruited from the participants in the hangang marathon race in seoul , republic of korea . of those initially recruited , 30 male amateur runners who were nonsmokers and nondrinkers , had no particular medical disease , and who had completed at least 3 full marathons and participated in regular running exercise at least 3 times a week were ultimately selected . the 30 subjects were randomly assigned to 10 km , 21 km , and 42 km groups , with 10 subjects assigned to each group . physical characteristics are presented in table 1table 1.characteristics of the subjectsvariables / group10 km ( n=10)21 km ( n=10)42 km ( n=10)age ( years)36.510.945.07.837.913.6height ( cm)173.14.3167.35.2175.99.2weight ( kg)68.97.266.66.169.48.8body fat ( % ) 15.53.817.73.813.92.1volume of training ( hours / week)5.01.55.63.66.11.2marathon careers ( years)5.94.06.62.27.04.2values are means sd . the study protocol was approved by an institutional ethics review board of the department of physical education at yonsei university . all participants provided written informed consent , and the study conformed to the standards set by the latest revision of the declaration of helsinki . values are means sd the day before the marathon race , height , weight , and body composition were measured using an impedance analyzer ( inbody 4.0 , biospace , seoul , republic of korea ) , and prerace blood samples were collected . the subjects were directed to avoid excessive physical activity from the day before blood collection and to maintain an empty stomach for at least 12 hours after the last meal . blood samples were collected from a forearm vein before ( pre ) and after the races ( post ) , and on the 3rd day of recovery ( recovery ) . postrace blood collection was carried out at the finish line , immediately after completion of the individual marathon courses ( 10 km , 21 km , and 42.195 km ) . blood collection on the 3rd day of recovery was carried out by the same method as used for the prerace blood samples . subjects were directed not to take vitamin compounds or nutritional supplements from immediately after the marathon race until the 3rd day of recovery . blood samples were centrifuged at 3,000 rpm for 20 min , stored at 80 c , and directly analyzed . serum ck and ldh levels were determined using a clinical chemistry analyzer ( ektachem dtscii , kodak , usa ) . lymphocyte dna damage was determined by using a comet assay , which showed single- or double - stranded dna breaks . for the comet assay , 130 l of whole blood was mixed with 900 l of phosphate buffered saline ( pbs ) and poured gently over a 150 l lymphocyte separation solution . after centrifugation at 1,450 rpm ( 4 min ) , lymphocytes were pipetted out and transferred to another tube . seventy - five microliters of low melting temperature agarose ( lma ) was put into the tube and mixed with a pipette . after removing the cover glass from the slide , the mixture was poured over the slide horizontally , covered with a cover glass , put on a freezing plate , and refrigerated for 5 min . when electrophoresis was finished , the nuclei were treated with fluorescence - based staining and observed under a fluorescence microscope ( leica , germany ) . an image of each nucleus was captured with a ccd camera ( nikon , japan ) and was analyzed with the komet 4.0 comet image analyzing system ( andor technology , belfast , uk ) . data are presented as the mean standard deviation ( sd ) unless otherwise stated . to identify differences in normally distributed results , when a significant interaction was apparent , the simple main effects on measured variables were determined using one - way anova . table 2table 2.comparison of serum ck and ldh levels according to the different running distancesvariablestimegroup10 km21 km42 kmck ( u / l)pre136.140.7143.239.2140.656.4cv0.300.270.40post175.052.8177.338.1312.6146.5cv0.300.210.47recovery179.056.7176.551.6320.1179.5cv0.320.290.56ldh ( u / l)pre289.333.4290.031.5302.237.4cv0.120.110.12post336.330.5343.832.0427.042.6cv0.090.090.10recovery302.828.4282.528.3327.965.2cv0.090.100.20values are means sd . p < 0.05 vs. pre ; p < 0.05 vs. 42 km shows a comparison of serum ck and ldh levels at rest and in response to different marathon running distances . serum ck levels were significantly higher at post and recovery than at pre in all groups ( p < 0.05 ) . in addition , the 42 km group showed significantly higher serum ck levels than the 10 km and 21 km groups at post and recovery ( p < 0.05 ) . serum ldh levels were significantly higher at post than at pre and recovery in all groups ( p < 0.05 ) . in addition , the 42 km group showed significantly higher ldh levels than the 10 km and 21 km groups at post ( p < 0.05 ) . p < 0.05 vs. pre ; p < 0.05 vs. 42 km table 3table 3.comparison of lymphocyte dna damage according to the different running distancesvariablestimegroup10 km21 km42 kmdna in tail ( % ) pre7.991.338.231.218.322.21cv0.170.150.27post12.351.9112.201.5213.222.11cv0.150.120.16recovery9.041.608.680.898.860.89cv0.180.100.10tail length ( m)pre51.455.6052.284.5052.5010.88cv0.110.090.21post66.135.0864.167.5768.739.87cv0.080.120.14recovery53.616.7450.973.4752.795.79cv0.130.070.11tail momentpre5.891.416.291.346.522.18cv0.240.210.33post9.551.889.491.9313.194.55cv0.200.200.34recovery5.921.875.771.166.621.50cv0.320.200.23values are means sd . p < 0.05 vs. pre ; p < 0.05 vs. 42 km shows a comparison of lymphocyte dna damage ( dna in the tail , tail length , and tail moment ) at rest and in response to the different marathon running distances . tail moment was significantly higher at post than at pre and recovery ( p < 0.05 ) . in addition , the 42 km group showed a significantly higher tail moment level than the 10 km and 21 km groups at post ( p < 0.05 ) . however , dna in the tail and tail length were not significantly different among the groups and time points . ck and ldh levels in the blood can be increased by prolonged physical exercise and are generally used as indices of skeletal muscle damage16 , 17 . the present study analyzed serum ck and ldh to determine the extent of skeletal muscle damage according to marathon running distance . during prolonged competitive exercise , such as a marathon , membrane permeability increases and larger amounts of the enzymes that reflect muscle damage , such as ck and ldh , short - distance or less - intensive running can achieve muscle tissue exercise without a large change in membrane permeability13 . thus , many previous studies2 , 13 , 14 have demonstrated that the duration and intensity of exercise are the main factors affecting the activities of such enzymes . the results of the present study also showed that the 42 km marathon group showed greater muscle damage than the other groups , which ran shorter distances . however , the 10 km and 21 km marathon groups also showed increases in ck and ldh after marathon races compared with the prerace levels . kim et al.3 reported that the ck concentration began to increase steadily after running 10 km in a 42.195 km marathon race , and jastrzbski14 reported that the ck and ldh concentrations began to increase after running 25 km in a 100 km ultramarathon . such studies showed that muscle damage could be caused not only by full and ultramarathons but also by marathons of shorter distances , such as 10 km and 21 km half marathons . in addition , the present study showed that the ck levels of all groups were higher even 3 days after finishing a marathon . kim et al.3 reported that the ck concentration was high until the 4th day of recovery after a 42 km marathon , and until the 5th day of recovery after a 200 km marathon . tsai et al.19 reported that blood ck activity was high until the 7th day after a 42 km marathon . therefore , it can be inferred that recovery from muscle damage induced by competitive endurance exercise takes at least 5 days , depending on various factors such as running distance and physical strength . however , if oxidative stress in a tissue exceeds the antioxidant capacity of the cells , damage to biological molecules , such as dna20 , can occur . in the present study , the extent of oxidative dna damage according to marathon distance was analyzed using the comet assay , which is considered a sensitive and fast method for detecting dna damage21 . the results were presented as the values of dna in the tail , tail length , and tail moment . it is well known that many kinds of exhaustive high - intensity endurance exercises cause dna damage but that those exercises that do not cause a high level of stress in the body , such as habitual exercise or low- or moderate - intensity exercise , do not cause dna damage8 , 22 . in the present study , although the 42 km marathon group showed a higher value for tail moment than the other groups , relatively short distance ( 10 km and 21 km ) marathons were also shown to cause dna damage . this result supports the results of previous studies23 , 24 , showing that dna damage had a positive correlation with a variety of exercises , such as treadmill running to exhaustion , half marathons , marathons , and triathlons . increased oxygen intake and oxygen supply to active tissue during strenuous exercise , such as a marathon , result in increased ros , which in turn can cause oxidative dna damage . ros can also be produced during the process of recovery from tissue damage after exhaustive exercise . that is , exhaustive exercise increases ros production in the vascular system through inflammatory cell infiltration in myofibril injuries and through circulating phagocytes , and increased ros can permeate into peripheral leukocytes , resulting in the modification of nucleic acids9 , 25 , 26 . in addition , ros may also be produced during the reparative process of tissue damage caused by exhaustive exercise26 , 27 . tsai et al.19 reported that there was a correlation between plasma ck and oxidative dna damage caused by 42 km marathons , and the results of the present study also showed the same pattern of correlation between ck and dna damage after marathons . on the other hand , the present study showed that all 3 groups recovered from a significantly high level of dna damage to a resting level 3 days after a marathon race . hartmann et al.28 reported that dna migration increased to the maximum level 1 day after multiple step tests on a treadmill and then returned to a resting level 3 days after the test . however , a follow - up study on dna effects of a short - distance triathlon event reported that dna migration began to increase 1 day after the event , reaching the maximum level 3 days after the event , and that such an increase continued until 5 days after the event . tsai et al.19 reported that dna damage began to increase 24 hours after a 42 km marathon and that such an increase continued until 7 days after the marathon . however , mastaloudis et al.8 reported that a high level of dna damage caused by a 50 km ultramarathon race returned to the resting level 2 hours after the race . it has been reported that the extent and duration of dna damage can vary according to the type , duration , running distance , and intensity of exercise , as well as training conditions and physical strength29,30,31,32,33 . in the present study , the relatively fast recovery from dna damage is presumed to be due to all subjects in the 3 groups , who were all amateur runners , getting regular aerobic exercise and being familiar with long - distance running , as they had participated in marathon races . however , there has been insufficient study of the effect of exercise distance and other factors on the extent and time course of dna damage . accordingly , future studies should assess dna damage responses according to health , physical strength , training condition , and various exercise distances and intensities .

[ purpose ] the aim of this study was to investigate the impact of different marathon running distances ( 10 km , 21 km , and 42.195 km ) on muscle and lymphocyte dna damage in amateur marathon runners . [ subjects and methods ] thirty male amateur runners were randomly assigned to 10 km , 21 km , and 42 km groups , with 10 subjects in each group . blood samples were collected before and after the races and on the 3rd day of recovery to examine levels of muscle damage ( creatine kinase and lactate dehydrogenase ) and lymphocyte dna damage ( dna in the tail , tail length , and tail moment ) . [ results ] serum creatine kinase , serum lactate dehydrogenase , and tail moment were significantly higher after the races compared with before the races in all groups . in addition , the 42 km group showed significantly higher levels of creatine kinase , lactate dehydrogenase , and tail moment than the 10 km and 21 km groups after the races . [ conclusion ] strenuous endurance exercise can cause muscle and lymphocyte dna damage , and the extent of such damage can increase as running distance increases .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

the extracellular matrix ( ecm ) present within all tissues and organs provides not only essential physical scaffolding for the cellular constituents but also initiates crucial biochemical and biomechanical signals that are required for tissue morphogenesis , differentiation , and homeostasis.1 the ecm is composed of two main classes of macromolecules : proteoglycans , which includes glycosaminoglycan chains , primarily hyaluronic acid ( ha ) ; and fibrous proteins , which include collagens , elastins , fibronectins , and laminins . ha is the predominant glycosaminoglycan of human skin , constituting more than 50% of the total ha in the body.2 ha as an injectable implantable device and dermal filler is approved by the us food and drug administration for correction of facial lines and wrinkles . because of its negative charge , ha is highly hydrated and serves as an extracellular reservoir to hold large amounts of cations and water , a mechanism for maintaining normal hydration of the skin . with advancing age , ha polymers become more tissue associated , presumably through ha - binding proteins such as fibrinogen , collagen , cd44 , and hyaluronidase , which may underlie some of the changes in human skin that occur with aging.3 these changes include loss of moisture in the skin leading to dryness , collagen degradation , loss of elasticity , epidermal atrophy , and wrinkling of the skin . the symptoms of photoaged skin including wrinkling , laxity , and a leather - like appearance are causally connected to histological and ultrastructural changes of the connective tissue of the dermis , including changes in the hyaluronan and proteoglycan matrix leading to reduced water content.4 uvb exposure results in decreased ha in the skin , presumably through down - regulation of has2 expression by proteolytic collagen fragments mediated by mmps in response to uvb.5 in mice , subcutaneous estradiol treatment resulted in increased dermal ha , correlated with induction of has3 , up - regulated by egf.6 ha in tissues is degraded by hyaluronidases , naturally occurring enzymes in the ecm . degradation of ha in the ecm results in a breakdown of structural integrity and an increase in tissue permeability.7 hyaluronidases in the ecm are present in an inactive or suppressed form , bound to inhibitors . this inhibition of hyaluronidase activity prevents otherwise rapid degradation of ha in the ecm and functions to maintain structural integrity . inhibitors of hyaluronidase are also naturally occurring in the ecm and are potent regulating agents involved in maintaining the balance between anabolism and catabolism of ha . the balanced regulation of ha metabolizing enzymes is necessary for normal tissue organization and ecm mediated functions . as agents that maintain ha homeostasis , hyaluronidase inhibitors may serve as anti - aging , anti - inflammatory , and anti - microbial agents.8 while hyaluronidase inhibitors have not been well characterized , studies suggest that the circulating hyaluronidase inhibitor is a plasma protein with the characteristics of an ii molecule with a high molecular mass , ranging from 130 to 240 kda present in the circulation in approximately 0.20.7 mg / ml.4 significant immunohistochemical staining for ii was observed in the dermis of normal human skin . the authors also describe pericellular ( eg , fibroblast ) matrix stabilization of hyaluronan with the polypeptide ii . sodium copper chlorophyllin complex is a semi - synthetic mixture of the water - soluble sodium salt of copper chlorophyllin derived from plant chlorophyll that possesses a unique combination of anti - inflammatory , antibacterial , and antioxidant activities . early research on the pharmacology of chlorophyllins demonstrated the anti - hyaluronidase activity of water - soluble chlorophyllins , suggesting a mechanism for the anti - inflammatory activities observed.9 sodium copper chlorophyllin complex has previously been used topically to aid in wound healing1013 but the ingredient has not been used therapeutically until recently as an anti - aging cosmeceutical in topical cosmetic and personal care products.14 sodium copper chlorophyllin complex is the active component of phytochromatic md complex , which is included in the rejuvaphyl line of topical products from mdrejuvena , inc . the major small molecule analog compounds present in sodium copper chlorophyllin complex have been reported previously15 based on high - performance liquid chromatography ( hplc ) analysis . in this study , various commercial lots of sodium copper chlorophyllin complex were first analyzed by the method of mortensen and geppel15 to examine the small molecule constituents in the preparations in advance of screening the lots of sodium copper chlorophyllin complex and their small molecule constituents for hyaluronidase inhibitory activity by an in vitro method . in vitro testing of various known small molecule components of copper chlorophyllin was performed to evaluate their hyaluronidase inhibitory activity . ascorbic acid and various ascorbate compounds are often included in topical over - the - counter facial skin treatment formulations as antioxidants . additionally , ascorbate molecules have been cited as inhibitors of hyaluronidase.16 therefore several ascorbate compounds were tested with sodium copper chlorophyllin complex for potential additive or synergistic activity . test materials were dissolved in either sterile water or ethanol , as appropriate , immediately before each experiment . test materials were tested at concentrations ranging from 100 g / ml to 0.4 g / ml . type i water and ethanol were the negative controls , and the positive control was tannic acid.17 ( chemical abstracts service number 1401 - 55 - 4 ; sigma - aldrich co , st louis , mo , usa ) , a known strong inhibitor of hyaluronidase activity.18 the effect of test materials on the hydrolytic activity of hyaluronidase ( iv - s , bovine ; sigma - aldrich co ) was assessed by precipitating the non - digested hyaluronate with 10% cetylpyridinium chloride ( maypro industries , purchase , ny , usa ) and measuring the related turbidity at 595 nm with spectramax190 in a manner similar to the method first described in 1948 by dorfman et al.19 three separate experiments were conducted for each test material . assays were carried out by sunny biodiscovery , inc . , santa paula , ca , usa . all small molecule analog components of sodium copper chlorophyllin complex were supplied by frontier scientific , logan , ut , usa . sodium copper chlorophyllin ( c3999 ) and ascorbyl palmitate ( 6-o - palmitoyl - l - ascorbic acid ) were supplied by spectrum chemical , new brunswick , nj , usa . sodium magnesium chlorophyllin complex ( chlorophyll mm ) was supplied by food ingredient solutions , teterboro , nj , usa . sodium ascorbate ( na asc ) and magnesium ascorbyl phosphate ( amp ) were supplied by goodier cosmetics , dallas , tx , usa and the dipalmitoyl ascorbate ( bv - adp ) was supplied by barnet products corporation , englewood cliffs , nj , usa . p - values representing statistical significance were calculated using paired student s t - test , and threshold of statistical significance was fixed at p=0.05 and at least 15% difference as compared to the water control . four commercial samples of sodium copper chlorophyllin complex were analyzed by hplc and mass spectroscopy by frontier scientific . the purpose of the analysis was to identify the primary small molecule constituents in each lot using the procedure described by mortensen and geppel.15 the four samples included both an old and a new lot of sodium copper chlorophyllin complex from two commercial suppliers , food ingredient solutions , llc and spectrum chemical . some of the small molecule analog constituents of sodium copper chlorophyllin complex were identified using authentic standards , and others were identified through comparison to the literature . test materials were dissolved in either sterile water or ethanol , as appropriate , immediately before each experiment . test materials were tested at concentrations ranging from 100 g / ml to 0.4 g / ml . type i water and ethanol were the negative controls , and the positive control was tannic acid.17 ( chemical abstracts service number 1401 - 55 - 4 ; sigma - aldrich co , st louis , mo , usa ) , a known strong inhibitor of hyaluronidase activity.18 the effect of test materials on the hydrolytic activity of hyaluronidase ( iv - s , bovine ; sigma - aldrich co ) was assessed by precipitating the non - digested hyaluronate with 10% cetylpyridinium chloride ( maypro industries , purchase , ny , usa ) and measuring the related turbidity at 595 nm with spectramax190 in a manner similar to the method first described in 1948 by dorfman et al.19 three separate experiments were conducted for each test material . assays were carried out by sunny biodiscovery , inc . , santa paula , ca , usa . all small molecule analog components of sodium copper chlorophyllin complex were supplied by frontier scientific , logan , ut , usa . sodium copper chlorophyllin ( c3999 ) and ascorbyl palmitate ( 6-o - palmitoyl - l - ascorbic acid ) were supplied by spectrum chemical , new brunswick , nj , usa . sodium magnesium chlorophyllin complex ( chlorophyll mm ) was supplied by food ingredient solutions , teterboro , nj , usa . sodium ascorbate ( na asc ) and magnesium ascorbyl phosphate ( amp ) were supplied by goodier cosmetics , dallas , tx , usa and the dipalmitoyl ascorbate ( bv - adp ) was supplied by barnet products corporation , englewood cliffs , nj , usa . p - values representing statistical significance were calculated using paired student s t - test , and threshold of statistical significance was fixed at p=0.05 and at least 15% difference as compared to the water control . four commercial samples of sodium copper chlorophyllin complex were analyzed by hplc and mass spectroscopy by frontier scientific . the purpose of the analysis was to identify the primary small molecule constituents in each lot using the procedure described by mortensen and geppel.15 the four samples included both an old and a new lot of sodium copper chlorophyllin complex from two commercial suppliers , food ingredient solutions , llc and spectrum chemical . some of the small molecule analog constituents of sodium copper chlorophyllin complex were identified using authentic standards , and others were identified through comparison to the literature . sodium copper chlorophyllin complex , sodium magnesium chlorophyllin complex , and small molecule component compounds of sodium copper chlorophyllin complex were evaluated for hyaluronidase inhibitory activity in vitro , compared to the positive control ( tannic acid ) and the negative controls ( type i water and ethanol ) . three sets of experiments were carried out . as shown in table 1 and figure 1 , sodium copper chlorophyllin complex and copper ( ii ) isochlorin e4 disodium salt had hyaluronidase inhibitory activity down to 10 g / ml . the oxidized form of copper ( ii ) isochlorin e4 disodium salt had substantial hyaluronidase inhibitory activity at 100 g / ml but not at 10 g / ml , and chlorophyll mm ( sodium magnesium chlorophyllin complex ) had no activity up to 100 g / ml . the structure of copper isochlorin e4 is shown in figure 2 , and the structure of other copper chlorophyllin analogs are provided in tumolo and lanfer - marquez.20 as shown in table 2 , hyaluronidase inhibitory activity of sodium copper chlorophyllin complex was not enhanced by the addition of various ascorbate derivatives , including sodium ascorbate , magnesium ascorbyl phosphate , 6-o - palmitoyl - l - ascorbic acid , and dipalmitoyl ascorbate . various small molecule components of sodium copper chlorophyllin were tested individually for hyaluronidase inhibitory activity . as shown in table 3 , disodium copper isochlorin e4 was the most active material , followed by disodium isochlorin e4 . table 3 does not contain the oxidized forms of the various small molecule components of sodium copper chlorophyllin complex and only the oxidized form of copper ( ii ) isochlorin e4 , disodium salt was evaluated ( table 1 ) . analysis of old and new lots from two commercial suppliers , food ingredient solutions and spectrum chemical , showed varying levels of copper isochlorin e4 and oxidized copper isochlorin e4 , as shown in table 4 . new lots were analyzed within 1 year of production while old lots were 45 years post - production and had been stored at room temperature ( 5986f ) . in addition to the disodium salts of copper isochlorin e4 and oxidized copper isochlorin e4 analogs , smaller percentages of sodium salts of copper chlorin e6 , copper chlorin p6 , oxidized chlorin p6 , oxidized chlorin e6 , chlorin e4 , and isochlorin e4 were identified in some of the lots . however , the disodium salt of copper isochlorin e4 was always the dominant component of the small molecule content . the disodium salt of oxidized copper isochlorin e4 appears to increase in concentration in the older lots as expected . sodium copper chlorophyllin complex , sodium magnesium chlorophyllin complex , and small molecule component compounds of sodium copper chlorophyllin complex were evaluated for hyaluronidase inhibitory activity in vitro , compared to the positive control ( tannic acid ) and the negative controls ( type i water and ethanol ) . three sets of experiments were carried out . as shown in table 1 and figure 1 , sodium copper chlorophyllin complex and copper ( ii ) isochlorin e4 disodium salt had hyaluronidase inhibitory activity down to 10 g / ml . the oxidized form of copper ( ii ) isochlorin e4 disodium salt had substantial hyaluronidase inhibitory activity at 100 g / ml but not at 10 g / ml , and chlorophyll mm ( sodium magnesium chlorophyllin complex ) had no activity up to 100 g / ml . the structure of copper isochlorin e4 is shown in figure 2 , and the structure of other copper chlorophyllin analogs are provided in tumolo and lanfer - marquez.20 as shown in table 2 , hyaluronidase inhibitory activity of sodium copper chlorophyllin complex was not enhanced by the addition of various ascorbate derivatives , including sodium ascorbate , magnesium ascorbyl phosphate , 6-o - palmitoyl - l - ascorbic acid , and dipalmitoyl ascorbate . various small molecule components of sodium copper chlorophyllin were tested individually for hyaluronidase inhibitory activity . as shown in table 3 , disodium copper isochlorin e4 was the most active material , followed by disodium isochlorin e4 . table 3 does not contain the oxidized forms of the various small molecule components of sodium copper chlorophyllin complex and only the oxidized form of copper ( ii ) isochlorin e4 , disodium salt was evaluated ( table 1 ) . analysis of old and new lots from two commercial suppliers , food ingredient solutions and spectrum chemical , showed varying levels of copper isochlorin e4 and oxidized copper isochlorin e4 , as shown in table 4 . new lots were analyzed within 1 year of production while old lots were 45 years post - production and had been stored at room temperature ( 5986f ) . in addition to the disodium salts of copper isochlorin e4 and oxidized copper isochlorin e4 analogs , smaller percentages of sodium salts of copper chlorin e6 , copper chlorin p6 , oxidized chlorin p6 , oxidized chlorin e6 , chlorin e4 , and isochlorin e4 were identified in some of the lots . however , the disodium salt of copper isochlorin e4 was always the dominant component of the small molecule content . the disodium salt of oxidized copper isochlorin e4 appears to increase in concentration in the older lots as expected . ha is a critical component of the ecm necessary for maintaining normal hydration of human skin . the primary mechanism of ha enhancement is through inhibition of hyaluronidase activity by hyaluronidase inhibitors . sodium copper chlorophyllin complex , the active component of phytochromatic md complex , demonstrated strong hyaluronidase inhibitory activity in vitro attributable primarily to disodium copper isochlorin e4 , a small molecule component of the parent sodium copper chlorophyllin complex . hyaluronidase inhibitory activity of sodium copper chlorophyllin was not enhanced by the addition of various ascorbate derivatives . the results indicate that copper is an important component of the inhibitory activity , given the lack of inhibitory activity seen with sodium magnesium chlorophyllin complex . although not tested , natural chlorophyll extracts from plant sources are magnesium chelates of chlorophyll and would therefore not be expected to show hyaluronidase inhibitory activity . analysis of various commercial lots of sodium copper chlorophyllin complex showed that the primary small molecule component , as found in newer lots , was disodium copper isochlorin e4 . older lots had proportionally higher amounts of disodium oxidized copper isochlorin e4 , which demonstrated lower hyaluronidase inhibitory activity in vitro . topical application of sodium copper chlorophyllin complex may be useful in the regulation of ha by inhibition of hyaluronidase activity in the skin , thereby acting to enhance the improvement in the appearance of facial skin . complete inhibition of hyaluronidase activity in vitro was demonstrated at sodium copper chlorophyllin complex concentrations substantially lower than those found in phytochromatic md complex . sodium copper chlorophyllin complex is present at concentrations of 2501,000 g / ml in phytochromatic md complex , an enhanced penetrating liposomal concentrate of sodium copper chlorophyllin complex , as utilized in various topical anti - aging treatment products developed by mdrejuvena , inc . these results support the concept of using the hyaluronidase inhibitory activity of sodium copper chlorophyllin complex , alone or together with other topical cosmeceuticals , for example , retinoids , alphahydroxy acids , and anti - aging peptides , in order to improve the appearance of aged or photoaged skin ; particularly improvements related to the integrity of the dermal matrix .

backgroundinhibitors of hyaluronidase are potent agents that maintain hyaluronic acid homeostasis and may serve as anti - aging , anti - inflammatory , and anti - microbial agents . sodium copper chlorophyllin complex is being used therapeutically as a component in anti - aging cosmeceuticals , and has been shown to have anti - hyaluronidase activity . in this study we evaluated various commercial lots of sodium copper chlorophyllin complex to identify the primary small molecule constituents , and to test various sodium copper chlorophyllin complexes and their small molecule analog compounds for hyaluronidase inhibitory activity in vitro . ascorbate analogs were tested in combination with copper chlorophyllin complexes for potential additive or synergistic activity.materials and methodsfor hyaluronidase activity assays , dilutions of test materials were evaluated for hydrolytic activity of hyaluronidase by precipitation of non - digested hyaluronate by measuring related turbidity at 595 nm . high - performance liquid chromatography and mass spectroscopy was used to analyze and identify the primary small molecule constituents in various old and new commercial lots of sodium copper chlorophyllin complex.resultsthe most active small molecule component of sodium copper chlorophyllin complex was disodium copper isochlorin e4 , followed by oxidized disodium copper isochlorin e4 . sodium copper chlorophyllin complex and copper isochlorin e4 disodium salt had hyaluronidase inhibitory activity down to 10 g / ml . the oxidized form of copper isochlorin e4 disodium salt had substantial hyaluronidase inhibitory activity at 100 g / ml but not at 10 g / ml . ascorbate derivatives did not enhance the hyaluronidase inhibitory activity of sodium copper chlorophyllin . copper isochlorin e4 analogs were always the dominant components of the small molecule content of the commercial lots tested ; oxidized copper isochlorin e4 was found in increased concentrations in older compared to newer lots tested.conclusionthese results support the concept of using the hyaluronidase inhibitory activity of sodium copper chlorophyllin complex to increase the hyaluronic acid level of the dermal extracellular matrix for the improvement of the appearance of aging facial skin .

Introduction Materials and methods Determination of hyaluronidase activity Analysis of sodium copper chlorophyllin samples Results Effect of test materials on hyaluronidase activity in vitro Analysis of commercial sodium copper chlorophyllin samples Discussion Conclusion

to report a case of macular hole closure after the exchange of a silicone - oil tamponade with gas c3f8 14% . a 64-year - old female patient with a stage iv macular hole underwent a three - port pars - plana vitrectomy and internal limiting membrane peeling . due to the patient 's chronic illness ( respiratory problems ) , a silicone - oil tamponade was preferred . macular hole closure was confirmed with optical coherence tomography six weeks after exchanging the silicone oil with gas . macular hole surgery using a silicone - oil tamponade has been proposed as treatment of choice for patients unable to posture . in our case , the use of a long - acting gas ( c3f8 14% ) , even without posturing , proved to be more effective . idiopathic macular hole is a common cause of visual impairment in people in their sixth decade or older , with a higher prevalence in females . pars - plana vitrectomy was introduced as treatment of choice for a full thickness macula hole ( ftmh ) in the early 1990s . since then , a number of modifications in the surgical technique have been introduced in order to achieve anatomical restoration of the macular area . internal limiting membrane ( ilm ) peeling and the use of substances such as autologous platelets and/or serum have been proposed as adjuncts to the standard procedure to achieve a higher success rate . the use of a gas tamponade and face - down position postoperatively were considered mandatory for optimal results . we report a case of a ftmh ( stage iv ) , which was initially treated with pars - plana vitrectomy , ilm peeling and a silicone - oil tamponade . anatomical closure was achieved only when the silicone oil was replaced by long - acting gas c3f8 ( 14% ) , four months after the first surgery . a 64-year - old female patient was referred to our clinic with complaints of a gradual deterioration of vision in her left eye over the last six months . on initial examination , snellen visual acuity was 0.9 in her right eye and 0.1 in her left eye . dilated fundus examination showed a normal fundus in her right eye , but revealed a macular hole in her left eye . optical coherence tomography ( oct ) confirmed the presence of a stage iv macular hole ( fig . 1 ) . the patient had undergone an uneventful cataract surgery with intraocular lens implantation in both eyes the previous year . the patient underwent a standard vitrectomy procedure followed by air - fluid exchange and ilm peeling using membrane blue . silicone oil ( 1,000 centistokes ) was used as the optimal tamponade instead of a long - acting gas , as postoperative posturing was not possible for the patient due to her respiratory problems . four months later , the visual acuity in her left eye was still 0.1 , and oct imaging showed that the macular hole was still flat open ( fig . the patient underwent a second surgical procedure where the silicone oil was exchanged with a long - acting gas , c3f8 ( 14% ) , without any further intervention or posturing . macular hole closure was confirmed by oct six weeks later and has remained stable since then ( fig . following successful pars - plana vitrectomy for ftmh , glial and mller cells form a plug within the hole and this allows the edges to close . the presence of residual fluid in the hole postoperatively may split the plug formation and inhibit the approximation of the hole edges . the use of a tamponade provides a floatation force that maintains the macula dry and keeps the edges in close proximity . long - acting gas remains the tamponade of choice , providing sufficient floatation force , which is greater in a face - down position . furthermore , in comparison to the use of silicone oil , which needs removal in a second surgical intervention , a subsequent procedure is not required . however , silicone oil is still an alternative option for patients with specific health problems ( e.g. in patients who are not able to posture ) and in patients with a single eye who require rapid rehabilitation . silicone - oil tamponade has also been proposed for the management of large or re - opened macular holes . it has been reported that prolonged macular tamponade with long - acting gas and a strict face - down position has a high closure rate , even in holes larger than 400 m [ 4 , 6 ] . on the contrary , tornambe et al . described good anatomical results with the use of long - acting gas regardless of the head position . the use of silicone oil in ftmh surgery has been shown to be effective , with a high anatomical success rate but contradictory functional outcome [ 5 , 8 , 9 ] . in our case , not only silicone - oil tamponade did not lead to anatomical restoration but the macular hole healed without posturing with the use of long - acting gas c3f8 ( 14% ) .

purposeto report a case of macular hole closure after the exchange of a silicone - oil tamponade with gas c3f8 14%.methoda 64-year - old female patient with a stage iv macular hole underwent a three - port pars - plana vitrectomy and internal limiting membrane peeling . due to the patient 's chronic illness ( respiratory problems ) , a silicone - oil tamponade was preferred . however , the macula hole was still flat opened four months postoperatively . therefore , the patient underwent an exchange of silicone oil with gas c3f8 14% . no face - down position was advised postoperatively due to her health problems.resultsmacular hole closure was confirmed with optical coherence tomography six weeks after exchanging the silicone oil with gas.conclusionsmacular hole surgery using a silicone - oil tamponade has been proposed as treatment of choice for patients unable to posture . in our case , the use of a long - acting gas ( c3f8 14% ) , even without posturing , proved to be more effective .

Purpose Method Results Conclusions Introduction Case Report Discussion

the purity of new tested compounds was determined to be 95% by analytical hplc . hplc analyses were carried out on a waters 2695 alliance module equipped with a waters 2996 photodiode array detector ( 210350 nm ) . the chromatographic system consisted of a hichrom guard column for hplc and a phenomenex synergi 4 max - rp 80a column ( 150 mm 4.60 mm ) , eluted at 1 ml / min with the following ion - pair buffer : 0.17% ( m / v ) cetrimide and 45% ( v / v ) phosphate buffer ( ph 6.4 ) in meoh . nadase ( from neurospora crassa ; sigma ; 0.9 u ) in tris - hcl buffer ( 2 ml , 0.1 m , ph 7.27.4 ) was added to a solution of the nad analogue ( 30 mol ) in tris - hcl buffer ( 1 ml , 0.1 m , ph 7.27.4 ) . the reaction mixture was stirred at 37 c until complete , followed by purification of the product by ion - exchange ( q - sepharose ) chromatography eluting with a gradient ( 050% ) of teab ( 1.0 m ) in milli - q water . the residue was coevaporated several times with meoh to remove excess teab to yield the desired adpr analogue as a glassy solid in its triethylammonium ( tea ) form . cesium carbonate ( 0.24 mmol , 2.9 equiv ) was added in one portion to a stirred solution of the corresponding boronic acid ( 0.103 mmol , 1.2 equiv ) , palladium acetate ( 0.004 mmol , 0.05 equiv ) , tppts ( 0.02 mmol , 0.24 equiv ) , and 8-br - adpr ( tea salt , 0.0823 mmol ) in degassed mecn h2o ( 1:2 v / v ; 2.4 ml ) under an argon atmosphere . the reaction mixture was heated at 125 c for 5 min ; the reaction mixture turned black and hplc analysis confirmed the reaction was complete . the reaction mixture was cooled to room temperature , quadrapure tu ( 100 mg ) added , and the mixture stirred for 16 h. the mixture was filtered and evaporated under reduced pressure to leave a crude product that was purified by ion - exchange ( q - sepharose ) chromatography eluted with a gradient ( 040% ) of teab ( 1.0 m ) in milli - q water followed by reverse phase ( rp-18 ) column chromatography , eluted with 020% mecn in teab ( 0.05 m ) to isolate the desired 8-substituted adpr product . to a solution of amine ( 0.443 mmol ) and dipea ( 42 l , 0.239 mmol ) in etoh ( 5 ml ) was added diethylsquarate ( 72 l , 0.487 mmol ) . the reaction was stirred at rt until tlc indicated completion of the reaction ( ca . 1 h ) . the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm acetone , 8:2 v / v ) to yield the desired product . the protected compound ( 0.1 mmol ) was stirred in a 75% aq tfa solution ( 5 ml ) at rt for 1 h. the solvents were evaporated under reduced pressure , and the residue was coevaporated with meoh to remove any residual tfa . the remaining residue was purified on an isco purification system ( dcm meoh , 8:2 v / v ) to yield the desired compound as a white solid . phenylboronic acid ( 0.103 mmol , 21 mg ) and 8-br - adpr 4 ( tea salt , 0.0823 mmol ) were reacted under the general protocol b , yielding 8-ph - adpr ( tea salt , 6.0 by h nmr ) ( 18 mg , 14.3 mol , 19% ) as a colorless solid . h ( 400 mhz , d2o ) 8.14 ( br s , 1h , h-2 ) , 7.567.48 ( br m , 5h , ph ) , 5.78 ( d , 1h , j = 5.9 , h-1 ) , 5.16 ( br , 0.4h , h-1 ) , 5.08 ( br , 1h , h-2 ) , 5.05 ( br , 0.6h , h-1 ) , 4.30 ( br , 1h , h-2 ) , 3.824.18 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) . c ( 100 mhz , d2o ) 154.5 , 153.4 , 152.3 , 150.3 ( c-2 ) , 131.3 ( ph , c h ) , 129.7 ( ph , c h ) , 129.2 ( ph , c h ) , 127.9 , 118.6 , 101.3 ( c/-1 ) , 96.5 ( c/-1 ) , 89.0 ( c-1 ) , 83.2 ( c-4 or c/-4 ) , 81.9 ( c-4 or c/-4 ) 81.3 ( c-4 or c/-4 ) , 75.3 , 70.8 , 70.6 , 70.5 ( c-2 ) , 70.2 , 69.7 ( c-2 ) , 66.5 ( c-5 or c/-5 ) 65.4 ( c-5 or c/-5 ) and 65.5 ( c-5 or c/-5 ) ; p ( 162 mhz , d2o ) 10.1 ( very br ) . hrms ( es ) calcd for c21h26n5o14p2 , 634.0957 m ; found , 634.0970 ; and rt = 26.7 min . 3-acetylphenylboronic acid ( 0.1 mmol , 17 mg ) and 8-br - adpr 4 ( 2 equiv tea salt , 67 mg , 0.079 mmol ) were reacted under the general protocol b to yield 8-(3-ac - ph)-adpr ( tea salt , 3.0 equiv by h nmr ) ( 11 mg , 9.3 mol , 12% ) as a colorless solid . h ( 400 mhz , d2o ) 8.138.19 ( m , 2h , ar 2-h and h-2 ) , 8.05 ( d , 1h , j = 6.9 , ar 6-h ) , 7.86 ( d , 1h , j = 6.9 , ar 4-h ) , 7.62 ( t , 1h , j = 6.9 , ar 5-h ) , 5.78 ( d , 1h , j = 5.9 , h-1 ) , 5.195.23 ( m , 1.4h , ( 1h ) h-2 and ( 0.4h ) h-1 ) , 5.09 ( d , 0.6h , j = 2.4 , h-1 ) , 4.374.41 ( m , 1h , h-2 ) , 3.874.21 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) and 2.62 ( s , 3h , arcoch3 ) . c ( 100 mhz , d2o ) 202.4 ( c = o ) , 155.1 , 152.8 ( c-2 ) , 151.9 , 150.1 , 136.7 , 134.4 ( ar 4-c ) , 130.6 ( ar 6-c ) , 129.6 , 129.4 ( ar 5-c ) , 128.3 ( ar 2-c ) , 118.5 , 101.1 ( c/-1 ) , 96.3 ( c/-1 ) , 88.8 ( c-1 ) , 83.0 ( c-4 or c/-4 , d , j 9.4 ) , 81.7 ( c-4 or c/-4 ) 81.0 ( c-4 or c/-4 , d , j = 9.4 ) , 75.1 , 70.6 , 70.3 , 70.3 ( c-2 ) , 69.9 , 69.5 ( c/-2 ) , 66.2 ( c-5 or c/-5 , d , j = 7.1 ) , 65.3 ( c-5 or c/-5 , d , j = 7.1 ) , 65.3 ( c-5 or c/-5 , d , j = 7.1 ) and 26.3 ( coch3 ) . p ( 162 mhz , d2o ) 11.2 ( br ) and 11.4 ( br ) . hrms ( es ) calcd for c23h28n5o15p2 , 676.1063 m ; found , 676.1076 ; and rt = 17.2 min . thiophene-3-boronic acid ( 0.12 mmol , 16 mg ) and 8-br - adpr 4 ( tea salt , 0.097 mmol ) were reacted under the general protocol b to give 8-(3-thiophenyl)-adpr ( tea salt , 2.3 equiv by h nmr ) ( 25 mg , 24.7 mol , 25% ) as a colorless solid . h ( 400 mhz , d2o ) 8.14 ( s , 1h , h-2 ) , 7.88 ( br s , 1h , thiophenyl 2-h ) , 7.54 ( dd , 1h , j = 4.7 , 3.2 , thiophenyl 4-h ) , 7.35 ( d , 1h , j = 4.7 , thiophenyl 5-h ) , 5.90 ( d , 1h , j = 5.9 , h-1 ) , 5.175.21 ( m , 1.4h , ( 1h ) h-2 and ( 0.4h ) h-1 ) , 5.09 ( d , 0.6h , j = 1.9 , h-1 ) , 4.374.40 ( m , 1h , h-2 ) and 3.884.18 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) . c ( 100 mhz , d2o ) 154.5 , 152.1 ( c-2 ) , 149.9 , 148.8 , 129.3 , 127.9 , 127.8 , 127.7 , 118.2 , 101.1 ( c/-1 ) , 96.3 ( c/-1 ) , 88.6 ( c-1 ) , 82.8 ( c-4 or c/-4 , d , = j 8.5 ) , 81.7 ( c-4 or c/-4 ) , 81.1 ( c-4 or c/-4 , d , j = 8.5 ) , 75.1 , 70.6 , 70.3 , 70.1 , 69.9 , 69.4 , 66.2 ( c-5 or c/-5 ) , 65.3 ( c-5 or c/-5 ) , 65.3 ( c-5 or c/-5 ) . p ( 162 mhz , d2o ) 11.2 ( br ) and 11.3 ( br ) . hrms ( es ) calcd for c19h24n5o14p2s , 640.0521 m ; found , 640.0527 ; and rt = 24.9 min . dl-4-boronophenylalanine ( 0.1 mmol , 21 mg ) and 8-br - amp 8 ( 0.75 equiv tea salts , 40 mg , 0.08 mmol ) were reacted under the general protocol b to give 8-(4-(2-aminopropanoic acid)phenyl)-amp ( tea salt , 2.2 equiv by h nmr ) ( 19 mg , 14.4 mol , 18% ) as a colorless solid . h ( 400 mhz , d2o ) 8.17 ( s , 1h , h-2 ) , 7.61 ( d , 2h , j = 8.2 , ar h ) , 5.77 ( d , 1h , j = 5.8 , h-1 ) , 5.16 ( t , 1h , j = 6.3 , h-2 ) , 4.35 ( dd , 1h , j = 6.2 , 5.1 , h-3 ) , 3.884.09 ( m , 4h , h-4 , h-5 and nh2chch2 ) , 3.26 ( dd , 1h , j = 14.9 , 5.3 , nh2chcha / b ) and 3.08 ( 1h , obscured by et3n salt peak , nh2chcha / b ) . c ( 100 mhz , d2o ) 192.2 ( c = o ) , 155.1 , 152.8 , 152.6 ( c-2 ) , 150.1 , 138.6 , 129.9 , 129.8 , 126.9 , 118.4 , 88.6 ( c-1 ) , 83.6 ( c-4 ) , 70.0 ( c-2 ) , 69.5 ( c-3 ) , 63.4 ( c-5 ) , 55.8 ( nh2chch2 ) and 36.5 ( arch2 ) . hrms ( es ) calcd for c19h22n6o9p , 509.1191 m ; found , 509.1174 ; and rt = 6.96 min . triphenylphosphine ( 130 mg , 0.5 mmol ) , morpholine ( 92 ml , 1.06 mmol ) , and 2,2-dipyridyldisulfide ( 110 mg , 0.5 mmol ) were added to a solution of 8-nh2-amp 10 ( 55 mg , 0.15 mmol ) in dry dmso ( 600 l ) . the mixture was stirred at rt for 4 h , and then a solution of sodium iodide in acetone ( 0.1 m ) was added dropwise . the precipitate that formed was collected , washed with acetone , and redissolved in water and lyophilized to leave the crude morpholidate intermediate ( 39 mg ) as a pale - yellow solid . the morpholidate was dissolved in a solution of mncl2 in formamide ( 1 ml , 0.2 m ) , mgso4 ( 48 mg , 0.4 mmol ) and -nmn ( 67 mmol , 0.2 mmol ) were added , and the mixture was stirred for 2 days . the crude product was precipitated from the reaction mixture by the dropwise addition of mecn , and the precipitate was collected , washed with mecn , and dried . the crude product was purified by reverse phase column chromatography , eluting with 020% mecn in teab ( 0.05 m ) . the sample was then treated with chelex 100 ( sodium form ) to remove any paramagnetic material and lyophilized to yield the 8-amino - nad ( 13 mg , 0.02 mmol , 13% ) as a colorless solid . h ( 270 mhz , d2o ) broad , possibly small amount of remaining mn . hrms ( es ) calcd for c21h29n8o14p2 , 679.1273 m ; found , 679.1252 ; and rt = 3.03 min . nadase ( from neurospora crassa ; sigma ; 0.52 u ) in tris - hcl buffer ( 1 ml , 0.1 m , ph 7.27.4 ) was added to a solution of 8-nh2-nad11 ( 13 mg ) in tris - hcl buffer ( 4 ml , 0.1 m , ph 7.27.4 ) . after 4 h , all of the starting material had been consumed , the reaction mixture was diluted with water until the conductivity < 200 s / cm , and the product purified by ion - exchange ( q - sepaharose ) chromatography eluting with a gradient ( 050% ) of teab ( 1.0 m ) in milli - q . subsequent purification by reverse phase column chromatography , eluting with 030% mecn in teab ( 0.05 m ) , left the desired 8-nh2-adpr product ( 4.5 mg , 7.65 mol , 40% ) as a colorless solid . h ( 400 mhz , d2o ) 7.98 ( s , 1h , h-2 ) , 5.99 ( d , 1h , j = 7.6 , h-1 ) , 5.245.31 ( br , 0.4h , h-1 ) , 5.115.17 ( br , 0.6h , h-1 ) , 4.684.64 ( br m , 1h , h-2 ) , 4.384.44 ( br m , 1h , h-2 ) , 3.914.31 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) . hrms ( es ) calcd for c15h23n6o14p2 , 573.0753 m ; found , 573.0775 ; and rt = 12.2 min . nhd ( 30 mol ) and nadase were reacted under the general protocol a to afford idpr as a glassy solid ( 24.6 mol , 82% ) . h ( 400 mhz , d2o ) 8.44 ( s , 1h , h-2 ) , 8.19 ( s , 1h , h-8 ) , 6.11 ( d , 1h , j1,2 = 6.1 , h-1 ) , 5.31 ( d , 1h , j1,2 = 4.1 , h-1 ) , 5.17 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.764.72 ( m , 1h , h-2 ) and 4.533.96 ( m , 9h , h-3 , h-4 , 2 h-5 , h-2 , h-3 , h-4 and 2 h-5 ) . p ( decoupled , 162 mhz , d2o ) 10.2 ( d , ab system , j = 18.8 ) , 10.6 ( d , ab system , j = 18.8 ) . hrms ( es ) calcd for c15h21n4o15p2 , 559.0484 ( m h ) ; found , 559.0480 . uv ( h2o , ph 7.2 ) max 248 nm ( 14500 ) . nicotinamide-7-deaza-8-bromoadenine-5-dinucletide ( 7-deaza-8-bromo - nad , 15 mol ) was treated with nadase under the general procedure a to afford 7-deaza-8-br - adpr as a glassy solid ( 12.7 mol , 85% ) . h ( 270 mhz , d2o ) 8.03 ( s , 1h , h-2 ) , 6.66 ( s , 1h , h-7 ) , 6.17 ( d , 1h , j1,2 = 6.1 , h-1 ) , 5.215.17 ( m , 2h , h-2 and h-1 ) , 4.544.50 ( m , 1h , h-3 ) and 4.183.94 ( m , 8h , h - ribose ) . p ( decoupled , 109 mhz , d2o ) 10.5 ( m ) and 10.7 ( m ) . hrms ( es ) calcd for c12h22n4o14p2br , 634.9797 ( m h ) ; found 634.9787 . hrms ( es ) calcd for c12h22n4o14p2br , 636.9776 ( m h ) ; found , 636.9778 . to a solution of 1,2,3,5-o - tetraacetate ribofuranose 18 ( 4.7 g , 14.7 mmol ) , 6-chloropurine 17 ( 2.5 g , 16.17 mmol ) , and dbu ( 6.5 ml , 44.1 mmol ) in dry mecn ( 100 ml ) was added dropwise tmsotf ( 10 ml , 58.8 mmol ) at 0 c . the resulting clear brown solution was stirred for 2 h at 60 c , after which it was cooled to room temperature and aq satd nahco3 ( 400 ml ) was added . the aqueous phase was extracted with dcm ( 3 300 ml ) , dried ( na2so4 ) , filtered , and evaporated under reduced pressure , giving a brown oil . the crude was purified by column chromatography on silica gel ( dcm acetone , 9:1 v / v ) to afford the desired product as a white foam ( 4.9 g , 91% ) . h ( 270 mhz , cdcl3 ) 8.75 ( s , 1h , h-8 ) , 8.28 ( s , 1h , h-2 ) , 6.21 ( d , 1h , j1,2 = 5.1 , h-1 ) , 5.92 ( app t , 1h , j2,1 = j2,3 = 5.1 , h-2 ) , 5.62 ( app t , 1h , j3,2 = j3,4 = 5.1 , h-3 ) , 4.484.33 ( m , 3h , h-4 , h-5a and h-5b ) , 2.13 ( s , 3h , ch3 ) , 2.10 ( s , 3h , ch3 ) and 2.06 ( s , 3h , ch3 ) . c ( 68 mhz , cdcl3 ) 170.4 , 169.7 , 169.5 ( all c = o ) , 152.4 ( c-2 ) , 151.7 , 151.3 ( 2 c ) , 143.7 ( c-8 ) , 86.9 ( c-1 ) , 80.6 ( c-4 ) , 73.2 ( c-2 ) , 70.5 ( c-3 ) , 62.9 ( c-5 ) , 20.8 , 20.6 , and 20.5 ( 3 ch3 ) . rf = 0.57 ( dcm acetone , 9:1 v / v ) . 2,3,5-tri - o - acetyl-6-chloro adenosine 19 ( 1.45 g , 3.52 mmol ) was added to a freshly prepared solution of naome in meoh ( 7.04 mmol in 10 ml ) . the solution was refluxed for one hour , after which it was cooled to rt and neutralized with acoh . the solvent was evaporated , and the residue was purified by column chromatography on silica gel ( dcm acetone , 6:4 v / v ) to yield the desired product as a white foam ( 943 mg , 95% ) . h ( 270 mhz , meoh - d4 ) 8.49 ( s , 1h , h-8 ) , 8.42 ( s , 1h , h-2 ) , 6.04 ( d , 1h , j1,2 = 5.9 , h-1 ) , 4.774.73 ( m , 1h , h-2 ) , 4.38 ( dd , 1h , j3,2 = 5.1 and j3,4 = 3.1 , h-3 ) , 4.184.15 ( m , 1h , h-4 ) , 4.13 ( s , 3h , ch3 ) , 3.91 ( dd , 1h , j5a,5b = 12.5 and j5a,4 = 2.6 , h-5a ) and 3.77 ( dd , 1h , j5b,5a = 12.5 and j5b,4 = 3.5 , h-5b ) . c ( 68 mhz , meoh - d4 ) 160.5 ( c-6 ) , 151.7 ( c-2 ) , 150.8 ( c ) , 142.6 ( c-8 ) , 121.3 ( c ) , 89.9 ( c-1 ) , 86.6 ( c-4 ) , 74.3 ( c-2 ) , 71.1 ( c-3 ) , 61.9 ( c-5 ) and 53.7 ( ch3 ) ; rf = 0.09 ( dcm acetone , 6:4 v / v ) . ms ( apci ) m / z 283.4 [ ( mh ) , 100% ] . hrms ( es ) calcd for c11h15n4o5 , 283.1037 ( mh ) ; found , 283.1038 . 6-o - methylinosine 20 ( 80 mg , 0.264 mmol ) was dissolved in triethylphosphate ( 1 ml ) by heating with a heatgun . the resulting colorless solution was cooled to 0 c , and water ( 2 l ) was added followed by pocl3 ( 0.1 ml , 1.056 mmol ) . it was stirred at 0 c until disappearance of starting material and formation of a single peak as shown by hplc . after 1 h , the reaction mixture was quenched by addition of ice / water ( 15 ml ) and stirred for 15 min at 0 c , after which it was warmed up to rt . triethylphosphate was extracted with etoac ( 6 6 ml ) , and the aqueous phase was neutralized with 2 m naoh . it was then applied to a reverse phase gradifrac column eluted with a gradient of 565% mecn in 0.05 m teab . the appropriate fractions were collected and lyophilized overnight to afford the desired monophosphate as its triethylammonium salt . h ( 270 mhz , d2o ) 9.01 ( s , 1h , h-8 ) , 8.51 ( s , 1h , h-2 ) , 6.14 ( d , 1h , j1,2 = 3.7 , h-1 ) , 4.63 ( app t , 1h , j2,1 = j2,3 = 4.2 , h-2 ) , 4.414.37 ( m , 1h , h-3 ) , 4.31 ( br s , 1h , h-3 ) , 4.224.15 ( m , 1h , h-5a ) and 4.11 ( m , 4h , och3 and h-5b ) . c ( 68 mhz , cdcl3 ) 159.5 ( c-6 ) , 153.6 ( c-2 ) , 149.4 ( c-4 ) , 129.6 ( c-8 ) , 115.7 ( c-5 ) , 89.6 ( c-1 ) , 83.7 ( c-4 , j = 8.7 ) , 74.7 ( c-2 ) , 69.5 ( c-3 ) , 64.2 ( c-5 ) and 55.9 ( och3 ) . ms : ( es ) m / z 361.5 [ ( m h ) , 100% ] . hrms ( es ) calcd for c11h14n4o8p , 361.0555 [ ( m h ) ] ; found , 361.0558 . 6-o - me - imp 21 ( 120 mg , 0.331 mmol ) was dissolved in dry dmso ( 2 ml ) and coevaporated with dry dmf ( 5 3 ml ) . the residue was dissolved in dmso ( 1 ml ) to which was added morpholine ( 150 l , 1.724 mmol ) , dipyridyldisulfide ( 182 mg , 0.827 mmol ) , and triphenylphosphine ( 217 mg , 0.827 mmol ) , at which point the solution became bright yellow . it was stirred for 1 h at rt , after which hplc analysis showed formation of a new peak . precipitation of the product occurred by dropwise addition of a solution of nai in acetone ( 0.1 m ) . the resulting precipitate was filtered and washed with acetone to yield the desired product as a pale - yellow solid , which was used in the next step without further purification . 6-o - me - imp morpholidate ( 100 mg , 0.232 mmol ) , -nmn ( 85 mg , 0.253 mmol ) , and mgso4 ( 54 mg , 0.464 mmol ) were dissolved in a 0.2 m solution of mncl2 in formamide ( 1.7 ml ) and stirred at rt for 16 h , after which hplc analysis showed completion of the reaction ( rt ( -nmn ) = 2.1 min and rt ( 6-o - me - nhd ) = 3.8 min ) . mecn was added to precipitate the product , which was filtered , dissolved in milli - q , and applied to a reverse phase gradifrac column eluted with a gradient of 565% mecn in 0.05 m teab . further treatment with chelex 100 to remove any paramagnetic particles afforded the desired product as the sodium salt ( 18 mg , 8% ) . h ( 400 mhz , d2o ) 9.21 ( s , 1h , hn2 ) , 9.07 ( d , 1h , j6,5 = 6.3 , hn6 ) , 8.67 ( d , 1h , j4,5 = 8.2 , hn4 ) , 8.39 ( s , 1h , h-8 ) , 8.27 ( s , 1h , h-2 ) , 8.098.06 ( m , 1h , hn5 ) , 5.96 ( d , 1h , j1,2 = 5.9 , h-1 ) , 5.94 ( d , 1h , j1,2 = 5.5 , h-1 ) , 4.62 ( app t , 1h , j2,1 = j2,3 = 5.5 , h-2 ) and 4.384.06 ( m , 9h , hsugar ) . c ( 100 mhz , d2o ) 165.1 ( c = o ) , 160.7 ( c-6 ) , 151.1 ( c-8 ) , 151.0 ( c-4 ) , 145.7 ( cn4 ) , 142.4 ( cn6 ) , 141.5 ( c-2 ) , 139.8 ( cn2 ) , 133.6 ( cn3 ) , 128.6 ( cn5 ) , 120.4 ( c-5 ) , 99.9 ( c-1 ) , 87.0 ( c-1 ) , 86.8 ( c-4 , d , j = 9.2 ) , 83.7 ( c-4 , d , j = 9.2 ) , 77.4 ( c-2 ) , 74.0 ( c-2 ) , 70.4 ( c-3 ) , 70.2 ( c-3 ) , 64.8 , 63.3 ( 2 ch2 ) and 54.9 ( ch3 ) . p ( 109 mhz , d2o ) 11.4 ( d , j = 20.7 ) and 11.7 ( d , j = 20.7 ) . ms ( es ) m / z 678.2 [ ( m h ) , 100% ] . hrms ( es ) calcd for c22h28n6o15p2 , 678.1093 [ ( m h ) ] ; found , 678.1088 . 6-o - me - nhd sodium salt 23 ( 17.3 mg , 25.5 mol ) was incubated with aplysia cyclase ( 40 l ) in a 25 mm hepes buffer ( 35 ml , ph 7.4 ) at rt . after 4 h at rt , hplc analysis showed completion of the reaction ( rt ( nicotinamide ) = 1.7 min and rt ( product ) = 15.9 min ) . the mixture was then applied to a q - sepharose ion exchange column eluted with 1 m teab buffer . the appropriate fractions were collected and evaporated under vacuum , and the residue was coevaporated with meoh to afford the hydrolyzed product 6-o - me - idpr as a triethylammonium salt . h ( 270 mhz , d2o ) 8.58 ( s , 1h , h-2 ) , 8.45 ( s , 1h , h-8 ) , 6.15 ( d , 1h , j1,2 = 5.6 , h-1 ) , 5.26 ( d , 0.5 h , j1,2 = 4.2 , h-1 ) , 5.16 ( d , 0.5 h , j1,2 = 2.2 , h-1 ) , 4.78 ( 1h , hidden under hdo peak ) , 4.484.47 ( m , 1h ) , 4.34 ( br s , 1h ) , 4.274.17 ( m , 3h ) , 4.12 ( s , 3h , ome ) , 4.083.92 ( m , 3h ) and 3.843.82 ( m , 1h ) . p ( 109 mhz , d2o ) 10.2 ( d , j = 21.1 ) and 10.6 ( d , j = 21.1 ) . ms : ( es ) m / z 573.4 [ ( m h ) , 80% ] . hrms ( es ) calcd for c16h23n4o15p2 , 573.0641 [ ( m h ) ] ; found , 573.0646 . 2-deoxy - nad32 ( 22 mol ) was reacted with nadase under general protocol b to yield the desired hydrolyzed product ( 18.7 mol , 85% ) . h ( 270 mhz , d2o ) 8.41 ( s , 1h , h-2 ) , 8.17 ( s , 1h , h-8 ) , 6.486.43 ( m , 1h , h-1 ) , 5.26 ( d , 1h , j1,2 = 4.1 , h-1 ) , 5.15 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.71 ( m , 1h , partially hidden under hdo peak , h-2 ) , 4.273.87 ( m , 8h , h-3 , h-4 , h-5 , h-3 , h-4 and h-5 ) , 2.832.78 ( m , 1h , h-2a ) and 2.55 ( ddd , 1h , j2b,2a = 14.0 , j2b,1 = 6.3 and j2b,3 = 3.3 , h-2b ) . p ( decoupled , 109 mhz , d2o ) 10.4 ( br s ) , 10.5 ( br s ) . hrms ( es ) calcd for c15h22n5o13p2 , 542.0695 ( m h ) ; found , 542.0681 . uv ( h2o , ph 7.4 ) max 259 nm ( 15400 ) . to a solution of 3-deoxy - nad42 ( 16 mol ) in tris buffer ( 100 mm , ph 7.3 , 5 ml ) was added nadase ( 200 l ) . the reaction was left for 2 h at 37 c , after which hplc analysis showed no remaining starting material . the volatiles were evaporated under reduced pressure , and the residue was applied to a semipreparative c18 column developed with a linear gradient of 0.1 m teab against mecn . the appropriate fractions were evaporated , and excess tea salt was removed by coevaporation with meoh to leave the desired adpr analogue ( 2.6 mol , 20% ) as a glassy solid tea salt . h ( 400 mhz , d2o ) 8.37 ( s , 1h , h-8 ) , 8.16 ( s , 1h , h-2 ) , 6.03 ( d , 1h , j1,2 = 5.0 , h-1 ) , 5.20 ( d , 1h , j1,2 = 4.1 , h-1 ) , 5.10 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.714.63 ( m , 2h , h - sugar ) , 4.233.85 ( m , 7h , h - sugar ) , 2.35 ( dd , 1h , j3a,3b = 10.0 and j3a,4 = 5.8 , h-3a ) and 2.172.12 ( m , 1h , h-3b ) . p ( decoupled , 162 mhz , d2o ) 11.1 ( br m ) . hrms ( es ) calcd for c15h22n5o13p2 , 542.3090 ( m h ) ; found , 542.3098 . 9-(4-hydroxybutyl)adenine 27 ( 80 mg , 0.386 mmol ) was dissolved in trimethylphosphate ( 1.3 ml ) by heating with a heatgun . phosphorus oxychloride ( 144 l , 1.545 mmol ) and water ( 2 l ) were added at 0 c , and the resulting solution was stirred at rt for 3 h. ice / water ( 15 ml ) was then added , and the mixture was stirred for further 15 min , after which it was extracted with etoac ( 6 ) . the aqueous layer was neutralized with 5 n naoh and applied to a reverse phase column and the product eluted with a gradient of 0.05 m teab against mecn . the residue obtained was coevaporated with meoh to remove excess tea salt , leaving the desired monophosphate as its triethylammonium salt ( 92 mg , 72% ) . h ( 270 mhz , dmso - d6 ) 8.13 ( s , 1h , h-2 or h-8 ) , 7.92 ( s , 1h , h-8 or h-2 ) , 7.88 ( br s , 2h , nh2 ) , 4.03 ( t , 2h , j = 7.2 , ch2-n ) , 3.85 ( q , 2h , j = 7.2 , ch2-o ) , 1.801.75 ( m , 2h , o - ch2-ch2 ) and 1.561.49 ( m , 2h , o - ch2-ch2 ) . 9-(4-acetoxybutyl)adenine-5-monophosphate1tea 28 ( 92 mg , 0.277 mmol ) was dissolved in dry dmso ( 1 ml ) and coevaporated with dry dmf ( 5 3 ml ) . the residue was dissolved in dmso ( 400 l ) to which was added morpholine ( 106 l , 1.233 mmol ) , dipyridyldisulfide ( 130 mg , 0.592 mmol ) , and triphenylphosphine ( 155 mg , 0.592 mmol ) , at which point the solution became bright yellow . it was stirred for 2 h at rt , after which hplc analysis showed completion of the reaction . precipitation of the product occurred by dropwise addition of a solution of nai in acetone ( 0.1 m , 20 ml ) . the resulting precipitate was filtered , washed with acetone , and dried ( p : = 6.7 ppm ) . it was then reacted with -nmn ( 84 mg , 0.250 mmol ) and mgso4 ( 53 mg , 0.454 mmol ) in a 0.2 m solution of mncl2 in formamide ( 1.5 ml ) at rt overnigh , t after which hplc analysis showed completion of the reaction ( rt = 2.9 min ) . the precipitate was filtered , dissolved in milli - q , and applied to a reverse phase column eluted with a 565% gradient of mecn in 0.05 m teab . further treatment with chelex 100 to remove any paramagnetic particles afforded the desired dinucleotide as its sodium salt . nicotinamide-9-(4-acetoxybutyl)adenine-5-dinucleotide 29 ( 10 mol ) was treated with nadase under general procedure b to leave the desired acyclic - adpr ( 8.1 mol , 81% ) . h ( 270 mhz , d2o ) 8.09 ( s , 2h , h-2 and h-8 ) , 5.25 ( d , 0.4h , j1,2 = 3.8 , h-1 ) , 5.17 ( d , 0.6h , j1,2 = 1.9 , h-1 ) , 4.204.02 ( m , 3h , h-2 and ch2-n ) , 3.973.90 ( m , 5h , h-3 , h-4 , h-5 and ch2-o ) , 1.901.83 ( m , 2h , o - ch2ch2 ) and 1.621.55 ( m , 2h , o - ch2ch2 ) . p ( decoupled , 109 mhz , do ) 10.2 ( m ) . hrms ( es ) calcd for c14h22n5o11p2 , 498.0795 ( m h ) ; found , 498.0786 . uv ( h2o , ph 7.2 ) max 261 nm ( 16000 ) . a solution of catpr 46 ( 5 mol ) in tris hcl ( 100 mm , ph 7 ) was heated to 100 c for 1 h , after which hplc analysis showed conversion to a new product . the solution was applied to a reverse phase column eluted with a 565% gradient of mecn in 0.05 m teab . the appropriate fractions were collected and evaporated to afford the desired nucleotide as its triethylammonium salt ( 2.7 mol , 54% ) . h ( 270 mhz , do ) 8.54 ( s , 1h , h-2 ) , 8.26 ( s , 1h , h-8 ) , 6.11 ( d , 1h , j1,2 = 5.8 , h-1 ) , 5.31 ( d , 0.4h , j1,2 = 4.1 , h-1 ) , 5.15 ( d , 0.6h , j1,2 = 2.3 , h-1 ) , 4.554.52 ( m , 1h , h-2 ) and 4.373.96 ( m , 9h , h-3 , h-4 , h-5 , h-2 , h-3 , h-4 and h-5 ) . p ( decoupled , 109 mhz , d2o ) 11.6 ( br s ) , 23.4 ( br s , o - p - o ) . hrms ( es ) calcd for c15h23n5o17p2 , 638.0307 ( m h ) ; found , 638.0331 . uv ( h2o , ph 7.2 ) max 259 nm ( 17180 ) . synthesis was carried out without protection of the 6-amino group to generate sal - ams . for details , see supporting information . 10% pd / c ( 110 mg ) was added to a solution of 2,3-o - isopropylidene-5-azido-5-deoxyadenosine ( 1.0 g , 3.01 mmol ) in etoh . the mixture was stirred for 16 h under a hydrogen atmosphere , after which the palladium was filtered and the solvent was removed under vacuum , yielding the desired compound as a white solid ( 0.9 g , 95% ) . h ( 400 mhz , dmso - d6 ) 8.34 ( s , 1h , h-8 ) , 8.14 ( s , 1h , h-2 ) , 7.29 ( br s , 2h , nh2 ) , 6.11 ( d , 1h , j1,2 = 3.0 , h-1 ) , 5.42 ( dd , 1h , j2,3 = 6.2 and j2,1 = 3.0 , h-2 ) , 5.01 ( dd , 1h , j3,2 = 6.2 and j3,4 = 2.9 , h-3 ) , 4.204.16 ( m , 1h , h-4 ) , 2.912.81 ( m , 2h , 2 h-5 ) , 1.52 ( s , 3h , ch3 ) and 1.30 ( s , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 156.1 ( c-6 ) , 152.7 ( c-8 ) , 148.8 ( c-4 ) , 140.0 ( c-2 ) , 119.2 ( c-5 ) , 113.3 ( c ) , 89.2 ( c-1 ) , 878.0 ( c-4 ) , 82.7 ( c-2 ) , 81.6 ( c-3 ) , 43.7 ( c-5 ) , 27.0 and 25.2 ( 2 ch3 ) . hrms ( es ) calcd for c13h19n6o3 , 307.1513 ( mh ) ; found , 307.1511 . to a solution of 1-o - methyl-2,3-o - isopropylidene--d - ribofuranose 49 ( 0.61 g , 2.989 mmol ) in dry pyridine ( 1 ml ) , externally cooled with ice , was added p - toluenesulfonyl chloride ( 0.7 g , 3.668 mmol ) and a catalytic amount of dmap . the reaction mixture was stirred at rt under nitrogen for 5 h. water ( 0.3 ml ) was added and stirring continued for 30 min . this mixture was extracted with chloroform ( 3 10 ml ) and the combined organic phases washed sequentially with cuso4 ( 10% w / v , aq satd ) , nahco3 ( aq satd ) and water and then dried over anhydrous sodium sulfate . the solvent was evaporated , and the residue was purified on an isco chromatographic system ( petrol etoac , 7:3 v / v ) to yield the desired compound as a white solid ( 0.92 g , 81% ) . h ( 400 mhz , cdcl3 ) 7.71 ( d , 2h , j = 8.7 2 ar h ) , 7.26 ( d , 2h , j = 8.0 , ar h ) , 4.83 ( s , 1h , h-1 ) , 4.51 ( dd , 1h , j3,2 = 6.0 and j3,4 = 0.6 , h-3 ) , 4.44 ( d , 1h , j2,3 = 6.0 , h-2 ) , 4.21 ( dt , 1h , j4,5 = 7.1 and j4,3 = 0.6 , h-4 ) , 3.933.91 ( m , 2h , h-5 ) , 3.14 ( s , 3h , ome ) , 2.36 ( s , 3h , ch3 ) , 1.35 ( s , 3h , ch3 ) and 1.19 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 144.9 ( c - so2 ) , 132.8 ( c - me ) , 129.8 ( 2c ) , 127.9 ( 2c ) ( all ch ) , 112.6 ( c ) , 109.4 ( c-1 ) , 84.8 ( c-4 ) , 83.5 ( c-2 ) , 81.3 ( c-3 ) , 69.1 ( c-5 ) , 54.9 ( ome ) , 26.2 , 24.8 ( 2 ch3 ) and 21.5 ( ch3-ph ) . hrms ( es ) calcd for c16h22nao7s , 381.0978 ( mh ) ; found , 381.0969 . to a solution of 1-o - methyl-2,3-o - isopropylidene-5-o - p - toluenesulfonyl--d - ribofuranose 50 ( 2.4 g , 6.7 mmol ) in dmf ( 20 ml ) was added nan3 ( 5.2 g , 80.4 mmol ) , and the reaction mixture was stirred at 120 c for 16 h. after cooling to rt , acetone ( 20 ml ) was added and the solid was removed by filtration . the solvents were evaporated under reduced pressure , and the residue was dissolved in dcm ( 50 ml ) and washed successively with water ( 50 ml ) , satd aq nahco3 ( 50 ml ) , and water ( 50 ml ) . the organic layer was dried ( na2so4 ) , filtered , and evaporated to leave an oil which was purified on an isco chromatographic system ( petrol etoac , 1:1 v / v ) , yielding the title compound as a colorless oil ( 1.4 g , 91% ) . h ( 400 mhz , cdcl3 ) 4.90 ( s , 1h , h-1 ) , 4.50 ( s , 2h , h-2 and h-3 ) , 4.19 ( ddd , 1h , j4,5a = 7.6 , j4,5b = 6.8 and j4,3 = 0.6 , h-4 ) , 3.35 ( dd , 1h , j5a,5b = 12.5 and j5a,4 = 7.6 , h-5a ) , 3.28 ( s , 3h , ome ) , 3.17 ( dd , 1h , j5b,5a = 12.5 and j5b,4 = 6.8 , h-5b ) , 1.39 ( s , 3h , ch3 ) and 1.22 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 112.6 ( c ) , 109.8 ( c-1 ) , 85.3 ( c-4 ) , 85.1 ( c-2 ) , 82.0 ( c-3 ) , 55.1 ( ome ) , 53.7 ( c-5 ) , 26.4 and 24.9 ( 2 ch3 ) . hrms ( es ) calcd for c9h15n3nao4 , 252.0955 ( mh ) ; found , 252.0949 . pph3 ( 1.95 g , 7.45 mmol ) was added to a solution of 1-o - methyl-2,3-o - isopropylidene-5-azido-5-deoxy--d - ribofuranose 51 ( 1.4 g , 6.11 mmol ) in thf ( 7 ml ) . the reaction mixture was stirred at rt for 16 h , after which water ( 7 ml ) was added and it was stirred for further 7 h. evaporation of the solvents followed by purification on an isco chromatographic system ( petrol etoac , 1:1 v / v ) gave the title compound as a colorless oil ( 1.04 g , 85% ) . h ( 400 mhz , cdcl3 ) 4.84 ( s , 1h , h-1 ) , 4.494.46 ( s , 2h , h-2 and h-3 ) , 4.054.01 ( m , 1h , h-4 ) , 3.24 ( s , 3h , ome ) , 2.712.62 ( m , 2h , 2 h-5 ) , 1.36 ( s , 3h , ch3 ) and 1.19 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 112.2 ( c ) , 109.5 ( c-1 ) , 88.8 ( c-4 ) , 85.4 ( c-2 ) , 82.1 ( c-3 ) , 54.9 ( ome ) , 45.4 ( c-5 ) , 26.4 and 24.8 ( 2 ch3 ) . hrms ( es ) calcd for c9h18no4 , 204.1230 ( mh ) ; found , 204.1226 . 1-o - methyl-2,3-o - isopropylidene-5-amino-5-deoxy--d - ribofuranose 52 ( 90 mg , 0.443 mmol ) , dipea ( 42 l , 0.239 mmol ) , and diethylsquarate ( 72 l , 0.487 mmol ) were reacted under the general protocol c to yield the desired product as a white foam ( 137 mg , 95% ) . h ( 400 mhz , cdcl3 ) 4.91 ( s , 1h , h-1 ) , 4.66 ( q , 4h , j = 6.9 , ch2 ) , 4.534.49 ( m , 2h , h-2 and h-3 ) , 4.29 ( app t , 1h , j = 5.6 , h-4 ) , 3.733.71 ( br m , 1h , h-5a ) , 3.513.49 ( br m , 1h , h-5b , 3.31 ( s , 3h , ome ) , 1.38 ( s , 3h , ch3 ) , 1.37 ( t , 3h , j = 6.9 , ch3 ) and 1.22 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 189.4 ( c = o ) , 184.3 ( c = o ) , 172.6 ( 2 c = c ) , 112.8 ( c ) , 109.9 ( c-1 ) , 85.8 ( c-4 ) , 85.2 ( c-2 ) , 81.5 ( c-3 ) , 69.7 ( ch2 ) , 55.5 ( ome ) , 46.4 ( c-5 ) , 26.3 , 24.8 ( 2 ch3 isopropyl ) and 15.7 ( ch3 ) . hrms ( es ) calcd for c15h22no7 , 328.1391 ( mh ) ; found , 328.1408 . to a solution of 3-(1-o - methyl-2,3-o - isopropylidene-5-amino-5-deoxy--d - ribofuranose)-4-ethoxycyclobut-3-ene-1,2-dione ( 91 mg , 0.305 mmol ) and dipea ( 26 l , 0.152 mmol ) in etoh ( 2 ml ) the reaction was stirred at rt for 1 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white foam ( 106 mg , 60% ) . h ( 400 mhz , dmso - d6 ) 8.30 ( s , 1h , h-2 ) , 8.16 ( s , 1h , h-8 ) , 7.29 ( br s , 2h , nh2 ) , 6.18 ( d , 1h , j1,2 = 2.5 , h-1 ) , 5.42 ( dd , 1h , j2,3 = 6.3 and j2,1 = 2.5 , h-2 ) , 5.0 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.5 , h-3 ) , 4.91 ( s , 1h , h-1 ) , 4.63 ( d , 1h , j3,2 = 6.0 , h-3 ) , 4.55 ( d , 1h , j2,3 = 6.0 , h-2 ) , 4.264.22 ( m , 1h , h-4 ) , 4.12 ( app t , 1h , j4,5 = 7.0 , h-4 ) , 3.91 ( br s , 1h , h-5a ) , 3.753.68 ( m , 1h , h-5b ) , 3.64 ( br s , 1h , h-5a ) , 3.493.47 ( m , 1h , h-5b ) , 3.27 ( s , 3h , ome ) , 1.52 ( s , 3h , ch3 ) , 1.34 ( s , 3h , ch3 ) , 1.30 ( s , 3h , ch3 ) and 1.22 ( s , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 182.7 , 182.6 ( 2 c = o ) , 167.6 ( 2 c = c ) , 156.1 ( c-6 ) , 152.8 ( c-2 ) , 148.8 ( c-4 ) , 139.9 ( c-8 ) , 119.2(c-5 ) , 113.7 , 111.6 ( 2 c ) , 108.8 ( c-1 ) , 88.7 ( c-1 ) , 85.5 ( c-4 ) , 85.1 ( c-4 ) , 84.5 ( c-2 ) , 83.2 ( c-2 ) , 81.2 ( c-3 ) , 81.1 ( c-3 ) , 54.4 ( och3 ) , 46.4 ( c-5 ) , 45.1 ( c-5 ) , 27.0 , 26.2 , 25.3 , and 24.7 ( 4 ch3 ) . hrms ( es ) calcd for c26h34n7o9 , 588.2413 ( mh ) ; found , 588.2429 . 3-(2,3-isopropylidene-5-amino-5-deoxyadenosine)-4-(1-o - methyl-2,3-o - isopropylidene-5-amino-5-deoxy--d - ribofuranose ) cyclobut-3-ene-1,2-dione 60 ( 40 mg , 0.07 mmol ) was deprotected by stirring in 0.1 m h2so4 for 16 h at 80 c to yield the desired compound as a white solid ( 15 mg , 45% ) . h ( 400 mhz , dmso - d6 ) 8.31 ( s , 1h , h-2 ) , 8.16 ( s , 1h , h-8 ) , 7.27 ( br s , 2h , nh2 ) , 6.17 ( d , 1h , j1,2 = 2.5 , h-1 ) , 4.91 ( s , 1h , h-1 ) , 4.354.24 ( m , 4h , h-2 , h-2 , h-3 , h-3 ) , 4.224.18 ( m , 1h , h-4 ) , 4.12 ( app t , 1h , j4,5 = 7.0 , h-4 ) , 3.92 ( br s , 1h , h-5a ) , 3.753.68 ( m , 1h , h-5b ) , 3.65 ( br s , 1h , h-5a ) , 3.493.47 ( m , 1h , h-5b ) . c ( 100 mhz , dmso - d6 ) 182.8 , 182.6 ( 2 c = o ) , 167.7 ( 2 c = c ) , 156.2 ( c-6 ) , 152.8 ( c-2 ) , 148.9 ( c-4 ) , 139.9 ( c-8 ) , 119.2(c-5 ) , 108.8 ( c-1 ) , 88.7 ( c-1 ) , 85.5 ( c-4 ) , 85.1 ( c-4 ) , 84.5 ( c-2 ) , 83.2 ( c-2 ) , 81.2 ( c-3 ) , 81.1 ( c-3 ) , 46.4 ( c-5 ) , 45.1 ( c-5 ) . hrms ( es ) calcd for c19h23n7o9 , 493.1557 ( mh ) ; found , 493.1564 . cyclopentylamine ( 104 l , 0.863 mmol ) , dipea ( 99 l , 0.570 mmol ) , and diethylsquarate ( 172 l , 1.162 mmol ) were reacted under the general protocol c to yield the desired product as a white foam ( 137 mg , 95% ) . h ( 400 mhz , cdcl3 ) 7.04 ( br s , 1h , nh ) , 4.754.73 ( m , 2h , och2 ) , 4.084.03 ( m , 1h , ch ) , 1.991.96 ( m , 2h ) , 1.741.72 ( m , 2h ) , 1.591.56 ( m , 4h ) ( 4 ch2 ) and 1.41 ( t , 3h , j = 6.6 , ch3 ) . c ( 100 mhz , cdcl3 ) 189.6 ( c-2 ) , 182.6 ( c-1 ) , 177.3 ( c-3 ) , 171.8 ( c-4 ) , 69.4 ( ch2 ) , 56.4 ( ch ) , 33.8 ( ch2 ) , 23.5 ( ch2 ) and 15.7 ( ch3 ) . hrms ( es ) calcd for c11h15no3 , 210.1130 ( mh ) ; found , 211.1127 . rf = 0.3 ( petrol etoac , 6:4 v / v ) . to a solution of 3-cyclopentylamino-4-ethoxycyclobut-3-ene-1,2-dione 55 ( 110 mg , 0.526 mmol ) and dipea ( 50 l , 0.284 mmol ) in etoh ( 3 ml ) the reaction mixture was stirred at rt for 18 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white solid ( 106 mg , 43% ) . h ( 400 mhz , meoh - d4 ) 8.32 ( s , 1h , h-8 ) , 8.29 ( s , 1h , h-2 ) , 6.25 ( d , 1h , j1,2 = 2.6 , h-1 ) , 5.55 ( dd , 1h , j2,3 = 6.4 and j2,1 = 2.6 , h-2 ) , 5.16 ( dd , 1h , j3,2 = 6.4 and j3,4 = 3.8 , h-3 ) , 4.444.40 ( m , 1h , h-4 ) , 4.07 ( dd , 1h , j5a,5b = 14.1 and j5a,4 = 4.4 , h-5a ) , 3.93 ( dd , 1h , j5ba,5a = 14.1 and j5b,4 = 6.7 , h-5b ) , 3.78 ( sept , 1h , j = 6.6 , ch ) , 1.722.07 ( m , 8h , 4 ch2 ) , 1.64 ( s , 3h , ch3 ) and 1.43 ( s , 3h , ch3 ) . c ( 100 mhz , meoh - d4 ) 183.9 ( c-2 ) , 183.5 ( c-1 ) , 169.4 ( c-3 ) , 169.0 ( c-4 ) , 157.4 ( c-6 ) , 154.2 ( c-2 ) , 150.3 ( c-4 ) , 141.9 ( c-8 ) , 120.7 ( c-5 ) , 115.9 ( c ) , 91.4 ( c-1 ) , 87.0 ( c-4 ) , 85.2 ( c-2 ) , 82.9 ( c-3 ) , 55.9 ( ch ) , 46.6 ( c-5 ) , 43.8 , 35.1 ( 4 ch2 ) , 27.5 and 25.6 ( 2 ch3 ) . hrms ( es ) calcd for c22h28n7o5 , 470.2146 ( mh ) ; found , 470.2158 . 3-(2,3-o - isopropylidene-5-amino-5-deoxyadenosine)-4-(cyclopentylamino)-cyclobut-3-ene-1,2dione 61 ( 50 mg , 0.11 mmol ) was deprotected under general protocol d to yield the desired compound as a white solid ( 40 mg , 85% ) . h ( 400 mhz , dmso - d6 ) 9.32 , 9.17 ( 2 nh ) , 8.39 ( s , 1h , h-8 ) , 8.30 ( s , 1h , h-2 ) , 7.74 ( br s , 2h , nh2 ) , 5.94 ( d , 1h , j = 5.9 , h-1 ) , 4.744.63 ( m , 4h , 2 ch2 ) , 4.254.14 ( m , 2h , h-2 , h-3 ) , 3.993.96 ( m , 1h , h-4 ) , 3.843.80 ( m , 1h , h-5a ) , 3.753.67 ( m , 2h , ch , h-5b ) , 1.42 ( t , 2h , j = 6.8 ) and 1.33 ( t , 2h , j = 6.8)(2 ch2 ) . c ( 100 , dmso - d6 ) 189.2 ( c = o ) , 182.3 ( c = o ) , 176.8 ( c = c ) , 172.8 ( c = c ) , 155.3 ( c-6 ) , 151.3 ( c-2 ) , 148.8 ( c-4 ) , 140.7 ( c-2 ) , 119.5 ( c-5 ) , 88.3 ( c-1 ) , 83.5 ( c-2 ) , 72.5 ( c-3 ) , 70.8 ( c-4 ) , 68.8 ( 2c , 2 ch2 ) , 45.8 ( c-5 ) , 15.5 ( 2c , 2 ch2 ) . hrms ( es ) calcd for c19h24n7o5 , 430.1833 ( mh ) ; found , 418.1838 . butylamine ( 135 l , 1.367 mmol ) , dipea ( 141 l , 0.811 mmol ) , and diethylsquarate 53 ( 222 l , 1.503 mmol ) were reacted under general protocol c to leave the desired product as a white foam ( 230 mg , 91% ) . h ( 400 mhz , cdcl3 ) 4.77 ( q , 2h , j = 7.2 , och2-me ) , 3.66 ( t , 1h , j = 7.0 , chh ) , 3.48 ( t , 1h , j = 7.0 , chh ) , 1.691.62 ( m , 2h , ch2 ) , 1.531.40 ( br m , 5h , ch2 and ch3 ) and 1.01 ( t , 3h , j = 7.2 , ch3 ) . c ( 100 mhz , cdcl3 ) 189.9 ( c-2 ) , 184.5 ( c-1 ) , 177.6 ( c-3 ) , 174.7 ( c-4 ) , 70.7 , 45.3 , 33.7 , 20.6 ( 4 ch2 ) , 16.2 ( et : ch3 ) and 14.0 ( bu : ch3 ) . hrms ( es ) calcd for c10h16no3 , 198.1125 ( mh ) ; found , 198.1124 . rf = 0.5 ( petrol etoac , 6:4 v / v ) . to a solution of 3-butylamino-4-ethoxycyclobut-3-ene-1,2-dione 56 ( 200 mg , 1.081 mmol ) and dipea ( 92 l , 0.531 mmol ) in etoh ( 5 ml ) the reaction mixture was stirred at rt for 24 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white foam ( 364 mg , 81% ) . h ( 400 mhz , dmso - d6 ) 8.38 ( s , 1h , h-8 ) , 8.23 ( s , 1h , h-2 ) , 7.39 ( br s , 2h , nh2 ) , 6.25 ( d , 1h , j1,2 = 2.4 , h-1 ) , 5.50 ( dd , 1h , j2,3 = 6.3 and j2,1 = 2.4 , h-2 ) , 5.04 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.5 , h-3 ) , 4.334 .. 29 ( m , 1h , h-4 ) , 3.95 ( br , 1h , h-5a ) , 3.813.75 ( br , 1h , h-5b ) , 3.51 ( br , 2h , ch2 ) , 3.383.34 ( m , 1h , chh ) , 1.60 ( s , 3h , ch3 ) , 1.51 ( br , 1h , chh ) , 1.32 ( s , 3h , ch3 ) , 1.32 ( q , 2h , j = 7.3 , ch2-me ) and 0.91 ( t , 3h , j = 7.3 , ch3 ) . c ( 100 mhz , dmso - d6 ) 182.7 ( c = o ) , 182.2 ( c = o ) , 167.7 ( c = c ) , 167.1 ( c = c ) , 156.1 ( c-6 ) , 152.8 ( c-2 ) , 148.8 ( c-4 ) , 139.9 ( c-8 ) , 119.1 ( c-5 ) , 113.7 ( c ) , 88.7 ( c-1 ) , 85.1 ( c-4 ) , 83.6 ( c-2 ) , 81.2 ( c-3 ) , 45.0 ( ch2 ) , 42.9 ( c-5 ) , 32.7 ( ch2 ) , 27.0 , 25.2 ( 2 ch3 ) , 18.9 ( ch2 ) and 13.4 ( ch3 ) . hrms ( es ) calcd for c21h28n7o5 , 458.2146 ( mh ) ; found , 458.2142 . 3-(2,3-o - isopropylidene-5-amino-5-deoxyadenosine)-4-butylamino - cyclobut-3-ene-1,2-dione 62 ( 50 mg , 0.109 mmol ) was deprotected under general protocol d to give the desired compound as a white solid ( 41 mg , 91% ) . h ( 400 mhz , dmso - d6 ) 8.40 ( s , 1h , h-8 ) , 8.26 ( s , 1h , h-2 ) , 7.567.45 ( br m , 4h , nh2 and 2 nh ) , 5.98 ( d , 1h , j1,2 = 5.8 , h-1 ) , 4.73 ( app t , 1h , j2,3 = j2,1 = 5.8 , h-2 ) , 4.23 ( app t , 1h , j3,2 = j3,4 = 5.8 , h-3 ) , 4.104.06 ( m , 1h , h-4 ) , 3.863.79 ( m , 2h , 2 h-5 ) , 3.535.52 ( m , 2h , ch2 ) , 1.511.49 ( m , 2h , ch2 ) , 1.34 ( q , 2h , j = 7.3 ) and 0.92 ( t , 3h , j = 7.3 ) . c ( 100 mhz , dmso - d6 ) 182.2 ( 2 c = o ) , 167.6 ( c-3 ) , 167.2 ( c-4 ) , 154.9 ( c-6 ) , 151.2 ( c-2 ) , 149.2 ( c-4 ) , 140.4 ( c-8 ) , 119.2 ( c-5 ) , 87.8 ( c-1 ) , 83.7 ( c-4 ) , 72.9 ( c-2 ) , 70.8 ( c-3 ) , 45.2 ( c-5 ) , 33.4 , 24.8 , 23.8 ( 3 ch2 ) and 15.8 ( ch3 ) . hrms ( es ) calcd for c18h24n7o5 , 418.1833 ( mh ) ; found , 418.1834 . hexylamine ( 130 l , 0.988 mmol ) , dipea ( 92 l , 0.533 mmol ) , and diethylsquarate 53 ( 161 l , 1.087 mmol ) were reacted under general protocol c to yield the desired product as a white foam ( 200 mg , 95% ) . h ( 400 mhz , cdcl3 ) 4.804.75 ( m , 2h , ch2-me ) , 3.65 ( t , 1h , j = 7.0 , chh - nh ) , 3.48 ( t , 1h , j = 7.0 , chh - nh ) , 1.691.64 ( m , 2h , ch2 ) , 1.531.44 ( m , 9h , 3 ch2 and ch3 ) and 0.990.96 ( m , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 189.9 ( c-2 ) , 184.5 ( c-1 ) , 177.5 ( c-3 ) , 174.8 ( c-4 ) , 70.7 ( et : ch2 ) , 45.6 , 32.5 , 31.6 , 27.1 , 23.6 ( 5 ch2 ) , 16.2 ( et : ch3 ) and 14.5 ( hex : ch3 ) . hrms ( es ) calcd for c12h20no3 , 226.1438 ( mh ) ; found , 226.1443 . rf = 0.62 ( petrol etoac , 6:4 v / v ) . to a solution of 3-hexylamino-4-ethoxycyclobut-3-ene-1,2-dione 57 ( 190 mg , 0.892 mmol ) and dipea ( 76 l , 0.438 mmol ) in etoh ( 5 ml ) the reaction was stirred at rt for 20 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white foam ( 291 mg , 74% ) . h ( 400 mhz , dmso - d6 ) 8.37 ( s , 1h , h-8 ) , 8.23 ( s , 1h , h-2 ) , 7.38 ( br s , 4h , nh2 and 2 nh ) , 6.26 ( d , 1h , j1,2 = 2.4 , h-1 ) , 5.49 ( dd , 1h , j2,3 = 6.2 and j2,1 = 2.4 , h-2 ) , 5.07 ( dd , 1h , j3,2 = 6.2 and j3,4 = 3.5 , h-3 ) , 4.334.29 ( m , 1h , h-4 ) , 3.96 ( br , 1h , h-5a ) , 3.813.74 ( br , 1h , h-5b ) , 3.50 ( br , 2h , ch2 ) , 1.60 ( s , 3h , ch3 ) , 1.51 ( br , 1h , chh ) , 1.38 ( s , 3h , ch3 ) , 1.30 ( br , 7h , 3 ch2 and chh ) and 0.910.88 ( m , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 182.7 ( c-2 ) , 182.2 ( c-1 ) , 167.9 ( c-3 ) , 168.5 ( c-4 ) , 156.1 ( c-6 ) , 152.8 ( c-2 ) , 148.8 ( c-4 ) , 139.9 ( c-8 ) , 119.2 ( c-5 ) , 113.7 ( c ) , 88.7 ( c-1 ) , 85.2 ( c-4 ) , 83.1 ( c-2 ) , 81.2 ( c-3 ) , 45.1 ( ch2 ) , 43.2 ( c-5 ) , 30.7 , 30.6 ( 2 ch2 ) , 27.0 ( ch3 ) , 25.4 ( ch2 ) , 25.3 ( ch3 ) 21.9 ( ch2 ) and 13.8 ( ch3 ) . hrms ( es ) calcd for c23h32n7o5 , 486.2459 ( mh ) ; found , 486.2475 . 3-(2,3-o - isopropylidene-5-amino-5-deoxyadenosine)-4-(hexylamino)cyclobut-3-ene-1,2-dione 63 ( 50 mg , 0.102 mmol ) was deprotected under general protocol d to yield the desired compound as a white solid ( 41 mg , 91% ) . h ( 400 mhz , dmso - d6 ) 8.42 ( s , 1h , h-8 ) , 8.27 ( s , 1h , h-2 ) , 7.65 ( br s , 2h , nh2 ) , 7.44 ( br s , 2h , 2 nh ) , 5.98 ( d , 1h , j1,2 = 5.7 , h-1 ) , 4.72 ( app t , 1h , j = 5.0 , h-2 ) , 4.22 ( app t , 1h , j = 4.3 , h-3 ) , 4.104.06 ( m , 2h , h-4 and h-5a ) , 3.853.79 ( m , 1h , h-5b ) , 3.51 ( br s , 2h , ch2-nh ) , 1.511.29 ( m , 8h , 4 ch2 ) and 0.910.88 ( m , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 182.6 ( c-2 ) , 182.3 ( c-1 ) , 167.9 ( 2 c = c ) , 155.2 ( c-6 ) , 151.5 ( c-2 ) , 149.2 ( c-4 ) , 140.2 ( c-8 ) , 119.2 ( c-5 ) , 87.6 ( c-1 ) , 83.7 ( c-4 ) , 72.9 ( c-2 ) , 70.8 ( c-3 ) , 45.5 ( ch2 ) , 43.2 ( c-5 ) , 30.7 , 30.6 , 25.4 , 21.9 ( 4 ch2 ) and 13.8 ( ch3 ) . hrms ( es ) calcd for c20h28n7o5 , 446.2146 ( mh ) ; found , 446.2157 . a solution of 1-o - methyl-2,3-o - isopropylidene--d - ribofuranose 49 ( 600 mg , 2.94 mmol ) in dmf ( 40 ml ) was cooled to 0 c , and nah ( 156 mg , 3.91 mmol , 60% in mineral oil ) was added . the mixture was stirred at 0 c for 30 min , after which tbai ( 65 mg , 0.176 mmol ) and propargyl chloride ( 0.25 ml , 3.528 mmol ) were added . the reaction mixture was stirred at rt for 16 h , the solvent was removed under reduced pressure , and the residue was purified by column chromatography using an isco chromatographic system ( petrol etoac , 1:0 0:1 v / v ) . the product was obtained as a colorless liquid ( 512 mg , 72% ) . h ( 400 mhz , cdcl3 ) 4.95 ( s , 1h , h-1 ) , 4.65 ( d , 1h , j2,3 = 6.0 , h-2 ) , 4.55 ( d , 1h , j3,2 = 6.0 , h-3 ) , 4.334.30 ( m , 1h , h-4 ) , 4.17 ( d , 2h , j = 2.4 , ch2 ) , 3.58 ( dd , 1h , j5a,5b = 9.5 and j5a,4 = 6.5 , h-5a ) , 3.523.47 ( m , 1h , h-5b ) , 3.32 ( s , 3h , ome ) , 2.42 ( t , 1h , j = 6.3 hz , ch ) , 1.46 ( s , 3h , ch3 ) and 1.30 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 112.3 ( c ) , 109.2 ( c-1 ) , 85.0 ( c-4 ) , 84.8 ( c-2 ) , 81.9 ( c-3 ) , 79.3 ( c ) , 74.6 ( hc ) , 70.5 ( c-5 ) , 58.3 ( ch2 ) , 54.8 ( och3 ) , 26.4 and 24.9 ( 2 ch3 ) . hrms ( es ) calcd for c12h18nao5 , 265.1046 ( mh ) ; found , 265.1042 . 2,3-o - isopropylidene-5-azido-5-deoxyadenosine 68 ( 100 mg , 0.30 mmol ) was taken up in naoac buffer ( ph 4 , 1 m , 15 ml ) and br2 ( 12 l , 0.45 mmol ) added . the resulting solution was stirred in the dark for 24 h and then a solution of nahso3 ( 4 m , aq ) added until the solution was colorless . all solvents were evaporated and the residue purified by column chromatography using an isco chromatographic system ( dcm acetone , 6:4 v / v ) . the title compound was obtained as an off - white solid ( 123 mg , 99% ) . h ( 400 mhz , cdcl3 ) 8.27 ( s , 1h , h-2 ) , 6.20 ( d , 1h , j1,2 = 1.8 hz , h-1 ) , 5.99 ( br s , 2h , nh2 ) , 5.68 ( dd , 1h , j2,3 = 6.3 and j2,1 = 1.8 , h-2 ) , 5.15 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.6 , h-4 ) , 4.364.31 ( m , 1h , h-4 ) , 3.543.43 ( m , 2h , 2 h-5 ) , 1.61 ( s , 3h , ch3 ) and 1.39 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 154.4 ( c-6 ) , 152.8 ( c-2 ) , 150.3 ( c-4 ) , 127.5 ( c-8 ) , 120.1 ( c-5 ) , 114.5 ( c ) , 91.2 ( c-1 ) , 86.4 ( c-4 ) , 83.4 ( c-2 ) , 82.4 ( c-3 ) , 52.1 ( c-5 ) , 27.0 and 25.3 ( 2 ch3 ) . hrms ( es ) calcd for c13h16n8o3br , 411.0523 ( mh ) ; found , 411.0532 ; and calcd for c13h16n8o3br , 413.0503 ( mh ) ; found , 413.0522 . rf = 0.58 ( dcm acetone , 3:2 v / v ) . to a solution of 2,3-o - isopropylidene-5-deoxy-5-azido-8-bromoadenosine 69 ( 123 mg , 0.30 mmol ) in a mixture of buoh - h2o ( 1:1 v / v , 6 ml ) was added cuso45h2o ( 2 mg , 0.015 mmol ) , sodium ascorbate ( 6 mg , 0.03 mmol ) , and 1-o - methyl-2,3-o - isopropylidene-5-o - propargyl--d - ribofuranose 70 ( 73 mg , 0.30 mmol ) . the reaction mixture was stirred at rt for 16 h , the solvents were removed under vacuum , and the residue was purified on an isco chromatographic system ( dcm acetone , 6:4 v / v ) to yield the product as a pale - yellow solid ( 140 mg , 71% ) . h ( 400 mhz , cdcl3 ) 8.22 ( s , 1h , h-2 ) , 7.32 ( s , 1h , ch - triazole ) , 6.29 ( br s , 2h , nh2 ) , 6.17 ( d , 1h , j1,2 = 1.7 hz , h-1 ) , 5.55 ( dd , 1h , j2,3 = 6.3 and j2,1 = 1.7 , h-2 ) , 5.22 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.9 , h-3 ) , 4.88 ( s , 1h , h-1 ) , 4.74 ( dd , 1h , j5a,5b = 13.9 and j5a,4 = 4.1 , h-5a ) , 4.624.48 ( m , 6h , h-4 , h-2 , h-3 , h-5b and ch2-triazole ) , 4.254.21 ( m , 1h , h-4 ) , 3.503.39 ( m , 2h , 2 h-5 ) , 3.20 ( s , 3h , ome ) , 1.55 ( s , 3h , ch3 ) , 1.40 ( s , 3h , ch3 ) , 1.33 ( s , 3h , ch3 ) and 1.21 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 154.6 ( c-6 ) , 153.1 ( c-2 ) , 150.1 ( c-4 ) , 144.9 ( c - triazole ) , 127.0 ( c-8 ) , 123.5 ( ch - triazole ) , 120.1 ( c-5 ) , 114.7 , 112.3 ( 2 c ) , 109.2 ( c-1 ) , 90.9 ( c-1 ) , 85.9 ( c-4 ) , 85.0 ( c-4 ) , 84.9 ( c-2 ) , 83.9 ( c-2 ) , 81.9 ( 2c , c-3 and c-3 ) , 71.3 ( c-5 ) , 64.6 ( och2-tr ) , 54.6 ( och3 ) , 51.5 ( c-5 ) , 27.0 , 26.3 , 25.3 , and 24.9 ( 4 ch3 ) . hrms ( es ) calcd for c25h33n8nao8br , 675.1497 ( mh ) ; found , 675.1469 ; calcd for c25h33n8nao8br , 677.1476 ( mh ) ; found , 677.1451 . rf = 0.58 ( dcm acetone , 3:2 v / v ) . to 1-(2,3-o - isopropylidene-5-deoxy-8-bromoadenosine)-4-(2,3-o - isopropylidene-5-o - methylribosyl)-1,2,3-triazole 71 ( 140 mg , 0.21 mmol ) , na2cl4pd ( 3 mg , 5 mol % ) , phb(oh2 ) ( 32 mg , 0.27 mmol ) , tppts ( 30 mg , 25 mol % ) , and na2co3 ( 68 mg , 0.64 mmol ) was added degassed mecn h2o ( 3 ml , 1:2 v / v ) and the resulting solution stirred at 80 c for 1 h. all solvents were evaporated and the residue purified by column chromatography using an isco chromatography system ( dcm acetone , 6:4 v / v ) to yield the product ( 30 mg , 21% ) . h ( 400 mhz , cdcl3 ) 8.27 ( s , 1h , h-2 ) , 7.707.48 ( m , 5h , ph ) , 7.35 ( s , 1h , ch - triazole ) , 6.90 ( br s , 2h , nh2 ) , 6.04 ( d , 1h , j1,2 = 1.6 , h-1 ) , 5.57 ( dd , 1h , j2,3 = 6.2 and j2,1 = 1.6 , h-2 ) , 5.28 ( dd , 1h , j3,2 = 6.2 and j3,4 = 3.5 , h-3 ) , 4.87 ( s , 1h , h-1 ) , 4.82 ( dd , 1h , j5a,5b = 14.2 and j5a,4 = 4.7 , h-5a ) , 4.71 ( dd , 1h , j5b,5a = 14.2 and j5b,4 = 8.0 , h-5a ) , 4.594.46 ( m , 5h , h-4 , h-2 , h-3 and ch2-triazole ) , 4.234.20 ( m , 1h , h-4 ) , 3.47 ( dd , 1h , j5a,5b = 9.7 and j5a,4 = 6.5 , h-5a ) , 3.433.40 ( m , 1h , h-5b ) , 3.18 ( s , 3h , ome ) , 1.45 ( s , 3h , ch3 ) , 1.38 ( s , 3h , ch3 ) , 1.29 ( s , 3h , ch3 ) and 1.21 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 155.6 ( c-6 ) , 152.6 ( c-2 ) , 151.5 ( c-8 ) , 150.0 ( c-4 ) , 144.8 ( c - triazole ) , 130.5 ( 2c ) , 129.6 ( 2c ) , 128.9 ( 5 ch - phenyl ) , 128.6 ( c - phenyl ) , 123.5 ( ch - triazole ) , 119.4 ( c-5 ) , 114.3 , 112.2 ( 2 c ) , 109.1 ( c-1 ) , 90.4 ( c-1 ) , 86.1 ( c-4 ) , 85.0 ( c-4 ) , 84.9 ( c-2 ) , 83.8 ( c-2 ) , 82.5 ( c-3 ) , 81.9 ( c-3 ) , 71.3 ( c-5 ) , 64.6 ( och2-tr ) , 54.6 ( och3 ) , 51.8 ( c-5 ) , 26.9 , 26.3 , 25.2 , and 24.9 ( 4 ch3 ) . hrms ( es ) calcd for c31h38n8nao8 , 673.2705 ( mh ) ; found , 673.2678 . 1-(2,3-o - isopropylidene-5-deoxy-8-phenyladenosine)-4-(2,3-o - isopropylidene-5-o - methylribosyl)-1,2,3-triazole 72 ( 30 mg , 0.046 mmol ) was deprotected by stirring in 0.1 m h2so4 for 16 h at 80 c to yield the desired compound ( 6 mg , 24% ) as a white solid . h ( 400 mhz , cdcl3 ) 8.27 ( s , 1h , h-2 ) , 7.707.48 ( m , 5h , ph ) , 7.35 ( s , 1h , ch - triazole ) , 6.90 ( br s , 2h , nh2 ) , 6.04 ( d , 1h , j1,2 = 1.6 , h-1 ) , 5.57 ( dd , 1h , j2,3 = 6.2 and j2,1 = 1.6 , h-2 ) , 5.28 ( dd , 1h , j3,2 = 6.2 and j3,4 = 3.5 , h-3 ) , 4.87 ( s , 1h , h-1 ) , 4.82 ( dd , 1h , j5a,5b = 14.2 and j5a,4 = 4.7 , h-5a ) , 4.71 ( dd , 1h , j5b,5a = 14.2 and j5b,4 = 8.0 , h-5a ) , 4.594.46 ( m , 5h , h-4 , h-2 , h-3 and ch2-triazole ) , 4.234.20 ( m , 1h , h-4 ) , 3.47 ( dd , 1h , j5a,5b = 9.7 and j5a,4 = 6.5 , h-5a ) and 3.433.40 ( m , 1h , h-5b ) . c ( 100 mhz , cdcl3 ) 155.6 ( c-6 ) , 152.6 ( c-2 ) , 151.5 ( c-8 ) , 150.0 ( c-4 ) , 144.8 ( c - triazole ) , 130.5 ( 2c ) , 129.6 ( 2c ) , 128.9 ( 5 ch - phenyl ) , 128.6 ( c - phenyl ) , 123.5 ( ch - triazole ) , 119.4 ( c-5 ) , 109.1 ( c-1 ) , 90.4 ( c-1 ) , 86.1 ( c-4 ) , 85.0 ( c-4 ) , 84.9 ( c-2 ) , 83.8 ( c-2 ) , 82.5 ( c-3 ) , 81.9 ( c-3 ) , 71.3 ( c-5 ) , 64.6 ( och2-tr ) and 51.8 ( c-5 ) . hrms ( es ) calcd for c24h29n8o8 , 557.2103 ( mh ) ; found , 557.2097 . to a solution of tetrazole ( 81 mg , 1.16 mmol ) and diisopropyl - dibenzylphosphoramidite ( 300 mg , 0.871 mmol ) in dcm ( 10 ml ) was added cyclopentanol 77 ( 50 mg , 0.58 mmol ) . the reaction mixture was stirred at rt for 20 min , after which tlc analysis showed total conversion of starting material to a single phosphite ( petrol etoac , 6:4 v / v , rf = 0.32 ) . the solution was cooled to 0 c , and mcpba ( 200 mg , 1.16 mmol ) was added in one portion . the mixture was warmed up to rt , diluted with etoac ( 20 ml ) , and washed with 10% na2so3 ( 20 ml ) , satd aq nahco3 ( 20 ml ) , and brine ( 20 ml ) . the organic phase was collected , dried ( na2so4 ) , filtered , and evaporated to dryness . the residue was purified with an isco chromatographic system ( petrol etoac , 7:3 v / v ) to yield the title compound as a colorless oil ( 173 mg , 86% ) . h ( 400 mhz , cdcl3 ) 7.367.20 ( m , 10h , h - benzyl ) , 5.064.97 ( m , 4h , 2 ch2 ) , 4.904.85 ( m , 1h , ch p ( 161 mhz , cdcl3 , decoupled ) 1.6 ( s ) . the above material ( 78 , 173 mg , 0.5 mmol ) cyclohexane ( 10:1:5 v / v / v , 16 ml ) to which was added pd(oh)2/c ( 20% ) . the solution was heated to 80 c for 2 h , after which the palladium was removed by filtration through celite and the filtrate was evaporated under reduced pressure , leaving a residue which was used directly in the next step . ampna salt ( 190 mg , 0.547 mmol ) was passed through a small dowex column ( tea form ) and eluted with milli - q water . the solvent was evaporated to leave a residue , which was dissolved in dmso and coevaporated with dmf ( 3 3 ml ) . the residue obtained was dissolved in dmso ( 3 ml ) and morpholine ( 0.25 ml , 2.845 mmol ) , dipyridyldisulfide ( 301 mg , 1.367 mmol ) , and triphenylphosphine ( 358 mg , 1.367 mmol ) were added in this order . the resulting yellow solution was stirred for 90 min , after which a 0.1 m solution of nai in acetone was added . the precipitate obtained was collected by filtration and used directly in the next step . to a solution of amp - morpholidate ( 154 mg , 0.350 mmol ) and cyclopentane monophosphate 79 ( 64 mg , 0.380 mmol ) in 0.2 n mncl2 in formamide ( 2 ml ) was added mgso4 ( 82 mg , 0.70 mmol ) , and it was stirred for 16 h at rt , after which hplc analysis showed product formation . precipitation of the product occurred on addition of mecn and purification on rp-18 afforded ( after treatment with chelex 100 ) the desired dinucleotide as a glassy solid ( 55 mol , 14% over 2 steps ) . h ( 400 mhz , d2o ) 8.44 ( s , 1h , h-2 ) , 8.19 ( s , 1h , h-8 ) , 6.07 ( s , 1h , h-1 ) , 4.734.71 ( m , 1h , ch o ) , 4.66 ( br s , 1h , h-2 ) , 4.48 ( br s , 1h , h-3 ) , 4.32 ( br s , 1h , h-4 ) , 4.15 ( br s , 2h , 2 h-5 ) , 1.621.60 ( m , 4h ) , 1.521.50 ( m , 2h ) and 1.361.34 ( m , 2h ) ( 4 ch2 ) . c ( 100 mhz , d2o ) 158.2 ( c-6 ) , 153.0 ( c-8 ) , 149.3 ( c-4 ) , 140.0 ( c-2 ) , 113.3 ( c-5 ) , 87.0 ( c-1 ) , 84.0 ( c-4 ) , 79.9 ( ch ) , 74.3 ( c-2 ) , 70.5 ( c-3 ) , 65.2 ( c-5 ) , 33.4 and 22.7 ( 2 ch2 ) . a flask containing 8-bromo-2,3-o - isopropylidene - adenosine 81 ( 200 mg , 0.519 mmol ) , na2cl4pd ( 5 mol % ) , tppts ( 25 mol % ) , phb(oh)2 ( 190 mg , 1.562 mmol ) , and na2co3 ( 165 mg , 1.557 mmol ) was purged with argon , and a degassed mixture of mecn h2o ( 1:1 v / v , 6 ml ) was added . the resulting mixture was refluxed for 1 h , then water ( 6 ml ) was added and the solution neutralized with 1 m hcl . the white precipitate obtained was collected by filtration and dried under vacuum ( 161 mg , 81% ) . h ( 400 mhz , dmso - d6 ) 8.16 ( s , 1h , h-2 ) , 7.737.71 ( m , 2h , ar h ) , 7.44 ( s , 2h , nh2 ) , 5.84 ( d , 1h , j1,2 = 3.4 , h-1 ) , 5.56 ( dd , 1h , j2,3 = 6.1 and j2,1 = 3.4 , h-2 ) , 5.385.36 ( m , 1h , 5oh ) , 5.03 ( dd , 1h , j3,2 = 6.1 and j3,4 = 2.5 , h-3 ) , 4.17 ( dd , 1h , j4,5 = 5.1 and j4,3 = 2.5 , h-4 ) , 3.63 ( dd , 1h , j5a,5b = 11.5 and j5a,4 = 5.1 , h-5a ) , 3.563.51 ( m , 1h , h-5b ) , 1.41 ( s , 3h , ch3 ) and 1.28 ( s , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 156.1 ( c-6 ) , 152.4 ( c-2 ) , 150.1 ( c-4 ) , 149.6 ( c - ph ) , 130.3 , 129.6 ( 2 ch ) , 129.1 ( c-8 ) , 128.8 ( ch ) , 118.8 ( c-5 ) , 113.0 ( c ) , 90.4 ( c-1 ) , 86.5 ( c-4 ) , 81.9 ( c-2 ) , 81.8 ( c-3 ) , 61.9 ( c-5 ) , 27.0 and 25.2 ( 2 ch3 ) . hrms ( es ) calcd for c19h21n5o4 , 384.1672 ( mh ) ; found , 384.1686 . 8-phenyl-2,3-o - isopropylidene - adenosine ( 82 , 150 mg , 0.39 mmol ) was deprotected under general protocol d to yield the desired compound as a white solid which was used directly in the next step . 8-phenyl - adenosine ( 0.39 mmol ) was dissolved in triethylphosphate ( 1 ml ) by heating with a heatgun . the resulting colorless solution was cooled to 0 c , and water ( 2 l ) was added followed by pocl3 ( 0.15 ml , 1.56 mmol ) , then stirred at 0 c until disappearance of the starting material and formation of a single peak was observed as shown by hplc . water ( 15 ml ) and the mixture was stirred for 15 min at 0 c , after which it was warmed to rt . triethylphosphate was extracted with etoac ( 6 6 ml ) , and the aqueous phase was neutralized with 2 n naoh . it was then applied to a reverse phase gradifrac column eluted with a 565% gradient of mecn in 0.05 m teab . the appropriate fractions were collected and lyophilized to afford the desired monophosphate as its triethylammonium salt . h ( 400 mhz , dmso - d6 ) 8.16 ( s , 1h , h-2 ) , 7.737.71 ( m , 2h , ar h ) , 7.44 ( s , 2h , nh2 ) , 5.84 ( d , 1h , j1,2 = 3.4 , h-1 ) , 5.56 ( dd , 1h , j2,3 = 6.1 and j2,1 = 3.4 , h-2 ) , 5.03 ( dd , 1h , j3,2 = 6.1 and j3,4 = 2.5 , h-3 ) , 4.17 ( dd , 1h , j4,5 = 5.1 and j4,3 = 2.5 , h-4 ) , 3.63 ( dd , 1h , j5a,5b = 11.5 and j5a,4 = 5.1 , h-5a ) and 3.563.51 ( m , 1h , h-5b ) . c ( 100 mhz , dmso - d6 ) 156.1 ( c-6 ) , 152.4 ( c-2 ) , 150.1 ( c-4 ) , 149.6 ( c - ph ) , 130.3 , 129.6 ( 2 ch ) , 129.1 ( c-8 ) , 128.8 ( ch ) , 118.8 ( c-5 ) , 113.0 ( c ) , 90.4 ( c-1 ) , 86.5 ( c-4 , d , j = 8.3 hz ) , 81.9 ( c-2 ) , 81.8 ( c-3 ) , 61.9 ( c-5 , d , j = 8.8 hz ) . hrms ( es ) calcd for c16h17n5o7 , 422.0871 ( m h ) ; found , 422.0868 . 8-ph - ampna salt ( 83 , 53 mg , 0.092 mmol ) was passed through a small dowex column ( tea form ) and eluted with milli - q water . the solvent was evaporated to leave a residue , which was dissolved in dmso and coevaporated with dmf ( 3 3 ml ) . the residue obtained was dissolved in dmso ( 90 l ) and morpholine ( 42 l , 0.478 mmol ) , dipyridyldisulfide ( 51 mg , 0.23 mmol ) , and triphenylphosphine ( 60 mg , 0.23 mmol ) were added in this order . the resulting yellow solution was stirred for 90 min , after which a 0.1 m solution of nai in acetone was added . the precipitate obtained was collected by filtration and used directly in the next step . to a solution of 8-ph - amp - morpholidate ( 31 mg , 0.060 mmol ) and cyclopentane monophosphate 79 ( 11 mg , 0.066 mmol ) in 0.2 n mncl2 in formamide ( 0.5 ml ) was added mgso4 ( 14 mg , 0.12 mmol ) , and it was stirred for 16 h at rt , after which hplc analysis showed product formation . precipitation of the product occurred on addition of mecn and purification on rp-18 afforded ( after treatment with chelex 100 ) the desired dinucleotide as a glassy solid ( 11 mol , 12% over 2 steps ) . h ( 400 mhz , d2o ) 8.21 ( s , 1h , h-2 ) , 7.67 ( d , 1h , j = 6.2 ) , 7.607.56 ( m , 2h ) , 7.28 ( d , 2h , j = 8.1 ) ( 5 arh ) , 5.82 ( d , 1h , j = 6.4 , h-1 ) , 5.15 ( app t , 1h , h-2 ) , 4.31 ( dd , 1h , j = 6.4 , 4.5 , h-3 ) , 4.083.98 ( m , 4h , h-4 , 2 h-5 , ch o ) , 1.621.60 ( m , 4h ) , 1.521.50 ( m , 2h ) and 1.361.34 ( m , 2h ) ( 4 ch2 ) . c ( 100 mhz , d2o ) 158.3 ( c-6 ) , 152.1 ( c-8 ) , 149.3 ( c-4 ) , 140.1 ( c-2 ) , 132.4 ( 2c ) , 129.7 ( 2c ) , 128.6 ( 5 arch ) , 113.2 ( c-5 ) , 87.2 ( c-1 ) , 83.8 ( c-4 ) , 79.7 ( ch ) , 73.9 ( c-2 ) , 70.4 ( c-3 ) , 65.3 ( c-5 ) , 33.6 and 22.9 ( 2 ch2 ) . hrms ( es ) calcd for c21h27n5o10p2 , 570.1155 ( m h ) ; found , 570.1149 . uv ( h2o , ph 7.4 ) max 276 nm ( 17600 ) . 8-phenyl-2-deoxy - cadpr 85 ( 13 mol ) was incubated in kh2po4 buffer ( 100 mm , ph 7.4 ) at 70 c for 2.5 h , after which hplc analysis showed a new peak at rt = 28 min . the volatiles were removed under reduced pressure , and the residue was applied to a c18 semipreparative column eluted with a gradient of 0.1 m teab in mecn . the appropriate fractions were combined and evaporated to leave the desired product as a glassy solid in its triethylammonium form ( 5.06 mol , 39% ) . h ( 500 mhz , d2o ) 8.21 ( s , 1h , h-2 ) , 7.657.55 ( m , 5h , ar - h ) , 6.296.27 ( m , 1h , h-1 ) , 5.21 ( d , 1h , j1,2 = 4.5 , h-1 ) , 5.10 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.543.81 ( m , 9h , h - ribose ) , 3.223.16 ( m , 1h , h-2a ) and 2.202.13 ( m , 1h , h-2b ) . p ( decoupled , 109 mhz , d2o ) 11.1 ( br s ) . c ( 100 m , d2o ) 153.0 ( c-6 ) , 152.6 ( c-8 ) , 150.3 ( c-2 ) , 148.4 ( c-4 ) , 131.1 , 129.7 , 129.0 , 128.5 ( 5 ch phenyl ) , 101.2 ( c-1 ) , 91.1 ( c-1 ) , 86.6 ( c-4/c-4 ) , 75.2 ( c-2 ) , 74.8 ( c-2 ) , 70.9 ( c-3 ) , 70.4 ( c-3 ) , 65.4 ( c-5 ) and 62.8 ( c-5 ) . hrms ( es ) calcd for c21h26n5o13p2 , 618.1008 ( m h ) ; found , 618.1013 . bsa ( bovine serum albumin ) , fura-2/am , nacl , egta , nmdg , tris base , and histopaque-1119 were purchased from sigma aldrich ( mnchen , germany ) . kcl , mgso4 , mgcl2 , cacl2 , nah2po4 , d - glucose , l - ascorbic acid , tween , ionomycin , and edta were obtained from merck ( darmstadt , germany ) . fibronectin , dmem , and penicillin / streptomycin were supplied by invitrogen ( darmstadt , germany ) . fbs ( fetal bovine serum ) and g418 sulfate were purchased from biochrom ( berlin , germany ) . the anti - trpm2 antibody was procured from novus biologicals ( littleton , usa ) . the goat antirabbit antiserum was purchased from dianova ( hamburg , germany ) . percoll and ecl western blotting detection reagents were supplied by ge healthcare ( uppsala , sweden ) . hek293 cells were maintained in dmem medium containing glutamax i complemented with 10% fbs , 100 units / ml penicillin , and 100 g / ml streptomycin at 37 c in the presence of 5% co2 . hek293 clones expressing trpm2/egfp ( or egfp for control ) were cultured under the same conditions , while the medium was supplemented with 400 g / ml g418 sulfate . hek293 wild - type cells were transfected with two different expression vectors coding either for human trpm2 and egfp ( pires2-egfp - trpm2 ) or for egfp alone ( pires2-egfp ) as described previously . cells carrying the expression constructs were selected by addition of 400 g / ml g418 sulfate ( biochrom ) to the culture medium . cells were seeded at low density the day before use . during the experiments , cells were kept at room temperature in bath solution ( 1 mm cacl2 , 140 mm nmdg , 5 mm kcl , 3.3 mm mgcl2 , 1 mm cacl2 , 5 mm d - glucose , 10 mm hepes , ph 7.4 ) . patch pipets with resistances of 1.73.5 m were pulled from 1.5 mm diameter borosilicate glass capillaries and filled with pipet solution ( 120 mm kcl , 8 mm nacl , 1 mm mgcl2 , 10 mm hepes , 10 mm egta , 5.6 mm cacl2 ) , resulting in 200 nm free [ ca ] as calculated by cabuf software ( g. droogmans , formerly available from ftp://ftp.cc.kuleuven.ac.be/pub/droogmans/cabuf.zip ) . data were acquired with an epc10 amplifier and patchmaster software ( heka elektronik , germany ) and were compensated for fast and slow capacity transients . the cells were held at 50 mv and current was measured during 140 ms voltage ramps from 85 to 20 mv every 5 s over a period of 450 s. series resistance was compensated by 70% . for activation of trpm2 , adpr was added to the pipet solution at a concentration of 100 m . antagonist activity of the adpr analogues was tested by adding them at different concentrations to a pipet solution with 100 m adpr . during some experiments , the pipet solution contained 0.1% dmso because stock solutions of the more lipophilic adpr analogues were prepared in dmso . neutrophils were isolated as described elsewhere . in brief , the blood was fractionated with a histopaque-1119 density gradient and subsequently neutrophils were further purified by the use of percoll layers ranging from 65 to 85% in density . after a final washing step , the cells were resuspended in ca measurement buffer ( 140 mm nacl , 5 mm kcl , 1 mm mgso4 , 1 mm cacl2 , 1 mm nah2po4 , 4 mm glucose , 20 mm hepes , ph 7.4 ) and kept on ice until use . to avoid premature activation of the neutrophils , all buffers used during the isolation were supplemented with 2 mm edta , cell concentrations exceeding 5 10 cells / ml were avoided , and only endotoxin free materials and solutions were used . neutrophils were incubated with 4 m fura2/am for 30 min at 37 c in the dark , washed twice , and resuspended in ca measurement buffer ( see above ) at a concentration of 1 10 cells / ml . for each measurement , 5 10 cells were transferred to a small chamber consisting of a rubber o - ring fixed with silicon grease on a glass coverslip coated subsequently with 25 ng of bsa and 250 ng of fibronectin . the cells were incubated for 15 min at ambient temperature in the presence of 10 mm l - ascorbic acid ( ph 7.4 ) and , if applicable , varying concentrations of 8-phenyl - adpr . the loaded coverslip was mounted on the stage of a perkinelmer / imrovision imaging system built around a leica dm ire 2 fluorescence microscope . approximately 70 s after the beginning of the measurement , the cells were stimulated by addition of fmlp ( final concentration 1 m ) or a5 peptide ( final concentration 10 m ) . the migration of neutrophils was observed microscopically in microfluidic devices ( -slide chemotaxis , ibidi , martinsried , germany ) . first the -slides were coated with 50 g / ml fibronectin for 30 min at ambient temperature before washing three times and drying . isolated neutrophils were resuspended to a concentration of 3 10 cells / ml in ca measurement buffer supplemented with 10% ( v / v ) plasma obtained from the same donor . if applicable , 8-phenyl - adpr or egta was added and the whole slide was loaded according to the manufacturer s instructions and incubated at room temperature for 15 min . adding 18 l of fmlp ( 125 nm ) to the upper reservoir resulted in a chemotactical gradient from 0 50 nm fmlp across the observation chamber . the slide was mounted on the stage of the imaging system , and the main chamber observed at 10 times magnification in bright - field mode . after a 5 min resting period , greyscale images with a resolution of 672 510 pixels were recorded every 30 s for 1 h using openlab software 4.0.4 . cell migration was tracked manually with a 5 5 pixel maximum intensity centering correction using the manual - tracking plugin for imagej ( 1.45e ) . migrational parameters were calculated from the movement paths using the chemotaxis and migration tool software ( v2.0 , ibidi gmbh ) . phenylboronic acid ( 0.103 mmol , 21 mg ) and 8-br - adpr 4 ( tea salt , 0.0823 mmol ) were reacted under the general protocol b , yielding 8-ph - adpr ( tea salt , 6.0 by h nmr ) ( 18 mg , 14.3 mol , 19% ) as a colorless solid . h ( 400 mhz , d2o ) 8.14 ( br s , 1h , h-2 ) , 7.567.48 ( br m , 5h , ph ) , 5.78 ( d , 1h , j = 5.9 , h-1 ) , 5.16 ( br , 0.4h , h-1 ) , 5.08 ( br , 1h , h-2 ) , 5.05 ( br , 0.6h , h-1 ) , 4.30 ( br , 1h , h-2 ) , 3.824.18 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) . c ( 100 mhz , d2o ) 154.5 , 153.4 , 152.3 , 150.3 ( c-2 ) , 131.3 ( ph , c h ) , 129.7 ( ph , c h ) , 129.2 ( ph , c h ) , 127.9 , 118.6 , 101.3 ( c/-1 ) , 96.5 ( c/-1 ) , 89.0 ( c-1 ) , 83.2 ( c-4 or c/-4 ) , 81.9 ( c-4 or c/-4 ) 81.3 ( c-4 or c/-4 ) , 75.3 , 70.8 , 70.6 , 70.5 ( c-2 ) , 70.2 , 69.7 ( c-2 ) , 66.5 ( c-5 or c/-5 ) 65.4 ( c-5 or c/-5 ) and 65.5 ( c-5 or c/-5 ) ; p ( 162 mhz , d2o ) 10.1 ( very br ) . hrms ( es ) calcd for c21h26n5o14p2 , 634.0957 m ; found , 634.0970 ; and rt = 26.7 min . 3-acetylphenylboronic acid ( 0.1 mmol , 17 mg ) and 8-br - adpr 4 ( 2 equiv tea salt , 67 mg , 0.079 mmol ) were reacted under the general protocol b to yield 8-(3-ac - ph)-adpr ( tea salt , 3.0 equiv by h nmr ) ( 11 mg , 9.3 mol , 12% ) as a colorless solid . h ( 400 mhz , d2o ) 8.138.19 ( m , 2h , ar 2-h and h-2 ) , 8.05 ( d , 1h , j = 6.9 , ar 6-h ) , 7.86 ( d , 1h , j = 6.9 , ar 4-h ) , 7.62 ( t , 1h , j = 6.9 , ar 5-h ) , 5.78 ( d , 1h , j = 5.9 , h-1 ) , 5.195.23 ( m , 1.4h , ( 1h ) h-2 and ( 0.4h ) h-1 ) , 5.09 ( d , 0.6h , j = 2.4 , h-1 ) , 4.374.41 ( m , 1h , h-2 ) , 3.874.21 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) and 2.62 ( s , 3h , arcoch3 ) . c ( 100 mhz , d2o ) 202.4 ( c = o ) , 155.1 , 152.8 ( c-2 ) , 151.9 , 150.1 , 136.7 , 134.4 ( ar 4-c ) , 130.6 ( ar 6-c ) , 129.6 , 129.4 ( ar 5-c ) , 128.3 ( ar 2-c ) , 118.5 , 101.1 ( c/-1 ) , 96.3 ( c/-1 ) , 88.8 ( c-1 ) , 83.0 ( c-4 or c/-4 , d , j 9.4 ) , 81.7 ( c-4 or c/-4 ) 81.0 ( c-4 or c/-4 , d , j = 9.4 ) , 75.1 , 70.6 , 70.3 , 70.3 ( c-2 ) , 69.9 , 69.5 ( c/-2 ) , 66.2 ( c-5 or c/-5 , d , j = 7.1 ) , 65.3 ( c-5 or c/-5 , d , j = 7.1 ) , 65.3 ( c-5 or c/-5 , d , j = 7.1 ) and 26.3 ( coch3 ) . p ( 162 mhz , d2o ) 11.2 ( br ) and 11.4 ( br ) . hrms ( es ) calcd for c23h28n5o15p2 , 676.1063 m ; found , 676.1076 ; and rt = 17.2 min . thiophene-3-boronic acid ( 0.12 mmol , 16 mg ) and 8-br - adpr 4 ( tea salt , 0.097 mmol ) were reacted under the general protocol b to give 8-(3-thiophenyl)-adpr ( tea salt , 2.3 equiv by h nmr ) ( 25 mg , 24.7 mol , 25% ) as a colorless solid . h ( 400 mhz , d2o ) 8.14 ( s , 1h , h-2 ) , 7.88 ( br s , 1h , thiophenyl 2-h ) , 7.54 ( dd , 1h , j = 4.7 , 3.2 , thiophenyl 4-h ) , 7.35 ( d , 1h , j = 4.7 , thiophenyl 5-h ) , 5.90 ( d , 1h , j = 5.9 , h-1 ) , 5.175.21 ( m , 1.4h , ( 1h ) h-2 and ( 0.4h ) h-1 ) , 5.09 ( d , 0.6h , j = 1.9 , h-1 ) , 4.374.40 ( m , 1h , h-2 ) and 3.884.18 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) . c ( 100 mhz , d2o ) 154.5 , 152.1 ( c-2 ) , 149.9 , 148.8 , 129.3 , 127.9 , 127.8 , 127.7 , 118.2 , 101.1 ( c/-1 ) , 96.3 ( c/-1 ) , 88.6 ( c-1 ) , 82.8 ( c-4 or c/-4 , d , = j 8.5 ) , 81.7 ( c-4 or c/-4 ) , 81.1 ( c-4 or c/-4 , d , j = 8.5 ) , 75.1 , 70.6 , 70.3 , 70.1 , 69.9 , 69.4 , 66.2 ( c-5 or c/-5 ) , 65.3 ( c-5 or c/-5 ) , 65.3 ( c-5 or c/-5 ) . p ( 162 mhz , d2o ) 11.2 ( br ) and 11.3 ( br ) . hrms ( es ) calcd for c19h24n5o14p2s , 640.0521 m ; found , 640.0527 ; and rt = 24.9 min . dl-4-boronophenylalanine ( 0.1 mmol , 21 mg ) and 8-br - amp 8 ( 0.75 equiv tea salts , 40 mg , 0.08 mmol ) were reacted under the general protocol b to give 8-(4-(2-aminopropanoic acid)phenyl)-amp ( tea salt , 2.2 equiv by h nmr ) ( 19 mg , 14.4 mol , 18% ) as a colorless solid . h ( 400 mhz , d2o ) 8.17 ( s , 1h , h-2 ) , 7.61 ( d , 2h , j = 8.2 , ar h ) , 5.77 ( d , 1h , j = 5.8 , h-1 ) , 5.16 ( t , 1h , j = 6.3 , h-2 ) , 4.35 ( dd , 1h , j = 6.2 , 5.1 , h-3 ) , 3.884.09 ( m , 4h , h-4 , h-5 and nh2chch2 ) , 3.26 ( dd , 1h , j = 14.9 , 5.3 , nh2chcha / b ) and 3.08 ( 1h , obscured by et3n salt peak , nh2chcha / b ) . c ( 100 mhz , d2o ) 192.2 ( c = o ) , 155.1 , 152.8 , 152.6 ( c-2 ) , 150.1 , 138.6 , 129.9 , 129.8 , 126.9 , 118.4 , 88.6 ( c-1 ) , 83.6 ( c-4 ) , 70.0 ( c-2 ) , 69.5 ( c-3 ) , 63.4 ( c-5 ) , 55.8 ( nh2chch2 ) and 36.5 ( arch2 ) . p ( 162 mhz , d2o ) 5.6 ( s ) . hrms ( es ) calcd for c19h22n6o9p , 509.1191 m ; found , 509.1174 ; and rt = 6.96 min . triphenylphosphine ( 130 mg , 0.5 mmol ) , morpholine ( 92 ml , 1.06 mmol ) , and 2,2-dipyridyldisulfide ( 110 mg , 0.5 mmol ) were added to a solution of 8-nh2-amp 10 ( 55 mg , 0.15 mmol ) in dry dmso ( 600 l ) . the mixture was stirred at rt for 4 h , and then a solution of sodium iodide in acetone ( 0.1 m ) was added dropwise . the precipitate that formed was collected , washed with acetone , and redissolved in water and lyophilized to leave the crude morpholidate intermediate ( 39 mg ) as a pale - yellow solid . the morpholidate was dissolved in a solution of mncl2 in formamide ( 1 ml , 0.2 m ) , mgso4 ( 48 mg , 0.4 mmol ) and -nmn ( 67 mmol , 0.2 mmol ) were added , and the mixture was stirred for 2 days . the crude product was precipitated from the reaction mixture by the dropwise addition of mecn , and the precipitate was collected , washed with mecn , and dried . the crude product was purified by reverse phase column chromatography , eluting with 020% mecn in teab ( 0.05 m ) . the sample was then treated with chelex 100 ( sodium form ) to remove any paramagnetic material and lyophilized to yield the 8-amino - nad ( 13 mg , 0.02 mmol , 13% ) as a colorless solid . h ( 270 mhz , d2o ) broad , possibly small amount of remaining mn . hrms ( es ) calcd for c21h29n8o14p2 , 679.1273 m ; found , 679.1252 ; and rt = 3.03 min . nadase ( from neurospora crassa ; sigma ; 0.52 u ) in tris - hcl buffer ( 1 ml , 0.1 m , ph 7.27.4 ) was added to a solution of 8-nh2-nad11 ( 13 mg ) in tris - hcl buffer ( 4 ml , 0.1 m , ph 7.27.4 ) . after 4 h , all of the starting material had been consumed , the reaction mixture was diluted with water until the conductivity < 200 s / cm , and the product purified by ion - exchange ( q - sepaharose ) chromatography eluting with a gradient ( 050% ) of teab ( 1.0 m ) in milli - q . subsequent purification by reverse phase column chromatography , eluting with 030% mecn in teab ( 0.05 m ) , left the desired 8-nh2-adpr product ( 4.5 mg , 7.65 mol , 40% ) as a colorless solid . h ( 400 mhz , d2o ) 7.98 ( s , 1h , h-2 ) , 5.99 ( d , 1h , j = 7.6 , h-1 ) , 5.245.31 ( br , 0.4h , h-1 ) , 5.115.17 ( br , 0.6h , h-1 ) , 4.684.64 ( br m , 1h , h-2 ) , 4.384.44 ( br m , 1h , h-2 ) , 3.914.31 ( m , 8h , h-3 , h-4 , 2 h-5 , h-3 , h-4 and 2 h-5 ) . hrms ( es ) calcd for c15h23n6o14p2 , 573.0753 m ; found , 573.0775 ; and rt = 12.2 min . nhd ( 30 mol ) and nadase were reacted under the general protocol a to afford idpr as a glassy solid ( 24.6 mol , 82% ) . h ( 400 mhz , d2o ) 8.44 ( s , 1h , h-2 ) , 8.19 ( s , 1h , h-8 ) , 6.11 ( d , 1h , j1,2 = 6.1 , h-1 ) , 5.31 ( d , 1h , j1,2 = 4.1 , h-1 ) , 5.17 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.764.72 ( m , 1h , h-2 ) and 4.533.96 ( m , 9h , h-3 , h-4 , 2 h-5 , h-2 , h-3 , h-4 and 2 h-5 ) . p ( decoupled , 162 mhz , d2o ) 10.2 ( d , ab system , j = 18.8 ) , 10.6 ( d , ab system , j = 18.8 ) . hrms ( es ) calcd for c15h21n4o15p2 , 559.0484 ( m h ) ; found , 559.0480 . uv ( h2o , ph 7.2 ) max 248 nm ( 14500 ) . nicotinamide-7-deaza-8-bromoadenine-5-dinucletide ( 7-deaza-8-bromo - nad , 15 mol ) was treated with nadase under the general procedure a to afford 7-deaza-8-br - adpr as a glassy solid ( 12.7 mol , 85% ) . h ( 270 mhz , d2o ) 8.03 ( s , 1h , h-2 ) , 6.66 ( s , 1h , h-7 ) , 6.17 ( d , 1h , j1,2 = 6.1 , h-1 ) , 5.215.17 ( m , 2h , h-2 and h-1 ) , 4.544.50 ( m , 1h , h-3 ) and 4.183.94 ( m , 8h , h - ribose ) . p ( decoupled , 109 mhz , d2o ) 10.5 ( m ) and 10.7 ( m ) . hrms ( es ) calcd for c12h22n4o14p2br , 634.9797 ( m h ) ; found 634.9787 . to a solution of 1,2,3,5-o - tetraacetate ribofuranose 18 ( 4.7 g , 14.7 mmol ) , 6-chloropurine 17 ( 2.5 g , 16.17 mmol ) , and dbu ( 6.5 ml , 44.1 mmol ) in dry mecn ( 100 ml ) was added dropwise tmsotf ( 10 ml , 58.8 mmol ) at 0 c . the resulting clear brown solution was stirred for 2 h at 60 c , after which it was cooled to room temperature and aq satd nahco3 ( 400 ml ) was added . the aqueous phase was extracted with dcm ( 3 300 ml ) , dried ( na2so4 ) , filtered , and evaporated under reduced pressure , giving a brown oil . the crude was purified by column chromatography on silica gel ( dcm acetone , 9:1 v / v ) to afford the desired product as a white foam ( 4.9 g , 91% ) . h ( 270 mhz , cdcl3 ) 8.75 ( s , 1h , h-8 ) , 8.28 ( s , 1h , h-2 ) , 6.21 ( d , 1h , j1,2 = 5.1 , h-1 ) , 5.92 ( app t , 1h , j2,1 = j2,3 = 5.1 , h-2 ) , 5.62 ( app t , 1h , j3,2 = j3,4 = 5.1 , h-3 ) , 4.484.33 ( m , 3h , h-4 , h-5a and h-5b ) , 2.13 ( s , 3h , ch3 ) , 2.10 ( s , 3h , ch3 ) and 2.06 ( s , 3h , ch3 ) . c ( 68 mhz , cdcl3 ) 170.4 , 169.7 , 169.5 ( all c = o ) , 152.4 ( c-2 ) , 151.7 , 151.3 ( 2 c ) , 143.7 ( c-8 ) , 86.9 ( c-1 ) , 80.6 ( c-4 ) , 73.2 ( c-2 ) , 70.5 ( c-3 ) , 62.9 ( c-5 ) , 20.8 , 20.6 , and 20.5 ( 3 ch3 ) . rf = 0.57 ( dcm acetone , 9:1 v / v ) . 2,3,5-tri - o - acetyl-6-chloro adenosine 19 ( 1.45 g , 3.52 mmol ) was added to a freshly prepared solution of naome in meoh ( 7.04 mmol in 10 ml ) . the solution was refluxed for one hour , after which it was cooled to rt and neutralized with acoh . the solvent was evaporated , and the residue was purified by column chromatography on silica gel ( dcm acetone , 6:4 v / v ) to yield the desired product as a white foam ( 943 mg , 95% ) . h ( 270 mhz , meoh - d4 ) 8.49 ( s , 1h , h-8 ) , 8.42 ( s , 1h , h-2 ) , 6.04 ( d , 1h , j1,2 = 5.9 , h-1 ) , 4.774.73 ( m , 1h , h-2 ) , 4.38 ( dd , 1h , j3,2 = 5.1 and j3,4 = 3.1 , h-3 ) , 4.184.15 ( m , 1h , h-4 ) , 4.13 ( s , 3h , ch3 ) , 3.91 ( dd , 1h , j5a,5b = 12.5 and j5a,4 = 2.6 , h-5a ) and 3.77 ( dd , 1h , j5b,5a = 12.5 and j5b,4 = 3.5 , h-5b ) . c ( 68 mhz , meoh - d4 ) 160.5 ( c-6 ) , 151.7 ( c-2 ) , 150.8 ( c ) , 142.6 ( c-8 ) , 121.3 ( c ) , 89.9 ( c-1 ) , 86.6 ( c-4 ) , 74.3 ( c-2 ) , 71.1 ( c-3 ) , 61.9 ( c-5 ) and 53.7 ( ch3 ) ; rf = 0.09 ( dcm acetone , 6:4 v / v ) . ms ( apci ) m / z 283.4 [ ( mh ) , 100% ] . hrms ( es ) calcd for c11h15n4o5 , 283.1037 ( mh ) ; found , 283.1038 . 6-o - methylinosine 20 ( 80 mg , 0.264 mmol ) was dissolved in triethylphosphate ( 1 ml ) by heating with a heatgun . the resulting colorless solution was cooled to 0 c , and water ( 2 l ) was added followed by pocl3 ( 0.1 ml , 1.056 mmol ) . it was stirred at 0 c until disappearance of starting material and formation of a single peak as shown by hplc . after 1 h , the reaction mixture was quenched by addition of ice / water ( 15 ml ) and stirred for 15 min at 0 c , after which it was warmed up to rt . triethylphosphate was extracted with etoac ( 6 6 ml ) , and the aqueous phase was neutralized with 2 m naoh . it was then applied to a reverse phase gradifrac column eluted with a gradient of 565% mecn in 0.05 m teab . the appropriate fractions were collected and lyophilized overnight to afford the desired monophosphate as its triethylammonium salt . h ( 270 mhz , d2o ) 9.01 ( s , 1h , h-8 ) , 8.51 ( s , 1h , h-2 ) , 6.14 ( d , 1h , j1,2 = 3.7 , h-1 ) , 4.63 ( app t , 1h , j2,1 = j2,3 = 4.2 , h-2 ) , 4.414.37 ( m , 1h , h-3 ) , 4.31 ( br s , 1h , h-3 ) , 4.224.15 ( m , 1h , h-5a ) and 4.11 ( m , 4h , och3 and h-5b ) . c ( 68 mhz , cdcl3 ) 159.5 ( c-6 ) , 153.6 ( c-2 ) , 149.4 ( c-4 ) , 129.6 ( c-8 ) , 115.7 ( c-5 ) , 89.6 ( c-1 ) , 83.7 ( c-4 , j = 8.7 ) , 74.7 ( c-2 ) , 69.5 ( c-3 ) , 64.2 ( c-5 ) and 55.9 ( och3 ) . ms : ( es ) m / z 361.5 [ ( m h ) , 100% ] . hrms ( es ) calcd for c11h14n4o8p , 361.0555 [ ( m h ) ] ; found , 361.0558 . 6-o - me - imp 21 ( 120 mg , 0.331 mmol ) was dissolved in dry dmso ( 2 ml ) and coevaporated with dry dmf ( 5 3 ml ) . the residue was dissolved in dmso ( 1 ml ) to which was added morpholine ( 150 l , 1.724 mmol ) , dipyridyldisulfide ( 182 mg , 0.827 mmol ) , and triphenylphosphine ( 217 mg , 0.827 mmol ) , at which point the solution became bright yellow . it was stirred for 1 h at rt , after which hplc analysis showed formation of a new peak . precipitation of the product occurred by dropwise addition of a solution of nai in acetone ( 0.1 m ) . the resulting precipitate was filtered and washed with acetone to yield the desired product as a pale - yellow solid , which was used in the next step without further purification . 6-o - me - imp morpholidate ( 100 mg , 0.232 mmol ) , -nmn ( 85 mg , 0.253 mmol ) , and mgso4 ( 54 mg , 0.464 mmol ) were dissolved in a 0.2 m solution of mncl2 in formamide ( 1.7 ml ) and stirred at rt for 16 h , after which hplc analysis showed completion of the reaction ( rt ( -nmn ) = 2.1 min and rt ( 6-o - me - nhd ) = 3.8 min ) . mecn was added to precipitate the product , which was filtered , dissolved in milli - q , and applied to a reverse phase gradifrac column eluted with a gradient of 565% mecn in 0.05 m teab . further treatment with chelex 100 to remove any paramagnetic particles afforded the desired product as the sodium salt ( 18 mg , 8% ) . h ( 400 mhz , d2o ) 9.21 ( s , 1h , hn2 ) , 9.07 ( d , 1h , j6,5 = 6.3 , hn6 ) , 8.67 ( d , 1h , j4,5 = 8.2 , hn4 ) , 8.39 ( s , 1h , h-8 ) , 8.27 ( s , 1h , h-2 ) , 8.098.06 ( m , 1h , hn5 ) , 5.96 ( d , 1h , j1,2 = 5.9 , h-1 ) , 5.94 ( d , 1h , j1,2 = 5.5 , h-1 ) , 4.62 ( app t , 1h , j2,1 = j2,3 = 5.5 , h-2 ) and 4.384.06 ( m , 9h , hsugar ) . c ( 100 mhz , d2o ) 165.1 ( c = o ) , 160.7 ( c-6 ) , 151.1 ( c-8 ) , 151.0 ( c-4 ) , 145.7 ( cn4 ) , 142.4 ( cn6 ) , 141.5 ( c-2 ) , 139.8 ( cn2 ) , 133.6 ( cn3 ) , 128.6 ( cn5 ) , 120.4 ( c-5 ) , 99.9 ( c-1 ) , 87.0 ( c-1 ) , 86.8 ( c-4 , d , j = 9.2 ) , 83.7 ( c-4 , d , j = 9.2 ) , 77.4 ( c-2 ) , 74.0 ( c-2 ) , 70.4 ( c-3 ) , 70.2 ( c-3 ) , 64.8 , 63.3 ( 2 ch2 ) and 54.9 ( ch3 ) . p ( 109 mhz , d2o ) 11.4 ( d , j = 20.7 ) and 11.7 ( d , j = 20.7 ) . ms ( es ) m / z 678.2 [ ( m h ) , 100% ] . hrms ( es ) calcd for c22h28n6o15p2 , 678.1093 [ ( m h ) ] ; found , 678.1088 . 6-o - me - nhd sodium salt 23 ( 17.3 mg , 25.5 mol ) was incubated with aplysia cyclase ( 40 l ) in a 25 mm hepes buffer ( 35 ml , ph 7.4 ) at rt . after 4 h at rt , hplc analysis showed completion of the reaction ( rt ( nicotinamide ) = 1.7 min and rt ( product ) = 15.9 min ) . the mixture was then applied to a q - sepharose ion exchange column eluted with 1 m teab buffer . the appropriate fractions were collected and evaporated under vacuum , and the residue was coevaporated with meoh to afford the hydrolyzed product 6-o - me - idpr as a triethylammonium salt . h ( 270 mhz , d2o ) 8.58 ( s , 1h , h-2 ) , 8.45 ( s , 1h , h-8 ) , 6.15 ( d , 1h , j1,2 = 5.6 , h-1 ) , 5.26 ( d , 0.5 h , j1,2 = 4.2 , h-1 ) , 5.16 ( d , 0.5 h , j1,2 = 2.2 , h-1 ) , 4.78 ( 1h , hidden under hdo peak ) , 4.484.47 ( m , 1h ) , 4.34 ( br s , 1h ) , 4.274.17 ( m , 3h ) , 4.12 ( s , 3h , ome ) , 4.083.92 ( m , 3h ) and 3.843.82 ( m , 1h ) . p ( 109 mhz , d2o ) 10.2 ( d , j = 21.1 ) and 10.6 ( d , j = 21.1 ) . ms : ( es ) m / z 573.4 [ ( m h ) , 80% ] . hrms ( es ) calcd for c16h23n4o15p2 , 573.0641 [ ( m h ) ] ; found , 573.0646 . 2-deoxy - nad32 ( 22 mol ) was reacted with nadase under general protocol b to yield the desired hydrolyzed product ( 18.7 mol , 85% ) . h ( 270 mhz , d2o ) 8.41 ( s , 1h , h-2 ) , 8.17 ( s , 1h , h-8 ) , 6.486.43 ( m , 1h , h-1 ) , 5.26 ( d , 1h , j1,2 = 4.1 , h-1 ) , 5.15 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.71 ( m , 1h , partially hidden under hdo peak , h-2 ) , 4.273.87 ( m , 8h , h-3 , h-4 , h-5 , h-3 , h-4 and h-5 ) , 2.832.78 ( m , 1h , h-2a ) and 2.55 ( ddd , 1h , j2b,2a = 14.0 , j2b,1 = 6.3 and j2b,3 = 3.3 , h-2b ) . p ( decoupled , 109 mhz , d2o ) 10.4 ( br s ) , 10.5 ( br s ) . hrms ( es ) calcd for c15h22n5o13p2 , 542.0695 ( m h ) ; found , 542.0681 . uv ( h2o , ph 7.4 ) max 259 nm ( 15400 ) . to a solution of 3-deoxy - nad42 ( 16 mol ) in tris buffer ( 100 mm , ph 7.3 , 5 ml ) was added nadase ( 200 l ) . the reaction was left for 2 h at 37 c , after which hplc analysis showed no remaining starting material . the volatiles were evaporated under reduced pressure , and the residue was applied to a semipreparative c18 column developed with a linear gradient of 0.1 m teab against mecn . the appropriate fractions were evaporated , and excess tea salt was removed by coevaporation with meoh to leave the desired adpr analogue ( 2.6 mol , 20% ) as a glassy solid tea salt . h ( 400 mhz , d2o ) 8.37 ( s , 1h , h-8 ) , 8.16 ( s , 1h , h-2 ) , 6.03 ( d , 1h , j1,2 = 5.0 , h-1 ) , 5.20 ( d , 1h , j1,2 = 4.1 , h-1 ) , 5.10 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.714.63 ( m , 2h , h - sugar ) , 4.233.85 ( m , 7h , h - sugar ) , 2.35 ( dd , 1h , j3a,3b = 10.0 and j3a,4 = 5.8 , h-3a ) and 2.172.12 ( m , 1h , h-3b ) . p ( decoupled , 162 mhz , d2o ) 11.1 ( br m ) . hrms ( es ) calcd for c15h22n5o13p2 , 542.3090 ( m h ) ; found , 542.3098 . 9-(4-hydroxybutyl)adenine 27 ( 80 mg , 0.386 mmol ) was dissolved in trimethylphosphate ( 1.3 ml ) by heating with a heatgun . phosphorus oxychloride ( 144 l , 1.545 mmol ) and water ( 2 l ) were added at 0 c , and the resulting solution was stirred at rt for 3 h. ice / water ( 15 ml ) was then added , and the mixture was stirred for further 15 min , after which it was extracted with etoac ( 6 ) . the aqueous layer was neutralized with 5 n naoh and applied to a reverse phase column and the product eluted with a gradient of 0.05 m teab against mecn . the residue obtained was coevaporated with meoh to remove excess tea salt , leaving the desired monophosphate as its triethylammonium salt ( 92 mg , 72% ) . h ( 270 mhz , dmso - d6 ) 8.13 ( s , 1h , h-2 or h-8 ) , 7.92 ( s , 1h , h-8 or h-2 ) , 7.88 ( br s , 2h , nh2 ) , 4.03 ( t , 2h , j = 7.2 , ch2-n ) , 3.85 ( q , 2h , j = 7.2 , ch2-o ) , 1.801.75 ( m , 2h , o - ch2-ch2 ) and 1.561.49 ( m , 2h , o - ch2-ch2 ) . 9-(4-acetoxybutyl)adenine-5-monophosphate1tea 28 ( 92 mg , 0.277 mmol ) was dissolved in dry dmso ( 1 ml ) and coevaporated with dry dmf ( 5 3 ml ) . the residue was dissolved in dmso ( 400 l ) to which was added morpholine ( 106 l , 1.233 mmol ) , dipyridyldisulfide ( 130 mg , 0.592 mmol ) , and triphenylphosphine ( 155 mg , 0.592 mmol ) , at which point the solution became bright yellow . it was stirred for 2 h at rt , after which hplc analysis showed completion of the reaction . precipitation of the product occurred by dropwise addition of a solution of nai in acetone ( 0.1 m , 20 ml ) . the resulting precipitate was filtered , washed with acetone , and dried ( p : = 6.7 ppm ) . it was then reacted with -nmn ( 84 mg , 0.250 mmol ) and mgso4 ( 53 mg , 0.454 mmol ) in a 0.2 m solution of mncl2 in formamide ( 1.5 ml ) at rt overnigh , t after which hplc analysis showed completion of the reaction ( rt = 2.9 min ) . the precipitate was filtered , dissolved in milli - q , and applied to a reverse phase column eluted with a 565% gradient of mecn in 0.05 m teab . further treatment with chelex 100 to remove any paramagnetic particles afforded the desired dinucleotide as its sodium salt . nicotinamide-9-(4-acetoxybutyl)adenine-5-dinucleotide 29 ( 10 mol ) was treated with nadase under general procedure b to leave the desired acyclic - adpr ( 8.1 mol , 81% ) . h ( 270 mhz , d2o ) 8.09 ( s , 2h , h-2 and h-8 ) , 5.25 ( d , 0.4h , j1,2 = 3.8 , h-1 ) , 5.17 ( d , 0.6h , j1,2 = 1.9 , h-1 ) , 4.204.02 ( m , 3h , h-2 and ch2-n ) , 3.973.90 ( m , 5h , h-3 , h-4 , h-5 and ch2-o ) , 1.901.83 ( m , 2h , o - ch2ch2 ) and 1.621.55 ( m , 2h , o - ch2ch2 ) . . hrms ( es ) calcd for c14h22n5o11p2 , 498.0795 ( m h ) ; found , 498.0786 . uv ( h2o , ph 7.2 ) max 261 nm ( 16000 ) . a solution of catpr 46 ( 5 mol ) in tris hcl ( 100 mm , ph 7 ) was heated to 100 c for 1 h , after which hplc analysis showed conversion to a new product . the solution was applied to a reverse phase column eluted with a 565% gradient of mecn in 0.05 m teab . the appropriate fractions were collected and evaporated to afford the desired nucleotide as its triethylammonium salt ( 2.7 mol , 54% ) . h ( 270 mhz , do ) 8.54 ( s , 1h , h-2 ) , 8.26 ( s , 1h , h-8 ) , 6.11 ( d , 1h , j1,2 = 5.8 , h-1 ) , 5.31 ( d , 0.4h , j1,2 = 4.1 , h-1 ) , 5.15 ( d , 0.6h , j1,2 = 2.3 , h-1 ) , 4.554.52 ( m , 1h , h-2 ) and 4.373.96 ( m , 9h , h-3 , h-4 , h-5 , h-2 , h-3 , h-4 and h-5 ) . p ( decoupled , 109 mhz , d2o ) 11.6 ( br s ) , 23.4 ( br s , o - p - o ) . hrms ( es ) calcd for c15h23n5o17p2 , 638.0307 ( m h ) ; found , 638.0331 . uv ( h2o , ph 7.2 ) max 259 nm ( 17180 ) . 10% pd / c ( 110 mg ) was added to a solution of 2,3-o - isopropylidene-5-azido-5-deoxyadenosine ( 1.0 g , 3.01 mmol ) in etoh . the mixture was stirred for 16 h under a hydrogen atmosphere , after which the palladium was filtered and the solvent was removed under vacuum , yielding the desired compound as a white solid ( 0.9 g , 95% ) . h ( 400 mhz , dmso - d6 ) 8.34 ( s , 1h , h-8 ) , 8.14 ( s , 1h , h-2 ) , 7.29 ( br s , 2h , nh2 ) , 6.11 ( d , 1h , j1,2 = 3.0 , h-1 ) , 5.42 ( dd , 1h , j2,3 = 6.2 and j2,1 = 3.0 , h-2 ) , 5.01 ( dd , 1h , j3,2 = 6.2 and j3,4 = 2.9 , h-3 ) , 4.204.16 ( m , 1h , h-4 ) , 2.912.81 ( m , 2h , 2 h-5 ) , 1.52 ( s , 3h , ch3 ) and 1.30 ( s , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 156.1 ( c-6 ) , 152.7 ( c-8 ) , 148.8 ( c-4 ) , 140.0 ( c-2 ) , 119.2 ( c-5 ) , 113.3 ( c ) , 89.2 ( c-1 ) , 878.0 ( c-4 ) , 82.7 ( c-2 ) , 81.6 ( c-3 ) , 43.7 ( c-5 ) , 27.0 and 25.2 ( 2 ch3 ) . hrms ( es ) calcd for c13h19n6o3 , 307.1513 ( mh ) ; found , 307.1511 . to a solution of 1-o - methyl-2,3-o - isopropylidene--d - ribofuranose 49 ( 0.61 g , 2.989 mmol ) in dry pyridine ( 1 ml ) , externally cooled with ice , was added p - toluenesulfonyl chloride ( 0.7 g , 3.668 mmol ) and a catalytic amount of dmap . the reaction mixture was stirred at rt under nitrogen for 5 h. water ( 0.3 ml ) was added and stirring continued for 30 min . this mixture was extracted with chloroform ( 3 10 ml ) and the combined organic phases washed sequentially with cuso4 ( 10% w / v , aq satd ) , nahco3 ( aq satd ) and water and then dried over anhydrous sodium sulfate . the solvent was evaporated , and the residue was purified on an isco chromatographic system ( petrol etoac , 7:3 v / v ) to yield the desired compound as a white solid ( 0.92 g , 81% ) . h ( 400 mhz , cdcl3 ) 7.71 ( d , 2h , j = 8.7 2 ar h ) , 7.26 ( d , 2h , j = 8.0 , ar h ) , 4.83 ( s , 1h , h-1 ) , 4.51 ( dd , 1h , j3,2 = 6.0 and j3,4 = 0.6 , h-3 ) , 4.44 ( d , 1h , j2,3 = 6.0 , h-2 ) , 4.21 ( dt , 1h , j4,5 = 7.1 and j4,3 = 0.6 , h-4 ) , 3.933.91 ( m , 2h , h-5 ) , 3.14 ( s , 3h , ome ) , 2.36 ( s , 3h , ch3 ) , 1.35 ( s , 3h , ch3 ) and 1.19 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 144.9 ( c - so2 ) , 132.8 ( c - me ) , 129.8 ( 2c ) , 127.9 ( 2c ) ( all ch ) , 112.6 ( c ) , 109.4 ( c-1 ) , 84.8 ( c-4 ) , 83.5 ( c-2 ) , 81.3 ( c-3 ) , 69.1 ( c-5 ) , 54.9 ( ome ) , 26.2 , 24.8 ( 2 ch3 ) and 21.5 ( ch3-ph ) . hrms ( es ) calcd for c16h22nao7s , 381.0978 ( mh ) ; found , 381.0969 . to a solution of 1-o - methyl-2,3-o - isopropylidene-5-o - p - toluenesulfonyl--d - ribofuranose 50 ( 2.4 g , 6.7 mmol ) in dmf ( 20 ml ) was added nan3 ( 5.2 g , 80.4 mmol ) , and the reaction mixture was stirred at 120 c for 16 h. after cooling to rt , acetone ( 20 ml ) was added and the solid was removed by filtration . the solvents were evaporated under reduced pressure , and the residue was dissolved in dcm ( 50 ml ) and washed successively with water ( 50 ml ) , satd aq nahco3 ( 50 ml ) , and water ( 50 ml ) . the organic layer was dried ( na2so4 ) , filtered , and evaporated to leave an oil which was purified on an isco chromatographic system ( petrol etoac , 1:1 v / v ) , yielding the title compound as a colorless oil ( 1.4 g , 91% ) . h ( 400 mhz , cdcl3 ) 4.90 ( s , 1h , h-1 ) , 4.50 ( s , 2h , h-2 and h-3 ) , 4.19 ( ddd , 1h , j4,5a = 7.6 , j4,5b = 6.8 and j4,3 = 0.6 , h-4 ) , 3.35 ( dd , 1h , j5a,5b = 12.5 and j5a,4 = 7.6 , h-5a ) , 3.28 ( s , 3h , ome ) , 3.17 ( dd , 1h , j5b,5a = 12.5 and j5b,4 = 6.8 , h-5b ) , 1.39 ( s , 3h , ch3 ) and 1.22 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 112.6 ( c ) , 109.8 ( c-1 ) , 85.3 ( c-4 ) , 85.1 ( c-2 ) , 82.0 ( c-3 ) , 55.1 ( ome ) , 53.7 ( c-5 ) , 26.4 and 24.9 ( 2 ch3 ) . hrms ( es ) calcd for c9h15n3nao4 , 252.0955 ( mh ) ; found , 252.0949 . pph3 ( 1.95 g , 7.45 mmol ) was added to a solution of 1-o - methyl-2,3-o - isopropylidene-5-azido-5-deoxy--d - ribofuranose 51 ( 1.4 g , 6.11 mmol ) in thf ( 7 ml ) . the reaction mixture was stirred at rt for 16 h , after which water ( 7 ml ) was added and it was stirred for further 7 h. evaporation of the solvents followed by purification on an isco chromatographic system ( petrol etoac , 1:1 v / v ) gave the title compound as a colorless oil ( 1.04 g , 85% ) . h ( 400 mhz , cdcl3 ) 4.84 ( s , 1h , h-1 ) , 4.494.46 ( s , 2h , h-2 and h-3 ) , 4.054.01 ( m , 1h , h-4 ) , 3.24 ( s , 3h , ome ) , 2.712.62 ( m , 2h , 2 h-5 ) , 1.36 ( s , 3h , ch3 ) and 1.19 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 112.2 ( c ) , 109.5 ( c-1 ) , 88.8 ( c-4 ) , 85.4 ( c-2 ) , 82.1 ( c-3 ) , 54.9 ( ome ) , 45.4 ( c-5 ) , 26.4 and 24.8 ( 2 ch3 ) . hrms ( es ) calcd for c9h18no4 , 204.1230 ( mh ) ; found , 204.1226 . 1-o - methyl-2,3-o - isopropylidene-5-amino-5-deoxy--d - ribofuranose 52 ( 90 mg , 0.443 mmol ) , dipea ( 42 l , 0.239 mmol ) , and diethylsquarate ( 72 l , 0.487 mmol ) were reacted under the general protocol c to yield the desired product as a white foam ( 137 mg , 95% ) . h ( 400 mhz , cdcl3 ) 4.91 ( s , 1h , h-1 ) , 4.66 ( q , 4h , j = 6.9 , ch2 ) , 4.534.49 ( m , 2h , h-2 and h-3 ) , 4.29 ( app t , 1h , j = 5.6 , h-4 ) , 3.733.71 ( br m , 1h , h-5a ) , 3.513.49 ( br m , 1h , h-5b , 3.31 ( s , 3h , ome ) , 1.38 ( s , 3h , ch3 ) , 1.37 ( t , 3h , j = 6.9 , ch3 ) and 1.22 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 189.4 ( c = o ) , 184.3 ( c = o ) , 172.6 ( 2 c = c ) , 112.8 ( c ) , 109.9 ( c-1 ) , 85.8 ( c-4 ) , 85.2 ( c-2 ) , 81.5 ( c-3 ) , 69.7 ( ch2 ) , 55.5 ( ome ) , 46.4 ( c-5 ) , 26.3 , 24.8 ( 2 ch3 isopropyl ) and 15.7 ( ch3 ) . hrms ( es ) calcd for c15h22no7 , 328.1391 ( mh ) ; found , 328.1408 . to a solution of 3-(1-o - methyl-2,3-o - isopropylidene-5-amino-5-deoxy--d - ribofuranose)-4-ethoxycyclobut-3-ene-1,2-dione ( 91 mg , 0.305 mmol ) and dipea ( 26 l , 0.152 mmol ) in etoh ( 2 ml ) was added 2,3-isopropylidene-5-amino-5-deoxyadenosine ( 98 mg , 0.320 mmol ) . the reaction was stirred at rt for 1 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white foam ( 106 mg , 60% ) . h ( 400 mhz , dmso - d6 ) 8.30 ( s , 1h , h-2 ) , 8.16 ( s , 1h , h-8 ) , 7.29 ( br s , 2h , nh2 ) , 6.18 ( d , 1h , j1,2 = 2.5 , h-1 ) , 5.42 ( dd , 1h , j2,3 = 6.3 and j2,1 = 2.5 , h-2 ) , 5.0 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.5 , h-3 ) , 4.91 ( s , 1h , h-1 ) , 4.63 ( d , 1h , j3,2 = 6.0 , h-3 ) , 4.55 ( d , 1h , j2,3 = 6.0 , h-2 ) , 4.264.22 ( m , 1h , h-4 ) , 4.12 ( app t , 1h , j4,5 = 7.0 , h-4 ) , 3.91 ( br s , 1h , h-5a ) , 3.753.68 ( m , 1h , h-5b ) , 3.64 ( br s , 1h , h-5a ) , 3.493.47 ( m , 1h , h-5b ) , 3.27 ( s , 3h , ome ) , 1.52 ( s , 3h , ch3 ) , 1.34 ( s , 3h , ch3 ) , 1.30 ( s , 3h , ch3 ) and 1.22 ( s , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 182.7 , 182.6 ( 2 c = o ) , 167.6 ( 2 c = c ) , 156.1 ( c-6 ) , 152.8 ( c-2 ) , 148.8 ( c-4 ) , 139.9 ( c-8 ) , 119.2(c-5 ) , 113.7 , 111.6 ( 2 c ) , 108.8 ( c-1 ) , 88.7 ( c-1 ) , 85.5 ( c-4 ) , 85.1 ( c-4 ) , 84.5 ( c-2 ) , 83.2 ( c-2 ) , 81.2 ( c-3 ) , 81.1 ( c-3 ) , 54.4 ( och3 ) , 46.4 ( c-5 ) , 45.1 ( c-5 ) , 27.0 , 26.2 , 25.3 , and 24.7 ( 4 ch3 ) . hrms ( es ) calcd for c26h34n7o9 , 588.2413 ( mh ) ; found , 588.2429 . 3-(2,3-isopropylidene-5-amino-5-deoxyadenosine)-4-(1-o - methyl-2,3-o - isopropylidene-5-amino-5-deoxy--d - ribofuranose ) cyclobut-3-ene-1,2-dione 60 ( 40 mg , 0.07 mmol ) was deprotected by stirring in 0.1 m h2so4 for 16 h at 80 c to yield the desired compound as a white solid ( 15 mg , 45% ) . h ( 400 mhz , dmso - d6 ) 8.31 ( s , 1h , h-2 ) , 8.16 ( s , 1h , h-8 ) , 7.27 ( br s , 2h , nh2 ) , 6.17 ( d , 1h , j1,2 = 2.5 , h-1 ) , 4.91 ( s , 1h , h-1 ) , 4.354.24 ( m , 4h , h-2 , h-2 , h-3 , h-3 ) , 4.224.18 ( m , 1h , h-4 ) , 4.12 ( app t , 1h , j4,5 = 7.0 , h-4 ) , 3.92 ( br s , 1h , h-5a ) , 3.753.68 ( m , 1h , h-5b ) , 3.65 ( br s , 1h , h-5a ) , 3.493.47 ( m , 1h , h-5b ) . c ( 100 mhz , dmso - d6 ) 182.8 , 182.6 ( 2 c = o ) , 167.7 ( 2 c = c ) , 156.2 ( c-6 ) , 152.8 ( c-2 ) , 148.9 ( c-4 ) , 139.9 ( c-8 ) , 119.2(c-5 ) , 108.8 ( c-1 ) , 88.7 ( c-1 ) , 85.5 ( c-4 ) , 85.1 ( c-4 ) , 84.5 ( c-2 ) , 83.2 ( c-2 ) , 81.2 ( c-3 ) , 81.1 ( c-3 ) , 46.4 ( c-5 ) , 45.1 ( c-5 ) . hrms ( es ) calcd for c19h23n7o9 , 493.1557 ( mh ) ; found , 493.1564 . cyclopentylamine ( 104 l , 0.863 mmol ) , dipea ( 99 l , 0.570 mmol ) , and diethylsquarate ( 172 l , 1.162 mmol ) were reacted under the general protocol c to yield the desired product as a white foam ( 137 mg , 95% ) . h ( 400 mhz , cdcl3 ) 7.04 ( br s , 1h , nh ) , 4.754.73 ( m , 2h , och2 ) , 4.084.03 ( m , 1h , ch ) , 1.991.96 ( m , 2h ) , 1.741.72 ( m , 2h ) , 1.591.56 ( m , 4h ) ( 4 ch2 ) and 1.41 ( t , 3h , j = 6.6 , ch3 ) . c ( 100 mhz , cdcl3 ) 189.6 ( c-2 ) , 182.6 ( c-1 ) , 177.3 ( c-3 ) , 171.8 ( c-4 ) , 69.4 ( ch2 ) , 56.4 ( ch ) , 33.8 ( ch2 ) , 23.5 ( ch2 ) and 15.7 ( ch3 ) . hrms ( es ) calcd for c11h15no3 , 210.1130 ( mh ) ; found , 211.1127 . rf = 0.3 ( petrol etoac , 6:4 v / v ) . to a solution of 3-cyclopentylamino-4-ethoxycyclobut-3-ene-1,2-dione 55 ( 110 mg , 0.526 mmol ) and dipea ( 50 l , 0.284 mmol ) in etoh ( 3 ml ) the reaction mixture was stirred at rt for 18 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white solid ( 106 mg , 43% ) . h ( 400 mhz , meoh - d4 ) 8.32 ( s , 1h , h-8 ) , 8.29 ( s , 1h , h-2 ) , 6.25 ( d , 1h , j1,2 = 2.6 , h-1 ) , 5.55 ( dd , 1h , j2,3 = 6.4 and j2,1 = 2.6 , h-2 ) , 5.16 ( dd , 1h , j3,2 = 6.4 and j3,4 = 3.8 , h-3 ) , 4.444.40 ( m , 1h , h-4 ) , 4.07 ( dd , 1h , j5a,5b = 14.1 and j5a,4 = 4.4 , h-5a ) , 3.93 ( dd , 1h , j5ba,5a = 14.1 and j5b,4 = 6.7 , h-5b ) , 3.78 ( sept , 1h , j = 6.6 , ch ) , 1.722.07 ( m , 8h , 4 ch2 ) , 1.64 ( s , 3h , ch3 ) and 1.43 ( s , 3h , ch3 ) . c ( 100 mhz , meoh - d4 ) 183.9 ( c-2 ) , 183.5 ( c-1 ) , 169.4 ( c-3 ) , 169.0 ( c-4 ) , 157.4 ( c-6 ) , 154.2 ( c-2 ) , 150.3 ( c-4 ) , 141.9 ( c-8 ) , 120.7 ( c-5 ) , 115.9 ( c ) , 91.4 ( c-1 ) , 87.0 ( c-4 ) , 85.2 ( c-2 ) , 82.9 ( c-3 ) , 55.9 ( ch ) , 46.6 ( c-5 ) , 43.8 , 35.1 ( 4 ch2 ) , 27.5 and 25.6 ( 2 ch3 ) . hrms ( es ) calcd for c22h28n7o5 , 470.2146 ( mh ) ; found , 470.2158 . 3-(2,3-o - isopropylidene-5-amino-5-deoxyadenosine)-4-(cyclopentylamino)-cyclobut-3-ene-1,2dione 61 ( 50 mg , 0.11 mmol ) was deprotected under general protocol d to yield the desired compound as a white solid ( 40 mg , 85% ) . h ( 400 mhz , dmso - d6 ) 9.32 , 9.17 ( 2 nh ) , 8.39 ( s , 1h , h-8 ) , 8.30 ( s , 1h , h-2 ) , 7.74 ( br s , 2h , nh2 ) , 5.94 ( d , 1h , j = 5.9 , h-1 ) , 4.744.63 ( m , 4h , 2 ch2 ) , 4.254.14 ( m , 2h , h-2 , h-3 ) , 3.993.96 ( m , 1h , h-4 ) , 3.843.80 ( m , 1h , h-5a ) , 3.753.67 ( m , 2h , ch , h-5b ) , 1.42 ( t , 2h , j = 6.8 ) and 1.33 ( t , 2h , j = 6.8)(2 ch2 ) . c ( 100 , dmso - d6 ) 189.2 ( c = o ) , 182.3 ( c = o ) , 176.8 ( c = c ) , 172.8 ( c = c ) , 155.3 ( c-6 ) , 151.3 ( c-2 ) , 148.8 ( c-4 ) , 140.7 ( c-2 ) , 119.5 ( c-5 ) , 88.3 ( c-1 ) , 83.5 ( c-2 ) , 72.5 ( c-3 ) , 70.8 ( c-4 ) , 68.8 ( 2c , 2 ch2 ) , 45.8 ( c-5 ) , 15.5 ( 2c , 2 ch2 ) . hrms ( es ) calcd for c19h24n7o5 , 430.1833 ( mh ) ; found , 418.1838 . butylamine ( 135 l , 1.367 mmol ) , dipea ( 141 l , 0.811 mmol ) , and diethylsquarate 53 ( 222 l , 1.503 mmol ) were reacted under general protocol c to leave the desired product as a white foam ( 230 mg , 91% ) . h ( 400 mhz , cdcl3 ) 4.77 ( q , 2h , j = 7.2 , och2-me ) , 3.66 ( t , 1h , j = 7.0 , chh ) , 3.48 ( t , 1h , j = 7.0 , chh ) , 1.691.62 ( m , 2h , ch2 ) , 1.531.40 ( br m , 5h , ch2 and ch3 ) and 1.01 ( t , 3h , j = 7.2 , ch3 ) . c ( 100 mhz , cdcl3 ) 189.9 ( c-2 ) , 184.5 ( c-1 ) , 177.6 ( c-3 ) , 174.7 ( c-4 ) , 70.7 , 45.3 , 33.7 , 20.6 ( 4 ch2 ) , 16.2 ( et : ch3 ) and 14.0 ( bu : ch3 ) . hrms ( es ) calcd for c10h16no3 , 198.1125 ( mh ) ; found , 198.1124 . rf = 0.5 ( petrol etoac , 6:4 v / v ) . to a solution of 3-butylamino-4-ethoxycyclobut-3-ene-1,2-dione 56 ( 200 mg , 1.081 mmol ) and dipea ( 92 l , 0.531 mmol ) in etoh ( 5 ml ) the reaction mixture was stirred at rt for 24 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white foam ( 364 mg , 81% ) . h ( 400 mhz , dmso - d6 ) 8.38 ( s , 1h , h-8 ) , 8.23 ( s , 1h , h-2 ) , 7.39 ( br s , 2h , nh2 ) , 6.25 ( d , 1h , j1,2 = 2.4 , h-1 ) , 5.50 ( dd , 1h , j2,3 = 6.3 and j2,1 = 2.4 , h-2 ) , 5.04 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.5 , h-3 ) , 4.334 .. 29 ( m , 1h , h-4 ) , 3.95 ( br , 1h , h-5a ) , 3.813.75 ( br , 1h , h-5b ) , 3.51 ( br , 2h , ch2 ) , 3.383.34 ( m , 1h , chh ) , 1.60 ( s , 3h , ch3 ) , 1.51 ( br , 1h , chh ) , 1.32 ( s , 3h , ch3 ) , 1.32 ( q , 2h , j = 7.3 , ch2-me ) and 0.91 ( t , 3h , j = 7.3 , ch3 ) . c ( 100 mhz , dmso - d6 ) 182.7 ( c = o ) , 182.2 ( c = o ) , 167.7 ( c = c ) , 167.1 ( c = c ) , 156.1 ( c-6 ) , 152.8 ( c-2 ) , 148.8 ( c-4 ) , 139.9 ( c-8 ) , 119.1 ( c-5 ) , 113.7 ( c ) , 88.7 ( c-1 ) , 85.1 ( c-4 ) , 83.6 ( c-2 ) , 81.2 ( c-3 ) , 45.0 ( ch2 ) , 42.9 ( c-5 ) , 32.7 ( ch2 ) , 27.0 , 25.2 ( 2 ch3 ) , 18.9 ( ch2 ) and 13.4 ( ch3 ) . hrms ( es ) calcd for c21h28n7o5 , 458.2146 ( mh ) ; found , 458.2142 . 3-(2,3-o - isopropylidene-5-amino-5-deoxyadenosine)-4-butylamino - cyclobut-3-ene-1,2-dione 62 ( 50 mg , 0.109 mmol ) was deprotected under general protocol d to give the desired compound as a white solid ( 41 mg , 91% ) . h ( 400 mhz , dmso - d6 ) 8.40 ( s , 1h , h-8 ) , 8.26 ( s , 1h , h-2 ) , 7.567.45 ( br m , 4h , nh2 and 2 nh ) , 5.98 ( d , 1h , j1,2 = 5.8 , h-1 ) , 4.73 ( app t , 1h , j2,3 = j2,1 = 5.8 , h-2 ) , 4.23 ( app t , 1h , j3,2 = j3,4 = 5.8 , h-3 ) , 4.104.06 ( m , 1h , h-4 ) , 3.863.79 ( m , 2h , 2 h-5 ) , 3.535.52 ( m , 2h , ch2 ) , 1.511.49 ( m , 2h , ch2 ) , 1.34 ( q , 2h , j = 7.3 ) and 0.92 ( t , 3h , j = 7.3 ) . c ( 100 mhz , dmso - d6 ) 182.2 ( 2 c = o ) , 167.6 ( c-3 ) , 167.2 ( c-4 ) , 154.9 ( c-6 ) , 151.2 ( c-2 ) , 149.2 ( c-4 ) , 140.4 ( c-8 ) , 119.2 ( c-5 ) , 87.8 ( c-1 ) , 83.7 ( c-4 ) , 72.9 ( c-2 ) , 70.8 ( c-3 ) , 45.2 ( c-5 ) , 33.4 , 24.8 , 23.8 ( 3 ch2 ) and 15.8 ( ch3 ) . hrms ( es ) calcd for c18h24n7o5 , 418.1833 ( mh ) ; found , 418.1834 . hexylamine ( 130 l , 0.988 mmol ) , dipea ( 92 l , 0.533 mmol ) , and diethylsquarate 53 ( 161 l , 1.087 mmol ) were reacted under general protocol c to yield the desired product as a white foam ( 200 mg , 95% ) . h ( 400 mhz , cdcl3 ) 4.804.75 ( m , 2h , ch2-me ) , 3.65 ( t , 1h , j = 7.0 , chh - nh ) , 3.48 ( t , 1h , j = 7.0 , chh - nh ) , 1.691.64 ( m , 2h , ch2 ) , 1.531.44 ( m , 9h , 3 ch2 and ch3 ) and 0.990.96 ( m , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 189.9 ( c-2 ) , 184.5 ( c-1 ) , 177.5 ( c-3 ) , 174.8 ( c-4 ) , 70.7 ( et : ch2 ) , 45.6 , 32.5 , 31.6 , 27.1 , 23.6 ( 5 ch2 ) , 16.2 ( et : ch3 ) and 14.5 ( hex : ch3 ) . hrms ( es ) calcd for c12h20no3 , 226.1438 ( mh ) ; found , 226.1443 . rf = 0.62 ( petrol etoac , 6:4 v / v ) . to a solution of 3-hexylamino-4-ethoxycyclobut-3-ene-1,2-dione 57 ( 190 mg , 0.892 mmol ) and dipea ( 76 l , 0.438 mmol ) in etoh ( 5 ml ) was added 2,3-o - isopropylidene-5-amino-5-deoxyadenosine 59 ( 248 mg , 0.811 mmol ) . the reaction was stirred at rt for 20 h. the solvent was removed under reduced pressure , and the residue was purified on an isco chromatographic system ( dcm meoh , 8:2 v / v ) to yield the desired product as a white foam ( 291 mg , 74% ) . h ( 400 mhz , dmso - d6 ) 8.37 ( s , 1h , h-8 ) , 8.23 ( s , 1h , h-2 ) , 7.38 ( br s , 4h , nh2 and 2 nh ) , 6.26 ( d , 1h , j1,2 = 2.4 , h-1 ) , 5.49 ( dd , 1h , j2,3 = 6.2 and j2,1 = 2.4 , h-2 ) , 5.07 ( dd , 1h , j3,2 = 6.2 and j3,4 = 3.5 , h-3 ) , 4.334.29 ( m , 1h , h-4 ) , 3.96 ( br , 1h , h-5a ) , 3.813.74 ( br , 1h , h-5b ) , 3.50 ( br , 2h , ch2 ) , 1.60 ( s , 3h , ch3 ) , 1.51 ( br , 1h , chh ) , 1.38 ( s , 3h , ch3 ) , 1.30 ( br , 7h , 3 ch2 and chh ) and 0.910.88 ( m , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 182.7 ( c-2 ) , 182.2 ( c-1 ) , 167.9 ( c-3 ) , 168.5 ( c-4 ) , 156.1 ( c-6 ) , 152.8 ( c-2 ) , 148.8 ( c-4 ) , 139.9 ( c-8 ) , 119.2 ( c-5 ) , 113.7 ( c ) , 88.7 ( c-1 ) , 85.2 ( c-4 ) , 83.1 ( c-2 ) , 81.2 ( c-3 ) , 45.1 ( ch2 ) , 43.2 ( c-5 ) , 30.7 , 30.6 ( 2 ch2 ) , 27.0 ( ch3 ) , 25.4 ( ch2 ) , 25.3 ( ch3 ) 21.9 ( ch2 ) and 13.8 ( ch3 ) . hrms ( es ) calcd for c23h32n7o5 , 486.2459 ( mh ) ; found , 486.2475 . 3-(2,3-o - isopropylidene-5-amino-5-deoxyadenosine)-4-(hexylamino)cyclobut-3-ene-1,2-dione 63 ( 50 mg , 0.102 mmol ) was deprotected under general protocol d to yield the desired compound as a white solid ( 41 mg , 91% ) . h ( 400 mhz , dmso - d6 ) 8.42 ( s , 1h , h-8 ) , 8.27 ( s , 1h , h-2 ) , 7.65 ( br s , 2h , nh2 ) , 7.44 ( br s , 2h , 2 nh ) , 5.98 ( d , 1h , j1,2 = 5.7 , h-1 ) , 4.72 ( app t , 1h , j = 5.0 , h-2 ) , 4.22 ( app t , 1h , j = 4.3 , h-3 ) , 4.104.06 ( m , 2h , h-4 and h-5a ) , 3.853.79 ( m , 1h , h-5b ) , 3.51 ( br s , 2h , ch2-nh ) , 1.511.29 ( m , 8h , 4 ch2 ) and 0.910.88 c ( 100 mhz , dmso - d6 ) 182.6 ( c-2 ) , 182.3 ( c-1 ) , 167.9 ( 2 c = c ) , 155.2 ( c-6 ) , 151.5 ( c-2 ) , 149.2 ( c-4 ) , 140.2 ( c-8 ) , 119.2 ( c-5 ) , 87.6 ( c-1 ) , 83.7 ( c-4 ) , 72.9 ( c-2 ) , 70.8 ( c-3 ) , 45.5 ( ch2 ) , 43.2 ( c-5 ) , 30.7 , 30.6 , 25.4 , 21.9 ( 4 ch2 ) and 13.8 ( ch3 ) . hrms ( es ) calcd for c20h28n7o5 , 446.2146 ( mh ) ; found , 446.2157 . a solution of 1-o - methyl-2,3-o - isopropylidene--d - ribofuranose 49 ( 600 mg , 2.94 mmol ) in dmf ( 40 ml ) was cooled to 0 c , and nah ( 156 mg , 3.91 mmol , 60% in mineral oil ) was added . the mixture was stirred at 0 c for 30 min , after which tbai ( 65 mg , 0.176 mmol ) and propargyl chloride ( 0.25 ml , 3.528 mmol ) were added . the reaction mixture was stirred at rt for 16 h , the solvent was removed under reduced pressure , and the residue was purified by column chromatography using an isco chromatographic system ( petrol etoac , 1:0 0:1 v / v ) . the product was obtained as a colorless liquid ( 512 mg , 72% ) . h ( 400 mhz , cdcl3 ) 4.95 ( s , 1h , h-1 ) , 4.65 ( d , 1h , j2,3 = 6.0 , h-2 ) , 4.55 ( d , 1h , j3,2 = 6.0 , h-3 ) , 4.334.30 ( m , 1h , h-4 ) , 4.17 ( d , 2h , j = 2.4 , ch2 ) , 3.58 ( dd , 1h , j5a,5b = 9.5 and j5a,4 = 6.5 , h-5a ) , 3.523.47 ( m , 1h , h-5b ) , 3.32 ( s , 3h , ome ) , 2.42 ( t , 1h , j = 6.3 hz , ch ) , 1.46 ( s , 3h , ch3 ) and 1.30 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 112.3 ( c ) , 109.2 ( c-1 ) , 85.0 ( c-4 ) , 84.8 ( c-2 ) , 81.9 ( c-3 ) , 79.3 ( c ) , 74.6 ( hc ) , 70.5 ( c-5 ) , 58.3 ( ch2 ) , 54.8 ( och3 ) , 26.4 and 24.9 ( 2 ch3 ) . hrms ( es ) calcd for c12h18nao5 , 265.1046 ( mh ) ; found , 265.1042 . 2,3-o - isopropylidene-5-azido-5-deoxyadenosine 68 ( 100 mg , 0.30 mmol ) was taken up in naoac buffer ( ph 4 , 1 m , 15 ml ) and br2 ( 12 l , 0.45 mmol ) added . the resulting solution was stirred in the dark for 24 h and then a solution of nahso3 ( 4 m , aq ) added until the solution was colorless . all solvents were evaporated and the residue purified by column chromatography using an isco chromatographic system ( dcm acetone , 6:4 v / v ) . the title compound was obtained as an off - white solid ( 123 mg , 99% ) . h ( 400 mhz , cdcl3 ) 8.27 ( s , 1h , h-2 ) , 6.20 ( d , 1h , j1,2 = 1.8 hz , h-1 ) , 5.99 ( br s , 2h , nh2 ) , 5.68 ( dd , 1h , j2,3 = 6.3 and j2,1 = 1.8 , h-2 ) , 5.15 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.6 , h-4 ) , 4.364.31 ( m , 1h , h-4 ) , 3.543.43 ( m , 2h , 2 h-5 ) , 1.61 ( s , 3h , ch3 ) and 1.39 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 154.4 ( c-6 ) , 152.8 ( c-2 ) , 150.3 ( c-4 ) , 127.5 ( c-8 ) , 120.1 ( c-5 ) , 114.5 ( c ) , 91.2 ( c-1 ) , 86.4 ( c-4 ) , 83.4 ( c-2 ) , 82.4 ( c-3 ) , 52.1 ( c-5 ) , 27.0 and 25.3 ( 2 ch3 ) . hrms ( es ) calcd for c13h16n8o3br , 411.0523 ( mh ) ; found , 411.0532 ; and calcd for c13h16n8o3br , 413.0503 ( mh ) ; found , 413.0522 . rf = 0.58 ( dcm acetone , 3:2 v / v ) . to a solution of 2,3-o - isopropylidene-5-deoxy-5-azido-8-bromoadenosine 69 ( 123 mg , 0.30 mmol ) in a mixture of buoh - h2o ( 1:1 v / v , 6 ml ) was added cuso45h2o ( 2 mg , 0.015 mmol ) , sodium ascorbate ( 6 mg , 0.03 mmol ) , and 1-o - methyl-2,3-o - isopropylidene-5-o - propargyl--d - ribofuranose 70 ( 73 mg , 0.30 mmol ) . the reaction mixture was stirred at rt for 16 h , the solvents were removed under vacuum , and the residue was purified on an isco chromatographic system ( dcm acetone , 6:4 v / v ) to yield the product as a pale - yellow solid ( 140 mg , 71% ) . h ( 400 mhz , cdcl3 ) 8.22 ( s , 1h , h-2 ) , 7.32 ( s , 1h , ch - triazole ) , 6.29 ( br s , 2h , nh2 ) , 6.17 ( d , 1h , j1,2 = 1.7 hz , h-1 ) , 5.55 ( dd , 1h , j2,3 = 6.3 and j2,1 = 1.7 , h-2 ) , 5.22 ( dd , 1h , j3,2 = 6.3 and j3,4 = 3.9 , h-3 ) , 4.88 ( s , 1h , h-1 ) , 4.74 ( dd , 1h , j5a,5b = 13.9 and j5a,4 = 4.1 , h-5a ) , 4.624.48 ( m , 6h , h-4 , h-2 , h-3 , h-5b and ch2-triazole ) , 4.254.21 ( m , 1h , h-4 ) , 3.503.39 ( m , 2h , 2 h-5 ) , 3.20 ( s , 3h , ome ) , 1.55 ( s , 3h , ch3 ) , 1.40 ( s , 3h , ch3 ) , 1.33 ( s , 3h , ch3 ) and 1.21 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 154.6 ( c-6 ) , 153.1 ( c-2 ) , 150.1 ( c-4 ) , 144.9 ( c - triazole ) , 127.0 ( c-8 ) , 123.5 ( ch - triazole ) , 120.1 ( c-5 ) , 114.7 , 112.3 ( 2 c ) , 109.2 ( c-1 ) , 90.9 ( c-1 ) , 85.9 ( c-4 ) , 85.0 ( c-4 ) , 84.9 ( c-2 ) , 83.9 ( c-2 ) , 81.9 ( 2c , c-3 and c-3 ) , 71.3 ( c-5 ) , 64.6 ( och2-tr ) , 54.6 ( och3 ) , 51.5 ( c-5 ) , 27.0 , 26.3 , 25.3 , and 24.9 ( 4 ch3 ) . hrms ( es ) calcd for c25h33n8nao8br , 675.1497 ( mh ) ; found , 675.1469 ; calcd for c25h33n8nao8br , 677.1476 ( mh ) ; found , 677.1451 . rf = 0.58 ( dcm acetone , 3:2 v / v ) . to 1-(2,3-o - isopropylidene-5-deoxy-8-bromoadenosine)-4-(2,3-o - isopropylidene-5-o - methylribosyl)-1,2,3-triazole 71 ( 140 mg , 0.21 mmol ) , na2cl4pd ( 3 mg , 5 mol % ) , phb(oh2 ) ( 32 mg , 0.27 mmol ) , tppts ( 30 mg , 25 mol % ) , and na2co3 ( 68 mg , 0.64 mmol ) was added degassed mecn h2o ( 3 ml , 1:2 v / v ) and the resulting solution stirred at 80 c for 1 h. all solvents were evaporated and the residue purified by column chromatography using an isco chromatography system ( dcm acetone , 6:4 v / v ) to yield the product ( 30 mg , 21% ) . h ( 400 mhz , cdcl3 ) 8.27 ( s , 1h , h-2 ) , 7.707.48 ( m , 5h , ph ) , 7.35 ( s , 1h , ch - triazole ) , 6.90 ( br s , 2h , nh2 ) , 6.04 ( d , 1h , j1,2 = 1.6 , h-1 ) , 5.57 ( dd , 1h , j2,3 = 6.2 and j2,1 = 1.6 , h-2 ) , 5.28 ( dd , 1h , j3,2 = 6.2 and j3,4 = 3.5 , h-3 ) , 4.87 ( s , 1h , h-1 ) , 4.82 ( dd , 1h , j5a,5b = 14.2 and j5a,4 = 4.7 , h-5a ) , 4.71 ( dd , 1h , j5b,5a = 14.2 and j5b,4 = 8.0 , h-5a ) , 4.594.46 ( m , 5h , h-4 , h-2 , h-3 and ch2-triazole ) , 4.234.20 ( m , 1h , h-4 ) , 3.47 ( dd , 1h , j5a,5b = 9.7 and j5a,4 = 6.5 , h-5a ) , 3.433.40 ( m , 1h , h-5b ) , 3.18 ( s , 3h , ome ) , 1.45 ( s , 3h , ch3 ) , 1.38 ( s , 3h , ch3 ) , 1.29 ( s , 3h , ch3 ) and 1.21 ( s , 3h , ch3 ) . c ( 100 mhz , cdcl3 ) 155.6 ( c-6 ) , 152.6 ( c-2 ) , 151.5 ( c-8 ) , 150.0 ( c-4 ) , 144.8 ( c - triazole ) , 130.5 ( 2c ) , 129.6 ( 2c ) , 128.9 ( 5 ch - phenyl ) , 128.6 ( c - phenyl ) , 123.5 ( ch - triazole ) , 119.4 ( c-5 ) , 114.3 , 112.2 ( 2 c ) , 109.1 ( c-1 ) , 90.4 ( c-1 ) , 86.1 ( c-4 ) , 85.0 ( c-4 ) , 84.9 ( c-2 ) , 83.8 ( c-2 ) , 82.5 ( c-3 ) , 81.9 ( c-3 ) , 71.3 ( c-5 ) , 64.6 ( och2-tr ) , 54.6 ( och3 ) , 51.8 ( c-5 ) , 26.9 , 26.3 , 25.2 , and 24.9 ( 4 ch3 ) . hrms ( es ) calcd for c31h38n8nao8 , 673.2705 ( mh ) ; found , 673.2678 . 1-(2,3-o - isopropylidene-5-deoxy-8-phenyladenosine)-4-(2,3-o - isopropylidene-5-o - methylribosyl)-1,2,3-triazole 72 ( 30 mg , 0.046 mmol ) was deprotected by stirring in 0.1 m h2so4 for 16 h at 80 c to yield the desired compound ( 6 mg , 24% ) as a white solid . h ( 400 mhz , cdcl3 ) 8.27 ( s , 1h , h-2 ) , 7.707.48 ( m , 5h , ph ) , 7.35 ( s , 1h , ch - triazole ) , 6.90 ( br s , 2h , nh2 ) , 6.04 ( d , 1h , j1,2 = 1.6 , h-1 ) , 5.57 ( dd , 1h , j2,3 = 6.2 and j2,1 = 1.6 , h-2 ) , 5.28 ( dd , 1h , j3,2 = 6.2 and j3,4 = 3.5 , h-3 ) , 4.87 ( s , 1h , h-1 ) , 4.82 ( dd , 1h , j5a,5b = 14.2 and j5a,4 = 4.7 , h-5a ) , 4.71 ( dd , 1h , j5b,5a = 14.2 and j5b,4 = 8.0 , h-5a ) , 4.594.46 ( m , 5h , h-4 , h-2 , h-3 and ch2-triazole ) , 4.234.20 ( m , 1h , h-4 ) , 3.47 ( dd , 1h , j5a,5b = 9.7 and j5a,4 = 6.5 , h-5a ) and 3.433.40 ( m , 1h , h-5b ) . c ( 100 mhz , cdcl3 ) 155.6 ( c-6 ) , 152.6 ( c-2 ) , 151.5 ( c-8 ) , 150.0 ( c-4 ) , 144.8 ( c - triazole ) , 130.5 ( 2c ) , 129.6 ( 2c ) , 128.9 ( 5 ch - phenyl ) , 128.6 ( c - phenyl ) , 123.5 ( ch - triazole ) , 119.4 ( c-5 ) , 109.1 ( c-1 ) , 90.4 ( c-1 ) , 86.1 ( c-4 ) , 85.0 ( c-4 ) , 84.9 ( c-2 ) , 83.8 ( c-2 ) , 82.5 ( c-3 ) , 81.9 ( c-3 ) , 71.3 ( c-5 ) , 64.6 ( och2-tr ) and 51.8 ( c-5 ) . hrms ( es ) calcd for c24h29n8o8 , 557.2103 ( mh ) ; found , 557.2097 . to a solution of tetrazole ( 81 mg , 1.16 mmol ) and diisopropyl - dibenzylphosphoramidite ( 300 mg , 0.871 mmol ) in dcm ( 10 ml ) was added cyclopentanol 77 ( 50 mg , 0.58 mmol ) . the reaction mixture was stirred at rt for 20 min , after which tlc analysis showed total conversion of starting material to a single phosphite ( petrol etoac , 6:4 v / v , rf = 0.32 ) . the solution was cooled to 0 c , and mcpba ( 200 mg , 1.16 mmol ) was added in one portion . the mixture was warmed up to rt , diluted with etoac ( 20 ml ) , and washed with 10% na2so3 ( 20 ml ) , satd aq nahco3 ( 20 ml ) , and brine ( 20 ml ) . the organic phase was collected , dried ( na2so4 ) , filtered , and evaporated to dryness . the residue was purified with an isco chromatographic system ( petrol etoac , 7:3 v / v ) to yield the title compound as a colorless oil ( 173 mg , 86% ) . h ( 400 mhz , cdcl3 ) 7.367.20 ( m , 10h , h - benzyl ) , 5.064.97 ( m , 4h , 2 ch2 ) , 4.904.85 ( m , 1h , ch p ( 161 mhz , cdcl3 , decoupled ) 1.6 ( s ) . the above material ( 78 , 173 mg , 0.5 mmol ) was dissolved in a mixture of meoh h2o cyclohexane ( 10:1:5 v / v / v , 16 ml ) to which was added pd(oh)2/c ( 20% ) . the solution was heated to 80 c for 2 h , after which the palladium was removed by filtration through celite and the filtrate was evaporated under reduced pressure , leaving a residue which was used directly in the next step . ampna salt ( 190 mg , 0.547 mmol ) was passed through a small dowex column ( tea form ) and eluted with milli - q water . the solvent was evaporated to leave a residue , which was dissolved in dmso and coevaporated with dmf ( 3 3 ml ) . the residue obtained was dissolved in dmso ( 3 ml ) and morpholine ( 0.25 ml , 2.845 mmol ) , dipyridyldisulfide ( 301 mg , 1.367 mmol ) , and triphenylphosphine ( 358 mg , 1.367 mmol ) were added in this order . the resulting yellow solution was stirred for 90 min , after which a 0.1 m solution of nai in acetone was added . the precipitate obtained was collected by filtration and used directly in the next step . to a solution of amp - morpholidate ( 154 mg , 0.350 mmol ) and cyclopentane monophosphate 79 ( 64 mg , 0.380 mmol ) in 0.2 n mncl2 in formamide ( 2 ml ) was added mgso4 ( 82 mg , 0.70 mmol ) , and it was stirred for 16 h at rt , after which hplc analysis showed product formation . precipitation of the product occurred on addition of mecn and purification on rp-18 afforded ( after treatment with chelex 100 ) the desired dinucleotide as a glassy solid ( 55 mol , 14% over 2 steps ) . h ( 400 mhz , d2o ) 8.44 ( s , 1h , h-2 ) , 8.19 ( s , 1h , h-8 ) , 6.07 ( s , 1h , h-1 ) , 4.734.71 ( m , 1h , ch o ) , 4.66 ( br s , 1h , h-2 ) , 4.48 ( br s , 1h , h-3 ) , 4.32 ( br s , 1h , h-4 ) , 4.15 ( br s , 2h , 2 h-5 ) , 1.621.60 ( m , 4h ) , 1.521.50 ( m , 2h ) and 1.361.34 ( m , 2h ) ( 4 ch2 ) . c ( 100 mhz , d2o ) 158.2 ( c-6 ) , 153.0 ( c-8 ) , 149.3 ( c-4 ) , 140.0 ( c-2 ) , 113.3 ( c-5 ) , 87.0 ( c-1 ) , 84.0 ( c-4 ) , 79.9 ( ch ) , 74.3 ( c-2 ) , 70.5 ( c-3 ) , 65.2 ( c-5 ) , 33.4 and 22.7 ( 2 ch2 ) . a flask containing 8-bromo-2,3-o - isopropylidene - adenosine 81 ( 200 mg , 0.519 mmol ) , na2cl4pd ( 5 mol % ) , tppts ( 25 mol % ) , phb(oh)2 ( 190 mg , 1.562 mmol ) , and na2co3 ( 165 mg , 1.557 mmol ) was purged with argon , and a degassed mixture of mecn h2o ( 1:1 v / v , 6 ml ) was added . the resulting mixture was refluxed for 1 h , then water ( 6 ml ) was added and the solution neutralized with 1 m hcl . the white precipitate obtained was collected by filtration and dried under vacuum ( 161 mg , 81% ) . h ( 400 mhz , dmso - d6 ) 8.16 ( s , 1h , h-2 ) , 7.737.71 ( m , 2h , ar h ) , 7.44 ( s , 2h , nh2 ) , 5.84 ( d , 1h , j1,2 = 3.4 , h-1 ) , 5.56 ( dd , 1h , j2,3 = 6.1 and j2,1 = 3.4 , h-2 ) , 5.385.36 ( m , 1h , 5oh ) , 5.03 ( dd , 1h , j3,2 = 6.1 and j3,4 = 2.5 , h-3 ) , 4.17 ( dd , 1h , j4,5 = 5.1 and j4,3 = 2.5 , h-4 ) , 3.63 ( dd , 1h , j5a,5b = 11.5 and j5a,4 = 5.1 , h-5a ) , 3.563.51 ( m , 1h , h-5b ) , 1.41 ( s , 3h , ch3 ) and 1.28 ( s , 3h , ch3 ) . c ( 100 mhz , dmso - d6 ) 156.1 ( c-6 ) , 152.4 ( c-2 ) , 150.1 ( c-4 ) , 149.6 ( c - ph ) , 130.3 , 129.6 ( 2 ch ) , 129.1 ( c-8 ) , 128.8 ( ch ) , 118.8 ( c-5 ) , 113.0 ( c ) , 90.4 ( c-1 ) , 86.5 ( c-4 ) , 81.9 ( c-2 ) , 81.8 ( c-3 ) , 61.9 ( c-5 ) , 27.0 and 25.2 ( 2 ch3 ) . hrms ( es ) calcd for c19h21n5o4 , 384.1672 ( mh ) ; found , 384.1686 . 8-phenyl-2,3-o - isopropylidene - adenosine ( 82 , 150 mg , 0.39 mmol ) was deprotected under general protocol d to yield the desired compound as a white solid which was used directly in the next step . 8-phenyl - adenosine ( 0.39 mmol ) was dissolved in triethylphosphate ( 1 ml ) by heating with a heatgun . the resulting colorless solution was cooled to 0 c , and water ( 2 l ) was added followed by pocl3 ( 0.15 ml , 1.56 mmol ) , then stirred at 0 c until disappearance of the starting material and formation of a single peak was observed as shown by hplc . water ( 15 ml ) and the mixture was stirred for 15 min at 0 c , after which it was warmed to rt . triethylphosphate was extracted with etoac ( 6 6 ml ) , and the aqueous phase was neutralized with 2 n naoh . it was then applied to a reverse phase gradifrac column eluted with a 565% gradient of mecn in 0.05 m teab . the appropriate fractions were collected and lyophilized to afford the desired monophosphate as its triethylammonium salt . h ( 400 mhz , dmso - d6 ) 8.16 ( s , 1h , h-2 ) , 7.737.71 ( m , 2h , ar h ) , 7.44 ( s , 2h , nh2 ) , 5.84 ( d , 1h , j1,2 = 3.4 , h-1 ) , 5.56 ( dd , 1h , j2,3 = 6.1 and j2,1 = 3.4 , h-2 ) , 5.03 ( dd , 1h , j3,2 = 6.1 and j3,4 = 2.5 , h-3 ) , 4.17 ( dd , 1h , j4,5 = 5.1 and j4,3 = 2.5 , h-4 ) , 3.63 ( dd , 1h , j5a,5b = 11.5 and j5a,4 = 5.1 , h-5a ) and 3.563.51 ( m , 1h , h-5b ) . c ( 100 mhz , dmso - d6 ) 156.1 ( c-6 ) , 152.4 ( c-2 ) , 150.1 ( c-4 ) , 149.6 ( c - ph ) , 130.3 , 129.6 ( 2 ch ) , 129.1 ( c-8 ) , 128.8 ( ch ) , 118.8 ( c-5 ) , 113.0 ( c ) , 90.4 ( c-1 ) , 86.5 ( c-4 , d , j = 8.3 hz ) , 81.9 ( c-2 ) , 81.8 ( c-3 ) , 61.9 ( c-5 , d , j = 8.8 hz ) . 8-ph - ampna salt ( 83 , 53 mg , 0.092 mmol ) was passed through a small dowex column ( tea form ) and eluted with milli - q water . the solvent was evaporated to leave a residue , which was dissolved in dmso and coevaporated with dmf ( 3 3 ml ) . the residue obtained was dissolved in dmso ( 90 l ) and morpholine ( 42 l , 0.478 mmol ) , dipyridyldisulfide ( 51 mg , 0.23 mmol ) , and triphenylphosphine ( 60 mg , 0.23 mmol ) were added in this order . the resulting yellow solution was stirred for 90 min , after which a 0.1 m solution of nai in acetone was added . the precipitate obtained was collected by filtration and used directly in the next step . to a solution of 8-ph - amp - morpholidate ( 31 mg , 0.060 mmol ) and cyclopentane monophosphate 79 ( 11 mg , 0.066 mmol ) in 0.2 n mncl2 in formamide ( 0.5 ml ) was added mgso4 ( 14 mg , 0.12 mmol ) , and it was stirred for 16 h at rt , after which hplc analysis showed product formation . precipitation of the product occurred on addition of mecn and purification on rp-18 afforded ( after treatment with chelex 100 ) the desired dinucleotide as a glassy solid ( 11 mol , 12% over 2 steps ) . h ( 400 mhz , d2o ) 8.21 ( s , 1h , h-2 ) , 7.67 ( d , 1h , j = 6.2 ) , 7.607.56 ( m , 2h ) , 7.28 ( d , 2h , j = 8.1 ) ( 5 arh ) , 5.82 ( d , 1h , j = 6.4 , h-1 ) , 5.15 ( app t , 1h , h-2 ) , 4.31 ( dd , 1h , j = 6.4 , 4.5 , h-3 ) , 4.083.98 ( m , 4h , h-4 , 2 h-5 , ch o ) , 1.621.60 ( m , 4h ) , 1.521.50 ( m , 2h ) and 1.361.34 ( m , 2h ) ( 4 ch2 ) . c ( 100 mhz , d2o ) 158.3 ( c-6 ) , 152.1 ( c-8 ) , 149.3 ( c-4 ) , 140.1 ( c-2 ) , 132.4 ( 2c ) , 129.7 ( 2c ) , 128.6 ( 5 arch ) , 113.2 ( c-5 ) , 87.2 ( c-1 ) , 83.8 ( c-4 ) , 79.7 ( ch ) , 73.9 ( c-2 ) , 70.4 ( c-3 ) , 65.3 ( c-5 ) , 33.6 and 22.9 ( 2 ch2 ) . hrms ( es ) calcd for c21h27n5o10p2 , 570.1155 ( m h ) ; found , 570.1149 . uv ( h2o , ph 7.4 ) max 276 nm ( 17600 ) . 8-phenyl-2-deoxy - cadpr 85 ( 13 mol ) was incubated in kh2po4 buffer ( 100 mm , ph 7.4 ) at 70 c for 2.5 h , after which hplc analysis showed a new peak at rt = 28 min . the volatiles were removed under reduced pressure , and the residue was applied to a c18 semipreparative column eluted with a gradient of 0.1 m teab in mecn . the appropriate fractions were combined and evaporated to leave the desired product as a glassy solid in its triethylammonium form ( 5.06 mol , 39% ) . h ( 500 mhz , d2o ) 8.21 ( s , 1h , h-2 ) , 7.657.55 ( m , 5h , ar - h ) , 6.296.27 ( m , 1h , h-1 ) , 5.21 ( d , 1h , j1,2 = 4.5 , h-1 ) , 5.10 ( d , 1h , j1,2 = 2.2 , h-1 ) , 4.543.81 ( m , 9h , h - ribose ) , 3.223.16 ( m , 1h , h-2a ) and 2.202.13 ( m , 1h , h-2b ) . p ( decoupled , 109 mhz , d2o ) 11.1 ( br s ) . c ( 100 m , d2o ) 153.0 ( c-6 ) , 152.6 ( c-8 ) , 150.3 ( c-2 ) , 148.4 ( c-4 ) , 131.1 , 129.7 , 129.0 , 128.5 ( 5 ch phenyl ) , 101.2 ( c-1 ) , 91.1 ( c-1 ) , 86.6 ( c-4/c-4 ) , 75.2 ( c-2 ) , 74.8 ( c-2 ) , 70.9 ( c-3 ) , 70.4 ( c-3 ) , 65.4 ( c-5 ) and 62.8 ( c-5 ) . hrms ( es ) calcd for c21h26n5o13p2 , 618.1008 ( m h ) ; found , 618.1013 . bsa ( bovine serum albumin ) , fura-2/am , nacl , egta , nmdg , tris base , and histopaque-1119 were purchased from sigma aldrich ( mnchen , germany ) . kcl , mgso4 , mgcl2 , cacl2 , nah2po4 , d - glucose , l - ascorbic acid , tween , ionomycin , and edta were obtained from merck ( darmstadt , germany ) . fibronectin , dmem , and penicillin / streptomycin were supplied by invitrogen ( darmstadt , germany ) . fbs ( fetal bovine serum ) and g418 sulfate were purchased from biochrom ( berlin , germany ) . the anti - trpm2 antibody was procured from novus biologicals ( littleton , usa ) . the goat antirabbit antiserum was purchased from dianova ( hamburg , germany ) . percoll and ecl western blotting detection reagents were supplied by ge healthcare ( uppsala , sweden ) . hek293 cells were maintained in dmem medium containing glutamax i complemented with 10% fbs , 100 units / ml penicillin , and 100 g / ml streptomycin at 37 c in the presence of 5% co2 . hek293 clones expressing trpm2/egfp ( or egfp for control ) were cultured under the same conditions , while the medium was supplemented with 400 g / ml g418 sulfate . hek293 wild - type cells were transfected with two different expression vectors coding either for human trpm2 and egfp ( pires2-egfp - trpm2 ) or for egfp alone ( pires2-egfp ) as described previously . cells carrying the expression constructs were selected by addition of 400 g / ml g418 sulfate ( biochrom ) to the culture medium . cells were seeded at low density the day before use . during the experiments , cells were kept at room temperature in bath solution ( 1 mm cacl2 , 140 mm nmdg , 5 mm kcl , 3.3 mm mgcl2 , 1 mm cacl2 , 5 mm d - glucose , 10 mm hepes , ph 7.4 ) . patch pipets with resistances of 1.73.5 m were pulled from 1.5 mm diameter borosilicate glass capillaries and filled with pipet solution ( 120 mm kcl , 8 mm nacl , 1 mm mgcl2 , 10 mm hepes , 10 mm egta , 5.6 mm cacl2 ) , resulting in 200 nm free [ ca ] as calculated by cabuf software ( g. droogmans , formerly available from ftp://ftp.cc.kuleuven.ac.be/pub/droogmans/cabuf.zip ) . data were acquired with an epc10 amplifier and patchmaster software ( heka elektronik , germany ) and were compensated for fast and slow capacity transients . the cells were held at 50 mv and current was measured during 140 ms voltage ramps from 85 to 20 mv every 5 s over a period of 450 s. series resistance was compensated by 70% . for activation of trpm2 , adpr was added to the pipet solution at a concentration of 100 m . antagonist activity of the adpr analogues was tested by adding them at different concentrations to a pipet solution with 100 m adpr . during some experiments , the pipet solution contained 0.1% dmso because stock solutions of the more lipophilic adpr analogues were prepared in dmso . fresh blood with edta as anticoagulant was obtained from indiscriminately selected volunteers . neutrophils were isolated as described elsewhere . in brief , the blood was fractionated with a histopaque-1119 density gradient and subsequently neutrophils were further purified by the use of percoll layers ranging from 65 to 85% in density . after a final washing step , the cells were resuspended in ca measurement buffer ( 140 mm nacl , 5 mm kcl , 1 mm mgso4 , 1 mm cacl2 , 1 mm nah2po4 , 4 mm glucose , 20 mm hepes , ph 7.4 ) and kept on ice until use . to avoid premature activation of the neutrophils , all buffers used during the isolation were supplemented with 2 mm edta , cell concentrations exceeding 5 10 cells / ml were avoided , and only endotoxin free materials and solutions were used . neutrophils were incubated with 4 m fura2/am for 30 min at 37 c in the dark , washed twice , and resuspended in ca measurement buffer ( see above ) at a concentration of 1 10 cells / ml . for each measurement , 5 10 cells were transferred to a small chamber consisting of a rubber o - ring fixed with silicon grease on a glass coverslip coated subsequently with 25 ng of bsa and 250 ng of fibronectin . the cells were incubated for 15 min at ambient temperature in the presence of 10 mm l - ascorbic acid ( ph 7.4 ) and , if applicable , varying concentrations of 8-phenyl - adpr . the loaded coverslip was mounted on the stage of a perkinelmer / imrovision imaging system built around a leica dm ire 2 fluorescence microscope . approximately 70 s after the beginning of the measurement , the cells were stimulated by addition of fmlp ( final concentration 1 m ) or a5 peptide ( final concentration 10 m ) . the migration of neutrophils was observed microscopically in microfluidic devices ( -slide chemotaxis , ibidi , martinsried , germany ) . first the -slides were coated with 50 g / ml fibronectin for 30 min at ambient temperature before washing three times and drying . isolated neutrophils were resuspended to a concentration of 3 10 cells / ml in ca measurement buffer supplemented with 10% ( v / v ) plasma obtained from the same donor . if applicable , 8-phenyl - adpr or egta was added and the whole slide was loaded according to the manufacturer s instructions and incubated at room temperature for 15 min . adding 18 l of fmlp ( 125 nm ) to the upper reservoir resulted in a chemotactical gradient from 0 50 nm fmlp across the observation chamber . the slide was mounted on the stage of the imaging system , and the main chamber observed at 10 times magnification in bright - field mode . after a 5 min resting period , greyscale images with a resolution of 672 510 pixels were recorded every 30 s for 1 h using openlab software 4.0.4 . cell migration was tracked manually with a 5 5 pixel maximum intensity centering correction using the manual - tracking plugin for imagej ( 1.45e ) . migrational parameters were calculated from the movement paths using the chemotaxis and migration tool software ( v2.0 , ibidi gmbh ) .

adenosine 5-diphosphoribose ( adpr ) activates trpm2 , a ca2 + , na+ , and k+ permeable cation channel . activation is induced by adpr binding to the cytosolic c - terminal nudt9-homology domain . to generate the first structure activity relationship , systematically modified adpr analogues were designed , synthesized , and evaluated as antagonists using patch - clamp experiments in hek293 cells overexpressing human trpm2 . compounds with a purine c8 substituent show antagonist activity , and an 8-phenyl substitution ( 8-ph - adpr , 5 ) is very effective . modification of the terminal ribose results in a weak antagonist , whereas its removal abolishes activity . an antagonist based upon a hybrid structure , 8-phenyl-2-deoxy - adpr ( 86 , ic50 = 3 m ) , is more potent than 8-ph - adpr ( 5 ) . initial bioisosteric replacement of the pyrophosphate linkage abolishes activity , but replacement of the pyrophosphate and the terminal ribose by a sulfamate - based group leads to a weak antagonist , a lead to more drug - like analogues . 8-ph - adpr ( 5 ) inhibits ca2 + signalling and chemotaxis in human neutrophils , illustrating the potential for pharmacological intervention at trpm2 .

Experimental Section Synthesis of 8-Modified ADPR Analogues Synthesis of Purine Modified ADPR Analogues Synthesis of Adenosine Ribose Modified ADPR Analogues Synthesis of Pyrophosphate Modified ADPR Analogues Synthesis of Squarate Analogues: Adenosine Squaryl ( Synthesis of Click Analogue: 8-Phenyladenosine-1,4-Triazole Ribose (8-Ph-ATrR) Synthesis of Terminal Ribose Modification: Synthesis of Cyclopentyl-ADP Synthesis of Cyclopentyl-8-Phenyl-ADP Synthesis of 8-Phenyl-2-Deoxy-ADPR Pharmacology

study design - this retrospective study used a case - control with a sample selection for the convenience of individuals who had received laboratory and clinical diagnoses of chronic chagas disease 13 years prior . one patient group ( n = 29 ) was treated with benznidazole and the other group ( n = 29 ) was untreated ( control group ) . the treated and untreated patients were matched with respect to the clinical form of chagas disease , gender , age and geographical locality . before the intervention , 46 patients presented with the indeterminate clinical form of the disease , 10 were classified as having the discrete cardiac form and two had the digestive form ( megaesophagus group i ) according to the oms / opas ( 1974 ) classification . all laboratory and clinical data obtained at the beginning of this study and 13 years later from both groups were compared and the current clinical form determined following the same criteria used at baseline ( oms / opas 1974 ) . patients - a group of 58 patients ( 20 males and 38 females ) born and living in the municipality of berilo , jequitinhonha valley , state of minas gerais ( mg ) , brazil , a chagas disease vector - controlled area , was studied . t. cruzi infection was diagnosed in all patients in 1997 using conventional serological tests , including indirect immunofluorescence and elisa . at that time , all patients were also clinically evaluated by anamnesis , physical examination , ecg and thorax x - ray using the oms / opas ( 1974 ) criteria , according to montoya ( 1998 ) . of these patients , 29 ( 10 males and 19 females ) , aged six-37 years at the time of diagnosis , were etiologically treated with benznidazole ( 5 mg / kg/60 days ) . the majority ( 82.8% ) of the patients thirteen years later , these patients were re - evaluated in parallel with 29 matched untreated patients ( control group ) . before study inclusion , all patients or their legal guardians read and signed the consent term approved by the ethical committee for human research from ren rachou research centre , oswaldo cruz foundation , belo horizonte , mg ( process 007/2002 ) . laboratory evaluation - conventional serological tests - the serological evaluation was performed using sera samples obtained before and 13 years after the intervention . in - house elisa , recombinant elisa ( rec - elisa ) and indirect haemagglutination ( iha ) were used to evaluate only the sera collected 13 years after the intervention . the serum samples from the treated patients ( collected before and after the treatment ) were stored at the chagas disease laboratory , federal university of ouro preto , mg and matched with the serum samples from the untreated patients ( control group ) ; the samples were collected and examined in parallel . an " in - house " elisa was performed based on a modification of the voller et al . ( 1975 ) method , with 4.5 g / ml of antigen obtained from t. cruzi y strain , a serum dilution of 1:80 and peroxidase - anti - human igg conjugate at a dilution of 1:7,500 . the cut - off value calculated for each plate was the mean absorbance of 10 negative control serum samples plus two standard deviations ( santos et al . the chagatest - wienner rec - elisa kit was used ( elisa recombinant v.3.0 ; wienner laboratorios , rosario , argentina ) and sera were processed according to the manufacturer 's instructions . positive and negative control sera were included in parallel and the cut - off was the mean absorbance of three negative control sera plus 0.3 optical densities ( od ) . for the iha assay , the hemacruzi ( biomrieux , brazil ) kit was used according to the manufacturer 's instructions . parasitological and molecular methods - these methods were used only during the final patient evaluation performed in 2010 . a portion of the volume was used for the haemoculture and the other portion was used for the pcr . for haemoculture , the chiari et al . ( 1989 ) methodology was used . briefly , 30 ml of heparinised venous blood was centrifuged at 3,000 rpm for 10 min and the plasma was discarded . the pellet was resuspended in 15 ml of liver infusion tryptose ( lit ) medium and centrifuged under the same conditions . after removing the supernatant , the pellet was resuspended in 15 ml of lit , distributed into three tubes , maintained at 28c , homogenised every 48 h and examined at regular 30-day intervals for 120 days . for the pcr , a modified methodology based on gomes et al . blood samples ( 5 ml ) were collected in an equal volume of 6 m guanidine - hcl and 0.2 m edta , ph 8.0 , as described by vila et al . the samples were kept at room temperature ( rt ) for seven days and then boiled in water for 10 min to cleave the dna ( britto et al . an aliquot of 200 l of the lysate was subjected to dna extraction with the wizard genomic dna purification kit ( promega , cat a1125 lot 262870 ) . pcr amplifications were conducted in a 9 l mixture containing tris - hcl 10 mm ( ph 9.0 ) , 0.1% triton x-100 ( invitrogen so paulo , sp , brazil ) , 75 mm kcl ( invitrogen so paulo ) , 3.5 mm mgcl2 ( invitrogen so paulo ) , 0.2 mm of each deoxynucleotide ( datp , dctp , dgtp , dttp ; sigma , st . louis , mo , eua ) , 0.5 u of platinum taq dna polymerase ( invitrogen so paulo ) and 10 pmol of each oligonucleotide primer { 121(aaataatgtacgggtgagatgcatga ) and 122(ggttcgattggggttggtgtaatata)}. two microlitres of the blood dna sample was added to the reaction mixture . after an initial denaturation step of 5 min at 94c , 35 cycles of amplification were performed in a thermal cycler ( biocycler mj96 g ) , each cycle consisted of 1 min at 95c for dna denaturation , 1 min at 65c for primer annealing and 1 min at 72c for primer extension , followed by a final extension step of 10 min at 72c . amplified dna was visualised in silver - stained 6% polyacrylamide gels ( santos et al . 1993 ) . negative results were re - evaluated with primers for the human beta - globin gene pco3 ( acacaaactgtgttcactagc ) and pco4 ( caacttcatccacgttcacc ) as an amplification control for the reaction . clinical evaluation - the final clinical evaluation ( in 2010 ) and final clinical classification of all patients were performed by three physicians , who followed the same criteria used before treatment , as recommended by oms / opas ( 1974 ) , including anamnesis , physical examination , ecg and thorax x - ray . data from treated and untreated patients in 2010 were compared with the original data from each patient in 1997 obtained by montoya ( 1998 ) . the clinical progression of the disease was calculated by dividing the number of patients who evolved clinically ( e.g. , anamnesis , ecg and thorax x - ray alterations ) by the total number of patients . statistical analysis - comparative analyses of the absorbance ( od ) obtained by conventional elisa during the two assessments ( before and 13 years after etiological treatment ) and for the comparative analysis of clinical forms were performed using the non - parametric wilcoxon test ( figs 1 , 2 ) . fisher 's exact test was used to compare the proportion of positive haemoculture results , pcr and clinical progressions between the treated and untreated patients ( figs 3 , 4 ) . 1:anti- trypanosoma cruzi igg reactivity ( elisa ) in serum samples from treated and untreated chagas disease patients ( ch ) at the beginning of treatment ( 1997 ) and 13 years later ( 2010 ) ( a ) and clinically categorised as having the indeterminate ( b ) or cardiac / digestive ( c ) form of the disease . 2:optical density ( od ) of serum samples from patients infected with trypanosoma cruzi in the treated and untreated groups at the beginning of the study ( 1997 ) and 13 years after intervention ( 2010 ) . 3:percentage of positivity of the parasitological method ( haemoculture ) and molecular test [ polymerase chain reaction ( pcr ) ] between patients infected by trypanosoma cruzi treated ( cht ) and untreated ( chnt ) after 13 years of follow - up . 4 : clinical progression among chagas disease patients treated ( cht ) and untreated ( chnt ) infected with trypanosoma cruzi after 13 years of follow - up and grouped by the indeterminate ( ind ) treated ( indt ) , ind untreated ( indnt ) , and cardiac ( card)/digestive ( dig ) forms of the disease ( dignt : dig untreated ; digt : dig treated ) based on clinical scores at the beginning of the study . in this study , the laboratory and clinical data from two matched chagas patient groups ( treated and untreated ) were obtained before intervention ( treatment ) in 1997 and 13 years later ( 2010 ) and compared . a more detailed analysis of the stored sera using an " in house " elisa assay revealed that before treatment ( 1997 ) , the median absorbance values displayed no significant differences between the treated and untreated groups ( p > 0.05 ) . after 13 years ( in 2010 ) , the serological evaluation revealed a lower absorbance reading in the sera of patients of the treated group compared with the untreated group ( p < 0.05 ) ( fig . when the patients were grouped by the clinical form of the disease exhibited before treatment , a lower absorbance in the treated group with the indeterminate form of the disease was observed compared with the untreated group ( p < 0.05 ) ( fig . the comparison of the absorbance of sera samples collected in the beginning of the study ( 1997 ) and 13 years after intervention ( 2010 ) revealed that in the treated group , the majority of patients presented stabilisation or lower serological reactivity ( p > 0.05 ) ( fig . 2a ) , whereas in the untreated group , the majority of the patients exhibited increased reactivity ( p < 0.0001 ) ( fig . parasitological and molecular evaluation - haemoculture revealed positive results in 6.9% and 27.6% of the treated and untreated patients , respectively , and these differences were significantly different ( fig . 3 ) . pcr produced positive results in 44.8% and 13.8% of the treated and untreated patients , respectively , and these differences were also significant ( fig . 3 ) . clinical evaluation - table shows the age , gender and clinical form of each patient etiologically treated before and 13 years after the intervention . thirteen years after the intervention ( treatment ) , clinical evaluation revealed that 27.6% of the treated patients and 65.5% of the untreated patients presented with disease progression ( p < 0.05 ) ( fig . when the patients were grouped according to the clinical form observed before treatment , the patients that received treatment during the indeterminate clinical form of the disease displayed less progression / evolution of the disease ( 17.4% ) compared with untreated patients ( 56.5% ) ( fig . the data revealed a lower percentage of annual clinical progression in the treated group ( 2.12% ) compared with the untreated group ( 5.03% ) . this result was verified in the comparison of the annual index of clinical progression observed in the treated ( 1.33% ) and untreated ( 4.34% ) patients who presented with the indeterminate clinical form of the disease in the beginning of the study . however , this difference was not observed in the group of patients with cardiac and digestive alterations . at the individual level , the treatment goals for t. cruzi infection are eliminating the parasite , decreasing the probability of clinical progression of the disease and indirectly affect t. cruzi transmission using vectorial and non - vectorial mechanisms of infection ( sosa - estani 1993 ) . several randomised studies have suggested that the etiological treatment of chagas disease leads to negative results in serological tests and/or the prevention of electrocardiographic and clinical changes related to disease progression ( macdo & silveira 1987 , miranda et al . however , other studies are contradictory and indicate that when treatment is administered during the chronic phase of the disease , the parasite is not eliminated , the progress of the disease is not interrupted ; therefore , the complications of the infection are not prevented ( ianni et al . 1993 , amato neto 1998 , ianni & mady 1998 , braga et al . . controversies still exist regarding the real effects of the drugs used in human treatment on the clinical progression of chagas disease , particularly during the chronic phase of the infection ( macdo & silveira 1987 , braga et al . these contradictions are most likely caused by the use of different treatment regimens and/or post - treatment evaluation protocols ( coura & de castro 2002 ) . consequently , despite the evidence that trypanocidal therapy may positively impact the clinical course of the disease in chronically infected patients ( sosa - estani & segura 2006 ) , there is neither a consensus nor sufficient data to support the routine use of the etiological treatment of chagas disease at this stage of infection ( marin - neto et al . , we comparatively evaluated the clinical and laboratory progression of etiologically treated and untreated chagas disease patients after 13 years of follow - up . all treated and untreated patients were reactive in the conventional serology ( elisa , iha and rec - elisa ) 13 years after the intervention . a more detailed assessment using elisa indicated a lower absorbance reading in the sera of treated patients compared with untreated patients . the lower absorbance rate was verified in the patients who were treated during the indeterminate form of the disease compared with the patients who displayed cardiac and/or digestive alterations before the treatment . after the treatment , decreased serological titres 2011 ) , but the decay occurs slowly , particularly among patients treated during the chronic phase of the disease ; this result justifies the need for several years of follow - up to verify the parasitological cure . ( 1998 ) evaluated children treated with benznidazole during the indeterminate form of the disease during four years of follow - up and observed a significant decrease in serological titres in the treated patients , whereas no changes were observed among the patients who received placebos . this result may be because the patients were young ( < 12 years ) , in which case the decrease of specific antibodies is more precocious . haemoculture is an important parameter for post - treatment evaluation because when positive the therapeutic failure is evident ( coura & de castro 2002 ) . this technique revealed therapeutic failure in two/29 ( 6.9% ) of the patients in the treated group and was positive in eight/29 ( 27.6% ) of the patients in the untreated group . haemoculture is useful for monitoring parasitological cures , but negative results must be carefully analysed because they do not necessarily indicate a cure because of low parasitaemia , which is characteristic of chronic patients ( particularly treated patients ) because of the intermittent nature of the parasitaemia , which can explain the low sensitivity of this parasitological method ( chiari et al . ( 2006 ) who evaluated treated and untreated patients and observed a high prevalence of positive haemoculture results in an untreated patient group compared with a treated group . pcr revealed positivity in 44.8% of the treated patients and 13.8% of the untreated group . more studies are necessary to verify the results obtained by this methodology in the context of the follow - up of treated patients compared with other laboratorial methods employed in humans and experimental models for the evaluation of treatment efficacy . although the pcr technique is of higher sensitivity than haemoculture , these pcr results can be also attributed to the intermittent nature of the parasitaemia in chronic patients . moreover , the blood samples examined in both methods ( haemoculture and pcr ) were not the same ( galvo et al . 2003 , britto 2009 ) , but collected at the same time in different tubes . it is important to highlights that the global serological results of the treated patients did not show parasitological cure , according to the classic cure criteria ( who 2002 ) . this is not surprising because previous evaluation by pcr of these same patients ( de lana et al . however , it is important to highlight that this percentage was obtained two blood samples : the first with 64% and the second 54% of positivity . in the present work , were only one blood sample was examined . moreover , the reaction controls show the reliability of the technique { in both phases , dna extraction ( amplification of human beta - globin gene ) and pcr reaction } and eliminate the possibility of risk of contamination by k - dna aerosol . thus , some of the patients still have the infection or at least kdna of t. cruzi in their bloodstreams . the results obtained may be also explained due the intermittent character of the parasitaemia and because only one sample of each patient was evaluated . after 13 years of follow - up , the clinical evaluation revealed that 27.6% of the treated patients showed clinical progression and 65.5% of patients in the untreated group did as well . these results indicate that etiological treatment significantly delays the clinical progression of the disease , even in cases in which a parasitological cure was not yet observed . these data confirm the reports of several other authors that comparatively evaluated groups of treated and untreated patients ( viotti et al . 1994 , fabbro et al . 2000 , 2007 , gallerano & sosa 2001 ) . ( 2006 ) evaluated groups of patients with t. cruzi infection who were untreated or treated with benznidazole and revealed that the treated patients showed less disease progression ( 4% vs. 14% ) or developed fewer ecg abnormalities ( 5% vs. 16% ) compared with untreated patients . these authors also demonstrated that treatment intervention was associated with reduced clinical progression of chagas disease and a better prognosis . ( 2007 ) evaluated 111 patients with chagas disease ( 54 treated and 57 untreated ) and observed a 37% seroconversion in the treated group and a 27.8% decrease in serological titres . the percentage of clinical progression was 3.7% in the treated group and 15.8% in the untreated group , which suggests that treatment induces a protective effect against the clinical progression of chagas disease . this observation was more evident in the patients who had the indeterminate form of the disease at the beginning of the study . in this group , the clinical progression these results indicate that treatment may prevent disease progression and reveals a better prognosis for patients treated during the indeterminate form of the disease , which confirms the findings of other studies ( gallerano & sosa 2000 , viotti et al . however , the number of treated patients who displayed cardiac and digestive alterations prior to treatment was low to allow a definitive interpretation regarding the prognosis of the disease following etiological treatment . a : patients that showed clinical progression after 13 years ; cf : cardiac form ; df : digestive form ; f : female ; if : indeterminate form ; m : male . this retrospective , comparative study matched treated and untreated chagas patients by the clinical form of the disease before intervention ( treatment ) and by gender , age and geographical locality using laboratory and clinical evaluations . even considering the low number of patients overall , this study revealed that the etiological treatment with benznidazole may benefit patients during the clinical progression of the disease and provide a better prognosis , particularly when the treatment is administered to patients with the indeterminate form of the disease .

the etiological treatment of chagas disease is recommended for all patients with acute or recent chronic infection , but controversies remain regarding the benefit of chemotherapy and interpretations of the parasitological cure after etiological treatment . this study compares the laboratory and clinical evaluations of chagas disease patients who were diagnosed 13 years earlier . fifty - eight chagas disease patients ( 29 treated with benznidazole and 29 untreated ) were matched at the time of treatment based on several variables . conventional serology revealed the absence of seroconversion in all patients . however , lower serological titres were verified in the treated group , primarily among patients who had the indeterminate form of the disease . haemoculture performed 13 years after the intervention was positive for 6.9% and 27.6% of the treated and untreated patients , respectively . polymerase chain reaction tests were positive for 44.8% and 13.8% of the treated and untreated patients , respectively . patients who presented with the indeterminate form of the disease at the beginning of the study exhibited less clinical progression ( 17.4% ) compared with the untreated group ( 56.5% ) . therefore , this global analysis revealed that etiological treatment with benznidazole may benefit patients with respect to the clinical progression of chagas disease and the prognosis , particularly when administered to patients with the indeterminate form of the disease .

PATIENTS, MATERIALS AND METHODS RESULTS DISCUSSION

neuroendocrine tumors ( nets ) arise from the embryologic neuroendocrine system and thus can occur in any location in the body . the gastrointestinal ( gi ) tract and lungs are the most common primary tumor sites . based on surveillance epidemiology and end results ( seer ) data , net incidence has increased 300% , up to 5.3 per 100,000 , in the last three decades . international data also suggest similar increases , as more recent studies have observed higher incidences than previous studies [ 24 ] . net prevalence has also increased to 103,312 in the us population making it more prevalent than adenocarcinoma of the stomach and pancreas combined [ 1 , 5 ] . much of the apparent rise in new diagnoses may reflect incidental detection of net through the increased use of imaging modalities such as computed tomography ( ct ) scans and endoscopic procedures for other indications rather than a true increase in tumor incidence . retrospective analysis suggests an average delay of nine years between initial onset of symptoms and final diagnosis . despite the long delay in diagnosis and advanced stage of the disease , the 5-year survival rates are relatively high which also contributes to the disease prevalence . based on autopsy data , the true prevalence may be closer to 65 to 120 in 100,000 [ 1 , 810 ] . tumor location , size , and histopathology and patient factors such as age , sex , and race have previously been shown to predict survival [ 1 , 9 , 10 ] . while this database is extensive , it is limited to certain regions of the united states . in addition , heterogeneity of patient populations and health care delivery systems could confound some outcomes such as survival . the veterans affairs ( va ) health system is the largest integrated health system in the us and includes patients from allover the country , and a single healthcare system may provide more homogeneous data . thus , the veterans affairs ( va ) population provides an attractive alternative population in which to examine net characteristics and survival . in addition , factors associated with the survival of patients in a large , integrated system could be used to improve the care of patients within that system . the purpose of this study is to characterize patients with gi net in the va system and explore factors associated with survival . we conducted a retrospective cohort study of va patients with a new diagnosis of gi net as identified in the va central cancer registry ( ccr ) . patients in the va ccr with a histological diagnosis of a primary malignant gi neuroendocrine tumor between january 1995 and november 2009 were included in this study . the cohort began with the year 1995 because only 6 patients with gi net were identified prior to 1995 . case ascertainment at each facility was accomplished by searching cytology , pathology , and microscopic data for various specimens by histologic codes , including neuroendocrine tumors . data for each cancer case were abstracted from clinical records using standardized coding and uploaded to the va ccr every 6 months . the method of tissue diagnosis , however , is not available in the administrative database . the vital status file uses data from the veterans benefits administration 's ( vba ) beneficiary identification records locator subsystem death file ( birlsdf ) , the social security administration ( ssa ) death master file ( dmf ) , the medical sas inpatient datasets ( msid ) , and medicare database to determine a patient 's date of death . the cause of death was not available ; therefore , the study outcome was all - cause death . use of these four sources to ascertain death ( birlsdf , msid , ssadmf , and medicare ) was shown to identify 98.3% of all national death index ( ndi ) deaths where ndi is considered the gold standard for mortality data . the ccr database provided patient - level covariates : age , gender , race ( which we collapsed into white and nonwhite due to low numbers in some of the nonwhite racial categories ) , marital status ( married , not married ) , and diagnosis date which we divided into 5-year increments : 19951999 , 20002004 , and 20052009 . specific tumor data were also obtained including primary tumor location , tumor size , tumor extent ( classified as localized , regional , or distant ) , and treatment . demographic and baseline clinical characteristics were summarized using frequency and percent for categorical characteristics , and means and standard deviations for continuous descriptors . unadjusted 5-year survival rates from time of diagnosis by net site were estimated using the kaplan - meier method . unadjusted and adjusted hazard ratio estimates and 95% confidence intervals were also generated using cox proportional hazards models where patients that were still alive on august 6 , 2010 were censored . we ran unadjusted models including each predictor separately and then ran two multivariable survival models . predictors we evaluated were age , race , marriage status , tumor location , year of diagnosis , cancer stage , and tumor size . in the first adjusted model ( table 2 , adjusted model 1 ) , we included all predictors except for tumor size because of the large number of patients missing tumor size data ( n = 818 ) . as a sensitivity analysis we also ran a multivariable model removing cancer stage as we had about 170 missing a tumor stage diagnosis ( table 2 . adjusted model 2 ) . sas , version 9.2 ( cary , nc ) , was used for all analyses . from 1995 to 2009 , there were 1855 patients diagnosed with a primary net of a digestive organ . we excluded 62 cases that involved the pancreas ( 38 ) , liver ( 19 ) , anus ( 4 ) , and esophagus ( 1 ) , because the incidences of net in these organs were small . the remaining 1793 patients had been diagnosed with net of the stomach , duodenum , small intestine , colon or rectum . the baseline characteristics of this cohort are provided in table 1 . as is typical for a va population , the most common gi site was the rectum ( 38% ) and the small intestine ( 24% ) . the tumor size ranged from 1 mm to 280 mm with a mean of 19.4 mm . most of the nets were diagnosed at an early stage , 62% in situ / local , but 12% had distant metastasis at diagnosis . among patients with metastasis , the most common sites were liver ( 69% ) , unknown ( 11% ) , peritoneum ( 9% ) , lung ( 5% ) , and lymph nodes ( 4% ) . sixty nine percent ( 69% ) of patients with gi nets underwent tumor resection , 3% had unspecified surgery , < 1% had tumor destruction , and 0.1% ( n = 2 ) were missing information on treatment . in the resection group , there was a negative margin rate of 61% , positive margins of 11% , and 28% with unknown margin status . the incidence increased further with an additional 192 cases between 20002004 and 20052009 time periods . unadjusted 5-year survival rates from time of diagnosis by site were stomach 56% , duodenum 66% , small intestine 52% , colon 67% , and rectum 84% . in the unadjusted model that included race , non - whites had decreased survival compared to whites ; however , in adjusted models , there are no racial differences ( table 2 ) . survival rates of patients with a rectal tumor site were higher than each of the 4 other sites in both unadjusted and adjusted models ( table 2 ) . increasing age , not being married , net location [ compared to rectum ] , stage compared to in situ / local , and earlier period of diagnosis were associated with decreased survival in the adjusted analysis . when cancer stage is removed from the model , the magnitude of the hazard ratio for comparing small intestine and colon to rectum is increased somewhat . this study provides the largest sample from a single healthcare system and represents a national sample of patients . these data add to our knowledge of gi net within the va by providing data on treatment and outcomes . this study adds to our general knowledge of gi net by providing important information on survival trends and by confirming previous results . we provide results from published studies using seer data as the context of what is currently known about the survival of patients with gi net ; however , the different methods of collection between the databases do not allow for direct comparisons of the data . the incidences rates of the stomach , duodenum , small intestine , colon , or rectum were comparable to the most recent review of the seer data . the only potential discrepancy involves the smaller incidence of pancreatic net ( 2% ) compared to seer data ( 11% of gi net ) . the reason remains unclear , but it may be that in the past , the va did not commonly document pancreatic net as suggested by the trend of more diagnosis in the latest 5-year period . we did not include the pancreatic net as well as the liver , esophagus , and anus net because of the smaller incidences . the incidence rates of the other organs did , however , correlate with new seer data . our study shows a 223% increase in incidence gi net from the time period of 19951999 to 20052009 . our adjusted analysis found an increased all - cause mortality rate associated with older age , tumor site ( compared to rectum ) , and advanced cancer stage . as expected , those diagnosed in earlier time periods have worse survival than those diagnosed in later time periods . the increased gi net incidence is consistent with previous seer database analyses [ 1 , 10 , 13 ] . in part the va , in particular , has had increased use of colonoscopy for screening and surveillance . thus , there has been an increased opportunity to incidentally diagnose colon and rectal net , and this may in part explain the higher percentage of rectal net in this population ( 38% ) compared to the previous seer database analysis which has also shown a steady increase in rectal net [ 9 , 13 , 15 ] . in addition , this va study cohort had a higher percentage non - white population compared to the previous seer data analysis by modlin et al . . blacks made up the majority of the 35% non - white population in our study , and the modlin study found the black population to have 2.3 times more rectal net per population than whites . the unadjusted 5-year survival rate was consistent with previous seer data , with the rectal net having the highest survival of 84% ( versus 88% 19921999 seer ) , followed by duodenum at 66% , then small intestine with 52% ( 19921999 seer data with 63% but did not differentiate between small bowel and duodenum ) , and colon with 67% ( versus 62% 19921999 seer ) . classically , rectal nets have been associated with better survival than nets from other locations , and this was observed in our population . the better survival is likely due in part to increased incidental diagnosis from endoscopic exams as previously noted . also , they may have earlier symptoms such as rectal bleeding that would lead to further evaluation and subsequent diagnosis . the older seer analysis showed a small and often nonstatistically significant difference in survival between the time period of 19731991 and 19921999 , with an overall 5-year survival of 59.5% and 67.2% , respectively . another study compared the time period of 19731987 and 19882004 and found a hazard ratio of 0.73 ( 95% ci 0.69 to 0.77 ) for 19882004 . the most recent seer analysis confirms a trend of increasing 5-year survival in the last 30 years . our results suggest improved survival when the diagnosis was made in 20052009 versus previous time periods . perhaps this was in part due to the increased incidental findings through increased use of endoscopy and radiographic imaging studies . part of the improved survival may also reflect that there was a longer period of observation after a diagnosis resulting in an increased opportunity of death during that time period . two - thirds of patients diagnosed with gi net in the va system had local disease and 70% underwent resection or tumor destruction . we found no difference in survival rates between patients with local disease as compared to those with regional . although the distribution of stage at diagnosis ( i.e. , local , regional , and distant metastasis ) was similar in this va population compared to the seer database , the differences in 5-year survival rates between stages appear attenuated . our results should be interpreted in the context of the study 's strengths and limitations . va databases provide considerable linked data , and by examining patients in a single health care system , there may be fewer confounders to outcomes such as survival than in other databases . with its many facilities distributed throughout the country , the cohort we obtained provides a national sample of patients . admittedly , va patients are a select population and thus may not be generalizable to other populations . interestingly and contrary to popular belief , a 2009 va report found that the life expectancy of male veterans was 75.6 years and 80.3 years for female veterans . by comparison , central intelligence agency ( cia ) data indicate that the life expectancy of the general us population is 75.8 years for men and 80.8 years for women . there are also limitations of cancer registries that include the observational design , the lack of some clinical details that may also impact survival such as comorbidity status , method of diagnosis ( e.g. , incidental findings on endoscopy ) , and missing data for some potentially important covariates ( tumor size , treatment ) . also , we were not able to subtype the nets into categories such as insulinoma , gastrinoma , or vipoma which limits our ability to understand the different types of net . in conclusion , our findings indicate that the incidence and prognosis of nets in veterans are similar to patients in non - va settings . since many patients with gi net have a good prognosis , future studies should examine the role of surveillance after tumor resection or destruction .

background . gastrointestinal ( gi ) neuroendocrine tumor ( net ) incidence has been increasing ; however , gi net within the national veterans affairs ( va ) health system has not been described . methods . we used the va central cancer registry to identify the cohort of patients diagnosed with gi net in 19952009 . cox regression models were constructed to explore factors associated with survival . results . we included 1793 patients with net of the stomach ( 9% ) , duodenum ( 10% ) , small intestine ( 24% ) , colon ( 19% ) or rectum ( 38% ) . twenty percent were diagnosed in 19951999 , 35% in 20002004 , and 45% in 20052009 . unadjusted 5-year survival rates were : stomach 56% , duodenum 66% , small intestine 52% , colon 67% , and rectum 84% . factors associated with shorter survival were increasing age , hazard ratio ( hr ) 1.05 ( 95% ci 1.041.06 ) , net location [ compared to rectum : stomach hr 2.26 ( 95% ci 1.683.05 ) , duodenum hr 1.70 ( 95% ci 1.262.28 ) , small intestine hr 1.85 ( 95% ci 1.422.42 ) , and colon 1.83 ( 95% ci 1.412.39 ) ] , stage [ compared to in situ / local : regional hr 1.15 ( 95% ci 0.901.47 ) , distant hr 2.38 ( 95% ci 1.873.05 ) ] , and earlier period of diagnosis [ compared to 19951999 : 20002004 hr 0.70 ( 95% ci 0.590.85 ) , 20052009 hr 0.43 ( 95% ci 0.340.54 ) ] . conclusions . the incidence of gi net has also increased over time in the va system with similar survival rates to those observed in non - va settings . worsened survival was associated with older age , tumor site , advanced stage , and earlier year of diagnosis .

1. Introduction 2. Methods 3. Results 4. Discussion

over the past few years , many advances have been made in mass spectrometry techniques and protein enrichment strategies that have significantly improved the detection efficiency of phosphorylated proteins ( 1,2 ) . consequently , steadily increasing numbers of phosphorylated peptides are being reported from mouse and human cell lines as well as tissue samples ( 3,4 ) . however , the knowledge of the phosphorylated sites per se is neither sufficient to identify how signals are propagated into cells nor adequate to define the complexity of the intracellular networks . to fully appreciate the relevance of phosphoproteomic approaches it is essential to gain additional knowledge about the biological conditions under which the phosphorylation occurs , to identify the enzymes ( kinases and phosphatases ) that switch on and off their substrates , and to understand the functional consequences that these modification events have on cellular processes . amino acid phosphorylation is probably the most abundant of the intracellular post - translational protein modifications used to regulate the state of eukaryotic cells , with estimates ranging up to 500 000 phosphorylation sites in the human proteome ( 5 ) . it is considered that cell regulatory systems exhibit the property of robustness , but that this vital property can not be achieved without system complexity ( 6 ) . complexity is therefore inevitable and unavoidable , yet it is probable that it has so far been systematically underestimated . however , there are now indications that we are at the dawn of a new and more realistic era in our approaches to signaling research ( 7 ) . more and more authors are highlighting the importance of factors such as cooperativity , networking , redundancy and decision - making by in - complex molecular switching as we move away from overly linear pathway - based descriptions of cellular systems ( 814 ) . in this context , the efforts to deploy large scale phosphoproteomics to map cellular networks ( e.g. ( 1517 ) ) can be seen as indispensable to the process of covering more of the signaling network space . an important aspect to consider is the evolutionary conservation of the phospho - residues . due to their crucial role in regulating protein function however , phosphorylation motifs are short , strongly dependent on the surrounding context ( 18 ) and often reside in unstructured and rapidly - evolving regions ( 19 ) , hence they have been difficult to trace evolutionarily and mixed conclusions have been reported ( 20,21 ) . lack of data has limited the possibility for this kind of analysis ; only recently has phosphoproteomic data been available from different model organisms , thereby enabling comparative studies of the evolutionary and functional dynamics of reversible phosphorylation across eukaryotes ( 20 ) . a significant , though not so surprising , observation is that phosphorylated residues are significantly more conserved than equivalent but non - phosphorylated ones ( 10,22,23 ) . since the future knowledge and exploitation of reversible phosphorylation relies on the accessibility of the data , it is of fundamental importance to develop and maintain public repositories to facilitate data retrieval for both wet lab scientists and computational biologists . in this article we describe the content and the more recent features of phospho.elm , a manually curated web - based resource dedicated to eukaryotic phosphorylation sites . the core structure of the database has been retained ( 24,25 ) and extended , while new features have been implemented to improve data retrieval and presentation . in addition to a much larger data set , information for the phosphorylated residue , i.e. a conservation score ( cs ) and the surface accessibility score ( either calculated or predicted ) , have also been included in the update . the phospho.elm data can be accessed by a user - friendly web interface , directly via url , or programmatically via a xml / soap web service . the user can query the database by keyword or sequence identifier [ from uniprot ( 26 ) or ensembl ( 27 ) ] to get information about single proteins / substrates , or by kinase name to retrieve all phosphorylated substrates of a particular kinase . table 1.examples of different search options for retrieving data stored in the phospho.elm resourcephospho.elm data retrieval methodsinput queryresultaccess via web interface : http://phospho.elm.eu.org/protein name ( keyword)retrieval of phosphorylation sites identified in sequences of the same substrate for multiple speciesuniprot or ensembl accretrieval of phosphorylation sites of a specific sequencekinase nameretrieval of phosphorylation sites recognized by the specified kinaseaccess via url : input prefix : http://phospho.elm.eu.org/byaccession/src_human.htmlretrieval of the human src ( uniprot acc p12931)byaccession / p12931.htmlbyaccession / p12931,p07948.htmlretrieval of all the phosphorylation sites of two proteins ( uniprot acc p12931 and p07948)byaccession / p12931,p07948.csvretrieval of a plain output of the phosphorylation sites of two proteins ( uniprot acc p12931 and p07948)bydomain / cbl_sh2.htmlretrieval of phosphorylation sites which bind to the phospho - binding domain cbl_sh2p12931.fastaretrieval of the protein sequence stored in the phospho.elm databaseaccess via phosphoblast : http://phospho.elm.eu.org/pelmblastsearch.htmluniprot ac or text sequenceretrieval of phosphorylation sites that are conserved in related proteins ( whether orthologues or paralogues)access via web service : http://phospho.elm.eu.org/webservice/phosphoelmdb.wsdlpelmdbws = phosphoelmdblocator().getphosphoelmdb()for retrieving phosphorylation sites recognized by the selected kinase ( e.g. alk)kinasename = alk'req = getinstancesbykinasetextsearchrequestmsg()req._querytext = kinasenameresult = pelmdbws.getinstancesbykinasetextsearch(req ) examples of different search options for retrieving data stored in the phospho.elm resource the results page displays all phosphoproteins and phosphorylation sites ( instances ) meeting the searching criteria ; the results tables can be sorted on any column , aiding inspection of the data according to different criteria , such as : the residue number and code , the pubmed references , the sequence ( 10 ) surrounding the phospho - residue and , when available , the upstream kinases as well as the phosphopeptide - binding domains , such as the sh2 , 14 - 3 - 3 or ptb domains ( these data have been annotated for 1250 phosphosites ) . furthermore , links to matching kinase recognition motif entries stored in the elm database ( 28 ) is provided when available . figure 1.output example of a phospho.elm search using the cyclin dependent kinase inhibitor 1b ( uniprot p46527 ) as query . the results table contains : the phosphorylated residue and its position ; surrounding sequence ; kinase responsible for the phosphorylation ; literature reference ; type of source ( htp / ltp ) ; conservation score ; link to elm database ; annotation of domain which binds to the phosphorylated residue ; protein domain identified by smart or pfam ; a disorder score calculated by iupred ; link to pdb structure ; and accessibility score calculated by phospho3d . the conservation of the instance and the multiple sequence alignment that was used to calculate the cs can be inspected using the jalview plugin ( top right ) . furthermore links to phospho3d and the respective elm entry are shown at the bottom right . output example of a phospho.elm search using the cyclin dependent kinase inhibitor 1b ( uniprot p46527 ) as query . the results table contains : the phosphorylated residue and its position ; surrounding sequence ; kinase responsible for the phosphorylation ; literature reference ; type of source ( htp / ltp ) ; conservation score ; link to elm database ; annotation of domain which binds to the phosphorylated residue ; protein domain identified by smart or pfam ; a disorder score calculated by iupred ; link to pdb structure ; and accessibility score calculated by phospho3d . the conservation of the instance and the multiple sequence alignment that was used to calculate the cs can be inspected using the jalview plugin ( top right ) . furthermore links to phospho3d and the respective elm entry are shown at the bottom right . it should be mentioned that this percentage has decreased since the last phospho.elm publication ( 25 ) ; this data reflects the current limitation of both experimental and computational methods in assigning the kinase recognizing a given phosphorylation site . since this information is relevant for gaining insights into the regulation of cellular processes , we provide direct links to networkin ( 29 ) , a database of predicted kinase in addition , we encourage our users to explore the links to other resources that integrate information on signaling networks or protein protein interactions , such as mint ( 30 ) and string ( 31 ) , to expand their knowledge of the phosphoprotein substrates . the entire phospho.elm data set can be freely downloaded in a tab - delimited format at : http://phospho.elm.eu.org/dataset.html the current release of the phospho.elm data set ( version 9.0 ) contains more than 42 500 non - redundant instances of phosphorylated residues in more than 11 000 different protein sequences ( 3370 tyrosine , 31 754 serine and 7449 threonine residues ) . for each phosphosite we report whether the phosphorylation evidence has been identified by small - scale analyses ( low - throughput , ltp ) and/or by large - scale experiments ( high - throughput , htp ) , which mainly apply ms techniques . the venn diagram in figure 2 shows the remarkably small overlap between the ltp and htp phospho - instances . a total of 4249 instances have been obtained exclusively by ltp experiments and 37 413 instances solely by htp assays while 846 instances were confirmed by both htp and ltp analyses . a total of 4249 instances have been obtained exclusively by ltp experiments and 37 413 instances solely by htp assays while 846 instances were confirmed by both htp and ltp analyses . the majority of the protein instances from phospho . elm are vertebrate ( mostly homo sapiens ( 62% ) and mus musculus ( 16% ) ) though 22% are from other species , mainly drosophila melanogaster ( 13% ) and caenorhabditis elegans ( 7% ) . in total , more than 300 different kinases have been annotated and a document providing additional information about all kinases annotated in phospho.elm can be found at http://phospho.elm.eu.org/kinases.html . in order to improve the biological understanding of a particular site and thereby indirectly providing the users with additional evidence , we have added information about sequence conservation . this will help researchers to better assess the reliability of the identified sites , especially for those derived from proteomic analyses . for each instance , we have calculated the conservation score ( cs ) as described in chica et al . the conservation of the phosphorylation sites in the database has been calculated using a tree - based approach specifically developed for assessing the conservation of short linear protein motifs ( 32 ) , also accessible as individual service at http://conscore.embl.de . the method takes into account the presence / absence of the phosphorylated serine , threonine or tyrosine in relation to the global sequence conservation and gives a value between 0 and 1 , where 1 indicates conservation in all the homologous sequences at a certain distance from the query sequence , and 0 corresponds to absence of conservation . the cs of an instance is an estimation of the persistence of a phosphosite during the divergent evolution of a homologous protein sequence set . in a protein - centered view a high cs , together with other contextual information such as high residue accessibility , represents cumulative evidence for the biological relevance of such a site . this is particularly useful when analyzing htp sites that might be phosphorylated in vitro but not in vivo . the distribution of the cs of manually annotated instances is indeed significantly ( p - value < 2.2e-16 ) skewed towards 1 , in comparison to that of the instances coming from htp experiments ( figure 3 ) . figure 3.distribution of the conservation scores for ltp and htp instances in the phospho.elm database . the two distributions differ according to the kolmogorov - smirnov test with p - value < 2.2e-16 , with the ltp sites being more conserved . the two distributions differ according to the kolmogorov - smirnov test with p - value < 2.2e-16 , with the ltp sites being more conserved . in a protein interaction network context , the cs can be used to suggest evolutionarily stable protein interactions as well as taxa - specific interactions that might have been gained during evolution as regulatory circuits are changed and modulated . alignments between the phosphoprotein and the corresponding homologous sequences are available for close inspection of the conservation of the phosphosites of interest in different species ( figure 1 , button , the alignment editor jalview ( 33 ) ( http://www.jalview.org ) has been embedded as a java plugin in the html output . here , known instances are highlighted in different colors according to the phospho - residues ( light green for phosphotyrosine , purple for phosphoserine and red for phosphothreonine ) , while the conservation of the corresponding peptides in the aligned sequences are displayed as dark green columns . we urge users to look at these alignments , particularly if the cs is low , since there are several factors unrelated to the evolution of the protein sequence , e.g. sequencing errors in not well studied genomes , which could artificially diminish the score even if the site itself is quite conserved across different species . phosphorylation sites are often found in intrinsically disordered regions of proteins ( 34 ) , which usually can not be experimentally determined by x - ray crystallography . however , in a number of cases , they lie on globular domains whose sequence can confidently be mapped onto x - ray determined structures . for the latter sites , accessibility to the solvent can be calculated . currently we have been able to assign an accessibility value to 3% of all the sites in phospho.elm ( 1281 of 42 574 instances ) and we anticipate that this number will increase in parallel with the increase in solved structures . these data are particularly relevant for bioinformaticians who develop computational methods to predict kinase substrates . because of the transient nature of phosphorylation events , phosphorylation sites tend to lie on the surface of proteins . many studies [ see via et al . ( 35 ) for a summary ] have shown that the substrate specificity is not only dependent on the primary sequence of the motif hosting the phosphorylation site , but also on its structural conformation . the correspondence between a phospho.elm sequence and an x - ray protein data bank ( pdb ) structure ( 36 ) is based on sequence alignment using at least 98% global sequence identity and 100% identity at the phosphorylation site . when more than one pdb structure corresponded to a single phospho.elm sequence , one with the lowest resolution was retained . whenever a site can be mapped onto a pdb structure , its solvent accessibility ( sa in ) is taken from dssp ( 37 ) and the corresponding percentage is obtained by normalizing the sa to the phospho - residue accessibility maximum value [ as determined in ( 38 ) ] . furthermore , we have also integrated protein surface accessibility data and links to structural data ( when available ) obtained from the phospho3d database ( 39 ) . for details on the structure , one can follow the link to pdbe ( 40 ) ( http://www.ebi.ac.uk/pdbe ) . the accessibility data , however , should be interpreted in the context of the structure . for example , a low accessibility value ( of 18% ) is reported in the phospho.elm entry for the human src ( uniprot p12931 ) tyrosine 530 , which is a well known substrate of the csk kinase . this is due to the fact that the structure used to calculate the accessibility has been determined in a closed src conformation , where the phosphorylated tail binds to the sh2 domain . in general , when evaluating the sa of an instance , the user is advised to be aware of the instance molecular context . note that in most cases , the best resolution structures are not in the phosphorylated conformation ( i.e. with the phosphate moiety attached ) or , as in the src example , they are in a phosphorylated but closed , inactive conformation . in particular , if a site becomes available to its cognate kinase only as a consequence of a conformational change , this might be reflected in a ( transiently ) low accessibility value . in the great majority of the cases ( 97% ) , either an x - ray reference structure is not available for a phospho.elm sequence or a structure can be found but the phosphorylation site falls in an unresolved ( disordered ) region of the structure . in these cases , we provide the users with predicted accessibility values . the sa predictions were carried out using the real - spine integrated system of neural networks ( 41 ) . the accessibility score is shown as the last column in the html output ( figure 1 ) and , when provided , it is linked to the phospho3d resource ( http://arianna.bio.uniroma1.it/phospho3d ) . the user is encouraged to investigate this link to gain more insight into the structural features of the particular protein including a 3d representation of the instance as well as a comparison of all pdb entries available for that instance . the pdb entry that was used to calculate the score , is listed in the second last column of the html output and is linked to the pdbe resource at the ebi where different viewers are available for closer inspection of the site . in addition to providing more evidence about the structural properties of the region surrounding the phosphosites , we determine if the sites reside within domains annotated in the smart resource ( 42 ) . furthermore , for each phosphosite , a probabilistic score was calculated ranging from 0 ( complete order ) to 1 ( complete disorder ) using the iupred intrinsic order disorder predictor ( 43 ) . long and a window of 21 residues for smoothing the score . in the html output table , iupred scores below 0.5 ( predicted ordered ) are colored in grey while iupred scores above 0.5 ( predicted disordered ) are colored in black . figure 4 shows the distributions of iupred scores for instances that reside either within ( upper panel ) or outside ( lower panel ) known smart domains . outside the known domains , the sites are strongly skewed to the native disorder values , reaffirming the earlier analyses ( 34 ) . these curves may help in understanding the nature of cell regulation as they imply that most protein phosphorylation explicitly modulates protein protein interactions in dynamic regulatory systems , rather than through allosteric regulation of the shape of the modified protein , although this is clearly an important function of the less abundant in - domain sites . instances with an iupred score above 0.5 are predicted to be in a region of polypeptide sequence that is intrinsically disordered ( i.e. can not fold into a stable native structure ) . instances that reside outside globular domains have a tendency towards higher iupred scores ( disordered , lower panel ) whereas the scores of instances within domains are more evenly distributed ( upper panel ) . note that sites mapping outside the known domains are predicted to be predominantly in natively disordered polypeptides . instances with an iupred score above 0.5 are predicted to be in a region of polypeptide sequence that is intrinsically disordered ( i.e. can not fold into a stable native structure ) . instances that reside outside globular domains have a tendency towards higher iupred scores ( disordered , lower panel ) whereas the scores of instances within domains are more evenly distributed ( upper panel ) . note that sites mapping outside the known domains are predicted to be predominantly in natively disordered polypeptides . a few years ago it was estimated that more than 100 000 phosphorylation sites might exist in the human proteome ( 44 ) . recently this number has been corrected upwards to more than 500 000 sites ( 5 ) . yet it seems quite plausible , given the low ltp / htp overlap in figure 2 . other bioinformatics resources also incorporate substantial phosphorylation data : more general ones are uniprot ( 26 ) , hprd ( 45 ) , and phosphositeplus ( 46 ) . the latter provides mainly phosphorylation sites from vertebrata , but also includes data from other ptms such as acetylation , methylation , ubiquitination , and o - glycosylation . both phosida ( 47 ) and phosphopep ( 48 ) are specialized in annotation of large - scale experiments ; phosphogrid for saccharomyces cerevisiae ( 49 ) , virptm for viruses ( 50 ) and pdb for various plants ( 51 ) are devoted to specific species . additional information on phosphorylation resources can be found at the phospho.elm link page ( http://phospho.embl.de/links.html ) and at the gps compendium of computational resources for protein phosphorylation ( 52 ) ( http://gps.biocuckoo.org/links.php ) . in addition , a collection of phosphorylation databases and predictors has been recently published in a review by via et al . though we intend to incorporate the most relevant large - scale analyses , we consider our main effort should be on the collection of manually curated phosphorylation sites and related information derived from small - scale experiments on various model organisms . in the near future , we plan to integrate more information on phosphorylation motifs and protein kinase specificity , such as the kinase docking motifs ( 53 ) . in order to provide an up - to - date and comprehensive resource , we encourage our users to participate in the curation of the phospho.elm resource by submitting their own data ( http://phospho.elm.eu.org/submit.html ) .

the phospho.elm resource ( http://phospho.elm.eu.org ) is a relational database designed to store in vivo and in vitro phosphorylation data extracted from the scientific literature and phosphoproteomic analyses . the resource has been actively developed for more than 7 years and currently comprises 42 574 serine , threonine and tyrosine non - redundant phosphorylation sites . several new features have been implemented , such as structural disorder / order and accessibility information and a conservation score . additionally , the conservation of the phosphosites can now be visualized directly on the multiple sequence alignment used for the score calculation . finally , special emphasis has been put on linking to external resources such as interaction networks and other databases .

INTRODUCTION THE Phospho.ELM RESOURCE AND ITS USAGE DATA SET CONSERVATION SCORE STRUCTURAL INFORMATION CONCLUSION FUNDING

the incidence of thyroid cancer is rapidly rising in the united states at a rate of 4% per year for the past twenty years . in 2010 , there were 44,670 newly diagnosed cases and 1,690 deaths reported from thyroid cancer . papillary thyroid cancer ( ptc ) is the most common type of thyroid cancer . however , despite its indolent course , it accounts for more than 50% of deaths from thyroid cancer [ 3 , 4 ] . in 1998 , the national cancer database reported on a series of 53,856 patients with thyroid cancer from 1985 to 1995 in the united states . in this series , , ptc is associated with a high rate ( 30% to 90% of patients ) of overall lymph node metastases . this has led to controversy regarding the optimal surgical management of the neck in thyroid cancer . despite this controversy , recent data indicates that volume of neck dissections performed in the united states for thyroid and parathyroid diseases increased from 2,822 in 2000 to 5,282 in 2006 . previous studies have reported on the patterns of cervical lymph node metastases and have made recommendations regarding the neck treatment [ 811 ] . the american thyroid association ( ata ) recommends preoperative cervical ( central and lateral ) lymph node ultrasound ( us ) on all patients with biopsy - proven thyroid malignancy and fine needle aspiration of all sonographically suspicious ( loss of fatty hilus , rounded shape , hypoechogencity , cystic change , calcification , and peripheral vascularity ) lymph nodes . although the ata favors en bloc neck dissection over berry picking , they do not make specific recommendations regarding which neck levels should be operated on . the impact of neck dissection on overall survival is unclear [ 8 , 10 , 13 ] . lateral neck dissection has been shown to afford a survival advantage in certain subsets of patients . for instance , data from japan has indicated a survival advantage for neck dissection in patients with gross nodal involvement , in women older than 60 years , and when the primary tumor extends beyond the thyroid capsule . it is suggested that when lateral neck metastases are identified , neck dissection provides good regional control , improves the efficacy of radioactive iodine ablation of microscopic disease , and allows for a more accurate monitoring of posttreatment serum thyroglobulin levels . there are many unanswered questions when it comes to the management of lateral neck metastases in ptc . while radical neck dissection is rarely performed for this disease , what extent of neck dissection is appropriate ? which neck levels should be included in these neck dissections ? what are the patterns of lateral lymph node metastases in primary versus recurrent cases of ptc ? the objective of this retrospective study is to present our data in order to better understand the patterns of lateral lymph node metastases in patients with primary and recurrent ptc and to evaluate outcomes in these patients . we reviewed the medical records of a series of patients who underwent lateral neck dissection ( lnd ) for ptc at georgetown university hospital ( guh ) , washington , dc , department of otolaryngology - head and neck surgery between 1995 and 2009 . data regarding demographics , prior history of thyroid cancer , prior treatments ( including surgical and radioactive iodine ) , extent of lymphadenectomy , and total number of nodes removed were collected . patients who had not received any prior thyroid treatment ( surgery with or without radioactive iodine ) were categorized as the primary group , and patients who had received prior treatment ( thyroidectomy with or without radioactive iodine ) for ptc were categorized as the recurrent group . the pathology reports were analyzed to determine the incidence of metastatic disease at each level of the neck . we also gathered information on postsurgical and postradioactive iodine serum thyroglobulin levels , neck control , followup , and current disease status . neck control was defined as the absence of clinical , pathologic , and imaging evidence of recurrence . where data allowed , patients underwent lnd either during the initial thyroidectomy or at a later date when recurrent disease in the lateral neck was noted . in all cases , lateral lymphadenopathy was detected based on preoperative radiographic or clinical examination . in the case of recurrent disease , none of the patients underwent lnd for serum thyroglobulin ( tg ) elevation only . neck levels were considered positive for disease if they had at least one pathologically metastatic node . analyses were performed comparing the proportion of neck levels documented to contain positive disease . chi - square and fisher 's exact tests were performed in order to compare nodal positivity in the different neck levels between the primary and recurrent groups . forty - nine patients were identified : 27 ( 55% ) women and 22 ( 45% ) men . the mean age in this study was 41 ( 1469 ) years . twenty - five patients were treated for primary disease , and 28 patients were treated for recurrent disease . twenty - three of the 28 ( 82% ) patients in the recurrent group were previously treated for ptc at outside institutions prior to presenting to guh . the other five patients were treated for both primary and recurrent disease at guh . all of the patients in the recurrent group had undergone surgical treatment , and 26 ( 93% ) had also received radioactive iodine treatment ( table 1 ) . the cumulative radioactive iodine dose prior to neck dissection in this group ranged from 96 mci to 743 mci . the extent of neck dissections varied , but 29 of 57 ( 51% ) consisted of levels ii v . twelve of 57 ( 21% ) neck dissections consisted of levels i v . twelve of 57 ( 21% ) neck dissections consisted of levels ii iv . one of 57 ( 1.8% ) necks involved only levels i iv . one of 57 ( 1.8% ) necks involved only levels i v . two ( 3.5% ) double - level ( iii - iv ) neck surgeries were also performed . one of these was performed on the contralateral neck in a guh patient undergoing bilateral neck dissections . one of these was performed on a patient who was previously treated at an osh with total thyroidectomy only . overall , neck dissections included the following levels : 14 of 57 ( 25% ) included level i , 55 of 57 ( 96% ) included level ii , 57 of 57 ( 100% ) included level iii , 57 of 57 ( 100% ) included level iv , and 43 of 57 ( 75% ) included level v. an average of 31 ( 4 to 94 ) lymph nodes were removed with each neck dissection specimen . an average of 7 lymph nodes were positive with each neck specimen with a range of 1 to 94 nodes . among all of the patients treated , metastatic ptc adenopathy was confirmed pathologically in 2% of level i , 45% of level ii , 57% of level iii , 60% of level iv , and 22% of level v neck levels . when comparing primary and recurrent cases ( table 2 ) , levels ii , iii , and iv were the most common and level i was the least commonly involved in both groups . comparing primary and recurrent cases , there was no difference in the prevalence of positive disease at levels i , ii , and iii . level iv was more common in the recurrent cases ( p = 0.05 ) . level v involvement was equivalent in the recurrent ( 24% ) and in the primary ( 21% ) cases ( p = 0.76 ) . central neck dissections ( cnds ) were performed in 21 of 25 patients in the primary group . an average of 8 ( 0 to 29 ) lymph nodes were removed with each neck specimen . an average of 5 ( 0 to 25 ) lymph nodes were positive with each neck specimen . among all of the necks treated in this group , metastatic ptc adenopathy to the medial compartment two of 21 ( 9.5% ) patients in this group had pathologically positive lateral neck nodes , but did not have positive level vi nodes . one of these patients had positive lateral neck nodes in levels ii and iii , and one patient had positive lateral neck nodes in levels ii v . all of these were performed in patients who had their primary treatment at an outside institution prior to presenting to guh . an average of 5 ( 0 to 18 ) lymph nodes were removed with each neck specimen . an average of 2 ( 0 to 8) lymph nodes were positive with each neck specimen . metastatic ptc adenopathy to the medial compartment was confirmed pathologically in 3 of 5 ( 60% ) necks . twenty - four of 25 ( 96% ) patients in the primary group received radioactive iodine ( i-131 ) . the cumulative dose of i-131 following neck dissection ranged from 102 mci to 650 mci . twelve of 28 ( 43% ) patients in the recurrent group received i-131 following neck dissection . the cumulative dose of i-131 following neck dissection in this group ranged from 150 mci to 507 mci . follow - up information was available on 43 of 49 ( 88% ) patients . at a median of 34 ( 1111 ) months , the follow - up status was as follows : 38 of 43 patients ( 88% ) alive without evidence of clinical disease , 4 of 43 patients ( 9% ) alive with clinical disease , and 1 patient ( 2% ) deceased from metastatic thyroid cancer . of the 4 patients who are alive with disease at last followup , 1 will be treated with external beam radiation therapy for a solitary neck recurrence , one has recurrence in the neck and mediastinum , and 2 patients have distant metastases . follow - up information was available in 51 of 57 ( 89% ) necks . pathologic control of disease in the operated neck was seen in 48 of 51 ( 94% ) necks at a median followup of 34 ( 1111 ) months . of these , 1 patient recurred in a previously unoperated level i. one patient recurred in a previously operated level iii , and another patient recurred in a previously operated level iv . overall , there were only 2 ( 3.9% ) recurrences within previously operated neck levels . following neck dissection and radioactive iodine adminstration serum thyroglobulin levels with thyroid stimulating hormone ( tsh ) suppression and stimulation were analyzed . in the tsh suppression data , 4 of 49 ( 8.2% ) patients had positive thyroglobulin antibodies and were eliminated . tsh - suppressed thyroglobulin information was available in 42 of 45 ( 93% ) patients . thyroglobulin level was < 1.0 ng / ml in 27 of 42 ( 64% ) patients at a median followup of 14 ( 176 ) months . in the rhtsh stimulation data , 4 of 49 ( 8.2% ) patients had positive thyroglobulin antibodies and were eliminated . tsh - stimulated thyroglobulin information was available in 32 of 45 ( 71% ) patients . stimulated thyroglobulin level was < 1.0 ng / ml in 15 of 32 ( 47% ) patients at a median followup of 15 months ( 1.5120 ) . undetectable thyroglobulin level was designated as the lowest range reported by the laboratory ( either < 0.5 ng / ml or < 0.2 ng / ml depending upon the laboratory ) . in the primary group , undetectable thyroglobulin levels were present in 9/16 ( 56% ) under tsh suppression and in 6/14 ( 43% ) patients with rhtsh stimulation . in the recurrent group , undetectable thyroglobulin levels were present in 15/26 ( 58% ) of patients under tsh suppression and 5/18 ( 27% ) with rhtsh stimulation . in the present series , lnd was performed to address suspicious lymphadenopathy that was evident on clinical examination , imaging , or intraoperatively . clinical control in the operated neck is excellent in both primary and recurrent cases . the majority of primary patients and a substantial minority of patients with recurrence in the neck demonstrated undetectable stimulated tg levels in followup . sivanandan and soo described the most commonly involved neck levels in ptc . in their study of 75 patients with primary ptc , levels ii iv were frequently involved , with level iii being the most common site for lateral neck metastases . kupferman et al . described similar results in their study of 39 patients ( 44 neck dissections ) . the distribution of nodal positivity in levels i , ii , iii , iv , and v in this study was 14% , 52% , 57% , 41% , and 21% , respectively . iv are the most frequently involved cervical nodal basins [ 9 , 15 , 16 ] . our study adds support to this previous data with metastatic ptc commonly present in levels ii ( 45% ) , iii ( 57% ) , and iv ( 60% ) . when comparing primary and recurrent groups , there were no significant differences in the rate of positive disease in levels ii - iii . level iv was more common in recurrent cases , which was significant . despite this , due to the high rates of nodal positivity ( table 2 ) , we would recommend performing routine level iv dissection in both primary and recurrent cases . overall , level i involvement ( 2% ) was rare ; this is comparable to other studies [ 8 , 14 ] . level i nodal metastases were more common but not statistically significant in the recurrent cases ( 3.4% ) . given the low rate of level i metastases in both primary and recurrent cases , we do not advocate routine dissection of level i unless exam , imaging , or biopsy indicates involvement . it is important to determine whether level v lymphadenectomy is necessary in ptc because this portion of the procedure can be associated with postoperative morbidity related to the spinal accessory nerve ( san ) . among the necks treated , metastatic adenopathy was confirmed pathologically in 22% of level v. this is similar to the 21% and 29% incidences described by others , but is lower than the 40% incidence reported by kupferman et al . , overall , previous studies have shown that level v harbors metastatic disease in 21% to 60% of necks [ 8 , 17 ] . in our series , when the primary and recurrent cases were analyzed , 21% and 24% of the necks harbored metastatic ptc , respectively . divide level v - a and v - b based on the horizontal plane marking the inferior border of the cricoid cartilage . they recommend dissection of level v - b only in order to minimize the risk of damage to the san . in our practice , dissection of level v typically includes localization and dissection of a portion of level v - a and all of v - b by dissecting along , but not posterior to ; the san . we believe that this provides the safety of nerve identification while avoiding circumferential mobilization of the nerve . we suspect that this will reduce the risk of san - associated morbidity including shoulder pain and dysfunction while allowing an adequate dissection of level v. in our practice , dissection of the portion of level v above the spinal accessory nerve is based upon imaging and intraoperative findings . we agree with the ata recommendations to perform cnd in patients with ptc who have clinically involved central neck lymphadenopathy . in patients with clinically uninvolved central neck lymphadenopathy , we also agree with the ata guidelines to perform elective cnd for advanced primary tumors ( t3 or t4 ) . therefore , in primary cases with lateral neck disease , we recommend cnd in all cases , and in recurrent cases with lateral neck disease , we recommend careful imaging and intraoperative evaluation of the central neck and low threshold for cnd . in these recurrent cases , if there is no suspicion of central neck disease , surgical judgment must consider preoperative parathyroid status , recurrent nerve function , and overall disease burden before pursuing elective central neck dissection . only two patients developed recurrences in a previously operated neck level resulting in a 96% neck control within previously operated neck levels . tsh - stimulated undetectable tg levels were identified in 43% and 27% of our primary and recurrent patients after median followup of 16 ( 288 ) and 14 ( 198 ) months , respectively . in a study of recurrent lateral neck disease by al - saif et al . , tsh - stimulated tg levels were undetectable in 24% of patients with recurrent ptc after a five - year followup . we recognize that our study is limited by insufficient follow up data on some of our patients . however , we believe that our study gives important insight into the management of lateral lymph node metastases in patients with primary and recurrent ptc . level i dissection is not necessary in primary or recurrent cases unless exam or imaging indicates involvement . our data suggests performing dissection of level v in both primary and recurrent cases .

the incidence of thyroid cancer is rising in the united states with papillary thyroid cancer ( ptc ) being the most common type . we performed a retrospective study of 49 patients with ptc who underwent 57 lateral neck dissections ( nds ) . the extent of nds varied , but 29 of 57 ( 51% ) consisted of levels ii v . twelve of 57 ( 21% ) nds consisted of levels i v . twelve of 57 ( 21% ) nds consisted of levels ii iv . one of 57 ( 1.8% ) necks involved only levels i iv . one of 57(1.8% ) necks involved only levels i v . one of 57(1.8% ) necks involved only levels iii v . two ( 3.5% ) double - level ( iii iv ) neck surgeries were also performed . metastatic ptc adenopathy was confirmed pathologically in 2%-level - i , 45%-level - ii , 57%-level - iii , 60%-level - iv , and 22%-level - v necks . level - v was positive in 21% of primary and 24% of recurrent groups ( p = 0.76 ) . comparing primary and recurrent disease , there was no difference in nodal distribution or frequency for levels i , ii , iii , and v. level - iv was more common in the recurrent cases ( p = 0.05 ) . based on the pathologic distribution of nodes , dissection should routinely include levels ii iv and extend to level - v in primary and recurrent cases . our data does not suggest routine dissection of level - i .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

prion diseases are a group of fatal neurodegenerative disorders that are sporadic , inherited , or transmissible . these include kuru and creutzfeldt - jakob disease in humans , scrapie in sheep and bovine spongiform encephalopathy in cattle . these pathologies are caused by the conformational transition of the native and predominantly -helical cellular prion protein ( prp ) into a significantly more -sheet - containing pathogenic isoform ( prp ) , which unlike prp , is insoluble in mild detergents and partially resistant to digestion with proteinase k . prp is a cell surface glycosylphosphatidylinositol - anchored protein that is mainly expressed in neurons and glial cells and to a lesser extent in several peripheral tissues [ 4 , 5 ] . the normal physiological function of prp remains elusive , although it has been related to signaling , neuroprotection , neuritogenesis , synaptic transmission , oxidative stress , and copper metabolism [ 611 ] . prp binds copper ions with low micromolar affinity via histidine and glycine - containing peptide repeats in its n - terminal region [ 1217 ] . this cu binding domain is located between residues 6091 and consists of four identical repeats of the peptide sequence pro - his - gly - gly - gly - trp - gly - gln . although the number of octapeptide repeats varies in different species , in mammals this region is one of the most highly conserved and therefore , very likely defines a functional domain of prp . in vitro , the octarepeat region has the capacity to reduce cu(ii ) to cu(i ) [ 19 , 20 ] . in addition , there is another cu binding site outside the octarepeat region [ 2124 ] of higher affinity , in the order of nanomolar , that involves his96 and his111 . prp is localized presynaptically at central synapses [ 2527 ] and is found in synaptic membranes and in synaptic vesicles [ 9 , 28 ] . furthermore , prp - null mice show an impaired long - term potentiation , suggesting that prp is involved in normal synaptic function , and moreover , it has been shown that prp is involved in regulating the presynaptic cu concentration and synaptic transmission . the p2x family of nucleotide receptors forms non - selective cationic channels activated by extracellular adenosine triphosphate ( atp ) . these receptors are widely expressed in the central nervous system ( cns ) [ 3032 ] and are involved in synaptic transmission and plasticity including long - term potentiation as recently shown by us . interestingly , trace metals modulate p2x receptors , particularly , the p2x4 receptor subtype is differentially modulated by trace metals at physiological concentrations [ 3437 ] . while zn facilitates the atp - evoked currents , cu inhibits it in a concentration - dependent manner . previously , we demonstrated that the n - terminal octarepeat fragment of the prp prevents and reverses the inhibitory action of cu on the p2x4 receptor when added to the media . herein , in an attempt to determine whether the prp - cu interaction is relevant to synaptic activity , we extended our investigations to test whether the full - length prpco - expressed with the p2x4 receptor may modulate in situ the cu - induced inhibition of the atp current gated by the p2x4 receptor . copper chloride , atp ( as the tetrasodium salt ) , collagenase ia , and penicillin - streptomycin were purchased from sigma chemical co ( st louis , mo ) . all the salts used to prepare the barth 's incubation media and the recording solutions were analytically graded and were purchased from merck ( darmstadt , germany ) . a segment of the xenopus laevis ovary lobe was surgically removed from adult anesthetized frogs ; stages v - vi oocytes were manually defolliculated and then incubated with collagenase ia ( 1 mg / ml ) for 30 min . oocytes were manually injected with 7.512.5 ng cdna coding for the rat p2x4 receptor with or without cdna coding for the hamster prion protein ( prp-3f4 ) , both cdnas in plasmid pcdna3 , at 250 ng/l . after 4872 h of incubation at 15c in barth 's solution ( in mm ) : 88 nacl , 1 kcl , 2.4 nahco3 , 10 hepes , 0.82 mgso4 , 0.33 ca(no3)2 , ph 7.5 , supplemented with 10 iu / l penicillin/10 mg streptomycin , oocytes were clamped at 70 mv using the two - electrode voltage clamp technique with an oc-725c oocyte clamper ( warner instrument corp , hamden , ct ) . atp and cucl2 , dissolved in barth 's solution , were superfused at 2 ml / min . atp - evoked currents were recorded with a 10 s atp exposure applied regularly at 1015 min intervals . these intervals were increased up to 25 min for maximal atp concentrations in concentration - response curves protocols to decrease desensitization . copper was applied for 30 s prior 10 m atp ( coapplied with cucl2 ) . to study the distribution of prp , oocytes were coinjected with the cdna coding for the rat p2x4 receptor with the cdna coding for mouse prp - gfp ( mmprp - egfp[25 - 266]-cdna3 ) . oocytes , where p2x4 receptor expression was validated electrophysiologically , were directly analyzed on a zeiss lsm 5 pascal confocal microscope . after electrophysiological protocols , each oocyte injected with cdna coding for p2x4 and prp-3f4 was homogenized for 30 min in ice , using 40 l of lysis buffer per oocyte ( 100 mm nacl , 20 mm tris - hcl ph 7.4 , 1% triton x-100 ) supplemented with a protease inhibitors cocktail . the extracts were centrifuged for 30 s at 14000 r.p.m . at 4c and the supernatant was removed and resolved by 12% sds - page and transferred to nitrocellulose . nonspecific binding sites were blocked with 5% ( w / v ) milk in tris - buffered saline ( tbs ) 0.1% tween ( tbst ) for 1 h. after blocking , blots were incubated with monoclonal anti-3f4 antibody , diluted 1 : 5000 in 3% ( w / v ) milk in tbst for 1 h at room temperature , followed by three 15 min washes in tbst at room temperature . the reactions were followed by incubation with anti - mouse antibody peroxidase labeled ( pierce , rockford , il ) and developed by enhanced chemiluminescence . the atp and cu concentration - response curves were fitted to a sigmoid function using the graphpad prism software ( san diego , cal ) . the median effective ( ec50 ) or median inhibitory concentrations ( ic50 ) for atp or copper , respectively , were interpolated from these curves . each protocol was performed in separate oocytes coming from at least two separate batches of oocytes . mann - whitney nonparametric student 's t - test was used for statistical analysis . a p value < 0.05 was considered significant . to evaluate whether the expression of prp modulates the inhibition of the p2x4 receptor by cu , we first evaluated the expression of prp in oocytes co - injected with the cdna coding for the hamster prion protein ( prp-3f4 ) and the cdna coding for the rat p2x4 receptor . figure 1(a ) shows the detection by western blot of p2x4 receptor and prp-3f4 using an antibody that recognizes the 3f4 epitope . both proteins are strongly detected in an injected oocyte and not in the control noninjected oocyte . then we analyzed the distribution of prp in oocytes co - injected with the cdna coding for the rat p2x4 receptor and the cdna coding for prp - gfp . oocytes in which the expression of p2x4 receptor was verified electrophysiologically were analyzed in a confocal microscope to study the localization of prp - gfp . as observed in figure 1(b ) , prp - gfp is located on the surface of injected oocytes . then , we evaluated the atp concentration - response curves in oocytes expressing the p2x4 receptor and coexpressing the p2x4 receptor and prp-3f4 . the presence of prp-3f4 caused a slight , but not significant , reduction in the potency of atp , reflected as an increase in its ec50 from 11.2 1.1 m for p2x4 alone to 45.2 9.4 m for p2x4/prp-3f4 ( n = 4 , p = 0.0571 , figure 2 ) , this slight displacement of atp concentration - response curve in the presence of prp-3f4 could represent a minor regulation of prp-3f4 on p2x4 receptor activity . we assess the cu - induced inhibition of 10 m atp currents in oocytes expressing p2x4 receptors . the magnitude of the inhibition by 10 m cu , preapplied during 30 s , was 51.5 5.3% of the 10 m atp - evoked currents however , the 10 m cu - induced inhibition was reduced only to 71.9 5% of the 10 m atp - evoked currents in oocytes co - expressing p2x4 receptors and the prp-3f4 ( n = 12 , p < 0.05 compared to p2x4 alone , figures 3(a ) and 3(b ) ) , showing that prp-3f4 prevented the cu - induced inhibition of p2x4 receptors compared to the cu inhibition elicited in oocytes expressing only this receptor . furthermore , the presence of prp-3f4 in the oocytes caused a rightward displacement of the cu concentration - response curve obtained in oocytes expressing only p2x4 receptor , an ic50 of 11.5 1.9 m was obtained for p2x4 and 34.1 7.6 m for p2x4/prp-3f4 ( n = 57 , p < 0.01 , figure 3(c ) ) , confirming that prp-3f4 prevented the cu - induced inhibition not only at low micromolar concentrations of cu , but even at higher physiological concentrations of the metal . several functions have been attributed to prp , including immunoregulation , signal transduction , copper binding , neurite outgrowth , induction of apoptosis or prevention of apoptosis against apoptotic stimuli , and others . in addition , prp has been related to synapse formation and maintenance and synaptic transmission [ 9 , 10 , 42 ] , although the mechanisms by which it exerts its role is still unknown . one of the proposed targets for prp in synapse is to modulate cu homeostasis , based on a highly conserved cu - binding sequence located on its n - terminal domain , which includes four identical repeats of the peptide sequence pro - his - gly - gly - gly - trp - gly - gln [ 12 , 15 , 16 ] . it is known that prp binds cu with high affinity [ 1417 ] , and the octarepeat region of the human prp ( prp59 - 91 ) reduces cu(ii ) to cu(i ) in vitro , which depends on the tryptophan residues present in the octapeptide repeats [ 19 , 20 ] . cu modulates synaptic transmission at micromolar concentrations by a wide range of mechanisms , be one of the most relevanting modulations of neurotransmitter receptors within glutamatergic , gabaergic , and purinergic synapses , among others [ 43 , 44 ] . in a previous study , we demonstrated that cu at micromolar concentrations inhibits the atp - evoked currents of p2x4 receptors . here we show that the full - length prion protein - expressed in xenopus oocytes localizes in the cell surface and modulates the cu interaction with p2x4 receptor ; oocytes which coexpressed prp-3f4 and p2x4 receptors have a diminished cu - induced inhibition of the atp - evoked currents compared with oocytes which only expressed the p2x4 receptor . this reduced inhibition by cu was observed on cu concentration - response curves , where the ic50 of cu was significantly increased in the presence of prp-3f4 , indicating that prp-3f4 can exert its modulatory role even at high micromolar concentrations of cu , reached in the synaptic cleft after depolarization . these results , together with our previous findings showing that coapplication of cu with the n - terminal prp fragment ( prp59 - 91 ) prevents the inhibitory effect of copper on p2x4 receptors and even reverts the established cu - induced inhibition of the p2x4 receptors , strongly support the idea that prp could modulate synaptic copper and therefore affect the function of p2x4 receptors and synaptic transmission . in addition to the potential synaptic role of prp driven by its ability to bind cu , a known modulator of neuronal excitability [ 43 , 44 ] , there is increasing evidence of direct interaction between prp and neurotransmitter receptors . prp directly interacts with the nr2d subunit of the nmda receptor , inhibiting it and preventing nmda - induced excitoxicity in the hippocampus . on the other hand , prp also exerts a neuroprotective role against kainate - induced neurotoxicity in the hippocampus , probably by regulating differentially the expression of glur6 and glur7 kainate receptor subunits . moreover , prp can modulate the activity of serotoninergic receptors signaling pathways in 1c11 cells . we observed a slight , although not significant , reduction on atp affinity of p2x4 receptor in the presence of prp-3f4 , this might suggest an interference with atp binding or stabilization of closed states , although further experiments are required to evaluate this hypothesis . altogether , these studies and the presented here highlight the modulatory role of prp at synaptic transmission in cns , involving direct regulation of neurotransmitter receptors and/or their signaling cascade , or indirectly , by controlling the synaptic levels of cu . the understanding of the physiological function of prp on synaptic transmission may clarify the pathogenic processes underlying prion diseases . based on our results , it is possible to suggest that the resulting cognitive deterioration of prion diseases could involve a loss of the modulatory role of prp on brain function , as it is converted to the pathogenic isoform .

although the physiological function of the cellular prion protein ( prpc ) remains unknown , several evidences support the notion of its role in copper homeostasis . prpc binds cu2 + through a domain composed by four to five repeats of eight amino acids . previously , we have shown that the perfusion of this domain prevents and reverses the inhibition by cu2 + of the adenosine triphosphate ( atp)-evoked currents in the p2x4 receptor subtype , highlighting a modulatory role for prpc in synaptic transmission through regulation of cu2 + levels . here , we study the effect of full - length prpc in cu2 + inhibition of p2x4 receptor when both are coexpressed . prpc expression does not significantly change the atp concentration - response curve in oocytes expressing p2x4 receptors . however , the presence of prpc reduces the inhibition by cu2 + of the atp - elicited currents in these oocytes , confirming our previous observations with the cu2 + binding domain . thus , our observations suggest a role for prpc in modulating synaptic activity through binding of extracellular cu2 + .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

although , eus is already available in many countries , there is no official data regarding clinical practice in latin america ( la ) . the main objective of this study was to evaluate the current practice of eus in la and methods of existing training . other objectives were to obtain information about cost , fee and reimbursement in eus procedures . a web survey form containing four pages with 34 questions ( appendix ) was developed in three languages ( english , spanish and portuguese ) . questions 1 - 27 were obligatory to the completion of the questionnaire and were related to clinical practice and training . questions 28 - 34 were optional and related to costs , fees and reimbursement for eus . a message containing a link to the online questionnaire was sent directly via e - mail , in august 2012 , to 268 captulo latino americano de ultrasonido endoscpico ( cleus ) members organization , which represents physicians interested in eus in la ) . the message was also forwarded to other physicians who perform eus ( non - cleus members ) through e - mail by the cleus members who had received the link . the questionnaire was developed together with an it company ( trajettoria information technology ltda , so paulo , sp ) and was available through the site http://www.cleus-encuesta.com until january 2013 . to ensure confidentiality of the survey and the respondents , an account with login and electronic messages were sent twice a month , before 31 january 2013 requesting the participation of the members who had nt responded and those with incomplete questionnaires . the variables in some multiple choice questions were evaluated based on a score of frequency of responses , expressing a ranking of importance among the variables . the survey was sent to 268 cleus members and 13 new registrations were made , possibly , by referral of cleus members . of these 70 questionnaires , 57 ( 81% ) participants answered all mandatory questions . of the 57 endosonographers , 41 ( 72% ) also responded partially or all the optional questions related to cost , fees and reimbursement . among the la countries , latin american countries represented in the survey characteristics of respondents ( n = 70 ) respondents have an average of 6 years of independent practice in eus ( mode : 1 year , median : 3.5 years ) . regarding the place of practice , 37 ( 53% ) respondents are employees of private hospitals . a total of 22 endosonographers performed 100 or fewer procedures in their entire career , while 17 performed between 1001 and 5000 exams . the median number of procedures performed in 2011 was : 100 upper eus , 20 lower eus , 30 upper fine - needle aspirations ( fna ) and 0 lower fna ( tabs . current practice in eus in latin american median of eus procedures performed in entire career the indications for anatomical segments in order of frequency are : pancreatic - biliary - ampulary , gastroduodenal , esophageal , anorectal and mediastinal . the most common indications for pancreatic - biliary - ampulary segment are evaluation of solid and cystic tumors of the pancreas ( tab . score of indications for eus ( n = 67 ) the most frequent complication related to echoendoscopic procedure is bleeding which needed treatment or hospitalization ( 26 occurrences from 63 respondents ) . when asked about sedation , nearly 82% of respondents use propofol in most or all procedures . regarding the type of equipment , the linear echoendoscope is the most used , followed by electronic radial echoendoscope . other probes ( for example , rigid rectal probe ) are also used less frequently . 7 and 8 shows the combination of different endoscopes , needles and different brands available on the market . equipment used by latin american endosonographers score of preferred needles ( % ) a total of 88% of participants check the result of anatomopathology . the related average number of positive punctures to solid lesions is 80% ( n = 54 , average = 79.61 , = 18.53 ) and to cystic lesions is 70% ( n = 54 , average = 70.56 , = 23.89 ) . about 48% of respondents have more than 6 months of dedicated hands - on eus training . almost 90% of respondents consider that formal training in eus is needed to acquire competence . training methods used to learn eus ( n = 70 ) the minimum average training should be at least 6 months for 72.6% of respondents ( tab . 10 ) . most of the endosonographers consider that the minimum number of supervised procedures should be greater than 50 pancreatic - biliary - ampulary , 20 anorectal , 20 fna and nine therapeutic procedures ( tab . opinion of latin america endosonographers about training numbers of eus performed during training versus opinion on number of eus necessary for training the questions relating to reimbursement by health maintenance organization show that 13 of 28 respondents did not know how much was reimbursed in diagnostic procedures and 13 of 25 respondents did not know about fna procedures . reimbursement by the government institution is unknown among 18 of 26 respondents for diagnostic procedures and 18 of 25 for procedures with fna . the average costs for eus procedures in private practice ranges from $ 200 to $ 4000 among the respondents ( n = 37 ) . the costs with the needle ranges from $ 190 to $ 1200 ( n = 39 respondents , average = $ 534.77 dollars , = 275.21 ) . doctors fee also varied considerably , ranging from $ 170 to $ 1500 ( n = 35 respondents ) . respondents have an average of 6 years of independent practice in eus ( mode : 1 year , median : 3.5 years ) . regarding the place of practice , 37 ( 53% ) respondents are employees of private hospitals . a total of 22 endosonographers performed 100 or fewer procedures in their entire career , while 17 performed between 1001 and 5000 exams . the median number of procedures performed in 2011 was : 100 upper eus , 20 lower eus , 30 upper fine - needle aspirations ( fna ) and 0 lower fna ( tabs . current practice in eus in latin american median of eus procedures performed in entire career the indications for anatomical segments in order of frequency are : pancreatic - biliary - ampulary , gastroduodenal , esophageal , anorectal and mediastinal . the most common indications for pancreatic - biliary - ampulary segment are evaluation of solid and cystic tumors of the pancreas ( tab score of indications for eus ( n = 67 ) the most frequent complication related to echoendoscopic procedure is bleeding which needed treatment or hospitalization ( 26 occurrences from 63 respondents ) . when asked about sedation , nearly 82% of respondents use propofol in most or all procedures . other probes ( for example , rigid rectal probe ) are also used less frequently . 7 and 8 shows the combination of different endoscopes , needles and different brands available on the market . equipment used by latin american endosonographers score of preferred needles ( % ) a total of 88% of participants check the result of anatomopathology . the related average number of positive punctures to solid lesions is 80% ( n = 54 , average = 79.61 , = 18.53 ) and to cystic lesions is 70% ( n = 54 , average = 70.56 , = 23.89 ) . about 48% of respondents have more than 6 months of dedicated hands - on eus training . almost 90% of respondents consider that formal training in eus is needed to acquire competence . training methods used to learn eus ( n = 70 ) the minimum average training should be at least 6 months for 72.6% of respondents ( tab . most of the endosonographers consider that the minimum number of supervised procedures should be greater than 50 pancreatic - biliary - ampulary , 20 anorectal , 20 fna and nine therapeutic procedures ( tab . opinion of latin america endosonographers about training numbers of eus performed during training versus opinion on number of eus necessary for training the questions relating to reimbursement by health maintenance organization show that 13 of 28 respondents did not know how much was reimbursed in diagnostic procedures and 13 of 25 respondents did not know about fna procedures . reimbursement by the government institution is unknown among 18 of 26 respondents for diagnostic procedures and 18 of 25 for procedures with fna . the average costs for eus procedures in private practice ranges from $ 200 to $ 4000 among the respondents ( n = 37 ) . the costs with the needle ranges from $ 190 to $ 1200 ( n = 39 respondents , average = $ 534.77 dollars , = 275.21 ) . doctors fee also varied considerably , ranging from $ 170 to $ 1500 ( n = 35 respondents ) . respondents have an average of 6 years of independent practice in eus ( mode : 1 year , median : 3.5 years ) . regarding the place of practice , 37 ( 53% ) respondents are employees of private hospitals . a total of 22 endosonographers performed 100 or fewer procedures in their entire career , while 17 performed between 1001 and 5000 exams . the median number of procedures performed in 2011 was : 100 upper eus , 20 lower eus , 30 upper fine - needle aspirations ( fna ) and 0 lower fna ( tabs . current practice in eus in latin american median of eus procedures performed in entire career the indications for anatomical segments in order of frequency are : pancreatic - biliary - ampulary , gastroduodenal , esophageal , anorectal and mediastinal . the most common indications for pancreatic - biliary - ampulary segment are evaluation of solid and cystic tumors of the pancreas ( tab score of indications for eus ( n = 67 ) the most frequent complication related to echoendoscopic procedure is bleeding which needed treatment or hospitalization ( 26 occurrences from 63 respondents ) . when asked about sedation , nearly 82% of respondents use propofol in most or all procedures . other probes ( for example , rigid rectal probe ) are also used less frequently . 7 and 8 shows the combination of different endoscopes , needles and different brands available on the market . equipment used by latin american endosonographers score of preferred needles ( % ) a total of 88% of participants check the result of anatomopathology . the related average number of positive punctures to solid lesions is 80% ( n = 54 , average = 79.61 , = 18.53 ) and to cystic lesions is 70% ( n = 54 , average = 70.56 , = 23.89 ) . about 48% of respondents have more than 6 months of dedicated hands - on eus training . almost 90% of respondents consider that formal training in eus is needed to acquire competence . training methods used to learn eus ( n = 70 ) the minimum average training should be at least 6 months for 72.6% of respondents ( tab . most of the endosonographers consider that the minimum number of supervised procedures should be greater than 50 pancreatic - biliary - ampulary , 20 anorectal , 20 fna and nine therapeutic procedures ( tab . opinion of latin america endosonographers about training numbers of eus performed during training versus opinion on number of eus necessary for training the questions relating to reimbursement by health maintenance organization show that 13 of 28 respondents did not know how much was reimbursed in diagnostic procedures and 13 of 25 respondents did not know about fna procedures . reimbursement by the government institution is unknown among 18 of 26 respondents for diagnostic procedures and 18 of 25 for procedures with fna . the average costs for eus procedures in private practice ranges from $ 200 to $ 4000 among the respondents ( n = 37 ) . the costs with the needle ranges from $ 190 to $ 1200 ( n = 39 respondents , average = $ 534.77 dollars , = 275.21 ) . doctors fee also varied considerably , ranging from $ 170 to $ 1500 ( n = 35 respondents ) . this is the first survey to assess eus practice in la with participation of 17 different countries and one latin territory . furthermore , it is the first survey that jointly assesses issues relating to practice , training , costs and reimbursement . furthermore , it is a new method among cleus members , using electronic mail to enable a large number of respondents in different countries . other north american studies also used electronic mail as a method to reach a larger number of respondents.1234 although the initial number of electronic mails was considerable and the reason why only 25% of participants responded this research can possibly be explained by the fact that not all participants of cleus perform eus and many of them are surgeons and gastroenterologists interested in eus . the largest number of brazilians endosonographers can be possibly explained because it is the most populous country and the human development index is relatively better than many la neighbors.567 according to the annual report of the united nations , brazil ( 85 ) is behind four countries in south america , chile ( 40 ) , argentina ( 45 ) , uruguay ( 51 ) and peru ( 77 ) , ahead of ecuador ( 89 ) and colombia ( 91 ) . in 1999 , in the united states , the median age was 39 years , 57% were in academic practice and 84% performed endoscopic retrograde cholangiopancreatography ( ercp).8 in another international study comparing the practice of international and united states respondents , the mean age of participants was 40.5 years and 89.5% were men . the majority ( 63.4% ) were in some type of academic practice.2 in an asian study conducted in 2006 , the respondents were mostly young ( median age 40 years ) , male ( 97% ) , practicing in public hospitals ( 50.7%).9 in this survey , endosonographers tend to be male , young , interventional endoscopists ( perform ercp ) and in most cases were affiliated to a private institution . when compared with other studies , there is a correlation as regards endosonographers being young and mostly perform ercp . in 2004 , an international survey proposes to determine the practice patterns of international and united states endosonographers participating in a biennial international eus symposium . this study showed that in the united states , endosonographers are likely interventional gastroenterologists who also perform therapeutic ercp and are more likely to perform eus - guided interventional procedures . international endosonographers were less likely to perform ercp and other interventional eus procedures.2 in this study , it was not possible to perform this comparison between different countries . in the 1999 united states survey , although the median total number of procedures ever performed was 200 , 41% of respondents performed half or more of their total eus procedures during the year prior to the survey.8 in the 2004 international survey , approximately 90% of international as well as the united states endosonographers had been performing eus for more than 1 year and more than a third had been performing eus for at least 5 years.2 in the 2006 asian survey , the respondents had median experience of 5 years in eus practices and performed a median of 500 procedures in their career.9 in this survey , most endosonographers have been performing eus for at least 1 year . the vast majority of procedures are diagnostic upper eus compared to eus / fna and lower eus . lower eus was performed much less frequently than upper eus , probably about the least frequent indications for the procedure and/or rectal and anal sphincter evaluation by radiologists using magnetic resonance . this is consistent with research conducted in 1999;8 however , a 2006 study assessed the level of knowledge of gastroenterologists american society of gastroenterology ( asge ) members about the indications of eus in four segments : esophagus , gastroduodenum , hepatopancreatobiliary and colorectum . a research showed that gastroenterologists who perform eus have greater knowledge of indications of eus . however , the levels of knowledge of colorectal applications of eus are the poorest among the four studied organ systems . this refers to the fact that educational initiatives should focus on applications of eus in this category.4 regarding indications for upper eus , pancreatobiliary segment was among the most studied and the indications in this segment are the study of cystic and solid lesions of the pancreas . in another study,8 esophagogastric and pancreatico - biliary were the most common , but there is no detail about the lesions studied in each segment . in this study , linear echoendoscope was the most used , but when compared with radial echoendoscope ( electronic and mechanic ) , the difference is not significant . most participants also perform ercp . in 2004 , das et al.2 compared north american endosonographers with other international endosonographers and showed that north americans are more likely to use linear echoendoscope and perform ercp more frequently . this possibly explained why north american endosonographers were the most of participants also perform ercps were propense to perform eus interventional procedures are more likely to use liready likely to perform eus - fna and other interventional procedures . in this study , most endosonographers perform ercp and use the linear echoendoscope , but it is not possible to conclude that there is a propensity for eua - fna and other interventional procedures . perhaps , this reflects the fact that the indication for pancreatic segment is the most common and most studies in eus - fna performed in the pancreatic masses setting have been conducted using 22-g needles.10 in this study , the complication most often reported in eus is bleeding ; followed by infection and perforation . in the literature , the incidence of bleeding reported in large prospective series range between 0% and 0.5%.10 in relation to learning methods , the majority of respondents had a formal training of 6 months or more in eus after graduating in fellowship programs in gastroenterology or gastrointestinal endoscopy . this can be a reflection that new strategies are being put in place and newly trained endosonographers have a well - established training program than older endosonographers who did their training mainly in france , usa , japan and germany . in la , few training centers came into being in recent years , for instance , centro franco - brasileiro de ecoendoscopia in brazil and clinica alemana in chile . about 24% of endosonographers also learned eus observing other more experienced physicians . this may be related to the fact that even younger endosonographers spend a period during their training programs in other centers outside la . even in europe , the combination of two methods of learning eus is practice ; consisting of dedicated fellowship program and informal training ( short repeated exposures to hands - on experiences).10 in this study , 44% of endosonographers train others in eus . this number does not differ much from what was seen in the study published in 1999 with the united states endosonographers , where 40% trained other doctors . nearly 90% of participants agree that formal training is necessary to acquire competence , 80% think that training strategies must depend upon local endoscopy societies and 73% of respondents consider a time period longer than 6 months to acquire competence . in addition , during the training program , a minimum number of procedures for each anatomical segments , fna and therapeutic procedure are indicated by the respondents . thus , as ercp , learning in eus is considered technically more demanding and there is a variation in individual learning curve that should be evaluated by criteria goals . currently , there is no consensus on the number of procedures required to acquire competence . the asge guidelines published in 2006 states the minimum number of procedures : 75 cases of esophagus , stomach and rectum tumors ; 40 cases of submucosal abnormalities ; 75 pancreatobilliary cases ; 25 eus - fna ( non - pancreatic ) and 25 eus - fna ( pancreatic ) . the competence recommended generally in all aspects of eus would be a minimum of 150 supervised cases , of which , 75 should be pancreatobilliary and 50 eus - fna . trainees may start performing eus - fna after 50 procedures or more.1112 a study in the asia - pacific region also considered that there should be a median number of 100 supervised procedures with a minimum of 6 months training . most respondents ( 90% ) also believe that formal internship is necessary to acquire competence.9 as a result , new training strategies become imperative and each country should implement more appropriate training orientations to ensure quality in training and clinical practice of eus in la . insufficient statistical data did not allow us to reach a conclusion regarding costs , fees and reimbursement . this is because , 58 of the participants answered the questions related to these topics , about half of the respondents had no knowledge as regards refund of eus procedures and there are different payment systems in different countries in la . the questionnaires were sent to all cleus members and there was an increase in the sample through the e - mails sent to non - members . therefore , there are limitations in the methodology of this research , as we do not know accurately the number of doctors who perform eus in la and it is unlikely that all endosonographers have responded this survey . furthermore , it is likely that some respondents did not participate in the survey because they do not perform a large number of procedures . even sending reminders over the months in which the research was online , some doctors may not have received the questionnaire due to the limitations of the tool used for dissemination ( incorrect addresses , the presence of anti - spam , among others ) . this study provides an overview on the status of eus in la and from our standpoint , the greatest contribution of this study is the perception of the need to standardize eus training strategies in la .

objective : endoscopic ultrasound ( eus ) has become an important imaging modality for the diagnosis , staging and treatment of gastrointestinal disorders . however , no official data exists regarding clinical eus practice in latin america ( la ) . this study assessed current eus practice and training.patients and methods : a direct mail survey questionnaire was sent to 268 captulo latino americano de ultrasonido endoscpico members between august 2012 and january 2013 . the questionnaire was sent out in english , spanish and portuguese languages and was available through the following site : http://www.cleus-encuesta.com . responses were requested only from physicians who perform eus.results:a total of 70 la physicians answered the questionnaire until january 2013 . most of the participants were under 42 years of age ( 53% ) and 80% were men . most participants ( 45.7% ) perform eus in brazil , 53% work in a private hospital . the majority ( 70% ) also perform endoscopic retrograde cholangiopancreatography . a total 42% had performed eus for 2 years or less and 22.7% for 11 years or more . only 10% performed more than 5000 eus . the most common indication was an evaluation of pancreatic - biliary - ampullary lesions . regarding training , 48.6% had more than 6 months of dedicated hands - on eus and 37% think that at least 6 months of formal training is necessary to acquire competence . furthermore , 64% think that more than 50 procedures for pancreatic - biliary lesions are necessary.conclusion:this survey provides insight into the status of eus in la . eus is performed mostly by young endoscopists in la . diagnostic upper eus is the most common eus procedure . most endosonographers believe that formal training is necessary to acquire competence .

INTRODUCTION PATIENTS AND METHODS RESULTS None EUS practice EUS training Cost, fees and reimbursement in EUS DISCUSSION CONCLUSION

arterial revascularization coronary artery surgery has been the cornerstone of treatment of coronary artery disease since the introduction of aortocoronary bypass as a routine clinical procedure by favaloro in cleveland in 1968 . in 1986 loop and colleagues documented the superiority of the internal mammary artery graft for 10-year survival and other cardiac events . they had compared 2306 patients who received an internal mammary artery graft to the anterior descending coronary artery alone or combined with one or more saphenous vein grafts , with 3625 patients who had only saphenous vein grafts . they found that patients who had only vein grafts had a 1.61 times greater risk of death over a 10-year period , as compared with those who received an internal mammary artery graft . other disadvantages for the isolated vein grafting were an increased risk of late myocardial infarction ( 1.41 times ) , risk of hospitalisation ( 1.25 times ) , risk of cardiac reoperation ( 2.0 times ) and risk of late cardiac events ( 1.27 times ) . this technique is nowadays a routine in modern coronary artery bypass grafting . in 1999 lytle , again from the cleveland clinic , published a retrospective , non - randomized study with a mean follow - up interval of 10 postoperative years including patients who received either single ( 8123 patients ) or bilateral internal thoracic artery ( ita ) grafts ( 2001 patients ) with or without additional vein grafts . death , reoperation and percutaneous transluminal coronary angioplasty were more frequent in patients undergoing single rather than bilateral ita grafting . the differences were greatest in regard to reoperation ( decrease of risk of reoperation by 12 years at least 8.3% ) ( figure 1 ) . cabg = coronary artery bypass , bita = bilateral internal thoracic artery ; sita = single internal thoracic artery . although this finding sent a clear message throughout the world of coronary artery surgeons , this technique has yet not found predominant use . coronary artery surgery - syntax study today , coronary artery bypass surgery is challenged by the success story of modern interventional cardiology . the discussion of which patient goes to what treatment modality has been clarified by the recent syntax study . the syntax study compares outcomes of coronary artery bypass grafting with percutaneous coronary intervention in patients with triple vessel and/or left main disease . complexity of coronary artery disease was quantified by the syntax score , which combines the anatomic characteristics of each significant lesion . outcome was defined by major adverse cerebrovascular and cardiac events and its consequences over a period that is now over 4 years ( table 1 ) . the surgical advantages were relevant in terms of repeat revascularisation , but also underlined a significant surgical benefit concerning myocardial infarction and survival rates . in patients associated with greater complexity of coronary pathology , the syntax study also recommended that incomplete revascularisation is associated with adverse events during follow - up after percutaneous coronary intervention but not following coronary artery bypass grafting . another message of the syntax study is the recommendation of a heart team in which the interventional cardiology and the surgeon work closely together to provide adequate therapy for coronary artery patients . the syntax study should have a substantial impact on the treatment of coronary artery disease . its consequences are already found in the new european society for cardiology / european association for cardiothoracic surgery guidelines for myocardial revascularization . another point of ongoing discussion is whether on - pump or off - pump coronary artery revascularization is superior for the coronary artery disease patient . a recent study that analyzed 4752 patients from 79 centers in 19 countries randomly assigned patients in whom coronary artery bypass ( cabg ) was planned , to undergo off - pump or on - pump cabg . the first co - primary outcome was a composite of death , non - fatal stroke and non - fatal myocardial infarction . the results demonstrated that there was no significant difference between the two procedures with respect to the 30-day rate of death , myocardial infarction , stroke or renal failure requiring dialysis . the use of off - pump cabg , however , led to reduced rates of transfusion , reoperation for perioperative bleeding , respiratory complications and acute kidney injury , but also revealed an increased risk of early revascularization . others reported that the quality of the off - pump surgery , including the combination of aortic no - touch and total arterial revascularization with complete revascularization , leads to the fact that off - pump coronary artery bypass ( opcab ) patients benefit from significantly decreased rates of mortality , stroke , major adverse cardiac and cerebral vascular events ( macce ) . in particular , the no - touch technique leads to a significantly lower rate of stroke and should therefore be the procedure of choice in patients with atherosclerotic ascending aortic disease . these findings were underlined by a recent multicenter , randomized , parallel trial which had enrolled patients for elective or urgent isolated coronary artery bypass grafting with an additive european system for cardiac operative risk evaluation of 6 or more . the composite primary end - point included operative mortality , myocardial infarction , stroke , renal failure , reoperation for bleeding and adult respiratory distress syndrome within 30 days after surgery . a total of 195 patients could be treated on - pump and 216 off - pump . according to the intention to treat analysis , the rate of the composite primary end - point was significantly lower ( unadjusted p=.009 , adjusted p=.010 ) in the off - pump group ( 5.8% vs 13.3 % ) . the risk of experiencing the primary end - point was significantly greater for the on - pump group . the authors concluded that off - pump coronary artery bypass grafting reduces early mortality and morbidity in high - risk patients . neurological complications one of the most devastating complications of coronary artery surgery is definitely a postoperative adverse neurological outcome , as stroke or cognitive decline . recent large , prospective , randomized studies analyzing the rate of negative neurologic outcome after conventional on - pump surgery and after off - pump surgery were not able to show a significant risk reduction following off - pump surgery , as it had been presumed . as a consequence , investigations aiming to reduce the incidence of adverse neurological outcome following bypass surgery have shed light on the role of patient - related factors , such as the degree of atherosclerosis of the aorta or pre - existing cerebrovascular and systemic vascular disease and adequate preoperative screening and preparation , instead of focusing on the impact of surgery - related factors . in a paper addressing the cognitive and neurological outcome after coronary artery bypass surgery the authors concluded that the risk for both points should not be influencing the choice of surgical therapy for coronary artery bypass grafting . rather , strategies should focus on the preoperative assessment of specific risk factors and on an individualized surgical approach , especially in high - risk patients . undiagnosed cognitive impairment is not rare in coronary artery disease patients and is evaluated as a surrogate marker for underlying cerebrovascular disease . its long time effect should be addressed predominantly by reducing modifiable risk factors for cerebrovascular disease , since it is well known that late cognitive decline is more related to the progression of systemic vascular disease rather than being a late consequence of extracorporeal circulation . in experienced groups with over 95% off - pump procedures a mortality rate below 1% in elective patients can be achieved . current decision making in our institution in coronary artery surgery . by strictly adhering to the principle of the aortic no - touch technique , we were able to eliminate neurological deficits due to embolism from the aorta directly related to the surgical procedure and could document a 30 day mortality for our group of 0.6% in 2011 . some surgeons at our institution could reach , or are already close to , zero mortality . we also employed successfully the principle of opcab in reoperative coronary artery surgery , which could be used in the majority of our redo patients , excluding those who had strong adhesions from prior pericarditis . hybrid coronary revascularization is combining minimally invasive coronary artery surgery and percutaneous coronary intervention , thus allowing sternal preservation for the treatment of patients with multi - vessel coronary artery disease . revascularization of the left anterior descending coronary artery can be achieved by a robotically assisted endoscopic approach or conventional minimally invasive direct coronary artery bypass ( midcab ) surgery . early experience demonstrates the safety of the procedure , with perioperative clinical results comparable to those of conventional coronary artery revascularization . bonatti demonstrated the feasibility of a quadruple coronary artery bypass using a totally endoscopic technique . female gender is still a risk factor for early mortality following coronary artery surgery . a recent study by lehmkuhl analyzed 1559 consecutive patients treated between 2005 and 2008 . as a result , self - assessed physical functioning should be more seriously considered in preoperative risk assessment , particularly in women . key mediators of the overmortality of women after cabg were age , physical function and postoperative complications . to characterize trends in patients characteristics and outcomes after cabg over the past decade elbardissi et al . they concluded that from 2000 to 2009 the risk profile of patients undergoing cabg had changed , with fewer smokers , more patients with diabetes and better medical therapy characterizing patients referred for surgical coronary revascularization . the left internal artery had been nearly universally used and outcomes had improved substantially , combined with a significant decline in postoperative mortality and morbidity . surgical perspective coronary artery surgery in the next decade will be influenced by the further progression of minimally invasive surgical principles . , the advantage of closed chest revascularization has to be weighed against the risk of repeat revascularizations due to percutaneous coronary intervention in the right and circumflex artery . one of the challenges of the future will be to bring this progress in surgical technology to broad - scale application at a time when third world countries are lacking coronary artery surgery altogether or to a large degree . new treatment modalities for coronary artery disease will affect the incidence of surgical procedures as well as the decreased incidence of reoperations in patients in whom modern surgical principles , as complete arterial revascularization , have been used . possible influence of drug therapy in this regard it remains to be seen what the consequences of modern drug therapy concerning coronary artery surgery will be : so far it is of relevance to know that , for example , statins clearly improve the outcomes of cabg patients . all patients undergoing cabg are candidates for life - long statin therapy and its initiation is recommended as soon as coronary disease is documented ( in the absence of contraindications ) . however , the optimal postoperative lipid - lowering regimen remains unknown and is still the subject of upcoming trials . therefore , statin prescription rates and patient adherence are examples of priorities for future research . in addition to these , coronary artery surgery will be influenced substantially by a variety of factors . drivers of change will be : the industry , the patient , the health service , the health service purchaser , the craft of coronary surgery itself , the resident , the surgeon , the media and the cardiologist , as pointed out by sergeant in 2004 . christensen and raynor underlined that we have to keep in mind that disruptive strategies create a 37% chance of survival versus only 6% for incremental strategies . so alternatives within surgery will not only need to move to a disruptive strategy ( e.g. from on - pump to off - pump bypass ) but also have to secure sustained innovation , since we can be sure that the current cabg activity will change substantially in the coming years . new strategies , numbers , facts and figures are undoubtedly important but what matters most , not only in coronary artery surgery in the next decade , will be the basic existence of so - called soft factors as morality , intelligence , excellence , integrity , compassion and surgical judgment . definitely , coronary artery surgery will have its own role during the next decade and further into the future .

in coronary artery surgery the superiority of the internal mammary artery graft in 10-year survival was documented in 1986 . in 1999 it was demonstrated that death , reoperation and percutaneous transluminary coronary angioplasty were more frequent in patients undergoing single rather than bilateral internal mammary artery grafting . today coronary artery bypass grafting surgery is challenged by the success story of modern interventional cardiology . the syntax study , however , clearly underlined the better outcome for patients with triple - vessel and/or left main disease undergoing coronary artery bypass grafting in terms of repeat revascularization . another point of ongoing discussion is the comparison between on - pump and off - pump coronary artery revascularization techniques . even if mixed results exists in the literature , in experienced hands the combination of aortic no - touch and total arterial revascularization , probably leads to the superiority in off pump coronary artery bypass grafting in terms of significantly decreased rates of mortality , stroke , major adverse cardiac and cerebral vascular events . coronary artery surgery in the next decade will be influenced by the further progression of minimally invasive surgical principles and by a variety of other factors . the role of robotics and hybrid surgery has yet to be defined . alternatives within surgery will not only need to move to a less disruptive strategy ( e.g. from on - pump to off - pump bypass ) but also have to secure sustained innovation , as we can be sure that the current coronary artery bypass grafting activity will change substantially .

since being introduced in 2007 , laparoendoscopic single - site surgery ( less ) has rapidly gained popularity with surgeons as well as within the medical instrument manufacturing industry . almost all traditional laparoscopic surgeries can be performed using the less approach , including surgeries for morbid obesity and liver , spleen , and gastrointestinal diseases . however , the procedure is more difficult than traditional laparoscopic surgeries because of associated technical challenges including the crowding of the laparoscope and instruments around the umbilicus , the loss of triangulation between the 2 instruments in the operative field , and the required ambidexterity of the surgeons to adopt relatively difficult maneuvers . to overcome these problems in less , although these improvements may seem beneficial , one important question remains : do these improvements really benefit less ? digital image correlation ( dic ) is a relatively new strain measurement technique that uses a digital camera for continuous capturing of the surface of the samples during mechanical testing . a computer program compares the location of the ink dots in the speckle pattern that are captured in consecutive time points and calculates the displacement and strain fields all over the surface . accuracies of up to 0.01 pixel are reported for dic deformation measurement . except for a few studies , dic has not been widely used for full - field deformation measurement in the testing of soft tissues such as the sils port . the surface deformations that can be measured of the sils port are important for understanding its mechanism with different instruments and manipulations . the aim of the current study was to evaluate the repeatability and reliability of the dic measurement system by comparing surface deformations recorded using this proposed system with objective criteria loads applied and recorded by the universal material testing machine simultaneously . the results of the deformations measurement are used to further evaluate instruments and manipulations that have been developed for less and to find a better improvement that can promote the development of less . a straight forceps ( yida medical device co. ltd , hangzhou , zhejiang province , china ) and a universal testing machine ( bz2.5/tsis , zwick gmbh , ulm , germany ) were included in this study . the measurement system based on dic was composed of a box trainer ( model 200 , ruihong laboratory equipment co ltd , shanghai , china ) , a sils port ( covidien , mansfield , massachusetts ) , and a charge - coupled device camera type cv - a1 ( jai , copenhagen , denmark ) ( figure 1 ) . a , universal material testing machine ; b , forcep ; c , box trainer ; d , fishing wire ; e , sils port ; f , fiberoptic lights ; g , camera . the universal testing machine was connected to the handle joint of the forceps by a fishing wire and was pulled 50 mm at a constant rate of 0.33 mm / s . once the machine was started , it began to apply loads on the forceps , which physically disabled the surfaces of the sils port . throughout the tests , the universal testing machine and its associated software recorded the load - time curves . the anterior surfaces of the sils port were tagged with spray paint for the dic with a white background color and a red random speckle pattern ( figure 2 ) . when the universal material testing machine is pulling the forceps , the load applied on the sils port will deform the port surface . the deformations were recorded by a charge - coupled device camera with a frame rate of 1 hz . the camera created a stereo view of the surface from which the displacements and surface strains were calculated during the dic program ( matfolt co , ltd , shanghai , china ) ( figure 1 ) . a pearson correlation analysis was conducted to investigate the relationship between deformation measurements calculated by dic and objective criteria loads applied and recorded by the universal material testing machine . all statistical analyses were conducted by using spss statistical software ( version 15.0 ; spss , inc . , armonk , new york ) . statistical significance was set at p < .05 . a straight forceps ( yida medical device co. ltd , hangzhou , zhejiang province , china ) and a universal testing machine ( bz2.5/tsis , zwick gmbh , ulm , germany ) were included in this study . the measurement system based on dic was composed of a box trainer ( model 200 , ruihong laboratory equipment co ltd , shanghai , china ) , a sils port ( covidien , mansfield , massachusetts ) , and a charge - coupled device camera type cv - a1 ( jai , copenhagen , denmark ) ( figure 1 ) . a , universal material testing machine ; b , forcep ; c , box trainer ; d , fishing wire ; e , sils port ; f , fiberoptic lights ; g , camera . the universal testing machine was connected to the handle joint of the forceps by a fishing wire and was pulled 50 mm at a constant rate of 0.33 mm / s . once the machine was started , it began to apply loads on the forceps , which physically disabled the surfaces of the sils port . throughout the tests , the universal testing machine and the anterior surfaces of the sils port were tagged with spray paint for the dic with a white background color and a red random speckle pattern ( figure 2 ) . when the universal material testing machine is pulling the forceps , the load applied on the sils port will deform the port surface . the deformations were recorded by a charge - coupled device camera with a frame rate of 1 hz . the camera created a stereo view of the surface from which the displacements and surface strains were calculated during the dic program ( matfolt co , ltd , shanghai , china ) ( figure 1 ) . a pearson correlation analysis was conducted to investigate the relationship between deformation measurements calculated by dic and objective criteria loads applied and recorded by the universal material testing machine . all statistical analyses were conducted by using spss statistical software ( version 15.0 ; spss , inc . , armonk , new york ) . statistical significance was set at p < .05 . the pearson correlation coefficients between deformation measurements ( displacements and strains ) and loads were very high ( r > 0.98 , p < .001 ) . extremely similar repeatability results appeared in all repetitions of the procedure , as shown in table 1 . because of the high similarity of the results , we chose one of the repetitions to visualize it in scatter diagrams ( figures 3 to 5 ) . the pearson correlation analysis between deformation measurements and loads in all repetitions of the experiment r , correlation coefficient . as with most new surgical techniques , the early development of less was fraught with problems : a loss of triangulation , clashing of instruments and the instruments with the telescope and camera head , and a lack of maneuverability . new instruments and manipulations were developed by the pioneers to enable surgeons to overcome these difficulties . however , whether these improvements benefit less lacked an objective evaluation . there have been several studies that attempted to assess the benefit , because the measurements were subjective indexes including the operation success rates , errors , etc , and they lacked definite and objective assessment criteria . we set up a contacting mechanical system to compare the articulating instruments and the cross - handed manipulation with conventional instruments . the study indicated that more force and time were needed by using cross - handed manipulation in less . however , contacting mechanical components , such as the sensor or gauge used in the aforementioned studies , were vulnerable to external environmental interference during measurement . dic , an advanced noncontacting measurement system , has seen explosive growth in the past 2 decades . in recent years , the method has been modified and extended to encompass a large number of novel measurement systems . the term digital image correlation refers to the class of noncontacting methods that acquire images of an object , store images in digital form , and perform image analysis to extract full - field shape and deformation measurements . within the broad field of image analysis , dic the technique can be used to measure and observe the local mechanical behavior in natural and seminatural textures of different material such as metals , ceramics , and polymers . in this study , based on the dic , we aimed to develop a reliable noncontacting mechanical measurement system to evaluate instruments and manipulations in less using the sils port . according to the repeated experimental results of our study first , the noncontacting mechanical measurement system based on dic is proven to be reliable , because the measurement results show almost a perfect linear correlation with the objective criteria loads . second , an extreme similarity of the results appeared in all repetitions of the experiment , demonstrating the high repeatability of the measurement system . it is suitable for use in experimental and clinical practice because all its components are movable and isolated from the patient . no training or handling adjustments are required because all deformations are captured and analyzed by the camera and its attached software . because of the system 's high reliability and repeatability , there are several applications for the newly developed noncontacting mechanical measurement system . the objective and comprehensive measurements will provide a good feedback tool for evaluation of new instruments and manipulations in less . in addition , the system 's use in experimental and clinic practice would help to refine movement and tissue handling in the teaching and training of less . moreover , it can also be used to define force patterns incurred during certain surgical postures and the effect of muscle fatigue . a limitation of the current study is that only the sils port from covidien was tested even though a wide variety of assessment devices for less have being produced by several companies . however , because the dic measuring system reflected the deformations of the assessment devices no matter which assessment device was used , the results should be similar to the present study . it is another limitation that we did not study whether these findings were transferable to performance on human tissue . clinical validation studies will be pursued to determine the system 's discriminatory ability as a diagnostic tool in clinical practice . with the reliable and repeatable dic mechanical measurement system , less will become more common because of the rapid advances in technology and the use of better instruments .

objective : analysis of mechanical measurements in laparoendoscopic single - site surgery ( less ) is important for instrument design and surgical simulators . the aim of this study was to develop a measuring system for different instruments and manipulations in less using a single - incision laparoscopic surgery ( sils ) port.methods:the loads on the sils port were applied and recorded by the universal material testing machine by the following method . the handle of the forceps inserted in the sils port was connected with the machine by a fishing wire and pulled at a constant rate . the surface deformations ( displacements and strains ) of the sils port were recorded with digital image correlation ( dic ) simultaneously . the correlation between deformation measurements and loads were analyzed . this experiment was repeated 8 times.results:strong correlations existed between deformation measurements calculated by dic and objective criteria loads applied and recorded by the universal material testing machine ( r > 0.98 ) . the correlation coefficients were statistically significant ( p < .001 ) . a high repeatability of the results appeared in all repetitions of the experiment.conclusions:a dic measurement system has been developed for less , and comprehensive mechanical parameters of a sils port can be obtained precisely by using this system . it is reliable and repeatable for evaluation of instruments and manipulations in less .

INTRODUCTION MATERIALS AND METHODS Components of the Experiment Objective Criteria Loads Applied and Recorded by the Universal Material Testing Machine Deformations Measurement Recorded with DIC Statistical Analysis RESULTS DISCUSSION CONCLUSION

obesity is rising to pandemic proportions and is an important risk factor for cardiometabolic diseases , including diabetes , hypertension , dyslipidemia , and coronary heart disease ( chd ) [ 24 ] . neck circumference may likely be a very convenient and valid alternative measure of obesity and may even be a better marker of metabolic risk compared to standard measures such as body mass index ( bmi ) and waist circumference ( wc ) . overweight and obesity are defined by bmi , depicting weight higher than what is generally considered healthy for a given height , although the location of fat may modify the health implications of bmi , and central obesity is generally considered to be a stronger risk factor for cardiometabolic risk than overall obesity . an upper body distribution of fat , especially with increased visceral adipose tissue , is considered predictive of cardiometabolic conditions [ 79 ] . several anthropometric measures are used to assess overall obesity and also to assess specific aspects such as central or abdominal obesity , visceral fat , or subcutaneous fat . computed tomography and mri are the gold standard methods for measuring visceral fat , and dual - energy x - ray absorptiometry is considered a very reliable alternative . however , these are expensive and not feasible for large epidemiological studies . anthropometric measures such as weight and height for calculating bmi and waist circumference are relatively low - burden standard and valid surrogate measures for abdominal adiposity . overweight and obesity may be associated with fat deposition in the neck , resulting in higher neck circumference . neck circumference is a simple , convenient but less used anthropometric measure , which is correlated with waist circumference and bmi , and has been associated with components of metabolic syndrome in cross - sectional [ 1217 ] and cohort studies in different populations [ 14 , 18 ] . the association between neck fat and metabolic syndrome and its components may be attributed to an excess release of free fatty acids into plasma from the upper body subcutaneous fat . high levels of plasma free fatty acids , in turn , have been associated with markers of oxidative stress and insulin resistance , which in turn impact glycemia . it has been suggested that fat in the neck may be more similar to visceral fat , which is more strongly related with cardiometabolic risks compared to subcutaneous fat . an increase in neck circumference has even been found to be an independent predictor of nonalcoholic fatty liver disease [ 2022 ] . although studies have shown associations between neck circumference and components of metabolic syndrome , more studies directly comparing neck circumference with other anthropometric measures are needed , as neck circumference is not included in standard guidelines and practices and is not generally included in research studies or clinical assessments [ 23 , 24 ] , even in situations when waist circumference may not be feasible or meaningful . neck circumference is rarely evaluated in clinical practice or research , although it is a more practical and likely better measure , which may be especially useful in special populations such as morbidly obese people , patients in bed rest , and pregnant women . hence more studies are needed in different populations to elucidate the utility of this measurement for assessing obesity and predicting cardiometabolic risk factors when the traditional anthropometric measurements are not practicable or valid . therefore , the aim of this paper is to compare the relative utility of neck circumference as a metabolic risk marker among a high risk group of overweight / obese hispanic adults by comparing associations of neck circumference and metabolic factors including metabolic syndrome components , against similar comparisons using waist circumference and other standard measures . the present study utilizes baseline data from the san juan overweight adults longitudinal study ( soals ) . participants who were free of previously diagnosed diabetes , between 40 and 65 years , and overweight or obese ( bmi 25.0 people were excluded if they had previously diagnosed diabetes , had braces or less than four teeth ( since one of the primary goals of soals was relating periodontitis and glucose abnormalities ) , were pregnant , had some systemic conditions ( such as physician - diagnosed hypoglycemia , congenital heart murmurs , heart valve disease , congenital heart disease , endocarditis , rheumatic fever , and hemophilia or bleeding disorders ) , or were unable to complete study procedures . most exclusion criteria relate to health conditions that could potentially increase the risk of systemic complications that could develop during a periodontal examination . participants were further excluded if they had fasting plasma glucose 126 mg / dl , two - hour oral glucose tolerance test ( ogtt ) 200 mg / dl , or glycosylated hemoglobin ( hba1c ) 6.5% at the baseline exam . anthropometric measurements were taken in duplicate according to the nhanes iii procedures . in cases where the first two measures differed by 0.5 cm , a third measure was recorded , and the average of all measures recorded was computed . both body weight ( 0.2 kg weight graduation ) and body fat percent ( 0.1% body fat graduation ) were measured by a bioelectrical impedance analysis ( bia ) technology using tanita scale ( tanita body composition analyzer - tbf-310a ) , and height was measured in meters using a portable stadiometer ( seca corporation , hanover , md ) to calculate bmi . waist circumference was measured at the umbilicus and recorded to the nearest 0.1 cm . neck circumference was measured below the laryngeal prominence and perpendicular to the long axis of the neck , and the minimal circumference was recorded to the nearest 0.1 cm . the average pearson correlation coefficient between repeats for all measures was greater than 0.99 showing excellent reproducibility . we used standard cutoffs from the literature as described below for classifying metabolic syndrome and its components . participants were classified as having elevated blood pressure if they had systolic blood pressure 130 mm hg or diastolic blood pressure 85 mm hg or reported antihypertensive drug treatment . elevated triglycerides were defined as levels 150 mg / dl or a history of drug treatment for elevated triglycerides . low hdl - c was defined as levels < 40 mg / dl in men and levels < 50 mg / dl in women or history of drug treatment for reduced hdl - c . elevated fasting glucose was defined as levels 100 mg / dl or a history of drug treatment for elevated glucose . individuals with adiposity or metabolic syndrome commonly manifest insulin resistance , prediabetes , and a proinflammatory state ; hence these were also evaluated . high sensitivity c - reactive protein ( hs - crp ) levels were considered high if they exceeded 3 mg / l . glucose and insulin levels were evaluated at fasting and after administration of a 75 g glucose load at 30 , 60 , and 120 minutes . insulin resistance was estimated using homa - ir [ fasting glucose fasting insulin/405 ] . ( hba1c ) was measured with an assay based on a latex immunoagglutination inhibition method ( dca 2000 + analyzer , siemens healthcare diagnostics , ny , us ) . prediabetes was defined using standard cutoffs as fasting plasma glucose within 100125 mg / dl , 2 hr ogtt 140199 mg / dl , or hba1c of 5.76.4% . a questionnaire was administered by trained interviewers and included sociodemographic characteristics , lifestyle factors including diet , physical activity , and sleep duration and disorders , and medical and family history including medication use . sleep disordered breathing ( sdb ) was assessed by reported physician diagnosis of sleep apnea , insomnia , and restless legs syndrome . physical activity was defined as at least 150 minutes of moderate - intensity aerobic physical activity per week or at least 75 minutes of vigorous - intensity aerobic physical activity per week or an equivalent combination of moderate- and vigorous - intensity activity ( who recommended levels of physical activity for adults aged 1864 years ) . baseline characteristics of study participants were compared by high and normal neck circumference categories using student 's t - test , mann - whitney - wilcoxon test , or chi square test . since there were no standard thresholds , cutoffs were based on the median by gender : 35.8 cm for women and 41.3 cm for men . partial pearson 's correlations , adjusted for age , gender , smoking status , and physical activity , were calculated between anthropometric measures ( neck circumference , waist circumference , bmi , and body fat percent ) and between anthropometric measures and metabolic factors including components of metabolic syndrome . partial correlations were selected as they are easier to conceptualize and do not distinguish between exposure and outcome . logistic regression models were fit separately to evaluate the association of tertiles ( calculated separately by gender and then combined ) for the different anthropometric measurements with binary outcomes including prediabetes , homa - ir ( defined as the upper quartile of the homa - ir distribution ) , elevated blood pressure , elevated triglycerides , low hdl - c , and elevated hs - crp . although the scale and distribution differ across different anthropometric measures , tertiles would uniformly compare the highest third versus the lowest third . all models were adjusted for age , gender , smoking status , and physical activity . the akaike information criterion ( aic ) was used to determine which of the candidate models best approximated the data ( lower values indicating better fit ) . individuals with high and normal neck circumference were similar in age and gender ( table 1 ) . the mean neck circumference was 42.0 4.8 cm for men and 36.1 2.9 cm for women ( not shown in the table ) . among those with high neck circumference , 16% were current smokers compared to 22% in those with normal neck circumference . as expected , the group with high neck circumference had higher bmi , waist circumference , and body fat percent . measures of glucose tolerance , homa - ir , triglycerides , and hs - crp were also higher among individuals with high neck circumference compared to normal neck circumference subjects . the percent of individuals with prediabetes , hypertension , and metabolic syndrome were higher among the group with high compared to normal neck circumference . individuals in the normal neck circumference group had higher physical activity and hdl - c than those in the higher neck circumference group . table 2 shows pearson 's partial correlation coefficients between anthropometric measures , adjusted for age , gender , smoking status , and physical activity . bmi showed the largest correlation with waist circumference compared to its correlations with other anthropometric measures ( r = 0.87 , p < 0.001 ) . neck circumference was significantly ( p < 0.001 ) correlated with traditional assessments of body composition such as bmi ( r = 0.66 ) , waist circumference ( r = 0.64 ) , and body fat percent ( r = 0.45 ) . figure 2 shows a linear relationship between neck and waist circumference , with the spread increasing with increasing circumferences . hs - crp showed lowest correlations with neck circumference ( r = 0.30 ) compared to waist ( r = 0.40 ) and bmi ( r = 0.46 ) , and body fat percent showed larger correlation with fasting glucose ( r = 0.14 ) compared to neck ( r = 0.10 ) . all other metabolic factors showed significant correlations with most anthropometric measures with the highest correlations with neck circumference : 1 hr ogtt ( r = 0.18 ) , 2 hr ogtt ( r = 0.10 ) , hba1c ( r = 0.28 ) , homa - ir ( r = 0.45 ) , and systolic ( r = 0.18 ) and diastolic ( r = 0.23 ) blood pressure , and hdl - c ( r = 0.23 ) ; triglycerides were significantly associated only with neck with a small correlation of 0.12 . neck circumference was not adjusted for height since adjustment did not improve the correlations with other anthropometric measures or with glucose abnormalities . multivariable logistic regression analysis showed that individuals classified in the middle and upper tertiles ( cutoffs described in table 4 ) of neck circumference exhibited higher odds of prediabetes ( or = 1.34 , 95% ci : 1.011.79 ; or = 2.30 , 95% ci : 1.713.06 , resp . ) compared to those in the lowest tertile after adjusting for age , gender , smoking status , and physical activity ( table 5 ) . positive associations of prediabetes with middle and upper tertiles of waist circumference ( or = 1.22 , 95% ci : 0.911.61 ; or = 1.97 , 95% ci : 1.482.66 ) , bmi ( or = 1.41 , 95% ci : 1.061.87 ; or = 2.00 , 95% ci : 1.492.68 ) , and body fat percent ( or = 1.27 , 95% ci : 0.951.67 ; or = 1.82 , 95% ci : 1.362.46 , resp . ) were generally weaker , and models for other anthropometric measures showed higher aic ( 15781585 ) indicating worse model fit compared to neck ( aic = 1574 ) . only 52 participants reported sdb and the associations between neck circumference and insulin resistance ( or prediabetes ) did not change after adjusting for sdb . since our previous work in this population showed that 1 hr postload glucose was a better metabolic marker than 2 hr glucose , we evaluated an additional measure of prediabetes . in multivariable analyses comparing the upper tertile of neck circumference , waist circumference , bmi , and body fat percent with the lowest tertile , the odds of prediabetes increased after adding the 1 hr glucose > 155 mg / dl to the prediabetes definition : or = 2.63 , 2.19 , 2.40 , and 2.10 , respectively ( data not shown in tables ) , compared to or = 2.30 , 1.97 , 2.00 , and 1.82 , respectively , with prediabetes defined by only fasting glucose , 2 hr glucose , or hba1c . the upper tertile of neck circumference exhibited higher odds of being in the highest quartile ( versus lower 3 quartiles ) of homa - ir ( or = 8.42 , 95% ci : 5.4313.06 ) compared to waist ( or = 7.99 , 95% ci : 5.0812.57 ) . neck circumference also showed higher inverse association with low hdl - c ( or = 2.41 comparing highest and lowest tertile , 95% ci : 1.803.21 ) compared to waist circumference ( or = 2.13 , 95% ci : 1.592.84 ) and other anthropometric measures . compared to other anthropometric measures , upper tertiles of bmi had higher association with hs - crp ( or = 6.76 , 95% ci : 4.879.39 ) . the present study shows that neck circumference was significantly associated with measures of overall and central adiposity ; the magnitude of the associations is modest ranging from 0.45 to 0.66 . the correlations relating both neck and other anthropometric measures with metabolic factors are below 0.47 suggesting modest to weak correlations that are similar or higher for neck circumference ( except with hs - crp and fasting glucose ) . importantly , compared to traditional anthropometric measures such as bmi , waist circumference , and body fat percent , neck circumference showed higher positive associations with prediabetes and higher inverse association with hdl - c , independent of major confounders . as with waist circumference , neck circumference seems to be a good measure without adjusting for height , as the associations were similar when we considered factoring variations in height by using neck to height ratio . waist circumference is a widely used anthropometric measure reflecting central obesity , a major risk factor for cardiometabolic conditions . also , the cutoff points for high wc were derived from regression analysis identifying wc values associated with obesity based on bmi , so its incremental value beyond bmi may be somewhat limited . on the other hand , neck circumference is a simpler and more practical anthropometric parameter , not impeded by clothing or last meal . our data also shows that neck circumference has a smaller correlation with bmi , compared to waist circumference , implying that the incremental value of adding neck circumference would be higher , as neck circumference would be more independent of bmi compared to waist circumference . neck circumference should be included in guidelines and recommended for assessing obesity , especially in situations when the traditional anthropometric measures are not available , convenient , feasible , or meaningful . our study adds to the evidence that it is well correlated with other anthropometric measures and may be a good marker for glucose homeostasis parameters [ 12 , 13 , 29 ] and metabolic conditions [ 9 , 1214 , 30 ] , including blood pressure , fasting plasma glucose levels , and insulin resistance , and may be a good surrogate for visceral adiposity . neck circumference was associated with hs - crp and also correlated with triglycerides and inversely related with hdl - c even after adjusting for bmi or waist circumference [ 31 , 32 ] . it has been suggested that sleep disordered breathing might mediate the association between neck circumference and cardiometabolic risk factors [ 9 , 33 ] independent of obesity . the associations between neck circumference and insulin resistance ( or prediabetes ) did not change after adjusting for sdb in our study , suggesting that sdb is not mediating the associations , possibly because of the low number of participants who self - reported sdb . it has been hypothesized that fat in the neck , more similar to visceral fat , produces and releases substances that cause metabolic abnormalities . more recently it has been described as an ectopic fat depot functioning as a reserve for immediate energy source in a location not typically associated with adipose tissue storage . this causes increased delivery of free fatty acids to the liver , causing oxidative stress and ultimately leading to an increased cardiovascular and metabolic risk [ 38 , 39 ] . another likely pathway is that subcutaneous fat in the upper body , particularly in obese individuals , is responsible for a much bigger proportion of release of free fatty acids than visceral adipose tissue , and high levels of plasma free fatty acids could result in insulin resistance . the cross - sectional data limits us from evaluating the role of neck circumference in predicting incidence or progression of metabolic conditions . however , given the significant and consistent associations in our study and other populations , neck circumference shows promise as an alternative marker for the risk associated with central or visceral adiposity . measurement of neck circumference has been proposed as a useful tool for clinical screening of persons with a high risk of insulin resistance . further prospective research is needed to evaluate whether neck circumference is an important risk factor for the development of cardiometabolic conditions . additional work is needed to understand whether neck circumference can substitute or add to more traditional anthropometric measures such as waist circumference and to develop composite anthropometric measures incorporating neck circumference . the utility of neck circumference may be higher among populations where waist circumference is hard to measure or not interpretable as a measure of central adiposity because of culture , time of the day , clothing , last meal , empty bladder , pregnancy , and various health conditions , all of which are unlikely to impact neck circumference . this cross - sectional study shows that neck circumference has higher associations with prediabetes and lower associations for hs - crp compared to traditional anthropometric measures , and the associations with other metabolic factors are generally similar to waist circumference . neck circumference may be an important marker of central adiposity and perhaps of visceral adiposity and an important risk indicator of metabolic conditions . neck circumference may be an important measure to consider for routine assessment in primary care clinics and other health care settings as well as for research studies when the use of expensive and sophisticated machines is neither easy nor justifiable . it may be especially useful among populations such as pregnant women where traditional measures may be challenging or not meaningful .

this paper evaluates neck circumference as a metabolic risk marker . overweight / obese , nondiabetic hispanics , 4065 years old , who are free of major cardiovascular diseases , were recruited for the san juan overweight adults longitudinal study ( soals ) . baseline exams were completed by 1,206 participants . partial correlation coefficients ( r ) and logistic models adjusted for age , gender , smoking status , and physical activity were computed . neck circumference was significantly correlated with waist circumference ( r = 0.64 ) , bmi ( r = 0.66 ) , and body fat % ( r = 0.45 ) . neck circumference , highest ( compared to lowest ) tertile , had higher association with prediabetes : multivariable or = 2.30 ( 95% ci : 1.713.06 ) compared to waist circumference or = 1.97 ( 95% ci : 1.482.66 ) and other anthropometric measures . neck circumference showed higher associations with homa , low hdl - c , and triglycerides , multivariable or = 8.42 ( 95% ci : 5.4313.06 ) , 2.41 ( 95% ci : 1.803.21 ) , and 1.52 ( 95% ci : 1.142.03 ) , but weaker associations with hs - crp and hypertension , or = 3.61 ( 95% ci : 2.664.90 ) and or = 2.58 ( 95% ci : 1.903.49 ) , compared to waist circumference . aic for model fit was generally similar for neck or waist circumference . neck circumference showed similar or better associations with metabolic factors and is more practicable than waist circumference . hence , neck circumference may be a better alternative to waist circumference .

1. Introduction 2. Methods and Procedures 3. Results 4. Discussion 5. Conclusion

human t - lymphotropic virus type ( htlv- ) was first identified in humans in 1980 ( 1 ) and 1982 ( 2 ) . a type c retrovirus , htlv- , is the causative agent of two distinct human diseases , adult t - cell leukemia ( atl ) or lymphoma , and a chronic progressive demyelinating disorder known as htlv--associated myelopathy / tropical spastic paraparesis ( ham / tsp ) ( 3 ) . it is estimated that 10 to 20 million people worldwide are infected with htlv- ( 4 ) . whole blood components , platelets and packed red blood cells , but not fresh frozen plasma , are sources of virus transmission ( 7 ) . the probability of seroconversion in a recipient of contaminated blood is about 44% ( 8) . patients with thalassemia need infusion of four to six blood units per month and therefore the risk of blood - borne diseases caused by viruses such as htlv - i , hepatitis b virus ( hbv ) , hepatitis c virus ( hcv ) , and human immunodeficiency virus ( hiv ) increase in these patients ( 9 ) . however , few studies on the association between htlv- infection and malignancy risk have been published ( 10 ) . there are some case reports regarding finding htlv- in lymphoid malignancies except atl ( 11 ) . it is still controversial whether or not htlv- infection affects the incidence of several malignancies . found an association between htlv- and lymphoid malignancies in the dominican population ( 12 ) . most of htlv - i - infected individuals remain asymptomatic throughout their lives and in a few subjects htlv - i - associated diseases will appear . this infection is endemic in southern japan , the caribbean basin , central africa , central and south america , the melanesian islands in the pacific basin , and in the aboriginal population in australia ( 13 ) . in iran , this virus has been found in isolated pockets in which htlv- infection is endemic ( khorasan , the northeastern province of iran ) . the prevalence of htlv- infection in mashhad , khorasan was 0.77% among seeming healthy blood donors ( 14 ) . however , we have few data about the prevalence of htlv- and htlv - ii in patients with hematological disorders and malignancies in iran . according to another reports , the prevalence of htlv - i infection in mashhad , neishbour , and sabzevar was 2.1% , 3% and 1.6% , respectively ( 15 , 16 ) . however , the virus is less frequent in other parts of iran including urmia ( 0.34% ) in northwest and chaharmahal and bakhtiari ( 0.62% ) in southwest of iran ( 17 , 18 ) . the aim of this study was to determine the prevalence of htlvs among patients with chronic myelogenous leukemia ( cml ) , acute lymphoblastic leukemia ( all ) , acute myelogenous leukemia ( aml ) , lymphoma , hemophilia and thalassemia , and hemophilia . therefore , this study was conducted to detect htlv- and htlv - ii in patients with hematological disorders from isfahan province , center of iran . in this cross - sectional study , 101 patients with confirmed hematological disorders admitted to the oncology and thalassemia unit of seyed al - shohada hospital , isfahan , iran , were enrolled during april to october 2012 . hematological disorders were as follows ; leukemia ( 20 cases ) , lymphoma ( four cases ) , thalassemia ( 67 cases ) and hemophilia ( 10 cases ) . about 5 ml blood was collected from each patient without adding any anticoagulant . dna was extracted from each 100 l blood serum using high pure extraction kit ( cinnapure cell dna kit , cat no . pcr amplification was performed with two sets of primers , pol ( forward , ccctacaatccaaccagctcag ; reverse , tggagtaacttactaggttag ) for htlv- ( genbank accession no . j02029 ) ; and tax ( forward , cgattgtgtacaggccgattg ; reverse , cctgtacaccaggcagtctgga ) for htlv- ( genbank accession no . m10060 ) ; resulting in amplicons of 668 bp and 628 bp , respectively , according to dehee et al . it contained 5 l dna sample , 1 l of each primer ( 10 pmol , tag copenhagen , denmark ) , 0.5 l taq dna polymerase ( 500 uta7506c cinnagen , iran ) , 2.5 l pcr buffer 10x , 1 l dntp mixture ( 10 mm , dn7603c , cinnagen , iran ) , 1 l mgcl2 ( 50 mm , tp7506c , cinnagen , iran ) and 13 l distilled water . for htlv- , the reaction mixture was incubated for five minutes at 95c and then subjected to 40 cycles consisting of 30 seconds at 94c , 30 seconds at 57c , and one minute at 72c , and a final extension for seven minutes at 72c in a dna thermal cycler ( corbett , research , cgi-960 , australia ) . for htlv- , the reaction mixture was incubated for five minutes at 95c and then subjected to 40 cycles consisting of 30 seconds at 94c , 30 seconds at 62c , and one minute at 72c , and a final extension for seven minutes at 72c . genomic dna of htlv--infected cell line , tl - om1 , was used as positive control . the pcr products were analyzed by electrophoresis on agarose gel ( 1% ) and stained with ethidium bromide . in this cross - sectional study , 101 patients with confirmed hematological disorders admitted to the oncology and thalassemia unit of seyed al - shohada hospital , isfahan , iran , were enrolled during april to october 2012 . hematological disorders were as follows ; leukemia ( 20 cases ) , lymphoma ( four cases ) , thalassemia ( 67 cases ) and hemophilia ( 10 cases ) . about 5 ml blood was collected from each patient without adding any anticoagulant . dna was extracted from each 100 l blood serum using high pure extraction kit ( cinnapure cell dna kit , cat no . pcr amplification was performed with two sets of primers , pol ( forward , ccctacaatccaaccagctcag ; reverse , tggagtaacttactaggttag ) for htlv- ( genbank accession no . j02029 ) ; and tax ( forward , cgattgtgtacaggccgattg ; reverse , cctgtacaccaggcagtctgga ) for htlv- ( genbank accession no . m10060 ) ; resulting in amplicons of 668 bp and 628 bp , respectively , according to dehee et al . ( it contained 5 l dna sample , 1 l of each primer ( 10 pmol , tag copenhagen , denmark ) , 0.5 l taq dna polymerase ( 500 uta7506c cinnagen , iran ) , 2.5 l pcr buffer 10x , 1 l dntp mixture ( 10 mm , dn7603c , cinnagen , iran ) , 1 l mgcl2 ( 50 mm , tp7506c , cinnagen , iran ) and 13 l distilled water . for htlv- , the reaction mixture was incubated for five minutes at 95c and then subjected to 40 cycles consisting of 30 seconds at 94c , 30 seconds at 57c , and one minute at 72c , and a final extension for seven minutes at 72c in a dna thermal cycler ( corbett , research , cgi-960 , australia ) . for htlv- , the reaction mixture was incubated for five minutes at 95c and then subjected to 40 cycles consisting of 30 seconds at 94c , 30 seconds at 62c , and one minute at 72c , and a final extension for seven minutes at 72c . genomic dna of htlv--infected cell line , tl - om1 , was used as positive control . the pcr products were analyzed by electrophoresis on agarose gel ( 1% ) and stained with ethidium bromide . of 101 patients , 67 ( 66.33% ) and 34 ( 33.66% ) were female and male , respectively . according to the type of hematological disorders , the most cases with thalassemia were in the age group of 20 - 40 years ( table 1 ) . most of the patients with leukemia ( 20 ) were in the age group of 1 - 6 years and in hemophilic cases ( 10 ) , most of the patients were in the age group of 40 - 60 years . in the lymphoma group ( 4 ) , all of the four cases were over 12 years . the results showed that only one male ( 0.99% ) was positive for htlv - i in patients with thalassemia . according to the results of pcr , the overall prevalence of htlv - i infection in patients with thalassemia in isfahan was 1.49% . lane 1 , 100 bp marker ; lane 2 , positive control ( tl - oml ) ; lane 3 , negative sample ; lane 4 , positive sample ; lane 5 , negative control . approximately 5 - 10% of htlv - i - infected individuals develop either atl or ham / tsp . some evidences have shown that it has also been associated with other diseases such as cutaneous t cell lymphoma ( ctcl ) , htlv - i - associated arthropathy ( haap ) , graves disease , uveitis , polymyositis , chronic respiratory diseases , lymphadenitis , and dermatitis ( 20 ) . on the other hand , htlv- and htlv - ii infections are usually chronic and untreatable diseases ; so , adequate standards of diagnosis , prevention , care and support , as well as surveillance should be provided ( 21 ) . htlv- infection is endemic in certain parts of the world ( 22 ) as well as in a northern city of iran , mashhad ( 14 , 16 ) . in the present study , we tried to determine the prevalence of htlv - i and htlv - ii infections in patients with hematological disorders in isfahan province , iran . although there is no defined treatment for patients infected with htlv- and htlv - ii , the accurate knowledge of the prevalence rates in different populations may be helpful in establishing prophylactic measures to reduce the rates of viral transmission from infected individuals . htlv- and htlv - ii are cell associated and spread in cells after blood transfusion , sexual intercourse , or breastfeeding . patients with hematological disorders who need repeated blood transfusion are among the most high - risk groups for this infection ( 23 , 24 ) . htlv- and htlv - ii , related to thalassemia and hemophilia by blood transfusion , have been reported in previous publications . in iran , also , there is some evidence suggesting the relatively high prevalence of the virus in these patients . farias de carvalho et al . found a seroprevalence of 28.9% among patients with t - cell lymphoid malignancies in brazil ( 25 ) . adedayo and shehu found a 38.6% htlv- seropositivity in all hematological malignancies in india ( 12 ) . found an htlv-1 prevalence of 26.1% in 88 cases of non - hodgkin s lymphoma in japan ( 26 ) . the prevalence rate of htlv- and htlv - ii infections was 18% in southern chile in patients with malignant hematological diseases , and 27% in patients with chronic lymphoproliferative disorders , as barrientos et al . reported ( 27 ) . monavari et al . reported that the prevalence of htlv- among patients with malignant hematological diseases in tehran was 12% ( 28 ) . the information about htlv- and htlv - ii prevalence in different populations and patients is crucial , because it may be useful in establishing prophylactic measures to decrease the rates of viral transmissions from infected individuals . whereas the gold standard method for the diagnosis of htlv infection is the detection of htlv genome in specimens of patients , it seems that the prevalence of htlv- infection in our study population was 0.99% . pcr is an extremely sensitive technique , but sometimes has some limitations which lead to unexpected results . on the other hand , the presence of antibodies does not affect the results and the few copy number of the target sequence will appear in pcr product . negative control was the indicator of cross - contamination and the pcr product of negative control did not show any expected amplicon length . in the present study , we could not find any association between gender , age and occupation and htlv - i . in conclusion , our study showed that the prevalence of htlv - i infection in patients with thalassemia in isfahan was 1.49% , but none of the samples contained the genome of htlv - ii . therefore , it is necessary to carry out a large epidemiological study in this part of iran . although the prevalence of htlv - i and htlv - ii infection among patients with hematological disorders in isfahan province compared to other regions of iran is not too high , htlv screening should be performed prior to blood transfusion to decline the risk of virus transmission in these patients . patients with htlv- and htlv - ii infection may acquire this infection via blood transfusion , despite all of the precautions for screening the blood supply . therefore , the present study suggests that serious consideration must be given to prevent htlv - i and htlv - ii infection via transfusion in hematological disorders . routine serological screening for htlv - i and htlv - ii antibody and detection of htlv- and htlv - ii genome in blood donors is indicated to permit the deferral of blood product donations by asymptomatic htlv- and htlv - ii carriers .

background : human t - cell lymphotropic virus types and ( htlv- and htlv - ii ) are deltaretroviruses which may cause leukemia , lymphoma and htlv - associated myelopathy / tropical spastic paraparesis ( ham / tsp ) . in addition , htlv-1 may be related to thalassemia and hemophilia cases after blood transfusion.objectives:the aim of this study was evaluation of the prevalence of htlvs in patients with hematological disorders ( leukemia , thalassemia , lymphoma and hemophilia).patients and methods : this cross - sectional study was conducted during april to october 2012 . a total of 101 serum samples were collected from patients and were stored at -20c . dna was extracted from serum by an extraction kit . the extracted dna was tested by polymerase chain reaction ( pcr ) for detection of htlv- and htlv - ii pol and tax gene sequences , respectively . samples were collected from 67 ( 66.33% ) , 20 ( 19.80% ) , 4 ( 3.96% ) , and 10 ( 9.90% ) patients with thalassemia , leukemia , lymphoma and hemophilia , respectively.results:one thalassemia sample was htlv- positive , but none of the samples contained the genome of htlv - ii . the prevalence of htlv- in this study in patients with hematological disorders was 0.99%.conclusions : the prevalence of htlv- in hematological disorders was similar to that of other parts of iran . the present study revealed that htlv- screening should be performed before blood transfusion to reduce the risk of virus transmission in patients with hematological disorders . more study should be performed to detect these viruses in blood donors .

1. Background 2. Objectives 3. Patients and Methods 3.1. Population Study 3.2. Sampling 3.3. DNA Extraction 3.4. Polymerase Chain Reaction 4. Results 5. Discussion

obstructive sleep apnea ( osa ) is a common sleep disorder with the prevalence of about 5% in iranian population . it is well known as an independent risk - factor for serious cardiovascular related diseases , including systemic hypertension , coronary artery disease , stroke , and pulmonary hypertension.[27 ] moreover , it has economic impacts on societies by increasing the daytime sleepiness , leading to car accidents and work disability . diagnosis of osa is complex , and it is under - diagnosed most of the times , especially by primary care physicians who regularly visit the patients ; about 75% of even severe osa patients are diagnosed . currently , polysomnography is the gold standard tool for diagnosis of osa ; however , because of its expensiveness and the limitations of its access it can not be used regularly as the screening test . recently , a systematic review compared different instruments accuracies and showed the wisconsin and the berlin questionnaire ( bq ) to have the highest sensitivity and specificity , respectively . the bq is an instrument , which can indicate the presence of sleep apnea by addressing the presence and frequency of snoring behavior , wake time sleepiness or fatigue , and history of obesity or hypertension . the questionnaire has demonstrated the cronbach 's correlations of 0.86 - 0.92 with sensitivity of 86% , specificity of 77% , positive predictive value ( ppv ) of 89% , negative predictive value ( npv ) of 72% , and a likelihood ratio of 3.79 . with more than 400 citations , bq is one of the most applied instruments for screening patients for osa and is translated and validated in different populations . to the best of our knowledge , there is no report to evaluate the validity and reliability of the persian version of the bq . therefore , the aim of this study was to assess the reliability and diagnostic accuracy of the persian version of the bq in diagnosis of osa in iranian sleep clinic patients . at first , the translation and back translation of the original version of the berlin sleep questionnaire were conducted . back translation was reviewed by two pulmonologist in order to achieve a modified version of the original copy . then one translator and one researcher checked and agreed upon the provided version of the berlin sleep questionnaire as a representative of the original version in terms of wording and content . a cross - sectional linguistic validation study was conducted on consecutive iranian patients with persian language attending the bamdad sleep clinic in isfahan ( iran ) during the period , from september 2010 through october 2011 . patients with history of chronic anxiolytic / sedative drug use , those with renal , hepatic , cardiovascular or associated respiratory diseases , or upper respiratory tract infections within the past 4 weeks , as well as those who were critically ill or pregnant were excluded from the study . the study was approved by the ethics committee of the isfahan university of medical sciences , and all patients signed an inform consent before entering the study . apneas / hypopnea was scored when the baseline amplitude of respiration reduced 50% or more , or oxygen saturation reduces for at least 3% , either lasting for a minimum of 10 s. an apneas / hypopnea index ( ahi ) of > 5 was considered for diagnosis of osa and respiratory disturbance index ( rdi ) 15 indicating sleep - disordered breathing ( sdb ) . data on demographic characteristics , ( including age and gender ) and weight and height were collected from patients documents files . patients completed the bq , which contains 10questions in 3 categories ; 1 category includes five items on snoring , 2 category includes three items on daytime somnolence , and the 3 category includes two items on the history of hypertension and/or body mass index ( bmi ) > 30 kg / m . illiterate and low - educated patients filled out the questionnaire with the assistance of an investigator . having high - risk sleep apnea was considered if scores were positive on two or more of the three categories and those who identified as low - risk of having sleep apnea had positive scores on less than two categories . predictive parameters of the bq , and its categories , ( including sensitivity , specificity , ppv , and npv were calculated by considering ahi > 5 as the gold standard . at first , the translation and back translation of the original version of the berlin sleep questionnaire were conducted . back translation was reviewed by two pulmonologist in order to achieve a modified version of the original copy . then one translator and one researcher checked and agreed upon the provided version of the berlin sleep questionnaire as a representative of the original version in terms of wording and content . a cross - sectional linguistic validation study was conducted on consecutive iranian patients with persian language attending the bamdad sleep clinic in isfahan ( iran ) during the period , from september 2010 through october 2011 . patients with history of chronic anxiolytic / sedative drug use , those with renal , hepatic , cardiovascular or associated respiratory diseases , or upper respiratory tract infections within the past 4 weeks , as well as those who were critically ill or pregnant were excluded from the study . the study was approved by the ethics committee of the isfahan university of medical sciences , and all patients signed an inform consent before entering the study . apneas / hypopnea was scored when the baseline amplitude of respiration reduced 50% or more , or oxygen saturation reduces for at least 3% , either lasting for a minimum of 10 s. an apneas / hypopnea index ( ahi ) of > 5 was considered for diagnosis of osa and respiratory disturbance index ( rdi ) 15 indicating sleep - disordered breathing ( sdb ) . data on demographic characteristics , ( including age and gender ) and weight and height were collected from patients documents files . patients completed the bq , which contains 10questions in 3 categories ; 1 category includes five items on snoring , 2 category includes three items on daytime somnolence , and the 3 category includes two items on the history of hypertension and/or body mass index ( bmi ) > 30 kg / m . illiterate and low - educated patients filled out the questionnaire with the assistance of an investigator . having high - risk sleep apnea was considered if scores were positive on two or more of the three categories and those who identified as low - risk of having sleep apnea had positive scores on less than two categories . predictive parameters of the bq , and its categories , ( including sensitivity , specificity , ppv , and npv were calculated by considering ahi > 5 as the gold standard . one hundred and fifty seven patients ( 55.4% male ) with ages between 16 years and 89 years ( 52.3 13.6 years ) were evaluated in the sleep clinic during the study . studied population characteristics are presented in table 1 . rdi was available for 129 patients in whom 88.3% had rdi 15 indicating sdb . bq categories 1 - 3 were positive respectively in 88.5% , 67.5% , and 66.9% of the patients . general population characteristics the reliability analysis of the bq categories showed alpha cronbach 's as 0.70 and 0.50 for category 1 and category 2 , respectively . descriptive scale analysis of the 2 category showed that item 9 has an item - total correlation of 0.213 and increased the alpha to 0.552 if item deleted the bq and ahi were in agreement for 82.1% of the cases . the bq identified 80.3% ( n = 126 ) of the patients as being in the high - risk group for osa . in subjects with a high - risk score , osa diagnosis was confirmed by sleep study in 96.0% ( ppv , n = 121 ) . mild , moderate , and severe osa based on sleep study was present in 20.6% , 23.8% , and 51.5% of the patients in the high - risk group based on bq . of the subjects in the low - risk group , 32.2% , 12.9% , and 29.0% had mild , moderate , and severe osa , followed by those 25.8% ( n = 8) , in whom osa was excluded by sleep study npv . relationship between berlin questionnaire score and apnea / hypopnea index the sensitivity and the specificity of the whole bq for osa diagnosis with ahi > 5 were 84.0% and 61.5% , respectively with ppv of 96.0% , npv of 25.8% , positive likelihood ratio of 2.18 and negative likelihood ratio of 0.26 . considering rdi > 5 as the standard , the sensitivity and the specificity of the whole bq were 81.7% and 100% , respectively [ table 3 ] . the bq sensitivity and specificity were respectively as 82.1% and 100% in men and 86.6% and 50% in women . for category 1 , the sensitivity and specificity were 91.6% and 46.1% , and for category 2 they were 68.0% and 38.4% , respectively . in 67.5% of the cases , the reliability analysis of the bq categories showed alpha cronbach 's as 0.70 and 0.50 for category 1 and category 2 , respectively . descriptive scale analysis of the 2 category showed that item 9 has an item - total correlation of 0.213 and increased the alpha to 0.552 if item deleted the bq and ahi were in agreement for 82.1% of the cases . the bq identified 80.3% ( n = 126 ) of the patients as being in the high - risk group for osa . in subjects with a high - risk score , osa diagnosis was confirmed by sleep study in 96.0% ( ppv , n = 121 ) . mild , moderate , and severe osa based on sleep study was present in 20.6% , 23.8% , and 51.5% of the patients in the high - risk group based on bq . of the subjects in the low - risk group , 32.2% , 12.9% , and 29.0% had mild , moderate , and severe osa , followed by those 25.8% ( n = 8) , in whom osa was excluded by sleep study npv . relationship between berlin questionnaire score and apnea / hypopnea index the sensitivity and the specificity of the whole bq for osa diagnosis with ahi > 5 were 84.0% and 61.5% , respectively with ppv of 96.0% , npv of 25.8% , positive likelihood ratio of 2.18 and negative likelihood ratio of 0.26 . considering rdi > 5 as the standard , the sensitivity and the specificity of the whole bq were 81.7% and 100% , respectively [ table 3 ] . the bq sensitivity and specificity were respectively as 82.1% and 100% in men and 86.6% and 50% in women . for category 1 , the sensitivity and specificity were 91.6% and 46.1% , and for category 2 they were 68.0% and 38.4% , respectively . in 67.5% of the cases , our study was aimed to evaluate the validity and reliability of the persian version of the bq in iranian patients attending to sleep on clinic . the questionnaire reliability was appropriate for the first category ( cronbach 's alpha , 0.70 ) , but was not appropriate for the second category ( cronbach 's alpha , 0.50 ) . it might be due to ( 1 ) translation and scoring errors and/or ( 2 ) the ninth item , ( which is about nodding off or falling asleep while driving a vehicle ) , as far as the old population admitted to the sleep clinic did not drive regularly , and thus , this question was not appropriate to evaluate their daytime sleepiness . indeed the item - scale correlation of this item was not appropriate and its deletion increased the internal consistency of the category , similar to the original study ( from 0.63 to 0.86 ) . furthermore , the strong homogeneity of our studied patients could contribute to a low alpha . however , as the second category reliability is confirmed by the original study , and other linguistic validation studies , translation errors should also be considered in our study . among our study population that more than 90% of them were diagnosed as high - risk for osa , the persian bq had acceptable sensitivity of 84% and ppv of 96% , however , specificity of 61.5% and npv of 25.8% for diagnosing osa with ahi > 5 as the gold standard . predictive parameters of bq have been very different in previous studies . regarding the studies conducted on patients without history / complaints of sleep disorders , the original study in primary care setting found a sensitivity of 86% , specificity of 77% , ppv of 88% , and npv of 72% against rdi > 5 and another study in preoperative surgical patients showed a sensitivity of 68.9% and specificity of 56.4% ( ppv 779% and npv 44.9% ) . furthermore , a norwegian population - based study found a sensitivity and specificity of 37.2% and 84.0% , respectively ( ppv 61.3% and npv 66.2% ) against ahi 5 . with regard to the studies on patients with sleep complaints , the arabic bq has a sensitivity of 97% and specificity of 90% ( ppv 96% and npv 93% ) against ahi > 5 while the portuguese bq showed sensitivity of 72.1% and specificity of 50% ( ppv 87.7% and npv 26.7% ) against ahi > 5 in respiratory / sleep clinic patients ahmadi et al . , with retrospective chart review study of sleep clinic patients , found a sensitivity of 68% and specificity of 46% ( ppv 48% and npv 65% ) against rdi > 10 among patients with cardiovascular problems , bq showed a sensitivity of 68% to 70% and specificity of 34% to 48% ( ppv 56 - 68% and npv 50 - 64% ) against ahi 5 . these differences may be due to differences in studied population and the factors that may conflict with osa sign and symptoms , including complicated health conditions of cardiovascular patients ( that may cause sleep disturbances ) , and also patients underling diseases such as hypertension and obesity . difference between studies regarding the gold standard , rdi versus ahi , is also of great importance in this regard as the rdi is more broaden than the ahi . other factors that may affect the accuracy of bq in diagnosing osa are suggested as age , bmi , underling disease and the capability of the individuals to works . for example , among the young nurses for rdi 5 the validity parameters for bq would be weaker than other populations , it seems to be due to lower prevalence rates of sleep apnea in this population . moreover , the nurses expect to have poorer sleep quality because of their job situations . so this may affect their response to self - administered screening tests ( bq ) . other study demonstrated the sensitivity of 76.7% and specificity of 39.3% at a cut - off of ahi > 15 , and lower accuracy of the test in older individuals , women ( as our data confirm that as well ) and patients with hypertension . this was similar to our findings that the accuracy of bq was better among men and women ; however , the original study did not confirm a gender effect . regarding the bmi , the arabian study , in which the participants were more obese than in our study ( mean bmi of 41.2 ) found better predictive values , as the bmi is included in the third category of the bq . according to our study , and similar to some other reports , separate analysis of the bq categories showed better sensitivity and specificity for the first versus the second category . modified the item nine in the 2 category and found higher sensitivity of 85% and specificity of 95% ( ppv 96% and npv 81% ) for ahi > 5 . according to these results , it seems that this item needs modification and further studies are warranted in this regard . the possibility of errors in translation may have effects on predictive values of the persian bq . furthermore , our study sample was very homogenous and not large enough as there were only 13 cases that had not osa based on sleep study . therefore , further studies on editing , modifying , and applying the bq in a larger sample of patients are warranted in our society . according to high sensitivity and ppv of the test , the persian bq is useful as a screening test for diagnosing osa in patients with sleep complaints . however , the test has very low specificity and npv and thus , can not be used for rolling out osa among such patients . further studies on editing , modifying , and applying the bq in a larger sample of patients are warranted in our society

background : obstructive sleep apnea ( osa ) is a common but usually under - diagnosed sleep disorder . objective diagnosis is based on polysomnography , which is an expensive test . we assessed the reliability and diagnostic accuracy of the berlin questionnaire ( bq ) in diagnosis of osa in iranian sleep clinic patients.methods:a cross - sectional linguistic validation study was conducted on consecutive iranian patients with persian language attending one sleep clinic in isfahan ( iran ) were studied . patients completed the persian bq ( contains 10 questions in 3 categories ) , developed by forward - backward translation method . the patients underwent an overnight polysomnographic study at the clinic . apneas / hypopnea index of > 5/hour was considered for diagnosis of osa.results:one hundred and fifty seven patients ( 55.4% male , mean age = 52.3 13.6 years ) were evaluated . sleep study confirmed osa diagnosis in 91.7% of the studied patients . the reliability analysis of the bq categories showed alpha cronbach 's as 0.70 and 0.50 for category 1 and category 2 , respectively . bq categories 1 - 3 were positive respectively in 88.5% , 67.5% , and 66.9% of the patients . the bq and sleep study were in agreement for 82.1% of the cases . the sensitivity , specificity , positive and negative predictive values , and positive , and negative likelihood ratio of the bq were calculated as 84.0% , 61.5% , 96.0% , 25.8% , 2.18% , and 0.26% respectively.conclusions:bq is useful as a screening test for diagnosing osa in iranian patients with sleep complaints ; however , the test can not be used for rolling out the osa . further studies on editing , modifying , and applying the bq in a larger sample of patients are warranted in our society .

INTRODUCTION METHODS Translation process Patients and settings Data collection Statistical analysis RESULTS BQ performance DISCUSSIONS CONCLUSIONS

mimicry of interfacial protein segments has led to new classes of rationally designed inhibitors of protein protein interactions ( ppis ) . the identification and analysis of protein complexes mediated by protein secondary structures provide a platform for these explorations . we have recently examined the full set of protein complexes in the protein data bank mediated by -helices and -strands . our work , along with efforts by kritzer et al . to define loop motifs at protein interfaces , aims both to describe the interactions present in the protein data bank and to prescribe effective starting points for the design of ppi inhibitors . individual secondary structures are critical elements of protein interfaces ; however , many ppis feature more complex modes of binding , suggesting a potential role for synthetic tertiary structure mimetics or miniproteins as attractive candidates for the design of new classes of ppi inhibitors . miniproteins consisting of helical bundles , -sheet barrels , and loops , along with synthetic antibodies , are now routinely used to enrich ligands for protein targets , especially for extracellular receptors . in an effort to expand our atomic analysis of protein structural data beyond interactions that can be mediated by a single secondary structure element alone , we chose to begin our survey of protein tertiary interactions by focusing on helix dimers because the dimer is the simplest all - helical tertiary structure stoichiometry . coiled coils and helical bundles are well understood and have been extensively studied in diverse biochemical and biophysical contexts . dimeric coiled coils or similarly structured motifs such as bundles play essential roles in mediating biological processes , iconically driving the multimerization and stabilization of proteins involved in transcription factor complexes and vesicular trafficking , among other critical functions . several computational approaches have been implemented to predict coiled coil - mediated interactions by their pairwise and multimeric residue correlations . seminal studies have produced a comprehensive dataset of the coiled coil interactome . however , computational and experimental methods for the analysis of coiled coils described thus far are largely devoted to characterization of forces that lead to coiled coil formation . to complement these studies , we sought to analyze interactions of helical dimers with globular proteins as a step toward the rational design of coiled coil mimetics as ppi inhibitors . though canonical coiled coils possess supercoiling and particular packing properties , we did not impose these requirements , stipulating only that the helices be proximal and well - oriented . since our motivation for developing this dataset is to identify interactions that may not be inhibited by secondary structure mimics , we also required that critical binding residues be located on both helices . these criteria retain structures of high structural similarity to a coiled coil but eliminate canonical all - alpha tertiary structure motifs like the helix - loop - helix and helix - turn - helix dna binding domains , whose interhelical angles are far from parallel or antiparallel . examination of the helix dimer dataset suggests that coiled coil interfaces can be divided into three broad categories ( figure 1 ) according to their interaction stoichiometry . case 1 features a helical dimer from one protein interacting with a single partner protein . in case 2 , a helical dimer from one protein interacts with two different protein partners . in case 3 , a single helical dimer motif forms at the interface between partner proteins . we anticipate that helical dimers in case 3 would favor different interacting residues from examples in cases 1 and 2 , because in case 3 high - affinity interactions must form between two individual helices rather than a helix dimer and a globular protein . this taxonomy reflects the different properties demanded of potential designed inhibitors : case 1 features interactions on predominantly one dimer face ; case 2 generally interacts with two faces ; case 3 dimer interfaces may be interrupted by a single helix . models depicting three families of coiled coil - like structures at protein protein interfaces . ( a ) in the first family ( case 1 ) , a coiled coil entirely from chain a forms an interaction with protein b. ( b ) in the second family ( case 2 ) , a coiled coil , which may come from one or two proteins , interacts with two different proteins partners . ( c ) in the third family ( case 3 ) , a coiled coil forms across a protein interface . schematic for identification of protein interfaces in the protein data bank ( pdb ) where a helix dimer contributes significantly to complex formation . interfacial helices from the previously described hippdb dataset were culled to produce a set of structures for detailed analysis via stringent distance , orientation , and energetic criteria . on the basis of our evaluations , we classified the interactions among three classes ( cases 13 ) of helical tertiary structure - mediated ppis . the energetic contribution of each interface helix dimer and individual residues was approximated using rosetta . we examined the biophysical properties of each class in relation to each other , to typical interface helices in general , and to canonical coiled coils . coiled coils are defined as two or more -helices that wind around each other to form supercoils . classical coiled coils are characterized by a heptad repeat , ( abcdefg)n , where buried a and d positions form the interface between partner helices . we sought to identify all helix dimers that are in contact with a globular protein irrespective of whether such helices would meet the strict definition . this study has revealed the existence of a set of biologically relevant complexes as potential targets for inhibitor design . we also analyzed the biophysical properties of dimer interfaces , such as the composition of hot spot residues and the degree to which helical dimers differ from coiled coils and protein helices in general . this analysis shows that hot spot residues are concentrated over compact areas , potentially allowing the mimicry of these dimers by small or medium - sized molecules . hippdb was developed to comprise all interface helices of four or more residues that contain two or more hot spot residues , where hot spot residues are defined via computational alanine scanning , performed with rosetta , as those that result in a loss of binding energy ( g ) of at least 1.0 rosetta energy unit ( reu , which scales approximately as 1 kcal / mol ) . in this work , we expanded the hippdb dataset to include over 37 000 high - affinity interfaces and imposed stringent geometric and energetic criteria to obtain a set of over 1000 high - affinity helical dimers . we made modifications to our prior methodology to tailor it to the coiled coil motif ( figure 2 ) . in hippdb , we were interested in identifying minimal inhibitory motifs to aid the design of synthetic inhibitors . this goal requires identification of helical segments of a protein present at an interface without the sequences not in contact . in the context of helical dimers , the challenge is to capture the defining geometric parameters as accurately as possible so any energetically irrelevant residues far from the interface can be discarded separately . we altered our analysis such that any continuous stretch of helical residues counts as a helical element as long as part of the helix is present at the interface . this modified method identifies as a single element of interest helix dimers in which one helix makes contact with a partner protein at multiple separate points along its length . we imposed both geometric and energetic criteria to obtain a dataset of interfaces where coiled coil - like structures play an important role . we stipulated that each helix must contribute at least 6.0 rosetta energy units ( reu ) of g in its interaction with its partner , that the angle between their helical axes must be within 30 of parallel or antiparallel , and that the two helices are within 17 of each other . these conditions ensured coiled coil - like geometry and a substantial energetic contribution , equivalent to at least three strong hot spot residues , from each helix . the 6 reu threshold ensures that the selected coiled coil interfaces contain a sufficient number of hot spot residues to merit their mimicry by a potential synthetic inhibitor . lower energetic thresholds yield additional compelling complexes , but far too many to investigate individually . we also imposed conditions on the percentage of the interaction s overall g contributed by each helix . when both helices come from the same protein chain , we required each helix to contribute at least 20% of the chain s g . this requirement excluded any helical dimers that did not make a substantial total contribution to the binding interface , and ensured that the complexes in the database will truly require a dimer and are not amenable to disruption by mimic of a single helix . finally , we aimed to ensure that the dataset was not dominated by pairs of chains from multimeric helix bundles , as our interest lies in complexes where at least one partner is a globular protein . we observed that in structures of conventional helix bundles , almost every residue of each chain is present at the protein , we required that at least one partner in every complex must have at minimum 30% of its residues distant from the interface . dimers may be queried using pdb identification , total g and sasa , interhelical distances , and angles ( table 1 ) . . each field may be searched and sorted , and data may be downloaded in csv , pdf , or xls format . complexes of weaker affinity ( g cutoff of 4 reu ) are included for comparison in the website dataset . a cursory analysis would suggest that the hot spot residues may be distributed evenly over many heptads , requiring the design of large molecules or biologics for inhibition , as has been true for the design of coiled coil assembly inhibitors . we were surprised to find that a plurality of complexes in dippdb possessed hot spot residues over a relatively small region of the interface ( figure 3 ) . the average length of case 1 , 2 , and 3 helical dimers is 19 , 27 , and 22 residues , respectively , while their average hot spot spans are 13 , 17 , and 16.5 residues . the critical residues are limited to a single heptad in 15% of case 1 dimers and to two heptads in two - thirds of examples . the trend of compact hot segments in helical dimers is observed in each case with two - thirds of critical contact residues averaging fewer than three heptads . dimers that span three heptads or less ( roughly 30% of the dataset ) average a hot spot per 4.7 residues . this signature is strongly suggestive of an interface amenable to inhibition by designed peptidomimetics . however , as peptidic coiled coils of these length scales are not generally stable , we have undertaken an experimental effort to develop cross - linked helix dimers ( chds ) as minimal inhibitors of coiled coils and other helical ppis . histogram of the distance between the first and final hot spot residue in case 1 ( black ) , case 2 ( light gray ) , and case 3 ( dark gray ) helical dimers . further examination of dippdb interfaces suggests that helical dimers at protein protein interfaces have comparable amino acid composition to other high - affinity interface helices but significantly differ from canonical coiled coils . in general , classical coiled coil motifs possess a distribution of amino acids similar to the -helix but with considerable additional bias toward aliphatic residues , owing to their obligate interior packing interactions . we wished to understand whether helical dimers more closely reflected the amino acid distribution on high - affinity helices or classical coiled coils . in examining the distribution of amino acids in these structures , we found it largely consistent with the distribution on helices in general ( supporting information , figure s1 ) . though there is considerable selective pressure for coiled coil motifs to possess high proportions of aliphatic amino acids , especially leucine and isoleucine , for optimal knobs - into - holes packing arrangements , these residue types are not overwhelmingly enriched in the -helices that are part of dippdb . we also examined the distribution of hot spot residues on each family of helix dimers . a summary of these data is shown in figure 4 , and details for all three cases by residue types are included in the supporting information , figure s2 . aliphatic and charged residues are moderately enriched as hot spot residues , though generally consistent with the helical baseline . in contrast , polar residues were greatly depleted , and more so than the general helical case ; conversely , aromatic residues were more enriched in helical dimers . frequency of hot spot residues , normalized to natural abundance , in helix dimers and interfacial single helices , respectively . the plot shows distribution of aliphatic residues ( leu , ile , val ) , polar residues ( gln , asn , ser ) , aromatic residues ( phe , trp , tyr ) , and charged residues ( arg , asp , glu , lys ) in the three contexts . separate from our analysis of amino acid composition in general , we examined the inter - helix contacts made by case 1/2 and case 3 helical dimers and conventional coiled coils ( figure 5a ) . helix dimers feature a larger proportion of interstrand contacts between polar residues than typical coiled coils . in the classical coiled coil motif , core polar mutations may be tolerated via changes in stoichiometry , local distortions in geometry , or an increased inner void volume . the presence of polar contacts at the interior of helical dimers emphasizes the importance of their specific interactions . the leucine zipper coiled coil ( figure 5b ) contains four paired aliphatic knob - into - hole packing interactions , which dominate the interaction . in the particular case 1 dimer example depicted in figure 5c , aliphatic packing interactions are limited and energetically insignificant ; one helix only possesses one aliphatic residue ( a threonine ) facing its partner over five entire turns ; in contrast , the nonpolar residues from the other helix pack into non - canonical holes . the case 3 dimer example ( figure 5d ) possesses energetically important nonpolar residues , but they are not organized into the classic interior groove of a coiled coil , and the phenylalanines are more than twice as energetically important as the leucines by g . visual inspection of these examples and others inspired us to quantify the degree to which the helical dimer forms non - canonical packing interactions . ( a ) amino acid composition of inter - helical contact residues in helix dimers as opposed to true coiled coils . ( b ) the packing of a classic leucine zipper , gcn4 , features an aliphatic a / d groove with each residue packing into a complementary hole . ( c ) this case 1 helical dimer from 1,2-hydroquinol dehydrogenase homodimer illustrates highly non - canonical packing interactions . ( d ) the orphan nuclear receptor nur77 contains an aliphatic core but lacks any heptad repeat structure and knob / hole packing orientation . we found the examples of non - canonical inner grooves compelling and performed a more comprehensive analysis to determine how non - canonical these motifs are as compared to the classical coiled coil . we employed woolfson s socket analysis to explore the dataset ( supporting information , figure s4 ) . the socket algorithm identifies knobs - into - holes packing of coiled coils to distinguish them from helix dimers . of the 262 case 1 dimers , only 24 dimers were identified as being coiled coils by socket ( 9.2% ) , of which 22 were antiparallel and 2 were parallel . an additional 17 dimers contained only one complementary knob - into - hole packing interaction . might have four such interactions per heptad ( two per partner ) . moreover , more than half of those 24 coiled coils identified were fewer than three heptads in length . this analysis implies that while helical dimers may occasionally exhibit packing characteristic of coiled coil motifs , they are too short to be stable on their own . 27/261 case 2 dimers contained significant coiled coil structure ( 10.3% ) and 21 contained one complementary interaction . of case 3 dimers , 133/919 were identified as coiled coils by socket ( 14.4% ) and an additional 50 contained a single knob - in - hole interaction . to follow up on the disparities in inner groove composition demonstrated in figure 5 , we specifically studied the frequency of hydrophilic inner grooves . we found hydrophilic inner groove residues quite common : each case averaged at least three , and 40% of complexes overall had at least four such residues . we profile two complexes whose interfacial g results almost exclusively ( > 90% ) from hydrophilic contacts in the supporting information , figure s5 . such features are uncommon in canonical coiled coils . polar residues may be found at the interior of inside - out coiled coil motifs found in membrane proteins , though there is debate regarding the extent of polarity on the inside . because the vast majority of the proteins in dippdb are cytosolic , including these unusual examples , we hypothesized that a similar environment may make this inside - out geometry possible : the helical dimer is surrounded by hydrophobic residues presented by the protein in which it is found and by its binding partner , serving an analogous role to membrane lipids . the networks of buried hydrogen bonds that may form at the interior of a coiled coil are well studied , although the partially polar interiors observed here present an extreme case . we obtained the set of hydrophilic contact residues in case 1 helical dimers . a total of 79.4% of hydrophilic contact residues were flanked by at least one nonpolar residue . buried polar residues averaged under 30% relative sasa ( supporting information , figure s6 ) . this degree of burial is highly destabilizing if hydrogen bonds are left buried but unsatisfied as a result , but it concomitantly increases the value of satisfied hydrogen bonds , contributing to the strength of these interfaces . overall , though it is possible to find recognizably canonical packing at the interior of helical dimers , the majority do not succumb to the same generalizations as the coiled coil motif . as discussed above , the knobs - into - holes packing of coiled coils distinguishes them from helical dimers . because the two helices of a case 3 helical dimers come from different chains , we were able to compare knob hole packing interactions to the g of the knob residue by identifying the nearest three - residue hole on the partner helix ( i , i+1 , i+4 or i , i+3 , i+4 ) to each knob . we restricted this analysis to the inner groove of each helix and furthermore recomputed the knob g values on complexes only including the dimer helices so as to omit any interactions with other components of the protein . though the packing is not conventional enough to identify the dimers as coiled coils by socket , we anticipated that we would still be able to identify some trends . in contrast to the classical knobs - into - holes aliphatic model , residues of all types could form inner - groove contacts of considerable g . instead , we found the key feature , tightly correlated to g , was that knob residues made contact with chemically complementary holes . although aliphatic contact residues of low to moderate g do frequently pack into polar holes and vice versa , every aliphatic and aromatic residue type had higher average g when packing in a mostly aliphatic or aromatic hole than in a mostly polar one ( supporting information , figure s7 ) . in the creation of this dataset , we made no stipulation about the relative position of these helix bundles in the protein(s ) in question . we conjectured that helix - turn - helix motifs , or helical hairpins , which are common sources of ideal antiparallel coiled coils , might be particularly prominent interface elements . of the 262 case 1 helical dimers , 81 are separated by two to eight nonhelical residues . this substantial proportion of helix - turn - helix motifs is encouraging , as it suggests that the tertiary structure present at the interface is largely governed by local forces that may be mimicked by a designed inhibitor . overall , there are 133 parallel and 129 antiparallel dimers ; thus , development of scaffolds appropriate for both motifs is critical . in contrast , of the 115 case 2 helical dimers in which both dimer helices come from the same chain , only 25 exhibit helix - turn - helix motifs . the possible interplay between interface tertiary structure geometry and the stoichiometry of formed complexes merits further study , as it suggests a difference in folding cooperativity . even though the n and c termini of parallel dimers on the same chain are distant , the majority of parallel dimers are connected by a small number of motifs . of the 133 parallel case 1 dimers , 55 are connected by a two to four residue loop , a strand whose length varies with that of the dimer , a single residue turn , a short 310 or -helix , followed by another short loop ( figure 7 ) . the second most prevalent motif includes 16 examples of a strand bracketed by two 45-residue loops . the two helices are linked by a loop - helix - loop in only four instances . five possess the loop - strand - turn - helix - loop linker , five are connected by a loop - helix - loop , eight have a loop - strand - loop , but 11 contain a loop - helix - loop - helix - loop - helix - loop . ( specific pdbs for each motif are listed in the supporting information . ) to our knowledge , this is the first effort to establish common protein folds connecting helices of defined orientation outside of canonical coiled coils . redesigned and optimized derivatives of these motifs particularly the loop - strand - turn - helix - loop motif , as it is by far the most common and the most structurally interesting may serve as miniprotein scaffolds . common antiparallel ( a ) and parallel ( b ) helical dimer motifs feature linkers of a simple turn , a loop - strand - helix - loop , a loop - strand - loop , and a loop - helix - loop . given the importance of salt bridge interactions holding coiled coils together , we investigated the distribution of charge across helix monomers in each case . in case 1 , the average helix dimer has helices with net charges of 1.19 and 1.05 , and 61% are net neutral or positive in total . in contrast , though case 2 features dimers with net charges per helix of 0.89 and 0.33 , and thus a higher average charge , 66% are net neutral or positive . case 3 dimers are 70% net neutral or positive and have net charges for each helix of 0.88 and 0.08 . these percentages suggest that the surface bound by such helical dimers may also be frequently negative or neutral . we calculated the surface charge on proteins bound by case 1 dimers to be 70% net neutral or negative , with an average net charge of 0.75 . case 2 dimers bind surfaces that are 80% net neutral or negative with an average net charge of 0.68 . case 3 dimers bind surfaces that are 68% neutral or negative with an average charge of 0.61 . the net positive charge in dimers is consistent with the higher number of positively charged protein helices in general . ( a ) interfaces mediated by case 1 and case 2 helical dimers possess diverse functions and are dominated by enzyme complexes . ( b ) t. brucei s udp - galactose 4-epimerase features a mutation in the active site relative to the human enzyme , potentially permitting specific targeting . galactose metabolism is essential to the parasite s ability to cause african sleeping sickness , a neglected tropical disease . the enzyme is active in dimeric and tetrameric forms ; the target monomer is shown as gray surface . ( c ) pcsk9 propeptide ( surface ) binds with high affinity to pcsk9 ( cartoon ) and inhibits its proteolytic activity . this enzyme is linked to atherosclerosis and cardiovascular disease . in both figures , the nearby active site from the dimer chain the interfaces collated in dippdb have the traits of prime targets for drug design . we categorized the functions of ppis as defined in the pdb ( figure 8a ) and observed that they are implicated in biological processes from enzymatic function to transcription to the immune response . we identified a total of 523 interactions ( cases 1 and 2 ) that would require a helix dimer mimetic or miniprotein for inhibition . case 3 dimers , in contrast , feature a pair of single helices interacting with each other across an interface ; thus , mimics of a single helix can disrupt these interactions . intracellular ppis dominate the dataset ; thus , inhibition of these complexes will require development of synthetic analogues that can permeate the cell membrane . some of these newly identified targets will potentially aid efforts in drug discovery . in particular , it is interesting to note that the largest category , various enzymes , accounts for 63% of dipp interactions . this category contains many hydrolases , oxidoreductases , and transferases , among other enzymes . although enzyme function has typically been controlled using substrate or transition state analogues , helix dimers offer a potentially attractive alternative scaffold . figure 8b , c highlights two examples of interactions involving udp - galactose 4-epimerase and pcsk9 where helical dimers at dimeric interfaces in enzyme biological assemblies of considerable medical relevance bind near enzyme active sites . several targets in dippdb are critically relevant to cancer phenotypes . in particular , we explored classic cases leading to hallmarks of cancer and discovered a set of possible targets mediated by helical dimers . for example , three complexes mhf histone tetramer / fancm helicase ( pdb code 4e45 ) , mre11 nuclease / rad50 abc atpase ( pdb code 3qf7 ) , and the n- and c - terminal domains of the mms21 subunit of smc5 ( pdb code 3htk)have a role in dna repair . the interaction between epo and its receptor ( pdb code 1eer ) is implicated in the hypoxic response ; the complex between murine ifnar1 and interferon - beta ( pdb code 3wcy ) is implicated in the regulation of apoptosis , and the inhibition of the catalytic subunit p110 by the sh2 domain of the regulatory subunit p85 of phosphoinositide 3-kinase ( pdb code 2y3a ) is implicated in angiogenesis and invasive cell growth . in each case , mimicry of both helices is predicted to be essential to optimize binding affinity . beyond these targets , helical dimer interfaces include bacterial transcription and metabolism , quorum sensing , cell signaling , and more . a list of targets implicated in transcription is included in the supporting information , table s1 . we examined the 354 pdb structures that contain at least one case 1 or case 2 helical dimer and explored the gene ontology ( go ) terms annotating each complex . for example , two structures ( pdb codes 2p5 t and 1gvn ) were toxins annotated with nucleic acid binding transcription factor activity , and seven are implicated in organismal development ; two are involved in immune responses . we anticipate that these and more targets will become tractable for modulation by designed tertiary structure mimetics ; in figure 9 , we depict several interactions of particular pharmacological interest whose tertiary structure binding sites have not been drugged . these complexes , or the pathways they modulate , are known to be of therapeutic interest . we illustrate them here to highlight the importance of helix dimer domains in coaxing the formation of these complexes and the potential of dimer mimics as inhibitors . ( a ) lsd1-mediated nucleosome demethylation requires complexation with corest ; existing inhibitors of lsd1 bind its substrate pocket , and predicted binding sites have thus far omitted the helical dimer interface . ( b ) sam68 rna - binding protein is implicated in pro - oncogenic activity and modulates alternative splicing of cd44 and bcl - xl . ( c ) the kaposi s sarcoma protein vflip forms an a2b2 heterotetramer with nf - kappa - b essential modulator ( nemo ) coiled coil ; thus far , inhibition of this complex s function has only been achieved through geldanamycin inhibition of hsp90 . the aim of any systematic study of protein structures is both to uncover general principles governing protein geometry and to develop new insight into how to practically modulate protein function . topologically defined segments often mediate protein protein interactions , and mimicry of these regions has emerged as a successful strategy for inhibitor design . several examples of ppi inhibitors derived from mimicry of interfacial -helical and -strand domains have been described . emerging examples of tertiary mimetics as ppi inhibitors illustrate the broad potential of moving beyond secondary structure mimicry . we were motivated to analyze protein complexes featuring helical dimers to create a list of potential targets where mimics of a single helix may not be sufficient . modification of the protocol used to develop a database of interface helices ( hippdb ) provided a set of protein protein interactions where the critical binding residues reside on two helices oriented in parallel or antiparallel configurations . the dataset includes some helical dimers that would be classified as true coiled coils because of their heptad repeats and supercoiling as well as helical dimers that find other means of making contacts with each other . some helical dimers violate the typical expectations for coiled coil interiors and are held together largely by salt bridges and hydrogen bonds , while others violate expectations for typical protein interfaces , which contain mostly large , aliphatic hot spot residues . the length of dimers in contact with the protein partners spans one to three heptads , suggesting that medium - sized molecules or miniproteins will be able to disrupt these complexes . the online database provides a list of all entries in the dataset along with their pdb identifiers and the energetic contributions of the hot spot residues .

the modulation of protein protein interactions ( ppis ) by means of creating or stabilizing secondary structure conformations is a rapidly growing area of research . recent success in the inhibition of difficult ppis by secondary structure mimetics also points to potential limitations , because often , specific cases require tertiary structure mimetics . to streamline protein structure - based inhibitor design , we have previously described the examination of protein complexes in the protein data bank where -helices or -strands form critical contacts . here , we examined coiled coils and helix bundles that mediate complex formation to create a platform for the discovery of potential tertiary structure mimetics . though there has been extensive analysis of coiled coil motifs , the interactions between pre - formed coiled coils and globular proteins have not been systematically analyzed . this article identifies critical features of these helical interfaces with respect to coiled coil and other helical ppis . we expect the analysis to prove useful for the rational design of modulators of this fundamental class of protein assemblies .

Introduction Results and Discussion Conclusion

multidetector ct angiography examinations were performed with a 16-row mdct ( lightspeed ultra , ge healthcare , milwaukee , wi ) . patients were examined while in the supine position and all images were acquired during a single breath hold , extending from the base of the neck to the diaphragm . in adult patients , automatic tube current dose modulation was used . imaging parameters were as follows : tube voltage , 100 - 120 kv ; tube current , 140 - 300 ma , collimation , 16 1.25 mm ; slice thickness , 1.25 mm ; increment 0.6 mm ; table feed , 27.5 mm / sec ; rotation time , 0.5 sec . in pediatric patients , a body weight - based low - dose protocol ( 80 - 100 kv , 25 - 120 ma ) was used to further reduce radiation exposure . a tube voltage of 80 kv was used for patients weighing less than 50 kg and 100 kv was used for patients weighing more than 50 kg . a tube current of 25 mas was used for patients weighing less than 15 kg . a tube current of 30 mas was used for patients weighing between 15 and 24 kg . a tube current of 45 mas was used for patients weighing between 25 and 34 kg . a tube current of 75 mas was used for patients weighing between 35 and 44 kg . a tube current of 100 mas was used for patients weighing between 45 and 54 kg and a tube current of 120 mas was used for patients weighing more than 54 kg . imaging data was acquired after an intravenous injection of 1.5 - 2 ml / kg iodinated contrast agent ( iodixanol , 320 mgi / ml visipaque , ge healthcare ) at a rate of 3 - 4 ml / sec . the scanning delay was determined with the use of a bolus tracking technique . the examination was initiated 4 seconds after the attenuation of a region of interest positioned in the ascending aorta reached 150 hounsfield units ( hu ) . for three - dimensional image reconstruction , the raw mdct data was processed on a separate workstation ( advanced workstation 4.2 , ge healthcare ) with multiplanar reformatting ( mpr ) , maximum intensity projection ( mip ) , minimum intensity projection ( minip ) and volume rendering ( vr ) . mip and vr techniques were used mainly for evaluation of cardiovascular structures , the minip technique was used to evaluate the tracheobronchial air column and the mpr technique was used to evaluate both cardiovascular structures and the status of tracheal or esophageal compression . according to edward 's hypothetical double aortic arch system in which there is an aortic arch and a ductus arteriosus on each side , the right carotid and subclavian arteries arise from the right arch and the left carotid , and subclavian arteries originate from the left arch . . the normal arch system results from interruption of the dorsal segment of the right arch between the right subclavian artery and descending aorta , with regression of the right ductus arteriosus ( 4 ) ( fig . congenital anomalies of the aortic arch include the following . the left aortic arch ( laa ) with an aberrant right subclavian artery ( arsa ) , the right aortic arch ( raa ) with an aberrant left subclavian artery ( alsa ) , the raa with mirror image branching , the raa with isolation of the left subclavian artery ( lsa ) , the double aortic arch , the cervical aortic arch ( caa ) and the interrupted aortic arch ( iaa ) . an arsa originating from normal left sided aortic arch is the most common aortic arch anomaly , with an incidence of 0.5 - 2% ( 5 ) . this anomaly results from interruption of the dorsal segment of the right arch between the right carotid artery and right subclavian artery with regression of the right ductus arteriosus in the developing double aortic arch ( 4 ) ( fig . the right carotid artery arises as the first branch directly from the aortic arch , which is followed by the left carotid artery , left subclavian arteries and arsa ( fig . the arsa arises from the descending aorta as a last branch and crosses the mediastinum from left to right , passing behind the esophagus and trachea ( figs . 3 , 4 ) . an aortic diverticulum , also known as kommerell 's diverticulum , may be present at the origin of this vessel and has been reported in up to 60% of cases , representing the remnant of the distal raa ( 6 ) ( fig . an arsa is generally asymptomatic and has been diagnosed incidentally , but about 10% of adults with this anomaly have symptoms of dysphagia due to extrinsic compression of the esophagus due to its retroesophageal course ( fig . rarely , with failure regression of the right ductus , a loose vascular ring may be formed by the laa with an arsa , right pulmonary artery and right ductus arteriosus ( 1 ) . such an aneurysm may or may not be associated with kommerell 's diverticulum , and is believed to be the result of atherosclerotic disease ( 6 ) ( fig . this anomaly is isolated , but may be associated with other cardiovascular anomalies , principally with coarctation of the aorta ( fig . 6 ) , a patent ductus arteriosus , intracardiac defects , anomalous pulmonary artery circulation and carotid or vertebral artery anomalies ( 5 , 7 ) ( fig . 7 ) . the raa is a relatively common anomaly , occurring in approximately 0.05% of the population ( 5 ) . raas have been classified into three types according to the branching pattern of the arch vessels : an raa with an alsa , an raa with mirror image branching and an raa with isolation of the lsa . this anomaly results from interruption of the dorsal segment of the left arch between the left common carotid and left subclavian arteries with regression of the right ductus arteriosus in the hypothetical double aortic arch ( 4 ) ( fig . is the left carotid artery , which is followed by the right carotid artery , right subclavian arteries and alsa in order ( fig . an alsa may arise from a remnant of the left dorsal aortic root ( kommerell 's diverticulum ) ( 4 ) ( figs . this anomaly rarely produces symptoms and is usually an incidental radiological finding . rarely , a right arch with an alsa forms a complete vascular ring , left pulmonary artery and left ductus arteriosus . symptoms of esophageal compression may develop in older individuals with ectasia , tortuosity or an aneurysm of the alsa ( 1 ) ( figs . respiratory symptoms due to tracheal compression may be present in pediatric patients ( 8) . this anomaly is rarely associated with other cardiovascular abnormalities ( 5 ) . an raa with mirror image branching is uncommon , but not rare ( 5 ) . this anomaly results from interruption of the dorsal segment of the left arch between the lsa and the descending aorta , with regression of the right ductus arteriosus in the hypothetical double aortic arch ( fig . the left innominate artery is the first branch arising from the arch , which is followed by the right carotid artery and right subclavian arteries ( fig . this anomaly is usually associated with cyanotic congenital heart disease , especially tetralogy of fallot and truncus arteriosus ( 9 ) . this anomaly results from interruption of the left arch at two levels , with one level between the left common carotid and left subclavian arteries and the other level distal to the attachment of the left ductus ( fig . the left carotid artery arises as the first branch of the right arch , followed by the right carotid artery and right subclavian arteries . the lsa does not have a connection with the aorta , but is connected to the pulmonary artery by a left ductus arteriosus rarely , the anomaly is associated with congenital heart disease , especially tetralogy of fallot ( 10 ) . in a double aortic arch the left or anterior arch has a course similar to that of the normal laa , and the right or posterior arch has a course to the left behind the esophagus and joins the left arch . the right and left arches may be symmetric , but usually the right arch is larger , extends more cephalad and is more posterior than the left arch ( fig . clinically , the onset and severity of symptoms of esophageal and tracheal obstruction are variable and depend on the tightness of the ring . most patients present with stridor , recurrent respiratory infections or dysphagia within the first six months of life . occasionally , the ring is so loose that is discovered incidentally in asymptomatic adults ( 1 , 8) . a caa is an uncommon congenital anomaly with a prevalence of less than 0.01% , in which the aortic arch is situated cervically above the clavicle ( fig . though this condition is often an isolated anomaly , in some cases it may be associated with other cardiac and aortic abnormalities . a caa is associated with an aneurysm , more often left sided , in 20% of cases ( 11 ) . an iaa is rare congenital anomaly and is characterized by the separation between the ascending and descending aorta , and is differentiated from severe coarctation and aortic atresia by the absence of any structural connection between the ascending and descending aorta . an iaa is classified based on the site of interruption relative to the brachiocephalic arteries : type a occurs distal to the lsa , type b occurs between the lsa and the left carotid artery and type c occurs between the left carotid artery and the innominate artery . each of these three types is further subdivided as follows : subtype 1 , a normal subclavian artery ; subtype 2 , an aberrant subclavian artery ; subtype 3 , an isolated subclavian artery that arises from the ipsilateral pulmonary artery by way of the ductus arteriosus . an iaa is associated with additional cardiovascular anatomic defects in up to 98% of cases ( 12 , 13 ) . in conclusion , aortic arch anomalies may be associated with other developmental cardiovascular defects and may cause symptomatic esophageal or tracheal compression . mdct is able to display the detailed anatomy of the vascular structures and their spatial relationships to adjacent organs . this ability , combined with the availability of various post - processing options such as vr , mip and mpr that are applicable to all structures in the scanned volume , give mdct a significant advantage in comparison to the use of other imaging modalities in the evaluation of aortic arch anomalies . according to edward 's hypothetical double aortic arch system in which there is an aortic arch and a ductus arteriosus on each side , the right carotid and subclavian arteries arise from the right arch and the left carotid , and subclavian arteries originate from the left arch . interruption of this arch system at different locations can explain the various aortic arch anomalies . the normal arch system results from interruption of the dorsal segment of the right arch between the right subclavian artery and descending aorta , with regression of the right ductus arteriosus ( 4 ) ( fig . congenital anomalies of the aortic arch include the following . the left aortic arch ( laa ) with an aberrant right subclavian artery ( arsa ) , the right aortic arch ( raa ) with an aberrant left subclavian artery ( alsa ) , the raa with mirror image branching , the raa with isolation of the left subclavian artery ( lsa ) , the double aortic arch , the cervical aortic arch ( caa ) and the interrupted aortic arch ( iaa ) . an arsa originating from normal left sided aortic arch is the most common aortic arch anomaly , with an incidence of 0.5 - 2% ( 5 ) . this anomaly results from interruption of the dorsal segment of the right arch between the right carotid artery and right subclavian artery with regression of the right ductus arteriosus in the developing double aortic arch ( 4 ) ( fig . the right carotid artery arises as the first branch directly from the aortic arch , which is followed by the left carotid artery , left subclavian arteries and arsa ( fig . the arsa arises from the descending aorta as a last branch and crosses the mediastinum from left to right , passing behind the esophagus and trachea ( figs . 3 , 4 ) . an aortic diverticulum , also known as kommerell 's diverticulum , may be present at the origin of this vessel and has been reported in up to 60% of cases , representing the remnant of the distal raa ( 6 ) ( fig . an arsa is generally asymptomatic and has been diagnosed incidentally , but about 10% of adults with this anomaly have symptoms of dysphagia due to extrinsic compression of the esophagus due to its retroesophageal course ( fig . rarely , with failure regression of the right ductus , a loose vascular ring may be formed by the laa with an arsa , right pulmonary artery and right ductus arteriosus ( 1 ) . such an aneurysm may or may not be associated with kommerell 's diverticulum , and is believed to be the result of atherosclerotic disease ( 6 ) ( fig . this anomaly is isolated , but may be associated with other cardiovascular anomalies , principally with coarctation of the aorta ( fig . 6 ) , a patent ductus arteriosus , intracardiac defects , anomalous pulmonary artery circulation and carotid or vertebral artery anomalies ( 5 , 7 ) ( fig . the raa is a relatively common anomaly , occurring in approximately 0.05% of the population ( 5 ) . raas have been classified into three types according to the branching pattern of the arch vessels : an raa with an alsa , an raa with mirror image branching and an raa with isolation of the lsa . this anomaly results from interruption of the dorsal segment of the left arch between the left common carotid and left subclavian arteries with regression of the right ductus arteriosus in the hypothetical double aortic arch ( 4 ) ( fig . 8) . in this anomaly , the first branch arising from the aortic arch is the left carotid artery , which is followed by the right carotid artery , right subclavian arteries and alsa in order ( fig . an alsa may arise from a remnant of the left dorsal aortic root ( kommerell 's diverticulum ) ( 4 ) ( figs . this anomaly rarely produces symptoms and is usually an incidental radiological finding . rarely , a right arch with an alsa forms a complete vascular ring , left pulmonary artery and left ductus arteriosus . symptoms of esophageal compression may develop in older individuals with ectasia , tortuosity or an aneurysm of the alsa ( 1 ) ( figs . 10 , 11 ) . respiratory symptoms due to tracheal compression may be present in pediatric patients ( 8) . this anomaly is rarely associated with other cardiovascular abnormalities ( 5 ) . an raa with mirror image branching is uncommon , but not rare ( 5 ) . this anomaly results from interruption of the dorsal segment of the left arch between the lsa and the descending aorta , with regression of the right ductus arteriosus in the hypothetical double aortic arch ( fig . the left innominate artery is the first branch arising from the arch , which is followed by the right carotid artery and right subclavian arteries ( fig . this anomaly is usually associated with cyanotic congenital heart disease , especially tetralogy of fallot and truncus arteriosus ( 9 ) . this anomaly results from interruption of the left arch at two levels , with one level between the left common carotid and left subclavian arteries and the other level distal to the attachment of the left ductus ( fig . the left carotid artery arises as the first branch of the right arch , followed by the right carotid artery and right subclavian arteries . the lsa does not have a connection with the aorta , but is connected to the pulmonary artery by a left ductus arteriosus . rarely , the anomaly is associated with congenital heart disease , especially tetralogy of fallot ( 10 ) . the left or anterior arch has a course similar to that of the normal laa , and the right or posterior arch has a course to the left behind the esophagus and joins the left arch . the right and left arches may be symmetric , but usually the right arch is larger , extends more cephalad and is more posterior than the left arch ( fig . 15 ) . clinically , the onset and severity of symptoms of esophageal and tracheal obstruction are variable and depend on the tightness of the ring . most patients present with stridor , recurrent respiratory infections or dysphagia within the first six months of life . occasionally , the ring is so loose that is discovered incidentally in asymptomatic adults ( 1 , 8) . a caa is an uncommon congenital anomaly with a prevalence of less than 0.01% , in which the aortic arch is situated cervically above the clavicle ( fig . though this condition is often an isolated anomaly , in some cases it may be associated with other cardiac and aortic abnormalities . a caa is associated with an aneurysm , more often left sided , in 20% of cases ( 11 ) . an iaa is rare congenital anomaly and is characterized by the separation between the ascending and descending aorta , and is differentiated from severe coarctation and aortic atresia by the absence of any structural connection between the ascending and descending aorta . an iaa is classified based on the site of interruption relative to the brachiocephalic arteries : type a occurs distal to the lsa , type b occurs between the lsa and the left carotid artery and type c occurs between the left carotid artery and the innominate artery . each of these three types is further subdivided as follows : subtype 1 , a normal subclavian artery ; subtype 2 , an aberrant subclavian artery ; subtype 3 , an isolated subclavian artery that arises from the ipsilateral pulmonary artery by way of the ductus arteriosus . an iaa is associated with additional cardiovascular anatomic defects in up to 98% of cases ( 12 , 13 ) . in conclusion , aortic arch anomalies may be associated with other developmental cardiovascular defects and may cause symptomatic esophageal or tracheal compression . mdct is able to display the detailed anatomy of the vascular structures and their spatial relationships to adjacent organs . this ability , combined with the availability of various post - processing options such as vr , mip and mpr that are applicable to all structures in the scanned volume , give mdct a significant advantage in comparison to the use of other imaging modalities in the evaluation of aortic arch anomalies .

congenital anomalies of the aortic arch have clinical importance , as the anomalies may be associated with vascular rings or other congenital cardiovascular diseases . multidetector computed tomography ( mdct ) angiography enables one to display the detailed anatomy of vascular structures and the spatial relationships with adjacent organs ; this ability is the greatest advantage of the use of mdct angiography in comparison to other imaging modalities in the evaluation of the congenital anomalies of the aortic arch . in this review article , we illustrate 16-slice mdct angiography appearances of congenital anomalies of the aortic arch .

Multidetector CT Scanning Technique Embryology Left Aortic Arch with an Aberrant Right Subclavian Artery Right Aortic Arch Double Aortic Arch Cervical Aortic Arch Interrupted Aortic Arch

symptoms of cardiac involvement of tumor result from the location and impingement on adjacent structures . conduction disturbances due to several kinds of cardiac tumor such as primary rhabdomyosarcoma,1 ) malignant melanoma with cardiac metastasis,2 ) cardiac hemangioma3 ) and metastatic adenocarcinoma of lung4 ) were reported previously . mesotheliomas of the atrio - ventricular ( av ) node also cause heart block and sudden death.5 ) however , cardiac involvement of leiomyosarcoma is very rare . a 54-year - old man was referred to our electrophysiology laboratory because of dizziness and dyspnea . he was diagnosed with leiomyosarcoma of the right lower leg and received wide excision at another hospital 5 years ago . recently , the patient was in good physical condition for 2 years and no abnormal findings were detected on the surface electrocardiography ( ecg ) 2 years prior . however , the current ecg revealed complete av block and idioventricular escaped rhythm of bifascicular block morphology suggesting infrahisian block ( fig . the patient underwent cardiac magnetic resonance imaging , which revealed huge interventricular mass ( 6735 mm ) from base to apex with low signal intensity , similar to the myocardium on the t1-weighted image ( fig . 2a ) and mild higher signal intensity , as compared with the myocardium on the t2-weighted image ( fig . trans - thoracic echocardiography revealed normal left ventricular ejection fraction ( lvef 60% ) and no hemodynamic compromise . dual chamber permanent pacemaker was implanted on the second day of admission and we placed a right ventricular ( rv ) lead toward free wall of rv apex that was confirmed by fluoroscopy and echocardiography because of tumor invasion in the septum of rv apex . there were no procedure - related complications , however , ventricular tachycardia ( vt ) developed 3 days later . twelve - lead ecg showed wide qrs complex tachycardia , left bundle branch block pattern with left superior axis morphology and late transition , which is compatible with vt from rv apex ( fig . 3 ) . administered amiodarone and - blocker suppressed further events of vt and the patient was discharged uneventfully . he received pazopanib for palliative chemotherapy , which was stopped due to hepatic toxicity and poor performance status . the patient passed away after 3 months of pacemaker implantation due to progression of underlying disease and multiple organ failure . there are only a few sporadic case reports of arrhythmic presentation in patients with cardiac involvement of leiomyosarcoma . atrial fibrillation due to metastasis to pulmonary vein and left atrium,6 ) ectopic atrial tachycardia with right atrial leiomyosarcoma7 ) and vt due to local tumor growth in the right ventricular outflow tract8 ) were reported previously . this was the first case report of a large metastatic mass of leiomyosarcoma located on the entire interventricular septum causing complete av block . furthermore , there are no previous reports of cardiac involvement of tumor that caused both bradyarrhythmia and tachyarrhythmia . the patient was treated with implantation of permanent pacemaker for the management of complete av block and anti - arrhythmic drug suppressed vt successfully . pacemaker mediated tachycardia or pacemaker - induced vt was considered because of subsequent development of vt after pacemaker implantation without prior history of vt . however , 12-lead qrs morphology of vt was different from that of paced ventricular rhythm ( fig . 4 ) and apical septum of rv due to tumor invasion was suspected as the origin . pacemaker interrogation excluded pacing - induced vt or pacemaker - mediated tachycardia ( fig . 5 ) . there was no histopathological diagnosis of cardiac lesion , however , we diagnosed the mass as a malignant metastasis because of the simultaneous similar pattern of widespread metastatic lung lesions with prior histopathologic confirmation of metastatic malignant leiomyosarcoma . complete surgical resection of cardiac mass was not feasible because of infiltrative growth in the entire interventricular septum . pacemaker implantation and anti - arrhythmic medications were started for symptomatic relief . upgrade to implantable cardioverter defibrillator ( icd ) was considered regarding underlying structural substrate for vt . however , vt was well controlled with anti - arrhythmic drug and overall mean survival time in patients with metastasizing soft tissue sarcoma is approximately only 10 months despite therapy.9 ) thus , upgrade to icd was not performed and our patient passed away 3 month later due to disease progression cardiac metastasis should be considered when the patient with previously known leiomyosarcoma complains of cardiac symptom . clinicians should be aware that both bradyarrhythmia and tachyarrhythmia could develop in patients with cardiac metastasis of malignant leiomyosarcoma .

we described a case of a 54-year - old male who presented with dizziness and dyspnea due to cardiac metastasis of leiomyosarcoma . cardiac metastasis of leiomyosarcoma caused both bradyarrhythmia and tachyarrhythmia in the patient . he was treated with implantation of a permanent pacemaker for management of complete atrio - ventricular block and anti - arrhythmic drug that suppressed ventricular tachycardia successfully .

Introduction Case Discussion

gestational diabetes mellitus ( gdm ) is defined as any degree of glucose intolerance that occurred or is diagnosed for the first time during pregnancy . gdm is still a great problem for the mother and fetus and even in the best conditions , the risk of fetal malformations and mortality is 25 times higher than normal pregnancy . women with untreated gestational diabetes have a greater risk of developing some fetal , neonatal , and maternal outcomes . congenital anomalies , macrosomia , hypoglycemia , respiratory distress syndrome , hypocalcemia , and hyperbilirubinemia are the neonatal consequences of this complication . the use of insulin is a standard treatment of gestational diabetes because of its high effectiveness ; also , it is believed that insulin does not cross the placental barrier because of its large molecular size . results from previous studies showed that anti - insulin antibody is produced in response to insulin transcription in pregnant women with gdm and insulin can cross the placenta as a part of the insulin - antibody complexes . this autoimmune response to exogenous insulin can affect fetal development . furthermore , insulin injection has disadvantages such as fear , anxiety , repeated injections , the need for education , skills in dose adjustment and injection , the risk of hypoglycemia , more weight gain in pregnant women , and high costs . several studies have investigated oral antidiabetic agents in the treatment of gestational diabetes and some of them used glibenclamide . however , it is the second generation sulfonylureas that are commonly used in the treatment of diabetes . as a result of similarity in the pathophysiology of gestational diabetes and type 2 diabetes , this drug was also considered in gdm . in vitro and clinical studies with very little placental transfer for this drug the mechanism that reduces the human placental transport of glibenclamide is unknown . a combination of extremely high protein binding and the results of a meta - analysis of research entitled safety of glyburide for gestational diabetes did not show any increase in perinatal complications . the results of a study showed that glibenclamide can be used as the first blood sugar ( bs ) controller in pregnancy . zeng et al . also suggested that glibenclamide is effective in the treatment of women with gestational diabetes . however , balsells et al . concluded that glibenclamide should be used as the last drug after insulin and metformin . studies on glibenclamide , in the treatment of gdm , showed different neonatal outcomes . according to research carried out by cheng et al . , the risk of macrosomia in newborns ( weighing more than 4 kg ) and admission to the neonatal intensive care unit ( nicu ) was higher in glibenclamide than the insulin group . the results of some other studies found no difference in the incidence of neonatal hypoglycemia , increased risk of macrosomia , admission to the nicu , or fetal anomalies . due to the importance of this topic and the conflicting research results , this study was conducted to compare the effect of glibenclamide and insulin on neonatal outcomes in gdm . in this clinical trial study , 258 pregnant women who were referred to the gynecology clinics of shabihkhani and shahid beheshti hospital of kashan for prenatal care were used as subjects . the criteria for selecting them included the following : 1845 years , 1133 weeks of gestation , absence of diabetes before pregnancy , singleton pregnancy , absence of known kidney , and hepatic , hematological , and/or cardiovascular disease . women who experienced premature rupture of membranes , severe bleeding , or one of the above - mentioned diseases during the study were excluded from the study . for all women with fbs higher than 92 , glucose tolerance test , fbs , and bs at 1 , 2 , and 3 h after drinking 100 g of glucose solution were requested . if two of these criteria ( bs > 95 , 1 h > 180 , 2 h > 155 , and 3 h > 140 ) were high , gdm was diagnosed . education for lifestyle change ( exercise and diet ) was performed for all the participants . after 1 week , fbs and postprandial glucose test were checked at 2 h after breakfast , lunch , and dinner . patients were hospitalized if fbs and bs , 2 h after meal were > 90 and > 120 , respectively . sample size was calculated based on the assumption that the hypoglycemia ratio in patients who received insulin and glibenclamide in a previous study were 0.08 and 0.20 , respectively , at 95% confidence and 80% power . figure 1 presents the flow diagram of patient recruitment , showing that 258 eligible patients were randomized into the glibenclamide group ( 129 patients ) and insulin group ( 129 patients ) . flow diagram of participants through each stage of the study in enrolled patients , at first , hba1c was measured and then treatment was started randomly . block randomization was done for assignment of 2 groups to treatments . in the insulin group , subcutaneously , twice per day 2/3 of the dose was prescribed in the morning and 1/3 in the evening ; morning insulin included 2/3 of normal pressure hydrocephalus ( nph ) and 1/3 regular , evening insulin included 1/2 nph and 1/2 regular that increased every 3 days if necessary ( 1 unit regular insulin or nph was added if bs increased by 10 mg / dl ) . in the glibenclamide group , 1.25 mg of oral glibenclamide was administered once daily and increased from 1.25 to 2.5 mg every 3 days to the maximum of 20 mg / day if needed . bs was assessed 4 times / day ( fasting , 2 h after breakfast , 2 h after lunch , and 2 h after dinner ) . the purpose of treatment was to reduce fasting plasma glucose levels to < 90 as well as decrease 2 h postprandial glucose to < 120 mg / dl . insulin therapy was started if bs was not normal after 2 weeks of taking the highest dose of glibenclamide . fbs and bs 2 h after meal were assessed every 2 weeks in all eligible women and the dose of medication was adjusted . neonatal outcomes included apgar scores , macrosomia ( birth weight > 4000 g ) , hypoglycemia ( blood glucose < 40 mg / dl ) , hypocalcemia ( calcium < 7 mg / dl in the first 3 days after birth ) , hyperbilirubinemia ( bilirubin > 12 mg / dl in the first 7 days after birth ) , fetal anomalies , respiratory distress , and neonatal unit hospitalization were recorded . the bilirubin and serum calcium of the infants were measured using a machine in shahid beheshti hospital laboratory . birth weight was assessed using standard scales of seca brand ; a glucometer was used to check the bs of newborns every 30 min during the first 3 h after birth . all newborns were examined immediately after birth for respiratory distress ( need for respiratory support at least 4 h during the first 24 h after birth ) , major and minor anomalies , and admission to the nicu . furthermore , all infants were checked for jaundice within 1 week after birth . the questionnaire and checklist the differences of quantitative , normally distributed data in two groups were assessed by independent t - test ( body mass index [ bmi ] , age , and gestational age at the point of entry into the study ) . for data that were not normally distributed , the mann - whitney u - test statistics were used ( gestational age at delivery , hba1c , fbs after treatment , and bs 2 h after meal ) . chi - square or fisher exact test was used for qualitative data to compare the two groups . to determine the factors related to macrosomia , the independent sample t - test ( age , bmi , and parity ) , mann - whitney u - test ( hba1c , fbs , gestational age at delivery , and bs 2 h after meal ) and chi - square test ( sex of newborn and type of treatment ) were used as a univariate analysis . thereafter , multivariate analysis was performed using logistic regression to assess predictor factors of macrosomia . the variables were entered in regression logistic models if their p < 0.25 in univariate analysis ( fbs , gestational age at delivery , and type of treatment ) and backward modeling was performed . this study was approved by the ethics committee of kashan university of medical sciences on 08.26.2013 by the code 2062/1/5/29 . the aim of the study , the benefits , effectiveness , and possible side effects of two treatment methods were explained by the researchers before the trial began and written consent was obtained from all the patients . this study is registered in the iranian registry of clinical trials ( irct ) as trial number : irct2013102315045n2 . in this clinical trial study , 258 pregnant women who were referred to the gynecology clinics of shabihkhani and shahid beheshti hospital of kashan for prenatal care were used as subjects . the criteria for selecting them included the following : 1845 years , 1133 weeks of gestation , absence of diabetes before pregnancy , singleton pregnancy , absence of known kidney , and hepatic , hematological , and/or cardiovascular disease . women who experienced premature rupture of membranes , severe bleeding , or one of the above - mentioned diseases during the study were excluded from the study . for all women with fbs higher than 92 , glucose tolerance test , fbs , and bs at 1 , 2 , and 3 h after drinking 100 g of glucose solution were requested . if two of these criteria ( bs > 95 , 1 h > 180 , 2 h > 155 , and 3 h > 140 ) were high , gdm was diagnosed . education for lifestyle change ( exercise and diet ) was performed for all the participants . after 1 week , fbs and postprandial glucose test were checked at 2 h after breakfast , lunch , and dinner . patients were hospitalized if fbs and bs , 2 h after meal were > 90 and > 120 , respectively . sample size was calculated based on the assumption that the hypoglycemia ratio in patients who received insulin and glibenclamide in a previous study were 0.08 and 0.20 , respectively , at 95% confidence and 80% power . figure 1 presents the flow diagram of patient recruitment , showing that 258 eligible patients were randomized into the glibenclamide group ( 129 patients ) and insulin group ( 129 patients ) . in enrolled patients , at first , hba1c was measured and then treatment was started randomly . block randomization was done for assignment of 2 groups to treatments . in the insulin group , subcutaneously , twice per day 2/3 of the dose was prescribed in the morning and 1/3 in the evening ; morning insulin included 2/3 of normal pressure hydrocephalus ( nph ) and 1/3 regular , evening insulin included 1/2 nph and 1/2 regular that increased every 3 days if necessary ( 1 unit regular insulin or nph was added if bs increased by 10 mg / dl ) . in the glibenclamide group , 1.25 mg of oral glibenclamide was administered once daily and increased from 1.25 to 2.5 mg every 3 days to the maximum of 20 mg / day if needed . bs was assessed 4 times / day ( fasting , 2 h after breakfast , 2 h after lunch , and 2 h after dinner ) . the purpose of treatment was to reduce fasting plasma glucose levels to < 90 as well as decrease 2 h postprandial glucose to < 120 mg / dl . insulin therapy was started if bs was not normal after 2 weeks of taking the highest dose of glibenclamide . fbs and bs 2 h after meal were assessed every 2 weeks in all eligible women and the dose of medication was adjusted . neonatal outcomes included apgar scores , macrosomia ( birth weight > 4000 g ) , hypoglycemia ( blood glucose < 40 mg / dl ) , hypocalcemia ( calcium < 7 mg / dl in the first 3 days after birth ) , hyperbilirubinemia ( bilirubin > 12 mg / dl in the first 7 days after birth ) , fetal anomalies , respiratory distress , and neonatal unit hospitalization were recorded . the bilirubin and serum calcium of the infants were measured using a machine in shahid beheshti hospital laboratory . birth weight was assessed using standard scales of seca brand ; a glucometer was used to check the bs of newborns every 30 min during the first 3 h after birth . all newborns were examined immediately after birth for respiratory distress ( need for respiratory support at least 4 h during the first 24 h after birth ) , major and minor anomalies , and admission to the nicu . the questionnaire and checklist were completed by examining the subjects and observation of their laboratory tests . data were analyzed using spss version 16.0 ( spss inc . , chicago , il , usa ) . the kolmogorov the differences of quantitative , normally distributed data in two groups were assessed by independent t - test ( body mass index [ bmi ] , age , and gestational age at the point of entry into the study ) . for data that were not normally distributed , the mann - whitney u - test statistics were used ( gestational age at delivery , hba1c , fbs after treatment , and bs 2 h after meal ) . chi - square or fisher exact test was used for qualitative data to compare the two groups . to determine the factors related to macrosomia , the independent sample t - test ( age , bmi , and parity ) , mann - whitney u - test ( hba1c , fbs , gestational age at delivery , and bs 2 h after meal ) and chi - square test ( sex of newborn and type of treatment ) were used as a univariate analysis . thereafter , multivariate analysis was performed using logistic regression to assess predictor factors of macrosomia . the variables were entered in regression logistic models if their p < 0.25 in univariate analysis ( fbs , gestational age at delivery , and type of treatment ) and backward modeling was performed . this study was approved by the ethics committee of kashan university of medical sciences on 08.26.2013 by the code 2062/1/5/29 . the aim of the study , the benefits , effectiveness , and possible side effects of two treatment methods were explained by the researchers before the trial began and written consent was obtained from all the patients . this study is registered in the iranian registry of clinical trials ( irct ) as trial number : irct2013102315045n2 . a total of 258 pregnant women were studied in the insulin group ( 129 ) and glibenclamide group ( 129 ) . in the glibenclamide group , 9 the findings of this table showed no significant difference between the two groups in age , bmi , and gestational age [ table 1 ] . baseline patient characteristics in glibenclamide and insulin groups table 2 shows neonatal outcomes in the insulin and glibenclamide groups . the findings showed no significant difference in apgar score , hypoglycemia , hypocalcemia , fetal distress , hyperbilirubinemia , anomaly , and nicu admission between the two groups . fetal macrosomia in the insulin group was higher than the glibenclamide group ( p = 0.005 ) ( odds ratio : 0.227 , confidence interval : 0.0740.696 ) . the mean weights of infants in the insulin and glibenclamide groups were 3700.77 329.18 and 3433.29 344.61 g , respectively . independent t - test showed a significant difference in birth weight between two groups ( p = 0.001 ) . in this study , 50.4% of infants in the insulin group and 46.7% in the glibenclamide group were male . comparison of neonatal outcomes of glibenclamide and insulin groups the findings in table 2 showed that the prevalence of macrosomia was different in the two groups , and univariate analysis was performed based on the predictor factors of macrosomia . findings showed that gestational age at delivery ( p = 0.01 ) and types of treatment were associated with macrosomia ( p = 0.005 ) [ table 3 ] . univariate analysis based on predictor factors of macrosomia multivariate analysis was performed using logistic regression to assess predictor factors of macrosomia . the variables were entered in regression logistic models if their p < 0.25 in univariate analysis ( fbs , gestational age at delivery , and type of treatment ) . logistics test results showed that the type of treatment and gestational age at delivery were predictor factors of macrosomia ; such that a one unit increase in gestational age at delivery was associated with a 1.35-fold increase in macrosomia . in addition , a one unit increase in the use of insulin was associated with a 4.5-fold increase in macrosomia [ table 4 ] . in this study , neonatal outcomes were examined in glibenclamide and insulin therapy in gdm . the result indicated that the neonatal hypoglycemia was less in the glibenclamide group than insulin , but there was no statistically significant difference between the two groups . this finding was similar to the results of gilson and murphy other studies reported a higher incidence of neonatal hypoglycemia in the glibenclamide group when compared with the insulin group , but the difference between the groups was not significant . in a retrospective study by ramos et al . this difference may be related to the level of glycemic control in patients in the various studies . the results of this study showed that the incidence of macrosomia in the glibenclamide group was significantly less than the group receiving insulin ( p = 0.005 ) . in some studies , no significant difference was observed between insulin and glibenclamide groups in the prevalence of macrosomia . balsells et al . in a meta - analysis study showed that glibenclamide was associated with a higher birth weight and macrosomia . in another study , macrosomia risk ( weighing more than 4 kg ) was higher in the glibenclamide group than the insulin group . in this study , glycemic control was desirable with glibenclamide dose modification . since uncontrolled diabetes can lead to fetal macrosomia , perhaps the higher rate of macrosomia was due to higher bs levels in cheng 's study as compared to the current study . findings of this study showed that there was no statistically significant difference between the two groups in the prevalence of hypocalcemia , respiratory distress , and neonatal jaundice . two neonates in the insulin group had anomalies , one heart disease , and one polydactyly . treatment was started after organogenesis , when gestational age had reached 12 weeks or more . therefore , it may be that the incidence of abnormalities has been related with the type of treatment . ramos et al . reported greater incidence of congenital anomalies in patients treated with glibenclamide than the insulin group . there were no neonatal anomalies in glibenclamide and insulin groups in zangeneh et al.s trial study . data in homko et al.s study indicated that risk of major congenital abnormalities may be related to maternal glycemic control before and during pregnancy . the results of the current study showed that nicu admission was more in the insulin group ( 8 vs. 4 ) . jacobson et al . reported higher nicu admission rates in the group receiving insulin as compared to the group treated with glibenclamide and this difference was significant ( p < 0.001 ) . in cheng et al.s study , nicu admission was more in infants of mothers taking glibenclamide than the group receiving insulin . in general , the findings of this study showed that using glibenclamide for the treatment of gestational diabetes does not have side effects on newborns . this was corroborated in the study carried out by elliott et al . in their study , they observed that very low levels of second - generation sulfonylureas could pass through the placenta . they also observed that glibenclamide had the lowest concentration in infants umbilical cord blood of diabetic mothers under treatment . the reason behind this observation was the strong tendency of the drug to bind to proteins ( it is reported as 99.9% ) and a very short half - life of 46 h. in another study carried out by kraemer et al . , to remove the binding effect of glibenclamide to proteins , they found that by removing albumin , blood levels of glibenclamide in umbilical cord still remained undetectable . they concluded that a specific pump actively pumps glibenclamide into the maternal blood against the direction of fetal blood concentration . this pump , with the two above - mentioned mechanisms , has made glibenclamide a suitable drug for the treatment of gestational diabetes with minimal transmission to the fetus . this study did not assess the amount of drugs used in each patient , length of nicu stay for infants , and the cause of hospitalization . it is recommended that future studies consider the effects of each dose of drug used in neonatal outcomes . this study did not assess the amount of drugs used in each patient , length of nicu stay for infants , and the cause of hospitalization . it is recommended that future studies consider the effects of each dose of drug used in neonatal outcomes . from the results and findings of this study , glibenclamide was able to reduce the risk of macrosomia without increasing anomalies , jaundice , neonatal hypocalcemia , respiratory distress , and admission to the nicu . therefore , glibenclamide can be an excellent alternative for insulin in the treatment of gdm .

background : untreated or poorly controlled gestational diabetes can cause serious complications for mother and newborn . glibenclamide is rarely used in treating mothers with this disease . this study aimed at comparing the effect of glibenclamide and insulin on neonatal outcomes in women with gestational diabetes mellitus.methods:in this randomized controlled clinical trial , 249 pregnant women aged 1845 years within the 11th33rd weeks of gestation with gestational diabetes , single fetus pregnancy , and in need of hyperglycemia treatment were entered and grouped randomly as either glibenclamide or insulin . in the insulin group ( n = 129 ) , insulin was administered with an initial dose of 0.2 iu / kg subcutaneously twice per day , whereas in the glibenclamide group ( n = 120 ) , 1.25 mg oral glibenclamide was administered once daily and increased if needed.results:the results showed no significant difference in means age , gestational age , and body mass index between women in the two groups . in addition , there were no significant differences in the frequency of neonatal hypoglycemia , anomaly , hyperbilirubinemia , admission in neonatal intensive care unit ( nicu ) , and neonatal respiratory distress between two groups . macrosomia was lower in the glibenclamide group than the insulin group ( 3.3% vs. 13.2% , respectively , p = 0.005 ) . regression logistics model results showed that the type of treatment ( odds ratio [ or ] : 4.62 ; confidence interval [ ci ] : 1.4514.02 ; p = 0.01 ) and gestational age at delivery ( or : 1.41 ; ci : 1.041.74 ; p = 0.01 ) were as predictor factors of macrosomia.conclusions:the results of this study revealed that glibenclamide is able to reduce the risk of fetal macrosomia without increasing neonatal anomalies , jaundice , hypocalcemia , infant respiratory distress , and nicu admission .

INTRODUCTION METHODS Study design and participants Intervention and variable assessment Statistical analyses Ethics RESULTS DISCUSSION Limitation and suggestions CONCLUSIONS Financial support and sponsorship Conflicts of interest

, brescia , italy ) is an innovative pre - analytical specimen collection device that is compatible with all diagnostic tests , from culture to molecular amplifications assays . the flocked swab contains short nylon fibre strands attached to molded plastic , with a hydrophilic layer of nylon pile that results in efficient collection and release of particulate matter . flocked swabs are produced in a variety of sizes and shapes and are used to collect specimens from premature babies to adults and have become the pre - analytical device of choice for the investigation of infectious diseases . in recent publications in the journal of clinical microbiology , endocervical flocked swabs were reported to enhance the analytical sensitivity of antigen detection , culture and nucleic acid amplification assays ( chernesky et al . , 2006 ) . in another research study , the nasopharyngeal flocked swab design yielded significantly more total respiratory epithelial cells and more infected respiratory epithelial cells . this two- to three - fold increase in cell yield with the flocked swabs has a greater effect on diagnostic sensitivity compared to traditional fibre swabs ( daley et al . , 2006 ) . flocked swabs are currently used worldwide in italy , europe , canada , us , south america , australia , japan , and china and have been validated with all the state of the art diagnostics and forensic investigations . in food safety , microbiological work surface controls play an important role in the monitoring of contamination from the environment ( kusumaningrum et al . , 2003 ; verran et al . , 2010 there is great interest and continued commitment of all the entities involved , food business operators , laboratories and companies producing laboratory principals , in order to guarantee greater security concerning the aspect of hygiene of work surfaces and its verification ( moore and griffith , 2002 ; ismail et al . , 2013 ) . in this context , the possibility of adopting a new type of collection device for the recovery of bacteria from food surfaces for environmental monitoring has been taken into account ( probst et al . , 2010 ; lahou and uyttendaele , 2014 ) . clinical data and previous studies have demonstrated flocked swab superiority over traditional collection devices ( dalmaso et al . , 2008 ) in terms of recovery and release . based on these studies , it was decided to verify the applicability of flocked swabs in the food industry for the recovery of bacteria from surfaces for environmental monitoring and detection of specific pathogens . in the microbiology laboratory of the institute for experimental veterinary medicine of lombardy and emilia romagna a study to compare two different types of swabs a floqswab ( copan italia s.pa ) and a traditional rayon tipped swab ( copan italia s.p.a . ) was conducted . the two type of swabs were evaluated for their capacity to recover and release an analyte ( microorganism ) in vitro . suspensions with three different loads equal to 10 colony forming unit ( cfu)/ml 10 and 10 cfu / ml were prepared from overnight culture of escherichia coli ( reference strain atcc 25922 ) . for each load different tubes containing 100 l of the suspension the two different swabs were put inside the tubes containing the different bacterial load suspensions in order to absorb the inocula within 10 sec . five replicates for both swabs were analysed for each load according to iso 4833 - 2:2013 cor 1:2014 ( iso , 2014 ) for total mesophilic count at 30c . the gold standard for the three different loads was also verified placing directly the suspensions onto nutrient agar plates and incubating them at the appropriate conditions . after incubation for 72 h , plates were counted and results recorded . in the second experiment ( figure 1 ) , the two swabs were evaluated for their capacity to recover a bacterial load from contaminated surfaces . two different surface materials stainless steel ( ss ) and polypropylene ( pp ) were cleaned either by autoclaving ( ss ) or disinfectant ( quaternary ammonium compounds ) , and let air dry under a laminar flow for 2 h. suspensions with three different bacterial loads equal to 10 , 10 , and 10 cfu / ml were prepared from overnight culture of e. coli ( reference strain atcc 25922 ) . the testing surfaces were contaminated by dispensing 1 ml of different e. coli suspensions distributed on an approximate 1010 cm area using a sterile spreader in order to obtain approximately 10 , 10 , 10 cfu / cm . the contaminated surfaces were let air dry for 2 h and then sampled in parallel area with the two swabs , according to iso 18593:2004 ( iso , 2004 ; figure 1 ) . four replicates side by side of both swabs were analysed for each load both for the ss and the pp surface , according to iso 4833 - 2:2013 cor 1:2014 ( iso , 2014 ) for total mesophilic count at 30c . after the incubation time plates were counted and the results were recorded . the difference between means value were detected by the t - test and evaluations were based on a confidence interval of 95% . e. coli counts recorded using the floqswab were expressed as mean of the replicates , and the values resulted as 4.6010 cfu / ml for the lower , 4.1210 cfu / ml for the middle , and 3.1410 cfu / ml for the higher load . analysis for floqswab results , in comparison with the gold standard values , showed a recovery rate of 128% for the lower , 76% for the middle , and 112% for the higher load of the original concentration of microorganism used in the trial . e. coli counts recorded using a traditional rayon tipped swab were 1.9410 cfu / ml for the lower , 2.8410 cfu / ml for the middle , and 1.1910 cfu / ml for the higher load . analysis for the traditional rayon tipped swab results , in comparison with the gold standard values , showed a recovery rate of 54% for the lower , 53% for the middle , and 42% for the higher load of the original concentration of microorganism used in the trial ( table 1 ) . differences observed in means of values for the three different loads were statistically significant ( p<0.05 ) . e. coli counts recorded using the floqswab to recover the bacterial load from ss surfaces ( expressed as mean of the replicates for each bacterial load ) were 9.00 cfu / cm for the lower , 8.9510 cfu / cm for the middle , and 3.1810 cfu / cm for the higher load . using the floqswab and considering the original inoculum concentration used to contaminate the surface , the recovery rates were 9% for the lower , 9% for the middle , and 32% for the higher load ( figure 2 ) . on the surface using the traditional rayon tipped swab , e. coli counts expressed as mean of the replicates for each bacterial load were 1.00 , 4.0910 , and 4.4510 cfu / cm . with the traditional rayon tipped swab and considering the original inoculum concentration , the recovery rates were 1% for the lower , 1% for the middle , and 4% for the higher load . differences observed in means of value for the three different loads were statistically significant ( p<0.05 ) . for the pp surfaces , e. coli counts recorded using the floqswab and expressed as means of the replicates for each bacterial load , were 1.3010 cfu / cm for the lower , 2.1310 cfu / cm for the middle , and 2.0810 cfu / cm for the higher load . the floqswab and the original inoculum concentration considered , the recovery rates were 13% for the lower , 21% for the middle , and 21% for the higher load ( figure 3 ) . on the same surface using the traditional rayon tipped swab , e. coli counts ( expressed as means of the replicates for each bacterial load ) were 7.00 , 1.1810 , and 8.4510 cfu / cm . in this case , the recovery rates were 7% for the lower , 12% for the middle , and 8% for the higher load . differences observed in means of value were statistically significant ( p<0.05 ) for lower and higher loads , while for the middle load there was no statistical difference ( p>0.05 ) . e. coli counts recorded using the floqswab were expressed as mean of the replicates , and the values resulted as 4.6010 cfu / ml for the lower , 4.1210 cfu / ml for the middle , and 3.1410 cfu / ml for the higher load . analysis for floqswab results , in comparison with the gold standard values , showed a recovery rate of 128% for the lower , 76% for the middle , and 112% for the higher load of the original concentration of microorganism used in the trial . e. coli counts recorded using a traditional rayon tipped swab were 1.9410 cfu / ml for the lower , 2.8410 cfu / ml for the middle , and 1.1910 cfu / ml for the higher load . analysis for the traditional rayon tipped swab results , in comparison with the gold standard values , showed a recovery rate of 54% for the lower , 53% for the middle , and 42% for the higher load of the original concentration of microorganism used in the trial ( table 1 ) . differences observed in means of values for the three different loads were statistically significant ( p<0.05 ) . e. coli counts recorded using the floqswab to recover the bacterial load from ss surfaces ( expressed as mean of the replicates for each bacterial load ) were 9.00 cfu / cm for the lower , 8.9510 cfu / cm for the middle , and 3.1810 cfu / cm for the higher load . using the floqswab and considering the original inoculum concentration used to contaminate the surface , the recovery rates were 9% for the lower , 9% for the middle , and 32% for the higher load ( figure 2 ) . on the surface using the traditional rayon tipped swab , e. coli counts expressed as mean of the replicates for each bacterial load were 1.00 , 4.0910 , and 4.4510 cfu / cm . with the traditional rayon tipped swab and considering the original inoculum concentration , the recovery rates were 1% for the lower , 1% for the middle , and 4% for the higher load . differences observed in means of value for the three different loads were statistically significant ( p<0.05 ) . for the pp surfaces , e. coli counts recorded using the floqswab and expressed as means of the replicates for each bacterial load , were 1.3010 cfu / cm for the lower , 2.1310 cfu / cm for the middle , and 2.0810 cfu / cm for the higher load . the floqswab and the original inoculum concentration considered , the recovery rates were 13% for the lower , 21% for the middle , and 21% for the higher load ( figure 3 ) . on the same surface using the traditional rayon tipped swab , e. coli counts ( expressed as means of the replicates for each bacterial load ) were 7.00 , 1.1810 , and 8.4510 cfu / cm . in this case , the recovery rates were 7% for the lower , 12% for the middle , and 8% for the higher load . differences observed in means of value were statistically significant ( p<0.05 ) for lower and higher loads , while for the middle load there was no statistical difference ( p>0.05 ) . in the first experiment , floqswab adsorbed the analyte and then released it , applying a routine analytical protocol , in an amount comparable to what recovered in the gold standard analyses for all the three loads considered . regarding the lower bacterial load result , the fact that the floqswab recovered more than the original concentration has to be addressed to variables and errors that can be produced , and to the uncertainty inherent in microbiological counts . instead , the traditional rayon tipped swab showed a lower recovery rate . indeed , only 50% of microorganisms were recovered comparing to gold standards values . in the second experiment , the floqswab showed a better performance also when used as a collection tool as per iso 18593:2004 ( iso , 2004 ) from the two different surface materials tested . in particular , on the ss surface the recovery was more consistent especially at high bacterial load , compared to the traditional rayon tipped swab . in general , 1 log recovery improvement was recorded . on the pp surface the results were always better for the floqswab than the traditional rayon tipped swab , even if the differences in the percentage of recovery were lower . in food safety , microbiological work surface controls play a fundamental role in the prevention of contamination from the environment . the sampling techniques usually applied underrate the level of contamination of different surfaces that are in contact with food during food process . this could give food business operators false information about the level of cleanliness of processing environments . the floqswab was proposed as an improvement in collecting environmental hygiene controls , seem to be encouraging . indeed , this kind of swab , both in vitro and in experimental surface sampling tests , demonstrated to be more efficient compared to a traditional rayon tipped swab , which has been the state of the art so far and has been also suggested by the iso 18593:2004 ( iso , 2004 ) to be widely used in the food industries . the use of swabs for the environmental sampling was discouraged in the past due to the poor recovery and then for the risk of an erroneous or underestimated result . the introduction of the floqswab allows the operator to reintroduce the use of swab as a sampling tool for all the difficult - to - reach areas to be monitored for hygiene assessment . based on these preliminary results , it was decided to verify the applicability of the flocked swab , even with other laboratory confirmatory tests , directly in the food industry . companies should be mainly implicated in dairy and meat - derived production , and the recovery of bacteria should be done from a wider variety of surfaces ( wood , ss , pp or other plastic and ceramic surfaces ) for the sake of environmental monitoring and research of specific pathogens commonly involved in food poisoning event , like salmonella spp . and listeria monocytogenes .

the floqswab is a specimen collection device worldwide recognised for its superior performance in the clinical diagnostics . the aim of this work was to evaluate floqswab for the recovery of microbiological samples from surfaces compared to the traditional swab ( rayon tipped swab ) as per iso 18593:2004 standard . the floqswab , thanks to its innovative manufacturing technology , allows improving the efficiency of recovery and release of analyte . the study has been divided into two experiments . in the first experiment the two swabs were evaluated for their capacity to recover and release the analyte ( three different bacterial loads of escherichia coli ) . in the second experiment , the two swabs were evaluated for their capacity to recover three different bacterial loads of e. coli from two different surface materials ( stainless steel and polypropylene ) . in all experiments the flocked swab demonstrated a higher recovery rate compared to the traditional rayon tipped swab . the data obtained from this preliminary study demonstrated that the floqswab could be a good food surfaces collection device , which improves the recovery of the analyte and thus produces accurate results . based on the outcomes of the study , a larger field study is in progress using the floqswab for samples collection to improve both environmental monitoring and the efficacy of the hygiene controls for food safety .

Introduction Materials and Methods Results Experiment 1 Experiment 2 Discussion Conclusions

the esr and efsumb have issued a joint statement about the necessity of a formal report for all ultrasonographic examinations as well as proper archiving of both reports and images within hospital information technology ( it ) systems . both societies agreed on the importance of availability of us images and reports in clinical practice and agreed on a formal recommendation to their members on this topic . availability of reports and images of all us examinations is important in clinical practice as a record of patient status at the time of the studies and as a point of references for future studies , with either us or other imaging modalities . both esr and efsumb consider it good clinical practice to provide accurate and retrievable recordings of all ultrasonographic examinations . both esr and efsumb recommend to their members to organise workflow in ultrasonography so that proper archiving of both images and reports of all studies can be regularly obtained . ultrasonography is a diagnostic technique used in many clinical applications and by different specialists during their practice . us images are not always routinely saved in the hospital pacs systems and , within the same hospital , the reports of the us examinations are often recorded in a variety of archives . however , the availability of us images and reports is important in clinical practice as a record of both in- and out - patients status at the time of the examination and as a point of reference for future studies , with either us or other imaging modalities . availability of us images , videos and reports substantially improves the quality of services provided to patients . although it is recognised that : it may be difficult to find resources to link all us equipment to the it hospital system and to provide enough memory to store large amounts of data , especially if video clips have to be recorded;there may be problems in planning a uniform and complete storage of the examination reports since us can be used in a large variety of ways , from a stand - alone study to a simple and quick guide to a procedure or a physical exam;both esr and efsumb consider it good clinical practice to provide accurate and retrievable recordings of all us examinations . it may be difficult to find resources to link all us equipment to the it hospital system and to provide enough memory to store large amounts of data , especially if video clips have to be recorded ; there may be problems in planning a uniform and complete storage of the examination reports since us can be used in a large variety of ways , from a stand - alone study to a simple and quick guide to a procedure or a physical exam ; both societies recommend to their members to organise workflow in us so that proper archiving of images , videos and reports of all studies can be regularly obtained .

backgroundthe esr and efsumb have issued a joint statement about the necessity of a formal report for all ultrasonographic examinations as well as proper archiving of both reports and images within hospital information technology ( it ) systems . both societies agreed on the importance of availability of us images and reports in clinical practice and agreed on a formal recommendation to their members on this topic.main messages availability of reports and images of all us examinations is important in clinical practice as a record of patient status at the time of the studies and as a point of references for future studies , with either us or other imaging modalities. both esr and efsumb consider it good clinical practice to provide accurate and retrievable recordings of all ultrasonographic examinations. both esr and efsumb recommend to their members to organise workflow in ultrasonography so that proper archiving of both images and reports of all studies can be regularly obtained .

Background None Recommendation

a 65-year - old man with no medical history was transferred from another hospital because of pain in the right side of chin and ear . he complained of frequent paroxysms of severe stabbing pain in the right side of his mandible radiating to the right ear . his pain either occurred spontaneously or was triggered by chewing and tooth brushing and lasted few seconds in each pain attack . the patient was diagnosed as tn at another hospital and was prescribed carbamazepine ( 200 mg a day ) with only partial relief of the pain . he had a pain - free period for about 1 month before visiting our clinic and stopped medication on his own decision . in the last few days prior to the admission , his condition had got worse in terms of increase of frequency and severity of pain . neurological and nasopharyngeal assessments were normal findings . computed tomography of the neck and magnetic resonance imaging ( mri ) of the brain revealed also normal . his pain paroxysms had occurred four or five times daily with 100 of visual analogue scale ( vas , 0 is no pain and 100 is imaginary the worst pain ) at the first visit . he underwent mandibular nerve block with alcohol after the test block with 1% of mepivacaine . he still complained of right ear pain even though right v3 innervated area was anesthetized and pain free after the v3 alcohol block . ten minutes after the procedure , paroxysmal pain in right ear developed and he experienced faintness and got loss of consciousness with convulsive movement for about 1 minute . he was consulted with a neurologist to exclude seizure disorders . brain mri was not able to be performed due to convulsive movement during the pain attack . his echocardiogram was normal , however , bradycardia followed by asystole during pain attacks was revealed in the continuous electrocardiography . according to a careful asking about the pain characters following the v3 block with alcohol , he presented that his pain occurred in the soft palate , uvula and throat and was triggered by swallowing or mechanical stimulation of the right side of the pharynx . bradycardia and asystole accompanied with sometimes seizure - like activity occurred always with pain attack . based on his altered pain characters and cardiac symptoms with no specific etiology originated from heart , carbamazepine ( 100 mg twice a day ) was started for control of pain as well as asystole . regardless of increasing dose of carbamazepine up to 400 mg a day , severe bradycarida , asystole and syncope preceded by paroxysmal pain continued four to five times in one hour . a temporary cardiac pacemaker was implanted via left subclavian vein by a cardiologist to prevent cerebral ischemia during asystole . although syncope and seizure - like activity disappeared after the insertion of a temporary pacemaker , intensity or frequency of pain in the throat and ear was unchanged . carbamazepine increased up to 600 mg a day to reach pain control for 4 days after the implantation of temporary cardiac pacemaker . on the 5 day of hospitalization , he underwent implantation of a permanent pacemaker to prevent bradycardia and asystole by a cardiologist . he was achieved pain free and no cardiac symptoms after the implantation of permanent pacemaker with daily 600 mg of carbamazepine and has maintained symptom free condition for 4 months of follow - up . gpn is an uncommon form of facial pain ( 0.2 to 1.3% of the facial pain ) that occurs approximately one hundred times less frequently than tn . it was first described by weisenberg in 1910 in a patient with tumor affecting cerebellopontine angle . the other secondary causes of gpn are following ; cerebellopontine angle tumor , carcinoma of the laryngeal and nasopharyngeal tumors , parapharyngeal abscess , multiple sclerosis , trauma , direct carotid puncture , paget 's disease , calcified sylohyoid ligament , and chiari i malformation . pain characters are almost similar to tn , however , pain originates in the ear , posterior pharynx , tonsillar area and base of the tongue innervated by glossopharyngeal nerve . even though majority of gpn patients report that swallowing is a prominent trigger factor , some of tn patients also have it as a pain - provocating factor . because of the similar pain characters between gpn and tn , especially in the v3 division , it could be misdiagnosis gpn as tn . concurrent ipsilateral tn and gpn is rare , representing 10.0% to 46.7% of gpn cases but only 0.3% to 0.5% of tn cases . the pain is triggered by pharyngeal movement such as coughing , gargling and swallowing , especially cold liquids , as well as by touching in the above mentioned zones . while in tn , the pain is confined to the face , and is triggered by facial movement , such as chewing and speaking . in our patient he visited our clinic with known tn and presented tn symptom at the first visit , however , he could express the gpn component of pain when tn component of pain disappeared after the v3 alcohol block . the association between gpn and syncope is very rare phenomenon and could be life - threatening . it was reported that 217 patients diagnosed for gpn and only 4 were found having associated syncope postulating mechanism is originated from the idea of a close connection between the glossopharyngeal and vagus nerves with circulatory system . it has been suggested that intense afferent impulses from the sensory fibers of the glossopharyngeal nerve may stimulate the dorsal motor nucleus of the vagus nerve either by way of central collateral pathways or through an " artificial synapse " along the peripheral course of the glossopharyngeal nerve as it travels with the nerve of hering . in neuralgia pain condition like gpn , extremely severe pain could activate the vagoglossopharyngeal reflex resulting in bradycardia , hypotension and syncope . the basic goal of treatment of gpn with cardiac manifestations should be focused on control of the pain , which could be a main cause of bradycardia and syncope . first choice of medical treatment is carbamazepine and other medical trial is gabapentin although theoretically any membrane stabilizer could be used . the problem with using carbamazepine is the possibility of tachyphyaxis due to need of long - term use . in our case carbamazepine was effective at a moderate dosage ( 600 mg / day ) in abolishing paroxysmal pain . although percutaneous radiofrequency thermocoagulation through oval foramen has been tried , it carries the risk of injury to the whole vagus nerve . kondo reported that immediate complete relief was achieved in 67 to 79% of patients , and partial relief in 10 to 25% of patients obtained , while long - term complete relief was obtained in 58 to 76% and partial relief in 15 to 18% of patients . however , manipulation of lower cranial nerves can be associated with morbidity ; dysphagia , hoarseness , facial paresis , hearing disturbance associated 7th , 8th , 9th and 10th caranial nerve disturbances , and cerebrospinal fluid leakage . a temporary pacemaker should be used for emergency management of syncopal attacks caused by bradycardia and asystole originated from gpn like our patient until plasma concentration of carbamazepine reaches the therapeutic range . a temporary transvenous cardiac pacemaker implantation was described first by khero and mullins in 1971 to treat the reflex cardiac syncope while waiting for surgical section of the nerve . regarding permanent pacemaker implantation , the available literatures are quite controversial , because spontaneous recovery in gpn is not uncommon and relapses may occur . however , once severe bradycardia and asystole relapse again in unexpected time , the patient might be at risk of a fatal outcome . it should be individualized to determine to implant a permanent pacemaker in patients with gpn associated with neurocardiogenic syncope . in our case , a permanent pacemaker underwent to prevent heart and brain damage with the reasons of that every pain attack leaded to asystole and relatively old patient 's age . in conclusion , a temporary pacemaker combined with medical treatment should consider as an initial treatment modality in patients with gpn associated with asystole and syncope . furthermore , if the disorder is longstanding and severe , a permanent pacemaker combined with medical treatment could be a safe treatment option .

glossopharyneal neuralgia ( gpn ) is generally considered to be a pain disease . however , it can be also be a life - threatening cardiac cause of syncope . neuralgia in the throat and neck can trigger severe bradycardia up to the point of asystole , which can progress to cardiac syncope with or without seizures . a 65 year - old male patient diagnosed with glossopharyngeal neuralgia complained of severe paroxysmal pain in his right chin and ear followed by bradycardia , aystole and syncope . we report a case successfully treated with a permanent pacemaker and carbamazepine in a patient with gpn who had syncopal attacks preceded by paroxysms of pain .

CASE REPORT DISCUSSION

fungal keratitis ( fk ) is an ulcerative and sight - threatening infection of the cornea that sometimes leads to blindness . although patients with fk have been treated with antifungal drugs that prevent the progression of corneal pathogenesis , further study is still needed . the objectives of this study were to investigate the effect of atra - nlc on the zymosan - induced expression of the cytokines il-4 , il-10 , ifn- , mmps / timps , and tlr2 . zymosan , a -glucan component of the yeast cell wall , is a ligand of tlr2 and dectin-1 which stimulates macrophages to produce proinflammatory mediators . specifically , the levels of mmp-8 , mmp-9 , mmp-13 , and timp-1 increase during the early stages of c. albicans keratitis , and the ratio of mmps / timps is higher in the fk corneas . corneal polymorphonuclear neutrophils ( pmns ) that infiltrate the cornea of patients with fk increase the activities of mmp-8 and mmp-9 , thereby enhancing tissue destruction . therefore , this study was to determine the association between the mmp / timp and zymosan - induced inflammation to clarify the role of mmp / timp in the pathology of fk and then to study the potential role of new therapeutic method . il-4 and il-10 play a role in protective immunity against infections with extracellular parasites and are responsible for inflammatory diseases . ifn- is secreted by activated th1 and other immune cells , and it creates proinflammatory microenvironments . zymosan - induced production of the cytokines il-4 , il-10 , and ifn- by rcfs was examined in this study . nuclear receptors are ligand - activated transcription factors that signal the expression of the genome . understanding the expression of receptors and their activating lipid ligands in immune diseases will be crucial for the development of new therapies to target nuclear receptors . atra is a bioactive derivative of vitamin a that has demonstrated immunomodulatory effects in many immune disorders . atra is a crucial immunostimulatory cofactor that activates macrophages and their subsequent differentiation into dendritic - like cells . moreover , atra exerts an anti - inflammatory effect on monocytes via tlr2/1 and cd14 expression [ 10 , 11 ] . thus , atra may be a novel strategy to treat inflammation in humans , but it is poorly soluble , which hinders its ocular delivery . in this study , we designed nlcs to overcome these barriers , which led to poor bioavailability . because atra exhibits anti - inflammatory activity , we investigated the effect of atra - nlcs on the zymosan - induced expression of tlr2 , il-4 , il-10 , and ifn- , as well as the function of mmp / timp in rcfs . dispersant , collagenase , eagle 's minimum essential medium ( mem ) , dulbecco 's phosphate - buffered saline ( dpbs ) , fetal bovine serum ( fbs ) , ( sigma ) , atra ( sigma aldrich ) , whales wax palm , soybean oil ( aladdin reagent company ) , lecithin ( shanghai huishi biochemicals company ) , dibutylhydroxytoluene ( chemically pure , sinopharm group chemical reagent company ) , oleic acid ( chemically pure , recovery of tianjin institute of fine chemicals ) , and poly - yamanashi ester , 80 ( east china reagent factory in tianjin ) were used . the following antibodies were used : mmp-1 and mmp-3 and timp-1 ( rd ) , mmp-13 ( biovision ) , timp-2 and tlr2 ( boster ) , and gapdh ( cell signal ) . anti - mouse igg - hrp ( abcam ) and goat anti - rabbit igg - hrp ( rd ) were used . trizol reagent ( invitrogen ) lightcycler 480 real - time pcr system ( roche diagnostics gmbh ) and primer were synthesized by sangon biotech co. ltd . the following equipment was used : a df-101s hot - type constant temperature heating magnetic stirrer ( shanghai yukang science and education equipment co. ) , an ultrasonic cell crusher ( ningbo xingzhi biotechnology co. ) , a high - performance liquid chromatograph ( agilent ) , a zf - i ultraviolet analyzer ( shanghai gucun electro - optical instrument company ) , a particle size analyzer ( brookhaven instruments ) , and an electronic universal oven ( beijing everlasting light medical instrument company ) . atra - nlc was prepared by emulsification according to the process shown in figure 1 . new england white rabbits ( 2.0 to 2.5 kg ) were obtained from the animal department of jilin university . this study adhered to the arvo statement for the use of animals in ophthalmic and vision research and was approved by the animal experimental committee of jilin university . rcfs were isolated as follows : briefly , the enucleated eye was washed with dpbs containing an antibiotic - antimycotic mixture ; the endothelial layers and the epithelial sheets of the excised corneas were removed , and the remaining corneal tissue was cultured with collagenase ( 2 mg / ml , in mem ) at 37c . rcfs ( 30000 cells / ml ) were cultured in 24-well plates for 24 h with mem alone . serum - free rcfs were incubated with or without atra - nlc in the presence or absence of zymosan for 24 h. the il-4 , il-10 , and ifn- concentrations were then examined with a cytokine assay . p < 0.01 versus the corresponding value for cells cultured with zymosan ( dunnett t3 ) . rcfs were cultured in 60 mm dishes for 24 h with mem alone . serum - free rcfs were incubated with atra - nlcs for 1 hour and then for an additional 4 hours in the presence or absence of zymosan . total rna was isolated from rcfs in 60 mm culture dishes with the use of trizol reagent and was subjected to rt . the resulting cdna was subjected to real - time polymerase chain reaction ( pcr ) analysis with specific primers for il-4 , il-10 , and ifn- or glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) by the use of a lightcycler 480 real - time pcr system . the sequences of the pcr primers were designed by the literature previously : the primers for il-4 were gtttccctgctttgagatgg ( forward ) and tcaggaaacagcttcggagt ( reverse ) , the primers for il-10 were tttaggcgagaagctgaagg ( forward ) and tcttcacagggcaggaatct ( reverse ) , the primers for ifn- were tgaacatgatggatcgttgg ( forward ) and cattcactttgctggcagtg ( reverse ) , and the primers for gapdh were aactttggcattgtggaagga ( forward ) and aacatcatccctgcttccac ( reverse ) . immunoblot analyses of mmp-1 , mmp-3 , mmp-13 , timp-1 , timp-2 , and tlr2 were also performed as described previously . in brief , cells ( 5 10 cells per well of a 24-well plate ) were cultured for 24 h in mem and then incubated for 12 h with or without 0.010.1 mol / l atra - nlcs , followed by 30 min with or without zymosan ( 500 g / ml ) . the cell lysates ( 30 g of protein ) were collected , and then the cell lysates were subjected to immunoblot analyses . atra - nlcs were light - resistant and physically stable , and they exhibited an average size of 200 nm . precipitation and crystallization were not observed when the atra - nlcs were stored for one month at 4c . the effects of atra - nlc at various concentrations ( 0 , 0.01 , and 0.1 mol / ml ) on the release of il-4 , il-10 , and ifn- induced by zymosan from rcfs were investigated first ( figures 2(a ) , 2(b ) , and 2(c ) ) . further , quantitative rt - pcr analysis revealed that atra - nlc increased the amounts of il-4 and il-10 mrnas in rcfs induced by zymosan , and the amount of ifn- was inhibited in a dose - dependent manner ( figures 2(a ) , 2(b ) , 2(c ) , 2(d ) , 2(e ) , and 2(f ) ) . mol / l ) for 24 h , followed by incubation with zymosan ( 500 g / ml ) for 30 min . the immunoblot analysis showed that the levels of mmp-1 , mmp-3 , and mmp-13 and timp-1 and timp-2 tlr2 were increased by stimulation with zymosan , and this increase was inhibited by atra - nlcs ( figure 3 ) . natamycin 5% suspension , voriconazole , and topical amphotericin - b 0.015% constitute routine antifungal therapy for fk . however , existing methods can not meet the demands of clinical treatment , and new drugs are necessary . new antifungal therapies commonly target ergosterol , an essential constituent of fungal membranes that are not reluctant to microbial resistance and are minimally toxic to mammalian cells . we have shown that atra - nlcs inhibited the zymosan - induced expression of the cytokines ifn- , mmps / timps , and tlr2 and increased the zymosan - induced expression of the cytokines il-4 and il-10 by rcfs . the immune dominance of th1 ( ifn- and il-2 ) may be characteristic of many immune - inflammation pathogeneses . the th1 response was maintained after infection because ifn- production is based mainly on cd4 t cells . th1 cells are involved in all forms of dry eye , which is characterized by an inflammatory pathophysiology . il-4 administration may inhibit the inflammatory response and the infiltration of phenotypic macrophages to suppress tnf--induced osteocyte apoptosis . il-4 and moreover , zymosan induces the expression of pro- and anti - inflammatory factors and tregs . specifically , zymosan increases the levels of il-4 , il-10 , and foxp3-positive t cells . atra can also inhibit the expression of th1-associated ( ifn- ) cytokines and increase the levels of th2-associated cytokines ( il-4 , il-5 , and il-13 ) in pbmcas and purified t cells . atra promotes the expression of th2 cytokines rather than th1 cytokines , as observed in many cell lines . in this study , atra - nlcs increased zymosan - induced il-4 and il-10 expression and inhibited zymosan - induced ifn- expression in a dose - dependent manner by cytokine release assay and rt - pcr detection , which means that atra - nlcs can decrease fungi - associated corneal inflammation molecular expression . zymosan - induced mmp-9 expression at the single - cell level during peritonitis is a quantitative indicator of the phase - specific contribution of mast cells , macrophages , and neutrophils . this study investigated the effects of atra on zymosan - induced inflammation in corneal fibroblasts , including the regulation of matrix metalloproteinases ( mmps)/tissue inhibitor of metalloproteinase ( timp ) . previous studies have demonstrated that vitamin a and carotenoids regulate immune function in lymphocytes and splenocytes and that the carotenoid lutein regulates matrix metalloproteinase-9 ( mmp-9 ) production in macrophages . atra also inhibited tgf--induced collagen gel contraction mediated by human corneal fibroblasts by attenuating the production of mmp-1 and mmp-3 . atra downregulated mmp expression to exert an antimetastatic effect , induce differentiation and apoptosis , and inhibit proliferation and inflammation . atra may inhibit mmp expression in different diseases and act as a strong anti - inflammatory agent [ 18 , 24 ] . the data show that atra - nlcs can inhibit the zymosan - induced expression of mmp-1 , mmp-3 , and mmp-13 and timps in corneal fibroblasts . this effect may be attributed to an imbalance in the expression of proteolytic enzymes and their inhibitors , as described previously . in brief , timp-1 and timp-2 are produced and related to mmp-1 and mmp-9 in the context of corneal injury . the ratio of mmp / timp controls inflammation and is an indicator of tissue damage . atra - nlcs can attenuate mmp / timp expression and thus could potentially inhibit fk pathology process . tlr2 , a regulatory element in the innate immunity of corneal keratocytes , rapidly and transiently induces inflammatory mediators . antagonists of tlr2 may favor the inhibition of signaling responsible for autoimmune responses [ 27 , 28 ] . our data show that atra - nlcs inhibited the production of inflammatory mediators , that is , mmps , induced by the tlr2 ligand zymosan , and served as an inhibiting feedback regulator of tlr2 stimulation . the pharmacokinetics of potentially therapeutic peptides for the ocular surface , including the residence time of peptides at the cornea , their ability to penetrate the cornea , and the stability of the peptides , has been described . many studies have attempted to improve the efficacy of therapeutic peptides by improving the residence time . the low bioavailability and poor therapeutic response of traditional ophthalmic formulations is due to a reduced precorneal residence time of the formulation at the ocular surface . specifically , nlcs carrying drugs were more effective than the free drugs were because they increased the drug bioavailability . atra is highly lipophilic and poorly soluble in water , and nlcs were able to prolong the release of atra . atra - nlcs in this study showed light resistance , proper size , and good physical stability . the results of this study suggest that atra negatively regulates the expression of mmps , timps , tlr2 , and ifn- and positively regulates il-4 and il-10 expression . moreover , atra - nlcs play major roles as anti - inflammatory agents in the context of infection via the factors described herein . thus , atra may be useful as an anti - inflammatory agent in the treatment of fk .

purpose . the study aimed to evaluate the effect of all - trans retinoic acid - loaded nanostructured lipid carriers ( atra - nlcs ) on the zymosan - induced expression of the cytokines il-4 , il-10 , and ifn- and the matrix metalloproteinases / tissue inhibitor of metalloproteinases ( mmps / timps ) and tlr2 in rabbit corneal fibroblasts ( rcfs ) . methods . atra - nlcs were prepared by emulsification . rcfs were isolated and harvested after four to seven passages in monolayer culture . cytokine release ( il-4 , il-10 , and ifn- ) induced by zymosan was analyzed by cytokine release assay , reverse transcription , and real - time polymerase chain reaction ( rt - pcr ) analysis detection . mmp-1 , mmp-3 , and mmp-13 , timp-1 and timp-2 , and tlr2 expression were analyzed by immunoblotting . results . atra - nlcs were resistant to light and physically stable , and the average size of the atra - nlcs was 200 nm . atra - nlcs increased the zymosan - induced release of il-4 and il-10 and decreased the release of ifn- by rcfs . atra - nlcs decreased the levels of tlr2 and mmps / timps above . conclusions . atra may be a potent anti - inflammatory agent for the therapy of fungal keratitis ( fk ) .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Discussion

keratoconus is a progressive corneal ectatic disorder that may have a variable expression in early stages , with subtle signs and borderline abnormal features that are difficult to detect.13 corneal topography represented a true revolution in the diagnosis and management of corneal diseases like keratoconus as it could detect subtle changes on the anterior corneal surface prior to loss of corrected distance visual acuity and the development of typical slit - lamp microscopy findings.47 topography measurement by placido reflection , however , was limited exclusively to the anterior corneal surface . slit - imaging technology was an improvement in corneal imaging , as it could not only measure the anterior corneal surface but also the posterior surface , and was able to define the spatial relationship between the two , and to characterize corneal architecture in three dimensions . this reconstruction of the cornea provides more information , greatly enhancing the sensitivity and specificity for detecting ectasia . ambrsio and belin8 have previously proposed the term tomography to better reflect the three - dimensional characterization of the cornea instead of surface , ambrsio et al9 have previously reported on the use of pachymetric progression indices ( ppi ) and the concept of relational thickness in differentiating keratoconic and normal corneas compared with single - point thickness values . in particular , the study demonstrated that ambrsio relational thickness ( art ) parameters had the best receiver operating characteristics ( roc ) as a test , and art cutoffs for keratoconic eyes were determined . following the work of ambrsio et al8,9 few other studies have evaluated the findings in an asian population.10,11 the purpose of this study is thus to analyze the keratometric and pachymetric properties of keratoconic corneas of asian eyes with the scheimpflug imaging camera , and to study the usefulness of art and ppi in differentiating keratoconus from normal eyes . this study adhered to the tenets of the declaration of helsinki and was approved by the ethics committee of the singhealth centralised institutional review board . cases in the keratoconic group were selected from a prospective study on collagen cross - linking for keratoconus . inclusion criteria included visual acuity with contact lenses better than or equal to 6/12 ( 20/40 ) , good general health , and age of more than 18 years . patients with eyes that met the amsler - krumeich criteria12 for stage 1 keratoconus ( eccentric steepening , absence of any corneal scarring , myopia , and astigmatism < 5.00 d and mean keratometry < 48.0 d ) were included in this study . in patients with both eyes that met the inclusion criteria , one of the eyes was randomly selected for analysis . control cases were selected from a database of candidates for refractive surgery with normal corneas and myopia or myopic astigmatism . eyes were considered normal if they had no ocular pathology , no previous ocular surgery , and no irregular corneal pattern on corneal tomography . exclusion criteria included a history of corneal surgery , significant corneal scarring , and significant ophthalmic disease that may potentially affect the outcomes . all eyes had a comprehensive ocular examination as well as rotating scheimpflug corneal tomography ( pentacam ; oculus . patients that were using contact lenses were asked to discontinue use for at least 1 week before the topographic examination . during pentacam examination , subjects were positioned at the instrument with proper placement on the chin rest and forehead strap and asked to blink a few times before looking with both eyes at the fixation target . with proper alignment achieved , all participants underwent scanning according to a standardized protocol . only cases with acceptable - quality images the following anterior and posterior corneal surface parameters were evaluated with the pentacam : corneal keratometry power in the flattest meridian in the 3.0 mm central zone , corneal keratometry power in the steepest meridian in the 3.0 mm central zone , mean central keratometry in the 3.0 mm zone , and mean astigmatism in the 3.0 mm central zone . the minimum radius of corneal curvature was also measured . the central corneal thickness at the apex ( geometric center of the examination ) , central corneal thickness at the pupil center , and the minimum corneal thickness at the thinnest point were recorded . also , the vertical , horizontal , as well as the distances from the cornea apex to the point of the thinnest corneal location were determined . the pentacam calculates a ppi for every 1 meridian along the complete 360 , starting at the thinnest point . the average of all meridians and the ones with lowest and highest values are presented . the pachymetric index will be higher if the cornea gets thicker in a more accentuated pattern from the thinnest point out to the periphery . art was calculated by the following formulae : statistical analysis was performed using spss software ( version 11.0 ; spss inc . , whitney u - test ( wilcoxon rank sum test ) was used to compare each parameter between two groups . a p - value of less than 0.05 was considered statistically significant . roc curves13 were used to determine the overall predictive accuracy of the parameters when used as a test to identify eyes with keratoconus . the area under these curves14 ( auc ) measure discrimination ; that is , the ability of the test to correctly classify eyes with and without disease . an area of 1.0 represents a perfect test while an area of 0.5 represents a worthless test . the keratoconus group comprised 22 eyes , while the control group consisted of 48 eyes . the mean age of study subjects was 29.47.9 ( standard deviation [ sd ] ) years , while that of the control group was 31.09.2 ( sd ) years . racially , the study group was constituted of chinese ( 66.6% ) , malays ( 12.1% ) , indians ( 12.1% ) , and eurasians ( 9.0% ) . table 1 shows the mean tomographic , ppi , and art values in both groups . of note , while most tomographic readings did not show significant differences between the study and control groups , all ppi and art values indicated significant differences . cornea minimum radius of curvature , absolute distance from the corneal apex , as well as the distance from corneal apex in y - axis were also significantly different between study and control groups . the mean art values for the normal group were 404 and 563 m for art - max and art - avg , respectively . in the keratoconus group , the mean values were 241 and 352 m for art - max and art - avg , respectively . table 2 shows the mean art values of normal and keratoconic eyes in the present study , as well as the best cutoff values as reported by ambrsio et al9 for eyes with keratoconus and susceptibility for ectasia . table 3 shows the results of the roc curve analysis auc , 95% confidence intervals , and significance levels for each parameter tested in keratoconus and normal groups . in discriminating keratoconus from control eyes , ppi and art while the means of cornea minimum radius of curvature , absolute distance from the corneal apex , as well as the distance from corneal apex in y - axis were significantly different between the two groups , their lower aucs meant that using these parameters to test for keratoconus would result in poor diagnostic performances . mcneil method,14 are shown in table 4 . of note , no statistically significant difference was found between the art and ppi indices . table 1 shows the mean tomographic , ppi , and art values in both groups . of note , while most tomographic readings did not show significant differences between the study and control groups , all ppi and art values indicated significant differences . cornea minimum radius of curvature , absolute distance from the corneal apex , as well as the distance from corneal apex in y - axis were also significantly different between study and control groups . the mean art values for the normal group were 404 and 563 m for art - max and art - avg , respectively . in the keratoconus group , the mean values were 241 and 352 m for art - max and art - avg , respectively . table 2 shows the mean art values of normal and keratoconic eyes in the present study , as well as the best cutoff values as reported by ambrsio et al9 for eyes with keratoconus and susceptibility for ectasia . table 3 shows the results of the roc curve analysis auc , 95% confidence intervals , and significance levels for each parameter tested in keratoconus and normal groups . in discriminating keratoconus from control eyes , ppi and art produced high auc values , indicating good diagnostic performance when used as a test . while the means of cornea minimum radius of curvature , absolute distance from the corneal apex , as well as the distance from corneal apex in y - axis were significantly different between the two groups , their lower aucs meant that using these parameters to test for keratoconus would result in poor diagnostic performances . of note , no statistically significant difference was found between the art and ppi indices . in this study , keratometric , pachymetric , as well as novel thickness metrics from pentacam tomography are presented and evaluated in normal and keratoconic asian eyes . significant differences in these parameters have been found between normal and study eyes , in line with published reports on latin american and middle eastern populations.9,15 in terms of diagnostic performance , the ppi and art parameters produced the highest aucs amongst all the other parameters . ambrsio et al9 previously reported that the best aucs were produced by art - avg ( 0.987 ) , art - max ( 0.983 ) followed by ppi - average ( 0.980 ) . interestingly , in this study , ppi - average returned the highest auc ( 0.880 ) , followed by art - avg ( 0.865 ) and ppi - minimum ( 0.849 ) . however , pairwise comparisons did not show any significant difference between any of these parameters . comparing against the art - avg and art - max cutoffs previously reported by ambrsio et al9 for the identification of keratoconic eyes ( table 3 ) , the mean art - avg and art - max values found in the study group fell below the cutoff values . similarly , the mean art - avg and art - max values found in the control group were above the cutoff values for detecting eyes with ectasia susceptibility . these findings support the use of these pentacam indices for the evaluation of stage 1 keratoconus in asian eyes . while the results validate the usefulness of the pentacam in differentiating keratoconic from normal eyes in asians as a group , the sample size is too small to establish population norms for the measured parameters . however , there is no current evidence of differing clinical presentations of keratoconus between male and female patients , and thus , this is unlikely to skew the results of this study . in a recent study conducted by ruisenor vazquez et al16 in a non - asian population , pentacam scheimpflug imaging tomography was found to be able to detect most subclinical keratoconus cases with unremarkable topography . auc values obtained for ppi and art indices were mostly higher than in the current study , ranging from 0.79 to 0.93 . however , test specificity was highlighted as an issue , as up to 10% of subclinical keratoconus cases may be undetected by such evaluation . using the pentacam , bae et al17 evaluated topographic and tomographic changes in fellow eyes of asian patients with unilateral keratoconus to compare them with normal eyes . previous research indicates that true unilateral keratoconus is very rare , and thus the normal fellow eye may be the ideal model for the mildest form of subclinical keratoconus . the group found that fellow eyes in unilateral keratoconus patients showed differences in several parameters that were not detectable with the pentacam detection program . however , to be used as a test , each single parameter alone was not sufficient to detect these early changes . pentacam indices derived in this study are thus from clinically detectable keratoconus . as a test , it might be more useful if these were based on early or forme fruste keratoconus so that they can be detected even when not manifested clinically . nonetheless , the current study supports the findings previously reported on the usefulness of scheimpflug imaging in assessing keratoconic eyes . in order to develop it further into a deployable early detection tool , further studies will be needed to both determine its test performance as well as establish cutoff values for asian eyes . this study demonstrated significant differences in keratometric and pachymetric parameters between stage 1 keratoconic and normal corneas in asians . pachymetric indices such as the ppi and the art indices are useful tools for detecting keratoconus in this population . the findings also support the previously reported findings of the usefulness of the art in identifying keratoconus .

purposeto evaluate the keratometric and pachymetric parameters of keratoconic corneas of asian eyes with the scheimpflug imaging camera.patients and methodsthis is a cross - sectional study of 22 eyes with amsler - krumeich stage 1 keratoconus and 48 eyes from normal subjects conducted in a tertiary eye hospital . a rotating scheimpflug imaging system , the pentacam , was used to evaluate all eyes for tomographic parameters , as well as pachymetric progression indices ( ppi ) and ambrsio relational thickness ( art).resultsall ppi and art parameter values were significantly different between study and control groups . cornea minimum radius of curvature , absolute distance from corneal apex to thinnest location , as well as the distance from corneal apex to thinnest location in y - axis also demonstrated statistically significant differences . the mean art values for keratoconus eyes were 241 m ( art - maximum ) and 352 m ( art - average ) , falling within previously reported best cutoff values for detecting keratoconus . on receiver operating characteristics curve analysis , the area under the curve values were highest for ppi and art parameters.conclusionthere are significant differences in tomographic parameters between stage 1 keratoconic and normal asian eyes . pachymetric indices such as the ppi and the art index can serve as additional tools in differentiating keratoconic from normal eyes . the findings validate the usefulness of the art in identifying keratoconic eyes in asians .

Introduction Materials and methods Results Rotating Scheimpflug imaging ART ROC curve analysis Discussion Conclusion

diabetes mellitus , a complex disorder , is a combination of metabolic disorders associated with hyperglycemia due to inadequate insulin production or insulin action . type 1 is characterized by beta - cell destruction leading to insulin deficiency due to autoantibody formation . type 2 is characterized by insulin resistance and eventual reduced insulin secretion due to pancreatic scaring and loss of beta - cells . type 2 diabetes , comprising 90 - 95% of all cases of diabetes mellitus , is one of the most lethal diseases in the world . the main cause of death in type 2 diabetes is cardiovascular disease , specifically atherosclerosis . atherosclerosis is initiated by sequences of alterations in the structure and function of the vascular endothelium . however , experimental evidences suggest that imbalance between oxidative stress and host antioxidant defense along with pro - inflammatory and anti - inflammatory factors play critical roles in early vascular endothelial dysfunction . some ( but not all ) previous exercise interventions have resulted in enhanced vascular endothelial function in type 2 diabetics . however , limited information is available on the most effective type of exercise training program or mechanisms responsible for the improvements seen in vascular endothelial function . thus , this review has the following three aims : 1 ) to introduce presumed diabetes - specific mechanisms responsible for dysfunctional vascular endothelium ; 2 ) to summarize and investigate current evidence of the effect of exercise training on conduit vessel endothelial function in type 2 diabetic patients ; and 3 ) to present possible future directions to what should be further explored to expand our knowledge on this research topic . human vasculature is composed of three layers : the endothelium ( intima ) , smooth muscle cells ( media ) , and surrounding elastic and connective tissues ( adventitia ) . the vascular endothelium comprises the innermost layer of the vasculature , which directly senses changes in blood flow and interacts with hormones and neurotransmitters through various receptor - ligand complexes at its membrane , producing vasoactive agents such as nitric oxide ( no ) , prostacyclin ( pgi ) , endothelium - derived hyperpolarizing factors ( edhf ) , and endothelin-1 . these agents control vascular tone at the vascular smooth muscle level either through vasoconstriction or vasodilatation . the vasculature is relaxed or dilated if the effect of dilatory agents overrides that of constricting agents , such as the basal sympathetic tone and endothelin-1 , whereas vasoconstriction occurs if the dilatory signals are overpowered . nitric oxide or no , the most prominent vasodilatory agent , is produced by the l - arginine - endothelial nitric oxide synthase ( enos ) pathway as a byproduct . the l - citrulline in the vascular endothelium then diffuses into vascular smooth muscle cells and facilitates soluble guanylyl cyclase to convert guanosine triphosphate ( gtp ) to cyclic guanosine monophosphaste ( cgmp ) , which in turn leads to calcium ion movement into the sarcoplasmic reticulum , decreasing calcium ion concentration within the cytoplasm of smooth muscle cells , thus causing the vascular smooth muscle cells lose their tonicity . similarly , pgis are produced when cyclooxygenase ( cox ) uses arachidonic acid ( aa ) as a substrate in vascular endothelium to move into neighboring vascular smooth muscle cells , which then convert adenosine triphosphate ( atp ) into cyclic adenosine monophosphate ( camp ) through activated adenylyl cyclase ( ac ) , inducing vasodilation as a result of decreased calcium ion concentration in vascular smooth muscle cells . the endothelin derived hyperpolarizing factor ( edhf ) signaling pathway still remains to be elucidated although there have been many studies . however , it is known that edhfs are generated by the enzymatic activity of cytochrome p-450 within the golgi apparaturs in endothelial cells . like cox , aa used as a substrate for the enzymatic activity of cytochrome p-450 eventually leads to edhf stimulation or opening of potassium ion channels on the vascular smooth muscle cell membrane , resulting in hyperpolarization of vascular smooth muscle cells . this potassium mediated hyperpolarization reduces the duration of calcium ion channel opening , resulting in decreased calcium ion influx into vascular smooth muscle cells which leads to vascular smooth muscle relaxation . endothelin-1 ( et-1 ) is an endogenous constricting agent produced in vascular endothelial cells that acts as a vascular smooth muscle constricting agent after binding to et-1 receptors ( et - a or b receptors ) on the vascular smooth muscle cell membrane . as previously mentioned , the modulation of human vasculatures is very complicated since there are numerous physiological mediators involved neural ( release of norepinephrine ) and humoral ( angiotensin ii and epinephrine ) regulators which systemically influence and interact with more local regulators , such as the myogenic response and endothelium - derived relaxing factors ( edrf : no , pgi , and edhf ) . however , edrfs are considered to be the most important vasoregulators because they override resting vascular tone controlled by systemic regulators and fine tuning other local mediators . nitric oxide ( no ) also prevents abnormal growth of vascular smooth muscle cells and maintains optimal , healthy vascular wall structure . functionally , no is the major vasodilator modulating systemic vascular resistance , whereas pgi and edhf are less influential by providing supplementary means for vasodilatation . improved no production along with no bioavailability depend on the enos substrate l - arginine s availability , enos phosphorylation and dimeric coupling , availability of enos cofactors ( tetrahydrobipterin : bh4 , heat shock protein-90 : hsp-90 , and calmodulin ) , and a balance between oxidants and antioxidants . thus , it is important to assess systemic biomarkers with no - mediated vasodilation in order to understand the mechanisms involved in the structural and functional changes that occur in diabetes patients . unlike other tissues and cells not affected by abnormal systemic glucose concentration , vascular endothelium is very sensitive to alterations of blood glucose . oxidative stress has emerged as a major player in the cause of vascular endothelial dysfunction in other chronic diseases such as diabetes as well as in normal aging . however , in diabetes , it has been recognized that hyperglycemia - induced generation of reactive oxygen species ( ros ) in the vascular endothelium is the foundation of micro- and macro - vascular complications . four putative mechanisms of diabetes - mediated vascular complications have been indicated by well - designed molecular studies . firstly , the altered role of aldose reductase through sorbitol aldose reductase pathway increases oxidative stress , thus inducing the formation of uncoupled enos . unlike its normal function to convert aldehyde to inactive alcohol , aldose reductase converts glucose into sorbitol which abnormally increases intracellular glucose concentration . during this signaling process , aldose reductase uses nicotinamide adenine dinucleotide phosphate ( nadph ) as a cofactor . thus , the absolute quantity of nadph , a major cofactor in regenerating reduced glutathione , is decreased , further augmenting intracellular oxidative stress . secondly , hyperglycemia - induced advanced glycation end products ( ages ) in vascular endothelium cause increased production of ros and inflammatory cytokines as well as increased receptor ( rage ) activity and pro - atherogenic lipoprotein modification . thirdly , an overall increase in diacylglycerol ( dag ) production leads to protein kinase c ( pkc ) activation . dag , a mediator in the second messenger system , is recruited for intracellular lipid metabolism . after dag activation , pkc is involved not only in enos activity , but also in a lot of gene expression and cytokine production in the vascular endothelium . activated pkc increases ros generation by nadph oxidase , vascular adhesion molecules , pro - inflammatory cytokines , and growth factors , but decreases enos activity , resulting in a decrease of overall no bioavailability , a major characteristic of vascular endothelial dysfunction . fourthly , fructose 6-phosphate can be converted into glucosamine 6-phosphate by glucosamine 6-phosphate transferase through the hexosamine pathway in the hyperglycemic cellular environment , instead of being converted to glyceraldehyde 3-phosphate in the glycolytic pathway . uridine diphosphate ( udp ) n - acetyl glucosamine , the cytosolic end product of the hexosamine pathway , decreases enos phosphorylation but increases transforming growth factor-1 and plasminogen activator inhibitor-1 production , which in turn facilitates the pathological processes of diabetic vascular complications . however , they appear to have a common upstream inducer hyperglycemia and abnormally augmented ros production along the electron transport chains ( etc ) within vascular endothelial cell mitochondria . according to brownlee s concept on the role of oxidative stress in diabetes - mediated vascular complications , hyperglycemia facilitates the rate of glycolysis and the krebs cycle , which aberrantly generates more nicotinamide adenine dinucleotide ( nadh ) and flavin adenine dinucleotide ( fadh2 ) and abnormally over - activates etc . once the etc is activated , more hydrogen ions come out of the mitochondrial inner membrane which increase membrane potential . to bring the membrane potential back down to normal , complex iii in the etc is blocked , electrons from coenzyme q combined with oxygen molecules then generate more superoxide anions . however , hyperglycemia reduces both enzymatic ( superoxide dismutase , catalase , and glutathione peroxidase ) and non - enzymatic ( vitamin e , coenzyme q , lipoic acid , and glutathione ) antioxidants through the over production of ros . thus , the balance between oxidants and antioxidants is disrupted which becomes a main trigger of diabetic vascular complications . nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase , a major ros source in the cytosol , leads to augmented superoxide production in vascular endothelium in the presence of abnormal glucose concentrations . hyperglycemia and increased ros also results in structural and functional abnormality of the enos system . insulin resistance , another major symptom of diabetes , inhibits enos phosphorylation by down - regulating phosphoinositide 3-kinase and pi3k / akt pathway in vascular endothelium , decreasing no production and thus its bioavailability . the increased generation of reactive nitrogen species ( i.e. , peroxynitrite ) within the vascular endothelium in diabetics could be also due to hyperglycemia . these reactive nitrogen species help facilitate lipid peroxidation , nitrotyrosine production , and dna modification , leading to cardiovascular complications such as atherosclerosis . activated vascular adhesion molecules pooled into vascular endothelium also contribute to atherosclerotic plaque development in diabetics . putative pathways related to hyperglycemia - induced vascular endothelial dysfunction are illustrated in figure 2 . flow mediated dilation or fmd is the non - invasive gold - standard way to assess no - mediated vascular endothelial function in response to a physiological stimulus as seen in reactive hyperemia . since this methodological approach was introduced by dr . celermajer in the lancet journal in 1992 , many cardiovascular physiologists who work on human subjects have employed and further developed this methodology . unlike other methods such as venous occlusion plethysmography which indirectly assesses changes in local smaller vessel blood flow as segmental volume changes of a limb in response to local invasive pharmacological stimulus ( i.e. , acetylcholine ) , fmd directly measures changes in larger conduit vessel diameter in response to reactive hyperemia , which occurs after 5 minutes of local limb blood flow occlusion . fmd determines the dilatory capacity of larger vessels by determining the difference between the resting diameter and the diameter during peak reactive hyperemia . fmd also has a strong correlation with invasive coronary epicardial vasoreactivity when evaluating conduit artery function . it has benefits in assessing other important functional parameters such as blood flow , velocity and vascular conductance . in addition , it needs unified guidelines and standardizations in order to have validity when comparing results to other studies . recently , dr . dan green s group provided a methodological guideline to assess fmd . although there are differences in operators , equipment , devices , analysis tools , and software between laboratories , unified technical guidelines will help researchers to accurately measure and evaluate fmd , and to compare the outcomes found in different laboratories . most importantly , vascular smooth muscle responsiveness to a nitric oxide donor ( i.e. , nitroglycerin ) needs to be tested if fmd method is used in order to ensure that results are coming specifically in an endothelium - dependent manner . in many studies , the outcomes of fmd have been supported by assays of numerous systemic biomarkers . since dr . feng and dr . colombo introduced and developed a state - of - the - art methodological approach which collects vascular endothelial cells by inserting guide wires into artery or vein via catheterization and evaluates local endothelial cell protein expressions using immunofluorescence , such method has provided an abundant amount of scientific evidence to understand the mechanisms associated with vascular endothelial function [ 9,22,23,28,32 , 39,62,63,73,74 ] . thus , assessing both systemic and local biomarkers with fmd would be a great methodological approach to understand the mechanisms involved in any functional changes . although there has been a substantial effort to promote vascular health in type 2 diabetic patients , only a few randomized controlled trials have tested the effect of aerobic exercise training on vascular endothelial function in type 2 diabetic patients with inconclusive and controversial results . some experimental evidence demonstrated a positive influence of regular physical activity and aerobic exercise on the improvement of the vascular endothelial function through systemic inflammatory biomarkers in diabetics . however , other studies indicated that regular aerobic exercise did not enhance the impaired endothelial function or systemic biomarkers in type 2 diabetic patients . although there has been a lot of attention on the effect of aerobic exercise on large conduit artery health mainly assessed by fmd , only a couple of studies have evaluated the effect of aerobic exercise training specifically on conduit artery endothelial function in type 2 diabetics . according to the recent collaborative statement by the american college of sports medicine ( acsm ) and the american diabetes association ( ada ) , either aerobic or combined exercise ( aerobic & resistance training ) is recommended to prevent diabetes and the associated complications specifically to improve diabetic vascular health . however , the recommended guidelines for aerobic exercise training are still nonspecific without specific aerobic exercise regimen aimed specifically towards helping improve vascular endothelial function in type 2 diabetic patients . this is partly due to the fact the mechanisms of the beneficial effects that aerobic exercise training has on diabetic vascular complications have not yet been fully elucidated . recently , dr . wisloff and his colleagues have demonstrated that 16 weeks of high - intensive interval training was greatly superior to moderate continuous exercise on the improvement of the vascular endothelial function , insulin signaling , and overall blood glucose in metabolic syndrome patients , including patients with prediabetes . the proposed effects of high - intensity interval training has caused patients and health care providers alike to become skeptical on its benefits when considering its potential risks and secondary detrimental effects it might have on individuals who are not physically fit . however , it has been recently demonstrated that high - intensity interval training can be safely employed in patients of high risk groups such as those with heart failure , metabolic syndrome , coronary artery disease , or hypertension . high - intensity interval training has been tested to over 2000 hours of intervention without any negative events . accordingly , future studies should demonstrate the benefit of high - intensity interval training on vascular endothelial function in type 2 diabetic patients . furthermore , the optimal training modality , intensity , frequency , and duration to improve impaired and dysfunctional diabetic vasculature should be emphasized . human vasculature is composed of three layers : the endothelium ( intima ) , smooth muscle cells ( media ) , and surrounding elastic and connective tissues ( adventitia ) . the vascular endothelium comprises the innermost layer of the vasculature , which directly senses changes in blood flow and interacts with hormones and neurotransmitters through various receptor - ligand complexes at its membrane , producing vasoactive agents such as nitric oxide ( no ) , prostacyclin ( pgi ) , endothelium - derived hyperpolarizing factors ( edhf ) , and endothelin-1 . these agents control vascular tone at the vascular smooth muscle level either through vasoconstriction or vasodilatation . the vasculature is relaxed or dilated if the effect of dilatory agents overrides that of constricting agents , such as the basal sympathetic tone and endothelin-1 , whereas vasoconstriction occurs if the dilatory signals are overpowered . nitric oxide or no , the most prominent vasodilatory agent , is produced by the l - arginine - endothelial nitric oxide synthase ( enos ) pathway as a byproduct . the l - citrulline in the vascular endothelium then diffuses into vascular smooth muscle cells and facilitates soluble guanylyl cyclase to convert guanosine triphosphate ( gtp ) to cyclic guanosine monophosphaste ( cgmp ) , which in turn leads to calcium ion movement into the sarcoplasmic reticulum , decreasing calcium ion concentration within the cytoplasm of smooth muscle cells , thus causing the vascular smooth muscle cells lose their tonicity . similarly , pgis are produced when cyclooxygenase ( cox ) uses arachidonic acid ( aa ) as a substrate in vascular endothelium to move into neighboring vascular smooth muscle cells , which then convert adenosine triphosphate ( atp ) into cyclic adenosine monophosphate ( camp ) through activated adenylyl cyclase ( ac ) , inducing vasodilation as a result of decreased calcium ion concentration in vascular smooth muscle cells . the endothelin derived hyperpolarizing factor ( edhf ) signaling pathway still remains to be elucidated although there have been many studies . however , it is known that edhfs are generated by the enzymatic activity of cytochrome p-450 within the golgi apparaturs in endothelial cells . like cox , aa used as a substrate for the enzymatic activity of cytochrome p-450 eventually leads to edhf stimulation or opening of potassium ion channels on the vascular smooth muscle cell membrane , resulting in hyperpolarization of vascular smooth muscle cells . this potassium mediated hyperpolarization reduces the duration of calcium ion channel opening , resulting in decreased calcium ion influx into vascular smooth muscle cells which leads to vascular smooth muscle relaxation . endothelin-1 ( et-1 ) is an endogenous constricting agent produced in vascular endothelial cells that acts as a vascular smooth muscle constricting agent after binding to et-1 receptors ( et - a or b receptors ) on the vascular smooth muscle cell membrane . as previously mentioned , the modulation of human vasculatures is very complicated since there are numerous physiological mediators involved neural ( release of norepinephrine ) and humoral ( angiotensin ii and epinephrine ) regulators which systemically influence and interact with more local regulators , such as the myogenic response and endothelium - derived relaxing factors ( edrf : no , pgi , and edhf ) . however , edrfs are considered to be the most important vasoregulators because they override resting vascular tone controlled by systemic regulators and fine tuning other local mediators . nitric oxide ( no ) also prevents abnormal growth of vascular smooth muscle cells and maintains optimal , healthy vascular wall structure . functionally , no is the major vasodilator modulating systemic vascular resistance , whereas pgi and edhf are less influential by providing supplementary means for vasodilatation . improved no production along with no bioavailability depend on the enos substrate l - arginine s availability , enos phosphorylation and dimeric coupling , availability of enos cofactors ( tetrahydrobipterin : bh4 , heat shock protein-90 : hsp-90 , and calmodulin ) , and a balance between oxidants and antioxidants . thus , it is important to assess systemic biomarkers with no - mediated vasodilation in order to understand the mechanisms involved in the structural and functional changes that occur in diabetes patients . unlike other tissues and cells not affected by abnormal systemic glucose concentration , vascular endothelium is very sensitive to alterations of blood glucose . oxidative stress has emerged as a major player in the cause of vascular endothelial dysfunction in other chronic diseases such as diabetes as well as in normal aging . however , in diabetes , it has been recognized that hyperglycemia - induced generation of reactive oxygen species ( ros ) in the vascular endothelium is the foundation of micro- and macro - vascular complications . four putative mechanisms of diabetes - mediated vascular complications have been indicated by well - designed molecular studies . firstly , the altered role of aldose reductase through sorbitol aldose reductase pathway increases oxidative stress , thus inducing the formation of uncoupled enos . unlike its normal function to convert aldehyde to inactive alcohol , aldose reductase converts glucose into sorbitol which abnormally increases intracellular glucose concentration . during this signaling process , thus , the absolute quantity of nadph , a major cofactor in regenerating reduced glutathione , is decreased , further augmenting intracellular oxidative stress . secondly , hyperglycemia - induced advanced glycation end products ( ages ) in vascular endothelium cause increased production of ros and inflammatory cytokines as well as increased receptor ( rage ) activity and pro - atherogenic lipoprotein modification . thirdly , an overall increase in diacylglycerol ( dag ) production leads to protein kinase c ( pkc ) activation . dag , a mediator in the second messenger system , is recruited for intracellular lipid metabolism . after dag activation , pkc is involved not only in enos activity , but also in a lot of gene expression and cytokine production in the vascular endothelium . activated pkc increases ros generation by nadph oxidase , vascular adhesion molecules , pro - inflammatory cytokines , and growth factors , but decreases enos activity , resulting in a decrease of overall no bioavailability , a major characteristic of vascular endothelial dysfunction . fourthly , fructose 6-phosphate can be converted into glucosamine 6-phosphate by glucosamine 6-phosphate transferase through the hexosamine pathway in the hyperglycemic cellular environment , instead of being converted to glyceraldehyde 3-phosphate in the glycolytic pathway . uridine diphosphate ( udp ) n - acetyl glucosamine , the cytosolic end product of the hexosamine pathway , decreases enos phosphorylation but increases transforming growth factor-1 and plasminogen activator inhibitor-1 production , which in turn facilitates the pathological processes of diabetic vascular complications . however , they appear to have a common upstream inducer hyperglycemia and abnormally augmented ros production along the electron transport chains ( etc ) within vascular endothelial cell mitochondria . according to brownlee s concept on the role of oxidative stress in diabetes - mediated vascular complications , hyperglycemia facilitates the rate of glycolysis and the krebs cycle , which aberrantly generates more nicotinamide adenine dinucleotide ( nadh ) and flavin adenine dinucleotide ( fadh2 ) and abnormally over - activates etc . once the etc is activated , more hydrogen ions come out of the mitochondrial inner membrane which increase membrane potential . to bring the membrane potential back down to normal , complex iii in the etc is blocked , electrons from coenzyme q combined with oxygen molecules then generate more superoxide anions . however , hyperglycemia reduces both enzymatic ( superoxide dismutase , catalase , and glutathione peroxidase ) and non - enzymatic ( vitamin e , coenzyme q , lipoic acid , and glutathione ) antioxidants through the over production of ros . thus , the balance between oxidants and antioxidants is disrupted which becomes a main trigger of diabetic vascular complications . nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase , a major ros source in the cytosol , leads to augmented superoxide production in vascular endothelium in the presence of abnormal glucose concentrations . hyperglycemia and increased ros also results in structural and functional abnormality of the enos system . insulin resistance , another major symptom of diabetes , inhibits enos phosphorylation by down - regulating phosphoinositide 3-kinase and pi3k / akt pathway in vascular endothelium , decreasing no production and thus its bioavailability . the increased generation of reactive nitrogen species ( i.e. , peroxynitrite ) within the vascular endothelium in diabetics could be also due to hyperglycemia . these reactive nitrogen species help facilitate lipid peroxidation , nitrotyrosine production , and dna modification , leading to cardiovascular complications such as atherosclerosis . activated vascular adhesion molecules pooled into vascular endothelium also contribute to atherosclerotic plaque development in diabetics . putative pathways related to hyperglycemia - induced vascular endothelial dysfunction are illustrated in figure 2 . flow mediated dilation or fmd is the non - invasive gold - standard way to assess no - mediated vascular endothelial function in response to a physiological stimulus as seen in reactive hyperemia . since this methodological approach was introduced by dr . celermajer in the lancet journal in 1992 , many cardiovascular physiologists who work on human subjects have employed and further developed this methodology . unlike other methods such as venous occlusion plethysmography which indirectly assesses changes in local smaller vessel blood flow as segmental volume changes of a limb in response to local invasive pharmacological stimulus ( i.e. , acetylcholine ) , fmd directly measures changes in larger conduit vessel diameter in response to reactive hyperemia , which occurs after 5 minutes of local limb blood flow occlusion . fmd determines the dilatory capacity of larger vessels by determining the difference between the resting diameter and the diameter during peak reactive hyperemia . fmd also has a strong correlation with invasive coronary epicardial vasoreactivity when evaluating conduit artery function . it has benefits in assessing other important functional parameters such as blood flow , velocity and vascular conductance . in addition , it needs unified guidelines and standardizations in order to have validity when comparing results to other studies . recently , dr . dan green s group provided a methodological guideline to assess fmd . although there are differences in operators , equipment , devices , analysis tools , and software between laboratories , unified technical guidelines will help researchers to accurately measure and evaluate fmd , and to compare the outcomes found in different laboratories . most importantly , vascular smooth muscle responsiveness to a nitric oxide donor ( i.e. , nitroglycerin ) needs to be tested if fmd method is used in order to ensure that results are coming specifically in an endothelium - dependent manner . in many studies , the outcomes of fmd have been supported by assays of numerous systemic biomarkers . since dr . feng and dr . colombo introduced and developed a state - of - the - art methodological approach which collects vascular endothelial cells by inserting guide wires into artery or vein via catheterization and evaluates local endothelial cell protein expressions using immunofluorescence , such method has provided an abundant amount of scientific evidence to understand the mechanisms associated with vascular endothelial function [ 9,22,23,28,32 , 39,62,63,73,74 ] . thus , assessing both systemic and local biomarkers with fmd would be a great methodological approach to understand the mechanisms involved in any functional changes . although there has been a substantial effort to promote vascular health in type 2 diabetic patients , only a few randomized controlled trials have tested the effect of aerobic exercise training on vascular endothelial function in type 2 diabetic patients with inconclusive and controversial results . some experimental evidence demonstrated a positive influence of regular physical activity and aerobic exercise on the improvement of the vascular endothelial function through systemic inflammatory biomarkers in diabetics . however , other studies indicated that regular aerobic exercise did not enhance the impaired endothelial function or systemic biomarkers in type 2 diabetic patients . although there has been a lot of attention on the effect of aerobic exercise on large conduit artery health mainly assessed by fmd , only a couple of studies have evaluated the effect of aerobic exercise training specifically on conduit artery endothelial function in type 2 diabetics . according to the recent collaborative statement by the american college of sports medicine ( acsm ) and the american diabetes association ( ada ) , either aerobic or combined exercise ( aerobic & resistance training ) is recommended to prevent diabetes and the associated complications specifically to improve diabetic vascular health . however , the recommended guidelines for aerobic exercise training are still nonspecific without specific aerobic exercise regimen aimed specifically towards helping improve vascular endothelial function in type 2 diabetic patients . this is partly due to the fact the mechanisms of the beneficial effects that aerobic exercise training has on diabetic vascular complications have not yet been fully elucidated . recently , dr . wisloff and his colleagues have demonstrated that 16 weeks of high - intensive interval training was greatly superior to moderate continuous exercise on the improvement of the vascular endothelial function , insulin signaling , and overall blood glucose in metabolic syndrome patients , including patients with prediabetes . the proposed effects of high - intensity interval training has caused patients and health care providers alike to become skeptical on its benefits when considering its potential risks and secondary detrimental effects it might have on individuals who are not physically fit . however , it has been recently demonstrated that high - intensity interval training can be safely employed in patients of high risk groups such as those with heart failure , metabolic syndrome , coronary artery disease , or hypertension . high - intensity interval training has been tested to over 2000 hours of intervention without any negative events . accordingly , future studies should demonstrate the benefit of high - intensity interval training on vascular endothelial function in type 2 diabetic patients . furthermore , the optimal training modality , intensity , frequency , and duration to improve impaired and dysfunctional diabetic vasculature should be emphasized . nitric oxide ( no ) is a major constituent necessary to maintain vascular integrity and dilatory capacity . increased ros generation of endothelial mitochondria has been implicated as a common precursor mechanism in the formation of diabetic vascular complications . even though some studies have explored the effects of exercise on the human vascular endothelial function and related mechanisms , thus , future studies need to demonstrate the optimal exercise regimen for impaired diabetic vasculature and to directly investigate related molecular and biochemical mechanisms involved in the induction and prevention of endothelial injury within collected vascular endothelial cells in addition to traditional systemic biomarkers .

[ purpose]vascular endothelial dysfunction is an early marker of atherosclerosis characterized by decreased nitric oxide bioavailability in the vascular endothelium and smooth muscle cells . recently , some animal models and in vitro trials demonstrated that excessive superoxide production from mitochondria within vascular endothelial cells played a role in the pathogenesis of atherosclerosis in type 2 diabetes . this review provides a systematic assessment of the effectiveness of exercise to identify effective approaches to recognize diabetes risk and prevent progression to heart disease.[methods]a systematic literature search was conducted to retrieve articles from 1979 to 2013 using the following databases : the medline , pubmed . articles had to describe an intervention that physical activity and exercise to identify effective approaches to heart and vascular endothelium.[results]currently , physical activity and exercise guidelines aimed to improve cardiovascular health in patients with type 2 diabetes are nonspecific . benefit of aerobic exercise training on vascular endothelial function in type 2 diabetic patients is still controversial.[conclusion]it is necessary to demonstrate the mechanism of endothelial dysfunction from live human tissues so that we can provide more specific exercise training regimens to enhance cardiovascular health in type 2 diabetic patients .

INTRODUCTION Relaxation of vascular endothelium: a major determinant for vascular integrity Potential mechanisms of diabetes-mediated vascular endothelial dysfunction Assessment of conduit artery endothelial function: Flow-mediated dilation (FMD) Aerobic exercise training and vascular endothelial function in type 2 diabetic patients CONCLUSION

in recent decades , controlled drug release from capsules made from biodegradable and biocompatible polymers has been extensively studied . the drug release from microspheres are considered to occur both by degradation of the polymer matrix and by simple diffusion of the drug molecules . it has been revealed that various factors affect the feature of drug release , such as the size and structure of the microsphere , porosity , chemistry , degradability , and molar mass of the polymer material , and ph value of the medium . microspheres for the drug release have been prepared by polymerization method or by solvent removing method . vinyl polymer microcapsules can be prepared by emulsion , suspension , or dispersion polymerization [ 1 , 5 ] . furthermore , controlled / living radical polymerization , which has been developed recently , can provide microspheres with well - controlled morphology . on the other hand , for biodegradable polymers such as poly(l - lactic acid ) ( plla ) , poly(glycolic acid ) ( pga ) , and various naturally occurring polymers , microspheres are usually prepared by solvent evaporation or spray - drying method [ 717 ] . it needs to be noted that porous biodegradable polymer particles can also be prepared by freeze - drying technique , and by solution crystallization method . we have prepared porous plla particles by the freeze - drying method from 1,4-dioxane solutions and have investigated their structure and thermal properties precisely [ 18 , 20 ] . it has been demonstrated that the interior of the freeze - dried plla ( fdplla ) is very porous consisting of thin membranes forming a fine , randomly arrayed tissue . in addition , crystallizability of fdplla is remarkably high due to the mobile surface layer of the fine membranes , and thus , the range of crystallinity that can be achieved is expanded from that of the bulk plla . the fdplla seems to be suitable for a carrier in controlled drug delivery system because of its high void content and biocompatibility . the porosity of the fdplla is expected to be controlled by freeze - drying conditions . additionally , it seems that the shape and size of the freeze - dried material can be controlled by the method of freezing . for example , if the solution is frozen as droplets , sphere - shaped material is yielded , and if it is frozen in a space between two flat substrates with a spacer , a plate - like one is yielded . in this paper , we investigate the possibility of applying the porous fdplla to controlled drug release system . we prepare protein - loaded fdplla particles with radius of ca . 3 mm and examine their morphology . we here employ a protein , bovine serum albumin ( bsa ) as a model drug compound . bsa can be loaded into the fdplla particle by simply immersing them into a bsa aqueous solution and subsequent drying . the release kinetics of bsa from the bsa - loaded fdplla in water is investigated , and the results are discussed in conjunction with the morphology . plla with a molar mass of 210 kda containing 98% l units was supplied from mitsui chemicals co. 1,4-dioxane was purchased from nacalai tesque , which was distilled before use . plla/1,4-dioxane solutions of which the plla concentration of c0 = 2.0 , 5.0 , and 8.0 wt% were prepared . the solution was directly poured into liquid n2 ( 77 k ) drop by drop so as to the solution was rapidly frozen . the frozen droplets were dried under vacuum for 168 h to remove the frozen solvent by sublimation , which yielded fdplla spherical particles with high porosity . the diameter of the particle was approximately 3 mm , being almost independent of c0 . more detailed procedure of freeze - drying is described elsewhere [ 18 , 20 ] . gravimetric measurement after heating at 190c revealed that the residual solvent contained in the fdplla was estimated to be less than 0.1 wt% . we confirmed by differential scanning calorimetry ( dsc ) and wide - angle x - ray scattering ( waxs ) that the as - prepared fdplla is completely amorphous as we reported elsewhere . additionally , we also prepared crystallized fdplla by annealing as - prepared fdplla at 115c for 15 min . the crystallinity of the crystallized samples was evaluated from the net heat of endotherm detected during a heating scan of dsc at 10 k min . specific surface area of the obtained fdplla , , was evaluated by the brunauer - emmett - teller ( bet ) adsorption isotherm of krypton . volume fraction of void in the particle , rv , was also evaluated by measuring the mass and apparent size of the particle . literature value 1.248 g cm for the density of amorphous plla was used in this evaluation . scanning electron microscopy ( sem ) was performed to investigate the morphology of fdplla particles by using a hitachi s-2600h electron microscope . bsa ( 66,776 da , lyophilized powder , > 96% ) was purchased from sigma - aldrich . fdplla was immersed in an aqueous solution of bsa ( 20 wt% ) in the following procedure . fdplla particles were placed in a sandwich cell that was made of two glass plates and a rubber spacer and were degassed under vacuum together with a bsa solution in a vacuum chamber ( see figure 1 ) . then , the open side of the cell was immersed in the bsa solution , followed by releasing the air into the chamber to atmospheric pressure . this method allows the solution to permeate thoroughly into the interior of the fdplla particle . on the contrary , when fdplla particle was simply added to the bsa solution , the solution hardly permeated into fdplla because of very high hydrophobicity of plla . after 10 min , the fdplla immersed in the solution was then separated and dried at room temperature in atmosphere for 24 h , followed by drying under vacuum for 24 h. the mass of bsa loaded in fdplla was evaluated by gravimetric measurement . in the release experiments , the ratio of bsa - loaded fdplla / water was determined so as to the expected final absorbance of bsa at 279 nm is in the rage 0.50.6 . in a typical experiment , 50 mg of bsa - loaded fdplla with c0 the mixture was subject to constant stirring , the temperature being controlled at 37.0 0.1c . the amount of released bsa was measured by monitoring ultraviolet ( uv ) absorption at 279 nm , where a peak characteristic of bsa is located with a molar absorption coefficient of 43,824 m cm . the uv measurements were done by using a uv spectrometer hitachi u-3900 h. from the results , time - dependent profile of the bsa concentration of the aqueous phase was evaluated . the yielded fdplla particles were revealed to be very porous . table 1 shows specific surface area and void fraction rv ( volume fraction of void ) of fdplla particles . the void content was evaluated from averaged values of apparent radius and mass of the particle . it is noted from table 1 that for amorphous fdplla , c0 + rv approximately equals 100% . this means that the shape of the as - freeze - dried sphere is originated from the solution droplet : the frozen droplets undergo no shrinkage upon freeze drying . the thickness of the thin membranes that form fine tissue in the interior was estimated to be 100200 nm from electron microscopy , which coincides with the results of specific surface area : thickness of a hypothetical flat film df that has the same specific surface area was estimated as df = 2/( ) , where is the density of amorphous plla , and it ranged from 120 to 191 nm ( see table 1 ) . figure 2 also shows that the surface of the sphere is less porous than that in the interior . fine tissue that is typically seen in the interior appears to have melted on the surface , which results in reduction of surface porosity . it appears that a less porous skin is formed on the surface . by analyzing the sem images , we estimated surface porosity as void fraction of the surface , avoid / at , where avoid is the area of the voids ( pores ) on the surface , and at is the total area of the surface . the surface porosity decreases with increasing c0 , and it is extremely low for c0 = 8.0 wt% . the formation of the surface skin layer may have occurred during freezing . when a droplet of the solution is quenched in liquid n2 , solid - liquid microphase separation would occur first , that is , crystallized solvent ( solid phase ) and unfrozen solution ( liquid phase ) may be formed . as the freezing process proceeds , the liquid phase becomes concentrated and finally it vitrifies when most of the solvent has moved to the frozen phase . although the whole frozen process occurs within a few seconds in liquid n2 , the intermediate liquid phase may have enough time to relax by reducing its interfacial area , which leads to surface melting . this process may occur preferentially on the surface where free space for the relaxation is available . the mass fraction of bsa loaded in the fdplla is presented in table 3 , which is defined as fbsa = mbsa /mt , where mbsa is the mass of bsa adsorbed in fdplla , and mt is the total mass of bsa - loaded fdplla . the obtained values of fbsa are extremely large compared with the plla scaffold prepared by the phase separation method . this feature is originated from the high porosity of the present fdplla , which seems to be suitable for drug delivery applications . the interior of the particle exhibits a similar feature of porous morphology to that of the unloaded fdplla . the loaded bsa in the interior of the particle exists as agglomerates , which is typically seen in figure 3(b ) . the high porosity for the bsa - loaded fdplla is reasonably understood from their void fraction rv , loaded presented in table 3 : it is rather high even after the bsa adsorption , indicating that the bsa - loaded fdplla is still very porous . here , rv , loaded was estimated from fbsa as ( 1)rv , loaded=1 ( 1rv ) ( 1+fbsa1fbsapllabsa ) , where rv is the void fraction before the bsa loading , and plla and bsa ( 1.07 g cm ) are the densities of plla and bsa , respectively . on the other hand , the surface of the particle seems to be covered with deposited bsa , and the voids on the surface is hidden for c0 = 5.0 and 8.0 wt% . from electron micrographs , the deposited bsa layer on the surface for c0 = 5.0 and 8.0 wt% was roughly estimated to be as thin as 0.51 m , which does not alter the apparent size of the particle significantly . as for c0 = 2.0 wt% , the surface is still ragged , which may be originated from the very porous surface shown in figure 2(a ) . we found that the apparent size of fdplla particles is reduced upon isothermal crystallization at 115c for 15 min . figure 4 shows a typical morphology of the interior of crystallized fdplla ( c0 = 8.0 wt% ) . aggregation of curved fine layers is observed ; each layer is probably made of stacked crystalline lamellae of plla . the space ( void ) between them was found to be reduced upon crystallization , which is consistent with the reduction of the apparent size of the particle ( see table 1 ) . as for the bsa loading , fbsa is smaller than that for the corresponding amorphous fdplla as shown in table 3 . it is most likely that this is due to the reduction of void fraction upon crystallization . as the crystallized fdplla particles have indefinite shape which seems to prevent simple kinetic analysis , we here report the release data only from the amorphous fdplla . the amount of bsa released into water from the fdplla was evaluated by uv absorbance at 279 nm . figure 5 shows release of bsa with respect to elapsed time as presented by [ bsa]t/[bsa] , where [ bsa]t is the bsa concentration in water at time t , and [ bsa] is the final value of the bsa concentration that was estimated from the total mass of bsa loaded in the fdplla . for the three samples , a major portion of bsa release occurs within at least several hours , which suggests that the release occurs mainly by the diffusion mechanism prior to the degradation of plla : we confirmed that significant hydrolysis of plla in water under the present condition takes more than several days . we infer that the c0 dependence of release rate may be due to the difference in surface porosity . additionally , it is seen that a burst of release occurs in the early period , which is probably due to rapid solvation of bsa deposited on the surface of the particles as observed in figures 3(a ) , 3(c ) , and 3(e ) . we speculate that the release of bsa from the interior of the particle occurs in two subsequent processes : permeation of water into the fdplla sphere , and the diffusion of bsa out of the particle . the values of avoid / at in table 2 indicate that the surface porosity decreases remarkably with increasing c0 . the interior porosity of the particle also decreases with increasing c0 as shown in table 1 , but this dependence is weaker than that of the surface porosity . thus , it is likely that the release rate due to the diffusion process from the interior is largely governed by the surface porosity . the profiles in figure 5 suggest that the release takes place in two steps : dissolution of the bsa deposited on or near the surface occurs first , which is responsible for the initial burst , and then , bsa leaches out from the interior of the particle . the first step occurs within a few minutes , as evidenced by nonzero values of [ bsa]t/[bsa] , at 60 s in figure 5 ( 0.10.3 ) . the release of the second step commences after certain induction period , which is needed for water to permeate into the interior of the particle , and this depends strongly on the surface porosity as discussed above . the release rate due to the second step is governed by the diffusion process of bsa in the particle and through the surface skin with less porosity . to analyze the time - evolution profiles in figure 5 , we assume a model of fickian diffusion from a nonswellable sphere . in this case , an analytical expression for [ bsa]t/[bsa] is given by ( 2)[bsa]t[bsa]=162n=11n2exp[dn22ta2 ] , where d is the diffusion coefficient of bsa travelling in the fdplla particle , and a is the radius of the fdplla sphere . we further takes into account the initial burst as a baseline fraction parameter b , and the induction period for the second step as ti , thus , the time - dependent release is expressed by ( 3)[bsa]t[bsa]=(1b ) { 162n=11n2exp[dn22(tti)a2 ] } + b . the experimental profiles were fitted with equation ( 3 ) by nonlinear least squares fitting , d and ti being treated as variable parameters , and the obtained best fit values are listed in table 4 . in the analysis , the series in equation ( 3 ) was cut off at n = 400 ; we confirmed that this does not affect the results significantly . equation ( 3 ) assumes that both the distribution and diffusion rate of bsa are spatially uniform in the spherical particle , thus the evaluated d is regarded as an averaged diffusion coefficient over the interior of the sphere including the surface skin layer . the diffusion coefficient d for c0 = 2.0 wt% is more than an order of magnitude greater than that for c0 = 8.0 wt% . this can be understood by the large difference in the surface porosity between the two samples ( table 2 ) . thus , it is reasonable to consider that the release rate due to the diffusion process is largely affected by the porosity of the surface skin layer . the baseline parameter b decreases with increasing c0 , which implies that the release due to the initial burst is larger for lower c0 . this suggests that the initial burst is originated not only from the bsa portion deposited on the surface but also from that deposited near the surface . we infer that during the induction period , water goes into the particle , and this process is considered to be affected strongly by the surface porosity . in this study , we have prepared bsa - loaded fdplla particles and have investigated their morphology and release kinetics of bsa into water . we have found that the porosity and specific surface area of the present fdplla are rather high , which leads to prominent ability of protein loading . the surface of fdplla particle is less porous than the interior , which is suggested to affect significantly the release rate of bsa . the concentration c0 of the original solution , from which fdplla is prepared , seems to be a key parameter that controls both bsa loading and release rate : as c0 decreases , the loading of bsa increases , while the release rate becomes greater . the present results suggest that fdplla is a promising material as a carrier for controlled drug release . on the other hand , it may not be suitable for tissue engineering applications , because the size of the pore is too small for cell seeding , growth , and tissue formation . the release rate observed in this study may be too fast for a practical use in controlled releasing system . this problem could be overcome by arranging the surface of the fdplla particle by either chemical or physical treatment . in addition , the size of the particle could be arranged so as to be suitable for various medical administrations ( ingestion or injection ) by development of spray method on freezing with controlled viscosity of the solution .

freeze - drying a biodegradable polymer , poly(l - lactic acid ) ( plla ) , from 1,4-dioxane solutions provided very porous spherical particles of ca . 3 mm in radius with specific surface area of 813 m2 g1 . the surface of the particle was found to be less porous compared with its interior . to apply the freeze - dried plla ( fdplla ) to drug delivery system , its morphology and drug releasing kinetics were investigated , bovine serum albumin ( bsa ) being used as a model drug compound . immersion of fdplla into a bsa aqueous solution gave bsa - loaded fdplla , where mass fraction of the adsorbed bsa reached up to 79% . time - dependent release profile of bsa in water suggested a two - step mechanism : ( 1 ) very rapid release of bsa deposited on and near the particle surface , which results in an initial burst , and ( 2 ) leaching of bsa from the interior of the particle by the diffusion process . it was suggested that the latter process is largely governed by the surface porosity . the porosity of both the interior and surface was found to decrease remarkably as the concentration of the original plla/1,4-dioxane solution increases , c0 . thus , c0 is a key parameter that controls the loading and releasing of bsa .

1. Introduction 2. Experimental Methods 3. Results and Discussion 4. Conclusions

aberrant cytokine expression accompanies both lymphoid and myeloid malignancies and is believed to contribute to disease phenotype and outcome . recent studies in diffuse large b - cell lymphoma and primary myelofibrosis ( pmf ) have provided proof - of - concept in this regard by demonstrating phenotypic correlates and a powerful prognostic value for plasma levels of certain cytokines ; circulating levels of interleukin ( il)-2r , interleukin ( il)-8 , il-12 , il-15 and c x c motif chemokine 10 ( cxcl10 ) in pmf and il-2r , il-8 , il-10 , il-12 , cxcl9 and cxcl10 in diffuse large b - cell lymphoma were independently associated with worse survival . in addition , in pmf , jak2v617f - positive patients , compared to their mutation - negative counterparts , were more likely to display higher plasma levels of il-1ra , il-2r , il-6 , il-12 , hepatocyte growth factor ( hgf ) , cxcl10 and monokine induced by interferon ( ifn)- other phenotypic correlates included increased levels of ( i ) il-6 and il-8 with constitutional symptoms , ( ii ) hgf with marked splenomegaly , ( iii ) il-2r , il-8 , il-10 , macrophage inflammatory protein ( mip)-1 and monocyte chemotactic protein-1 with red cell transfusion dependency , ( iv ) il-2r , hgf and cxcl10 with leukocytosis and ( v ) cxcl10 with thrombocytopenia . furthermore , a recent report suggested that anemia response to pomalidomide treatment in pmf was predicted by lower levels of circulating monocyte chemotactic protein-1 , il-2r , il-15 and il-8 . the above - mentioned observations in pmf strongly suggest that specific cytokines contribute to specific disease symptoms and poor survival , and are also predictive of therapeutic response . whether or not the particular nosogenic cytokines represent the host 's immune response to clonal myeloproliferation or a tumor - specific autocrine process is yet to be clarified . similarly , the detrimental effect on survival might be mediated by either exacerbation of co - morbid conditions , such as cardiovascular disease , or by promoting clonal evolution and/or leukemic transformation . the latter are consistent with the general concept of a direct link between inflammation and oncogenesis . myelodysplastic syndrome ( mds ) and pmf are both clonal stem cell diseases and share a number of clinical features , including ineffective erythropoiesis , bone marrow neoangiogenesis and an increased risk of leukemic transformation . these similarities , as well as the known role of immune dysregulation in mds development and/or progression , led us to hypothesize that an altered plasma cytokine profile in mds is both phenotypically and prognostically relevant and may also provide additional pathogenetic and therapeutic insights . to that end , in the current study , we performed a comprehensive plasma cytokine analysis in 78 patients with primary mds . the main objectives of the study were : ( i ) describe the spectrum of abnormalities in cytokine levels and their comparison with normal controls ; ( ii ) identify phenotypic and prognostic correlates of abnormally expressed cytokines ; and ( iii ) compare plasma cytokine signatures of mds and pmf . the current study was approved by the mayo clinic institutional review board . all patients provided informed written consent for study sample collection as well as permission for use in research . inclusion to the current study required availability of archived plasma , bone marrow aspirate and biopsy and cytogenetic information at the time of first referral to the mayo clinic . the diagnoses of mds and its subclassification were according to the world health organization criteria . to assure mature survival data , follow - up information was updated in june 2011 through review of patient histories and correspondence , social security death index or a telephone call to the patient or their local physician ; date of last follow - up ' reflected this time point and not the last time a patient was seen at the mayo clinic . peripheral blood was collected under a mayo clinic protocol for patients with myeloid malignancies and standard procedures were followed to centrifuge samples at 4 c and store aliquots at 80 c . concentrations of 30 plasma cytokines were analyzed in duplicates using multiplex bead - based luminex technology ( invitrogen , carlsbad , ca , usa ) : il-1 , il-1ra , il-2 , il-2r , il-4 , il-5 , il-6 , il-7 , il-8 , il-10 , il-12 , il-13 , il-15 , il-16 , il-17 , epidermal growth factor , eotaxin , fibroblast growth factor - basic , granulocyte macrophage colony - stimulating factor ( gm - csf ) , granulocyte colony - stimulating factor , hgf , ifn- , ifn- , ifn--inducible protein 10/cxcl10 , monocyte chemotactic protein-1 , monokine induced by ifn- , mip-1 , mip-1 , regulated on activation normally t - cell expressed and secreted ( rantes ) , tumor necrosis factor- and vascular endothelial growth factor . measurements were performed on a luminex 200 analyzer ( luminex corporation , austin , tx , usa ) and resulting data were evaluated using the xponent software ( luminex corporation ) . the observed intensities of duplicate samples were averaged and mapped to a fitted curve derived from a serial dilution series of known cytokine standards ; observed intensities below and above the standard range were marked as 0% and 100% , respectively . all statistical analyses were considered clinical and laboratory parameters obtained at the time of first referral to the mayo clinic , which usually coincided with the time of plasma collection for cytokine analysis . differences in the distribution of continuous variables between categories were analyzed by either mann whitney ( for comparison of two groups ) or kruskal wallis ( comparison of three or more groups ) test . overall survival analysis was considered from the date of first referral to the mayo clinic ( that is , date of plasma collection ) to date of death ( uncensored ) or last contact ( censored ) . date of leukemic transformation replaced date of death , as the uncensored variable , for estimating leukemia - free survival . overall and leukemia - free survival curves were prepared by the kaplan meier method and compared by the log - rank test . the jmp statistical package ( sas institute , cary , nc , usa ) was used for all calculations . the study population comprised of 78 consecutive patients with primary mds ( median age , 72 years ; range 4489 years ; 67% male ) for whom an archived plasma sample collected at the time of referral to the mayo clinic was available for cytokine analysis ( table 1 ) . in all , 64 ( 82% ) patients were not receiving mds - directed therapy at the time of sample collection , and the remaining were receiving erythropoiesis - stimulating agents ( that is , recombinant erythropoietin ) alone . in total , 57 ( 73% ) patients were treatment - nave ; nine ( 11% ) and five ( 6% ) patients had previously received hematopoietic growth factors and hypomethylating agents , respectively . the international prognostic scoring system ( ipss ) distribution was as follows : low ( 28% ) , intermediate-1 ( 47% ) , intermediate-2 ( 18% ) and high ( 5% ) ; the corresponding distribution per the revised ipss ( ipss - r ) was as follows : very good 15 ( 19% ) , good 33 ( 43% ) , intermediate 13 ( 17% ) , poor 3 ( 4% ) and very poor 13 ( 17% ) . the world health organization subgroups were as follows : refractory cytopenia with multilineage dysplasia / refractory cytopenia with multilineage dysplasia and ringed sideroblasts : 29 ( 37% ) ; refractory anemia with excess blast-1 : 13 ( 17% ) ; refractory anemia with excess blast-2 : 16 ( 21% ) ; refractory anemia / refractory anemia with ringed sideroblasts : 8 ( 10% ) ; mds with isolated del(5q ) : 7 ( 9% ) ; mds - unclassified : 3 ( 4% ) ; and refractory cytopenia with unilineage dysplasia ( refractory thrombocytopenia ) : 2 ( 3% ) . other risk - relevant information , such as the proportion of patients with red cell transfusion dependency , unfavorable karyotype and thrombocytopenia , is outlined in table 1 . plasma cytokine levels were measured in 78 patients with primary mds ( table 2 ) and 35 normal controls . compared to normal controls , the levels of 19 cytokines were significantly different for mds patients : all were increased except for rantes ( table 2 ) . phenotypic correlates in mds included increased levels of il-8 with higher ipss risk category , red cell transfusion dependency , higher bone marrow blast count and female gender ; increased levels of cxcl10 with the presence of circulating peripheral blood blasts and thrombocytopenia ; decreased levels of eotaxin with ipss - defined unfavorable karyotype ; increased levels of rantes with thrombocytopenia ; and decreased levels of il-17 with red cell transfusion dependency ; with other associations as outlined in table 2 . median follow - up from the time of plasma sample collection was 24 months ( range , 0114 months ) ; for the 32 living patients , the median follow - up was 31 months ( range , 0114 months ) . during this period , 46 deaths ( 59% ) a number of clinical and laboratory parameters were identified as being associated with shortened survival by using cox proportional hazards regression models ( table 3 ) . of the 18 cytokines that were abnormally elevated in mds patients , only three cytokines were associated with shortened survival on univariate analysis : cxcl10 ( p<0.01 ) , il-6 ( p=0.02 ) and il-7 ( p=0.02 ) ( table 3 ) . all three cytokines maintained their individual significant association with shortened survival when the cox model was adjusted for the ipss or ipss - r ( table 3 ) . consistent with this finding , there was no significant difference in cxcl-10 , il-7 or il-6 levels between ipss low- and high - risk subgroups , or refractory anemia / refractory anemia with ringed sideroblasts /isolated on multivariable analysis that included the three cytokines , increased levels of cxcl10 ( p<0.01 ) and il-7 ( p=0.02 ) were identified as predictors of shortened survival , whereas il-6 maintained borderline significance ( p=0.07 ) . the survival association for cxcl10 ( p=0.02 ) and il-7 ( p=0.04 ) remained significant when the cox model was adjusted for ipss or ipss - r , age , red cell transfusion dependence and thrombocytopenia ( il-6 levels remained borderline significant in this analysis ) . based on the strength of their association with survival , a model for risk categorization of mds patients based on increased plasma levels of il-6 , il-7 and cxcl10 was developed . for consistency with a previous similar analysis in pmf patients , a cytokine level that exceeded 3 standard deviations from the normal mean ( > 3 s.d . ) mds patients with normal plasma levels of il-6 , il-7 and cxcl10 lived significantly longer ( n=20 ; median survival 76 months ) as compared to those with increased levels of one or more of the three cytokines ( n=57 ; median survival 25 months ) ( p<0.01 ) ( figure 1 ) . the risk - categorization model retained its predictive significance when adjusted for ipss ( or ipss - r ) , red cell transfusion dependence and thrombocytopenia using a cox proportional hazards regression model ( p=0.03 ; risk ratio=2.7 , 95% confidence interval=1.18.2 ) . in the present cohort , complete follow - up information ( up to june 2011 ) including cause of death ( where applicable ) was available for 50 mds patients ( 64% ) ; of these , six patients ( 12% ) were confirmed to have undergone leukemic transformation . leukemia - free survival was significantly associated with increased il-6 level ( p=0.01 ) and borderline associated with increased cxcl10 level ( p=0.09 ) , but not with increased il-7 level ( p=0.8 ) . the association between inferior leukemia - free survival and increased il-6 was not accounted for by age , transfusion dependence , ipss , ipss - r , world health organization mds category , thrombocytopenia , ipss - defined karyotype or bm blast category ( p<0.05 ) . the present findings were not affected when the analysis was extended to the entire cohort ; that is , the remaining 28 mds patients were included after censoring for leukemic transformation at the date of last follow - up ( data not shown ) . given recent data regarding a similar significant association of cytokines with specific phenotypic features as well as clinical outcome ( overall and leukemia - free survival ) in pmf , we sought to compare plasma cytokine levels between the two diseases ( that is , mds and pmf ) . of the 31 cytokines interrogated , plasma levels of all except il-2 , il-5 , il-8 , granulocyte macrophage colony - stimulating factor , monocyte chemotactic protein-1 and vascular endothelial growth factor were significantly different between the two disease groups ( table 4 ) . the mds are a clinically and molecularly heterogeneous group of clonal hematopoietic stem cell disorders that are singularly characterized by peripheral blood cytopenias from ineffective hematopoiesis and an increased but variable risk of leukemic transformation . dysregulation of the immune system is thought to play an important role in mds pathogenesis by promoting the development and/or progression of disease . the best evidence in this regard comes from the proven efficacy of immunosuppressive therapies such as anti - thymocyte globulin , cyclosporin a and alemtuzumab in at least a subset of mds patients where autoimmunity is the central pathophysiological mechanism , and also the frequent concurrence of autoimmune conditions with mds . further evidence comes from a large , population - based , case control study using registry data , which demonstrated that chronic immune stimulation , represented by a wide range of infectious or autoimmune conditions , was significantly associated with an increased risk of developing mds or acute myeloid leukemia . various aspects of immune dysregulation have been studied in mds , including the antigen - driven expansion of autoreactive cd8 + t cells of restricted v repertoire that are capable of suppressing hematopoietic colony growth in vitro . evidence for impaired immune surveillance comes from the presence of dysfunctional natural killer ( nk ) cells with decreased cytolytic activity possibly reflecting expansion of clonal nk cells and/or decreased expression of nk activating receptors , and also from the presence of increased numbers of peripheral blood t regulatory cells ( defined as cd4 + , cd25 foxp3 + t cells ) of polyclonal origin , particularly in advanced mds patients . another possible mechanism is the inflammatory cytokine - driven expansion of myeloid - derived suppressor cells that may further contribute to the development of immune tolerance in mds . mds patients exhibit an abnormal cytokine milieu that likely stems from the interaction of the mds clone with bone marrow stromal cells and infiltrating immune effector cells that underpins the persistent low - level inflammatory state . although much of the attention has been focused on the study of individual myelosuppressive / pro - apoptotic or pro - inflammatory cytokines such as tumor necrosis factor- , tumor growth factor- , ifn- or il-6 , only two previous studies to our knowledge have attempted to comprehensively profile circulating cytokine chemokine levels in mds patients . in one study of 162 acute myeloid leukemia and 100 mds patients who profiled 27 cytokines , a combined analysis of both patient groups showed that serum ( not plasma ) levels of csf3 , il-1ra , il-8 , il-12 , il-15 , cxcl10 , tumor necrosis factor - and il-17 were significantly elevated relative to normal controls . unexpectedly , the expression profiles of 24 of the 27 cytokines were statistically indistinguishable between acute myeloid leukemia and mds patients . although individual cytokine levels were not correlated with clinical or laboratory features , elevated levels of il-4 and mip-1 were associated with longer survival in mds ; the latter observation was however not confirmed within the context of other known prognostic factors in mds in a multivariate analysis . in the other study of 33 aplastic anemia and 57 mds patients , plasma levels of tumor necrosis factor - , il-6 , mip-1 , mip-1 and hgf although distinct cytokine signature profiles were identified for aa and mds patients , there were no data presented regarding clinical or laboratory correlates of individual cytokines or any information regarding association of cytokine levels with clinical outcome . the current study adds significant novel information relative to the two aforementioned studies of cytokine profiling in mds . first , we measured cytokine levels in plasma , which may be an advantage given the significant differences in levels of soluble protein factors between plasma relative to serum due to activation of the coagulation cascade in the latter . second , the vast majority of mds patients in our study were not receiving active therapy at the time of sample collection and none were receiving disease - modifying therapy that could potentially alter the disease - inherent baseline cytokine profile . third , the follow - up of patients in our cohort was mature , thereby allowing for full analysis of the effect of cytokine levels on overall survival and leukemia - free survival . fourth , availability of a fully annotated clinical database allowed a detailed assessment of association of cytokine levels with clinical or laboratory features . fifth , updated prognostic information per the ipss - r was incorporated and the added prognostic impact of cytokine levels on clinical outcome was confirmed within this context . sixth , a full comparison of cytokine profiles between mds and pmf was conducted given the disease similarities in terms of anemia prevalence , presence of constitutional symptoms and increased risk of bone marrow failure and leukemic transformation . in the current study of mds patients , il-8 and cxcl10 stand out as the most relevant cytokines in terms of phenotypic correlations and cxcl10 , il-7 and il-6 in terms of their prognostic impact . shortened overall survival was predicted by increased levels of the latter three cytokines independent of conventional prognostic factors in mds that included ipss or ipss - r , age , red cell transfusion dependence and thrombocytopenia . this suggests a significant pathogenetic contribution of the aforementioned cytokines in disease development and/or progression that is independent of the mds clone and confirms the importance of dysregulated immunity in mds . accordingly , the cytokine data could be effectively combined into a model for risk categorization , wherein normal levels of all three cytokines identified mds patients with significantly longer survival relative to those with elevated levels of one or more cytokines . although the predictive value of this model was confirmed to be independent of known prognostic factors in mds for the overall cohort , the analysis was not extended to ipss subsets given the limited number of patients in the current study . death in mds patients results from the competing phenomena of worsening co - morbidities , bone marrow failure and leukemic transformation . in an analysis of the association of specific cytokines with the risk of leukemic transformation , we found that two of the three cytokines that were associated with inferior overall survival ( il-6 , and to a lesser extent cxcl10 ) were also predictive for inferior leukemia - free survival in mds , independent of previously established prognostic factors in this regard . this observation suggests an additional permissive role of specific cytokines in the process of clonal evolution in mds and identifies at least one reason for the inferior survival of patients with increased cytokine levels . additional studies are needed to ascertain whether elevated cytokine levels are also implicated in excess deaths due to increased progression of co - morbidities such as cardiovascular disease , and so on . observations from the current study reinforce the concept of distinct and prognostically relevant plasma cytokine signatures in hematological malignancies . although the plasma cytokine profile between mds and pmf is substantially dissimilar , it is interesting to note that cxcl10 was identified as an independent prognostic indicator in both diseases and also large - cell lymphoma . the particular observation suggests a general host response to a disease state with an aggressive biology rather than a tumor - specific cytokine release . also of note is the observation that the other prognostically relevant cytokines were different between mds ( il-6 , il-7 ) and pmf ( il-2r , il-8 , il-12 , il-15 ) or large - cell lymphoma ( il-2r , il-8 , il-10 , il-12 , cxcl9 ) . in this instance , some of the nosogenic cytokines might be under the control of a tumor - specific autocrine process and therefore also relevant to disease pathogenesis . with regards to mds - relevant cytokines , il-7 was initially identified as a growth factor for b - lymphocyte progenitors and is now known to be an important regulator for many aspects of b - cell lymphopoiesis . il-6 is a pro - inflammatory cytokine , which has an important role in activating the immune system , particularly in the transition from an innate to an acquired immune response . cxcl10 is a chemokine induced by ifn- , and is also classified as an inflammatory cytokine ; this chemokine binds to cxcr3 and regulates the immune response through the activation and recruitment of various immune - competent cells . the observations from the current study may also have therapeutic implications , an aspect that is exemplified by the known activity of drugs such as thalidomide and lenalidomide that have broad immunomodulatory activity in mds . patients with mds face not only shortened survival , but also a major compromise in quality of life as a result of frequent red blood cell transfusion requirement and other complications such as infections and bleeding . it is possible that the specific aforementioned cytokines or their downstream signaling intermediates can be therapeutically targeted to alleviate clinically relevant aspects of mds .

recent studies suggest a powerful prognostic value for plasma cytokine levels in primary myelofibrosis ( interleukin ( il)-2r , il-8 , il-12 , il-15 and c x c motif chemokine 10 ( cxcl10 ) ) and large - cell lymphoma ( il-2r , il-8 , il-10 , il-12 , cxcl9 and cxcl10 ) . to examine the possibility of a similar phenomenon in myelodysplastic syndromes ( mds ) , we used multiplex enzyme - linked immunosorbent assay to measure 30 plasma cytokines in 78 patients with primary mds . compared with normal controls ( n=35 ) , the levels of 19 cytokines were significantly altered . multivariable analysis identified increased levels of cxcl10 ( p<0.01 ) , il-7 ( p=0.02 ) and il-6 ( p=0.07 ) as predictors of shortened survival ; the survival association remained significant when the cox model was adjusted for the international prognostic scoring system , age , transfusion - need or thrombocytopenia . mds patients with normal plasma levels of cxcl10 , il-7 and il-6 lived significantly longer ( median survival 76 months ) than those with elevated levels of at least one of the three cytokines ( median survival 25 months ) ( p<0.01 ) . increased levels of il-6 were associated with inferior leukemia - free survival , independent of other prognostic factors ( p=0.01 ) . comparison of plasma cytokines between mds ( n=78 ) and primary myelofibrosis ( n=127 ) revealed a significantly different pattern of abnormalities . these observations reinforce the concept of distinct and prognostically relevant plasma cytokine signatures in hematological malignancies .

Introduction Materials and methods Results Discussion

tuberculosis ( tb ) is the second most prevalent cause of infectious - related mortality right behind hiv / aids . despite effective treatment , tb remains as one of the main public health problems around the world . the number of affected people with tb has been reached to 9.6 million in 2014 , whereas in the same year , 1.5 million deceased from tb related complications . more than 95% of tb cases and its mortality have occurred in low- and middle - income countries . overall , decrease of mortality and occurrence of tb has become in all six world health organization ( who ) regions is in line with the millennium development goals . as a result , compared to year 2000 , the proportion of 18% in tb cases and 47% in the mortality between 1990 and 2015 has decreased . despite international attention to the disease and effective prevention and control programs , the pandemic of hiv / aids is one of the main causes of increasing tb cases . poverty , population growth , migration , economic and social conditions , diabetes , and malnutrition are other related causes to lack of accepted indicators in the disease detection and successful treatment of tb . in iran , the disease incidence rate since 1964 , from 142 cases per one hundred thousand has reached to 13.71 per one hundred thousand cases in 2013 . according to the who report in 2015 iran is partly surrounded by countries which are regarded among 22 high - burden countries for tb in eastern mediterranean region , such as afghanistan , pakistan , and iraq . on the other hand , newly independent countries of soviet union on the north of iran are facing the problem of multi - drug resistant tb which complicates tb control programs . description of the disease trend over time can play an important role to assess the disease control strategies , health development index , predicting the future incidence , and prevalence and also in health planning . although previous national and international reports on the tb incidence trend revealed a decline in the incidence , these studies were limited to the persian language studies and were related to the past 5 years . therefore , this study , which used the data from the who , aimed to determine the incidence of smear - positive pulmonary tuberculosis ( sppt ) by sub - age and sex groups in iran during the years of 19952012 . the results of the present study provide insights for decision makers to identify effective factors contributing on tb control programs , as well as comparisons of national tb program ( ntp ) with who strategies . this retrospective cohort study was performed in 2015 . due to the notification legislation in almost all countries around the world , directive of integration tb control program in the public health network system was communicated to all provinces of the country in 1991 . in 1995 , according to the international recommendations , directly observed treatment short ( dots ) strategy for tb program was notified to all medical universities . then with the introduction of dots ii strategy in the world , tb control strategy in the country was adapted with this program . according to the ntp , a case of tb should has definite criteria including microscopic positive sputum - smear ( at least two ) , microscopic positive sputum - smears along with culture positive sputum - smears , or microscopic sputum - smears along with pathologically active tb on chest x - ray . the model assumption is that the change in trend would be constant within each time segment ( e.g. , change points ) and varies between different time segments . therefore , the trend and number of change points are as independent variables and are determined by segmented regression with at most three change points for the entire time period of 18 years ( 19952012 ) . the incidence rate of sppt per 100000 by sex and age groups was considered as dependent variable . we also estimated the annual percent changes ( apcs ) , a way to measure trends of disease over time , and average annual percent changes ( aapcs ) , an index for trend and the interval of years , to determine the summery statistics of trend . the annual constant change in the rate is linearly done based on natural log scale of the rate . the following regression model was used to estimate the apc : log ( ry ) = b0 + b1y , where log(ry ) is the natural log of the rate in year y. in addition , the apc from year y to year ( y + 1 ) is : aapc provides a summary measure of trend over fixed time intervals . it also uses a value as the average apcs over years and is valid even when the join - models indicates some changes . estimation of aacp is based on a weighted average on acps from join - models , with weights proportional to length of apc intervals . the following equation is used to estimate the aapc : that bis are the slope coefficients for each segment in the desired range of years , and the wis are the length of each segment runs in the range of years . bayesian information criteria was used to select the number of change point and model selection . joinpoint software version 3.5.1 ( national cancer institute , usa ) was used to perform statistical analysis . this retrospective cohort study was performed in 2015 . due to the notification legislation in almost all countries around the world , directive of integration tb control program in the public health network system was communicated to all provinces of the country in 1991 . in 1995 , according to the international recommendations , directly observed treatment short ( dots ) strategy for tb program was notified to all medical universities . then with the introduction of dots ii strategy in the world , tb control strategy in the country was adapted with this program . according to the ntp , a case of tb should has definite criteria including microscopic positive sputum - smear ( at least two ) , microscopic positive sputum - smears along with culture positive sputum - smears , or microscopic sputum - smears along with pathologically active tb on chest x - ray . the model assumption is that the change in trend would be constant within each time segment ( e.g. , change points ) and varies between different time segments . therefore , the trend and number of change points are as independent variables and are determined by segmented regression with at most three change points for the entire time period of 18 years ( 19952012 ) . the incidence rate of sppt per 100000 by sex and age groups was considered as dependent variable . we also estimated the annual percent changes ( apcs ) , a way to measure trends of disease over time , and average annual percent changes ( aapcs ) , an index for trend and the interval of years , to determine the summery statistics of trend . the annual constant change in the rate is linearly done based on natural log scale of the rate . the following regression model was used to estimate the apc : log ( ry ) = b0 + b1y , where log(ry ) is the natural log of the rate in year y. in addition , the apc from year y to year ( y + 1 ) is : aapc provides a summary measure of trend over fixed time intervals . it also uses a value as the average apcs over years and is valid even when the join - models indicates some changes . estimation of aacp is based on a weighted average on acps from join - models , with weights proportional to length of apc intervals . the following equation is used to estimate the aapc : that bis are the slope coefficients for each segment in the desired range of years , and the wis are the length of each segment runs in the range of years . bayesian information criteria was used to select the number of change point and model selection . joinpoint software version 3.5.1 ( national cancer institute , usa ) was used to perform statistical analysis . during 19952012 , there were 96579 sppt case notifications in iran ( male to female ratio : 0.99 ) . of them , 19.5% were 014 years , 70.9% were 1565 years old , and the rest were over 60 years of age . . incidence rate ( per 100,000 populations ) of smear - positive pulmonary tuberculosis by age groups , sex , and years of study in iran according to table 2 , there is only one change point in 1997 for sppt incidence in subgroups of age and sex during 19952012 . aapc for both genders and also all three age groups have a negative sign that shows decreasing trend during these period of time ( p < 0.05 ) . aapc of tb incidence for females ( aapc = 4.7 ) compared to men ( aapc = 3.9 ) was far more than zero . in age groups , the maximum decrease of estimated aapc is attributed to age group 014 years ( aapc = 9.1 ) and the minimum value is attributed to age over 65 years ( aapc = 2 ) . number and local of change points and average annual percent changes in smear - positive pulmonary tuberculosis incidence however , according to last segment ( 19972012 ) which are shown in table 3 , there is a mild decreasing slope of incidence rate . as far as in age group over 65 years the results of apc and estimated trends for all sppt incidences by sex and age groups are shown in figures 1 and 2 . annual percent changes in smear - positive pulmonary tuberculosis incidence in two change points by sex and age groups trend and annual percent change smear - positive pulmonary tuberculosis incidence rate in iran , by sex during 19952012 trend and annual percent change of smear - positive pulmonary tuberculosis incidence rate in iran , by age groups during 19952012 in the present study , the incidence trend of sppt over an 18-year period ( 19952012 ) in iran was evaluated which has been changed in this period . according to the results , the trend of sppt through all ages and in males and females has significantly decreased in 1997 which these findings consistent with the results of other studies . another similar study conducted in iran showed the decreasing trend in the incidence rate of tb after year 1992 . this study indicated that one reason may be the successful implementation of tb programs in iran . although the incidence trend of tb is declining nationally , but the results of province studies might be difference . a study conducted in hamadan province , western iran , to determine the epidemiological status of tb over a 7-year period , demonstrated that the incidence rate of all tb classifications has increased significantly during the study period . with regard to the implementation of the dots strategy in 1995 in iran and also in many other countries around the world ; therefore , it can be noted that by the implementation of this strategy , many patients with sppt after a treatment period , they were completely and successfully cured . thus , we prevented from the spreading the disease to other individuals and its spread in the community and therefore a significant decline was found in the incidence trend of sppt in iran and other countries . so that after the implementation of global dots strategy as a direct measurement of tb intensity control to measure and identify smear - positive tb cases , the results of various studies have reported a significant decrease in the tb incidence . as a result , five countries have experienced more than 10% reduction in the tb incidence due to the implementation of dots strategy . on the other hand , sharp decreasing trend in 19951997 years could be due to consequences of predisposing factors such as increased primary health cares , reducing of immigrants and the persistence of tb treatment in the country . political and social changes in the neighboring countries , particularly afghanistan ( afghan civil war in 19921996 ) caused enormous afghan refugees into iran during the years of war in afghanistan . forasmuch as tb is closely associated with poverty , malnutrition , overcrowding and inadequate housing . therefore , immigrants and refugees are considered as the groups at higher risk of tb . some of high incidence rate of sppt in 1995 can be attributed to this subject . in a study conducted in italy , immigration and aids created two onward in the trend of tb in 1988 and 1996 , respectively . according to the results in this study , the sppt incidence rate at the beginning period of assessment was higher in women than men , but this trend , at the end of period , increased in men . in an investigation on tb epidemiology in iran during 20012008 reported the decreasing incidence trend of tb among women and the increasing trend for both sexes over 65 years of age . however , studies conducted in ethiopia and bhutan showed that the incidence rate of sppt in men were always more than women . the higher incidence rate of sppt in women than in men can be attributed to several factors . for example , women are more sensitive about their health status and with onset of disease symptoms , they refer to health centers . gender differences due to health related outcome , as a possible another reason in this regard , has been reported . on the other hand , the increasing of public awareness in terms of tb disease and improving health care services in our country could be important factors to increase the trend of identifying sppt among men . moreover , according to social and cultural conditions in which men have more outside occupation of the house than women and they are in the crowded places , they might be more likely exposed to mycobacterium tuberculosis . another reason about this finding should be considered that men are at a greater risk of hiv compared to women due to some high risk behaviors such as unsafe injection drug . hiv infection increases the risk of tb several more times and then the increasing rate of sppt in men is explainable compared to women . the results of this study suggest that the sppt incidence rate in 014 and 1564 year age groups have downturn trend . in the age group over 65 years , the rate has significantly decreased in the first point of period ( 19951997 ) but in the end of that ( 19972012 ) had upward trend . this finding is homogenous with findings of saudis studies , but does not consistent with the results of studies which conducted in zambia and butane . to explain these findings , we should consider variety of factors including age - related diseases ( e.g. , malignancy and diabetes ) , poor nutrition , immunosuppression , chronic renal failure , that is the increasing result of tb risk in older people . this study had some limitations . because of lack of access to data , changes in trend of some indices of sppt ( such as ; treatment success rate , case detection rate , failure in treatment rate , sppt mortality rate ) and also by separate provinces were not assessed . another limitation of the study is failure to examine the effect of related factors on the tb incidence such as hiv co - infection , ethnic groups , geographical regions , and individual 's socioeconomic status . the third limitation is the under reporting of the cases because of passive surveillance system for tb control program , especially in small cities . according to the results of this study , a downward trend in the sppt incidence was seen after the implementation of dots strategy and the results might be due to the success of the strategy . accordingly , the program should continue with more sensitivity and accuracy in the country . it seems that to achieve the set goals and high successful in tb control program , especially reduction in sppt , pay more attention to old age and males should be considered . in addition , improvement of clinical and medical care services and notification processes would be imperative .

background : describing trend in tuberculosis ( tb ) over time can play an important role to assess the disease control strategies and predict the future morbidity and mortality . this study aimed to determine the incidence trend of smear - positive pulmonary tuberculosis ( sppt ) in sub - age and sex groups during the years of 19952012.methods:this retrospective cohort study was performed in 2015 by using the dataset regarding national statistics of sppt reported by world health organization during 19952012 . annual percent changes ( apcs ) and average annual percent changes ( aapcs ) were estimated to determine the summery statistics of trend using segmented regression model.results:during 19952012 , there were 96,579 sppt case notifications in iran ( male to female ratio : 0.99 ) . there was only one change point in 1997 for sppt incidence in subgroups of age and sex during 19952012 . the aapcs for both genders and also all three age groups had a significant descending trend during the time period ( p < 0.05).conclusions : our results showed a downward trend in the sppt incidence . it seems that to achieve the set goals and high successful in tb control program especially reduction in sppt , pay more attention to old age and males should be considered . in addition , improvement of clinical and medical care services and notification processes would be imperative .

INTRODUCTION METHODS Study design and dataset Procedures Statistical analysis RESULTS DISCUSSION CONCLUSIONS Financial support and sponsorship Conflicts of interest

nurses , as the most significant and largest human resource of healthcare organizations , play a vital role in improving the social health of a community , such that no healthcare organizations can achieve any success without having efficient nurses ( 1 ) . considering the annual estimation of 1.8 million hospitalized children , it seems necessary to determine the efficiency of hospital resources for taking care of these children ( 2 ) . high self - efficacy increases the quality of care services provided and ultimately improves individual and organizational performance ( 3 - 5 ) . self - efficacy is one of the applied concepts in bandura 's social cognitive learning theory on professional behavior . self - efficacy reflects an individual s beliefs with regard to his or her capabilities to perform specific behaviors leading to certain outcomes . bandura introduced a new approach to human behavior in which individuals trust is a key element in their control and action ( 6 , 7 ) . professional self - efficacy deals with specific behaviors and performance , such as academic or professional success ( 8) . self - efficacy is introduced as the main predictor of nurses behavior and plays an important role in nurses professional behavior ( 9 , 10 ) . it resembles a structure affecting one s motivation , learning , skill development , and professional progress . high self - efficacy leads to the affective utilization of cognitive , meta cognitive , and other performances in many areas ( 11 ) . nursing studies indicate that self - efficacy and the acquisition of clinical skills are correlated and an increase in self - efficacy reduces the gap between theory and practice ( 12 ) . they also indicate that self - efficacy not only affects nurses caring capabilities , but also prevents many clinical errors ( 13 ) . individuals identify their capabilities by with knowing more aspects of capabilities and abilities are considered a great help by overcoming psychological pressures to meet individual and organizational objectives . thus , knowing concepts such as nurses self - efficacy and threatening factors , particularly in the realm of pediatric care , which is one of the most vulnerable parts of the healthcare system , is necessary . considering the fact that self - efficacy is a personal and context - based issue ( 7 ) , this research was conducted to introduce threats to the caring self - efficacy concept from pediatric nurses viewpoint so that appropriate plans can be designed to improve pediatric nurses self - efficacy and the quality of pediatric care . this paper is part of a nursing doctorate thesis conducted in 2014 in iran to clarify the caring self - efficiency concept among pediatric nurses . the study was conducted usingqualitative content analysis . considering the significance of a detailed review of individuals experiences , 27 pediatric nurses and clinical directors of isfahan hospital and clinical nursing professors on thepediatric faculty of the nursing and midwifery college of isfahan were selected through purposive sampling . the inclusion criteria were having a bs or a higher degree in nursing , having at least one year of clinical experience , and a willingness to share one s experience . the interviews commenced by the interviewer introducing himself / herself and a short description on the objectives of the study . interviews lasted from 28 to 60 minutes and were conducted in a peaceful place chosen by the participants . the interview manual contained several questions such as , what does self - efficacy mean in caring for children ? and based on your experience , what is a threat to nurses self - efficacy ? sampling continued until data saturation . along with data collection , the data were analyzed using the conventional content analysis method . the recorded interviews were transcribed verbatim . as an in - depth analysis is required in such qualitative research projects , the researcher listened to the interviews several times and reviewed the transcripts word by word and line by line to select the unit of analysis , determine the important sentences and phrases as meaning units , and condense sentences and phrases as condensed meaning units to extract the words containing the key concepts or units of meaning . the researcher labeled condensed meaning units as codes and extracted the primary codes from statements made by the interviewees and participants . then the codes were reviewed in a continuous process from the extraction to naming step . then , similar codes were merged and categorized . then based on the ideas contained in the categories , the naming and subcategories emerged . the extracted subcategories were then compared with one another . in cases of similarity , they were merged if possible . the main themes were revealed ultimately ( 14 , 15 ) . to ensure data accuracy , in addition , to increase the reliability of the study , adequate time was dedicated by the researcher to provide information to participants , maintaining contact with participants to gain their trust , reviewing the data continuously , reviewing the extracted codes with some of the participants , peer - reviewing the findings , and using their views for amendments . interviews and coding were conducted by the first researcher , and two expert professors of qualitative research supervised and audited the entire research procedure . the utilization of several data collection methods and the consideration of maximal variation ( with regard to age , work experience , different social and economic status ) in the selection of participants made data transferability possible . the immediate transcription of interviews and direct quotes made data entry possible . the study was confirmed by the ethical committee of isfahan university of medical sciences , and the approval code was 392258 . to respect participants rights , the objective of the study , confidentiality of their information , and their right to withdraw from the interview were explained to them before the interview , and informed consent was obtained . the time and location of interviews the raw data , including the interviews , are stored in a safe place accessible only to the research team . there were 27 participants , including 19 pediatric nurses , 4 pediatric headnurses , 1 supervisor , and 3 pediatric nursing instructors between 27 and 49 years old and with work experience ranging from 3 to 25 years . twenty - five of the participants were female and the rest were male ; 21 had a bs degree , 5 had an ms degree , and 1 had a phd degree in nursing ( demographic properties are presented in table 1 ) . theme was one of the main extracted themes in the recent study , which was comprised of two main categories : individual barriers and organizational barriers . not having a caring attitude was the main contributor to how self - efficacy is perceived and how the profession is liked . it sometimes gets difficult ; there are lots of pressures , but a mother s prayer or child s smile makes us forget all these difficulties and pressures . it is sweet to us and gives us the good feeling that we have done something positive for the kid . participant 15 said , a self - efficient pediatric nurse would work with great passion , love , and enthusiasm . participants mentioned that liking children would cause nurses to make a greater attempt in taking care of children . if you love them , you actlike it , you look at them , and you care for them in time , and you enjoy all these things . participant 17 mentioned,i think the nurses who love children and care for them have greater self - confidencedue to the fact that dealing with kids takes a special person . the analysis of interviews revealed that an inefficient educational and professional system can serve as a threat to nurses self - efficacy . this category is comprised of 5 subcategories , including inefficient educational system , not developing professional capabilities , not valuating the organization in the concept of caring , poor rewards system , and inappropriate managerial strategies . according to nurses , their self - efficacy begins when they attend a university . however , the participants mentioned that nurses performance and students experience during their clinical training , due to the specific conditions and sensitivity of pediatric wards , were not highly efficient and the gap between theory and practice is wider in pediatric wards . this is detrimental to nurses perception of their self - efficacy when they start their profession in a pediatric ward . this was confirmed by participant 4 ( a nurse ) , stating that , a pediatric ward is of greater sensitivity ; drug doses and vein finding are important . nurse can perform their duties in adult wards with more ease , but pediatric wardsareof supreme sensitivity . as personnel are aware of such sensitivity , they do nt delegate such tasks to nurses ; that s why nurses in pediatric wards have less practice and experience , which leads to a lower level of self - confidence . participant 1 ( an instructor ) mentioned that,if we procure enough facilities for nurses so they can experience different scenarios and acquire more skills during their education , they will then achieve a higher level of self - efficacy . the educational system should provide more facilities for the rare cases and caring of the diseases with low incidence , so the nurses can experiment insimulated conditions and thus gain experience . if students gain enough experience during their education , they will have greater self efficacy . this category refers to opportunities that need to be created by managers to improve nurses knowledge and skills in specialized pediatric care , leading to nurses professional development and growth and enhanced confidence in their positive role . the personnel are mainly geared toward garnering scores for the end of june rather than learning practical knowledge . participant 24 said , for self - efficacy , there must be no distance between clinical practice and instruction . nurses must try to take part in classes and re - instructive courses to improve their skills and self - efficacy such that no other child is hurt . nurses statements indicated that an organizational respect for nurses caring profession , particularlyfrom doctors point of view , and acknowledging them as members of the treatment team , is one the most significant issues affecting nurses self - efficacy . participant 22 mentioned , a nurse will feel satisfied , self - confident , and pleased if she is viewed as an effective member of the treatment team . i believe our nurses should be acknowledged , respected , and valued . as a simple example , we write down our nursing reports , but who has even read them ? confirming the above statement , participant 18 mentioned , if the doctor believes in nurses ideas and performance , then the nurses would trust themselves more than before . this category indicates that factors such as supporting and offering verbal or non - verbal acknowledgements would motivate nurses and make them feel valued . participant 23 stated , our work is not usually acknowledged , and we are not usually thanked for what we do . that is why i may not have many good experiences and memories , which affects my self - efficacy greatly . it would be of great help , at least in the first few working years . a verbal encouragement , or even a distinction between efficient and inefficient nurses , would suffice . this would be a pivotal point for the continuation , or even improvement , of nurses self - efficacy . participants maintained that the clinical directors impeded nurses realization of their self - efficacy by employing inappropriate managerial strategies . unfortunately , hospital policies do not specify clear plans for the nurses for their evaluation . from the participants viewpoint , not having a caring attitude was the main contributor to how self - efficacy is perceived and how the profession is liked . it sometimes gets difficult ; there are lots of pressures , but a mother s prayer or child s smile makes us forget all these difficulties and pressures . it is sweet to us and gives us the good feeling that we have done something positive for the kid . participant 15 said , a self - efficient pediatric nurse would work with great passion , love , and enthusiasm . there is no sense of obligation in this work . participants mentioned that liking children would cause nurses to make a greater attempt in taking care of children . if you love them , you actlike it , you look at them , and you care for them in time , and you enjoy all these things . participant 17 mentioned,i think the nurses who love children and care for them have greater self - confidencedue to the fact that dealing with kids takes a special person . from the participants viewpoint , not having a caring attitude was the main contributor to how self - efficacy is perceived and how the profession is liked . it sometimes gets difficult ; there are lots of pressures , but a mother s prayer or child s smile makes us forget all these difficulties and pressures . it is sweet to us and gives us the good feeling that we have done something positive for the kid . participant 15 said , a self - efficient pediatric nurse would work with great passion , love , and enthusiasm . there is no sense of obligation in this work . participants mentioned that liking children would cause nurses to make a greater attempt in taking care of children . if you love them , you actlike it , you look at them , and you care for them in time , and you enjoy all these things . participant 17 mentioned,i think the nurses who love children and care for them have greater self - confidencedue to the fact that dealing with kids takes a special person . the analysis of interviews revealed that an inefficient educational and professional system can serve as a threat to nurses self - efficacy . this category is comprised of 5 subcategories , including inefficient educational system , not developing professional capabilities , not valuating the organization in the concept of caring , poor rewards system , and inappropriate managerial strategies . according to nurses , their self - efficacy begins when they attend a university . however , the participants mentioned that nurses performance and students experience during their clinical training , due to the specific conditions and sensitivity of pediatric wards , were not highly efficient and the gap between theory and practice is wider in pediatric wards . this is detrimental to nurses perception of their self - efficacy when they start their profession in a pediatric ward . this was confirmed by participant 4 ( a nurse ) , stating that , a pediatric ward is of greater sensitivity ; drug doses and vein finding are important . no proper training is usually offered to nurses in this regard . nurse can perform their duties in adult wards with more ease , but pediatric wardsareof supreme sensitivity . as personnel are aware of such sensitivity , they do nt delegate such tasks to nurses ; that s why nurses in pediatric wards have less practice and experience , which leads to a lower level of self - confidence . participant 1 ( an instructor ) mentioned that,if we procure enough facilities for nurses so they can experience different scenarios and acquire more skills during their education , they will then achieve a higher level of self - efficacy . the educational system should provide more facilities for the rare cases and caring of the diseases with low incidence , so the nurses can experiment insimulated conditions and thus gain experience . if students gain enough experience during their education , they will have greater self efficacy . this category refers to opportunities that need to be created by managers to improve nurses knowledge and skills in specialized pediatric care , leading to nurses professional development and growth and enhanced confidence in their positive role . the personnel are mainly geared toward garnering scores for the end of june rather than learning practical knowledge . participant 24 said , for self - efficacy , there must be no distance between clinical practice and instruction . nurses must try to take part in classes and re - instructive courses to improve their skills and self - efficacy such that no other child is hurt . nurses statements indicated that an organizational respect for nurses caring profession , particularlyfrom doctors point of view , and acknowledging them as members of the treatment team , is one the most significant issues affecting nurses self - efficacy . participant 22 mentioned , a nurse will feel satisfied , self - confident , and pleased if she is viewed as an effective member of the treatment team i believe our nurses should be acknowledged , respected , and valued . as a simple example , we write down our nursing reports , but who has even read them ? confirming the above statement , participant 18 mentioned , if the doctor believes in nurses ideas and performance , then the nurses would trust themselves more than before . this category indicates that factors such as supporting and offering verbal or non - verbal acknowledgements would motivate nurses and make them feel valued . participant 23 stated , our work is not usually acknowledged , and we are not usually thanked for what we do . that is why i may not have many good experiences and memories , which affects my self - efficacy greatly . it would be of great help , at least in the first few working years . . a verbal encouragement , or even a distinction between efficient and inefficient nurses , would suffice . this would be a pivotal point for the continuation , or even improvement , of nurses self - efficacy . participants maintained that the clinical directors impeded nurses realization of their self - efficacy by employing inappropriate managerial strategies . unfortunately , hospital policies do not specify clear plans for the nurses for their evaluation . . however , the participants mentioned that nurses performance and students experience during their clinical training , due to the specific conditions and sensitivity of pediatric wards , were not highly efficient and the gap between theory and practice is wider in pediatric wards . this is detrimental to nurses perception of their self - efficacy when they start their profession in a pediatric ward . this was confirmed by participant 4 ( a nurse ) , stating that , a pediatric ward is of greater sensitivity ; drug doses and vein finding are important . no proper training is usually offered to nurses in this regard . nurse can perform their duties in adult wards with more ease , but pediatric wardsareof supreme sensitivity . as personnel are aware of such sensitivity , they do nt delegate such tasks to nurses ; that s why nurses in pediatric wards have less practice and experience , which leads to a lower level of self - confidence . participant 1 ( an instructor ) mentioned that,if we procure enough facilities for nurses so they can experience different scenarios and acquire more skills during their education , they will then achieve a higher level of self - efficacy . the educational system should provide more facilities for the rare cases and caring of the diseases with low incidence , so the nurses can experiment insimulated conditions and thus gain experience . if students gain enough experience during their education , they will have greater self efficacy . this category refers to opportunities that need to be created by managers to improve nurses knowledge and skills in specialized pediatric care , leading to nurses professional development and growth and enhanced confidence in their positive role . the personnel are mainly geared toward garnering scores for the end of june rather than learning practical knowledge . participant 24 said , for self - efficacy , there must be no distance between clinical practice and instruction . nurses must try to take part in classes and re - instructive courses to improve their skills and self - efficacy such that no other child is hurt . nurses statements indicated that an organizational respect for nurses caring profession , particularlyfrom doctors point of view , and acknowledging them as members of the treatment team , is one the most significant issues affecting nurses self - efficacy . participant 22 mentioned , a nurse will feel satisfied , self - confident , and pleased if she is viewed as an effective member of the treatment team i believe our nurses should be acknowledged , respected , and valued . as a simple example , we write down our nursing reports , but who has even read them ? confirming the above statement , participant 18 mentioned , if the doctor believes in nurses ideas and performance , then the nurses would trust themselves more than before . this category indicates that factors such as supporting and offering verbal or non - verbal acknowledgements would motivate nurses and make them feel valued . participant 23 stated , our work is not usually acknowledged , and we are not usually thanked for what we do . that is why i may not have many good experiences and memories , which affects my self - efficacy greatly . it would be of great help , at least in the first few working years . a verbal encouragement , or even a distinction between efficient and inefficient nurses , would suffice . this would be a pivotal point for the continuation , or even improvement , of nurses self - efficacy . participants maintained that the clinical directors impeded nurses realization of their self - efficacy by employing inappropriate managerial strategies . unfortunately , hospital policies do not specify clear plans for the nurses for their evaluation . the findings of this study clarify the threats to pediatric nurses perception of self - efficacy from their viewpoint . the findings indicate that lacking a caring attitude and not liking and being interested in children are among the most important individual barriers to pediatric nurses perception of self - efficacy . in fact , it seems that , giving that the purpose of the nursing profession is to help invalids ( 16 ) , a positive attitude and personal willingness are required personal characteristics for pediatric caring profession . the studies also show that this works as the driving force and gives meaning and sense to the nursing profession . maintaining a positive caring approach and nurses with such a personal trait seem to have changed their approach have gained a psychological immunity , and exhibit their capabilities with greater confidence ( 17 ) . the results of the current study indicate that an inefficient educational system is an organizational barrier to nurses self - efficacy . the pediatric nurses emphasized that the intern nurses and newly employed nurses were not ready to perform healthcare tasks in the pediatric ward due to the inefficient university education , and they began working in the pediatric ward with fear , anxiety , and feeling inefficient in caring for children . the main focus of formal nursing trainings is unfortunately on adults , and nurses experiences during their trainings mainly involve adult patients . as pediatric nursing students deal with weaker and more fragile patients and need to face the challenge of interacting with the children s family members , their experiences most of the participants , particularly instructors , emphasized that due to limitations in pediatric clinical trainings , simulators can serve as efficient aids to clinical trainings . many studies , including experimental research , show that simulation programs have a positive effect on nursing students and nurses sense of self - efficacy ( 19 , 20 ) . considering the progress of technology and science in the fields of nursing and medical sciences , nurses professional capabilities also need to be developed . results obtained by aghdami also showed that insufficient re - instructive courses are one of the most significant barriers to the fulfillment of pediatric nurses technical duties ( 21 ) . participants also believed that lack of a rewards system and inappropriate managerial policies , including the non - application of cooperative management by nursing directors , impacts nurses inefficiency . in bandura s view , a proper rewards system including verbal compliment and feedback received from social environments is among the most common and easiest sources of self - efficacy creation and improvement . verbal convincing and verbal encouragements , such as telling them they have the prerequisites to be successful and reach their goals , can improve their sense of self - efficacy ( 22 , 23 ) . in addition , manojlovich study revealed that providing encouragement and complements , even verbally , improves nurses self - efficacy and performance ( 10 ) . for nurses to feel efficient , their directors and nurses should encourage and compliment them , accept , support , and reassure them . managers can help to enhance nurses self - efficacy through emotional encouragement ( 24 ) . . showed in their semi - experimental study that there is a significant relationship between managerial qualities and nurses perception of their capabilities ( 25 ) . participants also stated that a lack of teamwork and cooperative management , not allowing them to make decisions , and limiting nurses to pre - planned tasks mars nurses sense of self - efficacy . study also showed that the improper distribution of power , a lack of freedom , and not contributing to decision making reduce nurses sense of self - efficacy and professional health and efficiency , as well as increases their tension , absence , and inability to provide quality caring services ( 26 ) . nursing director s management method affects nurses quality of life and their capabilities ( 27 ) . thus , in today s world in which thought and human capital areof prime importance , the identification of these criteria would help managers and nursing directors to change their attitude and managerial and educational strategies to overcome the barriers to nurses sense of self - efficacy and pave the way for improving the quality of their caring services , enhancing patients satisfaction , and improving the social status of the nursing profession . although the subjective nature of the data collection limits the generalizability of this study s results , the strong points of this study were choosing subjects from among experienced people with different nursing educational qualifications and utilizing maximal variation ( with regard to age , work experience , different social and economic status ) in the selection of participants , which make the results largely applicable in similar units .

background : nurses are considered the largest and most important human resource for healthcare organizations . self - efficacy as the main predictor of nurses behavior plays an important role in nurses professional behavior . however , the various dimensions and threats of caring self- efficacy concept have not been taken into consideration.objectives:the present paper attempts to identify threats to self - efficacy as an important aspect of the concept of pediatric nurses caring self-efficacy.materials and methods : this study is part of a larger study on the caring self - efficacy concept that was conducted through content analysis and from a qualitative approach in 2014 in iran . twenty - seven nurses and pediatric clinical instructors participated in this research according to the purposive sampling method employed in the study . data were collected through semi - structured interviews . the collected data were analyzed using the conventional content analysis method.results:threats to self - efficacy was one of the main themes extracted from the interview analysis results in the present study . the theme consists of two main categories individual barriers , including not having a caring attitude and not being interested in children , and organizational barriers , including an inefficient educational system , not developing professional capabilities , non - valuation of the organization in a caring context , a poor rewards system , and inappropriate managerial policies.conclusions:nursing management and custodians of nursing trainings can break through the barriers to self - efficacy by knowing these factors and making changes in the educational programs and providing supporting policies . this can be an important step toward improving nurses inefficacy and ultimately improving the provision of quality healthcare services .

1. Background 2. Objectives 3. Materials and Methods 4. Results 4.1. Individual Barriers 4.1.1. Not Having a Caring Attitude 4.1.2. Not Being Interested in Children 4.2. Organizational Barriers 4.2.1. Inefficient Educational System 4.2.2. Not Developing Professional Capabilities 4.2.3. Not Valuating the Organization in the Concept of Caring 4.2.4. Poor Rewards System 4.2.5. Inappropriate Managerial Strategies 5. Discussion

cutaneous lymphomas form the second most common group of extranodal non - hodgkin 's lymphoma . t - cell lymphomas comprise 65% of the cases , whereas b - cell lymphomas form 25% of the cutaneous lymphomas . primary cutaneous anaplastic large cell lymphoma ( pcalcl ) forms 9% of the cutaneous t - cell lymphomas . there are three types of anaplastic large cell lymphoma : pcalcl , primary systemic anaplastic lymphoma kinase ( alk)-positive alcl , and primary systemic alk - negative alcl . the diagnosis of primary cutaneous alcl is made only if the lesions are limited to the skin for at least 6 months after the initial identification . therefore , regular follow up of these patients is important to rule out any systemic disease . a 35-year - old man presented with a complaint of asymptomatic red raised nodule over chin for last 15 days . after a few days , the lesion increased in size and progressed to form an erythematous nodule , which used to bleed easily . on cutaneous examination there was a single well - defined exophytic erythematous nodule of size 4 3 cm approximately , with a glistening surface [ figure 1 ] . lesion used to bleed easily on touch and was nontender . in view of these clinical findings complete hemogram , routine biochemistry , hiv test , and chest x - ray were within normal limit . fine - needle aspiration cytology ( fnac ) from the lesion revealed cellular smears comprising of large atypical lymphoid cells in isolation . the dermis showed diffuse infiltrate of large atypical lymphoid cells with pleomorphic round to irregular horse shoe - shaped nuclei , finely granular chromatin , multiple nucleoli , and moderate cytoplasm . in addition there were increased apoptotic cells , neutrophils , and erythrophagocytosis [ figure 2 ] . keeping in view the histopathology , and cd45 and cd30 positivity , the diagnosis of alcl was made . ultrasonography of neck revealed regional cervical lymphadenopathy involving levels i iii ; largest lymph node measuring 0.4 0.3 cm . the patient was started on chop regimen , which consisted of cyclophosphamide , doxorubicin , vincristine , and prednisolone . after first cycle of chemotherapy there was a significant reduction in the size of the lesion [ figure 5 ] . exophytic erythematous nodule mimicking a large pyogenic granuloma in the submandibular region photomicrograph showing diffuse infiltrate of large atypical lymphoid cells with pleomorphic round to irregular nuclei ( h and e , 40 ) tumor cells showing 1 + positivity for cd45 tumor cells showing strong ( 4 + ) cd30 membranous positivity improvement in lesion after first cycle of chemotherapy lymphoproliferative disorders of the primary cutaneous cd30 + type , of t - cell origin , consist of lymphomatoid papulosis , and cd30 + anaplastic large cell lymphoma . it commonly affects the trunk , extremities , and presents as solitary or multiple localized nodules with ulceration . but , sometimes it resembles other dermatological diseases like eczema , pyoderma gangrenosum , pyogenic granuloma , morphea , and squamous cell carcinoma . pyogenic granuloma is a common benign vascular tumor , which appears as a smooth , lobulated , exophytic mass , exhibiting pink to reddish - purple color , which can bleed on slight manipulation . cutaneous cd30 + anaplastic large cell lymphoma ( alcl ) is characterized by presence of cd30 expression in more than 75% of neoplastic cells . presence of cytogenetic abnormality , that is , nonrandom t(2 ; 5 ) ( p23 ; q35 ) chromosomal translocation which involves fusion of anaplastic lymphoma kinase ( alk ) with the nucleophosmin ( npm ) gene is usually seen in systemic alcl but only rarely in pcalcl . pcalcl usually presents as a solitary papulonodular lesion , which sometimes shows ulceration . our case presented with a large pyogenic granuloma - like lesion . reported a case of systemic alcl with local cutaneous involvement in the form of nonhealing pyogenic granuloma - like lesion in the right axillary area . reported a case of 57-year - old man who presented with asymptomatic lobulated erythematous nodule on the gingiva mimicking pyogenic granuloma . there was no regional lymphadenopathy and systemic involvement ; however , he was hiv positive . our patient had a similar morphology of lesion but he was younger in age , immunocompetent , and had regional lymphadenopathy . generalized or multifocal lesions are seen in about 20% of the patients . secondary regional lymphadenopathy is seen in approximately 25% of patients and it does not correlate with the prognosis of the disease . in our patient , systemic alcl was ruled out as all the related investigations were within normal limit and there was no systemic lymphadenopathy . a five - year survival rate of pcalcl is more than 90% but cutaneous disease arising from systemic alk expression in cutaneous lesions usually indicates systemic disease but rarely , it can be positive in pcalcl . also negative expression of alk does not rule out systemic disease as 20%60% of systemic alcl can be alk negative . twenty - five percent of the cases of primary cutaneous anaplastic cd30 + large t - cell lymphoma can also remit spontaneously . alcl can have varied cutaneous presentations . being uncommon , it may be missed . as the cutaneous lesions can be the only manifestation in a case of systemic alcl , clinicians should keep a high suspicion so that the disease can be detected at an early stage .

primary cutaneous anaplastic large cell lymphoma ( pcalcl ) forms 9% of the cutaneous t - cell lymphomas . it usually presents as solitary reddish brown ulcerating nodule or indurated plaque . sometimes , it mimics other dermatological diseases such as eczema , pyoderma gangrenosum , pyogenic granuloma , morphea , and squamous cell carcinoma . our case presented with large pyogenic granuloma like lesion with regional lymphadenopathy . since pcalcl is rare , one can misdiagnose such cases and therefore high index of suspicion is necessary .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

head and neck irradiation almost always entails irradiation of at least a part of the mandible ; hence it is the commonest bone manifesting various radiation effects . asymptomatic bone changes could include decreased bone density in the irradiated region , delayed wound healing and cortical bone destruction , thereby increasing the possibility of serious side effects such as osteoradionecrosis ( orn ) and fractures . we describe a late spontaneous pathologic fracture in a case of carcinoma tongue and the implications of such developments for radiation oncologists . a 55-year - old lady , with no comorbid conditions and no history of tobacco or alcohol intake , was evaluated at our institute nearly 9 years ago for a 2-month ulcerating lesion over left lateral border of tongue , not healing with conservative management . following examination and biopsy , a squamous cell carcinoma of oral tongue t2n0m0 she underwent partial glossectomy and ipsilateral supraomohyoid neck dissection , revealing a 2.2 cm 1.5 cm infiltrative growth with clear margins , depth of 6 mm , no perineural or lymphovascular invasion , and negative nodes ( 0/8 ) . she was advised adjuvant irradiation and received 60 gray in 30 fractions , 5 fractions / week , by cobalt-60 unit using lateral opposed portals . she tolerated the treatment well and was on regular follow - up as per institutional protocol , with no specific events . eight years after completion of her treatment , she reported to our clinic with the complaint of sudden onset oral pain and inability to open her mouth or eat . there was no history of any dental or oral procedures , oral infections or trauma preceding her complaints . on examination pantomogram was done , which showed a comminuted fracture at both angles of the jaw , just posterior to the last molars [ figure 1 ] . she was subsequently referred to the head and neck surgery department , where she underwent plate reconstruction for correction after initial conservative management . ( a ) and ( b ) anterior and lateral views of the patient showing the facial appearance . the mandible is the longest bone in head and neck region , and commonest bone affected is head and neck irradiation due to its unique location bearing the lower set of teeth , high density , and poor vascular supply compared with other bones in this region . complication risk is highest in the region of premolar , molar and retromolar trigone due to high density and low vascularity . it has an / ratio of 0.85 , suggesting it is a late reacting tissue and high sensitivity to large doses per fraction . most cases of osteonecrosis post - radiotherapy ( rt ) occur within first 23 years after treatment , but patients remain at indefinite risk due to ongoing changes in the bone due to age , altered oral microflora and dental infections . in early 1980s , marx redefined the pathophysiology of orn by proposing that rt induces endarteritis that results in tissue hypoxia , hypocellularity , which in turn causes tissue breakdown and chronic non - healing wounds . several factors that are associated with risk of bone injury or orn include patient factors ( deep parodontitis , bad oral hygiene , alcohol and tobacco abuse , bone inflammation , immune deficiencies , malnutrition , dental injury or extraction after rt ) , tumor factors ( tumor size , stage , proximity of tumor or nodes to bone , tumor location ) and treatment factors ( pre - irradiation bone surgery , surgical handling of bone or its vascular supply , rt dose , biologically effective dose , photon energy , brachytherapy dose rate , combination of external beam irradiation and interstitial brachytherapy , field size , fraction size , volume of the mandible irradiated with a high dose ) . a diagnosis of orn of bone mandates radiological evidence of bone necrosis within the radiation field , without any evidence of tumor recurrence . incidence varies from 2% to 22% in various series , and is higher in dentate patients compared to edentulous patients . clinical manifestations may include pain , orofacial fistulas , exposed necrotic bone , pathologic fractures or suppuration . pathologic fractures may be spontaneous ( 35% ) , occurring usually within the first 2 years of irradiation , while traumatic fractures related to dental procedures are more common but occur late . the highest incidence of orn has been reported with brachytherapy of oral lesions if the rt source lies in close proximity to the bone . external beam rt , especially when using kilovoltage or low energy ( 14 mv ) x - rays or electron beam , leads to high radiation absorption within the bone . this risk was greatest with the older techniques when use of large open parallel - opposed fields led to the inclusion of large areas of bone within the radiation portal , exposing it to high doses . modern techniques have been able to circumvent this problem to a large extent by conforming the high dose areas to the tumor bed only while minimizing the dose delivered to normal structures including mandible . given the severe quality of life implications of bone complications , preventive measures in the form of meticulous oral hygiene and dental evaluation before and after irradiation , improvement in rt techniques such as intensity modulation and development of reliable diagnostic and therapeutic procedures have gained importance in recent years . important considerations include completion of any necessary dental procedures such as extraction and management of periodontal disease prior to starting rt , education on lifelong use of high fluoride content dental gels and toothpastes , and minimal soft tissue trauma during extraction , and an interval of at least 2 weeks between extraction and rt commencement to allow healing . rt technique should allow adequate sparing of salivary glands to prevent oral dryness , prevention and avoid high dose regions within mandible and teeth . management of oral mucositis during treatment with soda - saline mouthwashes , antibiotics and antifungals , and use of spacers between mandible and brachytherapy source would reduce chances of oral infections and bone necrosis . post - treatment regular dental examination , fluoride prophylaxis and delaying use or dentures till 912 months following rt would help prevent most instances or risks of orn . bilateral mandibular pathologic post - radiation fracture is a very uncommon but serious late complication , with a huge impact on subsequent quality of life , and thus , preventive measures are necessary to minimize the risk .

mandible is the most frequently affected bone during head and neck irradiation . late changes in the mandible may manifest in the form of reduced bone density , dental caries , loss of spongiosa trabeculations , delayed healing following dental extraction , pathologic fractures , osteoradionecrosis , trismus , growth defects in children or second malignancies . pathologic fractures of mandibular bone are rare and may be spontaneous or traumatic ( following dental extraction ) . we report the case of a 55-year lady , who had undergone surgery and adjuvant radiotherapy for carcinoma oral tongue t2n0m0 on a cobalt-60 unit and was disease - free . after a follow - up of 8 years post - irradiation , she presented with sudden onset oral pain and inability to open mouth . pantomogram showed fracture at the junction of body and ramus of the mandible bilaterally .

INTRODUCTION CASE REPORT DISCUSSION

repair of undescended testis ( udt ) with hypospadias is rarely done simultaneously and there are more chances of fistula formation due to lack of adequate vascular cover for the neourethra.objective of this technique was to use processus vaginalis as vascular cover to reinforce the urethra . a 12-year - boy was presented with proximal penile hypospadias and bilateral palpable undescended testis . after release of chordee , tube pedicle urethroplasty ( duckett 's ) was done.the required 5 cm long tube was constructed on number 10 feeding tube.we routinely do proximal anastomosis first before making the tube . to prevent complications like fistula , the urethral repair needs vascular cover . at this juncture , we planned to do orchidopexy along with the repair of hypospadias . inguinal crease incision was taken on right side and herniotomy done close to the internal ring . after mobilizing the cord structure proximally , testis was brought down into scrotum along with its processus vaginalis [ figure 1 ] . testis was fixed into extra dartos pouch and processus vaginalis was cut open to form the flap [ figure 2 ] . this processus vaginalis was used to cover the neourethral repair as a blanket wrap [ figure 3 ] . the postoperative course was uneventful and patient voided single good stream on day 10th of operation . testis separated from prossess vaginalis testis brought in scrotum with processes vaginalis processess vaginalis wrap over neourethra there are various methods for protective intermediate vascular cover to the neourethra that would prevent fistula formation , for e.g. , snow ( 1986 ) described the use of tunica vaginalis wrap ; retik was the first to use dorsal subcutaneous flap from the prepuce ; motiwala described the use of dartos flap from the scrotum ; tunica vaginalis wrap is the most common method used with good results and long - term follow - up . in patients of hypospadias associated with the undescended testis , as scrotum is not well developed because of undescended testis , one can not get easily the dartos fascia for cover of urethral repair . yamataka et al . , described method of using gubernaculum as vascular cover after dissecting it from testis and leaving its anomalous distal attachment to the pubic tubercle intact , but the limitation of gubernaculum is that it is not long enough to cover whole urethra . we present a case where we could develop processus vaginalis flap and do orchidopexy to reinforce neourethra with processus vaginalis giving good results . our technique is useful to cover the anastomosis and suture line and simultaneously allow repair of udt . processes vaginalis is long and can be easily brought down with testis possessing good vascular supply . in order to achieve adequate mobilization of processus vaginalis there are no reports in literature regarding use of processus vaginalis as vascular cover and this simple technique would reduce the complication rate of hypospadias repair with udt .

incidence of the undescended testis ( udt ) along with hypospadias varies from 6 to 31% . the repair of udt and hypospadias is rarely done simultaneously . here we present a novel technique that uses processus vaginalis as vascular cover for neourethra in hyposapdias patients with udt . we have done urethroplasty and orchiopexy simultaneously . this is the first report of processus vaginalis being used to reinforce the urethra .

INTRODUCTION CASE REPORT DISCUSSION

facial asymmetry is an imbalanced state between one side of the face and the other.12 it is one of the essential factors affecting facial esthetics . since pursuing facial beauty is a major trend in contemporary society , more patients who complain about facial asymmetry visit orthodontic clinics for treatment . in addition , some want to improve their facial appearance without knowing exactly which part is asymmetric and seek advice from the orthodontist . heretofore , posteroanterior ( pa ) cephalometry was the key to diagnosis of facial asymmetry . however , its reliability is limited because of overlapped anatomical structures , magnification errors , and image distortion.345 therefore , some posterior asymmetries may not be detectable.6 computed tomography ( ct ) greatly reduces such problems and enables more detailed understanding of dentofacial structures.789 in addition , ct software are good tools for three - dimensional ( 3d ) reconstruction and measurement . several studies have used cone - beam ct ( cbct ) to examine craniomaxillofacial relationships and facial asymmetry . given the 3d nature of the maxillofacial complex , facial asymmetry ackerman et al.10 proposed the use of not only translation in three planes ( forward / backward , up / down , and right / left ) but also rotation about three perpendicular axes ( yaw , pitch , and roll ) to describe the orientation of the head , jaws , and dentition for comprehensive evaluation of dentofacial traits . accordingly , kim11 measured yaw and roll of the dental arches and mandible in class iii malocclusion with facial asymmetry . severt and proffit12 studied the relationship of clinically apparent asymmetry with dentofacial deformities and found different prevalences of facial asymmetry according to the vertical skeletal pattern . baek et al.13 reported that facial asymmetry in skeletal class iii deformity occurs due to greater growth and mesial inclination of the ramus and vertical maxillary excess on the contralateral side . further , by 3d maxillofacial image analysis , hwang et al.14 suggested that six factors influence chin deviation : maxillary height , ramal length , frontal ramal inclination , lateral ramal inclination , mandibular body length , and mandibular body height . however , only a few studies of the relationship between rotation of dentofacial structures and mandibular asymmetry have been conducted , especially according to different vertical skeletal patterns . the purpose of this study was to assess rotational patterns of dentofacial structures according to different vertical skeletal patterns by cbct and analyze their influence on menton deviation in skeletal class iii deformity with mandibular asymmetry . the control group included 30 young adults ( 15 men and 15 women ; mean age , 24.30 4.14 years ) with skeletal class i features who were screened from 480 dental students of wonkwang university ( iksan , korea ) . they were sampled from 1,000 patients who underwent cbct for routine diagnostic preparation in the orthodontic department of wonkwang university dental hospital from march 2010 to february 2014 . fifty - five subjects of the asymmetry group were classified into two subgroups depending on the mandibular plane angle ( sn - gome).15 mandibular plane angles were measured on lateral cephalometric images extracted from cbct images and digitized with ondemand3d software ( cybermed , inc . , subjects with mandibular plane angles larger than 35 were classified into the hyperdivergent subgroup ( 13 men and 15 women ; mean age , 26.34 3.14 years ; mean sn - gome , 39.78 2.90 ) and those with mandibular plane angles smaller than 35 were included in the hypodivergent subgroup ( 15 men and 12 women ; mean age , 28.96 5.27 years ; mean sn - gome , 31.24 2.78 ) . the institutional review board of wonkwang university approved this study ( wkdirb201402 - 01 ) . the following settings were used : field of view , 200 179 mm ; 80 kv ; 5.00 ma ; exposure time , 17 s ; voxel size , 0.39 mm ; and slice thickness , 1.00 mm . the voxels were exported in digital imaging and communications in medicine ( dicom ) format . the dicom files were reconstructed to 3d images using ondemand3d 1.0 software ( cybermed , inc . ) after the threshold was adjusted for visible pixels . to minimize measurement errors due to nonstandard head posture , the 3d images were reorientated according to two reference planes : nasofrontozygomatic and frankfort horizontal planes . the origin ( 0 , 0 , 0 ) of the coordinate system was registered at nasion and three axes ( x , y , and z ) were constructed . the transverse axis ( x - axis ) was parallel to the frontozygomatic line . the anteroposterior axis ( z - axis ) was perpendicular to the frontozygomatic line and parallel to the right frankfort horizontal line . the vertical axis ( y - axis ) was perpendicular to both the frontozygomatic and the right frankfort horizontal lines . the amount of menton deviation and shift , roll , and yaw of the dental arches and mandible were measured according to a previous study11 using the 3d ceph module of ondemand3d software . a positive or negative sign was added to each measurement depending on the direction of rotation relative to the direction of menton deviation ( figures 3,4,5 ) . to measure roll ( rotation around the z - axis ) , functional occlusal lines connecting canine cusp tips , mesiopalatal cusps of the maxillary molars , and mesiobuccal cusps of the mandibular molars were used ( table 4 and figure 6 ) . yaw ( rotation around the y - axis ) was measured at canine cusp tips and mesiobuccal cusps of the molars ( table 4 and figure 7 ) . shift was measured as the distance from the midpoint of the central incisors to the midsagittal plane ( table 4 and figure 8) . as a paired t - test showed no significant difference between the assessments ( p > 0.05 ) and the intra - examiner agreement was excellent ( intraclass correlation coefficients = 0.828 - 0.930 ) , the second assessment was used in this study . as some variables were not normally distributed , according to the shapiro - wilk test , the kruskal - wallis test was used to compare differences among the groups . then , the mann - whitney u - test was performed for post - hoc multiple comparison with bonferroni correction . spearman rank correlation and multiple regression analyses were performed to determine the relationships between the rotational variables and menton deviation . all statistical tests were set at 95% confidence level ( p < 0.05 ) and performed using spss statistics software , version 17.0 ( spss inc . , chicago , il , usa ) . the control group included 30 young adults ( 15 men and 15 women ; mean age , 24.30 4.14 years ) with skeletal class i features who were screened from 480 dental students of wonkwang university ( iksan , korea ) . they were sampled from 1,000 patients who underwent cbct for routine diagnostic preparation in the orthodontic department of wonkwang university dental hospital from march 2010 to february 2014 . fifty - five subjects of the asymmetry group were classified into two subgroups depending on the mandibular plane angle ( sn - gome).15 mandibular plane angles were measured on lateral cephalometric images extracted from cbct images and digitized with ondemand3d software ( cybermed , inc . , subjects with mandibular plane angles larger than 35 were classified into the hyperdivergent subgroup ( 13 men and 15 women ; mean age , 26.34 3.14 years ; mean sn - gome , 39.78 2.90 ) and those with mandibular plane angles smaller than 35 were included in the hypodivergent subgroup ( 15 men and 12 women ; mean age , 28.96 5.27 years ; mean sn - gome , 31.24 2.78 ) . the institutional review board of wonkwang university approved this study ( wkdirb201402 - 01 ) . the following settings were used : field of view , 200 179 mm ; 80 kv ; 5.00 ma ; exposure time , 17 s ; voxel size , 0.39 mm ; and slice thickness , 1.00 mm . the voxels were exported in digital imaging and communications in medicine ( dicom ) format . the dicom files were reconstructed to 3d images using ondemand3d 1.0 software ( cybermed , inc . ) after the threshold was adjusted for visible pixels . to minimize measurement errors due to nonstandard head posture , the 3d images were reorientated according to two reference planes : nasofrontozygomatic and frankfort horizontal planes . the origin ( 0 , 0 , 0 ) of the coordinate system was registered at nasion and three axes ( x , y , and z ) were constructed . the anteroposterior axis ( z - axis ) was perpendicular to the frontozygomatic line and parallel to the right frankfort horizontal line . the vertical axis ( y - axis ) was perpendicular to both the frontozygomatic and the right frankfort horizontal lines . the amount of menton deviation and shift , roll , and yaw of the dental arches and mandible were measured according to a previous study11 using the 3d ceph module of ondemand3d software . a positive or negative sign was added to each measurement depending on the direction of rotation relative to the direction of menton deviation ( figures 3,4,5 ) . to measure roll ( rotation around the z - axis ) , functional occlusal lines connecting canine cusp tips , mesiopalatal cusps of the maxillary molars , and mesiobuccal cusps of the mandibular molars were used ( table 4 and figure 6 ) . yaw ( rotation around the y - axis ) was measured at canine cusp tips and mesiobuccal cusps of the molars ( table 4 and figure 7 ) . shift was measured as the distance from the midpoint of the central incisors to the midsagittal plane ( table 4 and figure 8) . to measure roll ( rotation around the z - axis ) , functional occlusal lines connecting canine cusp tips , mesiopalatal cusps of the maxillary molars , and mesiobuccal cusps of the mandibular molars were used ( table 4 and figure 6 ) . yaw ( rotation around the y - axis ) was measured at canine cusp tips and mesiobuccal cusps of the molars ( table 4 and figure 7 ) . shift was measured as the distance from the midpoint of the central incisors to the midsagittal plane ( table 4 and figure 8) . as a paired t - test showed no significant difference between the assessments ( p > 0.05 ) and the intra - examiner agreement was excellent ( intraclass correlation coefficients = 0.828 - 0.930 ) , the second assessment was used in this study . as some variables were not normally distributed , according to the shapiro - wilk test , the kruskal - wallis test was used to compare differences among the groups . then , the mann - whitney u - test was performed for post - hoc multiple comparison with bonferroni correction . spearman rank correlation and multiple regression analyses were performed to determine the relationships between the rotational variables and menton deviation . all statistical tests were set at 95% confidence level ( p < 0.05 ) and performed using spss statistics software , version 17.0 ( spss inc . , chicago , il , usa ) . table 5 shows the results of the intergroup comparisons . lower anterior shift ( p < 0.01 ) , lower first molar roll ( p < 0.01 ) , lower second molar roll ( p < 0.01 ) , upper posterior yaw ( p < 0.05 ) , lower posterior yaw ( p < 0.01 ) , and mandibular yaw ( p < 0.01 ) were significantly larger in the hyperdivergent subgroup than in the control group . further , upper anterior shift ( p < 0.01 ) , lower anterior shift ( p < 0.01 ) , upper second molar roll ( p < 0.01 ) , lower canine roll ( p < 0.01 ) , lower first molar roll ( p < 0.01 ) , lower second molar roll ( p < 0.01 ) , lower posterior yaw ( p < 0.01 ) , and mandibular yaw ( p < 0.01 ) were significantly larger in the hypodivergent subgroup than in the control group . only upper posterior yaw ( p < 0.01 ) was significantly larger in the hypodivergent subgroup than in the hyperdivergent subgroup . lower anterior shift ( r = 0.820 ; p < 0.01 ) , mandibular yaw ( r = 0.674 ; p < 0.01 ) , lower posterior yaw ( r = 0.571 ; p < 0.01 ) , lower second molar roll ( r = 0.483 ; p < 0.01 ) , lower first molar roll ( r = 0.458 ; p < 0.01 ) , upper anterior shift ( r = 0.448 ; p < 0.01 ) , lower canine roll ( r = 0.364 ; p < 0.01 ) , lower anterior yaw ( r = 0.355 ; p < 0.01 ) , and upper second molar roll ( r = 0.323 ; p < 0.01 ) showed positive correlations with menton deviation . the measurements of roll except lower canine roll and mandibular roll were significantly ( p < 0.01 ) and positively correlated with one another ( table 6 ) . upper anterior yaw showed significant positive correlations with upper posterior yaw ( r = 0.501 ; p < 0.01 ) and lower anterior yaw ( r = 0.269 ; p < 0.05 ) . lower anterior yaw showed significant positive correlations with lower posterior yaw ( r = 0.382 ; p < 0.01 ) and mandibular yaw ( r = 0.276 ; p < 0.05 ) . further , lower posterior yaw showed a significant positive correlation with mandibular yaw ( r = 0.664 ; p < 0.01 ) . upper anterior shift was positively correlated with lower anterior shift ( r = 0.489 ; p < 0.01 ) . however , upper posterior yaw was positively correlated with upper canine roll ( r = 0.249 ; p < 0.05 ) , upper first molar roll ( r = 0.229 ; p < 0.05 ) , upper second molar roll ( r = 0.248 ; p < 0.05 ) , and lower canine roll ( r = 0.223 ; p < 0.05 ) . lower posterior yaw was significantly correlated with upper second molar roll ( r = 0.214 ; p < 0.05 ) , lower first molar roll ( r = 0.255 ; p < 0.05 ) , and lower second molar roll ( r = 0.254 ; p < 0.05 ) ( table 6 ) . multiple regression analysis showed that menton deviation was influenced by lower anterior shift , lower second molar roll , mandibular yaw , lower canine roll , and lower posterior yaw ( table 7 ) . table 5 shows the results of the intergroup comparisons . lower anterior shift ( p < 0.01 ) , lower first molar roll ( p < 0.01 ) , lower second molar roll ( p < 0.01 ) , upper posterior yaw ( p < 0.05 ) , lower posterior yaw ( p < 0.01 ) , and mandibular yaw ( p < 0.01 ) were significantly larger in the hyperdivergent subgroup than in the control group . further , upper anterior shift ( p < 0.01 ) , lower anterior shift ( p < 0.01 ) , upper second molar roll ( p < 0.01 ) , lower canine roll ( p < 0.01 ) , lower first molar roll ( p < 0.01 ) , lower second molar roll ( p < 0.01 ) , lower posterior yaw ( p < 0.01 ) , and mandibular yaw ( p < 0.01 ) were significantly larger in the hypodivergent subgroup than in the control group . only upper posterior yaw ( p < 0.01 ) was significantly larger in the hypodivergent subgroup than in the hyperdivergent subgroup . lower anterior shift ( r = 0.820 ; p < 0.01 ) , mandibular yaw ( r = 0.674 ; p < 0.01 ) , lower posterior yaw ( r = 0.571 ; p < 0.01 ) , lower second molar roll ( r = 0.483 ; p < 0.01 ) , lower first molar roll ( r = 0.458 ; p < 0.01 ) , upper anterior shift ( r = 0.448 ; p < 0.01 ) , lower canine roll ( r = 0.364 ; p < 0.01 ) , lower anterior yaw ( r = 0.355 ; p < 0.01 ) , and upper second molar roll ( r = 0.323 ; p < 0.01 ) showed positive correlations with menton deviation . the measurements of roll except lower canine roll and mandibular roll were significantly ( p < 0.01 ) and positively correlated with one another ( table 6 ) . upper anterior yaw showed significant positive correlations with upper posterior yaw ( r = 0.501 ; p < 0.01 ) and lower anterior yaw ( r = 0.269 ; p < 0.05 ) . lower anterior yaw showed significant positive correlations with lower posterior yaw ( r = 0.382 ; p < 0.01 ) and mandibular yaw ( r = 0.276 ; p < 0.05 ) . further , lower posterior yaw showed a significant positive correlation with mandibular yaw ( r = 0.664 ; p < 0.01 ) . upper anterior shift was positively correlated with lower anterior shift ( r = 0.489 ; p < 0.01 ) . upper and lower anterior yaw showed no significant correlation with any measurement of roll . however , upper posterior yaw was positively correlated with upper canine roll ( r = 0.249 ; p < 0.05 ) , upper first molar roll ( r = 0.229 ; p < 0.05 ) , upper second molar roll ( r = 0.248 ; p < 0.05 ) , and lower canine roll ( r = 0.223 ; p < 0.05 ) . lower posterior yaw was significantly correlated with upper second molar roll ( r = 0.214 ; p < 0.05 ) , lower first molar roll ( r = 0.255 ; p < 0.05 ) , and lower second molar roll ( r = 0.254 ; p < 0.05 ) ( table 6 ) . multiple regression analysis showed that menton deviation was influenced by lower anterior shift , lower second molar roll , mandibular yaw , lower canine roll , and lower posterior yaw ( table 7 ) . greater patient awareness of facial asymmetry , especially chin deformity , warrants greater attention in diagnosis of mandibular asymmetry.16 mandibular asymmetry can be evaluated by the amount of menton deviation from the midsagittal plane . however , in some cases , deviation or rotation of the maxilla can cause mandibular asymmetry as the temporomandibular joints adapt by remodeling or growth . maeda et al.17 detected solely mandibular asymmetry in 80% of their patients , while both the maxilla and the mandible were involved in 20% of the cases . another report described similar results : 74% of the cases involved mandibular asymmetry and 36% had both maxillary and mandibular asymmetry.12 in this study , rotation of mandibular structures affected menton deviation more than that of maxillary structures . midline discrepancy of the dental arches also influences the patient 's cognition of facial asymmetry . it reflects not only mandibular asymmetric growth but also deformation of the upper and middle thirds of the face . furthermore , dental features such as space deficiency , spacing , missing teeth , supernumerary teeth , and premature contact sometimes increase the tendency for facial asymmetry by altering arch form and direction of skeletal growth . therefore , this study examined the effect of rotation of the dental arches on facial asymmetry . according to haraguchi et al.,18 any landmark severt and proffit12 found an increased percentage of chin deviation of at least 2 mm from the midline in class iii deformity . further , chebib and chamma19 suggested that deviation of more than 3 mm is abnormal . in this study , mandibular asymmetry was considered present when menton deviation was more than 3 mm from the midsagittal plane : the asymmetry group showed a greater amount of menton deviation than the control group . radiographic techniques such as pa cephalometry and panoramic radiography can be used to assess facial asymmetry but produce only two - dimensional images and are prone to errors.2021 although cbct is relatively reliable with regard to head orientation,22 natural head position is not always ensured because head tilting is common in patients with facial asymmetry.23 therefore , reorientation based on the midsagittal plane is necessary to assess facial asymmetry . various landmarks have been proposed to develop the midsagittal plane . as the position of the anterior nasal spine changes if there is facial asymmetry including the maxilla , mandibular asymmetry can be overestimated or underestimated in relation to the maxilla.23 thus , the anterior nasal spine was not used as a landmark in this study . the frontozygomatic suture shows good potential as a reference for assessing facial asymmetry,52425 so the nasion and bilateral frontozygomatic points were used to construct the midsagittal plane in this study.26 importantly , kim et al.27 found that cranial base volume is correlated with mandibular asymmetry in patients with facial asymmetry and mandibular prognathism , influencing the construction of reference planes with landmarks at the cranial base . a few studies have focused on canting of anatomical structures ( eye , lip , occlusal plane , otobasion , gonion ) , similar to roll in this study . using frontal cephalograms , frontal photos , 3d ct images , hwang et al.28 found that preoperative lip - line ca nt shows positive correlations with menton deviation and mandibular anterior occlusal plane ca nt . lee et al.29 demonstrated that lip ca nt and chin deviation affect the assessment of facial asymmetry . these results are consistent with those of the present study , in which most measurements of roll were strongly correlated with menton deviation . kim11 examined rotational patterns of the dental arches and mandible in class iii deformity with facial asymmetry . in this study , roll and yaw of dentofacial structures in skeletal class iii deformity with mandibular asymmetry were measured according to different vertical skeletal patterns , as modified in establishing reference planes . only roll and yaw of the posterior parts of the mandible showed significant differences between the control and the asymmetry groups and positive correlations with menton deviation . the result implies that rotation of mandibular posterior dentofacial structures affects menton deviation , and therefore , mandibular asymmetry . further study with a larger sample size would enable more detailed evaluation of rotational patterns of dentofacial structures . moreover , the relationship between the anteroposterior skeletal pattern and rotation of dentofacial structures should be assessed for in - depth study of facial asymmetry . menton deviation in skeletal class iii deformity with mandibular asymmetry is associated with rotation of mandibular posterior dentofacial structures .

objectivethe purpose of this study was to assess rotational patterns of dentofacial structures according to different vertical skeletal patterns by cone - beam computed tomography ( cbct ) and analyze their influence on menton deviation in skeletal class iii deformity with mandibular asymmetry.methodsthe control group consisted of 30 young adults ( 15 men , 15 women ) without any severe skeletal deformity . the asymmetry group included 55 adults ( 28 men , 27 women ) with skeletal class iii deformity and at least 3-mm menton deviation from the midsagittal plane ; it was divided into the hyperdivergent and hypodivergent subgroups using a mandibular plane angle cutoff of 35. fourteen rotational variables of the dental arches and mandible were measured and compared among the groups . correlations between menton deviation and the other variables were evaluated.resultsthe asymmetry group showed significantly larger measurements of roll and yaw in the mandible than the control group . the hypodivergent subgroup showed significant differences in maxillary posterior measurements of yaw ( p < 0.01 ) and maxillary anterior shift ( p < 0.05 ) compared with the hyperdivergent subgroup . all the mandibular measurements had significant correlations with menton deviation ( p < 0.01 ) . most measurements of roll were positively correlated with one another ( p < 0.01 ) . measurements of yaw and roll in the posterior regions were also positively correlated ( p < 0.05).conclusionsmenton deviation in skeletal class iii deformity with mandibular asymmetry is influenced by rotation of mandibular posterior dentofacial structures . the rotational patterns vary slightly according to the vertical skeletal pattern .

INTRODUCTION MATERIALS AND METHODS Subjects CBCT imaging and 3D reconstruction Measurements Angular measurements Linear measurements Statistical analysis RESULTS Comparison of the control and asymmetry groups Relationships between rotational variables DISCUSSION CONCLUSION

chemicals : bpa was purchased from kanto chemical co. ( tokyo , japan ) ; bpa glucuronide and bpa glucuronide / sulfate diconjugate were obtained from frontier science co. ( ishikari , japan ) ; and all other chemicals for the liver perfusion study and high performance liquid chromatography ( hplc ) analysis were purchased from kanto chemical co. animals : male ( 330400 g ) and female ( 240280 g ) sprague - dawley rats ( 911 weeks old ) were used . before use in experiments , all rats were housed under standard conditions and given food and water ad libitum . the animals were handled according to the laboratory animal control guidelines of rakuno gakuen university ( ethics committee protocol approval number es23a06 , approved jan 13 , 2012 ) . surgical procedure for perfusion : to study perfusion , the rats were anesthetized by intraperitoneal injection of pentobarbital sodium ( 1.3 ml/100 g body weight ) . briefly , after anesthesia , the abdomen was surgically opened , and the portal vein and common bile duct were cannulated and the caudal vena cava was incised . oxygenated krebs - ringer buffer , described below , was infused by roller pump ( mp-32n ; eyela , tokyo , japan ) through the liver via the portal vein at a constant rate of 30 ml / min . once perfusion was begun , a polyethylene catheter was inserted into the vena cava . after insertion of the polyethylene catheter , each animal was euthanized by exsanguination under anesthesia . liver perfusion : krebs - ringer buffer ( nacl 115 mm , kcl 5.9 mm , mgcl2 1.2 mm , nah2po4 1.2 mm , na2so4 1.2 mm , cacl2 2.5 mm , nahco3 25 mm and glucose 10 mm ) was used in all experiments . the buffer solution was aerated using 95% o2 + 5% co2 , and the ph was adjusted to 7.4 . bpa was added to the substrate buffer solution at a final concentration of 0.1 m , 1 m or 10 m . preliminary perfusion with krebs - ringer solution was performed for 10 min , followed by 5 min inflow of the substrate buffer solution , and then reperfusion of krebs - ringer solution for 55 min . once perfusion of the substrate buffer had begun , the excreted bile and a small amount of the perfusate in the vein were collected independently at 5-min intervals for 1 hr . high performance liquid chromatography ( hplc ) analysis of reaction products : the perfusate samples were independently centrifuged for 3 min at 9,000 g , and the supernatant fraction was collected . the samples were analyzed by a hplc ( tosoh , tokyo , japan ) system consisting of an lc-8020 pump , co-8020 oven and uv-8020 uv detector . the samples were subjected to unizon uk - c18 reversed phase column ( 4.6 mm i.d . 150 mm ; imtakt , tokyo , japan ) chromatography and eluted with a linear gradient of methanol / water at flow rate of 1 ml / min ( solution a : methanol / water ( 24/76 v / v ) and 10 mm ammonium acetate to solution b : methanol ) over 15 min . the eluted samples were analyzed at 222 nm , and the results were recorded using lc-8020 integration software ( tosoh ) . the elution peaks of bpa , bpa glucuronide and bpa glucuronide / sulfate were noted , and the concentrations were compared with the standards . liquid chromatography - mass spectrometry conditions : liquid chromatography - electrospray ionization - time of flight mass spectrometry ( lc - esi - tof ms ) analysis was conducted using a lct premier mass spectrometer ( waters , milford , ma , u.s.a . ) . the mass spectrometer electrospray source capillary voltage was set to 2.2 kv , cone voltage to 20 v , source block temperature to 120c and desolvation temperature to 350c . the nitrogen nebulizing and desolvation gas flows were set to 50 l / hr and 650 area under the curve ( auc ) was used for comparison of bilious and venous excretion of bpa and its conjugates . comparisons were made by either a student s t test or analysis of variance , and a p value of 0.05 was taken to be significant . hplc analysis of reaction products : in the hplc samples obtained from rat liver perfused with 10 m bpa in krebs - ringer solution , two major peaks were eluted at 3.9 min and 7.2 min ( fig . 1.hplc chromatograms of bile and venous perfusate derived from rat liver perfused with bpa . the liver was perfused for 5 min with krebs - ringer buffer containing bpa and then perfused with normal krebs - ringer buffer . bile ( a ) and venous perfusate ( b ) were collected at 15 min after application of bpa to the liver . peaks of bpa glucuronide / sulfate diconjugate ( a ) and bpa mono - glucuronide ( b ) are indicated . panels d and e are a mass spectrum of peak a and peak b , respectively . ) . in lc - ms analysis , m / z of peak a ( rt=3.9 min ) and peak b ( rt=7.2 min ) were 455.06 and 375.10 , respectively . the first peak ( peak a ) , detected mainly in the bile , was identified as bpa glucuronide / sulfate diconjugate ( fig . the second peak ( peak b ) , found in both the bile and venous perfusate , was identified as bpa mono - glucuronide ( fig . the limits of detection for the bisphenol a glucuronide / sulfate diconjugate and the mono - glucuronide were 0.1 m and 0.2 m , respectively . the standard curves for the diconjugate and the mono - glucuronide resulted in a high linearity in a range of 1500 m . hplc chromatograms of bile and venous perfusate derived from rat liver perfused with bpa . the liver was perfused for 5 min with krebs - ringer buffer containing bpa and then perfused with normal krebs - ringer buffer . bile ( a ) and venous perfusate ( b ) were collected at 15 min after application of bpa to the liver . peaks of bpa glucuronide / sulfate diconjugate ( a ) and bpa mono - glucuronide ( b ) are indicated . panels d and e are a mass spectrum of peak a and peak b , respectively . bpa conjugation and excretion in the perfused liver of male rats : on perfusion of the liver with 10 m bpa in krebs - ringer solution , 99.6% of the substrate was transferred to the liver . bpa mono - glucuronide and glucuronide / sulfate diconjugate were subsequently excreted from the liver . the greatest glucuornide excretion was observed 1015 min after substrate application ( fig . 2.bpa conjugates excreted into the bile ( a ) and vein ( b ) after liver perfusion of male sprague - dawley rats with bpa . the liver was perfused for 5 min with 10 m bpa in krebs - ringer solution and for 55 min without substrate . bpa conjugates excreted into the bile ( a ) and vein ( b ) after liver perfusion of male sprague - dawley rats with bpa . the liver was perfused for 5 min with 10 m bpa in krebs - ringer solution and for 55 min without substrate . on application of low - doses of bpa to the perfused liver , the excretion of the conjugates diminished in a dose - dependent manner ( fig . 3fig . columns show total excretion of bpa glucuronide ( hatched line ) and diconjugate ( empty columns ) into the bile ( a ) and venous system ( b ) during 1-hr perfusion . the excretion of diconjugate was not detected following 15 mol application ( 0.1 m perfusion ; fig . the venous excretion of glucuronide / sulfate was below quantifiable levels in all trials in this study ( fig . columns show total excretion of bpa glucuronide ( hatched line ) and diconjugate ( empty columns ) into the bile ( a ) and venous system ( b ) during 1-hr perfusion . bpa conjugation and excretion in the liver of female rats : in female rats , liver perfusion of 10 m bpa in krebs - ringer solution resulted in up to 100% of the infused substrate being absorbed into the liver tissue , which was subsequently glucuronidated and excreted into the bile and the venous system . the greatest glucuornide excretion was observed 10 min after application of the substrate ( fig . 4.bpa conjugates excreted into the bile ( a ) and venous system ( b ) after perfusion of the liver of female rats with bpa . the liver was perfused for 5 min with 10 m bpa in krebs - ringer solution and for 55 min without substrate . bilious glucuronide excretion was estimated to be much higher than that of venous excretion . negligible amounts of diconjugate were excreted from the liver of female rats ( fig . bpa conjugates excreted into the bile ( a ) and venous system ( b ) after perfusion of the liver of female rats with bpa . the liver was perfused for 5 min with 10 m bpa in krebs - ringer solution and for 55 min without substrate . bilious and venous excretions of the resulting conjugates during 1-hr perfusion in male and female rats are illustrated in fig . 5fig . 5.bpa conjugates excreted into the bile ( upper graph ) and venous system ( lower graph ) during 1-hr perfusion . the livers of male ( left graph ) and female ( right graph ) rats were perfused for 5 min with 10 m bpa in krebs - ringer solution and for 55 min without substrate . results are shown as the mean s.e .. in male rats , the amounts of bilious and venous excretions of mono - glucuronide were 49.4% and 9.9% of the infused bpa , respectively . in female rats , the amounts of bilious and venous glucuronide were 73.7% and 10.1% , respectively . the excretion via glucuronide / sulfate diconjugate production in male rats was calculated as 22.3% of the infused bpa . total recovery of the infused substrate was 81.9% in male rats and 83.9% in female rats . bpa conjugates excreted into the bile ( upper graph ) and venous system ( lower graph ) during 1-hr perfusion . the livers of male ( left graph ) and female ( right graph ) rats were perfused for 5 min with 10 m bpa in krebs - ringer solution and for 55 min without substrate . in sprague - dawley rats perfused with bpa , the infused compound was highly conjugated during passage through the liver , and the resultant metabolites were excreted from the liver . one - quarter of the infused bpa was eliminated as a glucuronide / sulfate diconjugate , whereas the diconjugate was virtually absent in female rats . these findings concur with a recent report , in which bpa , added to the medium of isolated hepatocytes , was metabolized into both mono - glucuronide and diconjugate ; moreover , the diconjugate was almost nil in female rats . bpa sulfo - conjugation is mediated by the sult1 family , a phenol sulfotransferase isoform . one member of the sult1 family , sult1a1 , has been shown to have high - conjugation activity toward bpa . the expression level of the sult1 family is estimated to be higher in male than female rats . in contrast to the sulfotransferases , the ugt2 isoenzyme , which mediates bpa glucuronidation , exhibits gender differences in mrna expression ; higher levels were shown in females compared to males . these results suggest that sex differences in the conjugation pathways of bpa are responsible for the expression level of the conjugation enzymes . in the present study , this phenomenon can be explained by the two - step conjugation of bpa , in which a carboxy radical of the substrate is glucuronidated and an addition radical is subsequently sulfated . udp - glucuronosyltransferases are located on the endoplasmic reticulum , while sulfotransferases are found in the cytosol . it is presumable that in hepatocytes , lipophilic bpa crosses the plasma membrane and reaches the endoplasmic reticulum , where it is glucuronidated and diffuses into the cytosol . after conjugation , the resulting hydrosoluble metabolites are likely transported from inside the cell to outside via chemical transporters . we found that in rat liver , the bilious excretion of bpa mono - glucuronide is mediated by mrp2 ( abcc2 ) , a member of the atp - binding cassette ( abc ) family . pharmacokinetic studies involving 4-methylumbelliferone and ethinyl estradiol demonstrate that bcrp ( abcg2 ) mediates the transport of glucuronide and sulfate [ 21 , 22 ] . while identification of the transporter exporting bpa diconjugate requires further investigation , our previous study and recent studies suggest that the abc family mediates the export of diconjugate . on application of low - dose bpa to the perfused liver in the present study , bpa diconjugate levels were negligible ; however , the reaction increased in a dose - dependent manner . this indicates that bpa elimination via diconjugation occurs upon high exposure to the chemical . in animal studies of the health effects of bpa , long - term / low concentration exposure or short - term / our present results give rise to the view that , depending on the exposure level , different metabolic pathways are involved in the elimination of bpa . from bile , the excreted conjugates flow into the intestinal tract , where the metabolites are reabsorbed into the body . an in vivo study by kurebayashi et al . showed that oral bpa exposure flows into the enterohepatic circulation before excretion to the urine and feces . in light of these findings , we suggest that the bpa conjugates pass through internal organs , such as the heart , lung , kidney and brain , before being eliminated from the body . of concern our previous data showed that bpa glucuronide is absorbed from the maternal blood stream at the placenta . recently , chemical transporters involved in the movement of hormone - sulfates have been identified in the placenta [ 18 , 23 ] . it is highly likely that bpa diconjugate is actively transferred into the fetus at the placenta . demonstrated the production of a bpa glucuronide / sulfate diconjugate in female mice using isolated hepatocytes . given that greater diconjugate production in hepatocytes has been found in females , it is important that further work be done to determine the fate of the diconjugate in the pathway before excretion . in conclusion , the present study assessed bpa conjugation with mono - glucuronide and glucuronide / sulfate using a liver perfusion method . the results suggest that in the rat liver , bpa is conjugated primarily to mono - glucuronide and that diconjugate production occurs when the animal is exposed to high concentrations of the substrate . the potential public health hazards of bpa remain unknown . to elucidate the adverse effects of bpa systemically , further work focusing on the changes in bpa metabolism according to the dose is required .

in isolated hepatocytes , the environmental estrogen bisphenol a ( bpa ) is metabolized into a mono - glucuronide and a glucuronide / sulfate diconjugate . little is known about the fate of the diconjugate in the liver . the present study focused on the metabolism and dispostion of bpa diconjugate in the liver using a perfusion method . in sprague - dawley rats , bpa ( 15,150 or 1,500 nmol ) was applied into the liver . in male rats , the infused bpa was conjugated to both glucuronide and a diconjugate during passage through the liver . the diconjugate was observed at high - dose application of the substrate . in female rats , the chemical was conjugated almost exclusively to the glucuronide in all doses utilized in this study . in both the male and female rats , the resultant metabolites were preferentially excreted into the bile . these results suggest that bpa is conjugated primarily to mono - glucuronide in rat liver ; and that in males , diconjugate production occurs under conditions of high - dose exposure to bpa .

MATERIALS AND METHODS RESULTS DISCUSSION

cardiovascular disease ( cvd ) is a major contributor to the global burden of diseases1 , 2 . in addition , cvd ( heart failure and stroke , etc . ) often causes disuse muscle atrophy in the acute and subacute phase , which increases the likelihood of wheelchair or bedridden state in the chronic phase3,4,5 . consequently , the progression of muscle atrophy in lower extremity function may render a high need for medical and nursing care . the short physical performance battery ( sppb)a brief performance battery based on a timed short distance walk , repeated chair stands , and a set of balance tests is a validated assessment tool for measuring lower extremity function that is widely used in both clinical and research settings6 , 7 . the popularity of this instrument stems , in part , from its relative ease of use , perceived potential for implementation in clinical practice , and good association with physical activity levels and general walking disability in a variety of patients or older adults . it has also been found to predict mortality , hospitalization rate , and a variety of comorbid disease conditions7 . although the sppb is an effective assessment tool for lower extremity function , it is unclear the sppb can be used to evaluate mobility capability for cardiovascular disease patients including inpatients and outpatients . previous studies demonstrated that gait speed was associated with survival in older adults and which was faster with healthy older adults than outpatients , which was faster than inpatients8 , 9 . thus , the purpose of this study was to examine two hypotheses : that the sppb would be higher with healthy older adults than outpatients , which was higher than inpatients ; and that the sppb can be validated assessment tool for strength tests and lower extremity morphological evaluation in middle - aged and older adult cardiovascular disease patients . thirty - six middle - aged and older adults , aged 49 to 89 years , with cardiovascular diseases [ outpatients ( out - pt ) and inpatients ( in - pt ) ] and healthy subjects ( ctrl ) volunteered to participate in the study and were selected according to the exclusion criteria ( history of anemia , cerebrovascular disease and arthroscopic joint surgery ) . in addition , volunteers who suffered from a chronic disease such as severe orthopedic disorders , peripheral vascular disease , or cognitive dysfunction were excluded from the study . all participants had undergone complete chemistry and hematologic evaluation and were informed of the risks associated with involvement in the study and signed an informed consent document before participation . all participants were recruited through study notices in area and oral communications in the university hospital . the principles of the world medical association declaration of helsinki and the american college of sports medicine guidelines for use of human subjects were adopted in this study . analyses of ultrasound images and all measurements data were performed by the same author , who was blinded to the group assignments . the author has been specialized in the research of exercise physiology by use of ultrasound images , strength tests and lower extremity morphological evaluation more than 15 years . the tests were performed in the following sequence : a ) standing balance tests , b ) gait test , and c ) chair stand test . the standing balance portion requires participants to maintain , for 10 seconds each , stances with their feet placed side by side , semi - tandem , and in tandem . the gait test measured the time needed to walk 4 m at a typical pace . the chair stand required participants to rise from a steel chair , 0.40 m height and 0.30 m depth , with their arms across their chest , five times . categorical scores , range : 04 , for both the gait and the chair stand tests were based on timed quartiles established previously in a large population . individuals who were unable to complete either the 4 m gait task or the 5 repetitions chair stand test received a score of 0 . the sum of the three components comprised the final sppb score , with a possible range from 0 to 12 . maximum voluntary isometric contraction ( mvic ) of the handgrip was determined using a factory - calibrated hand dynamometer ( tkk 5401 , takei scientific instruments co. , ltd . , all subjects were instructed to maintain an upright standing position , arms at their side , holding the dynamometer in the right hand with the arm at a right angle and the elbow held at the side of the body . the size of the dynamometer handle was set so that it felt comfortable to the subject while squeezing the grip . each subject underwent 2 trials , and the best value of 2 trials was used for analysis . mvic of the knee extensors was determined using a digital handheld dynamometer ( tas mt-1 , anima co. , ltd . , the dynamometer pad is 55 55 mm , and its front side is curved to fit the shape of the area of the extremity to be measured . subjects were seated in a hard chair with their knees flexed 90 and their arms on their thighs . the dynamometer was placed perpendicular to the leg just above the malleoli . during all tests , the dynamometer was kept stable by the examiner using both hands and the subject s leg was fixed by a belt to keep the knee flexed at 90. subjects were told to push against the dynamometer by attempting to straighten their leg . each subject was given 2 trials with an interval of at least 2 min between the trials . percent body fat and fat - free mass were measured using leg - to - leg bioelectrical impedance analysis ( reactance technology , inner scan , tanita , tokyo , japan ) . the measurements were carried out while the subjects stood with their elbows extended and relaxed . after thigh and lower leg length measurements using anatomic landmarks , all measurement sites were marked with a marker pen and then mid - thigh , at 50% between the lateral condyle of the femur and the greater trochanter , and lower - leg , at 30% proximal between the lateral malleolus of the fibula and the lateral condyle of the tibia , girths and were measured using a tape measure on the right side of the body12 . ultrasound evaluation of muscle thickness ( mth ) was performed by using a real - time linear electronic scanner with a 10.0-mhz scanning head ( 5.5 cm length probe , prosound c3cv , hitachi aloka system , tokyo , japan ) . the scanning head was coated with a water - soluble transmission gel to provide acoustic contact without depressing the dermal surface . the subcutaneous adipose tissue - muscle interface and the muscle - bone interface were identified from the ultrasonic image . the perpendicular distance from the adipose tissue - muscle interface to the muscle - bone interface was considered to represent mth . briefly , the measurements were carried out while the subjects stood with their elbows extended and relaxed12 . all data were analyzed using jmp software v.12.0 for mac ( sas institute inc . pearson product correlations of tandem , or chair stand , or gait or total sppb scores and variable factors were also statistically quantified . when the data were not normally distributed , non - parametric statistical analysis , wilcoxon signed rank test , was used to identify differences in in - pt vs. out - pt vs. ctrl groups . a stepwise multiple - regression analysis ( method of increasing and decreasing the variables , criterion was set at p<0.05 ) was performed to develop a prediction equation for sppb scores using age , height , weight , bmi , % bf , systolic and diastolic blood pressures , resting heart rate , handgrip , knee extension , fat free - mass , mid - thigh and lower - leg girths , and anterior mid - thigh , posterior mid - thigh , and posterior lower - leg mths as independent variables . consequently , the predicted variables , coefficients and intercept coefficients were automatically picked out by the jmp software . the sample size was estimated from a priori power analysis to detect the correlation ( power of 0.80 , an of 0.05 , two - tailed , and =0.5 ) with the reference13 . the physical characteristics and clinical data are shown in table 1table 1.the physical characteristics and clinical datain - pt out - pt ctrl male ( n)777female ( n)555age ( years)71.8 ( 11.6)70.3 ( 8.1)70.0 ( 6.7)height ( cm)160 ( 14)162 ( 10)164 ( 9)weight ( kg)59.8 ( 14.0)60.9 ( 10.0)58.9 ( 7.1)body mass index ( kg / m)23.6 ( 6.5)23.3 ( 3.0)22.0 ( 1.4)% body fat30.1 ( 17.5)24.0 ( 7.6)23.1 ( 6.4)systolic bp ( mmhg)113 ( 24)133 ( 19)137 ( 19 ) diastolic bp ( mmhg)64 ( 14 ) 71 ( 11 ) 82 ( 12 ) resting heart rate ( bpm ) 79 ( 12 ) 71 ( 12 ) 73 ( 8)bnp ( pg / m1)177 ( 170 ) * 62 ( 46)-hospital admission ( within 10 years)number 2.9 ( 2.2 ) 2.0 ( 1.9)0duration ( days)49.3 ( 53.5)23.1 ( 24.2 ) 0specific diseases ( n)vascular diseases360ischemic heart diseases 6 100valvular diseases030congestive heart failure710hypertension690others 320 data are given as mean ( standard deviation ) . there were no significant differences among three conditions in physical characteristics except for systolic and diastolic blood pressures . total sppb scores , strength tests , and morphological assessments were greater in the ctrl and the out - pt groups compared with the in - pt group ( table 2table 2.short physical performance battery ( sppb ) , strength tests , and morphological assessmentsin - ptout - ptctrl sppb ( raw data)side - by - side stand ( sec)10.0 ( 0.0)10.0 ( 0.0)10.0 ( 0.0)semi - tandem stand ( sec)10.0 ( 0.0)10.0 ( 0.0)10.0 ( 0.0)tandem stand ( sec ) 7.1 ( 3.6)8.3 ( 3.1)10.0 ( 0.0 ) gait test ( sec/4 m ) 5.4 ( 3.2 ) 3.8 ( 0.6 ) * 3.4 ( 0.3 ) chair stand test ( sec/5rep)16.0 ( 5.0)10.0 ( 1.7 ) * * 7.4 ( 1.7 ) # # , sppb scoreside - by - side stand 1.0 ( 0.0 ) 1.0 ( 0.0 ) 1.0 ( 0.0)semi - tandem stand 1.0 ( 0.0 ) 1.0 ( 0.0 ) 1.0 ( 0.0)tandem stand 1.3 ( 0.8 ) 1.6 ( 0.8 ) 2.0 ( 0.0 ) gait test 3.5 ( 1.0 ) 3.9 ( 0.3 ) 4.0 ( 0.0)chair stand test 2.2 ( 1.3 ) 3.7 ( 0.5 ) * * 4.0 ( 0.0 ) total sppb 9.0 ( 2.4 ) 11.2 ( 1.0 ) * 12.0 ( 0.0 ) strength testhandgrip ( kg)24.1 ( 9.8)28.6 ( 8.6)29.3 ( 7.2)knee extension ( kg)19.7 ( 9.9)34.9 ( 10.3 ) * * 37.4 ( 6.3 ) morphological assessmentfat free - mass ( kg)40.9 ( 11.4)46.2 ( 8.4)43.5 ( 10.2)mid - thigh girth ( cm)43.8 ( 8.1)46.3 ( 3.3)45.0 ( 6.2)lower - leg girth ( cm)33.1 ( 5.2)35.3 ( 2.4)34.2 ( 4.1)anterior mid - thigh mth ( cm)3.13 ( 0.89 ) 4.28 ( 0.74 ) * * 4.34 ( 0.60 ) posterior mid - thigh mth ( cm)5.06 ( 0.78 ) 6.05 ( 0.51 ) * * 5.55 ( 0.81 ) posterior lower - leg mth ( cm)5.59 ( 0.82 ) 6.52 ( 0.61 ) * * 6.46 ( 0.50 ) n=36 . mth : muscle thickness . * * p<0.01 , * p<0.05 , in - pt vs. out - pt . pearson s correlation coefficients between sppb scores and variable factors are shown in table 3table 3.pearsons correlation coefficients between sppb scores and variable factorspearson s correlationtandemchair standgait total sppb scores strength testhandgrip0.432 * * 0.527 * * 0.523 * * 0.562 * * knee extension0.382 * 0.717 * * 0.491 * * 0.690 * * morphological assessmentfat free - mass0.369 * 0.386 * 0.429 * * 0.366 * mid - thigh girth0.2330.548 * * 0.364 * 0.464 * * lower - leg girth0.2640.598 * * 0.409 * 0.436 * * anterior mid - thigh mth0.463 * * 0.802 * * 0.569 * * 0.759 * * posterior mid - thigh mth0.488 * * 0.472 * * 0.465 * * 0.563 * * posterior lower - leg mth0.437 * * 0.670 * * 0.583 * * 0.655 * * n=36 . mth : muscle thickness . * * p<0.01 , * p<0.05 , in - pt vs. out - pt . mth : muscle thickness . * * p<0.01 , * p<0.05 to predict tandem stand , the predicted age and posterior mid - thigh muscle thickness were calculated ( tandem stand=1.80 posterior mid - thigh muscle thickness 0.10 age + 5.43 ) ( n=36 , r=0.331 , p<0.05 ) . to predict chair stand , the predicted fat free - mass , knee extension and anterior mid - thigh muscle thickness were calculated ( chair stand=0.21 fat - free mass 3.21 anterior mid - thigh muscle thickness 0.25 knee extension mvic + 22.34 ] ( r=0.776 , p<0.01 ) . to predict gait test , the predicted posterior lower - leg muscle thickness was only calculated ( gait test= 1.51 posterior lower - leg muscle thickness + 13.59 ) ( r=0.340 , p<0.01 ) . to predict total sppb scores , the predicted knee extension and anterior mid - thigh muscle thickness were calculated ( total sppb scores=0.05 knee extension mvic + 1.15 anterior mid - thigh muscle thickness + 4.60 ) ( r=0.630 , p<0.05 ) . the main findings of this study were as follows . first , total sppb scores were greater with ctrl group than out - pt group , which was higher than in - pt group . second , knee extension strength and anterior mid - thigh muscle thickness can predict total sppb scores in middle - aged and older adult cardiovascular disease patients . the sppb assessment was established as a disability evaluation for older adults , healthy elderly and some disability conditions6 , 14,15,16 . a previous study reported that impaired mobility was reflected by a total sppb score of less than 1014 . in addition , total sppb scores of 46 were 4.2 to 4.9 times more likely to have disability in the activities of daily living or mobility - related disability at 4 years . on the other hand , those with total sppb scores of 79 were 1.6 to 1.8 times more likely to become disabled17 . in this study , the average of total sppb scores in in - pt group was 9.0 and scores of 46 were only in 2 patients . however , a stepwise multiple - regression analysis could be applied to the predictor knee extension and anterior mid - thigh muscle thickness to predict total sppb scores . these results suggested that the total sppb scores could be evaluated by the strength tests and morphological assessment in knee extensor muscles for middle - aged and older adult cardiovascular disease patients , even if severely impaired mobility patients were very few within the group . in this study , the scores in side - by - side , semi - tandem stand and gait test were similar among the three groups . in contrast , the chair stand test ( 4 out of 12 score ) makes up a large part of total sppb scores compared with tandem stand ( 2 out of 12 score ) , suggesting that the differences of total sppb scores were mainly dependent on the chair stand test . it is well known that knee extension muscle size and strength play an important role in the chair stand performance for older adults18 , 19 . additionally , knee extension muscle size and strength were higher correlation coefficients with chair stand test , compared with balance and gait tests in this study . thus , it appears that the total sppb scores were largely affected by muscle strength and size of the quadriceps femoris . the limitation of this study was very difficult to evaluate the function and morphological assessment within the same hospital admission for in - pt group or the same hospital visit for the out - pt group . the sppb is an effective tool as the strength tests and lower extremity morphological evaluation for middle - aged and older adult cardiovascular disease patients . notably , high knee extensor muscle strength and quadriceps femoris muscle thickness are positively associated with high sppb scores .

[ purpose ] to examine if the sppb is higher with healthy subjects than outpatients , which was higher than inpatients and if the sppb can be validated assessment tool for strength tests and lower extremity morphological evaluation in cardiovascular disease patients . [ subjects and methods ] twenty - four middle aged and older adults with cardiovascular disease were recruited from inpatient and outpatient facilities and assigned to separate experimental groups . twelve age - matched healthy volunteers were assigned to a control group . sppb test was used to assess balance and functional motilities . the test outcomes were compared with level of care ( inpatient vs. outpatient ) , physical characteristics , strength and lower extremity morphology . [ results ] total sppb scores , strength tests ( knee extensor muscle strength ) , and lower extremity morphological evaluation ( muscle thickness of anterior and posterior mid - thigh and posterior lower - leg ) were greater in healthy subjects and outpatients groups compared with inpatients . to predict total short physical performance battery scores , the predicted knee extension and anterior mid - thigh muscle thickness were calculated . [ conclusion ] the sppb is an effective tool as the strength tests and lower extremity morphological evaluation for middle - aged and older adult cardiovascular disease patients . notably , high knee extensor muscle strength and quadriceps femoris muscle thickness are positively associated with high sppb scores .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION Conflicts of interest

familial adenomatous polyposis ( fap ) is an autosomal dominantly inherited syndrome characterized by the development of numerous ( hundreds to thousands ) polyps in the epithelium of the large intestines . its prevalence is approximately 310/100,000 , affecting both sexes equally , with symptoms clinically manifesting themselves by the late teens and in the twenties . the syndrome has a strong penetrance and in a typical course , all patients develop colorectal cancer , except when they are diagnosed and treated at an early stage . these polyps start out as adenomas in childhood , predominantly in the rectosigmoid colon , and during the second and third decades of life a malignant transformation to colorectal cancer occurs . the most common symptoms manifest in the advanced stage of fap and include rectal bleeding , anemia , abdominal pain , tenesmus , and diarrhea . in the majority of fap patients , a genetic disorder resulting from a germline mutation in the adenomatous polyposis gene ( apc gene ) other common clinical features in patients with fap include multiple gastric fundic gland polyps , duodenal , periampullar or ampullar adenomas , while extraintestinal features are desmoid tumors , congenital hypertrophy of the retinal pigment epithelium , epidermoid cysts , osteomas and thyroid cancer . the majority of patients with fap develop colorectal cancer by the age of 40 years . therefore , different surgical strategies have been adopted to prevent cancer development in the large bowel mucosa . all surgical interventions , histology , extracolonic manifestations , and mutations recorded in the affected family members are presented in a timeline fashion in table 1 . based on colonoscopically confirmed multiple polyps in the colon and rectum at the age of 11 coupled with a family history , a male patient underwent subtotal colectomy with ileorectal anastomosis . at 39 years of age , the patient underwent restorative proctectomy with ileal pouch - anal anastomosis . histopathology revealed hundreds of polyps with two adenocarcinomas found in the specimen both dukes a , astler coller b1 and g2 and multiple polyps with low- to high - grade dysplasia ( fig . 1 , fig . 2 ) . in 2010 , at the age of 41 , the patient was referred for genetic testing from the oncology department where he was receiving 5-fluoropirimidine / leucovorin and radiation as adjuvant treatment after miles procedure for recurrent rectal cancer ( a tumor 3 cm in diameter was found on ileoanal anastomosis , with 3 positive lymph nodes out of 4 isolated ) . the 2-year follow - up ct showed multiple lung and liver metastases and the patient was treated with a capecitabine - irinotecan ( xeliri ) plus bevacizumab protocol as first - line chemotherapy for metastatic colorectal cancer . in 1972 , the caucasian female , who was 24 years old at the time , underwent her first procedure , which was miles procedure for rectal cancer located at 13 cm from the anal verge . on pathology specimen , several polyps with high - grade dysplasia were found in the rectal ampulla . at the age of 33 , a correction of sigmoidostomy was performed due to a prolapse of the stoma , and multiple polyps were found in the specimen . total colectomy with kock 's reservoir was performed ( around 50 polyps with low- to high - grade dysplasia were recorded on pathology report ) . further follow - up was carried out according to fap protocols , and at the age of 55 , polyps were detected in the gastric antrum and duodenum and a biopsy revealed adenoma . at the age of 57 , 4 large periampullar polyps were removed , one of which comprised adenocarcinoma in situ . at the age of 63 and 65 , another 2 polyps , gastric and duodenal , were removed . at the age of 45 , after the clinical diagnosis was established in the family , other family members were screened . in 2010 , one year later , after high - grade dysplasia was confirmed by a polyp biopsy , total proctocolectomy with ileoanal anastomosis was performed ( pathology examination of the specimen revealed more than 50 polyps , with one comprising adenocarcinoma in situ ) . in 2012 , the patient underwent total thyroidectomy due to papillary thyroid cancer and duodenal polypectomy for duodenal tubular adenoma . 2 's mother had had colon cancer at the age of 41 and that her father had died of gastric cancer at the age of 69 . 1 's 31-year - old brother and his older daughter ( 14 years old ) had 2 and 3 polyps on colonoscopy , respectively ( adenomas on biopsy ) , while his younger daughter ( 12 years old ) had negative colonoscopy . a family pedigree chart ( fig . 3 ) was then constructed and genetic testing was offered to the entire family : patients no . based on colonoscopically confirmed multiple polyps in the colon and rectum at the age of 11 coupled with a family history , a male patient underwent subtotal colectomy with ileorectal anastomosis . at 39 years of age histopathology revealed hundreds of polyps with two adenocarcinomas found in the specimen both dukes a , astler coller b1 and g2 and multiple polyps with low- to high - grade dysplasia ( fig . 1 , fig . 2 ) . in 2010 , at the age of 41 , the patient was referred for genetic testing from the oncology department where he was receiving 5-fluoropirimidine / leucovorin and radiation as adjuvant treatment after miles procedure for recurrent rectal cancer ( a tumor 3 cm in diameter was found on ileoanal anastomosis , with 3 positive lymph nodes out of 4 isolated ) . the 2-year follow - up ct showed multiple lung and liver metastases and the patient was treated with a capecitabine - irinotecan ( xeliri ) plus bevacizumab protocol as first - line chemotherapy for metastatic colorectal cancer . the first clinically confirmed family member was patient no . 1 's mother . in 1972 , the caucasian female , who was 24 years old at the time , underwent her first procedure , which was miles procedure for rectal cancer located at 13 cm from the anal verge . on pathology specimen , several polyps with high - grade dysplasia were found in the rectal ampulla . at the age of 33 , a correction of sigmoidostomy was performed due to a prolapse of the stoma , and multiple polyps were found in the specimen . total colectomy with kock 's reservoir was performed ( around 50 polyps with low- to high - grade dysplasia were recorded on pathology report ) . further follow - up was carried out according to fap protocols , and at the age of 55 , polyps were detected in the gastric antrum and duodenum and a biopsy revealed adenoma . at the age of 57 , 4 large periampullar polyps were removed , one of which comprised adenocarcinoma in situ . at the age of 63 and 65 , another 2 polyps , gastric and duodenal , were removed . at the age of 45 , after the clinical diagnosis was established in the family , other family members were screened . in 2010 , one year later , after high - grade dysplasia was confirmed by a polyp biopsy , total proctocolectomy with ileoanal anastomosis was performed ( pathology examination of the specimen revealed more than 50 polyps , with one comprising adenocarcinoma in situ ) . in 2012 , the patient underwent total thyroidectomy due to papillary thyroid cancer and duodenal polypectomy for duodenal tubular adenoma . no other extracolonic disease or intestinal recurrences were found . 2 's mother had had colon cancer at the age of 41 and that her father had died of gastric cancer at the age of 69 . 1 's 31-year - old brother and his older daughter ( 14 years old ) had 2 and 3 polyps on colonoscopy , respectively ( adenomas on biopsy ) , while his younger daughter ( 12 years old ) had negative colonoscopy . 3 ) was then constructed and genetic testing was offered to the entire family : patients no . herein a three - generation case of fap in a single family is presented , in which the grandmother , her son and her granddaughter had a clinical presentation of fap . the grandmother and granddaughter remained disease - free after they had undergone total proctocolectomy , but the son developed recurrent colon cancer on ileoanal anastomosis and later metastatic disease . they were all subjected to the screening and follow - up recommended for fap patients , and genetic testing revealed a 2805c > g substitution , which results in a truncated protein . most individuals with fap will develop colon cancer by the age of 40 ; therefore , prophylactic surgery is generally recommended before the age of 25 . there are 3 main surgical options for patients with fap : ( 1 ) total proctocolectomy with brooke ileostomy ; ( 2 ) subtotal colectomy with ileorectal anastomosis , and ( 3 ) restorative proctocolectomy with the formation of an ileal reservoir and ileoanal anastomosis [ 5 , 6 ] . the treatment of choice is total colectomy ; however , the removal or preservation of the rectum is a matter of controversy . the decision to remove the rectum is influenced by the number of polyps in the rectum as well as by the family history . if there are only few polyps in the rectum , total colectomy with ileorectal anastomosis may be recommended . if the rectum is involved , then restorative proctocolectomy with ileal pouch - anal anastomosis is the treatment of choice . prophylactic surgery significantly improves the outcome of patients with fap . in the granddaughter 's resected colon , numerous polyps were found , microscopically demonstrating high - grade epithelial dysplasia as the last stage in the multistep process of colorectal carcinogenesis . these features probably displayed a more aggressive mutation phenotype since she was only 14 years old at the time of surgery . generally , prophylactic cancer - preventive colorectal surgery is recommended by the late teens or early twenties . half of fap patients develop adenomas by 15 years of age but cancer development at this age is uncommon . the optimal surgical procedure is proctocolectomy with pouch formation and ileoanal anastomosis since it completely removes all large bowel mucosa as potential origin of cancer and thereby minimizes the risk of malignancy , while preserving bowel function . for most patients , patients who undergo ileorectal anastomosis are at risk , varying from 13 to 59% , of developing rectal adenomas and carcinomas after 25 years and they demand lifelong rectal surveillance . moreover , in a subset of patients having undergone proctocolectomy , endoscopic annual surveillance of the pouch and transitional anal zone is essential since many studies have demonstrated that premalignant changes and invasive adenocarcinomas are found in the ileoanal pouch even after restorative proctocolectomy [ 11 , 12 , 13 ] . patient no . 1 omitted colonoscopic surveillance between the last two surgical procedures , which might explain the extent of local recurrence . colonoscopy and prophylactic colectomy are the primary strategies to prevent colon cancer or detect it at an early stage . the american gastroenterology association recommends annual sigmoidoscopy in patients with classic fap and at - risk relatives starting at the age of 1012 years . patients with adenomatous polyps found on sigmoidoscopy should undergo a full colonoscopy and random biopsies to establish the severity of the polyposis . the family members who are mutation - free will be surveyed by the protocols for the general population . implementation of genetic testing that would result in standard protocols is still a matter of debate , since the tests are still not widely available and patients are not referred when indicated , leaving room for improvement in fap treatment . the reason why the grandmother did not have a regular follow - up or a more aggressive surgical treatment remained obscure even after a careful review of her history . we believe it might both be due to the unawareness of this syndrome at the time of the first operation and surgery planning based on sigmoidoscopy . on the other hand , the patient had not been compliant with regular follow - up until the diagnosis of fap was made and its implication explained . this issue stresses the critical importance of lifelong follow - up and responsibility for both patients and physicians to adhere to when dealing with fap . several studies have demonstrated that a regular use of nonsteroidal anti - inflammatory drugs and selective cox-2 inhibitors can reduce the polyp number and size in patients with fap [ 15 , 16 , 17 ] . upon these results , celecoxib was approved as adjunctive preventive treatment in patients with fap , besides inevitable endoscopic surveillance and surgical intervention . 2 had surgery for parathyroid adenoma and patient no . 3 for thyroid cancer , while patient no . patient compliance with regular and strict surveillance is an important factor when deciding on the optimal type of prophylactic surgery . patients who are not adherent to surveillance should undergo proctocolectomy with ileal pouch - anal anastomosis . timing and type of preventive surgery as well as compliance with preventive strategies and strict follow - up are essential for minimizing the risk of cancer development in patients with fap .

backgroundfamilial adenomatous polyposis ( fap ) is an autosomal dominantly inherited syndrome characterized by the development of numerous polyps in the colon and rectum . if left untreated , the affected patients inevitably develop colon cancer by the age of 40 years . a resection of the colon ( colectomy ) or of the colon and rectum ( proctocolectomy ) is needed to minimize the risk of cancer.case presentationwe report a case of fap through three generations of a single family , in which the grandmother and granddaughter underwent total colectomy with ileoanal anastomosis and did not develop colon cancer , while the son underwent subtotal colectomy with ileorectal anastomosis and developed recurrent rectal cancer . data regarding timely surgery , surveillance , and chemoprevention are discussed.conclusionthe fap phenotype determines the type of treatment . in severe polyposis , proctocolectomy with ileoanal anastomosis seems to be the optimal method for minimizing the risk of cancer development . this case report advocates complete rectal removal , especially in cases of poor patient compliance with colonoscopic surveillance .

Background Case Presentation Case 1 Case 2 Case 3 The Family Mutations Discussion Conclusion

with the advent of a new concept for health and hygiene along with global developments in medical education that were initiated in a global meeting in almaty ( kazakhstan ) in 1978 , the primary health care ( phc ) strategy as the first step in achieving the health for all aim up to the year 2000 was suggested ( 1 ) . then , the resolutions of the world gathering in edinburgh , scotland , in 1988 showed the necessity of a change in the medical education programs based on the needs of society , and the modern role of the physician caused changes in medical educational programs . this should be in a way that graduates abilities are enhanced in terms of identifying society s health problems and to maintain and increase people s health care , thereby leading to changes in the general medical training programs ( 1 ) . the social accountability strategy tries to improve organizational performance by supporting the participation of citizens and accountability for policymakers in the public and private sectors . in practice , the concept of social accountability includes a wide range of innovation and creativity ( 2 ) . the concept of social accountability in response to a great wish for social justice in health care has many proponents in medical schools ( 3 ) . paying even more attention to the role of social factors in society s health has resulted in the fact that the role of physicians , in addition to providing diagnostic and therapeutic services , has increased relative to leadership of the community in terms of health and health - related issues . currently , the growth and rapid changes in medical knowledge are occurring so rapidly that the knowledge of a medical student is only sufficient for a brief time after graduation considering quality and up - to - date practices . thus , another role is defined for practitioners , which is the management of medical knowledge . physicians of the third millennium should be able to obtain their patients information in a short time and investigate its validity and reliability in taking care of the patients . the explosion of information in the health sector , the increasing complexity of the health system , the change in disease patterns , and the population that is becoming older , globalization , the advent of new technology , and the increase of costs in health care have caused medical educators to implement certain changes to adapt to the changing situation ( 4 , 5 ) . therefore , the biggest challenge of medical colleges in the future is their need to attempt to show more effects on health through a linked relationship with the community , which is the social accountability objective ( 6 ) . the world health organization in 1995 established new tasks for students , teachers , and educational planners by entering the society as a main factor in medical education and defined social accountability , i.e. , guided training , research and services in order to satisfy the health needs and priorities of the community , region or nation that have the service commitment ( 7 ) . today , the accreditation institutes , by developing evaluation indicators and performing foreign evaluations , have provided great help for the educational institutions . these institutes could be good motivators for educational institutions to pay attention to these issues by setting up appropriate indicators regarding the social response . the global consensus for social accountability of medical schools ( gcsa ) program has clearly considered the accountability of educational institutions for social response of the curriculum . in iran , in the ninth accountability standard of medical education centers for research and development programs , there has been an emphasis on providing organized programs for developing an accountable education in medical universities ( 8) . although the general principles of social accountability were provided over a decade ago , they rarely have been applied in medical schools ( 6 ) . the results of research conducted at a medical school in iran regarding the social accountability in education section showed that social accountability is at a relatively favorable level . this situation was undesirable in the design phase , relatively favorable while being conducted , and was desirable in the consequence stage ( 9 ) , and , since one of the initial stages of proper designing is proper investigation of the needs , in this research , we investigated the educational program needs of a general medical training course for social accountability in mashhad medical school in 2015 . this was a cross - sectional study performed on three groups , i.e. , experts , faculty members , and general physicians , working in the health centers of mashhad in 2014 . the study was conducted with regard to needs assessment with consensus method in three stages . the delphi method is a useful approach for developing consensus among a relatively large group of participants ( 10 ) . moreover , this method has been used extensively in the development of educational programs ( 11 , 12 ) . the research instrument was a questionnaire that was prepared using valid texts and resources . for content and face validity of the questions in the first stage , five experts and scholars in medical education and social accountability were identified , and , then , the necessary modifications of the tools were conducted . the reliability coefficient for the questionnaire s items based on cronbach s alpha coefficient was 95% . the questionnaire consisted of demographic information ( age , gender ) and the above - mentioned four areas designed based on the care model . clinical activities , advocacy , research , and training areas consisted of open - ended questions . we asked questions such as , what clinical work do you do that you consider socially accountable ? what advocacy work do you do for social accountability ? we looked more at the medical school as a whole and asked what elements apply to these issues and where there are gaps that should be addressed . in the first stage , basic questions were sent ( via email or fax ) in an unstructured or open - ended format for the sample population , and they were asked to brain storm and express their ideas freely and then return their responses . moreover , if necessary , we asked the questions face to face . when the responses were collected , they were organized by combining similar views , eliminating repeated issues , and making the responses as short as possible . if necessary , reminder emails were sent to individuals or phone calls were made as reminders . moreover , the care model is for identifying the social accountability , which identifies four important areas for social accountability measures , including clinical activities , advocacy , research and education , and training . therefore , the responses were classified into four groups based on these areas . in the second stage , we used a structured questionnaire , and the responses that were received were sent to people who were asked to rate the responses using a likert scale . at this point , the results of the second phase were sent to the participants , and they were asked to review the responses again and to revise their comments and judgments , if necessary , and to mention their reasons for the lack of consensus and grade their importance considering the mean and median scores . finally , the comments were finalized , and the items listed for each area for social accountability were identified based on the ideas of the target group . at this stage , the final results were prepared and published . this was a cross - sectional study performed on three groups , i.e. , experts , faculty members , and general physicians , working in the health centers of mashhad in 2014 . the study was conducted with regard to needs assessment with consensus method in three stages . the delphi method is a useful approach for developing consensus among a relatively large group of participants ( 10 ) . moreover , this method has been used extensively in the development of educational programs ( 11 , 12 ) . the research instrument was a questionnaire that was prepared using valid texts and resources . for content and face validity of the questions in the first stage , five experts and scholars in medical education and social accountability were identified , and , then , the necessary modifications of the tools were conducted . the reliability coefficient for the questionnaire s items based on cronbach s alpha coefficient was 95% . the questionnaire consisted of demographic information ( age , gender ) and the above - mentioned four areas designed based on the care model . clinical activities , advocacy , research , and training areas consisted of open - ended questions . we looked more at the medical school as a whole and asked what elements apply to these issues and where there are gaps that should be addressed . in the first stage , basic questions were sent ( via email or fax ) in an unstructured or open - ended format for the sample population , and they were asked to brain storm and express their ideas freely and then return their responses . moreover , if necessary , we asked the questions face to face . when the responses were collected , they were organized by combining similar views , eliminating repeated issues , and making the responses as short as possible . if necessary the care model is for identifying the social accountability , which identifies four important areas for social accountability measures , including clinical activities , advocacy , research and education , and training . therefore , the responses were classified into four groups based on these areas . in the second stage , we used a structured questionnaire , and the responses that were received were sent to people who were asked to rate the responses using a likert scale . at this point , the agreement and disagreement areas were identified . after collecting the questionnaires , , the results of the second phase were sent to the participants , and they were asked to review the responses again and to revise their comments and judgments , if necessary , and to mention their reasons for the lack of consensus and grade their importance considering the mean and median scores . finally , the comments were finalized , and the items listed for each area for social accountability were identified based on the ideas of the target group . at this stage , the final results were prepared and published . after collecting the data in three stages using the delphi method , the final results were determined as follows : in this study , only 19 people out of 30 selected people were involved in all three phases . different participants ages were 50.5 6.92 for experts , 44.4 6.67 for faculty members , and 37.6 3.97 for general physicians . the participants were 73.69% males and 26.31% females . in total , according to the results , 12 items in the scope of clinical activities , 10 items in advocacy activities , 8 items in research activities , and 8 items were identified in the educational activities . as indicated by the results of the needs analysis conducted in the present study , in order to reach social accountability of medical students of mashhad university of medical sciences , the curriculum must cover four major areas , including clinical activities , advocacy , research , and training . among others , clinical activities comprised of 12 items among which familiarizing students with common diseases , epidemiologic transition of disease , and change of the disease burden in society and early exposure of students to health problems ( e.g. , due to working in drop in centers ( dic ) , high - risk behavior counseling centers , community oriented health centers , and shelter mayoralty ) showed the highest ( 84.3% ) and advocacy area included 10 items among which community - oriented medical education and familiarizing students with insurance systems and people working in charities , respectively , demonstrated the highest ( 42.11% ) and the lowest ( 0% ) percentage of agreement . within the scope of the research , there were 8 items , including conducting key research regarding social health - related issues with the highest percentage of agreement ( 47.37% ) and the importance of community - based studies with the lowest ( 15.79% ) percentage of agreement . finally , educational area comprises of 8 items , including using community - based , outpatient medical education , problem - oriented and holistic models with the highest ( 52.63% ) and continuing education through continuous education programs , continuous study , etc . with the lowest ( 5.26% ) percentage of agreement ( tables 14 ) . there is a growing interest around the world in social accountability in medical schools and other health - related colleges ( 4 ) . according to the results , the first item in clinical activities area was to familiarize students with common diseases , epidemiological transition of diseases , and changes in the burden of diseases in the community . in iran , general practitioners should manage the provision of medical services to individuals . additionally , as the next priorities , the second up to the twelfth row emphasize on some important points including students clinical activities in terms of social accountability , the formation of medical schools contents based on societies priorities , and medical courses as being integrated ( horizontal , vertical ) and taught in health centers , clinics , hospitals and classrooms . in this , we can ensure that students become familiar with the communities in which they work , and they notice their health needs and how to react or dissolve their issues ( 13 , 14 ) . however , some amendments in mashhad medical school are recommended based on our investigation of the educational curriculum for medical education , such as the horizontal integration of some courses in the basic sciences and pathogenesis , as well as clinical teaching of hospitals and toward teaching to clinics . this is a very encouraging issue that the authorities in universities have felt the need for changes of the curriculum of medical students in line with the changes in recent years around the world , including changes in the growing population , the face of the population , and thus changing the face of diseases and injuries and health needs of community . therefore , the need for close scrutiny was considered in the medical education programs of mashhad university of medical sciences . noted in their article that one of the ways to increase the social accountability of medical education is a comprehensive direct confrontation with the problems of society . since the decade of the 1960s , medical schools have established clinics in society in which physicians are trained with other professionals and serve society at the same time ( 15 ) . moreover , in the advocacy area , 10 items were identified as priorities , and the first priority emphasizes community - based medical education . yamani et al . concluded in their paper that social accountability must be seen as medical universities main missions , and the first step in the development of accountability is to identify the needs of society ( 8) . noted that community - oriented issues in medical education meeting the actual needs of the community has confronted a chaotic way . community orientation is a concept that is more than ever required to provide services in the field of medical science ( 9 ) . in medical sciences fields , there is more quantitative paradigm in which its importance is more in the empirical sciences compared to humanities . professionalism , accountability , altruism , and empathy that are important indicators of the accountability of doctors are not considered much in quantitative paradigms . therefore , the medical education curriculum is poor in terms of humanistic insights . medical schools expect that doctors and students appreciate professional values both in clinics and in society . in addition , little attention has been paid to the concept of community s medical support ( advocacy ) in the medical curriculum or in social science education , which is closely related to accountability ( 1618 ) . based on the results , 8 items were identified in the research area , and the first one emphasizes the investigation and study of needs and society s priorities . rezaeian stated in his article that research is one of the activities of medical schools that usually is conducted in the areas of clinical and basic sciences . according to the research conducted in medical schools and despite paying attention to social problems covered by them , this kind of research does not have the necessary focus in medical schools ( 19 ) . collier , boelen , and woollard also emphasized the responsibility of medical schools toward society and expressed that , in addition to conducting research in the basic and clinical sciences , there should be an endeavor toward the priorities regarding the society s health ( 20 , 21 ) . the first priority is regarding the use of the community - based models , outpatient medical education , and problem - based , holistic education . ghaffari et al . concluded in their research that the use of new and effective educational practices , such as the use of problem solving - based learning ( pbl ) or small group discussions are the most prevailing educational practice in our country in the big groups that is most observed in basic science . this is while most of the medical schools that are prominent in the world have tried to transform teaching practices from lecture - based teaching to problem solving - based teaching and discussion in small groups , which is especially most considered in australian medical colleges ( 22 ) . as indicated by the results of some studies carried in canada and australia , social accountability seems to be the most initiative strategy in developing curriculum and running admission process satisfying regional needs ( 1 ) . this can successfully manage the existing unevenness and improve the positive and economic impacts demanded by the regions from medical schools . in total , for developing the culture of social accountability in medical schools , there is a necessity to recognize the existing needs and trends in order to design an appropriate program . as presented in the 10 solutions by the global consensus of social accountability of medical training , there is an emphasis on the development of outcomes - driven the curriculum , but it should be noted that changing and reforming the curriculum is a complex and time - consuming process . furthermore , reforming the curriculum requires funding , facilities , curriculum specialists presence , a new process for accepting students and community - based educational program ( 6 , 23 , 24 ) . however , various strategies are suggested to promote social accountability in the educational program , including the development of models and theoretical frameworks for curriculum accountability . omid et al . , in two studies on the use of general practitioners and family physicians , emphasized experience in determining the educational content required by doctors ( 25 , 26 ) . lindgren stated in his article that , in medical education , there should be consideration of a curriculum for the training of general practitioners . medical education at all three levels , such as general education , professional , and continuing education , should consider social accountability . standards of the world federation for medical education ( wfme ) have examined these three areas separately and have emphasized the importance of all three levels ( 27 ) . the findings of this study showed that training program needs for social accountability include four areas , i.e. , 12 items for clinical area in which items such as familiarizing students with common diseases , epidemiologic transition of disease , change of the disease burden in society had the highest percentage of agreement ( 84.3% ) , advocacy area included 10 item in which community oriented medical education had the highest percentage of agreement ( 42.11% ) , within the scope of research there are 8 items such as conducting key researches regarding societies health - related issues with the highest percentage of agreement ( 47.37% ) , and in educational area 8 items using community - based , outpatient medical education , problem - oriented and holistic models had highest percentage of agreement ( 52.63% ) . the findings of this study were significant , and training managers and planners can apply these findings toward developing standards for general medical curriculum guaranteeing accountability at the school of medicine . supplementary research on the health needs of the population with a needs assessment methodology can be the appropriate path for future research on this topic .

introductionexperts consider social accountability as a new paradigm in medical education and a cultural change that is necessary to be studied and understood more deeply . one of the problems of medical education is the inadequacy of medicine graduates to meet the social accountability . therefore , the aim of this study was to examine the general medicine curriculum for social accountability.methodsthis cross - sectional study was conducted on three groups of experts , faculty members , and general physicians working in health centers in mashhad in 2014 . according to the needs assessment and definition of need as a requirement or preference , the research was conducted in three stages using the delphi method , in which the opinions of experts , lecturers , and practitioners were collected and classified based on the care model in four areas , i.e. , clinical activities , advocacy , research , and educational categories , and , ultimately , the percentage of agreement was determined.resultsas indicated by the results of the need analysis , in order to reach social accountability of medical students of mashhad university of medical sciences , the curriculum should cover four major areas , i.e. , clinical activities , advocacy , research , and training . we found 38 items for social accountability that are required in the general medical curriculum , including clinical activities ( 12 items ) , advocacy ( 10 items ) , and scope of research ( 8 items ) . the educational area was comprised of 8 items . in this study , from 30 participants , only 19 people participated in the three - step delphi , and there was a 70% response rate in the first stage and second stage , but 90.47% in the third stage.conclusionthere is a growing interest around the world for social accountability in medical schools and other health - related schools . it is expected that the results will be of interest to planners and policy - makers in this field so that we will observe a promotion in the culture of social accountability in mashhad university of medical sciences .

1. Introduction 2. Material and Methods 2.1. Research design and setting 2.2. Instrument 2.3. Data collection 3. Results 4. Discussion 5. Conclusions

listeria monocytogenes ( l. monocytogenes ) un microrganismo patogeno , gram positivo , che colpisce soprattutto alcune categorie di popolazione a rischio quali soggetti immuno - compromessi e donne in gravidanza . la trasmissione dellagente infettivo , per via alimentare , ha un grande impatto per la salute pubblica , sia per la severit della malattia provocata , sia per limpatto sociale che ne consegue . nel 2010 sono stati registrati nellunione europea 1601 casi di listeriosi ( european food safety authority , 2012 ) . l. monocytogenes un patogeno molto diffuso nellambiente e negli alimenti di origine animale e vegetale , in grado di adattarsi a condizioni ambientali anche sfavorevoli . tuttavia quella alimentare rimane la principale via di infezione per luomo ( parisi , 2012 ) , ed il consumo di cibi ready - to - eat ha contribuito allaumento di listeriosi nei paesi pi industrializzati . il fatto che l. monocytogenes sia capace di sopravvivere e moltiplicarsi anche a basse temperature , ad esempio comprese tra + 2 e + 4c , rende la sua presenza negli alimenti rte particolarmente diffusa , ed in particolare nei prodotti lattiero - caseari , nelle carni salate e salumi ed in taluni prodotti della pesca ( european food safety authority , 2013 ) . il regolamento ( ce ) 2073 del 2005 ( commissione europea , 2005 ) e le successive modificazioni hanno introdotto , nel contesto legislativo di riferimento degli alimenti di origine animale , il concetto di alimento ready - to - eat su cui effettuare la ricerca e la numerazione di l. monocytogenes , a seconda che lalimento costituisca o meno terreno favorevole allo sviluppo del germe . nel caso dei prodotti lattiero - caseari , la presenza di l. monocytogenes pu essere dovuta a diversi fattori tra cui contaminazione iniziale della materia prima ( per i formaggi a latte crudo ) , insufficiente temperatura di pasteurizzazione , contaminazione nelle fasi successive al trattamento termico previsto nel processo produttivo . l. monocytogenes un germe in grado di resistere per anni nellambiente di manipolazione degli alimenti e sviluppare resistenza nei confronti dei comuni prodotti utilizzati per interventi di sanificazione . tale caratteristica agevolata dalla produzione di biofilm che l. monocytogenes pu formare da sola od insieme ad altri germi di contaminazione ambientale ( caruso et al . , 2012 ; in questultimo caso , risultano essere di fondamentale importanza le procedure di pulizia e sanificazione che devono essere applicate alle diverse tipologie di superfici che , se non in grado di rimuovere completamente la matrice adesiva e protettiva dei biofilm , portano inevitabilmente a rischi di contaminazione secondaria ( cecchini et al . , 2011 ) . nel mese di novembre 2012 un campione di mozzarella , prelevato presso un stabilimento della regione lazio nel corso delle regolari attivit di controllo ufficiale dei servizi veterinari , stato consegnato allizslt di roma per analisi di routine risultando poi positivo per la presenza di l. monocytogenes . a seguito della positivit sono state eseguite ulteriori verifiche sia da parte dellautorit competente sia da parte dellazienda produttrice nellambito delle azioni previste dal proprio piano di autocontrollo . scopo del presente lavoro quello di presentare i risultati derivanti dallattivit analitica svolta dai laboratori su campioni di mozzarella e campioni ambientali esaminati in seguito ad un episodio di contaminazione da l. monocytogenes . i risultati ottenuti sono stati poi messi in relazione con una precedente positivit riscontrata in autocontrollo , evidenziatasi qualche mese prima presso il medesimo stabilimento . le indagini sono state condotte per un periodo di tre mesi , su un totale di 161 campioni di cui 90 riferibili a prodotti lattiero - caseari ( mozzarella n=85 , primo sale n=2 , ricotta n=3 ) , 7 liquido di governo e salamoia e 64 tamponi ambientali . sui suddetti campioni , prelevati in regime di controllo ufficiale ed autocontrollo , sono state effettuate le seguenti determinazioni : ph , aw , l. monocytogenes presenza e conta per i prodotti lattiero caseari , solo l. monocytogenes presenza e conta sui campioni ambientali . la determinazione del ph stata eseguita utilizzando il metodo di riferimento mfhpb-03:2003 , per law il metodo di riferimento iso 21807:2004 ( iso , 2004 ) ; la presenza / assenza di l monocytogenes stata valutata con il metodo vidas lmo2 afnor bio-12/11 - 03/04 , consistente essenzialmente in unanalisi immuno - enzimatica a fluorescenza mediante lo strumento vidas ( biomrieux , marci letoile , francia ) , mentre per la sua numerazione il metodo di riferimento stato iso 11290 - 2:2005 ( uni , 2005 ) . lidentificazione biochimica , per la conferma delle colonie sospette , stata effettuata con il vitek 2 compact biomrieux . gli isolati di l. monocytogenes sono stati poi sottoposti a sierotipizzazione , mediante la combinazione di metodi molecolari e siero agglutinazione . la sierotipizzazione di l. monocytogenes , effettuata mediante multiplex pcr , stata eseguita utilizzando il protocollo doumith et al . e nella successiva suddivisione dei tre lignaggi i , ii e iii , in cinque gruppi filogenetici , ciascuno correlato con i seguenti sierotipi : gruppo i.1 ( sierotipi 1/2a-3a ) ; gruppo i.2 ( sierotipi 1/2c-3c ) ; gruppo ii.1 ( sierotipi 4b-4d-4e ) ; gruppo ii.2 ( sierotipi 1/2b-3b-7 ) ; gruppo iii ( sierotipi 4a-4c ) ( doumith et al . , 2004b ) . la sierotipizzazione con antisieri permette di distinguere i 12 sierotipi di l. monocytogenes differenziabili per lespressione , sulla superficie cellulare , di antigeni somatici o e flagellari h. per la conferma dei sierotipi dai sieroguppi , individuati con la metodica molecolare , si proceduto con la sieroagglutinazione mediante il kit listeria antisera seiken ( denka seiken co. ltd , tokyo , giappone ) . dei 47 ceppi di l. monocytogenes isolati , solo 11 sono stati sottoposti a caratterizzazione molecolare , 5 isolati da mozzarelle e 6 da tamponi ambientali . la selezione stata effettuata sulla base delle precedenti prove sierologiche e molecolari in pcr multiplex , che hanno messo in evidenza sempre lo stesso sierotipo . tali ceppi , sono stati poi confrontati con il ceppo precedentemente isolato da un campione di mozzarella prodotto presso lo stesso stabilimento ed analizzato nellambito dei controlli aziendali ; tale confronto stato effettuato mediante pulsed field gel electrophoresis ( pfge ) , secondo quanto descritto nel protocollo standardizzato pulsenet l. monocytogenes ( cdc , 2009 ) ; per il metodo stato utilizzato un enzima di restrizione ( asci ) ed uno standard riferibile a salmonella braenderup ( h9812 ) . su 4 dei ceppi suddetti , 3 provenienti da mozzarelle e 1 da campione ambientale ( tampone ) , stata effettuata anche la digestione con lenzima apai , dato che , ad una prima lettura dei loro profili , questi presentavano delle differenze che tale enzima avrebbe meglio evidenziato . dopo la digestione , i ceppi sono stati sottoposti a corsa elettroforetica con il sistema chef mapper xa ( biorad inc . , berkeley , ca , usa ) a 6v / cm con un switch time da 4 a 40 s per 21 h. il gel ottenuto stato colorato con il gelred ( biotium , hayward , ca , usa ) . la valutazione della similarit tra i diversi profili di macrorestrizione stata effettuata utilizzando il coefficiente di dice con una ottimizzazione e tolleranza dell1% . attraverso lutilizzo del software seguita poi la clusterizzazione e la costruzione del dendrogramma utilizzando il metodo unweighted pair group method with arithmetic mean ( upgma ) . fra i prodotti lattiero caseari , le positivit sono state riscontrate solo su campioni di mozzarella . il 24.4% dei campioni analizzati ( n=90 ) risultato positivo e di questi il 18.2% presentava valori di l. monocytogenes superiori a 100 ufc / g . dei 64 tamponi ambientali , 6 sono risultati positivi per l. monocytogenes ( 9,4% ) , ma con un numero di microrganismi < 10 ufc / g ; le acque di salamoia e di governo sono invece risultate tutte negative . i ceppi isolati ( n=47 ) dai prodotti lattiero caseari e dai tamponi ambientali sono risultati appartenere al medesimo sierotipo ( 4b/4e ) e pertanto sovrapponibile al primo i profili di restrizione ottenuti con lenzima asci mostrano una similarit del 98% mentre per quelli ottenuti con apai la percentuale di similarit risultata pari al 96,78% . il processo di produzione della mozzarella prevede la riduzione della cagliata in piccoli pezzi che favorisce leliminazione del siero in eccesso ; attraverso un sistema automatizzato la matrice viene trasferita nella filatrice costituita da pi sezioni . in tale fase di processo il prodotto viene ulteriormente sminuzzato e posto a contatto con acqua a temperatura di 82c cui segue , nella parte terminale della filatrice , la formazione di ununica massa filata con temperatura di circa 60c . le diverse fasi di produzione a temperatura controllata , sono state individuate come punti critici del processo da sottoporre a monitoraggio continuo ( ccp ) , in quanto volti ad eliminare o ridurre a livelli accettabili la presenza di l. monocytogenes , sebbene alcuni studi di processo sostengano il contrario ( rudolf e scherer , 2001 ) . le successive fasi di lavorazione ( formatura , rassodamento e confezionamento in liquido di governo ) non possono invece fornire adeguate garanzie in caso di contaminazione di l. monocytogenes in quanto non sono presenti ulteriori ccp . nel presente caso , il riscontro di l. monocytogenes in campioni di mozzarella pu essere attribuito ad una contaminazione di tipo ambientale post trattamento termico in quanto i medesimi sierotipi di l. monocytogenes , sono stati riscontrati in campioni ambientali prelevati dalla ditta in autocontrollo e verosimilmente riconducibile ad una non corretta applicazione delle procedure di pulizia e sanificazione delle superfici ed ambienti di lavoro . difatti , lanalisi dei profili pfge ottenuti con i 2 enzimi ( asci e apai ) ha evidenziato la presenza di una singola popolazione clonale in entrambi le tipologie di campioni ( ambiente ed alimento ) . la corretta applicazione delle procedure riportate nel piano di autocontrollo , la loro validazione e la verifica periodica della loro efficacia sono , come sempre , fondamentali per il controllo di processo e la sicurezza dei prodotti fabbricati . nel presente caso sono state apportate modifiche alle procedure di pulizia e sanificazione in uso , inclusi i prodotti , che hanno permesso leliminazione di l. monocytogenes , dagli ambienti di lavorazione e la risoluzione delle non conformit rilevate in autocontrollo . le verifiche periodiche da parte del controllo ufficiale sono poi di indispensabile ausilio al sistema di autocontrollo aziendale soprattutto nel caso in cui siano registrate non conformit nelligiene e dei criteri di processo , di cui al regolamento 2073/2205 , come quelle riportate nel presente lavoro . lo sviluppo e lapplicazione di metodi di laboratorio pi sofisticati , pcr e pfge ad esempio , rispetto ai microbiologici classici , sono poi di fondamentale importanza a supportare lidentificazione di eventuali non conformit non strettamente legate alle fasi di processo e , di conseguenza , ad individuare con piu accuratezza le problematiche di carattere procedurale .

following a listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in lazio region , further investigations have been conducted both by the competent authority and the food business operatordairy factory ( as a part of dairy factory haccp control ) . in total , 90 dairy products , 7 brine and 64 environmental samples have been tested . the prevalence of listeria monocytogenes was 24.4% in mozzarella cheese , and 9.4% in environmental samples , while brines were all negatives . forty - seven strains of l. monocytogenes have been isolated , all belonging to 4b/4e serotype . in 12 of these , the macrorestriction profile has been determined by means of pulsed field gel electrophoresis . the profiles obtained with asci enzyme showed a 100% similarity while those obtained with apai a 96.78% similarity . these characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination .

Introduzione Materiali e Metodi Risultati Discussione e Conclusioni

pharmacoeconomics is a sub - discipline of the field of health economics , which itself is a relatively new sub - discipline of economics , only formerly appearing in the economics scientific literature since the 1960s . pharmacoeconomics has been defined as the description and analysis of the costs of drug therapy to health care systems and society . it identifies , measures and compare costs ( resources consumed ) and consequences ( clinical , economic , humanistic ) of pharmaceutical products and services ( 1 ) . pharmacoeconomic studies weigh the cost of alternative drugs and drug regimens against the outcomes they achieve to guide decisions and policies about which drugs should be used in general , which drugs should be paid for by the government or other third party payers , etc . the importance of pharmacoeconomic information to healthcare decision makers will depend upon the viewpoint from which the analysis is conducted . pharmacoeconomics is needful in pharmaceutical industry , government , and in the private sector for comparing various cost consequences . the two fundamental components of pharmacoeconomic studies are measures of costs and measures of outcomes that are combined into a quantitative measure or ratio ( 2 ) . recently , role of pharmacoeconomics in decision making process about new pharmaceuticals inclusion into public funding schemes is increasing and becoming more important . the increase in expenditure of health care has prompted many governments , health insurance companies and health providers throughout the world to adopt strategies to manage the high cost of medication , including formulary management and the use of pharmacoeconomics ( 3 ) . development of pharmacoeconomic analysis and concept has led to it application beyond pharmaceuticals assessment . today , most of developed countries has established concept of health technology assessment which is defined as the devices , drugs , medical and surgical procedures and knowledge associated with their use in the prevention , diagnosis and treatment of diseases as well as in rehabilitation , and the organizational and supportive systems within which the care is provided(4 ) . most of european and developed countries has established national organizations performing pharmacoecnomic evaluations to inform health decision makers and payers about cost - effectiveness of new therapeutics and also those already introduced into national financing programs ( 5 ) . there is increasing trend in use of pharmacoeconomic studies in european union ( eu ) countries and more european countries are introducing formal requirements for economic evaluation of new medicines , particularly in the case of innovative products , or in situations in which the manufacturer is seeking a premium price ( 6 ) . most developing countries lack policies that encourage the use of economic evaluations in medicine selection for public funding , prioritization of aid or health insurance . in addition , relevant guidelines for reporting pharmacoeconomic analyses are not available in the majority of countries . most developing countries and low income countries do have national essential medicine lists to guide procurement and donation of medicines in the public sector which is the case in bosnia and herzegovina ( 7 ) . use of pharmacoeconomic evaluation in bosnia and herzegovina is extremely low and performed sporadically by health care decision makers ( 8 , 9 ) , even recently introduced legislation proposes pharmacoeconomic evaluation as part of reimbursement file , especially in case of innovative and expensive therapies ( 10 ) . in order to ensure financial sustainability of health care system but also to ensure access to novel therapies formal pharmacoeconomic evidence can potentially inform coverage and reimbursement decisions of various health interventions and technologies , as well as the development of formularies and clinical practice guidelines . this is especially important in lower income countries that face more serious constraints on the allocation of their scarce healthcare resources . research performed by singre described three components ought to be in place before the full potential of pharmacoeconomics can be realized : individuals capable of conducting the analyses ; a receptive and informed audience of policymakers ; and a body of relevant methodology and guidelines ( 11 ) . thus , it is imperative for developing countries to build an educational infrastructure of analysts and experts in pharmacoeconomics and to promote the education of pharmacoeconomics at the payer , provider and researcher levels , each according to their needs and tasks . pharmacoeconomics education in the developed world is well established and introduced into university curricula in undergraduate but also postgraduate programs . the number of us pharmacy colleges and schools teaching pharmacoeconomics at the professional level increased from 80% in 1997 to 92% in 2007 , and the colleges and schools that did not offer pharmacoeconomics courses were either new or looking for instructors ( 12 , 13 ) . internationally , the percentage of pharmacy colleges and schools offering pharmacoeconomic education increased from 41% in 1997 to 52% in 2004 . ( 14,15 ) in this international survey , response from only one existing faculty for pharmacy did not reply . recently performed pilot study on introduction of pharmacoeconomics and health economics into curriculums of healthcare faculties in bosnia and herzegovina showed that only one faculty of medicine and one faculty for pharmacy , out of 22 in the country , included topic as obligatory subject in undergraduate program . objective of this study is to explore understanding of pharmacoeconomics and its concept and analysis and to evaluated adopted knowledge among graduate ( fifth year / tenth semester ) pharmacy students who have listened subject , this study is one of the first attempts to comprehensively assess the extent of pharmacoeconomics education in pharmacy and healthcare faculties in bosnia and herzegovina . a self - administered questionnaire was developed consisted of 12 questions ; 4 of them with yes or no choices , 6 with multiple choices and 2 descriptive questions . we have selected graduate students on fifth year of study ( tenth semester ) who have listened and passed exam from subject named social pharmacy with pharmacoeconomics . all respondents are informed verbally and also through cover letter before the survey questions , described the rationale behind the survey and that answers will be used for research and improvement of future programs dealing with this topic . the completed questionnaires were collected and they were coded in microsoft excel using descriptive statistics for data analysis . the bachelor of science in pharmacy ( bs pharm ) degree remains the first professional degree required to practice pharmacy in bosnia and herzegovina , and is awarded after completion of a 5-year professional program . the oldest faculty for pharmacy is at university of sarajevo , where this research is conducted . survey has been answered by 54 graduate pharmacy students who have previously listened and passed exam from subject titled social pharmacy with pharmacoeconomics . majority of respondents , 43 ( 79.6% ) stated that the have learned about pharmacoeconomics at fifth year of the study , while 11 ( 20.4% ) did not provide the answer , which is surprising since the lecturers have been held in previous semester . same percent of 20.4% of respondents did not answer the question if the subject covering this field is elective or compulsory , which could lead us to the conclusion that maybe they were not participate the lectures or they focused on one part of the subject title referring to social pharmacy . 41 ( 75.9% ) stated that the subject dealing with this topic is compulsory and rest quoted it is elective . questioned whether the subject of pharmacoeconomics / health economics during undergraduate study was separate or part of another subject , 38 ( 70.4% ) answered that it was learned as part of another subject , 12 ( 22.2% ) did not listen this topic at all , while 4 ( 7.4% ) answered it was separate subject . asked to provide name of the subject under which lectures related to pharmacoeconomics / health economics have been provided , 37 ( 68.6% ) quoted social pharmacy with pharmacoeconomics , and 17 ( 31.5% ) did not state any other subject . figure 1 represents answers on the best explanation ( definition ) of the scope of pharmacoeconomics according to pharmacy students knowledge . majority of them ( 38.9% ) provide the most accurate definition including cost and outcomes examination , 13.0% state that main scope is examination of pharmaceuticals costs , and high percentage of students 25.9% stated that none of offered explanations are not related to the pharmacoeconomic definition and its scope . when it comes to differentiation of pharmacoeconomics versus health economics , 41 ( 76.0% ) of students agreed that these two terms are not the same , and 13 ( 24.0% ) consider it same . asked to state where pharmacoeconomics find its application , students were able to select multiple answers and most frequent application according to the responses were in planning of production and sales of the medicines , reimbursement ( introduction of medicines into positive lists ) and during pharmaceutical pricing process . table 1 provides overview on student s ability ( capacity ) to understand and perform basic pharmacoeconomic analysis based on current knowledge and information . most of graduate pharmacy students , 45 ( 83.0% ) consider that pharmacoeconomics as subject should be introduced or included into undergraduate curricula and all of the respondents agree that pharmacoeconomics has use in their work as a future health care professional . students ` opinion about acquiring additional knowledge in pharmacoeconomics are shown in the figure 3 represents that most of them ( 70.4% ) are interested in some of postgraduate programs ( specialization and postgraduate studies ) or through continuing education courses , but also significant number of them , almost one third ( 29.6% ) would like to gain more knowledge in this filed through self - interest and involvement . pharmaceutical education in bosnia and herzegovina was mostly limited to basic biomedical and pharmaceutical sciences . there are a few faculties for pharmacy in bosnia and herzegovina , private and public ( 17 ) and only faculty for pharmacy in sarajevo has subject covering field of pharmacoeconomics introduced into undergraduate curricula . we have conducted this study in order to explore extent of graduate students understanding of the concept but also to explore learning outcome of provided program and lectures . beside pharmaceutical education , it is important to stress that similar programs should be introduced at other health care faculties medicine , dentistry and high schools since there is need for newly qualified doctors to have a firm grounding in the principles of safe , suitable , efficacious and cost - effective prescribing ( 18 ) . kulkarani conducted research in form of pilot project among medical students and concluded that there is a need for medical undergraduate students to be sensitized on basic concept of pharmacoeconomics . hence , pe should be introduced in the curriculum of medical undergraduates what would help them to realize the enormous differences in cost of various brands available in the market and will also increase the awareness of indirect cost and intangible cost associated with the drug therapy . ( 19 ) there is some intention to introduce concept of education in the field of health economics and pharmacoeconomics in bosnia and herzegovina medical and health care faculties , but it is still in its infancy and only a small number of schools are teaching pharmacoeconomics at the undergraduate and graduate levels . ( 16 ) in bosnia and herzegovina there are professional associations like international society for pharmacoeconomics and outcomes research regional chapter in b&h ( ispor bh ) which provide some training in this field from health care professionals through seminars and conferences , publications and online modules in bosnian ( 20 ) . in this research we found interesting that most of the students surveyed state that they are familiar with term pharmacoeconomics and they make a difference versus health economics . it is also interested that most of them , even listened or passed exam , do not feel comfortable in conducting and understanding basic pharmacoeconomic methods and analysis . this could be a good signal for future deeper research on structure and time allocation to this topic . it is also interesting that education in this field is not provided under other subjects like pharmacology or clinical pharmacy . this could be one way of increasing awareness and knowledge among health care students since some pharmacoeconomic concepts could be covered and discussed under pharmacology or clinical pharmacy lectures . there is also need for additional training of lecturers included in educational process so they can provide quality education and training . there are only a few researchers in this field who are well educated and trained abroad , according to ispor bh databases ( 20 ) . we believe that the adoption of pharmacoeconomics in bosnia and herzegovina schools of pharmacy has lagged behind for many reasons . first , the lack of awareness about the existence and importance of pharmacoeconomics on the side of curriculum decision makers ( deans and department chairs ) poses a barrier to adopting pharmacoeconomics into the curriculum . second , the lack of experts in this field who reside in bosnia and herzegovina , but also neighboring countries , makes it more difficult to recruit instructors who can teach this subject in the pharmacy curriculum . third , as with any emerging area of education , efforts and resources must be expended to build sound foundations . as it is showed in results , most of students are not familiar with primary application of pharmacoeconomic studies results , stating that it is more suitable for pharmaceutical production and selling plans or pricing of medicines in pharmacy , it is clear that there is a huge room for improvement on clarification of pharmacoeconomic application . this finding also suggests that students are not familiar with pharmaceutical administration and legislation and that this topic are not covered during the study , especially under the subject named social pharmacy . there is increasing trend of use of pharmacoeconomic analysis and approach when submitting drugs for inclusion of reimbursement list ( 10 ) so faculties should prepare pharmacy students with this in order to assure their professional engagement after graduate . also , faculties could organize short courses on pharmacoeconomics in association with professional association for health care decision makers since there is an evidence that they are not familiar with this terms and not well educated to understand results of provided studies ( 21 ) . most of respondents also show interest in additional education in pharmacoeocnomics through postgraduate courses and programs . there are some intentions of specialization program for pharmacist organized by federal ministry of health to introduce specialization called pharmaceutical informatics and pharmacoecnomics but analyzing program adopted by moh there is no enough basic pharmacoeconomic education and there is a lack of pharmacoeconomic analysis education in terms of conducting studies , adopting them to local needs and understanding of study results ( 22 ) . based on these results and other studies published in literature we suggest that there is a need to raise awareness about pharmacoeconomics among various stakeholders and also encourage formal pharmacoeconomics education and training . healthcare professionals in training , such as student pharmacists and physicians , should have formal pharmacoeconomics education as a part of their required coursework and experiential training . the goal would be to develop their ability to apply pharmacoeconomic knowledge to critically evaluate economic evidence when making decisions in their practice . building a homegrown base of pharmacoeconomics experts could only be accomplished through formal degrees ( e.g. doctor of philosophy ) and research fellowships , where students learn how to conceptualize pharmacoeconomics at a more advanced level , synthesize new clinical and economic knowledge , develop new methodologies , and assimilate the multidisciplinary knowledge of pharmacoeconomics from its parent disciplines ( 23 ) . the appropriate use of credible pharmacoeconomic evidence can help strengthen health systems only when essential structural and regulatory policy measures are being implemented , along with continuous improvement in transparency and accountability within national pharmacy systems . there is a great deficit in the availability of pharmacoeconomics courses in pharmacy schools in bosnia and herzegovina at both the undergraduate and graduate levels . findings from this study suggest that pharmacy students are familiar with terms and basic concepts of pharmacoeconomics , but they do not feel capable to conduct or understand and adopt published studies . a unique opportunity exists for well - trained individuals to fill this gap . providing pharmacoeconomic education to pharmacy students is especially important in an era when evidencebased healthcare decision making and preparing future pharmacist for different field of work . this study is good basic for additional research among other pharmaceutical education institutions and health care faculties in bosnia and herzegovina compare results and also conduct similar survey based studies among graduated pharmacist currently working to gain their insight and view on this topic .

pharmacoeconomic ( pe ) is becoming more important in pharmaceutical reimbursement decision and drug evaluation . to ensure its appropriate application , conduction and assessment of studies it is important to have well trained and educated professionals . pharmaceutical faculties all over the world have established pe in under- and post - graduate curricula s . in this pilot research we examine situation in b&h . in bosnia - herzegovina , education in this field is poor and only one faculty for pharmacy has introduced pe as subject in its program . objective of this study is to explore understanding of pe and its concept and analysis and to evaluated adopted knowledge among graduate ( fifth year / tenth semester ) pharmacy students who have listened subject pharmacoeconomics in previous semester . a self - administered questionnaire was developed consisted of 12 questions and survey was conducted among students . results are analyzed in ms excel and we used descriptive statistics . even graduate students have lessons from pe they understand its scope and definition , but do not feel capable for conducting pe studies , but show interest in additional education and getting competencies in this field finding it applicable in their future professional engagements .

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSIONS Conflict of interest

the classification of the inconspicuous penis includes micropenis , webbed penis , trapped penis , concealed penis , and buried penis . among them , micropenis , webbed penis , and trapped penis have a general consensus about terminology and etiology . for concealed penis and buried penis , however , some confusion exists with the terminology and diverse etiology , including sinking of the penis under excessive suprapubic fat , tethering and shortening of the penis by abnormal fibrous bands of dartos fascia , poor penile skin fixation at the penile base , and deficient outer penile skin . therefore , the operative techniques to correct concealed or buried penis vary according to its diverse etiology [ 3 - 6 ] . on the basis of our surgical experiences and comprehension of the anatomical components , we simply categorized concealed penis and buried penis by use of a preoperative physical examination including the manual prepubic compression test and applied our surgical method to patients diagnosed with buried penis . we describe our surgical method to correct buried penis , which includes a minimal incision and simple anchoring of the penopubic skin to the prepubic deep fascia without degloving the whole penile skin . from march 2007 to november 2010 , we applied our new method to 17 patients diagnosed with buried penis after differentiation from concealed penis ( figs . 1 , 2 ) . concomitant genital anomalies , including hypospadias , chordee , and penoscrotal web , were excluded by careful examination . a flaccid unstretched penile length was measured from the penopubic junction to the tip of the penis with the patient in the standing position . the wilcoxon signed - rank test was used to determine the difference in the preoperative and postoperative penile lengths . for a retrospective review , the subjective outcome was determined from a telephone questionnaire answered by the boy 's parents . they were questioned about the level of satisfaction ( " what do you think of the results after surgery ? " with responses of unsatisfactory , good , or excellent ) and the intention of recommendation ( " would you recommend the procedure to someone who suffered the same problem ? " with the responses of yes or no ) . for the surgical technique , the patient was placed in the supine position and local anesthesia was applied to the deep subcutaneous tissue from 9 to 3 o'clock at the penopubic junction . because phimosis was usually present , a dorsal slit incision was made in the midline of the prepuce just long enough to expose the whole glans . an approximately 1 cm transverse incision was made near the penile base at 12 o'clock at the penopubic junction . through the incision , blunt dissection was performed to identify the prepubic deep fascia and hardness of the pubic bone . about 1 or 2 mm stab incisions at just skin depth were made in the 9 and 3 o'clock positions lateral to the penile shaft . an additional large half - circled needle was tied up to the end of 4 - 0 nylon and passed through the deep fascia from the 3 o'clock tiny stab incision to the 12 o'clock skin incision . to avoid the penile deep fascia and tunica albuginea being involved in the stitch the other end with the 4 - 0 nylon needle passed through the subcutaneous tissue from the 3 o'clock tiny stab incision to the 12 o'clock skin incision . from the 9 o'clock tiny stab incision to the 12 o'clock incision , another anchoring was done in the same manner . after confirming that the penopubic junction was secured to the prepubic deep fascia in the stretched state , each side of the stitch was tied up under the 12 o'clock incision . the penopubic junction skin incision was closed with 1 or 2 stitches and the bilateral tiny stab wounds remained unsutured . the mean age of the patients was 10.2 years , ranging from 8 years to 15 years . the median follow - up was 19 months ( range , 5 to 49 months ) . there were no serious intraoperative or postoperative complications . remarkable postoperative problems were distal penile skin edema and a skin dimple at the penopubic junction . the distal penile skin edema subsided without an additional procedure after several days and the skin dimples were noted in 6 patients , but no one complained about it . the mean penile lengths were 1.8 cm ( range , 1.1 to 2.5 cm ) preoperatively and 4.5 cm ( range , 3.3 to 5.8 cm ) postoperatively ( fig . the median difference between preoperative and postoperative penile lengths was 2.7 cm ( range , 2.1 to 3.9 cm ) . there was a statistically significant difference between the penile lengths before and after surgery ( p<0.05 ) ( table 1 ) . the level of satisfaction was excellent in 8 patients , good in 9 patients , and unsatisfactory in none . all the boys ' parents answered yes to the question about the intention of recommendation ( table 1 ) . since the first description of concealed penis as the apparent absence of the penis by keyes in 1919 , there has been some confusion with terminology : what should this anomaly be called , concealed penis or buried penis or something else ? maizels et al classified concealed penis into buried , webbed , and trapped penis and micropenis . they further subdivided buried penis into conditions due to poor skin suspension in children and localized adiposity in adolescents . elder classified inconspicuous penis into webbed penis , concealed penis ( synonymous with buried penis ) , and trapped penis and micropenis as a different entity . he described that concealed penis ( synonymous with buried penis ) was caused by inelasticity of the dartos fascia in infants and young children and abundant fat on the abdominal wall in older children and obese adolescents . in a recent study , oh et al classified inconspicuous penis as concealed , buried , webbed , and entrapped penis . they suggested that a concealed penis is due to deficient outer penile skin or inelasticity of the dartos fascia and a buried penis is due to poor penile skin fixation at the penile base or excessive suprapubic fat . a webbed penis is characterized by a ventral fold of skin that joins the distal shaft and scrotum , obscuring the penoscrotal angle . those authors expected that this classification would be helpful in deciding on a treatment strategy . we also think that this classification is helpful in further understanding the anatomical etiology of concealed penis and buried penis . accordingly , in our study , we tried to differentiate between buried penis due to poor penile skin fixation at the penile base or excessive suprapubic fat and concealed penis due to deficient outer penile skin or inelasticity of the dartos fascia by use of the manual compression test . shaeer and shaeer selected patients on the basis of improvement of the flaccid unstretched length by manually pushing the mons pubis backwards , and wood and woodhouse suggested that gentle pressure around the penis will often push back the suprapubic tissues and reveal an underlying normal penis . in our opinion , through the manual compression test , confirming a normally grown penis , that is , an effectually protruding penile shaft without unbalanced retraction and sufficient penile skin , is an essential step in diagnosing buried penis . various surgical techniques have been described for correction of the concealed penis and buried penis . these techniques include removal of excessive suprapubic fat , release of the dartos tethering bands by degloving the penile skin , anchoring the suprapubic skin to define the penopubic angle , and shaft skin reconstruction with various skin - covering methods to correct for the sparse shaft skin [ 12 - 14 ] . however , we have had some questions : is degloving the whole penile skin needed in all patients ? where should the penopubic skin be anchored to the prepubic deep fascia or penile shaft ? in their 31 cases of buried penis , redman reported no observation of any tethering bands or any abnormality of the tunica dartos . yu et al reported that 26 of 62 patients acquired an improved appearance of the penis by application of pressure at the base of the penile shaft . it seemed that not the abnormal fibrous bands but the insufficient exposure of the penile shaft and poor fixation of the penile skin resulted in the abnormal appearance of the penis in those patients . in our experience , buried penis seems to be the result of not abnormal tethering bands but inadequate attachment of the skin and superficial fascia to the deep fascia or excessive suprapubic fat pushing up the skin of the penopubic junction . these anatomical etiologic factors might cause the distorted penopubic angle that is located more distally at the level of the penile tip . to correct this anatomical defect , we simply anchored the elevated penopubic angle to the prepubic deep fascia and defined the new penopubic angle more downward to the pubic bone . concerning where to anchor the skin , anchoring the prepubic skin to the penile shaft should disrupt the normal gliding movement of the penile shaft in its covering skin structure . even though obesity is mentioned as a major contributor , no definitions of body mass index ( bmi ) cutoffs were found in a search of medline . according to mattson et al 's experience with obese patients , grade i and ii obesity ( defined by the world health organization [ who ] as a bmi > 30 - 35 and a bmi > 35 - 40 , respectively ) were not associated with severity or incidence of the buried penis , but in cases of extreme or morbid obesity ( who grade iii , bmi > 40 ) , it becomes common and the incidence increases . in our series , there were no extremely or morbidly obesity patients who required simultaneous removal of excess suprapubic fat such as lipectomy or liposuction . some authors reported that they could get satisfactory results in obese patients without lipectomy or liposuction . moreover , borsellino et al stated that excision of the prepubic fat pad in severely obese boys can create an ugly appearance with an unnatural suprapubic ledge . we also think that performing additional surgical procedures to remove the suprapubic fat pad is not essential in most cases . our procedure is much simpler than other previously described procedures and does not require a drain , compression dressing , or catheter placement , which is a notable difference compared with other procedures in which degloving the penile skin is done for the whole penis , thus interrupting the lymphatic drainage and causing significant edema or disastrous skin necrosis postoperatively . there has been some argument over the timing and indication of surgery in cases of buried penis . wood et al described that buried penis patients should definitely not have surgery until they have completed puberty , because with growth and development , the suprapubic fat pad may decrease considerably and these steps are important to avoid operating on patients either prematurely or unnecessarily . moon et al suggested that the timing of surgery should be determined by the severity of buried penis , the feelings of the patient , and the opinions of the parents . oh et al also suggested that surgery or additional treatment to correct buried penis should be performed between childhood and puberty after comprehensive consideration of factors such as the etiology , presence of psychological stress , and the degree of accompanying suprapubic fat pad . we also think that important factors that affect the performance of surgery are the embarrassment of the patient , pessimistic thoughts about their penis , and anxiety of the parents in addition to voiding problems , urinary tract infection , and poor hygiene . furthermore , it should not be overlooked that the incidence of buried penis in childhood and adolescence is increasing as a result of the increase in obesity in children . in this regard , if we could get competent results without complications by use of a minimally invasive surgical method , we think it would be worthwhile to apply the surgical treatment . our method was primarily aimed at improving penile length with minimal invasiveness and minimal complications in selected patients with buried penis . with the simple anchoring of the penopubic skin to the prepubic deep fascia , we obtained successful subjective and objective outcomes without complications . we think that this is a promising surgical method for selected patients with buried penis .

purposethe aim of this study was to categorize concealed penis and buried penis by preoperative physical examination including the manual prepubic compression test and to describe a simple surgical technique to correct buried penis that was based on surgical experience and comprehension of the anatomical components.materials and methodsfrom march 2007 to november 2010 , 17 patients were diagnosed with buried penis after differentiation of this condition from concealed penis . the described surgical technique consisted of a minimal incision and simple fixation of the penile shaft skin and superficial fascia to the prepubic deep fascia , without degloving the penile skin.resultsthe mean age of the patients was 10.2 years , ranging from 8 years to 15 years . the median follow - up was 19 months ( range , 5 to 49 months ) . the mean penile lengths were 1.8 cm ( range , 1.1 to 2.5 cm ) preoperatively and 4.5 cm ( range , 3.3 to 5.8 cm ) postoperatively . the median difference between preoperative and postoperative penile lengths was 2.7 cm ( range , 2.1 to 3.9 cm ) . there were no serious intra- or postoperative complications.conclusionswith the simple anchoring of the penopubic skin to the prepubic deep fascia , we obtained successful subjective and objective outcomes without complications . we suggest that this is a promising surgical method for selected patients with buried penis .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS

the 5-year survival rate of the treated patients was only about 20% [ 1 , 2 ] . the treatment of osteosarcoma currently involves surgical resection in combination with neoadjuvant chemotherapy . despite advances in the neoadjuvant chemotherapy and in limb - salvage surgery , the disease - free survival rate still remains poor for patients with metastatic , recurrent , or unresectable osteosarcoma . previously , we found that the novel lectin eucheuma serra agglutinin ( esa ) , which was successfully isolated by kawakubo et al . from the marine red alga eucheuma serra , specifically binds to carcinoma cell lines of human adenocarcinoma , human cervical squamous cell carcinoma , and marine adenocarcinoma but not to normal human fibroblasts or lymphocytes . we also revealed , that the specific binding of esa to carcinoma cells is based on specific interactions between esa and the unique sugar chains of high mannose type on the surface of the carcinoma cells . in a more recent study , hori et al . investigated the specific interactions between esa and various unique sugar chains of high mannose type in detail . furthermore , we successfully elaborated the basis for a novel type of drug delivery system ( dds ) for cancer therapy using esa ( i ) as targeting ligand to carcinoma tumors and ( ii ) as inducer of apoptosis due to specific esa binding to carcinoma cells . recently , the general potential of certain types of sugar binding proteins ( lectins ) as promising , alternative antitumor drugs has been emphasized . the antitumor activity of these lectins might be related directly to specific intermolecular interactions between the lectins and the sugar chains on the tumor cell surface . however , whether lectins also have antitumor activities against osteosarcomas has not been clarified yet . generally , carcinomas which originate in epithelial cells and sarcomas which originate in mesenchymal cells ( e.g. , osteosarcoma ) are thought to be quite different in their tumorigenesis as well as in the phenotypes including cytoskeleton , binding molecules , proliferation procedure , and surface glycoproteins [ 9 , 10 ] . therefore , different therapeutic approaches have been employed for the treatment of sarcomas , if compared with the therapies applied for the treatment of carcinomas , except for the surgical treatment . on the other hand , the existence of cell surface - bound sugar chain structures , which are common among carcinomas and sarcomas , but not present in normal cells , has been suggested . moreover , the concept of epithelial - mesenchymal transition in tumors implies common structures and/or mechanism among carcinomas and sarcomas [ 12 , 13 ] . therefore , on the basis of our previous in vitro and in vivo studies with esa bound to span 80 vesicles for targeting carcinoma cells , we found it worthwhile to investigate whether the lectin esa can also be applied in a therapeutic approach against osteosarcomas . span 80 is generally known in the food and cosmetic industries as sorbitan monooleate , although commercial span 80 is a heterogeneous mixture of sorbitan mono- , di- , tri- , and tetra - esters . we have already demonstrated that nonionic vesicles prepared from span 80 have promising physicochemical properties ( high membrane fluidity with temperature dependent fusiogenicity ) which make this type of vesicle an attractive possible alternative to the commonly used liposomes in vitro and in vivo [ 6 , 1422 ] . aim of the work was to clarify the specificity of the binding of esa to either ost cells or lm8 cells , both being osteosarcoma cell lines . furthermore , the potential effectivity of esa as ligand on the surface of span 80 vesicles [ 6 , 14 , 18 , 19 , 21 , 22 ] with targeting function and as possible apoptosis - inducer for the treatment of osteosarcoma was also examined . in the work presented , the interactions between esa and ost cells and between esa and lm8 cells were examined by means of fluorescence microscopy and flow cytometry . as a result of our study , the evidence is presented that esa specifically binds to these two types of osteosarcoma cells , followed by induction of apoptosis due to this specific esa binding to the cells . furthermore , we could demonstrate that esa has a considerable potential as novel type of ligand immobilized onto pegylated span 80 vesicles , an important step towards the potential development of a therapy for the treatment of refractory osteosarcoma , as novel lipidic microcapsule drug - delivery system ( dds ) for transporting and delivering anticancer drugs for the treatment of cancer . eucheuma serra agglutinin ( esa ) was extracted from the red alga eucheuma serra , by means of ethanol precipitation , followed by purification with fast protein liquid chromatography ( fplc ) , using a 10 mmol / l sodium phosphate buffer ( ph = 7.4 ) . propidium iodide ( pi ) , -mannnosidase , -mannnosidase , endoglycosidase h , and rhodamine 6 g were obtained from sigma - aldrich ( st . louis , mo , usa ) . annexin v - pe apoptosis detection kit i which contains annexin v - pe and 7-amino - actinomycin d ( 7-add ) was obtained from becton dickinson biosciences ( franklin lakes , nj , usa ) . the caspase assay system was purchased from promega ( madison , wi , usa ) . fluorescein isothiocyanate , isomer i ( fitc ) , span 80 , cholesterol , and lecithin from soybeans were obtained from wako pure chemical industries ( osaka , japan ) . the phospholipid 1,2-dioleoyl - sn - glycero-3-phosphoethanolamine - n-(succinyl ) ( supe ) was obtained from avanti polar lipids ( alabaster , al , usa ) . pbs ( phosphate buffered saline ) was composed of 137 mm nacl , 2.7 mm kcl , 10 mm na2hpo4 and 2 mm kh2po4 , ( ph = 7.4 ) . katsuro tomita ( department of orthopaedic surgery , kanazawa university school of medicine , japan ) , cultured in either erdf medium ( kyokuto pharmaceutical industrial , tokyo , japan ) or dulbecco 's modified eagle medium ( d - mem ) ( wako pure chemical industries , osaka , japan ) supplemented with 10% of fetal bovine serum ( fbs ) at 37c in a humidified atmosphere consisting of 5% co2 . murine osteosarcoma cell line ( lm8 cells ) was obtained from riken ( riken brc cell bank ) . these lm8 cells were grown in d - mem supplemented with 10% of fbs at 37c in a humidified atmosphere consisting of 5% co2 . ost cells and lm8 cells were inoculated in 6-well culture plates at a cell density of 2.0 10 cells / ml suspended in d - mem with 10% fbs . after 16 hours , the medium in each plate was exchanged with 10% fbs d - mem containing various concentration of esa . after incubation during one day , the cell number and the viabilities of both types of cells were evaluated by means of the propidium iodide nucleic acid stain using flow cytometry . the viability assay of ost cells for epv was also performed by the same way as above . in a similar way , time - courses of the viability of both ost cells and lm8 cells were experimentally measured in medium with esa at a concentration of 50 g / ml . apoptosis was analyzed by using the annexin v - pe apoptosis detection kit i according to a previously published protocol [ 2527 ] . ost cells or lm8 cells , at a concentration of 2 10 cells / ml , were suspended in d - mem containing 10% fbs , and then inoculated in 6-well culture plates . after 16 hours inoculation , the medium in each plate was exchanged with 10% fbs , d - mem containing 50 g / ml esa . the cell lines in each plate were incubated for different time periods , followed by twice washing with cold pbs . using a cell counter , the washed cells were diluted to a concentration of 1 10 cells / ml by resuspending the cells in 0.1 m hepes / naoh ( ph 7.4 ) containing 1.4 m nacl and 25 mm cacl2 ( binding buffer ) . volumes of 100 l of the cell suspensions were transferred to 1.5 ml eppendorf tubes . solutions of 5 l of annexinv - pe and 5 l of 7-add were added to the suspensions , followed by vortexing and incubation for 15 min at room temperature in the dark . then , 400 l binding buffer were added to each tube containing the incubated suspension , followed by analysis with a flow cytometer . caspase-3 activity was evaluated spectrophotometrically at = 405 nm with the caspase-3 substrate ac - devd - pna . ost cells were suspended at 2.0 10 cells / ml in d - mem with 10% fbs and then pipetted into 6-well culture plates . after 16 hours of incubation at 37c and 5% co2 , the medium in each plate was exchanged by 10% fbs , d - mem containing either 50 g / ml esa , or 50 g / ml esa + zvad - fmk ( = n - benzyloxycarbonyl - val - ala - asp(o - me ) fluoromethyl ketone ) which is a known caspase-3 inhibitor , or pbs as control . following culturing for 16 hours , the caspase-3 activity in these kinds of cells was measured with the caspase assay system ( promega , madison , wi , usa ) , using a spectrophotometer u-2000 ( hitachi , tokyo , japan ) according to the manufacturer 's instructions . an amount of 1.22 mg / ml esa was fluorescently labeled by addition of 1 mg / ml rhodamine 6 g ( rh6 g ) in 0.15 m sodium carbonate buffer ( ph = 9.0 ) , followed by removal of free fitc by using a pd-10 column ( ge healthcare , ct , usa ) . ost cells and lm8 cells , suspended at a concentration of 2.0 10 cells / ml , were cultured in 10% fbs erdf medium . after 16 hours , the culture medium was exchanged with a culture medium containing 10% fitc - esa solution , both types of cells were separately incubated for 3 , 6 , 9 , 12 , and 24 hours in a co2 incubator at 37c , respectively . after the incubation both cell suspensions were then analyzed by flow cytometry using a facs calibur instrument ( becton dickinson , mansfield , ma , usa ) . in a similar way , the binding activities of esa ( labeled with either rhodamine 6 g ( rh6 g ) or fitc ) to the sugar chains on the surface of ost cells were examined by incubation with -mannnosidase , or -mannnosidase , or endoglycosidase h for 2 hours before adding fluorescenctly labeled esa . after incubation for 1 hour , the esa binding to the ost cells was evaluated by using a fluorescence microscope ( bh2-rfc , olympus corp , tokyo , japan ) and the flow cytometer . esa - supe , a phospholipid - esa conjugate , was prepared as follows : 100 l of a supe solution ( 1.25 mg / ml in chloroform ) were added to a test tube . a thin film of supe formed after evaporation of chloroform under a stream of nitrogen gas . afterwards , 2.5 ml of an esa solution ( 0.675 mg / ml ) were added to the film to react with supe in 0.15 m sodium carbonate buffer ( ph 9.0 ) at room temperature . the reaction mixture was incubated for 2 hours with vortexing for a few seconds every 30 min , followed by letting the suspension stand at 4c overnight . residual supe in the buffer solution was removed by gel filtration with a pd-10 column packed with sephadex g-25 ( ge healthcare ; buckinghamshire , england ) . in the present work , type 1 : span 80 vesicles with immobilized esa and immobilized peg ( epv ) , containing as inner aqueous solution pbs . type 3 : span 80 vesicles with immobilized esa ( ev ) containing encapsulated fitc . type 4 : span 80 vesicles with immobilized esa and immobilized peg ( epv ) containing encapsulated fitc . the vesicles of types 2 , 3 , and 4 contained a 0.15 m sodium carbonate buffer solution ( ph = 9.0 ) containing 1 mg / ml fitc as inner aqueous solution . the vesicles were prepared with the two - step emulsification method in pretty much the same way of as described in the previous papers [ 6 , 19 ] . in this work , some minor modifications were applied for the preparation of epv containing fitc . a volume of 0.6 ml of the inner aqueous solutions ( the sodium carbonate buffer solution containing fitc as mentioned above ) was added to 6 ml of a n - hexane solution containing span 80 ( 264 mg ) , purified lecithin ( 24 mg ) and cholesterol ( 12 mg ) , followed by the first emulsification for 6 min at 17,500 rpm using a micro - homogenizer ns-310e 2 ( microtec co. , ltd . , funabashi , japan ) . afterwards , the solvent was removed in a rotary evaporator at 28c under reduced pressure , yielding a water - lipid emulsion to which 6 ml of the esa - supe solution ( obtained as described above ) containing tween 80 ( 96 mg ) and dspe - peg2000 ( 14.2 mg / ml ) were added , followed by the second emulsification with the homogenizer for 2 min at 3500 rpm to obtain a heterogeneous span 80 vesicle suspension . after stirring with a magnetic stirrer for 3 hours at room temperature , the vesicle suspension the vesicles were then purified by ultracentrifugation ( 50,000 rpm at 4c for 120 min ) in a himac centrifuge cr15b ( hitachi koki co. , ltd . , the lower phase was filtrated through 100-nm nucleopore track - etch polycarbonate membranes ( avanti polar lipids ; alabaster , al , usa ) and purified by gel filtration on a 7 cm ( diameter ) 50 cm ( length ) column containing biogel - a5 m ( bio - rad laboratories , richmond , ca , usa ) . cv containing fitc and ev containing fitc were also prepared in the same manner as above , but without both esa and peg ( for cv ) , and without dspe - peg2000 ( for ev ) , respectively . the diameters of cv , ev , and epv , which contained fitc were 104 7 nm , 100 2 nm , and 103 5 nm , respectively . ost cells were inoculated in 6-well culture plates at a cell density of 2.0 10 cells / ml suspended in d - mem with 10% fbs . , the culture medium was exchanged with 1.8 ml d - mem containing 10% fbs and 0.2 ml pbs , cv containing encapsulated fitc , ev containing encapsulated fitc , or epv containing encapsulated fitc . the cells were then kept for 15 min in a co2 incubator at 37c . after incubation , the ost cells were washed with cold pbs twice , followed by flow cytometric analysis . the viabilities of ost cells and lm8 cells were measured in the concentration range from 10 g / ml to 50 g / ml to evaluate the possible anticancer activity of esa . as shown in figure 1(a ) , the proliferations of both osteosarcoma cell types were inhibited by esa . the inhibitory effect against the cell viability increased with increasing amounts of added esa . addition of 50 g / ml esa , for example , decreased the cell viabilities of ost cells and lm8 cells to 54.7 11.4% and 41.7 12.3% , respectively . furthermore , figure 1(b ) the cell proliferation was inhibited completely by the addition of 50 g / ml esa after incubation for 48 hours . these experiments clearly demonstrate the anticancer activity of esa in the case of these osteosarcoma cells . the findings presented above about the inhibition of sarcoma cell proliferation ( see section 3.1 . ) suggested that esa may also induce apoptosis in sarcoma cells . therefore , apoptosis induction in either ost cells or lm8 cells by esa was examined by means of the double staining test for annexin v - pe and 7-add . the numerical values obtained from this analysis are displayed in figure 2 and summarized in table 1 . as shown in figure 2(a ) and table 1 , the relative amount of cells in the lower right part of the diagram ( indicating early stages of apoptosis ) was 74.8% at an elapsing time of 3 hours after adding esa , while in the case of the control cells ( pbs - treated only , no esa ) , the amount of the cells was 14.2% in the same part . moreover , the amount of cells in the upper right part of the diagram ( indicating dead cells ) increased from 22.5% ( at 3 hours after esa addition ) to 71.0% ( at 24 hours ) . the amount of cells in the lower right part of the diagram increased from 19.8% ( control ) to 68.2% at an elapsing time of 3 hours after adding esa , being similar to the case of ost cells . the amount of cells in the upper right of the diagram also increased from 17.9% ( at 3 hours ) to 23.1% ( at 24 hours ) . thus , esa also induced apoptosis in lm8 cells . from the results in sections 3.1 and 3.2 , it was found that esa specifically binds to ost cells and to lm8 cells , both being osteosarcoma cell lines , followed by induction of apoptosis . in the following investigations we mainly focused on ost cells , the activity of caspase-3 in ost cells was measured by using the caspase-3 assay in combination with the caspase-3 inhibitor zvad - fmk , as outlined in section 2.5 . the values reported on the y - axis of figure 3 are proportional to the amount ( i.e. , the activity ) of expressed caspase-3 , arising from the induced apoptosis in the ost cells . upon addition of esa , a 2.3-fold increase in caspase-3 activity was observed in comparison with the control ( without esa : only pbs ) . on the other hand , the addition of zvad - fmk inhibited the expressed capase-3 to almost the same level as in the case of the control . these data indicate that esa induces apoptotic cell death in ost cells , which confirms the independent results presented in figure 2 . to investigate the binding of esa ( labeled with fitc ) to both ost cells and lm8 cells , flow if esa - fitc binding to cells occurs , a rightward shift of the flow cyotometric curve is expected . this , indeed , was observed in the experiments with ost cells and lm8 cells , as shown in figure 4 . the fluorescence intensity of the cells treated with esa - fitc increased significantly , as compared to the control cells ( treated with pbs only ) . the curve shifts became larger with longer cell - incubation times : with both cell types , the shifts after 12 hours of incubation were larger than the shifts observed after 3 hours . in a previous study it was shown that esa is a lectin that specifically binds to high - mannose type ( hm ) n - glycans . the binding of esa to ost cells that were pretreated with glycosidases was investigated by labeling cell - bound esa with rhodamine 6 g ( rh6 g ) , see section 2.6 . first , the ost cells were pretreated with glycosidases to cleave sugar chains on the cell surface . incubation was for 2 hours using one of the following three glycosidases , -mannnosidase , -mannnosidase , or endoglycosidase h. the method of rh6 g labeling with esa was performed by incubating esa with rh6 g as mentioned in section 2.6 . then , the esa labeled with rh6 g was bound to the cells by incubating the cells for 1 hour , followed by a fluorescence microscopic observation of the labeled cells . as shown in figure 5 , non - treated ost cells ( as control ) displayed rh6 g fluorescence , but other ost cells that were pretreated with a glycosidases showed almost no fluorescence . this means that esa could not recognize the molecular structure of the sugar - chains on the surface of ost cell that were cleaved by glycosidases ; esa only recognized the native structure of the sugar - chains of the ost cells . thus , with these experiments it could be demonstrated that esa specifically binds to ost cells , through recognition of the sugar chains on the surface of the cells . to confirm the specific binding of esa to ost cells , a flow cytometric examination was also performed in a similar way as described in sections 3.4 and 3.5 . the results are shown in figure 6(a ) for cells treated with -mannosidase and -mannosidase , and in figure 6(b ) for cells treated with endoglycosidase h. in both cases , the decreases in fluorescence intensity in those cells that were treated with a glycosidase , if compared to untreated cells , were obvious . the intensity decrease in the case of treatment with -mannosidase seemed to be smaller than in the case of -mannosidase or endoglycosidase h. this is in good agreement with the images shown in figure 5 obtained with an independent analysis . although with rather low intensity only if the treatment was with -mannosidase . in the other two cases , there was no detectable fluorescence ( figure 5 ) . to test whether esa could be used as osteosarcoma - targeting ligand on a vesicular dds , span 80 vesicles with surface bound esa were prepared , and the interaction of these vesicles with ost cells three types of span 80 vesicles were prepared and tested ( see section 2.9 ) : cv ( control vesicles , no esa ) , ev ( vesicles with immobilized esa ) , and epv ( pegylated vesicles with immobilized esa ) . the vesicles were then mixed with ost cells and incubated , as mentioned in section 2.9 . then , flow cytometric measurements were performed . as shown in figure 7 , the fluorescence intensity in both cases was higher than for cells treated with cv containing fitc . this means that both types of vesicles with surface bound esa , epv , and ev bind to ost cells stronger than cv does . furthermore , the fluorescence intensity of the cells treated with epv containing fitc was found to be almost equal to the fluorescence intensity of the cells that were treated with ev containing fitc . therefore , pegylation did not hinder the binding of esa to the sugar chains on the surface of the cells . thus , span 80 vesicles with immobilized esa may be well suited for the development of a dds for targeting osteosarcoma cells . in a final investigation the variation of the ost cells viability as a function of the concentration of added esa ( incubation time was 48 hours ) is shown in figure 8 . epv also clearly showed a strong anticancer activity against ost cells , inhibiting proliferation of ost cells completely in a culture medium that contained 2 g / ml esa . this result is promising as it shows that pegylated span 80 vesicles with immobilized esa are potentially useful as drug carrier system with endogenous antitumor activity against osteosarcoma . in the esa concentration range above about 2 g / ml complete death of the ost cells was observed , as shown in figure 8 . this demonstrates that epv not only can function as targeting unit ( see section 3.7 ) , but also efficiently inhibit ost cell growth . it is known that the carbohydrate structures vary among the different cancer cell lines [ 27 , 28 ] . in this work , we report about our findings that esa has anticancer activity not only against carcinoma but also against sarcoma . this conclusion is based on the observation that both types of osteosarcoma cells , ost cells and lm8 cells , were significantly destroyed if incubated with esa at a concentration of 50 g / ml during a period of 24 hours , as shown in figure 1(a ) , and also destroyed completely if during 48 hours , as shown in figure 1(b ) . the effect of esa on the viabilities of osteosarcroma cells was compared with the effect of esa carcinoma cells studied previously , see s-2 , supplementary material , available online at doi:10.1155/2012/842785 . the supplementary material contains ( i ) data on the cytotoxicity and binding affinity of free esa and ev for normal cells and for cancer cells ; and ( ii ) a comparison of the effect of free esa on the cell viabilities of osteosarcoma and carcinoma cells . this comparison indicates that the antiproliferative activity of free esa in sarcoma cells is higher than in carcinoma cells , which may be related to differences in the carbohydrate structure of the surface of the two cell types . we already reported that esa specifically binds to high mannose type sugar chains in the case of carcinoma cells , inducing apoptotic cell death . as shown in figure 4 of the flow cytometric measurements , it was confirmed that esa bound not only to carcinoma cells but also to sarcoma cells like ost cells and lm8 cells . moreover , pretreatment of ost cells with different types of glycosidases , which cleaved the sugar chains on the surface of the ost cells , significantly decreased the binding of esa to the cells ( figures 5 and 6 ) . these results provide evidence that binding of esa to the sarcoma cells occurs through specific interactions between esa and carbohydrate chains on the cell surface . esa exhibited higher affinity towards ost cells as compared to lm8 cells ( figure 4 ) . the reason for this may be due to differences in the carbohydrate structure in the two cell types . this point needs to be also investigated , however , before any clear conclusion about the cell specificity can be drawn . esa induces apoptosis in osteosarcoma cells as shown by using the double staining test for annexin - v and 7-add [ 2527 ] . at an elapsing time of 3 hours after adding esa , apoptosis in both ost cells and lm8 cells was obvious . moreover , almost all of the ost cells were dead after 24 hours incubation with esa ( 50 g / ml ) , as shown in figure 2(a ) . the number of lm8 cells appearing in the upper right region of the plot did not seem to increase ( see figure 2(b ) ) . this apparent failure in staining is related to the apoptotic progress of the cell , and the apoptosis could n't be correctly measured with the double staining method . in fact , in the analysis of the flow cytometry , in the lm8 cells often fragmented and therefore counted correctly , when incubated during 24 hours with esa ( data not shown ) . induction of apoptosis in ost cells by esa was demonstrated by measuring the expression of caspase-3 ( see figure 3 ) . it was shown that the addition of esa to ost cells led to apoptosis in cells of sarcoma , because the caspase-3 expression is known to be directly related to the apoptosis mechanism . thus , esa may be used as efficient tumor - targeting ligand and apoptosis inducer in a dds in a sarcoma therapy . as shown in our previous work , pegylated span 80 vesicles with immobilized esa ( abbreviated as epv ) are rather promising drug carriers for the treatment of carcinoma cancers . the ability of esa , and epv , as targeting unit and apoptosis inducer in the case of cells of sarcoma was examined further by flow cytometry as well as cell viability measurements , choosing ost cells as typical sarcoma cell type . as shown with the flow cytometric measurements in figure 6 , targeting of esa to ost cells in vitro was observed from the shift of the flow cytometric curve to the right hand side ( see figure 6 ) . furthermore , comparing epv with cv in figure 7 ( as mentioned in section 3.7 . ) , it was found that the macromolecular structure of peg on the vesicle surface did not hinder ost cell binding of esa which was localized on the vesicle surface together with peg . . it may be due to the high mobility of both esa and peg , because of the high membrane fluidity of span 80 vesicles , as mentioned previously [ 19 , 30 ] . in addition , epv showed anticancer activity against ost cells since after an elapsing time of about 48 hours after the addition of epv at an esa concentration of 2 g / ml , the ost cell viability was reduced to almost zero , as shown in figure 8 . it seems that the anticancer activities of esa against ost cells in the vesicle system ( figure 8) is stronger than those in free esa system ( figure 1 ) . however , the activities of the two systems can not be compared directly , because either the incubation time or the esa concentration was different in the two systems . for example , for a direct comparison of the activities of the two systems against ost cells , the time - course of the viability upon addition of free esa system ( figure 1(b ) ) should be measured at [ esa ] = 2 g / ml ; at this concentration and after an incubation time of 48 hours , the cells were no more viable if the vesicles system was used ( figure 8) . unfortunately , the data obtained from measurements with free esa at this low concentration showed great variations . on the other hand , we have already examined [ 4 , 6 ] the cytotoxicity of either esa or ev for various carcinoma cancer cells and normal cells , followed by examining the binding affinities of esa and ev to the cells . in these experiments , colo201 ( human colon adenocarcinoma ) , mcf-7 ( human breast adenocarcinoma ) , hela ( human cervix adenocarcinoma ) , and hb4c5 cells ( human hybridoma cell line ) were used as carcinoma cells , and mcf10 - 2a ( non - tumorigenic epitherial cell line ) and normal fibroblasts ( from the umbilical cord ) were also used as normal cells . esa and ev showed cytotoxicity against carcinoma cells but not against normal cells , see s-1 , supplementary material . figure 9 is a graphical imaginary view indicating the binding between carbohydrate chains of high mannose type on sarcoma membranes and esa on the pegylated span 80 vesicle . in the study presented , the following main results were obtained : ( i ) esa specifically binds to sarcoma cells and induces apoptotic death of the cells ; ( ii ) the antiproliferative activity of esa in sarcoma is higher than the activity in carcinoma ; ( iii ) esa immobilized onto pegylated span 80 vesicles ( epv ) shows antitumor activity against ost cells without any entrapped antitumor agents . furthermore , in a previous study , it was already revealed that esa and ev ( esa - immobilized on span 80 vesicles ) hardly bind to normal cells ( either mcf10 - 2a ( non - tumorigenic epithelial cells ) or normal fibroblasts from the umbilical cord ) ; and cytotoxicity caused by esa and ev was not observed for these normal cells . therefore , esa has considerable potential as novel type of targeting ligand against sarcoma . based on all these findings , we propose using epv as possible dds not only for the targeted treatment of carcinoma , but also for the targeted treatment of sarcoma . furthermore , the administration of pegylated span 80 vesicles with immobilized esa , in which anticancer drugs are encapsulated , is expected to express more effective antitumor activity against sarcoma as compared to empty epv . we already performed first in vivo experiments by using either ev or epv with entrapped anticancer drugs toward the development of a sarcoma therapy .

previously , we demonstrated that the novel lectin eucheuma serra agglutinin from a marine red alga ( esa ) induces apoptotic cell death in carcinoma . we now find that esa induces apoptosis also in the case of sarcoma cells . first , propidium iodide assays with ost cells and lm8 cells showed a decrease in cell viability after addition of esa . with 50 g / ml esa , the viabilities after 24 hours decreased to 54.7 11.4% in the case of ost cells and to 41.7 12.3% for lm8 cells . second , using fluorescently labeled esa and flow cytometric and fluorescence microscopic measurements , it could be shown that esa does not bind to cells that were treated with glycosidases , indicating importance of the carbohydrate chains on the surface of the cells for efficient esa - cell interactions . third , span 80 vesicles with surface - bound esa as active targeting ligand were shown to display sarcoma cell binding activity , leading to apoptosis and complete ost cell death after 48 hours at 2 g / ml esa . the findings indicate that span 80 vesicles with surface - bound esa are a potentially useful drug delivery system not only for the treatment of carcinoma but also for the treatment of osteosarcoma .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

pancreatic neuroendocrine tumors ( pnets ) are a relatively rare and heterogeneous group of neoplasms comprising 12% of all pancreatic neoplasms and 2.6% of pancreatic cancers . due to the widespread use of high - quality imaging techniques , the incidence of pnets has remarkably increased from 0.17 to 0.43/100,000 over the past three decades in the united states . furthermore , autopsy studies indicate that the prevalence of pnets may be even higher . depending on whether clinical symptoms are related to excessive secretion of endocrine hormones , pnets are divided into functional and nonfunctional pnets ( nf - pnets ) . nf - pnets are defined by the absence of a hormone hypersecretion syndrome and account for approximately 90% of all pnets . nf tumors are asymptomatic or present with nonspecific symptoms related to local mass effect or metastatic disease and are associated with a poorer prognosis than functional tumors , probably due to delayed diagnosis and higher malignant potential . compared to pancreatic ductal adenocarcinoma , nf - pnets often have an indolent outcome but postoperative recurrence is not rare . lymph node metastasis ( lnm ) regarding nf - pnets , lymph node status is regarded as an important prognostic factor in both the european neuroendocrine tumor society ( enets ) tnm staging system and the american joint committee on cancer ( ajcc ) cancer staging system . in current guidelines , the national comprehensive cancer network ( nccn ) guidelines do not advocate routine lymphadenectomy in tumors < 2 cm , while this procedure is recommended for tumors that are 12 cm because of the risk of lnm . moreover , previous reports have demonstrated that only 3040% of patients with nf - pnets present with lnm at diagnosis , which suggests the importance of preoperative recognition of patients at high - risk of lnm , who may benefit from regional lymphadenectomy . therefore , the identification of reliable predictors of lnm is important in guiding clinical management decisions and avoiding an unnecessary lymphadenectomy in low - risk patients . the aims of this study were : ( 1 ) to evaluate the impact of lnm on postoperative recurrence of patients with surgically treated nf - pnet ; ( 2 ) to evaluate the feasibility of preoperative prediction of lnm in nf - pnets using preoperatively available variables . this was a mono - institutional retrospective cohort study of the clinical records of 100 patients who underwent pancreatic surgery with curative intent for nf - pnet between january 2004 and december 2014 . all patients who were diagnosed with nf - pnet were included ( n = 111 ) , whereas syndromic patients ( n = 1 ) , patients lost to the postoperative follow - up ( n = 6 ) and patients with distal metastasis ( n = 4 ) , were excluded from this study . nonfunctioning neoplasms were defined by the lack of any clinical syndrome caused by excess hormonal secretion . in total , information about clinical presentation , demographics , data regarding surgical procedures , postoperative course and complications , pathologic findings , and follow - up was collected . all patients underwent presurgical computed tomography ( ct ) evaluation of the dimensions , local invasiveness , and the presence of lymph node or distant metastasis . the pathological diameter of neoplasms was defined as the largest diameter of the surgical specimens . standard or parenchyma - preserving resection was selected for according to tumor size and anatomical location . all patients in this study had at least one lymph node sampled on resected specimens . the extent of regional lymphadenectomy was the same as that performed in cases of pancreatic ductal adenocarcinoma . for tumors located in the pancreatic head , regional nodes consisted of those located along the common bile duct , common hepatic artery , portal vein , superior mesenteric vein , posterior and anterior pancreatic head , and the right lateral wall of the superior mesenteric artery . for tumors located in the pancreatic body or tail , regional nodes included those along the common hepatic artery , celiac axis , splenic artery , and splenic hilum . the surgical specimens of all cases were classified according to the world health organization ( who ) classification criteria ( 2010 ) . all pnets were divided according to a grading scheme based on mitotic count or ki67 index into g1 ( mitotic count < 2/10 high - power fields ( hpf ) and/or 2% ki67 index ) , g2 ( mitotic count 220/10 hpf and/or 320% ki67 index ) , and g3 ( mitotic count > 20/10 hpf and/or > 20% ki67 index ) . the enets recommended tnm staging system was used for tumor staging . primary tumors ( t stage ) were classified into four categories : t1 , tumor limited to the pancreas and size < 2 cm ; t2 , tumor limited to the pancreas and size 24 cm ; t3 , tumor limited to the pancreas and size > 4 cm or invading the duodenum or bile duct ; and t4 , tumor invading adjacent organs ( stomach , spleen , colon , and adrenal gland ) or the wall of large vessels ( celiac axis or superior mesenteric artery ) . all patients enrolled in this study underwent a postoperative clinical and radiological follow - up . all patients underwent a radiological examination by ct scans every 612 months after surgery , and magnetic resonance imaging was performed if necessary . if patients had any symptoms suspected to be associated with tumor progression during follow - up , a radiological examination was performed immediately to rule out recurrence or distant metastasis . disease - free survival ( dfs ) was calculated as the months between surgery and 30 jun 2015 or the first documented disease recurrence . an acute postoperative mortality was defined as death which occurred within 30 days after surgery . the data on the operation and postoperative morbidity was collected from the electronic patient records of our institution . phone interviews were conducted for all patients with a response rate of 95% ( 105 patients ) and data on survival status , date of death , and tumor recurrence were collected . for all living patients , data were expressed as a mean standard deviation for continuous variables and as number and percentage for categorical variables . the comparison between subgroups was performed by the analysis of variance for quantitative variables and by the chi - square test or fisher exact test for categorical variables , when necessary . the cox regression model was used in univariate and multivariate analyses to evaluate the independent predictive factors of postoperative recurrence . hazard ratios ( hr ) and 95% confidence intervals ( ci ) were also calculated . variables with p 0.05 in univariate analysis were included in the multivariate model . logistic regression analysis performed in a stepwise fashion with backward selection was used to evaluate the value of clinical factors for predicting lnm and to establish the preoperative predictive model . receiver operating characteristic ( roc ) curve analysis was performed to assess the predictive power of the models through calculating the area under the curve ( auc ) . spss version 20.0 ( ibm , usa ) was used to perform all the data analysis . this was a mono - institutional retrospective cohort study of the clinical records of 100 patients who underwent pancreatic surgery with curative intent for nf - pnet between january 2004 and december 2014 . all patients who were diagnosed with nf - pnet were included ( n = 111 ) , whereas syndromic patients ( n = 1 ) , patients lost to the postoperative follow - up ( n = 6 ) and patients with distal metastasis ( n = 4 ) , were excluded from this study . nonfunctioning neoplasms were defined by the lack of any clinical syndrome caused by excess hormonal secretion . in total , information about clinical presentation , demographics , data regarding surgical procedures , postoperative course and complications , pathologic findings , and follow - up was collected . all patients underwent presurgical computed tomography ( ct ) evaluation of the dimensions , local invasiveness , and the presence of lymph node or distant metastasis . the pathological diameter of neoplasms was defined as the largest diameter of the surgical specimens . standard or parenchyma - preserving resection was selected for according to tumor size and anatomical location . all patients in this study had at least one lymph node sampled on resected specimens . the extent of regional lymphadenectomy was the same as that performed in cases of pancreatic ductal adenocarcinoma . for tumors located in the pancreatic head , regional nodes consisted of those located along the common bile duct , common hepatic artery , portal vein , superior mesenteric vein , posterior and anterior pancreatic head , and the right lateral wall of the superior mesenteric artery . for tumors located in the pancreatic body or tail , regional nodes included those along the common hepatic artery , celiac axis , splenic artery , and splenic hilum . the surgical specimens of all cases were classified according to the world health organization ( who ) classification criteria ( 2010 ) . all pnets were divided according to a grading scheme based on mitotic count or ki67 index into g1 ( mitotic count < 2/10 high - power fields ( hpf ) and/or 2% ki67 index ) , g2 ( mitotic count 220/10 hpf and/or 320% ki67 index ) , and g3 ( mitotic count > 20/10 hpf and/or > 20% ki67 index ) . the enets recommended tnm staging system was used for tumor staging . primary tumors ( t stage ) were classified into four categories : t1 , tumor limited to the pancreas and size < 2 cm ; t2 , tumor limited to the pancreas and size 24 cm ; t3 , tumor limited to the pancreas and size > 4 cm or invading the duodenum or bile duct ; and t4 , tumor invading adjacent organs ( stomach , spleen , colon , and adrenal gland ) or the wall of large vessels ( celiac axis or superior mesenteric artery ) . all patients enrolled in this study underwent a postoperative clinical and radiological follow - up . all patients underwent a radiological examination by ct scans every 612 months after surgery , and magnetic resonance imaging was performed if necessary . if patients had any symptoms suspected to be associated with tumor progression during follow - up , a radiological examination was performed immediately to rule out recurrence or distant metastasis . disease - free survival ( dfs ) was calculated as the months between surgery and 30 jun 2015 or the first documented disease recurrence . an acute postoperative mortality was defined as death which occurred within 30 days after surgery . the data on the operation and postoperative morbidity was collected from the electronic patient records of our institution . phone interviews were conducted for all patients with a response rate of 95% ( 105 patients ) and data on survival status , date of death , and tumor recurrence were collected . for all living patients , data were expressed as a mean standard deviation for continuous variables and as number and percentage for categorical variables . the comparison between subgroups was performed by the analysis of variance for quantitative variables and by the chi - square test or fisher exact test for categorical variables , when necessary . the cox regression model was used in univariate and multivariate analyses to evaluate the independent predictive factors of postoperative recurrence . hazard ratios ( hr ) and 95% confidence intervals ( ci ) were also calculated . variables with p 0.05 in univariate analysis were included in the multivariate model . logistic regression analysis performed in a stepwise fashion with backward selection was used to evaluate the value of clinical factors for predicting lnm and to establish the preoperative predictive model . receiver operating characteristic ( roc ) curve analysis was performed to assess the predictive power of the models through calculating the area under the curve ( auc ) . a two - sided p < 0.05 was considered to indicate statistical significance . spss version 20.0 ( ibm , usa ) was used to perform all the data analysis . the clinical and pathological data of the 100 nf - pnets are shown in table 1 . among the 100 patients , more than 50% ( n = 53 ) were symptomatic at the time of diagnosis . overall , 81 patients ( 81% ) underwent standard pancreatic resection , while 19 patients ( 19% ) underwent parenchyma - preserving pancreatic resection . postsurgical complications occurred in 55 patients ( 55% ) , among which , postoperative pancreatic fistula ( popf ) ( 50.9% ) was the most common . approximately , 40% of popfs were classified as grade a according to the international study group of pancreatic fistula criteria . clinical and pathological data of patients with nonfunctioning pnets * who 2010 classification ; enets recommended tnm staging system . pnets : pancreatic neuroendocrine tumors ; enets : european neuroendocrine tumor society ; tnm : tumor - node - metastasis ; who : world health organization . according to the 2010 who classification , among the 100 nf - pnets , 61 patients ( 61% ) were diagnosed as g1 tumors , 24 ( 24% ) patients as g2 tumors , and 15 ( 15% ) as g3 tumors . among the 85 patients with g1 or g2 tumors , 44 ( 51.8% ) were asymptomatic . in contrast , among the patients with g3 tumors , 12 ( 80% ) had symptoms before surgery . compared to g1 neoplasms , g2 or g3 neoplasms had larger diameter ( g2 vs. g1 : 4.4 cm 2.6 cm vs. 2.8 cm 2.1 cm , p = 0.001 ; g3 vs. g1 : 4.6 cm 2.0 cm vs. 2.8 cm 2.1 cm , p = 0.004 ) . tumor size in ln+ patients was larger than that in ln - patients ( 4.7 cm 2.6 cm vs. 3.2 cm 2.2 cm , p = 0.01 ) . according to the enets recommended tnm staging system , 29 ( 29% ) patients had t1 tumors , 35 ( 35% ) had t2 , 31 ( 31% ) had t3 , and 5 ( 5% ) had t4 . among the 100 patients , 27 patients ( 27% ) had stage i neoplasms , 32 ( 32% ) had stage iia , 22 ( 22% ) had stage iib , and 19 ( 19% ) had stage iiib . pathological examination revealed the presence of angioinvasion and perineural invasion in 15 patients ( 15% ) and 7 patients ( 7% ) , respectively . malignant behavior was found in 31 ( 31% ) of all nf - pnets and four ( 8.5% ) of 47 patients with radiological tumor size < 2.5 cm with lnm identified in 3 ( 75% ) of these patients . the 1 , 5 , and 8-year dfs was 90.2 , 64.147.1% , respectively [ figure 1 ] . during the follow - up period , variables associated with dfs in the univariate analysis are shown in table 2 . in the multivariate analysis , lymph node positive ( hr = 3.995 , 95% ci : 1.58510.06 , p = 0.003 ) , angioinvasion ( hr = 4.049 , 95% ci : 1.472 - 11.135 , p = 0.007 ) , and high tumor grading ( g3 vs. g1 + g2 : hr = 7.286 , 95% ci : 2.779718.980 , p = 0.000048 ) were significantly associated with decreased dfs in patients with resected nf - pnet [ table 2 ] . the 5- and 8-year dfs was 79.4% and 71.4% , respectively , for ln - patients compared to 24.9% and 8.3% , respectively , for patients with ln+ disease ( p = 0.000001 ) [ figure 2 ] . disease - free survival of patients with nonfunctional pancreatic neuroendocrine tumors . the 1 , 5 , and 8-year disease - free survival was 90.2% , 64.1% and 47.1% , respectively . univariate and multivariate analysis of risk factors of dfs * size on resected specimens ; who 2010 classification ; enets recommended tnm staging system . dfs : disease - free survival ; sd : standard deviation ; hr : hazard ratio ; 95% ci : 95% confidence interval ; ln : lymph node ; enets : european neuroendocrine tumor society ; tnm : tumor - node - metastasis ; who : world health organization . the 5-year disease - free survival was 79.4% for lymph node - patients compared to 24.9% for patients with ln + disease ( p = 0.000001 ) , ln : lymph node . among these 100 patients with nf - pnets , 92 who underwent regional lymphadenectomy variables that could be measured preoperatively were selected for the univariate analysis of the feasibility of preoperative prediction of ln status . in the univariate analysis , factors associated with ln metastasis were radiological tumor diameter > 2.5 cm ( odds ratio [ or ] = 5.667 , p = 0.010 ) , elevated ca199 ( or = 4.714 , p = 0.017 ) , high tumor grading ( g2:g1 , or = 6.125 , p = 0.007 ; g3:g1 , or = 14.000 , p = 0.000322 ) , and presence of symptoms ( or = 3.545 , p = 0.026 ) [ table 3 ] . in the multivariate analysis , tumor grading ( g2 vs. g1 : or = 6.287 , p = 0.008 ; g3 vs. g1 : or = 12.407 , p = 0.001 ) was an independent predictor of lnm [ table 3 ] . the rate of lnm progressively increased from g1 to g3 ( g1 , g2 vs. g3 : 7.5% , 33.3% vs. 53.3% ) . considering the difficulty of preoperative retrievability of tumor grade , we excluded tumor grade from the analysis , and as a result , radiological tumor size > 2.5 cm ( or = 5.430 , p = 0.013 ) and presence of symptoms ( or = 3.366 , p = 0.039 ) were independently associated with lnm [ table 3 ] . radiological diameter was consistent with pathological diameter ( 34.1 mm vs. 34.7 mm , p = 0.237 ) . when tumor size was treated as a continuous variable , the correlation with ln metastasis also reached significance ( or = 1.313 , p = 0.016 ) . roc analysis demonstrated radiological tumor diameter was a reliable and feasible predictor of lnm in patients with resectable nf - pnet with an auc of 0.693 [ figure 3a ] . compared to neoplasms with radiological size > 2.5 cm ( 32.1% ) , tumors 2.5 cm had an obviously lower risk of lnm ( 7.7% ) . the various clinicopathologic factors reviewed in this study stratified by a tumor size cut - off of 2.5 cm are summarized in table 4 . compared to tumors 2.5 cm , tumors > 2.5 cm had higher tumor grade and greater malignant potential . a cut - off of > 2.5 cm was associated with a sensitivity of 85% for the presence of ln+ disease . other cut - offs were also examined [ table 5 ] . with the purpose of promoting the predictive power , we constructed a preoperative predictive model of ln metastasis based on radiological tumor size combined with symptoms . the auc of this model was 0.747 [ figure 3b ] , and the probability of ln+ for every patient was calculated . for the patients with an ln+ risk of 20% , 89.6% of these patients were , actually , ln - negative . of the 21 incidentally discovered patients with tumors size 2.5 cm on ct scans , only one ( 4.8% ) had lnm and none presented a postoperative recurrence during follow - up . univariate and multivariate logistic regression analysis of ln metastasis * who 2010 classification ; multivariate analysis excluding tumor grade . or : odds ratio ; 95% ci : 95% confidence interval ; ln : lymph node ; who : world health organization . the area under the curve of radiological tumor size ( a ) is 0.693 , while the area under the curve of the constructed predictive model ( b ) is 0.747 . clinicopathologic factors stratified by radiological tumor size * standard resections include pancreaticoduodenectomy and distal pancreatectomy . atypical resections include middle pancreatectomy and enucleation ; laparoscopic and robotic surgery ; who 2010 classification ; enets recommended tnm staging system . sd : standard deviation ; ln : lymph node ; who : world health organization ; enets : european neuroendocrine tumor society ; tnm : tumor - node - metastasis . predictive values of different radiological size cut - offs for ln metastasis in patients with nf - pnets npv : negative predictive value ; ppv : positive predictive value ; auc : area under the curve ; nf - pnets : nonfunctional pancreatic neuroendocrine tumors ; ln : lymph node . the clinical and pathological data of the 100 nf - pnets are shown in table 1 . among the 100 patients , more than 50% ( n = 53 ) were symptomatic at the time of diagnosis . overall , 81 patients ( 81% ) underwent standard pancreatic resection , while 19 patients ( 19% ) underwent parenchyma - preserving pancreatic resection . postsurgical complications occurred in 55 patients ( 55% ) , among which , postoperative pancreatic fistula ( popf ) ( 50.9% ) was the most common . approximately , 40% of popfs were classified as grade a according to the international study group of pancreatic fistula criteria . clinical and pathological data of patients with nonfunctioning pnets * who 2010 classification ; enets recommended tnm staging system . pnets : pancreatic neuroendocrine tumors ; enets : european neuroendocrine tumor society ; tnm : tumor - node - metastasis ; who : world health organization . according to the 2010 who classification , among the 100 nf - pnets , 61 patients ( 61% ) were diagnosed as g1 tumors , 24 ( 24% ) patients as g2 tumors , and 15 ( 15% ) as g3 tumors . among the 85 patients with g1 or g2 tumors , 44 ( 51.8% ) were asymptomatic . in contrast , among the patients with g3 tumors , 12 ( 80% ) had symptoms before surgery . compared to g1 neoplasms , g2 or g3 neoplasms had larger diameter ( g2 vs. g1 : 4.4 cm 2.6 cm vs. 2.8 cm 2.1 cm , p = 0.001 ; g3 vs. g1 : 4.6 cm 2.0 cm vs. 2.8 cm 2.1 cm , p = 0.004 ) . tumor size in ln+ patients was larger than that in ln - patients ( 4.7 cm 2.6 cm vs. 3.2 cm 2.2 cm , p = 0.01 ) . according to the enets recommended tnm staging system , 29 ( 29% ) patients had t1 tumors , 35 ( 35% ) had t2 , 31 ( 31% ) had t3 , and 5 ( 5% ) had t4 . among the 100 patients , 27 patients ( 27% ) had stage i neoplasms , 32 ( 32% ) had stage iia , 22 ( 22% ) had stage iib , and 19 ( 19% ) had stage iiib . pathological examination revealed the presence of angioinvasion and perineural invasion in 15 patients ( 15% ) and 7 patients ( 7% ) , respectively . malignant behavior was found in 31 ( 31% ) of all nf - pnets and four ( 8.5% ) of 47 patients with radiological tumor size < 2.5 cm with lnm identified in 3 ( 75% ) of these patients . the 1 , 5 , and 8-year dfs was 90.2 , 64.147.1% , respectively [ figure 1 ] . during the follow - up period , variables associated with dfs in the univariate analysis are shown in table 2 . in the multivariate analysis , lymph node positive ( hr = 3.995 , 95% ci : 1.58510.06 , p = 0.003 ) , angioinvasion ( hr = 4.049 , 95% ci : 1.472 - 11.135 , p = 0.007 ) , and high tumor grading ( g3 vs. g1 + g2 : hr = 7.286 , 95% ci : 2.779718.980 , p = 0.000048 ) were significantly associated with decreased dfs in patients with resected nf - pnet [ table 2 ] . the 5- and 8-year dfs was 79.4% and 71.4% , respectively , for ln - patients compared to 24.9% and 8.3% , respectively , for patients with ln+ disease ( p = 0.000001 ) [ figure 2 ] . disease - free survival of patients with nonfunctional pancreatic neuroendocrine tumors . the 1 , 5 , and 8-year disease - free survival was 90.2% , 64.1% and 47.1% , respectively . univariate and multivariate analysis of risk factors of dfs * size on resected specimens ; who 2010 classification ; enets recommended tnm staging system . dfs : disease - free survival ; sd : standard deviation ; hr : hazard ratio ; 95% ci : 95% confidence interval ; ln : lymph node ; enets : european neuroendocrine tumor society ; tnm : tumor - node - metastasis ; who : world health organization . impact of lymph node status on disease - free survival . the 5-year disease - free survival was 79.4% for lymph node - patients compared to 24.9% for patients with ln + disease ( p = 0.000001 ) , ln : lymph node . among these 100 patients with nf - pnets , 92 who underwent regional lymphadenectomy were selected for analysis of predictors of lnm . of these patients , variables that could be measured preoperatively were selected for the univariate analysis of the feasibility of preoperative prediction of ln status . in the univariate analysis , factors associated with ln metastasis were radiological tumor diameter > 2.5 cm ( odds ratio [ or ] = 5.667 , p = 0.010 ) , elevated ca199 ( or = 4.714 , p = 0.017 ) , high tumor grading ( g2:g1 , or = 6.125 , p = 0.007 ; g3:g1 , or = 14.000 , p = 0.000322 ) , and presence of symptoms ( or = 3.545 , p = 0.026 ) [ table 3 ] . in the multivariate analysis , tumor grading ( g2 vs. g1 : or = 6.287 , p = 0.008 ; g3 vs. g1 : or = 12.407 , p = 0.001 ) was an independent predictor of lnm [ table 3 ] . the rate of lnm progressively increased from g1 to g3 ( g1 , g2 vs. g3 : 7.5% , 33.3% vs. 53.3% ) . considering the difficulty of preoperative retrievability of tumor grade , we excluded tumor grade from the analysis , and as a result , radiological tumor size > 2.5 cm ( or = 5.430 , p = 0.013 ) and presence of symptoms ( or = 3.366 , p = 0.039 ) were independently associated with lnm [ table 3 ] . radiological diameter was consistent with pathological diameter ( 34.1 mm vs. 34.7 mm , p = 0.237 ) . when tumor size was treated as a continuous variable , the correlation with ln metastasis also reached significance ( or = 1.313 , p = 0.016 ) . roc analysis demonstrated radiological tumor diameter was a reliable and feasible predictor of lnm in patients with resectable nf - pnet with an auc of 0.693 [ figure 3a ] . compared to neoplasms with radiological size > 2.5 cm ( 32.1% ) , tumors 2.5 cm had an obviously lower risk of lnm ( 7.7% ) . the various clinicopathologic factors reviewed in this study stratified by a tumor size cut - off of 2.5 cm are summarized in table 4 . compared to tumors 2.5 cm , tumors > 2.5 cm had higher tumor grade and greater malignant potential . a cut - off of > 2.5 cm was associated with a sensitivity of 85% for the presence of ln+ disease . other cut - offs were also examined [ table 5 ] . with the purpose of promoting the predictive power , we constructed a preoperative predictive model of ln metastasis based on radiological tumor size combined with symptoms . the auc of this model was 0.747 [ figure 3b ] , and the probability of ln+ for every patient was calculated . for the patients with an ln+ risk of 20% , 89.6% of these patients were , actually , ln - negative . of the 21 incidentally discovered patients with tumors size 2.5 cm on ct scans , only one ( 4.8% ) had lnm and none presented a postoperative recurrence during follow - up . univariate and multivariate logistic regression analysis of ln metastasis * who 2010 classification ; multivariate analysis excluding tumor grade . or : odds ratio ; 95% ci : 95% confidence interval ; ln : lymph node ; who : world health organization . the area under the curve of radiological tumor size ( a ) is 0.693 , while the area under the curve of the constructed predictive model ( b ) is 0.747 . clinicopathologic factors stratified by radiological tumor size * standard resections include pancreaticoduodenectomy and distal pancreatectomy . atypical resections include middle pancreatectomy and enucleation ; laparoscopic and robotic surgery ; who 2010 classification ; enets recommended tnm staging system . sd : standard deviation ; ln : lymph node ; who : world health organization ; enets : european neuroendocrine tumor society ; tnm : tumor - node - metastasis . predictive values of different radiological size cut - offs for ln metastasis in patients with nf - pnets npv : negative predictive value ; ppv : positive predictive value ; auc : area under the curve ; nf - pnets : nonfunctional pancreatic neuroendocrine tumors ; ln : lymph node . nf - pnets are relatively rare and heterogeneous pancreatic neoplasms with a remarkably increasing incidence . compared to functional neoplasms , nf neoplasms show a worse outcome in part due to the delay of diagnosis and higher malignant potential . the optimal management for pnet is still controversial . given its positive impact on survival , surgical resection has become the treatment choice for most patients with nf - pnets . in recent years , small nf - pnets are increasingly being discovered incidentally in cross - sectional imaging for other purposes and routine regional lymphadenectomy when surgical resection is considered in such cases remains controversial . for these reasons , we conducted a mono - institutional retrospective study of resectable nf - pnets with the purpose of ( 1 ) elucidating the clinical significance of lnm and ( 2 ) identifying reliable predictors of lnm to help surgeons to make informed treatment decisions . our clinical data demonstrated that the 5-year dfs of resectable nf - pnets was 64.1% . lnm is a significant prognostic predictor for most malignant tumors , although the impact of lnm on the survival of patients with nf - pnets remains open to debate . many previous studies have yielded conflicting evidence regarding the prognostic value of lnm for pnet . the difference in patient selection and low lymph node sampling rates during resection for pnets may account for these inconsistencies . in accordance with our results , several previous studies have demonstrated lnm is significantly associated with a poor prognosis . both the enets - tnm staging system and the ajcc cancer staging system regard lymph node status as an important prognostic factor . in our study , patients with lnm had a significantly higher risk ( nearly 4-fold ) of postoperative recurrence compared with those without lnm , which supports the necessity for regional lymphadenectomy in patients with high - risk of lymph node involvement . since lnm is apparently related to prognosis , the ability to distinguish patients with high - risk of lnm preoperatively is of great importance . nf - pnets classified , according to the criteria of the 2010 who classifications , were divided into three groups using a grading scheme based on the ki-67 index or mitotic count . our study confirmed the significant correlation between the 2010 who grading system and postoperative recurrence , which is consistent with recent studies . in addition , lnm occurred more frequently in patients with g2 or g3 nf - pnets than in those with g1 tumors ( g1 , g2 vs. g3 : 7.5% , 33.3% , 53.3% ) ; therefore , it was presumed that these patients would benefit from node clearance and routine lymphadenectomy was recommended . however , classification of tumor grade usually depends on pathological examination and the possibility of a preoperative evaluation of ki-67 is still questionable . endoscopic ultrasonography ( eus ) combined with fine - needle aspiration ( fna ) or tru - cut needle biopsy ( tcb ) can be used to evaluate tumor pathology preoperatively . preoperative evaluation of ki-67 index , combined with lesion size and imaging findings may help surgeons to decide on the best therapeutic approach and whether lymphadenectomy should be performed . however , there is a lack of data regarding the accuracy of fna cytology in the assessment of ki-67 value . all of the available reports describe studies with small sample sizes . in a recent study , use of eus tcb needles can overcome many of the problems that reduce the accuracy of fna , but they are not feasible for most patients as they are often performed only at high - volume centers , can be challenging for small masses , and are associated with a risk of pancreatitis and bleeding . moreover , intratumoral ki-67 heterogeneity limits the accurate preoperative evaluation of ki-67 value by eus fna . considering the limitations of preoperative evaluation of ki-67 index , can easily be obtained preoperatively by use of radiological techniques , it has been extensively studied to identify the patients with lnm . increasing tumor size reported that radiological tumor size 4 cm was an independent predictor of nodal metastasis in low and intermediate grade nf - pnets . in a retrospective study of 116 patients undergoing resection for nf - pnet , toste et al . demonstrated that radiological tumor size 2 cm predicted nodal metastasis with a sensitivity of 93.8% and only two ( 7.4% ) of 27 patients with tumor size < 2 cm had lnm . hashim et al . reported that patients with tumor diameter > 1.5 cm were 4.7 times more likely to have lnm compared to those with smaller tumor diameters . they also found two ( 12% ) of 17 patients with tumor size 1 cm and five ( 13% ) of 38 patients with tumor size 1.5 cm had lnm . in contrast , some studies indicate that tumor size is not an accurate predictor of lnm . reported that there was no difference in tumor size for patients with and without nodal metastasis ( 5.2 cm vs. 4.6 cm ) . <3 cm had nodal metastasis , while only 1 patient in their series with a tumor < 2 cm was ln positive . reported there was no association between decreasing tumor size and decreased percentage of cases presenting with regional nodal metastasis . our study suggests radiological tumor size is a sensitive predictor of lymph node status and demonstrates a strong correlation between increasing radiological tumor size and lnm . the incidence of lnm in patients with radiological size > 2.5 cm was more than 4 times greater than that in patients with a tumor size 2.5 cm . a cut - off of > 2.5 cm was associated with a sensitivity of 85% for the presence of positive lns . three of 39 ( 7.7% ) patients with a tumor size 2.5 cm had nodal metastasis and 2 patients ( 11.1% ) with a tumor size 1.5 cm had nodal metastasis . given that smaller tumors are associated with low rates of lnm , better histology , and a better outcome than larger tumors , it is unclear whether lymphadenectomy should be avoided for small nf - pnets . in a retrospective study of 1854 patients with nf - pnets 2 cm , gratian et al . demonstrated that there was no difference in 5-year overall survival in patients undergoing surgical resection between those who underwent lymphadenectomy and those who did not . interestingly , in this study , 29% of tumors 2 cm and 33% of tumors 0.5 cm presented with regional lnm with a median of eight lymph nodes sampled , which was unexpectedly higher than had been reported previously . however , patient selection bias might overestimate the malignant potential of these tumors and account for the high rate of lnm . nccn guidelines suggest that lymphadenectomy should not be performed routinely for tumors < 2 cm but should be considered in tumors that are 12 cm in size . the benefits of lymphadenectomy in patients with small tumors is still unknown and more clinical data or well - designed clinical trials are needed to resolve this problem ; however , such clinical trials are limited by the relative rarity and indolent behavior of small nf - pnets . in our study , patients with small tumors ( 2.5 cm ) has a very low - risk of lnm . in addition , recurrence occurred in only one of the patients with small tumors 84 months after surgery , and no deaths caused by these tumors were reported during the follow - up . nccn guidelines and current staging systems use the same cut - off of 2 cm as that used in pancreatic ductal adenocarcinoma , although patients with nf - pnets have a much better prognosis than those with pda . a cut - off of 2 cm has a low specificity for estimating the risk of lnm ; consequently , many patients undergo unnecessary lymphadenectomy under this criterion . based on our results , a cut - off of 2.5 cm was shown to be appropriate and safe . compared to 2 cm , a cut - off of 2.5 cm had a similar sensitivity , but higher specificity and negative predictive value , showing that a cut - off of 2.5 cm is more effective in distinguishing the patients who require ln resection . given the previously demonstrated strict correlation between tumor diameter and poor survival after resection of nf - pnets , raising the threshold may result in some tumors with malignant potential being considered benign . preoperative evaluation of ki-67 index , combined with lesion size and imaging findings , may help surgeons to decide the best therapeutic approach . since low - grade tumors are associated with a very low - risk of lnm and excellent survival , relaxing the indications for lymphadenectomy seems to be feasible . based on the results of this study , we identified radiological tumor size as a noninvasive and reliable factor to predict lnm in nf - pnets . a radiological diameter 2.5 cm yielded a powerful correlation with the risk of lnm . the presence of symptoms at diagnosis was also shown to be a predictor of lnm . although the symptoms of patients with nf - pnets are always unspecific , they are thought to be related to local mass effect or metastatic disease ; in other words , tumor burden . incidental detection of tumors is a strong prognostic factor for postoperative progression . in this study , incidentally discovered tumors were slightly smaller in size ( 3.2 cm vs. 3.7 cm ) and associated with a much lower risk of lnm ( 12.2% vs. 29.2% ) . reported only 6% of nf - pnets 2 cm were malignant when discovered incidentally . in our study , incidentally discovered small ( 2.5 cm ) nf - pnets had a very low - risk of lnm ( 4.2% ) and no cases of postoperative recurrence or death due to the disease occurred . considering the low - risk of ln involvement and the positive outcomes , routine lymphadenectomy is not recommended as an addition to pancreatic resection in cases of asymptomatic small nf - pnets when surgery is considered . in conclusion , preoperative prediction of ln involvement is feasible and radiological tumor size , which can be measured easily and accurately , was shown to be a useful and alternative variable correlated with ln involvement . our results suggest that parenchyma - sparing resection without regional lymphadenectomy is a reasonable option for selected patients with incidentally discovered nf - pnets 2.5 cm when surgical resection is considered because of the low probability of lnm and a good outcome . in contrast , lymphadenectomy should be performed routinely in patients with nf - pnets > 2.5 cm .

background : the optimal surgical management of nonfunctional pancreatic neuroendocrine tumors ( nf - pnets ) is still controversial . here , we evaluated the impact of lymph node status on postoperative recurrence in patients with nf - pnet and the potential of preoperative variables for predicting lymph node metastasis ( lnm).methods : in this mono - institutional retrospective cohort study conducted in 100 consecutive patients who underwent nf - pnet resection between january 2004 and december 2014 , we evaluated risk factors for survival using the kaplan meier method and the cox regression model . predictors of lnm were evaluated using the logistic regression model , and the power of predictive models was evaluated using receiver operating characteristic curve analysis.results:five-year disease - free survival of resected nf - pnet was 64.1% . lnm was independently associated with postoperative recurrence ( hazard ratio = 3.995 , p = 0.003 ) . multivariate analysis revealed tumor grade as an independent factor associated with lnm ( g2 vs. g1 : odds ratio [ or ] = 6.287 , p = 0.008 ; g3 vs. g1 : or = 12.407 , p = 0.001 ) . when tumor grade was excluded , radiological tumor diameter > 2.5 cm ( or = 5.430 , p = 0.013 ) and presence of symptoms ( or = 3.366 , p = 0.039 ) were significantly associated with lnm . compared to neoplasms with radiological diameter > 2.5 cm ( 32.1% ) , tumors 2.5 cm had an obviously lower risk of lnm ( 7.7% ) , indicating the reliability of this parameter in predicting lnm ( area under the curve , 0.693 ) . incidentally discovered nf - pnets 2.5 cm were associated with a low - risk of lnm and excellent survival.conclusions:lnm is significantly associated with postoperative recurrence . radiological tumor diameter is a reliable predictor of lnm in nf - pnets . our results indicate that lymphadenectomy in small ( 2.5 cm ) nf - pnets is not routinely necessary .

I M Patients Surgical treatment of nonfunctional pancreatic neuroendocrine tumors Pathological examination and staging system Follow-up Statistical analysis R Demographics, operative details, pathological findings Long-term outcomes Predictors of lymph node metastasis D Financial support and sponsorship Conflicts of interest

chronic obstructive pulmonary disease ( copd ) is one of the most prevalent illnesses worldwide and is estimated as the third leading cause of mortality in 2020 . the pathogenesis of copd is usually progressive and associated with an abnormal inflammatory response in the lungs , particularly in response to noxious particles or gases , such as cigarette smoke . recently , copd - associated inflammation is thought to be an autoimmune response induced by smoking or pathogenic microbials that activate lymphocytes and antigen - presenting cells . previous studies have shown that th1 cells are predominantly associated with the development of emphysematous lungs , leading to the progression of copd although the mechanisms by which tobacco smoke is associated with th1 immunity remain unclear [ 47 ] . cd4cd25foxp3 regulatory t cells ( tregs ) are crucial regulators of the maintenance of peripheral immunologic tolerance , and tregs can suppress effectors th1 , th2 , and th17 responses , inflammation , and autoimmune responses [ 8 , 9 ] . a deficiency in treg regulation has been associated with the development of many th1-mediated chronic inflammation and autoimmune disorders , including type 1 diabetes , multiple sclerosis , atherosclerosis , and rheumatoid arthritis [ 1114 ] . interestingly , decreased numbers of tregs were detected in the lungs of subjects with emphysema , suggesting that tregs participate in the regulation of emphysema - related inflammation in the lungs . however , little is known on what therapeutic strategies could increase the number of tregs and il-35 responses in the lungs of subjects with emphysema - related inflammation . currently , anti - inflammatory steroids have been often used for the treatment of copd patients with acute exacerbation , but the therapeutic efficacy of steroids is limited [ 16 , 17 ] . therefore , discovery of new therapeutic reagents will be of great significance in the management of patients with copd . erythromycin is a 14-membered ring macrolide antibiotic and has been prescribed for the treatment of various respiratory infections . erythromycin can inhibit mitogen - stimulated human t - cell proliferation and cytokine production , which are associated with inhibition of the mapk and nf-b activation [ 18 , 19 ] . furthermore , erythromycin can ameliorate chronic inflammation in various animal models [ 20 , 21 ] . in addition , long - term treatment with low doses of a 14-membered ring macrolide is beneficial for patients with airway inflammatory diseases , such as diffuse panbronchiolitis ( dpb ) , cystic fibrosis [ 23 , 24 ] , bronchiectasis , and bronchial asthma [ 26 , 27 ] . our previous study has reported that treatment with erythromycin reduces the number of smoking - induced airway inflammatory infiltrates and airway remodelling in the lungs of rodents . however , little is known on whether treatment with erythromycin could modulate treg and il-35 responses in the lungs . in this study , we evaluated the impact of treatment with erythromycin for nine weeks on cigarette smoking - induced inflammation in a rat model of emphysema . our findings indicated that treatment with erythromycin not only reduced smoking - induced airway inflammation and emphysema but also increased treg infiltrates and il-35 production in the lungs of rats . male wistar rats at 12 weeks of age were obtained from the animal research center of guangxi medical university . the animals were housed individually in standard laboratory cages with free access to standard food and tap water ad libitum . the experimental protocols were established , according to the guidelines of nih animal research care and were approved by the animal research care committee of guangxi medical university . individual rats ( n = 40 ) were exposed either to room air ( control ) or to cigarette smoke , as described previously . briefly , groups of rats ( n = 20 per group ) were exposed to tobacco smoke with 20 cigarettes ( nanning jiatianxia unfiltered cigarettes : 12 mg of tar and 0.9 mg of nicotine ) in a closed 0.54 m space for 2 hours daily for six consecutive days per week for 12 consecutive weeks . as a result , an optimal ratio of smoking to air at 1 : 6 was obtained and the levels of oxygen exposed by the rats were kept at a 21 1% , which is similar to atmospheric oxygen concentrations . the rats tolerated the cigarette smoke without evidence of toxicity ( the levels of serum carboxyhemoglobin in rats were at ~10% , and no weight loss in the rats was observed ) . the levels of serum carboxyhemoglobin in the smoking rats ( n = 20 ) were 8.3 1.4% , as compared with 1.0 0.2% in the control rats ( n = 20 ) , which were similar to the concentrations of blood carboxyhemoglobin of human smokers . three weeks after exposure to cigarette smoke , the rats were randomized and treated by gavage with 100 mg / kg / d of erythromycin ( meichuang pharmaceuticals , dailian , china ) in saline ( 1 ml ) or saline alone daily for nine weeks , respectively . we used this dose based on our previous findings to show that treatment with 100 mg / kg / d of erythromycin inhibits smoke - related lung inflammation without obvious adverse effect . the rats that exposed to regular air were randomized and treated with erythromycin or saline in the same manner . accordingly , there were four groups of rats ( n = 10 per group ) . the normal group of rats were exposed to regular air and treated with saline ( group n ) ; the smoking group of rats were exposed to smoking air for 12 weeks and treated with saline ( group s ) ; the erythromycin group of rats were exposed to smoking air for 12 weeks and treated with erythromycin ( group e ) ; the control group of rats were exposed to regular air and treated with erythromycin ( group c ) . one day after the last smoking , animals were injected intraperitoneally with 20 mg / kg pentobarbital and subjected to a thoracotomy . their left lungs were lavaged through an intratracheal cannula three times with 2 ml of cold saline , and the bronchoalveolar lavage fluid ( balf ) samples were collected . the lower lobes of their right lungs were fixed in 10% formalin for pathological examination . the fixed lower lobes of the right lungs were embedded in paraffin , and the midsagittal sections of the lungs were stained with hematoxylin and eosin ( h&e ) , followed by examining under a light microscope . three non - consecutive lung sections from each animal and three non - overlapping random fields from each section were examined for the quantification of lung damages . alveolar airspace enlargement was assessed by the mean linear intercept ( mli ) by two independent individuals in a blinded manner , as described previously . briefly , multiple digital images of histological sections were systematically captured at 100 magnification . images were overlaid with a 10 10 grid ( 1 mm ) , and the mli was established from every second image ( i.e. , in a checkerboard fashion , averaging six images for each rat ) . the distribution of the mli values of all the digital photographs was assessed using frequency distribution analysis and characterized using a gaussian model . the collected balf samples from the left lung tissues were centrifuged , and their supernatants were stored at 80c for elisa analysis . the pelleted cells were resuspended in pbs and a portion of the cells ( 1 10 cells ) was subjected to cytospin centrifugation on glass slides and fixed with methanol , followed by staining with may - grnwald - giemsa solution , and a differential cell count was performed under a light microscope , according to morphological characteristics . the concentrations of il-8 , il-35 , and tnf- in balf were measured with a multiplex - enzyme - linked immunosorbent assay ( elisa ) system , according to the manufacturers ' instructions ( lincoplex systems , st charles , mo , usa ) . a single - cell suspension of whole left lung tissue was prepared by combined procedures of mechanical fragmentation , enzymatic digestion , and centrifugation , as described in previous studies [ 5 , 15 ] . briefly , lungs were flushed via the right ventricle with 10 ml of warm ( 37c ) hbss ( calcium and magnesium free ) containing 5% fetal bovine serum ( fbs , sigma , beijing , china ) , 100 u / ml of penicillin , and 100 g / ml of streptomycin ( gibco brl ) . the lungs were then cut into small pieces ( ~2 mm in diameter ) and digested with 150 u / ml of collagenase ( worthington biochemical , freehold , nj , usa ) in hbss with being shaken at 37c for 1 h. using a plunger from a 5-ml syringe , the lung pieces were triturated through a mess of 100 m into hbss , and the resulting cell suspension was filtered through nylon mesh . the cells were washed twice , and mononuclear cells were isolated using density centrifugation in 30% percoll ( pharmacia , uppsala , sweden ) . the collected leukocytes ( 1 10 cells ) were used for flow cytometry analysis and the remaining cells were used for the extraction of total rna for rt - pcr analysis . the collected cells ( 1 10 ) from individual rats were stained with pe - cy5-conjugated anti - cd4 ( clone : ox-35 ) or its isotype control ( bd pharmingen , san diego , ca , usa ) at 4c for 45 minutes , fixed , permeabilized , and stained with pe - conjugated anti - foxp3 ( clone : fjk16s ) or its isotype control ( ebioscience , wembley , uk ) at 4c for another 40 minutes . the frequency and the number of tregs were determined by flow cytometry on a facscalibur ( bd pharmingen ) and analysed by fcs express software . total rna was extracted from the lung cells of individual rats with trizol reagent , according to the manufacturers ' instructions ( invitrogen , carlsbad , ca , usa ) . the quality and quantity of total rna were analysed by a spectrophotometer . the rna samples were reversely transcribed into cdna using a reverse transcription kit ( finn - zymes , espoo , finland ) and oligo ( dt ) primers . the relative levels of foxp3 mrna transcripts to control -actin in individual samples were characterized by quantitative rt - pcr using sybr green on a lightcycler ( icycler iq , biorad , usa ) and the specific primers . the sequences of primers were forward 5-ggagattactgccctggctccta-3 , and reverse 5-gactcatcgtactcctgcttgctg-3 for -actin and forward 5-tgagctggctgcaattctgg-3 and reverse 5-atctagctgctctgcatgaggtga-3 for foxp3 . the pcr amplifications were performed in triplicate at 95c for 30 sec and subjected to 40 cycles of 95c for 5 sec and 60c for 30 sec . the values of foxp3 mrna transcripts in each sample were normalized to that of -actin and the relative levels of foxp3 mrna transcripts were calculated . differences among groups were analysed using the analysis of variance ( anova ) and post hoc student 's t - test , the kruskal - wallis test , and the mann - whitney u - test where applicable using statistical package spss 11.0 ( spss , chicago , il , usa ) . following smoking for 12 weeks and treatment with erythromycin for 9 weeks , the lung tissue sections of the different groups of rats were stained with h&e and subjected to quantitative analysis of the lung airspace ( figure 1 ) . we observed the enlargement of air spaces and many inflammatory infiltrates in the lungs of the smoking rats . quantitative analysis indicated that there was no significant difference in the mli values between the n and c groups of rats . in contrast , the mli values in the s and e group of rats were significantly greater than that in the n and c groups of rats ( p < 0.05 ) , demonstrating that long - term heavy smoking - induced lung emphysema in rats . interestingly , the mli values in the e groups of rats were significantly less than that in the s group of rats although they remained greater than that in controls . in addition , treatment with erythromycin mitigated smoke - induced histological damage in the lungs of rats , consistent with our previous observation . these data indicated that treatment with erythromycin significantly diminished smoking - related emphysema in the lungs of rats . to quantify the airway inflammation response , we evaluated the numbers of inflammatory infiltrates in balf and found significantly increased numbers of total infiltrates , particularly macrophages , lymphocytes , and neutrophils in the balf from the smoking rats , as compared with that in the n and c groups of rats ( p < 0.05 , figure 2 ) . in contrast , the total numbers of inflammatory infiltrates , macrophages , lymphocytes , and neutrophils in the balf from the erythromycin - treated smoking rats were reduced significantly , as compared with those in the smoking rats without erythromycin treatment . in addition , treatment with erythromycin did not cause obvious adverse effect in rats , consistent with our previous findings . these data demonstrated that treatment with erythromycin significantly mitigated smoking - induced inflammatory cell infiltration in the lungs of rats . analysis of the concentrations of tnf- and il-8 in the balf indicated that significantly higher levels of tnf- and il-8 were detected in blaf from the smoking rats , as compared with that in the n and c groups of rats ( figure 3 ) . furthermore , the levels of tnf- and il-8 in balf from the smoking rats that had been treated with erythromycin were significantly lower than that in the smoking rats without erythromycin treatment . apparently , treatment with erythromycin inhibited the smoking - induced proinflammatory cytokine production in the lungs . flow cytometry analysis revealed that the frequency and the number of tregs in the lung parenchyma of smoking rats were significantly lower than that of the n and c groups of control rats ( p < 0.01 , figure 4 ) , while the frequency and the number of tregs in the erythromycin - treated group of rats were higher than that of the s group of rats ( p < 0.05 ) . a similar pattern of the relative levels of foxp3 mrna transcripts was detected in the different groups of rats . apparently , treatment with erythromycin mitigated heavy smoking - induced reduction in the numbers of tregs in the lungs of rats . next , we determined the levels of il-35 in balf from different groups of rats . the concentrations of il-35 in the balf from the s group of rats were significantly lower than that in the n and c groups of control rats ( figure 5 ) . interestingly , the levels of il-35 in the balf from e group of rats were similar to that in the n and c groups of rats and were significantly higher than that in the s group of rats . apparently , treatment with erythromycin increased the levels of il-35 responses in the lungs of rats . copd and emphysema are common destructive inflammatory diseases that are leading causes of mortality worldwide . the smoking - induced emphysema is thought to be an autoimmune disease and is mediated predominantly by th1 responses in the lung . in this study , we employed a rat model of smoking - related airway inflammation and emphysema to test the therapeutic effect of treatment with erythromycin and the potential mechanisms . our data showed that treatment with erythromycin significantly reduced smoking - induced lung inflammation and damages , consistent with our previous findings . furthermore , treatment with erythromycin increased the numbers of tregs , accompanied by increased levels of inhibitory il-35 in the lungs of rats . the increased levels of il-35 may contribute to the inhibition of erythromycin on smoking - related inflammation . our novel findings extend previous observations and suggest that erythromycin may be valuable for the intervention of airway inflammation by upregulating treg responses in patients with copd in the clinic . macrolide antibiotics have been used for the treatment of lung inflammation in patients with copd in the clinic . previous studies have shown that macrolides , especially for erythromycin , can modulate immune responses and inhibit inflammation in patients with db and cf . indeed , long - term treatment with a low dose of macrolide benefits patients with copd by its anti - inflammatory activities . in this study , we employed a well - known cigarette - smoking - inuced rat emphysema model and examined the effect of treatment with erythromycin on the airway inflammation and lung damages . we detected high values of mli , great numbers of inflammatory infiltrates , and high levels of tnf- and il-8 in the lungs of smoking rats , demonstrating that heavy smoking - inuced emphysema and airway inflammation in the lungs of rats . furthermore , we found that treatment with erythromycin mitigated the smoking - induced emphysema and reduced the numbers of inflammatory infiltrates and levels of tnf- and il-8 in the lungs of rats . our data were consistent with a previous report that treatment with clarithromycin for six months decreases airspace enlargement in the smoke - induced emphysema in mice . our findings support the notion that erythromycin inhibits airway inflammation . heavy smoking can modulate the function of antigen - presenting cells , which may induce t - cell autoimmunity against the lungs and th1 immunity has been thought to be related to the pathogenic process of copd [ 15 , 34 ] . microbials , such as erythromycin , can modulate t - cell responses and inhibit airway inflammation [ 23 , 27 , 35 ] . notably , tregs are potent regulators of t - cell autoimmunity and inflammation and il-35 is predominantly produced by tregs and contributes to regulatory t - cell function [ 8 , 9 ] . we found that treatment with erythromycin enhanced treg responses , which may contribute to the inhibition of airway inflammation . evidentially , in comparison with that in the smoking rats , treatment with erythromycin significantly increased the frequency and the numbers of treg infiltrates in the lungs . furthermore , treatment with erythromycin upregulated the levels of foxp3 mrna transcripts in the lungs . in addition , treatment with erythromycin increased the levels of il-35 in the balf , given that tregs can inhibit pathogenic t - cell responses and il-35 is crucial for the function of tregs . although the increased treg responses in the lungs by treatment with erythromycin were moderate the significantly reduced inflammation suggests that marginal effect of erythromycin on increasing treg response in the lung may be sufficient in suppressing smoking - related inflammation . we understand that our data did not demonstrate that the increased treg responses were responsible for the inhibition of smoke - related lung inflammation . we are interested in further investigation of whether adoptive transfer of tregs or inactivation of tregs could modulate smoke - induced inflammation and examining whether neutralization of il-35 could change the effect of treatment with erythromycin on smoke - induced lung damage in rats . while there is clear evidence that treatment with macrolide antibiotics inhibits effector t - cell proliferation and cytokine production there currently is little information on how macrolide antibiotics modulate t - cell immunity . indeed , the components of gut microbiota are crucial for the development of tregs in rodents . furthermore , a previous study has shown that roxithromycin inhibits chemokine - induced chemotaxis of th1 and th2 cells but does not affect regulatory t - cell migration . erythromycin may act , like roxithromycin , and inhibit the migration of effector t cells , but not tregs , leading to relative increase in the numbers of tregs in the lungs of rats . in addition , erythromycin has been shown to downregulate dendritic cell function and cytokine production , particularly for lps - stimulated dendritic cell maturation and activation . it is possible that erythromycin may modulate dendritic cell function toward to promoting treg development . given that il-35 has been shown to promote treg proliferation the increased levels of il-35 may feedback enhance treg responses in the lungs of rats . we are interested in further investigating the mechanisms underlying the role of erythromycin in regulating treg responses . in summary , treatment of copd currently remains a significant challenge , and pharmacological understanding of drugs for the treatment of copd is crucial for the control of disease progression . our data indicated that treatment with erythromycin significantly reduced smoking - related lung inflammation and damages and modulated treg and il-35 responses in the lungs of rats . therefore , our findings may provide new insights into understanding the pharmacological action of erythromycin in the management of copd in the clinic .

heavy smoking can induce airway inflammation and emphysema . macrolides can modulate inflammation and effector t - cell response in the lungs . however , there is no information on whether erythromycin can modulate regulatory t - cell ( treg ) response . this study is aimed at examining the impact of erythromycin on treg response in the lungs in a rat model of smoking - induced emphysema . male wistar rats were exposed to normal air or cigarette smoking daily for 12 weeks and treated by gavage with 100 mg / kg of erythromycin or saline daily beginning at the forth week for nine weeks . the lung inflammation and the numbers of inflammatory infiltrates in bronchoalveolar lavage fluid ( balf ) were characterized . the frequency , the number of tregs , and the levels of foxp3 expression in the lungs and il-8 , il-35 , and tnf- in balf were determined by flow cytometry , rt - pcr and elisa , respectively . treatment with erythromycin reduced smoking - induced inflammatory infiltrates , the levels of il-8 and tnf- in the balf and lung damages but increased the numbers of cd4+foxp3 + tregs and the levels of foxp3 transcription in the lungs , accompanied by increased levels of il-35 in the balf of rats . our novel data indicated that erythromycin enhanced treg responses , associated with the inhibition of smoking - induced inflammation in the lungs of rats .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

the eurodiab prospective complications study ( 19971999 ) is a follow - up of the eurodiab type 1 diabetes complications study ( 19891991 ) , which was designed to explore risk factors for diabetes complications in 3,250 randomly selected people with type 1 diabetes , aged 1560 years , attending 31 diabetes centers in 16 european countries ( 10,11 ) . a cross - sectional , nested , case - control study was designed at the 19971999 follow - up examination ( 1215 ) . case subjects were selected based on the greatest complication burden possible in order to provide sufficient numbers for subgroup analyses . thus , case subjects were defined as those with cardiovascular disease , proliferative retinopathy , or micro- or macroalbuminuria at follow - up . this design allowed the comparison of individuals with single or multiple complications with individuals free of complications , according to the study question , as efficiently as possible . applying these criteria , this yielded 363 case and 168 control subjects with full data on complications and samples available for analysis . the sample size provides a power of 95 and 80% ( = 0.05 ) , respectively , to detect a difference in log - hsp27 of at least one - third of an sd between all case and control subjects and between case subjects with single complications and control subjects with no complications . patient evaluation for the presence of cardiovascular risk factors ( hypertension , bmi , waist - to - hip ratio , smoking , cholesterol , triglycerides , and a1c ) is described elsewhere ( 1215 ) . albumin excretion rate ( aer ) , assessed on two 24-h urine collections by the immunoturbidimetric method , was categorized as normoalbuminuria ( < 20 g / min ) , microalbuminuria ( 20200 g / min ) , and macroalbuminuria ( 200 g / min ) . cardiovascular disease ( cvd ) was defined as physician - diagnosed myocardial infarction , angina , coronary artery bypass graft , or stroke and/or ischemic changes on a centrally minnesota - coded electrocardiogram . distal symmetrical polyneuropathy ( dsp ) was diagnosed on the basis of 1 ) the presence of one or more neuropathic symptoms , 2 ) the absence of two or more ankle or knee reflexes , and 3 ) abnormal vibration perception threshold , measured by centrally calibrated biothesiometers ( biomedical , newbury , oh ) on the right big toe and on the right medial malleolus . soluble vascular cell adhesion molecule ( svcam)-1 , soluble e - selectin ( se - selectin ) , interleukin ( il)-6 , and tumor necrosis factor ( tnf)- were measured by commercially available enzyme - linked immunosorbent assay ( elisa ) ( r&d systems , oxon , u.k . ) , and plasma levels of c - reactive protein ( crp ) and amadori albumin were measure by in - house elisa ( 12,13 ) . plasma homocysteine was determined with an automated fluorescence polarization immunoassay on an abbott imx analyzer ( abbott laboratories , abbott park , il ) ( 18 ) . briefly , 96-well plates were precoated with a mouse anti - human hsp27 , used as capture antibody . then , both hsp27 standards and samples , together with a rabbit polyclonal detection antibody specific for human hsp27 , were simultaneously incubated in the precoated wells . after washing , a goat anti - rabbit igg conjugated to horseradish peroxidase was added . the absorbance was read at 450 nm , and hsp27 levels were determined by comparing the absorbance of samples with the values obtained from the standard curve . the range of the assay was 201,000 pg / ml and intra- and interassay cvs were 4.4 and 8.59% , respectively , for both low ( 132 pg / ml ) and high ( 993 pg / ml ) range hsp27 levels . variables distributed normally are presented as means sd , whereas variables with skewed distribution were analyzed after logarithmic transformation ( triglycerides , aer , creatinine , crp , il-6 , tnf- , svcam , se - selectin , homocysteine , hsp27 ) and are presented as geometric means ( interquartile range ) . logistic regression analyses were used to estimate the ors of hsp27 for any complication ( aer 20 g / min , retinopathy , neuropathy , cvd ) , independently of confounders and known risk factors . the likelihood ratio test was used to compare nested models examining the role of age , sex , diabetes duration , bmi , waist - to - hip ratio , a1c , blood pressure , lipids , aer , crp , il-6 , tnf- , homocysteine , amadori albumin , se - selectin , svcam , and smoking . variables were retained in the final model if they added significantly to the likelihood of models or to the estimated coefficients of predictors . in light of the hypothesis of a different role of hsp27 in the pathogenesis of different complications , logistic regression models were also fitted separately for each complication . to assess patterns of ors across increasing hsp27 values , ors were categorized by the quartile distribution in control subjects . we tested for linear trends across quartiles by entering a single ordinal term into the models . when ors in the lower quartiles of hsp27 were similar , they were aggregated as the reference category in the final analysis and compared with the upper quartile . variables distributed normally are presented as means sd , whereas variables with skewed distribution were analyzed after logarithmic transformation ( triglycerides , aer , creatinine , crp , il-6 , tnf- , svcam , se - selectin , homocysteine , hsp27 ) and are presented as geometric means ( interquartile range ) . logistic regression analyses were used to estimate the ors of hsp27 for any complication ( aer 20 g / min , retinopathy , neuropathy , cvd ) , independently of confounders and known risk factors . both backward and forward strategies examining all explanatory variables were used to select models . the likelihood ratio test was used to compare nested models examining the role of age , sex , diabetes duration , bmi , waist - to - hip ratio , a1c , blood pressure , lipids , aer , crp , il-6 , tnf- , homocysteine , amadori albumin , se - selectin , svcam , and smoking . variables were retained in the final model if they added significantly to the likelihood of models or to the estimated coefficients of predictors . in light of the hypothesis of a different role of hsp27 in the pathogenesis of different complications , logistic regression models were also fitted separately for each complication . to assess patterns of ors across increasing hsp27 values , ors were categorized by the quartile distribution in control subjects . we tested for linear trends across quartiles by entering a single ordinal term into the models . when ors in the lower quartiles of hsp27 were similar , they were aggregated as the reference category in the final analysis and compared with the upper quartile . the study population ( n = 531 ) had a mean age of 39.6 years , a mean diabetes duration of 21.5 years , and an equal proportion of men and women . case subjects with vascular complications had a more adverse risk factor profile than control subjects ( table 1 ) . of the 363 case subjects , nephropathy was present in 206 ( 22.6% micro- and 34.3% macroalbuminuria ) , retinopathy in 292 ( background 39.1% and proliferative 41.3% ) , dsp in 205 ( 56.5% ) , and autonomic neuropathy in 118 ( 27.6% ) . most people , however , had more than one complication ; indeed , 187 ( 51.5% ) individuals had both aer 20 g / min and retinopathy , 128 ( 35.3% ) had both aer 20 g / min and dsp , and 123 ( 33.9% ) had aer 20 g / min , dsp , and retinopathy . cvd was present in 146 subjects ( 40.2% ) , all of whom also had at least one microvascular complication , apart from 12 individuals who had cvd only . hsp27 was measurable in all 531 samples , with a right - skewed distribution of values ( table 1 ) . shsp27 levels were not significantly different in case and control subjects , even after adjustment for age ( 670.9 vs. 548.8 pg / ml , p = 0.08 ) . with respect to control subjects , however , we found significantly greater age - adjusted hsp27 levels in case subjects with dsp ( p = 0.002 ) and in case subjects with micro-/macroalbuminuria ( p = 0.03 ) . although shsp27 levels were also slightly higher in case subjects with retinopathy ( p = 0.06 ) , this was mainly due to the confounding association with aer , as values became similar after further adjustment for aer ( p = 0.57 ) . on the contrary , the difference between case subjects with dsp and control subjects was significant , even after further adjustment for aer ( 785.9 vs. 574.7 pg / ml , p = 0.03 ) . we then performed logistic regression analyses to assess whether higher values of hsp27 conferred an increased or of having any complication , independently of main risk factors . models performed in all subjects and separately for each complication showed a tendency toward a negative confounding effect of both age and diabetes duration ( increasing ors from model 1 to model 2 ) and a positive confounding effect of a1c , hypertension , smoking , and tnf- ( decreasing ors from model 2 to model 3 ) . in the fully adjusted model , a significant linear trend of ors across quartiles of hsp27 was evident for dsp ( p = 0.03 ) , whereas a significant linear trend for micro-/macroalbuminuria and retinopathy was present exclusively in the age- and duration - adjusted model ( model 2 ) ( table 2 ) . hsp27 values in the upper quartile ( > 1,135 pg / ml ) conferred a 38% increased or ( 95% ci 0.772.49 ) of any complications compared with hsp27 values in the lower quartiles ( 1,135 pg / ml ) . final models , performed separately for each complication , showed that higher hsp27 values were associated with a more than twofold increased or of dsp , which was statistically significant ( or 2.45 [ 95% ci 1.205.03 ] ) , even after further adjustment for aer values ( 2.41 [ 1.115.24 ] ) . ors for other complications were increased in the upper versus lowers quartiles , but they did not reach statistical significance ( table 2 ) . study center did not contribute significantly to the final model and did not modify estimated ors . in this cross - sectional sample of type 1 diabetic patients from the eurodiab prospective complications study , we have provided the first evidence of an independent association between shsp27 levels and dsp . mean shsp27 levels were significantly higher in case subjects with dsp than in control subjects , even after adjustment for age and aer . furthermore , in logistic regression analysis , higher circulating hsp27 levels conferred a twofold increased or of dsp , independently of conventional risk factors , markers of inflammation , and aer . the lack of circulating markers for dsp represents an important limit of clinical research in this field ; therefore , our findings may be of potential clinical relevance . availability of a surrogate marker of dsp , which can be easily and noninvasively obtained , may facilitate diagnosis , measurement of progression , and assessment of therapeutic interventions . the rise in circulating hsp27 expression in patients with dsp may result from neuronal overexpression . consistent with this hypothesis , studies in experimental diabetes have shown hsp27 induction in the sensory neurons of the dorsal root ganglia ( 4,5 ) . intracellular hsp27 , a key survival factor for neurons , plays an important role in axonal regeneration ( 20 ) , and mutations of the hspb1 gene encoding for hsp27 cause inherited distal peripheral neuropathies , such as hereditary distal motor neuropathy and charcot - marie - tooth disease type 2 ( 21 ) . the mechanism of hsp27 neuroprotection is unclear , but preservation of the cytoskeletal stability and both chaperone - like and anti - apoptotic activities have been implicated ( 22 ) . in diabetic patients with dsp , overexpression of hsp27 may thus be aimed to counteract the neurological damage caused by the diabetic milieu . on the other hand , hsp27 release can also contribute to the neuronal damage , as anti - hsp27 autoantibodies , which are produced in response to extracellular hsp27 exposure , can induce neuronal apoptosis ( 23 ) . first , this is a cross - sectional study , hence restricting our ability to assess temporal relationships between shsp27 levels and microvascular complications and to identify causal biological mechanisms underlying this association . however , no data on hsp27 in large groups of type 1 diabetic patients exist ; therefore , this study may serve as a reasonable starting point to explore the role of this molecule in type 1 diabetes . second , the number of control subjects was lower than the overall number of case subjects , thus reducing the power of analyses ; comparisons between control subjects and case subjects with single complications allowed a more favorable case - to - control ratio , but multiple comparisons within the same case - control study base might have caused significant results due to chance . third , although serum samples were adequately stored , the possibility of protein degradation can not be excluded ; however , random misclassification would have biased our estimates downward , without affecting significant associations . unlike previous studies , a key strength here is the ability to account for confounding by other risk factors and complications , and the large sample size provides sufficient power for these analyses . in addition , our patients were from a representative sample of people with type 1 diabetes across europe , and our results are therefore likely to be generalizable . in conclusion , this is the first study measuring shsp27 in a large group of subjects , and the results provide evidence that shsp27 levels are independently associated with dsp in type 1 diabetic patients .

objective heat shock protein 27 ( hsp27 ) is a member of the small heat shock protein family of proteins . hsp27 expression is enhanced in target tissues of diabetic microvascular complications , and changes in circulating serum hsp27 levels ( shsp27 ) have been reported in patients with macrovascular disease . we investigated whether shsp27 levels were associated with micro- and macrovascular complications in type 1 diabetic patients.research design and methods a cross - sectional , nested , case - control study from the eurodiab prospective complications study of 531 type 1 diabetic patients was performed . case subjects ( n = 363 ) were defined as those with one or more complications of diabetes ; control subjects ( n = 168 ) were defined as those with no evidence of any complication . we measured shsp27 levels and investigated their associations with diabetes complications.resultsmean shsp27 levels were significantly higher in case subjects with distal symmetrical polyneuropathy ( dsp ) than in control subjects , even after adjustment for age and albumin excretion rate ( aer ) ( 785.9 vs. 574.7 pg / ml , p = 0.03 ) . in logistic regression analysis , shsp27 levels in the upper quartile were associated with a twofold increased odds ratio ( or ) of dsp , independently of conventional risk factors , markers of inflammation , and aer ( or 2.41 [ 95% ci 1.115.24]).conclusions in this large cohort of type 1 diabetic subjects , we found an independent association between shsp27 and dsp . this suggests that shsp27 levels may be a novel marker for diabetic neuropathy .

RESEARCH DESIGN AND METHODS Statistical analyses. RESULTS DISCUSSION

recent experimental and in silico studies have resulted in a much better understanding of the principles and mechanisms of prokaryotic signal transduction ( 16 ) . the list of recognized environmental sensors has been dramatically expanded and now includes , in addition to two - component histidine kinases and methyl - accepting chemotaxis proteins , ser / thr / tyr protein kinases and protein phosphatases , as well as adenylate and diguanylate cyclases and c - di - gmp phosphodiesterases ( 210 ) . these classes of proteins are also found as ( predicted ) cytoplasmic proteins , proposed to function as sensors of the intracellular biochemical parameters , such as ph , osmolarity or levels of oxygen , co , no and other molecules ( 2,10 ) . accordingly , many prokaryotic genomes contain multiple copies of the respective genes , whose exact functions ( i.e. the parameters sensed by their protein products ) are rarely known . detailed analyses of protein sets involved in signal transduction in such model organisms as escherichia coli , bacillus subtilis , pseudomonas aeruginosa , synechocystis sp . pcc7120 or halobacterium salinarum brought very interesting results and provided needed insight into the signal transduction mechanisms . in silico studies have contributed by highlighting such phenomena as the abundance of ( predicted ) diguanylate cyclases and c - di - gmp phosphodiesterases in many bacterial genomes , the importance of cross - talk between different signaling pathways and the existence of a complex system of intracellular signaling ( 2,3,10 ) . progress in understanding of prokaryotic signal transduction systems , as well as availability of a large number of newly sequenced genomes , prompted us to perform a major update of sentra ( ) , a database of signal transduction proteins developed by the bioinformatics group at argonne national laboratory ( 13,14 ) . the objective of further development of sentra was to provide users with an analytical environment containing expert - curated information describing prokaryotic signal transduction systems , as well as up - to - date knowledge base and interactive analytical tools for further analysis of signal transduction proteins in all completely sequenced genomes as they become publicly available . such an environment will add accuracy and sensitivity to the sequence analysis of signal transduction proteins and aid in the development of conjectures regarding the nature of the transmitted signal . the previous release of sentra featured signal transduction proteins encoded in 43 completely sequenced genomes ( 14 ) . although it contained all complete , public genomes at the time of publication , it was missing a number of valuable data and analytical capabilities . for example , it did not include diguanylate cyclases or c - di - gmp phosphodiesterases and did not support cross - genome comparative analysis of signal transduction systems ( 14 ) . further , since most components of the signal transduction machinery are multi - domain proteins , they are notoriously difficult to annotate through automated sequence comparisons and are commonly misannotated in genomic databases ( 10,15 ) . discovery of new domains often makes the existing annotations incomplete or even obsolete . to provide the solution to this problem , sentra was redesigned to perform periodic ( monthly ) automated updates that include automated pre - computed analysis of newly sequenced genomes and re - analysis of existing sentra genomes with an array of bioinformatics tools including interpro ( 16 ) , blocks ( 17 ) , blast ( 18 ) , tmhmm ( 19 ) and tools developed by our group ( e.g. dremmel , and chisel , ) . the results of these automated analyses are presented to the users in sentra 's interactive environment for further updates and annotation . the most significant changes in sentra database content , capabilities and user interface are as follows . sentra now consists of two principal components : ( i ) a manually curated list of signal transduction proteins that includes proteins derived from 202 completely sequenced prokaryotic genomes , and ( ii ) an automatically generated listing of predicted signaling proteins in 235 genomes that are awaiting manual curation . the expert - curated section of the database now lists , besides two - component histidine kinases and response regulators , ser / thr / tyr protein kinases and protein phosphatases , as well as adenylate and diguanylate cyclases and c - di - gmp phosphodiesterases , as defined in several recent reviews ( 2,10,12 ) . in the process of adaptation to environment , prokaryotic organisms have developed an ability to detect and process environmental signals that are vital for their survival . sentra provides a unique opportunity to explore and compare the signaling apparatus of prokaryotes according to their habitat ( e.g. aquatic , terrestrial ) , lifestyle ( e.g. pathogenic ) and major physiological features ( e.g. energy source , motility ) . users can also perform comparative analysis of signal transduction proteins characteristic of different taxonomic groups of organisms in the framework of the signaling pathways from the kegg database ( 20 ) . this capability allows identification of signaling pathways and mechanisms characteristic of particular taxonomic groups and habitats . sentra leverages the puma2 ( 21 ) system for high - throughput analysis of genomes being developed by the bioinformatics group at argonne . such a connection allows sentra to support comparative analysis of the prokaryotic signal transduction systems at multiple levels of organization : users may explore domain and feature composition of signal transduction proteins and perform interactive analysis of sequences by over 30 bioinformatics tools . all entries in sentra are annotated with the information from the puma2 knowledge base integrating information from over 20 sequence , structural , metabolic and taxonomic databases , as well as the derived results from various bioinformatics tools . sentra also contains information regarding participation of the signal transduction proteins in conserved chromosomal gene clusters ( 22 ) . one of the important new features of sentra is its support for the user annotation of the signal transduction proteins via the puma2 framework . registered users can interactively analyze the sequences , correct functional assignment and provide detailed comments . such capability will allow us to leverage an enormous expert knowledge accumulated in the scientific community for annotation of information in the sentra database . all computationally intensive operations in sentra are performed using the grid technology - based engine gadu ( 23 ) being developed by the bioinformatics group at argonne . as new completely sequenced microbial genomes become publicly available , they will be processed through the automated pipeline and included in quarterly updates of the database . these genomes will also be subject to manual curation of the overall protein lists and orthology groupings . we also intend to provide manually curated lists of proteins containing certain signal transduction domains , such as pas ( 24 ) and fha ( 25 ) . sentra now consists of two principal components : ( i ) a manually curated list of signal transduction proteins that includes proteins derived from 202 completely sequenced prokaryotic genomes , and ( ii ) an automatically generated listing of predicted signaling proteins in 235 genomes that are awaiting manual curation . the expert - curated section of the database now lists , besides two - component histidine kinases and response regulators , ser / thr / tyr protein kinases and protein phosphatases , as well as adenylate and diguanylate cyclases and c - di - gmp phosphodiesterases , as defined in several recent reviews ( 2,10,12 ) . in the process of adaptation to environment , prokaryotic organisms have developed an ability to detect and process environmental signals that are vital for their survival . sentra provides a unique opportunity to explore and compare the signaling apparatus of prokaryotes according to their habitat ( e.g. aquatic , terrestrial ) , lifestyle ( e.g. pathogenic ) and major physiological features ( e.g. energy source , motility ) . users can also perform comparative analysis of signal transduction proteins characteristic of different taxonomic groups of organisms in the framework of the signaling pathways from the kegg database ( 20 ) . this capability allows identification of signaling pathways and mechanisms characteristic of particular taxonomic groups and habitats . sentra leverages the puma2 ( 21 ) system for high - throughput analysis of genomes being developed by the bioinformatics group at argonne . such a connection allows sentra to support comparative analysis of the prokaryotic signal transduction systems at multiple levels of organization : users may explore domain and feature composition of signal transduction proteins and perform interactive analysis of sequences by over 30 bioinformatics tools . all entries in sentra are annotated with the information from the puma2 knowledge base integrating information from over 20 sequence , structural , metabolic and taxonomic databases , as well as the derived results from various bioinformatics tools . sentra also contains information regarding participation of the signal transduction proteins in conserved chromosomal gene clusters ( 22 ) . one of the important new features of sentra is its support for the user annotation of the signal transduction proteins via the puma2 framework . registered users can interactively analyze the sequences , correct functional assignment and provide detailed comments . such capability will allow us to leverage an enormous expert knowledge accumulated in the scientific community for annotation of information in the sentra database . all computationally intensive operations in sentra are performed using the grid technology - based engine gadu ( 23 ) being developed by the bioinformatics group at argonne . as new completely sequenced microbial genomes become publicly available , they will be processed through the automated pipeline and included in quarterly updates of the database . these genomes will also be subject to manual curation of the overall protein lists and orthology groupings . we also intend to provide manually curated lists of proteins containing certain signal transduction domains , such as pas ( 24 ) and fha ( 25 ) .

sentra ( ) , a database of signal transduction proteins encoded in completely sequenced prokaryotic genomes , has been updated to reflect recent advances in understanding signal transduction events on a whole - genome scale . sentra consists of two principal components , a manually curated list of signal transduction proteins in 202 completely sequenced prokaryotic genomes and an automatically generated listing of predicted signaling proteins in 235 sequenced genomes that are awaiting manual curation . in addition to two - component histidine kinases and response regulators , the database now lists manually curated ser / thr / tyr protein kinases and protein phosphatases , as well as adenylate and diguanylate cyclases and c - di - gmp phosphodiesterases , as defined in several recent reviews . all entries in sentra are extensively annotated with relevant information from public databases ( e.g. uniprot , kegg , pdb and ncbi ) . sentra 's infrastructure was redesigned to support interactive cross - genome comparisons of signal transduction capabilities of prokaryotic organisms from a taxonomic and phenotypic perspective and in the framework of signal transduction pathways from kegg . sentra leverages the puma2 system to support interactive analysis and annotation of signal transduction proteins by the users .

INTRODUCTION Update of the Sentra database content Support for comparative and evolutionary analysis of signal transduction proteins and signaling pathways Support for user annotation of signal transduction proteins Future prospects

a central question in neuroscience is the mechanism by which memories can be preserved for years . long - term memories are at least in part encoded as specific patterns , or engrams , of strengthened synapses [ 1 , 2 ] , and long - term synaptic potentiation ( ltp ) persists for months in vivo . how can specific groups of synapses remain strong for months or years despite turnover of macromolecules and fluctuations in the size and shape of synaptic structures ? numerous mathematical models have been developed that describe maintenance of long - term memory ( ltm ) as dependent on bistability of synaptic weights , mediated by positive feedback loops of biochemical reactions , typically thought of as operative in dendritic spines . proposed feedback mechanisms have relied on self - sustaining autophosphorylation of cam kinase ii [ 4 , 5 ] , persistent phosphorylation of ampa receptors by protein kinase a , enhanced translation of protein kinase m , or self - sustaining clustering of a translation activator , cytoplasmic polyadenylation element binding protein . with these models , ltp switches a synapse from a state of low basal weight to a high weight state and turns on the positive feedback loop . the loop then operates autonomously to keep the synapse in the high weight state indefinitely . however , despite extensive investigation , empirical evidence of a bistable distribution of two distinct synaptic weight states has not , in fact , been obtained . although some studies [ 9 , 10 ] have suggested two distinct strength states for synapses , as measured by the amplitude of excitatory postsynaptic currents before and after a stimulus protocol , these studies have only examined the early phase of ltp ( < 1 h ) , which does not depend on protein synthesis or other processes necessary for long - term memory storage . therefore , those data do not address the dynamics of long - term memory storage . in addition , a demonstration of synaptic bistability would require not only finding two distinct synaptic strength states but also finding that a set of different protocols for ltp induction ( e.g. , different patterns of stimuli , or localized application of pharmacological agents ) commonly switched synaptic weights between the same two stable states . in addition , modeling suggests that stochastic fluctuations of macromolecule numbers within a small volume such as a spine head are likely to destabilize steady states of biochemical positive feedback loops , causing randomly timed state switches (; see for an opposing view ) . finally , in hippocampal neuron cultures , continuous and extensive fluctuations of postsynaptic density ( psd ) morphology are observed and are driven in part by synaptic activity . such dynamics would seem difficult to reconcile with only two , or a few , stable weight states . empirical distributions of the weights of excitatory synapses onto cortical or hippocampal pyramidal neurons appear unimodal ( a single peak ) rather than bimodal and are commonly heavy - tailed ( skewed towards high weights ) [ 1318 ] . some histograms are based on relatively small numbers of measurements , so that some bimodality might be present but hidden in variability among bins . however , the weight distribution of song et al . is based on measurements of several hundred excitatory postsynaptic potential ( epsp ) amplitudes and appears to particularly disfavor the bimodal hypothesis . a large number of measurements are fit well by a log - normal distribution ( i.e. , a normal distribution with the logarithm of the volume on the x - axis ) . in addition , a histogram of the volume of dendritic spines , based on a large number of individual measurements ( ~10,000 ) in mouse auditory cortex , is clearly unimodal , heavy - tailed , and approximately log - normal . spine volume is approximately proportional to the postsynaptic density size [ 2022 ] and to the number of postsynaptic ampa receptors as well as to the amplitude of the epsc measured following localized glutamate uncaging . thus it is plausible , and we assume that increases / decreases in spine volume can serve as a proxy for ltp / ltd . if synaptic weights and correlated spine volumes are not in fact bistable , how can patterns of strong synapses be maintained for very long times ? two observations support a mechanism based on metastability of small clusters of large dendritic spines , corresponding to groups of strong synaptic contacts . the first observation is that although spine volumes fluctuate , some large spines are extremely stable , existing for months ( in sensory cortex or in motor cortex ) . the second is that induction of late , protein synthesis - dependent ltp ( l - ltp ) at a spine facilitates l - ltp expression at nearby spines , on the same dendritic branch , that coincidentally receive stimuli too weak to support l - ltp if given alone . this observation supports the clustered plasticity hypothesis in which clusters of spines on a single dendritic branch , rather than single spines , may serve as primary functional units for storage of ltm . for example ( 1 ) in motor cortex , learning induces coordinated formation of small spine clusters on a given dendritic branch ( 2 ) morphologically , spines are grouped into small clusters on pyramidal dendrites and ( 3 ) in rat hippocampal slice cultures , spontaneous coactivation of dendritic spines is frequent and is clustered , occurring more often for spines within 8 m of each other . here an initial , relatively phenomenological model is developed describing synaptic weight changes due to competing processes of ltp ( corresponding to spine growth ) and long - term synaptic depression ( ltd ) ( corresponding to spine shrinkage ) . assuming volume changes are a proxy for weight changes , weight changes are simulated for discrete intervals of 1 day , over times of months or years . the discrete intervals were chosen to simulate the dynamics observed in experiments where volumes are imaged at intervals of ~1 day [ 19 , 32 ] . in the model each day the magnitude of ltp is governed by a gaussian random variable , as is that of ltd ( methods ) . these magnitudes are also approximately proportional to the preexisting weight . as suggested by recent data ( [ 24 , 25 , 32 ] but see ) , a volatility factor was introduced so that the weights of larger synapses fluctuate less . this factor proved necessary for large synapses to remain stable for months ( see discussion ) . model parameter sensitivity was lessened when synapses were modeled as coupled into small clusters ( ~10 spines , modeled as on the same dendritic branch and able to interact ) . in accordance with data [ 32 , 33 ] , the model also incorporates disappearance or silencing of small synapses and compensatory regeneration of new synapses . when the dynamics of 1,000 small clusters were simulated , the weight distribution of the entire ensemble of individual synapses converged to a steady - state , log - normal form . individual clusters remained stable for many years , with the average number of active synapses maintained in a range consistent with empirical data . the magnitude of daily changes in synaptic weight approximated a normal distribution except for an extra peak at w = 0 , which constitutes a model prediction . if a subset of synapses was reinitialized to have large weights , this subset maintained large average weights for ~2 yrs , corresponding to persistence of a pattern of strong synapses that might serve as the engram for a memory . some memories however persist for even longer times . in support of the clustered plasticity hypothesis , our simulations suggest that such memories might be encoded as a pattern of specific , stable clusters of active synapses . in simulations , each cluster consists of ncl synapses , corresponding to ncl individual spines . at a given time , most of these synapses are active , with synaptic weight w ranging from ~0.2 to 10 . the remaining synapses are silent , with a very low , basal weight of 0.05 . weight evolution is simulated using discrete , large time steps t , considered to correspond to 24 h. at each time step , all weights are synchronously updated . the size and direction of a weight update at a given synapse are assumed uncorrelated with that at a neighboring synapse and with the preceding update at the given synapse . , two independent processes change synaptic weights during each time step . an ltp process increases w and an ltd process decreases w. strong synapses consume more resources for maintenance , corresponding to locally available mrnas / proteins . the model thus assumes that the more strong synapses present in a cluster , the fewer resources are available to support synaptic growth ( ltp ) . thus , the model assumes that the amplitude of ltp is also proportional to a volatility factor that decreases as w increases ( 1)-(2 ) as is that of ltd ( 3 ) . ltp and ltd add to give the net change in w per time step ( 4 ) . for each time step , the ltp and ltd amplitudes are proportional , respectively , to gaussian random variables r1 and r2 . these variables have respective means a1 and a2 , and sd1 and sd2 are the standard deviations . a1 and a2 are substantially larger , by a fixed factor of 4 , than are sd1 and sd2 . thus r1 and r2 are very rarely negative , but if either becomes negative it is reset to zero . the average ltp amplitude a1 is a decreasing function of the number of strong synapses in a given cluster , denoted as nst . with ncl the total number of synapses in a cluster , the average ltp amplitude a1 decreases linearly with nst , from a maximum amplitude x2 ( for nst = 0 ) to a minimum x1 ( for nst = ncl ) . for the simulation of figure 2(b ) with this amplitude decrease removed , a1 and thus sd1 are fixed parameters . for comparison , simulations were also carried out in which r1 and r2 were drawn from exponential distributions . with exponential distributions r1 and r2 are always nonnegative , with probability densities that peak at 0 and decay exponentially for increasing positive values . ltp and ltd are also proportional to a volatility factor vow , decreasing with w:(1)vow = vhivhivloww+wmed.from ( 1 ) , vow decreases from the parameter vhi ( for w = 0 ) to vlo ( for w wmed ) . when w = wmed , vow is midway between vhi and vlo . ltp and ltd amplitudes are also multiplied by the preexisting value of w. to keep w bounded the ltp amplitude is also multiplied by a decreasing function of w that has two parameters , khi and whi . combining factors ltd amplitude is(3)altd = wr2vow.at each time step , for each active synapse,(4)wnew = wold+altpaltd.if w falls below a threshold twk , the synapse is reset to be silent . for each silent synapse at each time step , the probability for regeneration pact increases with the number of strong synapses in its cluster , to a maximal value pbas:(5)pact = pbasnstncl.in addition , regeneration only occurs if an adjacent synapse is strong . in a cluster , synapse 1 can only switch to active if synapse 2 is strong , and synapse 5 can only switch if synapse 4 and/or 6 is strong . a switch resets w to wreset , above twk . for all simulations , to ensure initial weight , distributions were at steady state and distributions and other quantities were computed only after 50,000 simulated days . it is necessary that simulated time steps plausibly correspond to the common empirical interval of 1 day between spine imaging sessions . therefore , it was necessary to scale ltp and ltd amplitudes so that for a time step the simulated per cent change in w , averaged over all synapses , agreed with an average daily empirical change in w. empirically yasumatsu et al . presented a piecewise - linear relationship between spine volume v and its change v ( figure 7(b ) of ) under control conditions ( normal synaptic activity ) . this model , which they denote c-1 , was also able to predict an empirical steady - state spine volume distribution ( figure 8(e ) of ) . is(6)v=0.16v+0.01 for v0.25 m3 ( most spines),v=0.12v0.06 for 0.25 m3<v0.5 m3,v=0 for v>0.5 m3.from this relationship , combined with the plotted volumes in figures 1(b ) and 1(c ) of , it can be inferred that the average percent daily change in v lies within the range of ~1420% . one can not infer a more precise value from these data . for comparison , in the model 's steady - state weight distribution of figure 2(a ) , the percent change in w during a time step , averaged over all 10,000 synapses , is 16.5% . assuming v is a proxy for w , this qualitative agreement between simulated and empirical average weight changes suggests that the fixed time step in figures 25 , which is otherwise arbitrary , can be taken to correspond to approximately 1 day of weight dynamics . let xi denote the total set of n synaptic weights at a reference time , with i the indexing variable from 1 to n. for 1,000 10-synapse clusters , n = 10 , 000 . as t increases from the reference time , yi will evolve and r will decline from 1 . let x- , y- denote the means of xi , yi . the standard equation was used:(7)r=i=1nxixyiyi=1nxix2i=1nyiy2.standard parameter values , used in all simulations unless stated otherwise , are as follows:(8)ncl=10 , wreset=0.4 , twk=0.08,tst=0.8 , vhi=4.0 , vlo=0.2,wmed=0.4 , x1=0.144 , x2=0.18,a2=0.16 , khi=0.05 , whi=20.0 , pbas=0.1.in supplementary material ( available online at http://dx.doi.org/10.1155/2015/185410 ) , a java program is given that executes simulations from figures 24 . figure 2(a ) illustrates the approximately log - normal distribution of synaptic weights obtained at steady state . here , 1,000 clusters of synapses were simulated , with ncl = 10 . the black trace is the resulting histogram of synaptic weight w ; the red trace is a log - normal distribution fitted to the histogram . the range of w spans approximately 5 natural log units ( i.e. , a multiplicative factor of ~150 ) . this range is similar to data describing the range of dendritic spine volumes [ 19 , 32 ] . in this steady state , the relative synaptic weight change per time step , averaged over all synapses , is 16.5% . this agreement is necessary for the model time step to represent the empirical interval of 1 day between imaging sessions . to prevent this distribution from being overly sensitive to the average daily ltp amplitude , the model assumes this amplitude decreases with the number of strong synapses in the cluster to which the synapse belongs . starting from figure 2(a ) , when the mean ltp amplitude was decreased by 5% , the mean of w decreased by only 16% . in contrast , figure 2(b ) illustrates that in a model variant with mean and standard deviation of the ltp amplitude fixed , the weight histogram was shifted to the right of the log - normal distribution from figure 2(a ) and has a shape clearly distorted from log - normal with a much steeper cutoff at high w. to attempt to improve the histogram , the mean ltp amplitude was decreased by 2% . this small change resulted in a large shift of the histogram to the left ( blue trace ) , and 56% of the synapses became silent ( not included in the histogram ) . a similar distribution , with extreme sensitivity to mean ltp amplitude , resulted from a model variant in which synaptic clustering was deleted by fixing the mean and standard deviation of the ltp amplitude and also fixing the synapse regeneration probability pact ( 5 ) . the distribution is strongly bimodal , with almost 50% of synapses silenced at the low basal weight , unable to regenerate , and the remainder in a narrow distribution centered at very high weights . one other model variant was also simulated , in which the gaussian random variables r1 and r2 that govern the amplitudes of individual ltp and ltd increments were replaced by random variables drawn from exponential distributions ( methods ) . however , these simulations failed to produce synaptic weight distributions that resembled experimental data . if the decay rate constants for the two exponential distributions differed by more than twofold , almost all synaptic weights either ran to infinity ( if the mean ltp amplitude was greater ) or converged to a low basal synaptic weight imposed as a floor in the model ( if the mean ltd amplitude was greater ) . if the rate constants were similar a positive synaptic weight distribution could be obtained , but the shape of this distribution was itself exponential . all following results are therefore based on the first model variant described above , that of figure 2(a ) , with synaptic regeneration and an ltp amplitude that decreases with the number of strong synapses in a cluster . equations and parameter values are in methods . typical time courses for clusters with regeneration are illustrated in figures 3(a ) and 3(b ) . strong synapses are much more stable on average , in agreement with data demonstrating that large dendritic spines are more persistent [ 32 , 34 , 35 ] . strong synapses often maintain high values of w for a year or more , whereas weak synapses show much larger relative ( percent ) fluctuations in w. weak synapses often drop to a very low basal weight . silent synapses can regenerate , evident as vertical jumps in time courses near the bottom of figures 3(a)-3(b ) ( e.g. , arrowheads below x - axes ) . figure 3(c ) illustrates a typical time course for the number of strong synapses nst in a cluster ( with weights greater than a threshold tst = 0.8 ) . clusters are very stable in that , for ncl = 10 synapses per cluster , nst almost always remains between 4 and 7 for years . simulations with ncl = 15 or 20 also had very stable clusters . however , for a smaller ncl = 5 , the model no longer simulated a log - normal synaptic weight distribution at steady state . recorded synaptic dynamics for many days in cortical neuron cultures . rather than spine volume , they examined variations in the size of psd-95:gfp puncta , that is , localized concentrations , with a size corresponding to spines , of the postsynaptic density protein psd-95 fused to a gfp fluorophore . their dynamics are qualitatively consistent with those illustrated in figures 2(a ) and 3 in that ( 1 ) new synapses were continually formed , ( 2 ) synapses whose size was reduced beneath some threshold , analogous to the model threshold twk , were eliminated , and ( 3 ) large synapses tended to shrink and small synapses to grow . in accordance with ( 3 ) , stability of a simulated steady state , unimodal distribution such as that of figure 2(a ) requires that individual synapses with weights above the peak of the distribution decrease their weight on average and vice versa for those with low weights . empirically matsuzaki et al . found that smaller spines are more likely to undergo stable enlargement in response to an ltp induction protocol . figure 4(a ) illustrates a simulated histogram of the amplitudes of the daily changes in synaptic weight , w , at steady state . the majority of the histogram is fitted well by a normal distribution with the clear exception of the narrow peak close to w = 0 . a scatter plot of w versus w revealed that over almost the entire range of w , the amplitude of w varied from near zero to a peak value of ~0.30.5 . the plot is qualitatively linear , which is not surprising because , in the model , the average daily ltd and ltp amplitudes contain terms proportional to w ( methods , ( 2 ) , ( 3 ) ) . however , the plot further illustrates that the average change in w varies much less than does w itself . as w increases from 0.05 to 2.0 , the absolute value of w increases only from ~0.05 to 0.12 . thus , the relative change in w ( i.e. , w / w ) decreases substantially as w increases . this prediction of the model appears in accordance with the data from yasumatsu et al . but not with the data of loewenstein et al . for which this relative change appears nearly constant ( see discussion ) . however , what if the weight distribution is altered by an imposed large perturbation that sets high weights for a specified subset of synapses ? such a perturbation might correspond to formation of a specific , long - term memory engram . will the subset of strong synaptic weights remain elevated for months , corresponding to long - lasting storage of a memory ? starting from the distribution of figure 2(a ) , for all of the 1000 10-synapse clusters , synapses 15 were reset to a high weight of 5.0 at t = 200 days . this weight is well above the steady - state mean w. the other 5 synapses were reset to a low weight ( 0.5 ) . after the reset , the weights fluctuate but 400 days later , all but one of the strong synapses have maintained w above the steady - state average . figure 5(b ) illustrates the time course of resetting and decay for all 5,000 synapses that were reset to w = 5.0 . their average weight decays slowly such that 700 days after reset this average is still about twice the steady - state average of w. the lower red trace , one standard deviation below the average weight , is also still above the steady - state average . if the steady - state distribution of w is evolved without any perturbation , the time scale for decorrelation of synaptic weights from their specific values at a given time is , perhaps surprisingly , quite long , similar to the time scale for the decay of perturbed synaptic weights . starting from the distribution of figure 2(a ) , the pearson correlation coefficient between the weights of the 10,000 synapses decays with a time constant of approximately 500 days ( figure 5(c ) ) , similar to the dynamics of figure 5(b ) . with simulations of isolated , uncoupled synapses ( figure 2(b ) ) , weight distributions were extremely sensitive to model parameters . this model variant was therefore not a plausible description of synaptic dynamics , because biophysical parameters are expected to vary somewhat between spines , dendritic branches , and individual neurons . this sensitivity was eliminated when synapses were modeled as coupled into clusters ( ~10 synapses ) . in the model have reported similar spine clusters on primate cortical pyramidal neurons . on a scale of ~410 m along dendritic branches , numerous clusters of 515 spines were identified algorithmically . this distance scale and cluster number appears to correspond to the observations of takahashi et al . that spontaneous coactivation of dendritic spines is clustered , occurring more often for spines within 8 m of each other . we do note recent analysis by a different group failed to support clustering of this type and scale . with coupling into clusters of ~10 synapses , when the dynamics of 1,000 clusters were simulated , the weight distribution of individual synapses converged to a stable steady - state , log - normal form ( figure 2(a ) ) . data illustrates that spines compete for ltp expression ; that is , local resources ( possibly amounts of key proteins ) are limited such that the amount of ltp at a given spine decreases if ltp is simultaneously induced at multiple spines close together on the same dendritic branch . our mechanism of coupling synapses into clusters is similar in that it corresponds to an additional form of resource competition . however , in the model , competition is generated by ongoing maintenance of multiple synapses rather than only by simultaneous ltp of multiple synapses . thus , the mean magnitude of ltp at a given synapse during a simulated day was assumed to be a decreasing function of the number of other large synapses in the same cluster ( methods ) . ongoing maintenance of large spines is assumed to consume resources ( proteins , rna ) that would otherwise be available for strengthening of neighboring spines , so that their mean ltp magnitude decreased . the competition described by govindarajan et al . occurs over a distance scale of 1020 m , comparable to , although slightly larger than , the scale of 510 m posited by yadav et al . for clusters of ~510 spines . however , they did determine this rate for another measure of synaptic cross talk , the ability of a weakly stimulated spine to capture plasticity - related factors synthesized in response to strong stimulation of a nearby spine ( synaptic tagging and capture , resulting in ltp at the weakly stimulated spine ) . these data suggest that , for clusters of ~10 spines as simulated here , distance between spines might not limit the efficacy of resource competition . however , these data do not address whether competition could occur over a longer distance scale , for example , 50 m . to assess this question groups of spines spaced along a dendritic branch would need to be concurrently stimulated , and ltp quantified . to simulate a distribution spanning a broad range of synaptic weights , as is observed empirically , it was critical to model synaptic regeneration . to obtain distributions similar to that of figure 2(a ) , synapses that fell to a low basal weight needed to have , on successive days , a probability of weight reset to a higher , active value . this method of simulating regeneration was chosen to maintain equal average numbers of synaptic loss and regeneration events within any given cluster . empirically , the number of active spines in a cluster is relatively low ( ~37 ) . thus for clusters with low numbers of active spines to serve as functional memory storage units , as suggested by the clustered plasticity hypothesis , the average cluster size would need to be stable to avoid disappearance of clusters . an important question in neuroscience is how the observed regeneration of spines avoids disrupting stored memories or forming spurious memories . it is plausible that new , or regenerated , spines are generically not strong ( as in our model ) and therefore can not participate in memory storage unless they are potentiated by stimuli that induce long - term memory . however , further empirical investigation of this question , in conjunction with modeling , is needed . the model of loewenstein et al . simulates daily changes in the volume of dendritic spines and obtains a steady - state log - normal distribution of spine volumes very similar to the empirical distribution found by these authors . these important results have clarified the necessity of reconciling unimodal weight distributions with stable storage of long - term memory . their model consists of an ornstein - uhlenbeck stochastic process in which the logarithm of the volume of any given spine is directly incremented each day . the model presented here may constitute a further advance , in that it represents more biophysical elements , such as synapse loss / regeneration and synapse clustering . the ltp and ltd processes in the model ( 1 ) act directly on the synaptic weight rather than on its logarithm and ( 2 ) can be thought of as due to a large number of individual biochemical events occurring during a simulated day and corresponding to insertion and removal of individual molecular complexes or slots . point ( 2 ) connects the current model with the more detailed molecular model of lisman and raghavachari , in which ltp and ltd correspond , respectively , to insertion and removal of slot complexes , each consisting of a small number of ampa receptors together with associated scaffolding proteins and , possibly , kinases or other signaling proteins . additional elements of our model that may be consistent with that of lisman and raghavachari are as follows . if over a day , the time intervals between individual insertions of slot complexes as well as the intervals between removals of complexes follow poisson distributions , and if there are on average more than ~20 insertions and removals / day , then by the central limit theorem the sums of these poisson processes will approximate gaussian random variables . these gaussian variables would correspond to the model 's gaussian random variables r1 and r2 , to which the daily ltp and ltd amplitudes are proportional ( 2 ) , ( 3 ) . similarly , if the individual time intervals were gaussian random variables , their sum would be gaussian . it also appears plausible that average numbers of slot insertions and removals are proportional to the preexisting size of a spine , corresponding to the model assumption that mean ltp and ltd amplitudes are approximately proportional to synaptic weight . recent data are consistent with these ideas and also suggest such slot complexes include presynaptic components and release sites . current data has not directly examined whether there is spatial clustering of presynaptic boutons at the distance scale of ~5 m that corresponds to putative postsynaptic spine clusters . however , at this distance scale , such clusters would correspond to a single axon and spines in a cluster would thus be coactivated by a common input , consistent with the hypothesis that such clusters constitute functional units in the formation and storage of specific memories . in the model , the average relative ( percent ) change in w over a day decreases substantially as w increases ( figure 4(b ) ) . this result is essential for the model to represent stable long - term memory storage , because selective stability of strong synapses is only found if the relative change in w decreases in this manner . are these dynamics supported by current data ? relevant data describes the relationship of spine volume changes v to v. these data are , however , contradictory . illustrate a substantially larger relative variation in v ( figure 4(c ) of ) , such that v and v appear approximately proportional . however , yasumatsu et al . show a different relationship , for which smaller spines have an average v similar to large spines ( figure 1(c ) of ) . it is plausible that the difference in synaptic dynamics in these studies was generated , at least in part , by substantial differences in experimental conditions . imaged ca1 pyramidal neurons in cultured rat hippocampal slices at postnatal days 1723 , whereas loewenstein et al . did craniotomies to allow in vivo imaging of dendrites in auditory cortex of mice approximately 6 months old . in addition , filopodia ( protrusions without spine heads or with very small heads ) were eliminated from the former study , but not the latter . clearly further empirical investigation is needed to clarify these critical aspects of synaptic dynamics . at steady state the magnitudes of the daily changes in weight were distributed approximately normally except for an extra peak centered at w = 0 ( figure 4(a ) ) . however , data does indicate that a minor percentage of spines are stable for months or years [ 24 , 25 ] . these data suggest that a subpopulation of spines with very small daily weight changes might exist , but not yet be resolved due to empirical sensitivity limits . the current model does not represent the biochemical processes that might underlie long - term stability of such a subpopulation . however , recent studies support a relevant hypothesis that ongoing spontaneous neuronal activity is critical for long - term maintenance of synaptic strength . models have suggested that such activity can preferentially maintain synapses that are already strong possibly by preferentially reactivating stored patterns of strengthened synapses . empirically , a temporary induced knockdown of nmda receptor function can irreversibly eliminate remote memories , plausibly by preventing spontaneous activity from potentiating and thereby maintaining synapses . ongoing ltp increments that are necessary to maintain strong synapses , whether single or clustered ( as in the current model ) , may correspond to frequent spontaneous or environmentally induced activity , which may induce repeated cycles of nmda receptor - dependent ltp . simulations ( figures 5(a)-5(b ) ) illustrate that the model can store a specific memory trace , for ~1 yr , corresponding to persistence of a pattern of strong synapses . however , in humans , some memories persist for many years . in accordance with the hypothesis of govindarajan et al . , such memories might be encoded at the cluster level rather than the single - synapse level , as a set of specific , stable clusters of active synapses . in simulations , they maintained a range of strong synapse numbers ( ~47 ) similar to the range suggested by data demonstrating clustering on neocortical pyramidal dendrites . because each cluster was stable indefinitely , if a pattern of such clusters was established , that pattern would persist . in simulations , stable clusters were found when the total number of synapses in a cluster was 10 ( figure 3(c ) ) , or 1520 . however , for five synapses per cluster , anomalous dynamics resulted . a bimodal synaptic weight distribution , not resembling empirical data , we do not take this result to be a prediction of a minimum empirical cluster size . instead , we believe that the model should be improved in future work to avoid or reduce this dramatic change in dynamics . the model makes additional predictions . when comparing spines of similar sizes in different clusters , the average volume change between imaging sessions is predicted to be less positive ( or more negative ) if other spines in a cluster are large . in addition , because synaptic weights and spine volumes are not considered bistable , different induction protocols for late , protein - synthesis dependent ltp are predicted to induce clearly different amplitudes of synaptic weight increase or of average spine volume increase . without bistability , repeated applications of stimulus protocols should , at least in some cases , further enhance l - ltp .

memories are stored , at least partly , as patterns of strong synapses . given molecular turnover , how can synapses maintain strong for the years that memories can persist ? some models postulate that biochemical bistability maintains strong synapses . however , bistability should give a bimodal distribution of synaptic strength or weight , whereas current data show unimodal distributions for weights and for a correlated variable , dendritic spine volume . thus it is important for models to simulate both unimodal distributions and long - term memory persistence . here a model is developed that connects ongoing , competing processes of synaptic growth and weakening to stochastic processes of receptor insertion and removal in dendritic spines . the model simulates long - term ( > 1 yr ) persistence of groups of strong synapses . a unimodal weight distribution results . for stability of this distribution it proved essential to incorporate resource competition between synapses organized into small clusters . with competition , these clusters are stable for years . these simulations concur with recent data to support the clustered plasticity hypothesis which suggests clusters , rather than single synaptic contacts , may be a fundamental unit for storage of long - term memory . the model makes empirical predictions and may provide a framework to investigate mechanisms maintaining the balance between synaptic plasticity and stability of memory .

1. Introduction 2. Methods 3. Results 4. Discussion

spontaneous intracranial arterial dissection usually occurs in the posterior circulation and is relatively rare in the anterior circulation , particularly the anterior cerebral artery ( aca).4)7)8)17)20 ) it tends to develop in young healthy people , and is often associated with severe morbidity and mortality.13)17 ) it can also cause cerebral hemorrhage , ischemic stroke , or , rarely , combination of hemorrhage and ischemia.13)17 ) the exact incidence of aca dissection has not been reported . isolated aca territory infarction is very rare , representing 0.5 - 3% of all cases of ischemic stroke , and 47% of cases are angiographically proven dissection confined to the aca.8)10)14)15)18 ) the number of patients diagnosed with spontaneous aca dissection has recently shown a marked increase due to advancement of diagnostic devices , such as multi - channel 3-dimensional computed tomography angiography ( 3d - cta ) , high tesler magnetic resonance angiography ( mra ) , and high quality digital subtraction angiography ( dsa).7)13 ) in addition to the aid of advanced diagnostic tools , a high level of suspicion should be maintained in order to prevent misdiagnosis . due to the high instability of the dissected arterial walls , any aggressive manipulations or those made without preparation by careless decision herein , we report on two rare cases of subarachnoid hemorrhage ( sah ) caused by aca dissection ; a case presenting with simultaneous sah and infarction without aneurysmal formation and another case presenting with sah with fusiform aneurysmal formation . a 48-year - old female presented with a sudden bursting headache and right hemiparesis of grade i / v . initial brain computed tomography ( ct ) showed an obvious sah at the anterior interhemispheric fissure and left superior frontal sulcus ( fig . conventional cerebral angiography showed abrupt luminal tapering of the left distal aca with compromised distal flow ( fig . her brain magnetic resonance imaging ( mri ) showed an acute cerebral infarction in the left aca vascular territory ( fig . conservative treatment was administered since the area of infarction matched the presumed territory of the occluded aca without penumbra zone and further revascularization might not guarantee any benefit . three months later , she was able to walk unassisted with minor motor weakness of grade iv / v on her right leg . follow - up angiography after 33 months showed complete luminal healing without aneurysmal formation ( fig . 1e , f ) . a 56-year - old male presented with deep stuporous consciousness with a hunt and hess grade of iv . initial brain ct showed a thick sah at the basal cistern , sylvian fissures , and anterior interhemispheric fissure ( fig . conventional cerebral angiography showed an azygous aca , chronic total occlusion of the left proximal internal carotid artery ( ica ) , and a fusiform aneurysm on the right side wall of the a2 segment ( fig . the aneurysm measured 6.252.86 mm in size on the 3-dimensional rotational angiogram with a neck size of 6.25 mm and height of 2.02 mm . stent - assisted coil embolization of the azygous a2 dissecting aneurysm was performed under general anesthesia . 2c ) , however , follow - up angiography after two weeks showed complete obliteration of the aneurysm with preservation of the parent artery ( fig he showed improvement to drowsy mentality , but remained in a wheelchair - bound state . a 48-year - old female presented with a sudden bursting headache and right hemiparesis of grade i / v . initial brain computed tomography ( ct ) showed an obvious sah at the anterior interhemispheric fissure and left superior frontal sulcus ( fig . conventional cerebral angiography showed abrupt luminal tapering of the left distal aca with compromised distal flow ( fig . her brain magnetic resonance imaging ( mri ) showed an acute cerebral infarction in the left aca vascular territory ( fig . conservative treatment was administered since the area of infarction matched the presumed territory of the occluded aca without penumbra zone and further revascularization might not guarantee any benefit . three months later , she was able to walk unassisted with minor motor weakness of grade iv / v on her right leg . follow - up angiography after 33 months showed complete luminal healing without aneurysmal formation ( fig . a 56-year - old male presented with deep stuporous consciousness with a hunt and hess grade of iv . initial brain ct showed a thick sah at the basal cistern , sylvian fissures , and anterior interhemispheric fissure ( fig . conventional cerebral angiography showed an azygous aca , chronic total occlusion of the left proximal internal carotid artery ( ica ) , and a fusiform aneurysm on the right side wall of the a2 segment ( fig . the aneurysm measured 6.252.86 mm in size on the 3-dimensional rotational angiogram with a neck size of 6.25 mm and height of 2.02 mm . stent - assisted coil embolization of the azygous a2 dissecting aneurysm was performed under general anesthesia . 2c ) , however , follow - up angiography after two weeks showed complete obliteration of the aneurysm with preservation of the parent artery ( fig . 2d ) . he showed improvement to drowsy mentality , but remained in a wheelchair - bound state . intracranial arterial dissection is rare , and approximately 90% of arterial dissections occur in the posterior circulation.7)12)18)19)20 ) arterial dissections in the posterior circulation usually present with sah because of their elongated subarachnoid course.1)6 ) in contrast , those of the anterior circulations are generally involved in the supraclinoid segment of the ica and the middle cerebral artery and present with either hemorrhage or ischemia . aca involvement is possible when the ica dissection extends distally , however , those confined solely to the aca are extremely rare . several predisposing risk factors include preceding trauma and collagen disorders such as cystic necrosis of the media , fibromuscular dysplasia , moyamoya disease , marfan 's syndrome , ehler 's danlos syndrome type iv , and so forth . syphilitic angiopathy , guillain - barre syndrome , and common vascular risk factors such as atherosclerosis , hypertension , diabetes mellitus , and hyperlipidemia have also been implicated in the pathogenesis of arterial dissection.1)4)5)11 ) intracranial dissections can be categorized according to two types on the basis of the histological features ; subintimal and subadventitial dissection . subintimal dissection between the internal elastic lamina and media usually results in stenosis or occlusion with thrombosis of the true lumen of the parent artery , which causes ischemia.2)7)14)16)21 ) it generally shows good recovery from neurological symptoms . on the other hand , subadventitial dissection between the media and adventitia usually results in formation of aneurysmal dilatation and rupture of the dissected wall , which causes hemorrhage.1)7)14)18)21 ) the outcome is variable or worse than the ischemic presentation . in cases of simultaneous hemorrhage and ischemia , both mechanisms of subintimal and subadventitial dissection may be involved , indicating presentation of a more severe and deeper dissection plane , which may result in recurrent hemorrhage or ischemia.14 ) according to previous reports , ruptured aca dissection often led to nonperimesencephalic sah because distal aca is located away from the circle of willis at the basal cistern , and nonperimesencephalic sah usually showed a good outcome.3)18 ) therefore , we believe that sah from aca dissection often shows a relatively good outcome , if the hemorrhage is confined to the anterior interhemispheric fissure , when compared with sah from aneurysms at the circle of willis or dissecting aneurysms at the posterior circulation . reported incidence of arterial dissections with ischemic presentations is slightly higher than that of those with hemorrhagic presentations . approximately 60% of patients with arterial dissections presented with clinical manifestations of cerebral ischemia and 30% with hemorrhagic events.17 ) simultaneous hemorrhage and ischemia caused by aca dissection , as in our first case , appears to be even more rare.9)20 ) to the best of our knowledge , 10 cases have been reported so far , and our case of simultaneous hemorrhage and ischemia caused by aca dissection appears to be the eleventh report ( table 1).7)9)13)14)18)20 ) eight of these 11 cases demonstrated stenoses with aneurysmal dilatations which account for occurrences of simultaneous hemorrhage and ischemia . the three remaining cases , including our case , demonstrated only stenoses , however , the possibility that the dilated segment may be too small to recognize or that it may not be visualized from rapid formation of intramural hematoma remains . many clinicians have emphasized that it should be regarded as the differential diagnosis in case of acute stroke , especially when it occurs in younger adults , because aca dissection frequently occurs in the middle - aged group and the mean age of these patients is 49.2 10.4 years.13 ) typical radiological evidence of dissection includes pearl and string sign ( focal narrowing with distal dilatation ) , flame sign ( tapered occlusion ) , occlusion , and pseudoaneurysm.1)11)13)14)15 ) pathognomonic signs such as double lumen , or intimal flap are rarely observed.1)13)14 ) besides , dynamic changes on serial angiography are the most important features of dissection.1)13)14 ) in our report , conventional angiography of both patients showed double lumen sign or dynamic changes on serial angiography . the optimal treatment of aca dissection remains controversial due to rare prevalence of dissection confined to the aca , and is aimed at limiting neurological deficit by restoring blood flow and preventing occurrence of further ischemic or hemorrhagic events.7)13)14)18)19 ) patients presenting with ischemia are indicated for conservative treatment if there are no salvageable penumbra areas . another option is pushing the dissection flap outward in radial fashion using a stent if restoration of luminal patency is required.14 ) patients with hemorrhage usually require surgical management including either direct surgical management or endovascular intervention in order to prevent rebleeding . in our study , the patient ( case 2 ) who suffered from sah with evident aneurysmal formation underwent urgent endovascular intervention in order to seal off the leakage point and to prevent further recurrent hemorrhage . for patients presenting with simultaneous hemorrhage and ischemia , detailed evaluation of angiographic findings is required . due to possible involvement of both subintimal and subadventitial dissections , false lumen and intimal flap may be larger than those in other types and higher rates of recurrent hemorrhage or ischemia are expected . patients with arterial stenosis but without aneurysmal dilatation often receive conservative treatment and those with stenosis also with aneurysmal dilatation may require more aggressive treatments such as surgical or endovascular occlusion with or without bypass.7)14)18 ) however , variable degrees of spontaneous arterial repair may occur by collagen proliferation in all three types of dissections.7 ) in our report , the patient ( case 1 ) who suffered from sah and infarction without aneurysmal formation initially received conservative treatment . follow - up angiography showed considerable luminal healing without aneurysmal formation , and surgical procedures were not necessary . if follow - up angiography showed significant morphological changes of the aca , surgical or endovascular management might have been required . spontaneous aca dissection is extremely rare , and often develops in young adults . detailed evaluation of 3d - cta , mra , and dsa is mandatory for prompt and accurate diagnosis . consequences of an improper approach could be tragic , such as perforation of the arterial wall . the optimal treatment of aca dissection remains controversial ; however , the most reasonable option should be selected based on the clinical presentations and angiographic findings .

spontaneous anterior cerebral artery ( aca ) dissection , although extremely rare , is often associated with severe morbidity and mortality . it could lead to cerebral hemorrhage , ischemic stroke , or , rarely , combination of hemorrhage and ischemia due to hemodynamic changes . prompt and accurate diagnosis is essential for determining the appropriate management . however , the optimal treatment for aca dissection remains controversial . herein , we report on two rare cases of subarachnoid hemorrhage ( sah ) caused by aca dissection ; a case presenting with simultaneous sah and infarction without aneurysmal formation and another case presenting with sah with fusiform aneurysmal formation . a review of the related literature is provided , and optimal treatments for each type of dissection are suggested .

INTRODUCTION CASE REPORTS Case 1 Case 2 DISCUSSION CONCLUSION

actinomycosis is an uncommon chronic granulomatous disease that presents as a slowly progressive , indolent , indurated infiltration with multiple abscesses , fistulas , and sinuses . the purpose of this article is to report on a case of actinomycosis with clinical findings similar to periodontitis . a 46-year - old female presented with recurrent throbbing pain on the right first and second molar of the mandible three weeks after root planing . exploratory flap surgery was performed , and the bluish - gray tissue fragment found in the interproximal area between the two molars was sent for histopathology . the patient did not report any symptoms , and she is scheduled for a follow - up visit . actinomycosis should be included in the differential diagnosis in cases with periodontal pain and inflammation that do not respond to nonsurgical treatment for periodontitis . more routine submissions of tissue removed from the oral cavity for biopsies may be beneficial for differential diagnosis . actinomycosis is an uncommon , indolent , slowly progressive infection caused by anaerobic or microaerophilic bacteria that normally colonize the mouth , colon , and vagina . actinomycosis occurs rarely in humans , but occurs more frequently in cattle as a disease called lumpy jaw . it often presents as a slowly progressive , indolent , indurated infiltration with multiple abscesses , fistulas , and sinuses . four clinical forms of actinomycosis account for most of these human infections : the cervicofacial , thoracic , abdominopelvic , and cerebral . actinomyces exist in normal oral flora , and they can be found in calculus , periodontal pockets , carious lesions , and oral mucosal surfaces . the bacteria do not cause any pathology as long as they stay on the surface of the mucosa , but they become pathogenic and can initiate a prolonged chronic inflammatory process if the integrity of the mucosal barrier is compromised and access to the oral tissues or jawbones is gained . actinomycosis of the jaws and oral tissues has been considered for a long time to be a rare disease ; therefore , it has not generated much interest in research . other types of actinomycosis in oral tissues , such as periapical actinomycosis , are relatively well documented in the literature , but reports of actinomycosis with clinical and radiographic findings similar to periodontitis are limited . one case has been reported of a regional alveolar bone actinomycosis with a related juvenile - periodontitis - like lesion . a patient was diagnosed with actinomycosis without abscess formation or desquamation based on a biopsy during a periodontal flap procedure . this article reports a case of actinomycosis - mimicking periodontitis , and provides a review of the literature related to actinomycosis . a 46-year - old female was referred to the department of periodontics of seoul st . mary 's hospital ( seoul , korea ) for treatment of chronic periodontitis , particularly in the mandibular molar area ( fig . 1 ) . she complained of throbbing pain on the right first and second molars of the mandible . the patient 's medical and dental histories were taken , and clinical assessments and examination , including probing depths , tooth mobility , and bleeding on probing , were performed . the patient was a nonsmoker and went to the department of cardiology of seoul st . mary 's hospital for rheumatic mitral insufficiency ; she had been taking an anticoagulant ( warfarin , 2 mg cuparin tablets ; hana pharm co. , seoul , korea ) for 3 years . intraoral examination revealed generalized chronic periodontitis and particularly deep probing pocket depths : 7 to 8 mm on the distal area of the left second molar , right first molar , and right second molar of the mandible . her cardiologist was consulted for operability , and the cardiologist recommended continuing anticoagulant therapy . the initial cause - related therapy consisted of thorough full - mouth scaling and root planing in the quadrants under local anesthesia . three weeks after her final root planing treatment , she made an unscheduled visit to the clinic . she complained of recurrence of throbbing pain on the right first molar of the mandible . the right first and second molars of the mandible had positive responses for percussion , cold , and electric pulp testing . she complained of an unusual throbbing pain , which was relieved when she bit tightly . the probing pocket depth of the distal area on the right first molar was 7 mm . the right first and second molars of the mandible had positive responses for percussion , cold , and electric pulp testing . a sulcular incision was made around the right posterior teeth of the mandible to preserve the papillae , and the mucoperiosteal buccal and lingual access flaps were elevated ( fig . 2 ) . granulation tissue adherent to the teeth and the alveolar bone was removed . a round , hard , floating , bluish - gray fragment in the interproximal area between the right first and second molar of the mandible was seen . the resulting interproximal crater defect was filled with a xenograft bone material ( bio - oss , geistlich pharma ag , wolhusen , switzerland ) . an analgesic ( 300 mg acetaminophen , 300 mg endapen tablet ; chodang pharm co. , seoul , korea ) at 3 times a day , and an antimicrobial drug ( 625 mg amoxicillin with clavulanate , 625 mg moxicle tablet ; daewoong co. , seoul , korea ) , 3 times a day , were prescribed for 5 days . the patient was also instructed to abstain from brushing and flossing around the surgical area for 2 weeks , to use a 0.1% chlorhexidine ( hexamedine solution , bukwang pharm co. , seoul , korea ) solution rinse , and to consume a diet of soft food until suture removal . the follow - up visits after the surgical procedure were scheduled for each week of the first month after surgery . the mass removed from the interproximal alveolar bone was stored in 10% formalin , and was sent to the department of pathology of seoul st . five days after biopsy , the pathologist concluded that the fragment was aggregates of bacterial colonies and needed a special stain for diagnosis . after one week , the results of the gram , silver , and periodic acid - schiff ( pas ) stain were positive , and the differential diagnosis was actinomycosis ( figs the actinomycotic aggregate presented an isolated mass of bacterial filaments in the center and periphery , the so - called sun - ray effect ( figs . 4 and 5 ) . the healing was uneventful , and the patient reported mild discomfort , but was satisfied with the absence of throbbing pain . based on the histologic result , the patient was prescribed to continue taking amoxicillin and clavulanate ( 625 mg three times a day for 4 weeks ) . the patient was monitored weekly for the first month and then monthly for four months . the patient did not report any symptoms , and she is now scheduled for ongoing follow - up . a previous case reported on an adult patient who presented with periodontitis with a diffuse and atypical actinomycotic lesion that was limited to the gingiva and had an abscess formation , a large desquamation , and subsequent exposure of the alveolar bone in the involved region . actinomyces colonies can be identified using hematoxylin - eosin , gram , pas stains , and silver stain , exhibiting filamentous morphology with color variation between the center and periphery . the colonies have a basophilic center with eosinophilic rays terminating in pear - shaped clubs , the so - called sun - ray effect . in this case , gram , pas , and silver stains were performed , and the results were positive . infection by actinomyces may initiate complications , which may not be diagnosed correctly unless the tissue is biopsied and the actinomyces colonies are identified . in the clinical practice of periodontology , tissue is not routinely submitted for histopathologic analysis , and the authors would like to suggest more routine submissions of tissue removed from the oral cavity , especially during the treatment of periodontal disease . moreover , due to the opportunistic characteristics of the actinomycotic infection , early and adequate differential diagnosis of actinomycosis , prior to attempts at therapy and management steps , is of great importance in the oral cavity because it can prevent the spread of the disease . in a previous report , the majority of cases of actinomycosis were asymptomatic , with only 18% presenting symptoms such as pain and sensory disturbances ( 80% and 20% of the symptomatic cases , respectively ) . in this case , the patient had a recurrence of throbbing pain . actinomycotic patients have often been afflicted by more than one medical condition . won et al . have described actinomycosis as an opportunistic infection , suggesting cancer , immunodeficiency steroids taken over a long period of time , and malnutrition as possible contributing factors . however , most of the actinomycotic patients from the indian subcontinent have been systemically healthy . extended antimicrobial therapy has been recommended for patients with any clinical form of actinomycosis to prevent disease recrudescence . however , individualization of therapy is recommended whether the duration of antibiotics depends on the initial burden of disease , the site of infection , or the clinical and radiological response to treatment . actinomyces are sensitive to a number of antibiotics , and penicillin is the drug of choice for treating an infection caused by any of the actinomyces . in this report , the combination of penicillin ( amoxicillin ) and a beta - lactamase inhibitor ( clavulanate ) are recommended because this offers the advantage of coverage against penicillin - resistant aerobic and anaerobic copathogens . the density of actinomyces colonies , representing the bacterial load in the tissue , may also be considered because the length of antibiotic treatment may be modified according to the density . surgical excision or debridement may be desired as well , especially if extensive necrotic tissue , fistulas , or a neoplasm is present . the patient did not present any recurrence of actinomycosis after a short course of amoxicillin - clavulanate because the infected tissue was totally excised . actinomycosis should be included in the differential diagnosis in cases where pain has not responded to the appropriate periodontal treatment and the periapical lesion has not been detected . more routine submissions of tissue removed from the oral cavity may be beneficial for differential diagnosis .

purposeactinomycosis is an uncommon chronic granulomatous disease that presents as a slowly progressive , indolent , indurated infiltration with multiple abscesses , fistulas , and sinuses . the purpose of this article is to report on a case of actinomycosis with clinical findings similar to periodontitis.methodsa 46-year - old female presented with recurrent throbbing pain on the right first and second molar of the mandible three weeks after root planing . exploratory flap surgery was performed , and the bluish - gray tissue fragment found in the interproximal area between the two molars was sent for histopathology.resultsthe diagnosis from the biopsy was actinomycosis . the clinical and radiographic manifestations of this case were clinically indistinguishable from periodontitis . the patient did not report any symptoms , and she is scheduled for a follow - up visit.conclusionsthe present study has identified periodontitis - mimicking actinomycosis . actinomycosis should be included in the differential diagnosis in cases with periodontal pain and inflammation that do not respond to nonsurgical treatment for periodontitis . more routine submissions of tissue removed from the oral cavity for biopsies may be beneficial for differential diagnosis .

Purpose Methods Results Conclusions INTRODUCTION CASE REPORT DISCUSSION

type 1 diabetes mellitus ( t1 dm ) is one of the most prevalent endocrine disorders among children worldwide ; annually an estimated of 65,000 children develop the disease and its incidence is increasing 3% each year ( 1 ) . between 10 to 70% of these children present in diabetic ketoacidosis ( dka ) as their first presentation of the disease ( 1 ) . in addition to its life threatening aspects , dka is associated with a heavy financial burden ; it accounts for more than 500,000 hospital days per year with an estimated annual cost of 2.4 billion usd ( 2 ) . some studies have shown a higher prevalence of autoimmune disorders among patients with diabetes mellitus which might increase their chance of developing dka as the first manifestation of their disease ( 3 ) . hypothyroidism is prevalent among pediatric patients with t1 dm ; while the reported prevalence of hypothyroidism among general pediatric population is 0.1 to 2% ( 4 , 5 ) , the prevalence of hypothyroidism in patients with t1 dm is much higher ranging from 3 to 30% ( 6 , 7 ) . this could be due to the shared autoimmune disposition for both t1 dm and hypothyroidism ; recent studies have identified some shared genes involved in the susceptibility for both conditions ( 7 , 8) . additionally hypothyroidism and metabolic derangement in patients with t1 dm might form a vicious cycle aggravating disease severity ; hypothyroidism have been shown to increase insulin resistance and impair glucose metabolism ( 8 , 9 ) . while metabolic derangement have been shown to depress pituitary thyroid axis impairing thyroid function ( 9 ) . given the high prevalence of hypothyroidism among pediatric patients with t1 dm and the increased insulin resistance caused by hypothyroidism state and the increased risk of developing dka as the first manifestation of diabetes in individuals who have other autoimmune disorders ( 3 , 6 ) , we postulate that children with t1 dm who have simultaneous hypothyroidism might have a more aggressive form of the disease requiring tighter control and also might have higher chance of developing dka at initial diagnosis . searching the literature we found a considerable gap in this area of research ; we could not find enough studies searching for the relationship between hypothyroidism and the severity of t1 dm , the hemoglobin a1c ( hba1c ) levels , and the required insulin doses to control the disease . whether pediatric patients with both t1 dm and hypothyroidism have more aggressive onset of the disease ( dka ) is not clearly identified . furthermore it needs to be identified whether the family history of diabetes or hypothyroidism could affect the presence of both conditions in their affected children . we therefore conducted this study to assess the prevalence of hypothyroidism among pediatric patients with t1 dm in a developing country where the rate of consanguineous marriage is very high and to evaluate whether the presence of hypothyroidism has any associations with the severity of t1 dm as reflected in the required insulin dose , age at initial diagnosis , hba1c levels , and the occurrence of dka as the first manifestations of the disease . we studied the pediatric patients with t1 dm who were referred to the diabetes clinic of our institute , from january 2013 through january 2015 in a hospital based retrospective cohort study . the patients were considered eligible if they had less than 18 yr of age , had a documented t1 dm diagnosis based on the american diabetes association ( ada ) criteria and had not been on any thyroid medication . a total of 357 patients were eligible to participate in the study , and 27 were excluded due to the following criteria : age more than 18 yr , missing the medical records including the records on the first presentation of the disease and missing an informed consent . a total of 330 children aged from 2 to 18 yr completed this study which was approved by the research deputy and the ethics committee of our institute . after explaining the whole process an informed written consent was obtained from all the parents and when applicable from the patients who accepted to participate in the study . the patients were visited in a separate appointment and a questionnaire was completed for them through medical interviews and investigating their medical records . then a blood sample was obtained from patients to measure their thyroid stimulating hormone ( tsh ) , free thyroxin ( t4 ) , triiodothyronine ( t3 ) , anti - thyroid peroxidase ( anti - tpo ) antibodies , fasting blood glucose ( fbs ) , and glycated hemoglobin ( hba1c ) levels . the following information was retrieved from the patients medical records : age at diagnosis of t1 dm , occurrence of dka as the first clinical manifestation of the disease , the duration of t1 dm , the required insulin dose , and family history of autoimmune diseases in the first degree relatives . dka was diagnosed based on the following criteria : hyperglycemia over 250 mg / dl , plasma ph less than 7.3 , plasma hco3 less than 15 meq / l and the presence of ketonuria . clinical hypothyroidism was diagnosed based on the increased tsh level and decreased free t4 and/or t3 levels according to the normal range in different pediatric age groups ( table1table 1.reference range for the thyroid function tests in different pediatric age groups ) ( 10 ) . patients were divided into two groups , based on thyroid function tests ; patients with t1 dm and hypothyroidism and patients with t1 dm and normal thyroid function . the hba1c levels , required insulin dose , presence of thyroid antibodies , age at initial diagnosis of t1 dm , the occurrence of dka at initial diagnosis and demographics were compared between the two study groups . all statistical analyses were performed using spss statistical software ( version 18.0.0 : pasw , chicago , il ) . chi - squared analysis , fisher s exact test , independent - samples t test and multivariate logistic regression were used to for statistical analysis of the study . sample size was calculated for a power of 80% and an alpha error of 0.05 where at least 28 persons would be required in each group to detect a difference in presenting with dka at initial diagnosis of t1 dm . estimated odds ratios ( ors ) with 95% confidence intervals ( 95% cis ) and p value were used to evaluate the statistical significant . we studied the pediatric patients with t1 dm who were referred to the diabetes clinic of our institute , from january 2013 through january 2015 in a hospital based retrospective cohort study . the patients were considered eligible if they had less than 18 yr of age , had a documented t1 dm diagnosis based on the american diabetes association ( ada ) criteria and had not been on any thyroid medication . a total of 357 patients were eligible to participate in the study , and 27 were excluded due to the following criteria : age more than 18 yr , missing the medical records including the records on the first presentation of the disease and missing an informed consent . a total of 330 children aged from 2 to 18 yr completed this study which was approved by the research deputy and the ethics committee of our institute . after explaining the whole process an informed written consent was obtained from all the parents and when applicable from the patients who accepted to participate in the study . the patients were visited in a separate appointment and a questionnaire was completed for them through medical interviews and investigating their medical records . then a blood sample was obtained from patients to measure their thyroid stimulating hormone ( tsh ) , free thyroxin ( t4 ) , triiodothyronine ( t3 ) , anti - thyroid peroxidase ( anti - tpo ) antibodies , fasting blood glucose ( fbs ) , and glycated hemoglobin ( hba1c ) levels . the following information was retrieved from the patients medical records : age at diagnosis of t1 dm , occurrence of dka as the first clinical manifestation of the disease , the duration of t1 dm , the required insulin dose , and family history of autoimmune diseases in the first degree relatives . dka was diagnosed based on the following criteria : hyperglycemia over 250 mg / dl , plasma ph less than 7.3 , plasma hco3 less than 15 meq / l and the presence of ketonuria . clinical hypothyroidism was diagnosed based on the increased tsh level and decreased free t4 and/or t3 levels according to the normal range in different pediatric age groups ( table1table 1.reference range for the thyroid function tests in different pediatric age groups ) ( 10 ) . patients were divided into two groups , based on thyroid function tests ; patients with t1 dm and hypothyroidism and patients with t1 dm and normal thyroid function . the hba1c levels , required insulin dose , presence of thyroid antibodies , age at initial diagnosis of t1 dm , the occurrence of dka at initial diagnosis and demographics were compared between the two study groups . all statistical analyses were performed using spss statistical software ( version 18.0.0 : pasw , chicago , il ) . chi - squared analysis , fisher s exact test , independent - samples t test and multivariate logistic regression were used to for statistical analysis of the study . sample size was calculated for a power of 80% and an alpha error of 0.05 where at least 28 persons would be required in each group to detect a difference in presenting with dka at initial diagnosis of t1 dm . estimated odds ratios ( ors ) with 95% confidence intervals ( 95% cis ) and this study evaluated 330 children with t1 dm who were referred to our diabetes clinic between 2013 and 2015 . the mean standard deviation ( sd ) for the patients age was 11.6 2.4 yr ; the duration of t1 dm was 2.2 1.2 ys ; the age at diagnosing t1 dm was 9.1 2.3 yr ; the required insulin dose was 0.83 0.23 international unit ( iu)/kg / d ; the hba1c level was 8.8 1.9 . 193 patients ( 58.4% ) were female with a male : female ratio of 1:1.4 ; 32 patients ( 9.6% ) had hypothyroidism ; 63 patient ( 19% ) had positive anti - tpo antibodies ; in 123 children ( 37.2% ) dka was the first clinical presentation of t1 dm ; parents consanguinity was observed in 86 patients ( 26% ) ; 55 children ( 16.6% ) had a family history of diabetes mellitus in their first degree relatives ; 39 children ( 11.8% ) had a family history of hypothyroidism in their first degree relatives . children with t1 dm and hypothyroidism tended to have a higher rate of consanguinity in their parents ( 43.7 vs. 24.1% , p = 0.01 ) , and a higher rate of diabetes mellitus in their first degree relatives ( 31.2 vs. 15.1% , p = 0.02 ) compared to children with t1 dm who had normal thyroid function , while the family history of hypothyroidism was not significantly different between the two groups ( 18.7 vs. 11% , p = 0.2 ) ( table 2table 2.comparison of the patients demographics between diabetic patients with and without hypothyroidism ) . patients with t1 dm and hypothyroidism had significantly higher rates of dka at initial diagnosis ( 62.5 vs. 34.5% , p = 0.002 ) , younger age at initial diagnosis ( p = 0.04 ) , higher rates of positive anti - tpo antibodies ( 75 vs. 13% , p < 0.001 ) , and higher levels of hba1c upon enrolment in the study ( p = 0.02 ) compared to patients with t1 dm who had normal thyroid function . patients with hypothyroidism also required higher doses of insulin to control their disease ( p = 0.03 ) ( table 3table 3.comparison of the disease severity between diabetic patients with and without hypothyroidism ) . we used logistic regression model to adjust the results for patients sex , age at diagnosis , positive anti - tpo antibodies , parents consanguinity and family history of diabetes mellitus ; after these adjustments hypothyroidism remained significantly associated with the occurrence of dka as the initial manifestation of the disease in patients with t1 dm ( b = 1.1 , p = 0.004 , or = 3.03 , 95%ci = 1.416.48 ) ( table 4table 4.logistic regression analysis of the factors associated with the occurrence of dka at the initial diagnosis of t1 dm ) . in this study hypothyroidism was detected in 9.6% of children who suffer from t1 dm and was associated with a more aggressive disease ; in comparison to children with t1 dm who had normal thyroid function , children who had both t1 dm and hypothyroidism had significantly higher hba1c levels at enrolment , required higher insulin doses to control their disease , their disease tended to present at younger ages and most of them experienced dka as the first presentation of their disease . additionally children with t1 dm and hypothyroidism had significantly higher rates of anti - tpo antibodies , consanguinity among their parents and higher rates of diabetes in their first - degree relatives . in the current study hypothyroidism was a prevalent problem among children with t1 dm , complicating 9.6% of these children . this was in accordance with other studies ; based on a 2010 review 38% of pediatric patients with t1 dm have been reported to develop autoimmune hypothyroidism ( 6 ) . while a recently published review and a meta - analysis reported a much higher rate of 730% for the prevalence of hypothyroidism in patients with t1 dm ( 7 , 11 ) . the heterogeneity in the reported prevalence of hypothyroidism in these studies could be due to the variable population characteristics including age and ethnicity of patients , the differences in study design including the cut - off levels and classification of the disease with different definitions including autoimmune , subclinical , and clinical hypothyroidism ( 6 , 7 , 11 ) . in our study more than 70% of the patients with t1 dm and hypothyroidism had positive anti - tpo antibodies , in addition parental consanguinity and the presence of diabetes mellitus in the first - degree relatives were significantly higher among patients with both t1 dm and hypothyroidism , compared to patients with t1 dm but without hypothyroidism . these results strongly support the role of autoimmunity and the shared genetic susceptibility in the pathogenesis of hypothyroidism in patients with t1 dm . recent studies have revealed some genes that might be responsible for the joint susceptibility to t1 dm and autoimmune thyroid dysfunction ( 8) ; hla class ii loci , ctla4 , ins ( 12 , 13 , 15 ) , ptpn22 ( 14 , 15 ) , and foxp3 ( 15 ) , are among the identified genes . these genes have been recognized as the key role players in the regulation of the immune response ( 15,16,17,18 ) ; these genes are involved in the differentiation , regulation , activation and function of regulatory t - cells ( 15,16,17,18 ) , and their polymorphism have been linked to a number of autoimmune diseases including t1 dm and autoimmune thyroid dysfunction ( 12,13,14,15,16,17,18 ) . in this study hypothyroidism was associated with a more aggressive disease in pediatric patients with t1 dm ; patients with t1 dm and hypothyroidism had higher rates of dka at presentation , were younger at the onset of the disease , had higher hba1c levels and required higher insulin doses for the control of the disease . documented the association of severe metabolic derangement and impaired thyroid function in patients with newly diagnosed t1 dm ( 9 ) . lin et al . also showed a significantly lower levels of t3 , t4 and free t4 among children newly diagnosed t1 dm who presented with dka compared to patients without dka at initial diagnosis ( 19 ) . the association of thyroid dysfunction with the disease severity in t1 dm patients could be explained through several mechanisms ; our results supported by the aforementioned studies ( 12,13,14,15,16,17,18 ) , document that the occurrence of both t1 dm and hypothyroidism might show the presence of polymorphism in some of the immune response regulatory genes ( 12,13,14,15,16,17,18 ) , causing a more severe disease with stronger features of autoimmunity ( 15,16,17,18 ) . another mechanism might be through the effect of hypothyroidism on increasing insulin resistance and glucose metabolism(8 , 19,20,21,22 ) ; thyroid hormones stimulate glucose uptake into peripheral tissues and enhance an additive effect on insulin action on glucose transport into cells ( 19,20,21,22 ) . therefore in hypothyroid patients insulin - dependent glucose clearance could get defected ( 19,20,21,22 ) , putting diabetic patients with hypothyroidism at significantly higher risk of experiencing acute and possibly chronic complications of diabetes ( 8) . furthermore metabolic derangement and poor diabetic control for a long time might cause complete depression of hypothalamus - pituitary - thyroid axis causing clinical hypothyroidism ( 9 ) , which in turn aggravates insulin resistance , thus might form a vicious cycle resulting in a more aggressive disease . this study is among the rare studies that evaluate the clinical severity , insulin requirement and hba1c levels in pediatric patients with t1 dm who have hypothyroidism . however our study has some limitations that should be considered when interpreting the results ; we do not have information regarding thyroid function at the onset of t1 dm therefore it is not clear whether thyroid dysfunction developed though the course of the disease or it was present at the initial presentation of t1 dm . another limitation was that our patients were not followed to evaluate whether treating hypothyroidism could improve the severity of diabetes and lower the required insulin dose . additionally in our study thyroid scan and anti - thyroglobulin antibodies were not evaluated , this might have caused an underestimation of the presence of autoimmune thyroiditis among the patients with t1 dm . prospective and interventional studies are required to evaluate whether treating hypothyroidism could alleviate the severity of diabetes and lower the required insulin dose in patients with concurrent t1 dm and hypothyroidism , and to answer whether controlling diabetes could result in improvement of thyroid function in these patients . hypothyroidism is prevalent among pediatric patients with t1 dm and is associated with a more aggressive form of the disease . patients with t1 dm and hypothyroidism have higher rates of dka , develop the disease at younger ages , and require higher insulin doses . therefore all patients with t1 dm especially those with poorly controlled disease and those with positive family history for diabetes should be screened for thyroid dysfunction . interventional studies are required to evaluate the efficacy of treating thyroid dysfunction in these patients and to assess if hormone therapy in these patients could help in a better management of diabetes and reduce its complications .

abstract.we performed this study to evaluate the associations of hypothyroidism with clinical severity and the occurrence of diabetic ketoacidosis ( dka ) at initial diagnosis among pediatric patients with type 1 diabetes mellitus ( t1 dm ) . 330 children with t1 dm who referred to diabetes clinic were enrolled . the medical records were e valuated and a blood sample was drawn from patients for measuring thyroid function and antibodies , blood glucose , and glycated hemoglobin ( hba1c ) levels . hypothyroidism was detected in 9.6% of children with t1 dm and was associated with higher rates of dka ( or = 3.15 , 95%ci = 1.486.71 ) and younger age at initial diagnosis ( 7.3 3.2 vs. 10.1 2.5 , p = 0.04 ) , higher levels of hba1c upon enrolment ( 9.8 2.2 vs. 8.8 1.9 , p = 0.02 ) and the requirement for higher insulin doses to control the disease ( 0.9 0.42 vs. 0.81 0.2 , p = 0.03 ) compared to children with t1 dm and normal thyroid function . additionally children with t1 dm and hypothyroidism had significantly higher rates of anti - tpo antibodies ( p < 0.001 ) , consanguinity in their parents ( p = 0.01 ) , and family history of diabetes mellitus ( p = 0.02 ) in their first degree relatives . in conclusion autoimmune hypothyroidism is prevalent among children with t1 dm and is associated with a more aggressive disease at initial presentation , poorly controlled t1 dm , and requirement for higher insulin doses for controlling the disease .

Introduction Materials and Methods Study population and design Data and specimen collection Statistical analysis Results Discussion Conclusions

antimicrobial cationic peptides are host defense molecules produced by the innate immune system of organisms all across the evolutionary spectrum . indolicidin , encoded by a member of cathelicidin gene family , a cationic antimicrobial tridecapeptide amide ( h - ile - leu - pro - trp - lys - trp - pro - trp - trp - pro - trp - arg - arg - nh2 ) , was isolated from cytoplasmic granules of bovine neutrophils . it is one of the shortest known natural - occurring antimicrobial peptide , toxic to both prokaryotes and eukaryotes [ 3 , 4 ] . unlike several other antimicrobial peptides , the structure of indolicidin upon membrane interaction is not a well - defined helix or a -turn and does not display their characteristic amphipathic nature [ 47 ] . it has been reported that indolicidin expresses its antimicrobial activity by creating pores through cell membranes . other studies showed that indolicidin treatment resulted total disintegration of membrane structures or that it did not cause cell lysis even at high concentration . compared to -helical antibiotic peptides , indolicidin is less able to dissipate the bacterial inner membrane potential and forms smaller pores , yet it kills bacteria rapidly . it was reported that an interfacial membrane location was preferred by indolicidin [ 6 , 11 ] . these results point to a mechanism of action that is different from well - defined channel formation . lipid bilayer on polyelectrolyte films can be used as a useful experimental approach to study basic problems of biological membrane structures [ 1214 ] . bacteriorhodopsin is a light - driven proton pump in the plasma membrane of halobacterium salinarum . this integral membrane protein is tightly packed in two - dimensional crystalline from termed purple membrane with high ( 75% w / w ) bacteriorhodopsin content , with no other protein . microscopic ( afm ) experiments could provide detailed information about these systems . here , we present an afm study on the interaction of indolicidin with an artificial and a natural membrane . freshly cleaved mica ( spi - chem mica sheets , structure probe , inc . , west chester , pa , usa ) surface was covered with poly(l - lysine)-poly(l - glutamic acid)-dipalmitoyl phosphatidylcholine ( pll - pga - dppc ) layers [ 14 , 17 ] , or with purified purple membrane of halobacterium salinarum [ 1820 ] on the following ways : experiments were performed in tris(hydroxymethyl)aminomethane ( tris - hcl , 10 mm ) , and sodium chloride ( nacl , 0.15 m ) buffer at ph = 7.4 . the polyelectrolytes pll ( mr = 32600 g / mol ) and pga ( mr = 17000 g / mol ) have been both dissolved in the above mentioned buffer , at a concentration of 1 mg / ml . dppc was dissolved in chloroform : methanol ( 2 : 1 ) at final concentration of 20 mg / ml . afterward the solvent was evaporated by n2 flow . buffer was added to the dried dppc ( 250 g / ml ) , and liposomes were formed by sonication . no special care was taken to have unilamellar liposomes . to form polyelectrolyte layers , pll was adsorbed first to the freshly cleaved mica , then it was washed with buffer , and pga was adsorbed on pll layer , and it was washed again . these steps have been followed by covering the treated mica with dppc layer ; it was heated for 1 hour at 46c , and let to cool slowly . purple membrane of halobacterium salinarum was prepared according to the method of oesterhelt and stoeckenius , and it was adsorbed from a buffer containing 10 mm tris and 150 mm nacl at ph = 8.0 to the freshly cleaved mica surface treated with the same buffer containing 10 mm cacl2 . indolicidin was added just before the measurements to the same buffer in which the membrane surfaces were prepared at 0.52 , 2.6 , 5.2 , 7.9 , and 15.7 m concentrations ( 1 , 5 , 10 , 15 , and 30 g / ml , resp . ) [ 10 , 22 ] . all chemicals were purchased from sigma - aldrich ( st . louis , mo , usa ) . afm measurements were carried out with an asylum mfp-3d head and controller ( asylum research , santa barbara , ca , usa ) in tapping / noncontact ( ac ) mode . the driver program mfp-3d xop was written in igor pro software ( version 5.05a , wavemetrics , lake oswego , or , usa ) . silicon nitride ( biolever mini bl - ac40ts ) cantilevers ( olympus optical co. , ltd . , tokyo , japan ) were used for the experiments ( resonance frequency was 25 khz in water with 0.09 n / m spring constant ) . typically 512 512 points were taken at 1 line / s scan rate in ac mode under buffer solution . in order to clarify which model may be the more likely explanation of indolicidin 's antimicrobial activity ( i.e. , pore formation that disturbs the metabolism / homeostasis / ion balance of a cell , or the cell membrane destruction ) , we developed a modified supported membrane model : a polyelectrolyte film composed of pll and pga attached to flat mica surface and covered with a lipid bilayer of dppc . the reason why we chose this membrane model is that it contains a layer between the hard surface ( mica ) and the lipid bilayer through which small peptides are able to penetrate . in other words , if indolicidin creates a pore through a membrane , this structure may ensure space for indolicidin on the other side of the membrane , and it can access the membrane from the side that is close to mica , too . in models used previously for studying the action mechanism of indolicidin [ 8 , 23 , 24 ] , lipid bilayers were directly attached to mica , leaving no space between the membrane and the hard surface , which may be important for full pore formation . to test the effect of indolicidin on our membrane model , various concentrations of peptide solutions were used ( in a range of 0.52 to 15.7 m ) [ 10 , 21 ] . on one hand , when we used 0.52 m of indolicidin , no membrane alterations could be detected with afm ( figure 1(a ) ) . if the concentration was increased above 2.6 m , instead of creating pores , indolicidin induced the appearance of aggregates , but the membranes were still intact ( figures 1(b ) ( 2.6 m ) , 1(c ) ( 5.2 m ) ) . we hypothesize that these aggregates are formed from excess amount of indolicidin that is present in the system . however , the aggregation process was too fast , and it did not allow us to follow the formation of these aggregates during afm imaging ( taking one image required approximately 10 minutes of scanning ) . when we further increased the concentration of the antimicrobial peptide ( 7.9 m ( data not shown ) or 15.7 m ) , after about 2 hours , the membrane bilayer structure was destroyed ; this phenomenon was not observed at lower concentrations ( figure 1(d ) ) . in summary , in our model membrane , we could not find a concentration where pore formation occurred . this suggests that the mechanism through which indolicidin expresses its antimicrobial activity is more likely via disintegrating membranes . to make sure that smaller concentrations have a different effect relative to higher concentrations , and for better understanding of the membrane destruction process , the time dependence of indolicidin treatment was also measured ( figure 2 ) . 15.7 m of indolicidin started to induce detectable changes in the membrane structure after the first 4050 min ( figures 2(b ) and 2(d ) ) . the collapse of the membrane required 140 min at room temperature ( figures 2(e ) and 2(f ) ) . based upon the above observations , that is , ( 1 ) indolicidin needs a minimal concentration to affect the bilayer structure ( below which there is no detectable impact , and above which there is a major / significant impact ) . these results have a good agreement with the proposed mechanism reported by melo et al . . indolicidin may behave as a surfactant - like material in a sense that it breaks down the continuity of membranes . the purple membrane disks of halobacterium salinarum have been checked also to test the importance of pll / pga layer . these membrane disks were deposited directly on the ca covered mica surface , without any polyelectrolyte film . in this case , the interaction was slower and more specific . as it can be seen , indolicidin binds to the membrane , but the edges were preferred ( figures 3(b ) ( 7.9 m ) , 3(d ) ( 15.7 m ) ) , since the lipids were more accessible in those regions . also the roughness of the membrane increased , probably caused by the aggregation of the indolicidin on the surface . even at higher concentration ( 15.7 m ) , indolicidin attached to the membrane surface and especially on the border of membrane disk only but did not break the membrane integrity . this transient layer has about half height ( 3 - 4 nm ) of the purple membrane , in agreement with the results of shaw et al . and mecke et al . based on the height of the layer , it is probably a monolayer of lipids stabilized with indolicidin . the subject of our present publication is an in situ atomic force microscopy study of interaction of indolicidin with supported planar bilayer membranes of dppc , and purple membrane of halobacterium salinarum . the effect of the peptide on membranes was concentration dependent for dppc and it resulted in the destruction of intact membranes . among the samples examined , the purple membrane was less sensitive to indolicidin treatment , most likely due to the high membrane protein content . for these membranes , indolicidin tended to bind to the border of membrane disks , where the lipids are easier to interact with . in this paper , we demonstrated that the association of indolicidin with supported planar bilayers causes membrane thinning similar to the work of shaw et al . [ 23 , 24 ] and mecke et al . or solubilization of supported membrane on polyelectrolyte film rather than initiating pore formation . these results are in good correlation with molecular dynamics simulations [ 27 , 28 ] .

indolicidin , a cationic antimicrobial tridecapeptide amide , is rich in proline and tryptophan residues . its biological activity is intensively studied , but the details how indolicidin interacts with membranes are not fully understood yet . we report here an in situ atomic force microscopic study describing the effect of indolicidin on an artificial supported planar bilayer membrane of dipalmitoyl phosphatidylcholine ( dppc ) and on purple membrane of halobacterium salinarum . concentration dependent interaction of the peptide and membranes was found in case of dppc resulting the destruction of the membrane . purple membrane was much more resistant against indolicidin , probably due to its high protein content . indolicidin preferred the border of membrane disks , where the lipids are more accessible . these data suggest that the atomic force microscope is a powerful tool in the study of indolicidin - membrane interaction .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusion

dental plaque is implicated in the etiology of dental caries , gingivitis and periodontitis , therefore the removal of plaque is thought to play a key role in the prevention of these diseases . the relationship between plaque levels ( oral hygiene ) and periodontal disease is complex and not well understood . similarly , when teeth are brushed with fluoride toothpaste there is considerable evidence of a caries reduction . however , this reduction in caries levels is principally due to the action of fluoride in the toothpaste rather than brushing per se . commercial powered ( electric ) toothbrushes were first introduced in the early 1960s,[47 ] although frederick wilhelm , a swedish clockmaker , patented the earliest device in 1855 . subsequent development has lead to the development of rotary action brushes and more recently higher frequency of vibration brushes . one study has shown that 36 months after purchase , 62% of people were still using their powered brush on a daily basis . the reported compliance level was high and was unrelated to any social factors of the population studied . mechanical plaque removal with a manual toothbrush remains the primary method of maintaining good oral hygiene for the majority of the population . despite the increasing interest in powered toothbrushes , their effectiveness in comparison to manual toothbrushes systematic reviews of randomized controlled trials are seen as the gold standard for assessing the effectiveness of healthcare interventions . by following explicit , well - documented , scientific methodology meta - analysis is a statistical procedure that integrates the results of several independent studies considered to be it is a statistical approach to combine data derived from systematic review and it gives a more objective appraisal of the evidence than traditional narrative reviews . therefore , it should be based upon underlying systematic review but not every systematic review leads to meta - analysis . the aim of this systematic review and associated meta - analysis was to compare manual and powered brushes in relation to the removal of plaque and gingival health . the medline search revealed no report on meta - analysis of studies wherein a common type of control toothbrush is compared with different powered toothbrushes in different studies . hence , the present meta - analysis includes effect of three powered toothbrushes versus control toothbrush . to be included in the review a trial had to be a randomized - controlled trial ( rct ) comparing manual and powered brushes . trials confined to comparing different types of powered or different types of manual brushes were excluded . trials with subjects of specific age group ( 1825 years ) were included but trials including individuals with special needs and orthodontic bands that would compromise their brushing ability were excluded . for the purpose of the review , powered brushes were defined as those with a mechanical movement and additional features of the brush head . counter oscillation ( braun oral b ultra plaque remover ) : in which adjacent tufts of bristles ( usually 610 ) rotate in one direction and then the other , independently . each tuft rotating in the opposite direction to that adjacent to it.ultrasonic ( ultrasonex ) : in which the brush bristles vibrate at ultrasonic frequencies ( i.e. above 20 khz)ionic ( hyg ) : in which ions are released from brush bristles , this brings about disruption of plaque from tooth surface . counter oscillation ( braun oral b ultra plaque remover ) : in which adjacent tufts of bristles ( usually 610 ) rotate in one direction and then the other , independently . ultrasonic ( ultrasonex ) : in which the brush bristles vibrate at ultrasonic frequencies ( i.e. above 20 khz ) ionic ( hyg ) : in which ions are released from brush bristles , this brings about disruption of plaque from tooth surface . these databases were searched using controlled vocabulary ( mesh terms ) and free text words . the clinical reports in japanese were translated to english . there was a lack of data on common manual tooth brush ( control ) compared with different types of powered toothbrushes . the hand search led to the procurement of three rcts done with similar inclusion and exclusion criteria , indices used for plaque and gingival health and microbiological evaluation in single centre . three reviewers independently reviewed the titles and abstracts identified through the hand search strategy . if , in the opinion of both reviewers , an article clearly did not fulfill the defined inclusion criteria it was considered ineligible . full reports of three trials were obtained for assessment . for plaque , data were extracted where possible , as the turesky modification of the quigley hein plaque index . for gingivitis , where possible , data were extracted as the gingival bleeding index of ainamo and bay . trial data was recorded as short - term ( baseline to 28 days ) . considering the above measures , present meta - analysis included three studies , which are rct , split - mouth design , double blind with similar control brush . these databases were searched using controlled vocabulary ( mesh terms ) and free text words . the clinical reports in japanese were translated to english . there was a lack of data on common manual tooth brush ( control ) compared with different types of powered toothbrushes . the hand search led to the procurement of three rcts done with similar inclusion and exclusion criteria , indices used for plaque and gingival health and microbiological evaluation in single centre . three reviewers independently reviewed the titles and abstracts identified through the hand search strategy . if , in the opinion of both reviewers , an article clearly did not fulfill the defined inclusion criteria it was considered ineligible . full reports of three trials were obtained for assessment . for plaque , data were extracted where possible , as the turesky modification of the quigley hein plaque index . for gingivitis , where possible , data were extracted as the gingival bleeding index of ainamo and bay . trial data was recorded as short - term ( baseline to 28 days ) . considering the above measures , present meta - analysis included three studies , which are rct , split - mouth design , double blind with similar control brush . the search identified three trials with full articles.[1416 ] these include trials being published between 2002 and 2006 . the trials involved 56 subjects at baseline , without loss of subject for follow up . all trials were reported as self - funding trials ; however , ultrasonic and ionic toothbrush were supplied free of cost for research trial . all trials reported full mouth scores for plaque index and gingival bleeding index . in study i , the electric toothbrush ( braun oral b ultra plaque remover ) and manual toothbrush ( oral b indicator ) were compared . on statistical analysis it was found that electronic toothbrush showed 86% ( 1.770.39 sd ) reduction of plaque index and 95% of reduction in bleeding index from baseline , whereas manual toothbrush showed 85% ( 1.720.35 ) of reduction in plaque index and 90% reduction in bleeding index . ii , ultrasonic and manual brushes showed statistically significant reduction of plaque index ( 50% and 60% , respectively ) and bleeding index ( 35% and 26% , respectively ) from baseline but intergroup comparison showed non - significant results . in study iii , ionic and manual brushes showed statistically significant reduction of plaque index ( 83% and 17% , respectively ) and bleeding index ( 97% and 33% , respectively ) from baseline but intergroup comparison showed non - significant results . the effect size represents the magnitude of impact of intervention on an outcome or degree of association between two variables . effect size calculation was done for all the three trials wherein study i and study ii showed value 0.14 and 0.17 , respectively , which designates a very small effect , whereas study iii showed effect size value of 5.9 which designates a very large effect . effect size of pooled data showed value of 1.72 , which designates a very large effect of using powered toothbrush for plaque removal as compared to manual toothbrush [ table 2 ] . summary of pooled estimates of effect for gingival bleeding index study i showed a value of 0.12 which designates a very small effect , study ii showed value 0.5 which designates a moderate effect whereas study iii showed effect size value of 7 which designates a very large effect . effect size of pooled data showed value of 0.6 , which designates a moderately large effect of using powered toothbrush for reduction of gingival bleeding as compared to manual toothbrush [ table 3 ] . summary of pooled estimates of effect for gingival bleeding index all trials reported on microbiological analysis ( cfu ) , soft tissue trauma wherein trial ii reported stain removal efficacy . cfu results for study i ( electric ) and study ii ( ultrasonic ) showed greater cfu reduction in powered toothbrush group but were not statistically significant as compared to manual toothbrush whereas in study iii ionic brush showed statistically significant reduction from baseline to 28 day . effect size calculation was done for all the three trials wherein study i and study ii showed value 0.14 and 0.17 , respectively , which designates a very small effect , whereas study iii showed effect size value of 5.9 which designates a very large effect . effect size of pooled data showed value of 1.72 , which designates a very large effect of using powered toothbrush for plaque removal as compared to manual toothbrush [ table 2 ] . study i showed a value of 0.12 which designates a very small effect , study ii showed value 0.5 which designates a moderate effect whereas study iii showed effect size value of 7 which designates a very large effect . effect size of pooled data showed value of 0.6 , which designates a moderately large effect of using powered toothbrush for reduction of gingival bleeding as compared to manual toothbrush [ table 3 ] . summary of pooled estimates of effect for gingival bleeding index all trials reported on microbiological analysis ( cfu ) , soft tissue trauma wherein trial ii reported stain removal efficacy . cfu results for study i ( electric ) and study ii ( ultrasonic ) showed greater cfu reduction in powered toothbrush group but were not statistically significant as compared to manual toothbrush whereas in study iii ionic brush showed statistically significant reduction from baseline to 28 day . people brush their teeth for a number of reasons : to feel fresh and confident ; to have a nice smile ; to avoid bad breath and avoid disease . it may prevent periodontitis , although many factors as well as plaque are associated with periodontitis including tobacco usage and medical factors . it is likely that on initial use of a new device such as a new powered brush will have a novelty effect . as mentioned in tables 2 and 3 , the results of study i ( electric tooth brush ) are similar to study done by ainamo et al . whereas barnes et al . the results of study ii ( ultrasonic tooth brush ) are similar to study done by forgas et al . whereas terezhalmy et al . showed significant result with use of ultrasonic toothbrush and the results of study iii ( ionic tooth brush ) are similar to study done by van swol et al the effect size of pooled data for plaque index demonstrates value of 1.72 , which designates very large effect of using powered toothbrush for plaque removal as compared to manual brush . the plaque score in short - term trials of rotation oscillation brushes was smd 20.44 . using this level of effectiveness as an example , in the trial by cronin a similar smd ( 20.45 ) corresponded to a mean difference in the turesky modification of the quigley hein index of 0.27 . the mean plaque score among those using manual brushes in the trial by cronin was 2.55 and thus the difference is 11% . the effect size of pooled data for gingival bleeding index demonstrates value of 0.6 , which designates moderately large effect of using powered toothbrush for reduction of gingival bleeding as compared to manual brush . for gingival scores the smd in short - term trials of rotation oscillation brushes was also 20.44 . again , using this level of effectiveness , in the trial by heasman , the smd of 20.42 corresponded to a mean difference in the loe and silness gingival index of 0.09 . the mean gingival index score for those using manual brushes in the trial was 1.64 and thus the difference is 6% . this raises the question , what level of plaque removal and reduction in gingivitis will result in clinically significant improvements in oral health ? arbitrary thresholds are set , for example , the american dental association council on scientific affairs suggested a 15% statistically significant reduction versus baseline in gingivitis and a statistically significant reduction in plaque scores ; others have suggested 20% reductions as an appropriate threshold . unfortunately , at present there is no evidence to base such a threshold for either gingivitis or plaque . it has been suggested that thresholds for clinical significance are set in advance on clinical grounds . one possible weakness of the review is inclusion of only tree studies ; however , strength of this review is that it is a single centre study with a similar criteria . whilst this approach allowed more powerful meta - analyses , it is possible that toothbrushes whose actions or design had subtle differences were more or less effective . filament arrangement , orientation , size shape flexibility , brush head size and shape along with the presence or absence of a timer would be too difficult to define and standardize across brush types . time spent brushing may be related to the effectiveness of brushing and therefore a timer may be a particularly useful adjunct and motivator . one possible confounding factor is lack of compliance ; however , gingivitis and plaque levels improved in the individual studies suggesting at least some compliance . further , in randomized trial compliance levels are likely to be equal across the groups . one way to overcome this is to supervise brushing prior to measurements ; this reduces some confounding factors but can not be described as real life and therefore has its own problems . in present review , individuals who prefer to use a powered brush can be assured that in general there was no statistical difference between powered and manual toothbrushes and powered brushes are as safe . as no trail compared durability , reliability or cost of using manual versus powered brushes the review compared manual versus powered brushes and not comparisons of differing powered brushes and therefore different powered toothbrush manufacturer 's products . in the present meta - analysis , as compared to the systematic review , the present meta - analysis included similar age group , plaque and gingival bleeding indices , duration of brushing ; children group and subjects with orthodontic bands were excluded . for all of these reasons no recommendation regarding the effectiveness or efficiency of any specific powered toothbrush is made . however , short coming of present metaanalysis is that it includes only three studies of small sample size and short duration . data on the long - term benefits of powered toothbrushes would be valuable in their own right and could be used to trial other outcomes such as the adverse effects and benefits in the prevention of periodontitis and dental caries . moreover , more trials would lend greater power to systematic reviews of the effectiveness of powered toothbrushes . individuals who prefer to use a powered brush can be assured that in general there was no statistical difference between powered and manual brushes . the powered brushes are safe . as no trial compared durability and reliability of using manual versus powered brushes , it is not possible to make clear recommendation of toothbrush superiority . however , considering cost of powered brushes , manual brushes are still a choice for routine use in indian scenario .

background : the aim of this systematic review and associated meta - analysis was to compare manual and powered brushes in relation to the removal of plaque and gingival health . stain removal , adverse effects and microbiological evaluation cost were also considered.materials and methods : to be included in the review , a trial had to be a randomized - controlled trial ( rct ) comparing manual and powered brushes . trials confined to comparing different types of powered or different types of manual brushes were excluded . split mouth designs were eligible . trials with subjects of specific age group ( 1825 years ) were included . the primary outcomes were plaque and gingival health with data defined as short - term ( 028 days ) duration were analyzed . powered brushes were categorized into three groups depending on mode of action . numerical data extracted were checked by a fourth reviewer for accuracy.results:three trials with full articles were identified . these include trials published between 2002 and 2005 . the trials involved 56 subjects at baseline , without loss of subject for follow up . powered brushes reduced plaque and gingivitis at least as effectively as manual brushing . ionic brushes statistically significantly reduced plaque and gingivitis.conclusion:in general there was no evidence of a statistically significant difference between powered and manual brushes . however , ionic brushes significantly reduce plaque and gingivitis in both the short - term evaluations . the clinical significance of this reduction is not known . observation of methodological guidelines and greater standardization of design would benefit both future trials and meta - analyses .

INTRODUCTION MATERIALS AND METHODS Identification of relevant studies Study selection and data extraction Data RESULTS Effect size for plaque index Effect size for gingival bleeding index DISCUSSION CONCLUSION

historically too much emphasis has been placed on determining whether students and trainees can pass exams , and insufficient emphasis on whether they can perform in the role expected of them as medical practitioners ( 1 ) . traditional clinical examinations such as objective structured clinical examinations ( osces ) pioneered by ronald harden in dundee ( 2 ) have been used widely across many education fields for several decades . however there are limitations with such assessments . stations often require trainees to perform isolated aspects of the clinical encounter , which deconstructs the doctor - patient encounter , and the type of cases that can be simulated constrain the type of patient problems can be used ( 3 ) . recent trends in medical education are moving rapidly away from gaining a certain number of marks in high - stakes examinations and towards gathering evidence of clinical competence and professional behavior on a daily basis in the workplace . for this reason , on - the - job workplace - based assessments ( wpba ) have been developed to assess workplace - based learning programs . this paper aims to serve as an introduction of wpba as an effective tool for evaluation of competence , complementing other more traditional and formal specialty examinations . we first describe the educational basis and background to wpba and then discuss three of the most commonly used tools . in miller 's framework for assessing clinical competence , the lowest level of the pyramid is knowledge ( knows ) , followed by competence ( knows how ) , performance ( shows how ) , and action ( does ) ( 4 ) . action focuses on what occurs in practice rather than what happens in an artificial testing situation . workplace - based methods of assessment target this highest level of the pyramid and collect information about doctors performance in their everyday practice . other common methods of assessment , such as multiple - choice questions target the lower levels of the pyramid ( 5 ) . experts believe that assessments of actual practice are much better reflections of routine performance than assessments done under test conditions . a study was carried out to evaluate the use of comprehensive wpba across the medical specialties in the united kingdom between year 2003 and 2004 , and it was recognised that these methods are feasible to conduct and can make reliable distinctions between doctors performances ( 6 ) . dops is designed to provide feedback on procedural skills essential to the provision of good clinical care . each dops should represent a different procedure and will normally be completed opportunistically during everyday work . the trainee chooses the timing , procedure and the observer , which may be experienced registrars , consultants or appropriate nursing staff who are competent in the procedure assessed . the assessment involves an assessor observing the trainee perform a practical procedure within the workplace ; and a structured checklist is designed to give guidance for the assessors . there are certain mandatory procedures to be covered for trainees at different stages of medical training , for example for newly qualified trainees ( first year residents ) : venepuncture , arterial blood sampling , urinary catherterisation , etc . behaviours observed in a dops include : demonstrating understanding of indications , relevant anatomy and techniqueobtaining informed consentdemonstrating appropriate preparation pre - procedureappropriate analgesia or safe sedationtechnical abilityaseptic technique ( if appropriate)seeking help where appropriatepost procedure managementcommunication skillsconsideration of patient / professionalismoverall ability to perform procedure demonstrating understanding of indications , relevant anatomy and technique obtaining informed consent demonstrating appropriate preparation pre - procedure appropriate analgesia or safe sedation aseptic technique ( if appropriate ) seeking help where appropriate post procedure management consideration of patient / professionalism overall ability to perform procedure the following are the main advantages of dops as a valid assessment tool : the trainee is assessed during everyday work performing procedures on real patients.not only the technical ability is observed , but also interaction with patients , colleagues and professional behaviors can be assessed.a range of skills , from simple to very complex procedures can be assessed.many trainees will need further development , so after receiving feedback , the strengths and weaknesses can be highlighted and the trainee can work on them and be assessed at a later date.there is a need to check that doctors procedural skills have been retained and are used appropriately within the context of everyday practice , dops is a suitable assessment tool for this purpose . the trainee is assessed during everyday work performing procedures on real patients . not only the technical ability is observed , but also interaction with patients , colleagues and professional behaviors can be assessed . , so after receiving feedback , the strengths and weaknesses can be highlighted and the trainee can work on them and be assessed at a later date . there is a need to check that doctors procedural skills have been retained and are used appropriately within the context of everyday practice , dops is a suitable assessment tool for this purpose . the mini - cex was developed by the american board of internal medicine to assess medical residents in real life settings . mini - cex is a 15-minute snapshot of doctor - patient interaction , designed to assess the clinical skills , attitudes and behaviors essential to the provision of high quality care . each of these encounters should represent a different clinical problem and trainees should sample from a wide range of problem groups with each focusing on specific aspects of the clinical encounter . it permits evaluation based on a much broader set of clinical settings and patient problems , and is administered on site ( 7 ) . the estimated time required is 20 minutes ( 15 minutes for assessment , 5 minutes for feedback ) . the areas of competence covered include : history takingphysical examinationprofessionalismclinical judgmentcommunication skillsorganisationefficiencyoverall clinical care overall clinical care the main strengths of mini - cex as an assessment tool are as follows : it can be used in different clinical settings : on the ward , on ward rounds , during on - call shifts , or in outpatient clinics.skills such as history taking , communication skills , physical examination and the management of patient problems can be difficult to assess reliably and in the past such assessment has been sub - optimal . mini - cex provides a practical solution within the workplace.because the interaction is relatively short and each trainee can be evaluated on several occasions , in comparison to the traditional long case examination , mini - cex assesses trainees in a much broader range of clinical situations , has better reproducibility , and offers trainees greater opportunity for instruction and feedback by more than one faculty member and with more than one patient.through being observed undertaking a number of cases , over a period of time , with a number of different assessors , these individual brief encounters add up to provide a reliable measure of a trainee 's performance.mini-cex format may produce less anxiety than the traditional formats , because the assessment is less formal and less dependent on a single , high - stakes encounter with one faculty member and one patient . it can be used in different clinical settings : on the ward , on ward rounds , during on - call shifts , or in outpatient clinics . skills such as history taking , communication skills , physical examination and the management of patient problems can be difficult to assess reliably and in the past such assessment has been sub - optimal . because the interaction is relatively short and each trainee can be evaluated on several occasions , in comparison to the traditional long case examination , mini - cex assesses trainees in a much broader range of clinical situations , has better reproducibility , and offers trainees greater opportunity for instruction and feedback by more than one faculty member and with more than one patient . through being observed undertaking a number of cases , over a period of time , with a number of different assessors , these individual brief encounters mini - cex format may produce less anxiety than the traditional formats , because the assessment is less formal and less dependent on a single , high - stakes encounter with one faculty member and one patient . on the other hand , mini - cex may be more difficult to administer because multiple encounters must be scheduled for each trainee . exclusive use of mini - cex also prevents trainees from being observed while doing a complete history and physical examination ( 8) . the cbd is a structured discussion between the trainee and educational supervisor about how a clinical case was managed by the trainee ; talking through what occurred and reasons for actions . normally before the discussion the trainee selects 2 ( or more ) cases and present copies of relevant clinical entries to the supervisor who selects one of them . the discussion should be framed around the actual case and should not explore hypothetical events . the trainee and the trainer should ensure that throughout the placement , a balance of cases is represented across varying contexts . the following are considered as the main advantages of cbd : cbd is a structured , in - depth discussion between the trainee and educational supervisor about decision - making and application of medical knowledge in cases for which the trainee has been directly responsible , so it can be used to explore professional judgment . by using clinical cases that offer a challenge to the trainee , rather than routine cases , the trainee is able to explain the complexities and the reasoning behind choices made.cbd can test higher order thinking and synthesis as it allows assessors to explore deeper understanding of how trainees prioritise and apply knowledge.it enables the discussion of the ethical and legal framework of practice.as actual patient records are the basis for dialogue , the assessor can also evaluate the quality of record keeping and the presentation of cases . cbd is a structured , in - depth discussion between the trainee and educational supervisor about decision - making and application of medical knowledge in cases for which the trainee has been directly responsible , so it can be used to explore professional judgment . by using clinical cases that offer a challenge to the trainee , rather than routine cases , the trainee is able to explain the complexities and the reasoning behind choices made . cbd can test higher order thinking and synthesis as it allows assessors to explore deeper understanding of how trainees prioritise and apply knowledge . it enables the discussion of the ethical and legal framework of practice . as actual patient records are the basis for dialogue , the assessor can also evaluate the quality of record keeping and the presentation of cases . workplace - based assessments should be part of a structured program of teaching that is designed for doctors in training and in each clinical placement , the teaching program should constitute the following essential steps : inductionsystematic teaching , based on the curriculumworkplace - based learning and assessmenton - going feedbackencouraging a holistic approach , reflective practice and life - long learning systematic teaching , based on the curriculum workplace - based learning and assessment encouraging a holistic approach , reflective practice and life - long learning junior doctors should be asked to carry out a certain number of assessments ( dops , mini - cex and cbd ) in each placement . the trainees performance and progression can be reviewed at the end of each training year from a portfolio of on - going workplace based assessments . workplace - based assessments create a self - directive learning environment that is essential for continuing professional development . a broad discipline of everyday clinical encounters that is very relevant to trainees overall curriculum can be assessed at workplace and the interaction between trainees and their assessors provides an invaluable learning experience . there are several common advantages that make wpba a suitable and reliable method for assessment of doctors in training : the trainee is responsible for selecting cases , requesting an assessment and proper completion of the paperwork , so it promotes active , learner - centered learning.assessment occurs as a natural part of the training environment , which minimises the artificiality of the task . in hospitals , there is plenty of opportunity to do wpba.assessors do not need to have prior knowledge of the trainee.the assessor 's evaluation is recorded on a structured checklist that enables provision of developmental verbal feedback to the trainee immediately afterwards . trainers and trainees can identify and agree strengths , areas for development and an action plan for each encounter.all of the areas in miller 's pyramid which describes an overall assessment framework that is relevant to medicine both as a cognitive and skills - based discipline can be explored through wpbas ( 6).wpba help identify trainees who are struggling and are in need of extra support early in training . the trainee is responsible for selecting cases , requesting an assessment and proper completion of the paperwork , so it promotes active , learner - centered learning . assessment occurs as a natural part of the training environment , which minimises the artificiality of the task . in hospitals the assessor 's evaluation is recorded on a structured checklist that enables provision of developmental verbal feedback to the trainee immediately afterwards . trainers and trainees can identify and agree strengths , areas for development and an action plan for each encounter . all of the areas in miller 's pyramid which describes an overall assessment framework that is relevant to medicine both as a cognitive and skills - based discipline can be explored through wpbas ( 6 ) . wpba help identify trainees who are struggling and are in need of extra support early in training . evidence collected will support the judgments made about the trainee at mid - placement and final reviews throughout the entire program of training .

recent trends in medical education are moving rapidly away from gaining a certain number of marks in high - stakes examinations and towards gathering evidence of clinical competence and professional behavior observed in clinical environments ( workplace - based learning ) . in the miller 's framework for assessing clinical competence , workplace - based methods of assessment target the highest level of the pyramid and collect information about doctors performance in their everyday practice . direct observation of procedural skills ( dops ) , mini - clinical evaluation exercise ( mini - cex ) and case - based discussion ( cbd ) are some of the most commonly used methods of workplace - based assessments . i explain these three methods of assessment and their advantages and discuss that if incorporated in a structured program of teaching for doctors in training , they can promote active , learner - centered learning and facilitate provision of developmental verbal feedback to the trainee immediately afterwards .

Introduction Educational basis of workplace-based assessments Direct Observation of Procedural Skills (DOPS) Mini-Clinical Evaluation Exercise (mini-CEX) Case-based Discussion (CbD) How to use workplace-based assessments Conclusion

since its introduction in 1991 , laparoscopic adrenalectomy ( la ) has rapidly become the procedure of choice for the surgical management of most adrenal tumors , and the indications for la have expanded since its first description . however , the use of la for pheochromocytomas is still controversial , and the role of this procedure continues to be undefined . furthermore , surgeons were initially hesitant to resect pheochromocytomas laparoscopically because of the potential hemodynamic effects of catecholamine secretion during pneumoperitoneum and tumor manipulation . the development of preoperative localization , the improvement of pre- and perioperative pharmacologic and anesthetic management , combined with maturation of laparoscopic techniques have led to more patients with pheochromocytoma being safely cured laparoscopically . on the other hand , for more surgeons , invasive adrenal carcinoma is an absolute contraindication for la , and whether la should be proposed for large ( > 6 cm ) or potentially malignant tumors is questionable . the risk of malignancy increases with the size of pheochromocytomas , but the size does not reliably predict malignancy in pheochromocytomas with local disease only . some authors have demonstrated that the laparoscopic approach for pheochromocytomas yields results comparable to those of open resection . others have reported series demonstrating the feasibility or results of la for large and potentially malignant tumors . the aim of this study was to evaluate the risks and outcome of la performed in our department with large ( > 6 cm ) and potentially malignant pheochromocytomas . during the last 8 years , 48 adrenalectomies , 36 of which were la , have been performed in our department in 47 patients . we selected 5 patients with large pheochromocytomas . in none of these patients did a preoperative investigation demonstrate invasive carcinoma or preoperative evidence of extraadrenal disease . the following data were recorded : patient 's age and sex , preoperative diagnosis , final size of tumor , intra- and postoperative complications , operation time , final histological diagnosis , and length of postoperative stay . the diagnosis of pheochromocytoma was based on elevated levels of vanillylmandelic acid and unexpected high levels of metanephrin or normetanephrin . the localization of the lesions was accomplished with high - resolution computed tomography ( ct ) , magnetic resonance imaging ( mri ) , and radio - labeled meta - iodobenzylguanidine ( mibg ) to exclude extraadrenal disease . all 5 patients received preoperative preparation with alpha - blockers ( phenoxybenzamine ) , and in 3 of them a combination of beta - blockers was administered for treatment of tachycardia . preoperatively , phenoxybenzamine was administered in a daily dose of 20 mg to 40 mg . the minimal duration of preoperative administration was 20 days , and the maximum was 30 days to obtain sufficient hemodynamic correction and blood volume expansion . restoration of intravascular volume was determined by the stabilization of arterial pressure for at least 2 weeks plus the absence of orthostatic hypotension and a 10% decrease in hematocrit ( hct ) values . the preferable surgical approach was the lateral transperitoneal laparoscopic procedure , placing the patient in the lateral decubitus position with the affected side up . this approach offers a large working space , easier removal of large tumors , and a facile conversion to open adrenalectomy if necessary , according to our department experience , which is over 130 adrenalectomies in the last 25 years . the incision in case of conversion was placed at the line formed by the 3 anterior trocar sites . during surgery , blood pressure was strictly monitored by arterial line , and intravenous alpha- and beta - blockade was administered as necessary . an abdominal drain was placed in all patients for 20 hours to 24 hours on the adrenal bed . the cohort included 2 males and 3 females with a median age of 48 years ( range , 29 to 64 ) . the localizationof pheochromocytomas was 4 in the right side and 1 in the left , the smallest located left . patient characteristics the adrenal gland had brown pigmentation , and the tumor was paraganglioma with local invasion behind the tail of the pancreas . conversion to open was decided upon after ligation of the adrenal vein because of intraoperative evidence of retroperitoneal invasion . postexcision tumor size measured 6.5 cm to 15.2 cm ( median , 10.8 ) , which represents the real one , but the maximal diameter at ct or mri and on histological examination was significantly different . so , at ct and mri the size of the lesions was estimated from 5.5 cm to 13 cm , which means a difference of 20% especially for the right - sided ones . on the other hand , the maximum diameter on histological examination was about 15% to 25% smaller ( 4.5 cm to 12 cm ) due to severe blood loss after tumor removal and dehydration due to formaldehyde solution ( table 2 ) . tumor characteristics the first step of la in all patients with right - sided lesions was dissection of the adrenal vein from its medial attachment from the inferior vena cava and then successful ligation of the adrenal vein with staples , which was rather easily recognized at the front surface of the mass . the diameter of the adrenal vein was about 2 mm to 5 mm , which is very small for these large pheochromocytomas . on the contrary , the veins of the adrenal bed formed a network of very large vessels draining behind the vena cava prespinally or to the renal vein . accordingly , this was the most difficult step of the excision with the highest risk of hemorrhage or capsular disruption . the mobilization of the gland from the inferolateral site to its anteromedial boundaries was very helpful and time saving , with minimal blood loss . vessel ligation performed through ultrasound scissors or endoscopic gastrointestinal approximator ( endogia ) stapler or laparoscopic clips even with monopolar electro diathermy wherever appropriate . no capsular disruption occurred during the tumor dissection , and the lesions were resected en block with the adrenal cortex . the median blood loss was > 150 ml ( range , 80 to 300 ) . no hypertension storm ( systolic blood pressure > 220 mm hg ) , tachycardia ( > 110 beats / min ) , before tumor removal , or severe hypotension , after vessel ligation , occurred , which was the result of the prolonged ( > 20 days ) and sufficient hemodynamic correction . conversion to open adrenalectomy was performed in 2 patients due to intraoperative evidence of malignancy . in the first patient after the adrenal excision , which was large ( 6 cm ) and macroscopically had brown pigmentation , histological examination revealed brown pigmentation of the adrenal gland , and malignant pheochromocytoma of resected paraganglion with a small invasion of the capsule and attached fat . in the second patient after ligation of the adrenal vein , there was evidence of vena cava and retroperitoneal invasion with major technical difficulties , so conversion to open adrenalectomy was decided upon ( 4th in table 1 ) . all patients were postoperatively normotensive , and intravenous administration of fluids lasted from 24 hours to 36 hours . the median length of stay was 3.5 days ( range , 2 to 5 ) . since its initial report , laparoscopic adrenalectomy has become the preferred approach for surgical adrenal disease . although pheochromocytoma was initially considered a contraindication to laparoscopy , la is evolving as the standard of care . increasing numbers of series support the safety and efficacy of la for pheochromocytoma . the combination of pneumoperitoneum and the catecholamine effects of pheochromocytomas during laparoscopy present a unique perioperative management challenge to maintain hemodynamic stability . it is well known that during laparoscopy carbon dioxide pneumoperitoneum increases intraabdominal pressure and thus reduces systemic venous return . furthermore , pneumoperitoneum may increase sympathetic tone and thus increase peripheral vascular resistance and operative risk of hemodynamic instability . inabnet et al directly compared intraoperative hemo - dynamic parameters for 22 patients undergoing adrenalectomy for pheochromocytoma by open and laparoscopic approaches . there was no significant change in cardiac index or left ventricular work , but they found increased numbers of intraoperative hypertensive events for patients undergoing laparoscopy . the majority of authors agreed that the adequate preoperative preparation with alpha blockers , for sufficient blood volume correction , combined with careful manipulation of the tumor , correct regulation of gas pressure ( 8 to 13 mm hg ) and successful management of problems by an experienced anesthetic team can reduce the release of adrenergic substances . it appears that a period of 10 days to 12 days for preoperative preparation with alpha - blockers is inadequate to restore blood volume . in large pheochromocytomas , we tried phenoxybenzamine administration for at least 20 days in low doses ( 20 mg to 40 mg ) . surprisingly , a significant drop in hct occurred ( 8% to 10% ) in all cases , indicating intravascular volume restoration . we believe that the importance of adrenal vein early ligation in large and right - sided pheochromocytomas is a myth . the adrenal vein in these lesions was always found at the front side of the mass and surprisingly not large in size ( 2 mm to 5 mm ) . so after the recognition and dissection of the inferior vena cava , the preparation and ligation of the adrenal vein was rather easy . particularly in all right - sided tumors , we observed that veins of the adrenal bed formed a remarkable network of very large vessels draining behind the vena cava prespinally or to the renal vein . this was the most difficult step of the excision with the highest risk of hemorrhage or capsular disruption . the mobilization of the gland from the inferolateral site to its anteromedial boundaries was very helpful and time saving , with minimal blood loss , and no capsular disruption . on the other hand , no severe hypotensive episode occurred after the total mass excision due to adequate intravascular volume expansion . the diagnosis of malignant pheochromocytoma can only be made reliably by the findings of local invasion , nodal or distal metastasis . no accurate histologic criteria for the diagnosis existed , and 2.5% to 26% of pheochromocytomas are malignant and are only identified during follow - up . malignant pheochromocytoma is more likely in extraadrenal locations ( 30% to 40% ) and tumors of 6 cm or larger . many surgeons have traditionally used a size greater than 6 cm as a contraindication to laparoscopic resection . some studies favor the opinion that laparoscopy can also be indicated for large and potentially malignant tumors.5 our data support this theory , and the size of the tumor has not been used as a criterion for exclusion of la . in cases with no preoperative evidence of extraadrenal disease , the possibility of malignancy can be proved only intraoperatively , if evidence of local invasion is found . so , in our series , all patients underwent la , and in 2 patients there was evidence of local invasion ( of the smaller and larger lesions ) . in experienced hands , la can be proposed for large pheochromocytomas without preoperative signs of malignancy with no difference in postoperative morbidity or mortality . conversion to open adrenalectomy should be performed if local invasion is observed during surgery or technical difficulties are encountered

background and objectives : the majority of surgeons consider large and potentially malignant pheochromocytomas an absolute contraindication for laparoscopic adrenalectomy ( la ) . the aim of this study was to evaluate the risks and outcomes of la in patients with this anomaly.methods:five patients ( 2 males , 3 females ) with large ( > cm ) pheochromocytomas were selected . preoperative investigation demonstrated no evidence of invasive carcinoma . all patients received alpha - blocker preparation for at least 20 days . laparoscopic adrenalectomy via a lateral transperitoneal approach was performed in all cases.results:patient's median age was 48 years , and the median tumor size was 10.8 cm . no capsular disruption and no hypertensive crises occurred during the operation . the median operating time was 148 minutes and blood loss was < 150 ml . conversion to open adrenalectomy occurred in 2 patients owing to intraoperative evidence of carcinoma . no postoperative morbidity or mortality occurred . all patients are disease free after a median follow - up of 13 months.conclusions:in experienced hands , la can be proposed for large and potentially malignant pheochromocytomas . conversion to open adrenalectomy is mandatory if local invasion , capsular disruption , or technical difficulties are observed during the operation .

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSION

one alternative to treating bacterial infections in aquaculture is to use antibiotics during cultivation , as is common in shrimp aquaculture . enrofloxacin , oxytetracycline , and florfenicol are among the most commonly used antibiotics during shrimp cultivation and are commonly mixed into food pellets ; however , the inappropriate use of these compounds can result in accumulation of residual antibiotic in tissue and contribute to the emergence of resistant bacteria via residual antibiotics persisting in the sediment . enro is a fluoroquinolone ( fq ) , nalidixic acid derivative with broad - spectrum activity against gram - negative bacteria . the core structure is a dihydroquinoline or 4-quinolone ring ; this structure is lipophilic and has a low molecular weight , promoting tissue penetration . although the mechanism of action is known , the pharmacokinetics and resultant bioavailability of this antibiotic in shrimp aquaculture are poorly understood . more data are needed to determine the optimal drug dosage for use in shrimp farming and to establish the levels of enro accumulation in organs . this knowledge is crucial to establish the presence of residues in shrimp tissue , thus reducing the risks of sediment accumulation and emerging bacterial resistance . studies have been done on the pharmacokinetics of enro and cipro in other species , such as , crab ( scylla serrata ) , fish ( oreochromis niloticus ) , black shrimp ( penaeusmonodon ) , chinese shrimp ( penaeus chinensis ) , and bass ( dicentrarchus labrax ) [ 36 ] . these results , however , should not be extrapolated to l. vannamei , as the metabolic differences between species and the environmental conditions in which an organism grows can influence on the kinetic behavior of enro . the recent growth of shrimp farming in northwestern mexico has created a need for research on the safe and effective use of enro in shrimp aquaculture . to that end , this study aims to determine in vivo , under controlled conditions ( in a laboratory ) and semicontrolled conditions ( on a shrimp farm ) , the accumulation and distribution of enro in the muscle and hepatopancreas of l. vannamei , as well as the time needed after exposure to eliminate the antibiotic from the shrimp 's tissue . high purity ( 99.9% ) enro and cipro ( riedel - de - haea , vetranal , usa ) were used in the analysis . the active ingredient enro - blend aqua was prepared by avimex laboratory ( mexico ) and was added to the shrimp feed by a food manufacturer to a final enro concentration of 200 mg / kg . this study was conducted with three replications , using healthy subadult white shrimp , litopenaeus vannamei with weight to 15 - 16 g. the physiochemical parameters evaluated in the study , including temperature , dissolved oxygen ( with an oximeter , ysi 55 ) , ph ( with a potentiometer , phep hanna ) , and salinity ( with a refractometer , vitalsine sr6 ) . measurements were made at 4:00 and 16:00 h. the laboratory assay was conducted in the laboratory of marine invertebrate physiology , research center for food and development ( ciad ) , and a farm study was conducted on a commercial farm . the experiments were performed under similar conditions in bahia de kino sonora , mexico and each lasted 30 days . six 450 l - capacity tanks were filled with natural seawater , and a closed recirculation system replaced the water daily . each tank was stocked with 35 randomly selected shrimp , per 12 liters of water . the other three tanks were used as controls , and shrimp in these tanks received a diet free of antibiotics . the tanks were connected to a water recirculation system , with a seawater concentration of 36 , a 12-hour photoperiod , and a system to provide constant aeration . temperature , dissolved oxygen ( oximeter ysi 55 ) , salinity ( acuatic eco - systems ) , total ammonia ( fotometer ecosense , mod.9500 ) , and ph ( potentiometer , mettler toledo , seven easy ) were measured daily . the shrimp were fed three times a day , at 8:00 , 13:00 , and 18:00 h. this study was conducted on a shrimp farm in the state of sonora , mexico . three ponds measuring 6 to 7 ha each was selected in different sections of the farm under the assumption that these ponds had not been previously given antibiotics . white shrimp ( l. vannamei ) was used to stock the ponds to a density of 32 shrimp per m. before the studies were carried out , levels of enro were confirmed in the medicated and unmedicated feed . the extraction and chromatographic analyses for these tests was conducted using the methodology proposed by houglum et al . . the medicated feed was administered over a period of 14 days ( treatment phase ) . subsequently , the antibiotic - free diet was administered for 16 days ( elimination phase ) . shrimp samples were taken on days 1 , 2 , 4 , 6 , 8 , 10 , 12 , and 14 during both the treatment and elimination stages , with an additional sampling at day 16 of the latter phase . approximately 1 kg of shrimp was collected in the farm study , and 2 shrimps were collected from each tank in the laboratory study . the samples were stored at 20c until they were analyzed . a 0.5 g feed sample and 25 ml of acetonitrile mixture ( 0.02 m phosphoric acid at ph 3 , 80 : 20 , v / v ) were vortexed ( baynstead thermolyne type 37600 , usa ) for 1 min . the tubes were then sonicated for 25 min ( cole - parmer mod 8895-dth . chicago , il , usa ) and mechanically stirred for 30 min at 34 g ( kika labortechnik ks501 ds1 , germany ) . next , samples were centrifuged at 2054 g and 15c for 15 min ( beckman coulter allegra 6r . the supernatant was filtered through glass fiber ( whatman gf / a ) , and the filtrate was collected in a 50 ml polypropylene tube . fifty microliters of the filtered extract was adjusted to 10 ml with the mobile phase . subsequently , the samples were injected into the liquid chromatograph , which was equipped with a fluorescence detector . the limit of quantitation ( lq ) was 0.001 g / g for enrofloxacin and 0.01 g / g for ciprofloxacin . sampled shrimp were decapitated , and the cuticle was removed manually ; the muscle was placed in properly labeled containers . shrimp muscle was homogenized in a phillips food processor ( mod.hr 2875/am , mexico ) . subsequently , antibiotic analysis was done according to the methodology proposed by kirbi et al . this procedure consisted of weighing 2.5 g of shrimp muscle , to which 1.5 ml of trizma base solution ( ph 9 ) was added . the tissue was homogenized with a glass rod followed by one min of vortexing ( baynstead thermolyne type 37600 , usa ) , after which the mixture was allowed to stand for 15 min . 4 ml of reagent grade acetonitrile ( j. t. baker ) was added , and the mixture was vortexed . the samples were sonicated for 15 min and centrifuged at 2054 g for 30 min . the supernatant was removed with a pasteur pipette and placed in a 15 ml centrifuge tube , after which the extraction was repeated with an additional 4 ml of acetonitrile to remove the supernatant and collect the extract . the supernatant was evaporated in a water bath at 4550c ( vwr scientific products , mod 1202 , series 180 , usa ) with constant airflow , to a total volume of 2.5 ml . fat was removed from the extract by adding 1.5 ml of reagent - grade hexane ( j. t. baker ) . was then centrifuged at 2054 g for 30 min at 15c . the remaining aqueous phase was filtered using a syringe attached to an acrodisc ( 0.2 m ; lc13 pvdf , fisher scientific , pittsburgh , pa , usa ) . the extract was placed in a 4 ml amber vial for injection into the liquid chromatograph . the extracted hepatopancreas was homogenized , and enro and cipro analyses were performed per the technique described by tang et al . . this method consisted of weighing 0.5 g of hepatopancreas in a 15 ml centrifuge tube and adding 1 ml of a mixture of 1 m nacl : 0.2 m kh2po4 ( 50 : 50 , v / v ) at ph 7.4 ; the mixture was then stirred and allowed to stand for 15 min . next , 5 ml of reagent - grade dichloromethane ( j. t. baker ) was added , and the mixture was stirred for 1 min and sonicated for 15 min . g for 30 min at 15c . the lower layer of dichloromethane was removed by pasteur pipette and transferred to a 15-ml glass centrifuge tube . an additional 5 ml of dichloromethane was added to each tube , and the samples were agitated in a mechanical shaker at 200 rpm for 5 min ( kika labortechnik ks501 digital , germany ) and centrifuged for 20 min at 2054 g and 15c . the lower layer of dichloromethane was then removed and transferred to the tube containing the extract . the extracts were reconstituted with 4 ml of a mixture of 1 m nacl : 0.2 m kh2po4 at ph 7.4 ( 50 : 50 , v / v ) , stirred , and 4 ml of reagent - grade hexane was added and agitated for 1 min . this mixture was centrifuged at 2054 g for 30 min at 15c , and the top hexane layer was removed . the extract was then filtered using a plastic syringe attached to an acrodisc ( pore size 0.2 m ) . subsequently , the extract was filtered and transferred to a plastic syringe attached to an acrodisc ( pore size of 0.2 m ) . the extract was placed in an amber vial and stored until it was injected into the liquid chromatograph , which was equipped with a fluorescence detector . the recovery rate for the extraction technique was 89.79 11.88% for enro and 86.91 9.86% for cipro . we used a varian mod 9010 liquid chromatograph coupled to a varian prostar 410 auto sampler ( varian instruments inc . , palo alto , ca , usa ) and a c18 column ( supelco inc . , bellefonte , pa , usa , 5 m , 150 4.6 mm i d ) . the mobile phase consisted of 0.02 m phosphoric acid at ph 3 and acetonitrile ( 80 : 20 , v / v ) , with an isocratic flow of 1 ml / min . a varian mod 9070 fluorescence detector ( varian instruments inc . , palo alto , ca , usa ) , set to an excitation wavelength of 280 nm and emission of 440 nm , was also used . before the antibiotic - supplemented feed was given to the shrimp , enro levels in the feed were measured at 200.8 mg / kg by liquid chromatography ( figure 1 ) . the retention time was 3.174 min , which matches the retention time of the enro standard used as a reference . in the laboratory bioassays , the average tank salinity was 36.8 0.8 ; average ph was 7.8 0.1 ; temperature was maintained at 28.6 0.2c , and dissolved oxygen was 3.68 0.8 mg o2/l . table 1 shows the average of the physicochemical parameters of each of the three ponds used in the farm study . figure 2(a ) shows the kinetic behavior of enro in shrimp muscle under both laboratory and farm conditions , during the treatment and withdrawal stages . the highest levels of antibiotic were detected 10 days after the initial application under laboratory conditions and 12 days after application in the farm study . figure 2(b ) shows the withdrawal time , which is the time required to achieve levels below the lowest measureable concentration ( lq ) of the antibiotic ( 0.001 g / g for enro and 0.01 g / g for cipro ) . enro had a withdrawal time of 12 days under laboratory conditions and 14 days in the farm . figure 3(a ) shows the kinetic behavior of cipro in shrimp muscle in laboratory and farm during the treatment stage . treatment - phase and elimination - phase cipro levels obtained under laboratory and farm conditions are shown in table 2 . the greatest accumulation of cipro in the laboratory study was detected eight days after initial treatment , whereas the farm study required 12 days to reach maximum accumulation . in the elimination stage , the laboratory and farm withdrawal time based on the lq ( 0.01 g / g ) values were , respectively , 2 and 10 days ( figure 3(b ) ) . figure 4(a ) shows the kinetic behavior of enro in the shrimp hepatopancreas under laboratory and farm conditions . enro and cipro accumulation values during enro therapeutic treatment through medicated feed for 14 days are shown in table 2 , with enro cmax values reached at 12 days after the start of dosing . under laboratory and farm conditions , the maximum enro level found was reached at day ten . figure 4(b ) shows the elimination stage ; under laboratory conditions , residual enro was still detected in the hepatopancreas at an average level of 0.013 0.009 g / g 14 days after stopping treatment . in the farm , enro levels fell below the lq 10 days after treatment . figure 5(a ) shows the kinetic behavior of cipro in the shrimp hepatopancreas in both laboratory and farm treatments . under laboratory conditions , cipro cmax was reached after eight days of treatment ; under farm conditions , cmax was reached after 12 days of treatment . the withdrawal time values for the laboratory and farm treatments were 6 and 4 days , respectively . enro accumulation in muscle tissue was 33% lower in the farm study compared to the laboratory study and 55% lower in the hepatopancreas . the accumulated concentration of cipro was 66% lower under farm conditions than in the laboratory in both muscle and hepatopancreas tissue . salinity , ph , temperature , and dissolved oxygen ( do ) influence the pharmacokinetic behavior observed in the laboratory and in the farm . alzieu showed that variations in salinity influence fundamental reproductive functions , such as , gametogenesis as well as nutrition and growth of aquatic species . hunt proposed that the ideal salinity for shellfish cultivation is 33. this value was approximately the average salinity maintained in the laboratory and farm studies ( 36.8 0.8 and 36.4 0.13 , resp . ) . the variability in salinity values recorded may be due to latitude , climate , and , local hydrological characteristics . boyd reported that most aquatic organisms tolerate a ph range of 6 to 9 . the average ph in the farm and laboratory studies was 8.21 0.06 and 7.8 0.10 , respectively , which is within the recommended range for shrimp cultivation . extremely high or low ph conditions can kill over 50% of a shrimp population in the juvenile stage and dramatically reduce their movement through excess ammonia accumulation and the inability to transport oxygen . extreme ph values , combined with pollutants , such as , heavy metals , unionized ammonia , hydrogen cyanide , or hydrogen sulfide , can create a highly toxic environment . swingle reported that ph values below 4 and above 11 can cause fish death or at best , reduce survival rates and overall production . alzieu reported that increased temperature increases metabolism , and that the extra energy requirements are met through the consumption of additional food . the ideal temperature is 28 3c ; the average temperature measured in the farm was within the recommended range , with morning temperatures averaging 29.26 0.24c and afternoon temperatures averaging 31.29 0.30c . in the laboratory , dissolved oxygen levels in the farm averaged 3.17 0.30 mg o2/l in the morning and increased to 6.78 0.89 mg o2/l in the afternoon . alzieu has reported that water has a lower oxygen concentration at night than in the morning , when photosynthesis provides a surplus of oxygen ; this oxygen then dissipates into the atmosphere or is consumed during the process of respiration . fry noted that an aquatic organism can tolerate low oxygen levels for several hours without apparent effect of damage but may die if the condition is prolonged . low oxygen levels make these organisms more susceptible to pests and diseases , and plumb et al . have reported that low oxygen content could affect an organism 's ability to feed and grow . jiang et al . studied the effect of different concentrations of dissolved oxygen on l. vannamei and found that the ideal level of dissolved oxygen is between 3.57.5 mg o2/l . if the level is less than 3.5 mg o2/l , the organism may develop hypoxia . in the laboratory , dissolved oxygen content remained constant at 3.68 0.8 mg o2/l , which is within the recommended range . in addition , there was no decrease in the consumption of food by the organisms because of inadequate dissolved oxygen concentrations . in farm measurement of antibiotic accumulation in shrimp tissues showed that the highest levels of enro and cipro were found under laboratory conditions . this difference is likely a result of the controlled , closely monitored physicochemical parameters , and diet in the laboratory . in the farm study , these conditions were more variable , and the cultured shrimp had alternative food sources , such as plankton . this discrepancy reflects the importance of considering extraneous variables by performing both study types . tu et al . conducted a study using black shrimp ( penaeusmonodon ) under farm and laboratory conditions ; enro was administered throughout the study at a dose of 4000 mg / kg for 7 days . the average concentrations of enro in muscle tissue were 0.44 0.27 g / g in the laboratory and 0.10 0.01 g / g in the farm experiment , with rapid dissipation after treatment finished . this study , however , did not include a measurement of accumulated enro in the hepatopancreas and cipro concentration , even though cipro is reported to have antimicrobial activity . furthermore , the discrepancy in accumulated enro between the farm and the laboratory was 22.7% , less than the 33% found in our study . several factors influence the kinetic behavior of antibiotics , including the cultivated species , the route of drug administration , the dosage used , and the rates of drug accumulation and elimination [ 36 ] . xu et al . reported that at an enro dose of 50 mg / kg administered to chinese shrimp for 7 days , enro accumulation in muscle was 1.68 g / g and cipro accumulation was 0.07 g / g , and withdrawal time in muscle was 12 and 3 days for enro and cipro , respectively . tu et al . showed that a diet supplemented with 4000 mg / kg of enro in commercial l. vannamei ponds for 7 days led to lower levels of accumulated antibiotic in the muscle . this difference may be due to the lower bioavailability of the antibiotic in the marine environment . the seawater cations form complexes with quinolones reduce the capacity of shrimp to absorb the antibiotic . for this reason , a higher dose and longer treatment time are required when antibiotics are applied to marine organisms . another factor that influences the kinetic behavior of antibiotics is the individual response to the drug . when shrimp are sick or molting , they stop feeding , which reduces the accumulation of antibiotics in their systems . de oliveira cesar et al . reported that shrimp more than one - month - old have molting cycles of 4.6 0.5 days / cycle ; at ages 3 and 6 months , the shrimp have molting cycles of 11.8 1.7 days / cycle and 17.2 2.7 days / cycle , respectively . other authors have proposed eliminating enro and cipro use in shrimp cultivation , based on clearance times between 3 and 12 days [ 3 , 6 ] . these data are similar to those found in our study ( 2 to 14 days in the hepatopancreas and muscle ) . enro is cleared faster from the hepatopancreas than from the muscle , although enro and cipro reach higher concentrations in the hepatopancreas . this apparent discrepancy is due to the metabolic functions of the shrimp hepatopancreas , which are similar to those of the kidneys and stomach in other organisms , increasing metabolism and speeding drug clearance . a comparison of antibiotic levels in shrimp tissue with the minimum inhibitory concentrations ( mic , 0.25 to 10 g / ml ) for strains of vibrio bacteria isolated from the same shrimp ponds [ unpublished data ] indicates that insufficient antibiotic was accumulated for bacterial inhibition . a study of the antimicrobial sensitivity of 144 strains of vibrio isolated from shrimp culture systems showed that the bacteria had a mic of 0.5 g / ml . mohney et al . reported mic values for the same antibiotic ( 0.45 g / ml ) that were similar to those found in this study . although none of the fluoroquinolones are approved in the united states for use as aquaculture therapeutic agents , the potential for their extralabel use is of concern . the interest indicated by the aquaculture industry in these drugs and potential for the emergence of drug - resistant bacteria through their use have created a need for make studies about this compound . the generated date on concentration of enro and cipro in shrimp tissues can be used to help estimate if the use to this fq is adequate in seawater , considering environmental factors of the region in the shrimp cultured .

this study aimed to quantify the accumulation and elimination of enrofloxacin ( enro ) and ciprofloxacin ( cipro ) in cultivated litopenaeus vannamei under controlled laboratory and farm conditions . laboratory- and farm - raised shrimp were given feed supplemented with 200 mg / kg enro for 14 days , followed by a 16-day diet without antibiotics . the levels of enro and cipro were analyzed by high performance liquid chromatography ( hplc ) . in the laboratory , enro concentrations in the muscle and hepatopancreas reached a maximum ( cmax ) of 0.54 0.26 g / g and 3.52 1.9 g / g , respectively ; cmax values for cipro in the laboratory were 0.18 0.13 g / g ( muscle ) and 1.05 0.20 g / g ( hepatopancreas ) . in farmed shrimp , cmax values for enro were 0.36 0.17 g / g muscle and 1.60 0.82 g / g in the hepatopancreas ; cipro cmax values were 0.03 0.02 g / g ( muscle ) and 0.36 0.08 g / g ( hepatopancreas ) . two to fourteen days were necessary to eliminate both antibiotics from muscular tissue and four to more fourteen days for complete elimination of the antibiotics from the hepatopancreas . these results should be considered in terms of minimum concentrations necessary to inhibit vibrio bacteria to determine whether the current use of this antibiotic is effective in controlling disease .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

erythema multiforme ( em ) is an acute self - limited polymorphous eruption , probably mediated by deposition of immune complex in the superficial microvasculature of the skin . about 50% of em cases are triggered by identifiable factors , that include drugs ( 20% of cases ) and a viral or bacterial agent ( i.e. , herpes simplex and mycoplasma pneumoniae ) . approximately half the cases are idiopathic.[13 ] most commonly involved drugs include anticonvulsants , phenothiazines , nonsteroidal anti - inflammatory drugs , penicillins , and sulfonamides.[14 ] em minor presents with mildly itchy , erythematous , expanding macules or papules that may coalesce and become generalized . target lesions a 34-year - old - woman was referred to our department because she had developed a macular papular eruption involving the face , neck , arms , and trunk [ figure 1 ] . the day before , the patient had been treated with oral prednisone and loratadine at the emergency room . detailed clinical history did not reveal any significant medical disease , allergy , or skin manifestation . twelve days before , she had started consuming a slimming drug preparation ( 2 or 3 pills twice a day before meals ) and pilosella tincture ( 40 drops / day ) , which is a herbal remedy used in cellulitis and obesity due to its diuretic properties . the chemical composition of slimming preparation was pseudoephedrine hydrochloride 50 mg , theobromine 30 mg , caffeine 2 mg , vitamin c 100 mg , clorazepate dipotassium 1 mg , dehydrocholic acid 160 mg , magnesium stearate 2.4 mg , precipitated silica 0.8 mg , talc 0.8 mg , pregelatinized starch 156 mg . we suggested her to discontinue these drugs and we performed allergological investigations on 4-weeks control . on this occasion , lesions had completely resolved , leaving moderate postinflammatory hyperpigmentation , especially on the neck area [ figure 2 ] . patch tests ( pt ) performed with the sidapa 2005 standard series showed negative reactions . after 8 days we applied the second pt using the galenic preparations of the two drugs [ figure 3 ] : the pills were pulverized and then incorporated in vaseline 1% , and pilosella tincture was mixed in vaseline 1% too . pills - pt tested positive on day 2 ( + / ) and 4 ( + ) and negative on day 6 . intradermal test and oral challenge test were not performed : the patient 's mother , who was her guardian , refused because of the potential risk of immunologic reactions . the laboratory tests showed normal blood cell count , protidogram , and liver enzymes , along with mildly elevated erythrocyte sedimentation rate . the serological results excluded infections from hsv-1 , hsv-2 , ebv , and coxsackie virus a and b , borrelia burgdorferi , mycoplasma pneumonia , and klebsiella pneumoniae . given the absence of target lesions , a skin biopsy of a shoulder lesion was also carried out . histopathological findings of an inflammatory pattern characterized by high - density lichenoid infiltrate rich in t cells , lymphocytes at the dermoepidermal junction , satellite cell necrosis , vacuolar degeneration of the basal layer , and dermal edema were suggestive of an em - type drug eruption[13 ] [ figure 4 ] . the patient at presentation time : ( a ) face and neck involvement ; and ( b ) trunk and arms involvement ( a ) the patient at 1 month control , after having discontinued the slimming drug ; and ( b ) the patient at 1 month control , after having discontinued the slimming drug galenic preparations of the slimming drugs : pilosella tincture and thermogenic pills lesional biopsy of shoulder skin showing lymphocytic infiltrate at the dermal - epidermal interface and superficial dermis and vacuolar degeneration of the basal layer , likely a type of erythema multiforme eruption on 2 , 6 , 12 month follow - up , the patient had no more assumed slimming pills and similar eruptions never occurred . the clinical history , the diagnostic investigations results and the 1-year follow - up findings indicate slimming pills as the triggering agent of the erythema multiforme -like eruption , excluding idiopatic em . those slimming pills are also known as food integrators with thermogenic activity , as they contain agents that are claimed to stimulate thermogenesis and increase metabolism and lipolysis ( ie , pseudoephedrine hydrochloride [ psh ] , theobromine [ tb ] , and caffeine [ cf ] . the role of vitamin c ( vc ) is to hypothetically reduce the effects of the free radicals generated by lipolysis , whereas clorazepate dipotassium ( clp ) aims to mitigate possible side effects of psh . the remaining substances ( ie , magnesium stearate , precipitated silica , talc and pregelatinized starch ) act as thickeners or as excipients . when considering these components , we focused our attention on those who were more likely to have immunogenic potential . based on literature reports , we excluded cf , vc , and the four excipients / thickeners from analysis . some reports indicate psh as the cause of severe skin reactions , including recurrent pseudoscarlatina and nonpigmenting fixed drug eruption . tb ( 3,7-dimethyl-2,3,6,7-tetrahydro-1h - purine-2,6-dione ) , a methylxanthine , is a precursor molecule to pentoxifylline ( 3,7-dimethyl-1-(5-oxohexyl)-3,7-dihydro-1h - purine-2,6-dione ) . pentoxifylline was reported to be associated with em in 12 people over the last 13 years . in addition , theophylline ( 3,7-diidro-1,3-dimetil-1h - purina-2,6-dione ) , which is an isomer of tb , figures in the list of em - related drugs . given the chemical similarity between these three methylxanthines , we can hypothesize that the immunogenic potential of tb is similar to that of pentoxifylline and theophylline . there are some reports of em appearing after intake of benzodiazepines and tetrazepam , which is structurally similar to clp . during the last 12 years , 97 cases of em have been related to clp use : these cases were observed among a total of 4290 people who experienced clp side effects . there are no reports specifically about em caused by a slimming drug preparation , and no studies have identified thermogenic stimulant pills as cause of either adverse skin reactions or em / em - like eruption . our patient 's eruption probably resulted from the interaction between these four potentially immunogenic components ( ie , psh , clp , tb , and dha ) . although tb has not been related with em or em - like eruption yet it could be considered as a possible cause , given its similarity with the other em - associated methylxanthines . finally , psh and dha , which potentially cause rash and macular or papular rashes , may have contributed to the skin eruption too . thus , our patient 's adverse reaction is likely to result from a possible summation effect : each component may have stimulated an immune response with different intensity and this interaction can have triggered the eruption development . we then suggest that weight - loss compounds in slimming preparations should be kept in mind as a possible cause of drug - induced em - like eruption . this would be particularly important in those countries where obesity is becoming a significant problem .

we report a case of a 34-year - old woman presenting with an erythema multiforme ( em)-like eruption . lesions developed after a 12-day treatment with a slimming drug preparation ( food integrator with thermogenic activity ) and a herbal remedy ( pilosella tincture ) . serological investigations excluded viral or bacterial infections . patch testing with galenic preparations of both drugs demonstrated sensitization to the slimming drug preparation . according to literature reports and immune - chemical properties , those components that are likely to have triggered the skin eruption are clorazepate dipotassium and theobromine . their interaction with other two constituents such as pseudoephedrine hydrochloride and dehydrocholic acid may have caused the adverse reaction by means of a summation effect . there are no reports specifically about em caused by a slimming drug preparation and no studies have identified thermogenic pills as cause of em / em - like eruption . weight - loss compounds in slimming preparations should be kept in mind as a possible cause of drug - induced em - like eruption .

INTRODUCTION CASE REPORT DISCUSSION

primary sjgren 's syndrome ( pss ) is a systemic autoimmune disorder that affects secretory organs and is characterized by ocular and mouth dryness , fatigue , and pain , as well as extra - glandular manifestations that reveal the severity of this disorder [ 1 , 2 ] . patients with pss also present broad spectrum analytical features ( cytopenias , hypergammaglobulinemia , and cryoglobulins ) . biological signatures of the disease are b - lymphocyte activation , which could be triggered by the dysregulation of b - cell activating factor ( baff ) . one of the objective classification criteria for pss is serum ssa / ssb antibodies ( abs ) . recent research studies suggest that these antibodies may also be the biomarkers of disease activity . some studies indicate that anti - ssa / ssb seropositive patients have the increased amount of b - cell activation markers , such as baff , free immunoglobulin light chain , beta-2 microglobulin , and igg [ 37 ] . thus , the spectrum of the disease ranges widely from minimal local symptoms of the eyes and oral mucosa to systemic involvement and development of malignant lymphoma ; the latter are being the most worrisome complication of pss . recently , much attention has been focused on the relationship between innate responses and subsequent activation of specific adaptive - immunity in an attempt to understand subsequent immune dysregulation [ 810 ] . specific cytotoxic lymphocyte populations can lead to the formation of autoimmune diseases , whereas suppressive / regulatory cell populations may lead to suppression of autoimmunity and disease remission [ 11 , 12 ] . the aim of the study was to perform a detailed quantitative analysis of peripheral blood cd4 and cd8 t lymphocyte subpopulations in patients with sjgren 's syndrome with special emphasis on treg , th17 , nkt lymphocytes , nk cells , and b cells and expression of cd57 and cd27 markers on cd8 lymphocytes . in total , 52 patients with pss and 28 healthy controls were recruited at the state research institute center for innovative medicine for this study . patients with pss were grouped in two groups : pss abs group , 29 without anti - ssa and/or anti - ssb abs , and pss abs group , 23 patients with anti - ssa and/or anti - ssb abs . the average age of the patients groups and healthy controls was accordingly : 57 13 years , 56 13 years , and 53 11 years . the majority of enrolled patients in our study were lithuanian women . only 1 lithuanian man ( 1 in pss abs group ) nobody of the control group had connective tissue diseases , anti - ssa or anti - ssb abs . primary ss was diagnosed according to american - european consensus group classification criteria for sjgren 's syndrome . all patients underwent serologic evaluations , which included test for the presence of antibodies against ssa and ssb , schirmer 's i test , unstimulated whole salivary flow test , and histology of minor salivary glands . disease activity was assessed using eular sjgren 's syndrome disease activity index ( essdai ) and eular sjgren 's syndrome patient reported index ( esspri ) . the characteristics of the pss patients included in the study are summarized in table 1 . informed and written consent was obtained from all participants of this study . the study has been approved by the lithuanian bioethics committee ( no . 158200 - 03 - 299 - 73 ) . absolute counts of white blood cells ( wbc ) were determined with a haemocytometer and used for calculation of absolute numbers of lymphocyte populations ( numbers of cells/l peripheral blood ) . for cell surface staining , the following mabs were used : anti - cd3 fitc ( exbio , czech ) ; anti - cd4 percp ( bd , usa ) ; anti - cd8-percp ( bd ) ; anti - cd-16 + 56-pe ( exbio , czech ) ; anti - cd-19 percp ( exbio , czech ) ; anti - cd57 fitc ( bd , usa ) ; and anti - cd27-apc ( exbio , czech ) . for isotype controls staining , mouse anti - igg1-fitc ( bd , usa ) , igg1-percp ( bd , usa ) , and igg2a - pe ( bd , usa ) were used . cell staining was followed by red blood cell lysis using pharm lyse ( bd , usa ) lysing solution for 15 min at room temperature in the dark . leukocytes were then centrifuged ( 500 g for 10 min ) and washed two times with cellwash ( bd , usa ) and resuspended in fbs ( bd , usa ) . samples were examined immediately after staining without fixation . for the evaluation of intracellular cytokine il-17a of cd4 t cells , 1 ml of whole heparinized blood was diluted 1 : 2 in rpmi-1640 supplemented with 80 mg / l gentamycin and 2 nm glutamine . cells were stimulated using 50 ng / ml phorbol - myristate - acetate ( sigma aldrich , st . louis , mo , usa ) and 1 ng / ml ionomycin ( sigma aldrich ) in the presence of 0.7 l / ml monensin ( golgistop ( bd , usa ) ) for 4.5 h at 37c in an atmosphere containing 5% co2 . following stimulation , cells were stained for cd4 for 30 min at room temperature . cell staining was followed by red blood cell lysis using pharm lyse ( bd , usa ) lysing solution for 15 min at room temperature in the dark . leucocytes were then centrifuged ( at 500 g for 10 min ) and washed two times with cellwash ( bd ) . ( bd , usa ) solution for 20 min , washed two times with perm / wash ( bd , usa ) solution , and incubated further for 30 min in the dark with the specific mabs anti - il17a apc ( bd , usa ) and isotypic control anti - igg1 apc ( bd , usa ) . following the incubation with mabs , the cells were washed two times with perm / wash solution and resuspended in fbs ( bd , usa ) . for the evaluation of intracellular foxp3 marker of cd4 and cd8 t cells , cells were stained with anti - cd4 percp ( bd , usa ) , anti - cd25 fitc ( exbio , czech ) , and anti - cd8-percp ( bd , usa ) for 30 min at room temperature . cell staining was followed by red blood cell lysis using pharm lyse ( bd , usa ) solution for 15 min at room temperature in the dark . leucocytes were then centrifuged ( at 500 g for 10 min ) and washed two times with cellwash ( bd , usa ) . then , cells were fixed and permeabilized with cytofix / cytoperm ( bd , usa ) solution for 20 min , washed two times with perm / wash ( bd , usa ) solution , and incubated further for 30 min in the dark with the specific mabs anti - foxp3-pe ( bd , usa ) and isotypic controls anti - igg1-fitc ( bd , usa ) , igg1-percp ( bd , usa ) , and igg2a - pe ( bd , usa ) . following the incubation with mabs , ( bd , usa ) solution and resuspended in fbs ( bd , usa ) . flow cytometry was performed on facscalibur flow cytometer ( bd biosciences , san jose , ca , usa ) calibrated with calibrite beads ( bd biosciences , san jose , ca , usa ) using cell - quest software ( bd biosciences , san jose , ca , usa ) . serum samples were analyzed using commercial baff , soluble ( human ) elisa kit ( hypersensitive ) ( adipogen , switzerland ) . from collected blood samples , serum dilutions and enzyme - linked immunoassay was carried out in the strict accordance with the manufacturer 's instructions and sets recommendations . a regression analysis was performed to derive an equation that was then used to predict the concentration of the unknown samples with gen5 microplate data collection & analysis software ( biotek instruments , usa ) . correlations were assessed by the spearman 's rank test using standard program graphpad prism 5.0 software ( graphpad software , san diego , ca , usa ) . we found that absolute count of cd3 t cell population was significantly decreased in pss patients in comparison to healthy controls . no differences were observed between pss groups . significant decrease of cd3 cells was found in pss abs ( p = 0.027 ) and pss abs ( p = 0.0002 ) groups when compared to controls ; however , no differences in the cd3 cells proportion of wbc were found between pss groups . analysis of cd4 t cell population showed significant proportion differences in pss abs patient 's blood when compared to pss abs ( p = 0.036 ) and control group ( p = 0.0036 ) . but absolute counts of cd4 cells were significantly lower in both pss groups than in control group , pss abs ( p = 0.015 ) and pss abs ( p < 0.0001 ) , and also absolute counts of cd4 cells were significantly lower in pss abs than in pss abs ( p = 0.01 ) patients ' blood . no significant differences in the proportion of cd8 t cell population were found between pss patients and controls . but analysis of absolute counts showed significantly lower counts of cd8 t cells in pss abs ( p = 0.014 ) and pss abs ( p = 0.006 ) in comparison to controls ; no differences were found between pss groups ( table 2 , figure 1 ) . analysis of nkt ( cd3cd16/56 ) and nk ( cd3cd16/56 ) cells showed only decreased absolute counts in pss abs group ( resp . , p = 0.009 and p = 0.036 ) in comparison to controls . increased proportion of cd3cd19 ( b cells ) in pss abs ( p = 0.045 ) was found when compared to controls , but no differences were found analyzing absolute counts among pss groups and controls ( table 2 ) . analysis of cd4 lymphocyte subpopulations according to their expression of cd25 and foxp3 markers showed significant reduced absolute counts of cd4cd25 ( p = 0.036 ) and cd4 cd25foxp3 ( p = 0.017 ) cells when comparing pss abs with controls . no significant differences were observed analyzing other cd4 subpopulations according to their expression of cd25 and foxp3 markers ( table 3 ) . analysis of cd4il-17a ( th17 ) cells showed significant lower proportion and absolute counts of these cells in pss patients in comparison to control group 's results ( figure 2 ) . proportion was significantly altered in pss abs ( p = 0.0003 ) and pss abs ( p = 0.004 ) , and also absolute counts of th17 cell were significantly lower in pss abs ( p < 0.0001 ) and pss abs ( p no significant differences were found analyzing proportion and absolute counts of this subpopulation between pss groups ( table 3 , figure 1 ) . cd8 lymphocyte population was differentiated to subpopulations according to the markers cd57 and cd27 that defines replicative senescence ( figure 1 ) . analysis of cd8cd57cd27 subpopulation showed no differences in proportion and absolute counts among pss and control groups . in pss patients with abs , we observed significantly increased proportion ( p = 0.032 ) and absolute counts ( p = 0.011 ) of cd8cd57cd27 subpopulation in comparison to pss without abs . no significant differences were found when comparing results of pss abs and pss abs to controls . cd8cd57cd27 population 's proportion was significantly reduced only in pss without abs patients ' blood ( p = 0.026 ) when compared to controls and no significant differences between pss groups were observed . absolute counts of this subpopulation were significantly reduced both pss abs ( p = 0.0003 ) and pss abs ( p = 0.005 ) in comparison to controls . proportion of cd8 subpopulation lacking cd57 and cd27 markers ( cd8cd57cd27 ) was significantly increased only in pss abs patients ' blood when compared to controls . differences in proportion or absolute counts of subpopulation expressing foxp3 marker were not observed ( table 4 ) . focus score correlated with absolute counts of cd3 ( p = 0.047 , r = 0.474 ) , cd4 ( p = 0.033 , r = 0.503 ) , b cell ( p = 0.023 , r = 0.532 ) , and cd8cd57cd27 ( p = 0.016 , r = 0.560 ) cell populations . essdai correlated with nk ( p = 0.043 , r = 0.482 ) and cd4cd25foxp3 ( p = 0.047 , r = 0.474 ) cell absolute counts . in pss patients without abs , we found that schirmer 's i test correlated with proportion ( p = 0.033 , r = 0.504 ) and absolute counts serum baff concentration correlated with proportion of cd8 ( p = 0.032 , r = 0.415 ) , nk ( p = 0.009 , r = 0.491 ) , and cd8cd57cd27 ( p = 0.014 , r = 0.469 ) cell populations and negatively correlated with b cells ( p = 0.026 , r = 0.429 ) , cd8cd57cd27 ( p = 0.036 , r = 0.404 ) , and cd8cd57cd27 ( p = 0.009 , r = 0.493 ) . analyzing absolute counts of cells populations observed negative correlation between baff and cd4 ( p = 0.025 , r = 0.430 ) , b cell ( p = 0.007 , r = 0.509 ) , cd8cd57cd27 ( p = 0.028 , r = 0.424 ) , and cd8cd57cd27 ( p = 0.017 , r = 0.454 ) cells . schirmer 's i test correlated with proportion of b cells ( p = 0.038 , r = 0.467 ) and cd8cd57cd27 ( p = 0.006 , r = 0.589 ) and negatively correlated with cd3 ( p = 0.006 , r = 0.590 ) and cd8cd57cd27 ( p = 0.033 , r = 0.479 ) cells . also correlation between schirmer 's i test and absolute count of cd8cd57cd27 ( p = 0.021 , r = 0.512 ) and negative correlation with cd8cd57cd27 ( p = 0.017 , r = 0.525 ) cell counts were observed . unstimulated salivary flow rate correlated with proportion of cd8 ( p = 0.017 , r = 0.525 ) and th17 ( p = 0.015 , r = 0.535 ) and also negatively correlated with absolute counts of cd3 ( p = 0.011 , r = 0.555 ) and cd4 ( p = 0.017 , r = 0.526 ) cells . focus score negatively correlated with proportion and absolute counts of cd8cd57cd27 cells , respectively , ( p = 0.020 , r = 0.517 ) and ( p = 0.040 , r = 0.462 ) . esspri correlated with proportion of cd3 ( p = 0.015 , r = 0.535 ) , cd4foxp3 ( p = 0.044 , r = 0.454 ) , and cd4cd25foxp3 ( p = 0.041 , r = 0.461 ) cells and negatively correlated with proportion of cd4cd25 ( p = 0.026 , r = 0.496 ) and cd4cd25 ( p = 0.043 , r = 0.456 ) cells . essdai negatively correlated with proportion of th17 ( p = 0.001 , r = 0.675 ) cells and also with absolute counts of cd8 ( p = 0.042 , r = 0.459 ) , th17 ( p = 0.001 , r = 0.673 ) , and cd8cd57cd27 ( p = 0.028 , r = 0.492 ) cells . no correlation was observed between serum baff concentration and cell populations changes in pss patients with abs . despite systemic b - cell hyperactivity , t and b cells constitute the vast majority of infiltrating mononuclear cells at the minor salivary glands inflammatory lesions of pss , with their prevalence varying according to the severity of the infiltrates . cd8 t cells with cytotoxic activity , as manifested by their expression of granzymes , constitute around 15% of infiltrating cells . t cells predominate in mild lesions , whereas in severe lesions b cells constitute the main population . the prevalence of cd4 t cells decreases with lesion severity , whereas the prevalence of cd8 t cells remains unchanged . the prevalence of regulatory t cells associates with lesion severity , with the higher values to be observed at intermediate lesions . nk cells comprise a small but considerable portion of the infiltrating mononuclear cells , and their percentage correlates with the grade of the lesions [ 15 , 16 ] . in our study , t lymphocyte identification by cd4 and cd8 markers showed a statistically significant decrease in the absolute counts of cd4 and cd8 t lymphocytes in the peripheral blood of pss patients in comparison to the control group . this shows that the decline of cd3 t lymphocyte population in the peripheral blood of pss patients is influenced by a decrease of both cd4 and cd8 t lymphocyte absolute counts . the decrease of the total amount of cd4 t lymphocytes in the peripheral blood of pss patients is also confirmed by other authors . in some pss patients , low counts of cd4 lymphocytes or their dysfunction in peripheral blood maybe due to anti - cd4 antibodies . the fact is that the proportion of cd4 was lower only in our pss patients with abs , and no differences in proportion of cd3 and cd8 in all pss patients were observed ; let us think that this lymphopenia can also be genetically determined . apoptosis may also play a role in the pathogenesis of some extraglandular manifestations of pss and peripheral cd4 lymphocytopenia [ 19 , 20 ] . studies in patients with pss and animal models of pss have identified the presence of il-17 in the lymphocytic infiltrates of the exocrine glands , as well as higher levels of circulating il-17 in both serum and saliva [ 8 , 21 , 22 ] . on the one hand , our finding that th17 lymphocyte counts decreased in the peripheral blood of patients with sjgren 's syndrome is quite unexpected . on the other hand , this result may be explained by the redistribution of th17 lymphocytes , that is , increasing their concentration in tissues ( salivary glands ) and decreasing concentration in peripheral blood [ 8 , 10 ] . treg lymphocytes are characterized by autoimmune reaction - inhibiting properties [ 15 , 23 ] . however , in this study , we have not find more distinct treg cells changes in the peripheral blood of pss patients . no statistical significant differences were found analyzing cd4cd25foxp3 cells , cd4cd25 , or cd4cd25foxp3 cells . sometimes it is hard to define what is what , when conflicting results have been reported . one of the problems is that different authors as treg population define different pools of cd4 cells . some researchers uses two markers cd4 and cd25 to identify treg cells , while others also uses foxp3 marker . this is why we have checked more pools of cd4 that some authors define as treg cells . the role of cytotoxic t cells in pss pathogenesis has not been studied in detail . cd8 t - cell deficiency is a feature of many chronic autoimmune diseases , including multiple sclerosis , rheumatoid arthritis , systemic lupus erythematosus , sjgren 's syndrome , systemic sclerosis , ulcerative colitis , crohn 's disease , psoriasis , etc . it also occurs in blood of healthy relatives of patients with autoimmune diseases , suggesting that it is genetically determined . these cells play critical roles in purging acute infections , limiting persistent infections , and conferring life - long protective immunity . cd8 t cell deficiency can prompt the development of chronic autoimmune diseases by impairing cd8 t cell control of virus infection . it is known that viral infections are the best candidates for the role of environmental triggers to autoimmune reactions . it is proposed that , after activation in peripheral lymphoid organs by cross - reacting foreign antigens , autoreactive t cells enter the target organ where they are reactivated by b cells which provide costimulatory survival signals , thereby inhibiting the activation - induced t - cell apoptosis which normally occurs when autoreactive t cells enter the target organ . understanding cd8 t memory effector cells differentiation is essential for studying how virus - specific cd8 t cells control viral infection . distinct stages of virus - specific cd8 t memory effector cells differentiation have been extensively characterized by phenotypic and functional analyses . primed virus - specific cd8 t cells typically differentiate from the least mature memory stage ( cd27 ) to the most mature effector stage when they start to lose cd27 and obtain cd57 marker and eventually become terminally differentiated effector cells which can be further defined by cd57 expression . according to some studies , last stage of cd8 cells differentiation seems to be cd8cd27cd57 t cells subset with high perforin and killing activity . is this the true end - stage or terminally - differentiated state of cytotoxic t cells ? we observed increased proportion of this population in pss patients , but significant differences were observed only in pss without abs group . in pss with abs group , negative correlation between cd8cd27cd57 t cells subset absolute count and schirmer 's i test results was observed . this connection proposes that this subset can be involved in a pathogenic process which appears in the glandular tissue . impaired proportion and absolute counts of cd8cd27cd57 t cells in blood of pss patients can be the reason of lower counts of cd8 in blood of pss patients . it is not known whether the proportion and absolute counts of this population are downregulated in blood by migration to inflammatory sites , or this can be due to increased apoptosis of these cells . there is hypothesis that more mature effector stage ( cd8cd27cd57 and cd8cd27cd57 ) cells with lower capacity of proliferation are more resistant to apoptosis than least mature memory stage cd8cd27cd57 t cells [ 2931 ] . all these observed changes in cd8 t cell subpopulations rearrangement prove that these subpopulations actively participate in pathological processes of pss . nkt lymphocytes and nk cells might function as regulatory t cells and are one of the autoimmune process preventing chains [ 32 , 33 ] . according to literature , in patients with autoimmune rheumatic diseases , the decreased nkt and nk cell counts and functional characteristics published results where they identified higher proportion of these cells in blood of pss patients than in control group . our investigation of these populations showed a significant decrease of nkt and nk - cell absolute counts in the peripheral blood of pss patients with abs ; however , the fact that a proportion of these cells were similar with the controls can indicate that lower absolute counts can be due to genetically determined lymphopenia . there is also possibility that low counts of these cell populations in periphery can be by reason of overall lymphocyte population migration to inflammatory sites or / and apoptosis . in conjunction with the classical cd4 tregs , we were also investigating cd8 suppressor cells that express foxp3 marker , as foxp3 confers suppressive properties and is confined to regulatory t cells . cd8foxp3 cells represent a new regulatory population and ability of these cd8foxp3 treg to suppress cd8 responses far more effectively than cd4foxp3 treg . our study results did not show any significant differences in proportion or absolute count changes on these cells in pss patients ' peripheral blood in comparison to healthy controls . we found negative correlation between baff and t and b cells in pss patients without abs . increase of baff in serum can be due to negative regulation of baff secretion by monocytes . this fact can indicate tight control of baff secretion . whereas we do not found correlation between baff and lymphocyte populations changes in pss patients with abs group , what can be the indication of uncontrolled baff secretion and its homeostasis disturbance ? despite recent knowledge , in many respects , the role of t cells and their subsets in pss remains unexplained . are cells in the infiltrate specific , or maybe many of them are just bystanders ( with nonactivated phenotype ) recruited from the periphery to the inflammatory sites ? t cells undergo expansion within the gland , or does this occur elsewhere with subsequent migration ? is there migration in and out of the gland , or do t cells remain in the infiltrates once they arrive ? pointers to these questions could help us understand which processes are going on periphery . one of future projects should be the immunohistochemistry for assessing cell populations ' changes in salivary glands in parallel with blood analysis and apoptosis markers . such analysis could help better to define changes of cell populations in periphery , is this due migration to the inflammatory sites or increased apoptosis , or maybe both .

purpose of this study was to evaluate the lymphocyte populations ' distribution changes in peripheral blood of patients with primary sjgren 's syndrome ( pss ) . lymphocyte populations ' distribution changes in peripheral blood of pss patients were investigated in 52 patients with pss and in 28 healthy controls by flow cytometry . we found decreased absolute count of cd3 + t cell population in pss patients . analysis of cd4 + t cell population showed significant proportion and absolute count differences in pss patient 's blood with ssa / ssb antibodies ( abs ) in comparison to controls . no significant differences were observed analyzing cd4 + and cd8 + treg subpopulation . proportion and absolute counts of th17 cells were significantly lower in pss patient 's blood . absolute counts of cd8 + t cells were significantly lower in pss patients in comparison to controls and also impaired proportion and absolute counts of cd8 + subpopulations according to cd27 + and cd57 + were observed . absolute counts of nkt and nk cells were decreased in pss with abs . b cells proportion was increased only in blood of pss with abs . lymphocyte distribution impairment can be due to genetically determined lymphopenia or lymphocyte migration from periphery to inflammatory sites or / and increased susceptibility to apoptosis .

1. Introduction 2. Patients and Methods 3. Results 4. Discussion

strategies to interrupt transmission of hiv are urgently needed , especially in generalized epidemic settings with extremely high hiv prevalence in the general population , high hiv - related disease burden and limited resources to identify , engage and retain infected individuals in care . in the long term , serving populations at highest risk of transmitting or acquiring hiv is necessary to reduce the total number of people who will require lifelong treatment , helping to close the gap between global treatment targets and present - day , substantially lower levels of hiv diagnosis , treatment , and viral suppression . in generalized epidemic settings , there is not yet an accepted strategy for identifying these sub - populations , but the patterns of generalized hiv epidemics provide clues about their characteristics . a distinct characteristic of generalized epidemics is sustained high hiv incidence in young women , leading epidemiologists to hypothesize that the age patterns of hiv transmission are central to fueling the epidemic and may be vulnerable to interventions that collapse the chains of hiv transmission . we have previously used mathematical modeling to investigate the age patterns of those most at risk of transmitting hiv to another individual , and further , those most likely to be part of an ongoing chain of transmission ( as opposed to a building upon those investigations , the current study explores whether age - targeted intensification of primary and/or secondary hiv prevention could collapse chains of transmission in generalized epidemic settings . the targeting approach explored here draws inspiration from the epidemiological ring - fencing methods used to control the spread of smallpox since the 1870s up until the final eradication activities in the 1970s . rather than the quarantine and vaccination approaches used to create a shield to prevent the spread of smallpox , intensified hiv treatment and prevention services would be used to create a longer - term demographic we explore a strategy of intensified hiv services for a specific age range , forming a static age band that separates older from younger individuals ( figure 1a ) . alternatively , we explore intensification to an aging birth cohort consisting of individuals born between two specified dates . if begun when these individuals are mostly hiv - unexposed , such a band could sweep through the population , potentially leaving behind a future generation protected from hiv . figure 1.schematic of age - based targeting and cohort - based targeting of outreach . teal regions show the age range of the ( a ) age or ( b ) birth cohort receiving intensified hiv services . people can age in and out of the target group with age targeting , but not with birth cohort targeting . teal regions show the age range of the ( a ) age or ( b ) birth cohort receiving intensified hiv services . people can age in and out of the target group with age targeting , but not with birth cohort targeting . the concept of a demographic shield to protect future generations is relatively unexplored even among available age - structured models of hiv transmission . because the penetration and effectiveness of a hypothetical intervention can not be predicted in silico , the study presented here is exploratory in nature , scanning over a range of model assumptions and hypothetical combinations of novel or highly improved interventions to estimate the maximum potential impact of a given strategy . we used emod - hiv v0.8 , an age - structured , individual - based network model of hiv in south africa , to model the impact of intensifying primary and/or secondary hiv prevention services for a specified age range ( figure 1a ) or birth cohort ( figure 1b ) . primary prevention is defined as a service targeted to an uninfected individual to prevent acquisition of disease , whereas secondary prevention is targeted to an infected individual to prevent transmission of disease . the parameters , projections , and sensitivities of the baseline model projections ( to which the interventions are compared ) have been described previously and a detailed model description , user tutorials , model installer , and source code are available for download at http://idmod.org/software . briefly , emod - hiv is an individual - based model that simulates transmission using an explicitly defined network of relationships that are formed according to preference patterns and dissolve according to age - dependent durations ( younger individuals tending to form shorter - term relationships ) . the age patterns of sexual mixing were configured to match those observed in a rural , hiv - hyperendemic region of kwazulu - natal , south africa . recently , a validation study showed that self - reported partner ages in this setting to be relatively accurate , with 72% of self - reported estimates falling within two years of the partner 's actual date of birth . the model replicates the demographic patterns of south africa , explicitly simulating 1/200th of the south african population with age - dependent fertility and age / gender - dependent mortality . to ensure that the configured relationship preference patterns are realized given the underlying demographics , the rates of relationship formation are adjusted by a feed - forward algorithm to match the desired age patterns between couples . transmission rates within relationships depend on hiv disease stage , male circumcision , condom usage , co - infections , and antiretroviral therapy the latter causing the transmission rate to decline linearly over the first 6 months of therapy until viral suppression is achieved . viral suppression is assumed to reduce transmission by 92% in our more conservative scenarios an estimate based on observational data in which outside partnerships could have contributed to hiv acquisition or by as much as 100% in our most optimistic scenarios . the model includes a configurable health care system module , which we have configured to follow trends in antiretroviral therapy ( art ) expansion in south africa . treatment begins with voluntary counseling and testing ( vct ) , antenatal and infant testing , symptom - driven testing , and low level of couples testing . the model includes loss to follow - up between diagnosis and staging , between staging and linkage to art or pre - art care , and during art or pre - art care . the model 's projections of baseline treatment expansion in south africa predict gradual incidence declines without elimination , so that hiv remains endemic through 2050 . the cost and hiv burden in the targeted treatment scenarios were compared to the baseline scenario using a unit cost and disability - adjusted life year ( daly ) model developed by the hiv modelling consortium for the 2013 who revision of hiv treatment guidelines . primary prevention was implemented as a decrease in the probability that an individual becomes infected , up to a 100% decrease corresponding to full protection . secondary prevention was assumed to consist of hiv testing at a rate of once per year , with art ) initiation regardless of cd4 count for those testing positive . the intensified hiv testing was assumed to replace vct for those in the target group . these assumptions about the target group match those of a recent collaborative analysis of hypothetical universal test - and - treat for the entire population of south africa . in our analysis , we provide the full - population test - and - treat scenario as a reference point to compare to age - targeted test - and - treat . this provides a hypothetical maximum for cost and impact , and also provides a point of reference where our model has been compared to 11 other independently developed mathematical models . unlike birth cohort targeting , age range targeting would allow people to enter and leave the target group as they cross the lower and upper age thresholds . before entering and after leaving the target group , individuals exhibited eligibility , testing , and linkage rates identical to those used for the baseline scenario . however , those aging out of the target group continued art if they were initiated as part of the targeting intervention . presentation for antenatal , infant , couples , or symptom - driven testing was assumed to occur regardless of outreach , although the need for symptom - driven late presentation would decline for those who initiated care earlier than the onset of aids symptoms . a broad view of the model results is presented by scanning over starting and ending ages or years for a hypothetical age range ( figure 1a ) or birth cohort ( figure 1b ) , maintaining a range of two , five , 10 or 20 years from the youngest to the oldest age included in the target group . figure 2 shows the hiv disease burden relative to baseline , infections averted relative to baseline , incidence rate in the total population , and cost relative to baseline , assuming 80% penetration of outreach to the target group . infections , cost , and burden were accumulated over the first 20 years with a 3% annual discount rate , while incidence was reported for the 20th year ( 2035 ) . figure 2 also shows a maximum - impact scenario in which the whole population received the intensified testing and treatment intervention , providing a reference point for a population - wide intervention without age - specific targeting . figure 2.effect of age - targeted treatment expansion on hiv incidence , cumulative infections averted , cumulative disability - adjusted life years ( dalys ) averted , and cumulative program cost . effects of the interventions are represented on the y - axis , with x - axes showing the middle of the age group being targeted ( panels a the inclusion criteria of the targeted groups span 20 ( red ) , 10 ( green ) , 5 ( magenta ) or 2 ( blue ) years . incidence is shown at 20 years after the intervention begins , and other outcomes are accumulated over the first 20 years with a 3% annual discount rate . at the left and right extremes of each plot , the curves converge to black lines showing the baseline ( no intervention ) scenario , which projects current guidelines and trends in hiv treatment . the opposite black line shows universal treatment expansion with 80% coverage of annual testing for all individuals . dots in panels b and f show the strategy with the minimum cost per infection averted over 20 years . dots in panels c and g show the strategy with the mimumum cost per daly averted . effect of age - targeted treatment expansion on hiv incidence , cumulative infections averted , cumulative disability - adjusted life years ( dalys ) averted , and cumulative program cost . effects of the interventions are represented on the y - axis , with x - axes showing the middle of the age group being targeted ( panels a the inclusion criteria of the targeted groups span 20 ( red ) , 10 ( green ) , 5 ( magenta ) or 2 ( blue ) years . incidence is shown at 20 years after the intervention begins , and other outcomes are accumulated over the first 20 years with a 3% annual discount rate . at the left and right extremes of each plot , the curves converge to black lines showing the baseline ( no intervention ) scenario , which projects current guidelines and trends in hiv treatment . the opposite black line shows universal treatment expansion with 80% coverage of annual testing for all individuals . dots in panels b and f show the strategy with the minimum cost per infection averted over 20 years . dots in panels c and g show the strategy with the mimumum cost per daly averted . for interventions involving the scale - up of treatment , we used a unit cost model to approximate the cost and cost - effectiveness of universal and targeted treatment for prevention . the modeled universal treatment expansion intervention produced an additional five - fold reduction in incidence over what would be achieved with current trends in treatment , at an additional discounted cost of us$26 billion over twenty years ( figure 2a and 2e , gray lines ) . as expected , whole - population targeting was the most costly and highest - impact strategy , followed by 20-year age ranges spanning the highest - prevalence age groups . focusing on maximizing the cumulative infections averted , the dots in figure 2b show the most cost - effective ranges to target : ages 1030 at us$6238 per infection averted , ages 2030 at us$5031 per infection averted , ages 2227 at us$4279 per infection averted , and ages 2527 at us$3967 per infection averted . similarly , for infections averted by birth cohort targeting shown in figure 2f , the most cost - effective birth year ranges are marked at 19852005 at us$6826 per infection averted , 19871997 at us$5856 per infection averted , and 19901995 at us$5686 per infection averted . universal expansion to all ages / cohorts cost us$10 812 per infection averted . compared to universal expansion , targeting the 10-year age range of 2030 cost us$5.4 billion over 20 years and provided more than double the number of infections averted per us$ invested . however , the cumulative infections averted by targeting the 2030 age group was only 45% of the number possible with universal expansion . for cumulative dalys averted by age targeting shown in figure 2c , dots show the most cost - effective ranges to target : ages 2444 at us$1489 per daly averted , 2434 at us$1441 per daly averted , 2631 at us$1372 per daly averted , and 2729 at us$1285 per daly averted . similarly , for birth cohort targeting in figure 2 g , the most cost - effective birth year ranges are marked at 19611981 at us$1396 per infection averted , 19681978 at us$1374 per infection averted , and 19721977 at us$1373 per infection averted . the efficiency gained by age targeting was more modest for dalys than for infections averted . the most cost - effective 10-year age range for infections averted ( 2030 ) more than halved the cost per daly averted , whereas the most cost - effective 10-year age range for dalys averted ( 2434 ) reduced the cost per daly averted by only 17% . the most efficient age range for averting dalys was older than for averting infections , because dalys are averted by preventing new infections in the long run , but also by providing a direct health benefit to those receiving treatment in the short run . the health benefit is greatest for those who are most likely to progress quickly from asymptomatic hiv infection to symptomatic aids : older individuals , who experience faster disease progression and are more likely to have been infected for a longer period of time . having identified the 2030 age group as an efficient target for prevention , we then selected this age range as a hypothetical target group , and examined the age pattern of hiv incidence in the broader population to determine whether efficient targeting of treatment expansion to ages 2030 had the potential to interrupt hiv transmission to younger individuals . figure 3a shows the age pattern of incidence for baseline trends in hiv treatment . our model predicted a slow decline and slight aging of the pattern of hiv incidence , with hiv remaining endemic in the year 2050 . figure 3.age distribution of hiv incidence for the baseline simulation ( a ) , targeted treatment outreach ( b ) , and targeted complete prevention of hiv infection ( c ) . incidence is shown just before implementation of the intervention , and at 5 , 10 , 20 and 35 years after implementation of the intervention . shaded areas show the age range of the target group throughout the intervention ( left ) or for a birth cohort in the year of implementation ( start ) and 35 years after implementation ( end ) . age - dependent incidence per 100 uninfected person - years ( py ) was averaged across 20 stochastic simulation runs . age distribution of hiv incidence for the baseline simulation ( a ) , targeted treatment outreach ( b ) , and targeted complete prevention of hiv infection ( c ) . incidence is shown just before implementation of the intervention , and at 5 , 10 , 20 and 35 years after implementation of the intervention . shaded areas show the age range of the target group throughout the intervention ( left ) or for a birth cohort in the year of implementation ( start ) and 35 years after implementation ( end ) . age - dependent incidence per 100 uninfected person - years ( py ) was averaged across 20 stochastic simulation runs . when individuals aged 2030 were targeted with hiv treatment , even at an optimistic penetration level of 80% for outreach with testing and linkage to care , incidence declined across all age groups but fell short of completely eliminating hiv by 2050 ( figure 3b , left panel ) . by 2030 , incidence in the overall population was 37% lower than that of the baseline simulation , while incidence in those under age 20 was 60% lower than in the baseline scenario . by 2050 , the overall and under-20 incidence rates were 59% and 78% lower than the baseline scenario , respectively . one possible explanation for reduced but continuing incidence among teenagers is self - sustaining transmission among youth . thus , we next tested a strategy of birth cohort targeting for to those born in the years 2000 through 2010 . the targeted individuals would begin reaching sexual debut as the intervention was launched , and the 10-year targeted band would age through the population , with the intention of using a ring - fence like approach to the model results showed the cohort - based targeting approach to be less effective than age targeting ( figure 3b , right panel ) . by the year 2030 ( the year in which the target group reached 2030 years of age ) , incidence among those under 20 years of age was only 29% lower than in the baseline scenario , and incidence in the overall population was only 11% lower than in the baseline scenario . we further augmented the simulations of age - targeted treatment with a hypothetical prevention intervention to the same target group ( figure 3c ) . the extreme assumption of 100% coverage with perfect hiv prevention for those aged 2030 still did not eliminate hiv infections among those younger than age 20 , although incidence was greatly diminished . sweep out hiv from the population ( figure 3c , right panel ) . by the year 2030 , incidence emerged in young females at a rate of 005015% per year , and similar levels later emerged in young males . finally we addressed the question of how hiv the epidemic reached youth , even with a complete one - decade gap in hiv transmission . we considered four possible routes by which hiv could have entered the younger generation , illustrated in figure 4a . first , individuals older than the target group could infect those younger than the target group , essentially hopping the fence that was meant to protect younger generations . second , individuals in the target group could transmit to younger generations due to imperfect treatment coverage or efficacy . even when coupled with aggressive prevention interventions , some individuals in the target group could already be infected at the start of the intervention . third , the younger generation could sustain an epidemic on its own , unfettered by treatment or prevention in older generations . fourth , imperfect coverage and effectiveness of interventions to prevent mother - to - child transmission could permit some children to become infected and , with art , survive until sexual maturity . in figure 4a , these modalities are illustrated in blue , green , yellow , and red , respectively . figure 4.sources of new hiv infections in the generation younger than the target group . the diagram in panel ( a ) shows how infections can enter the younger generation from those older than the target group ( blue ) , those in the target group ( teal ) , those already infected in the younger generation itself ( yellow ) , or through mother - to - child transmission from any age group ( maroon ) . the contribution of each of these sources to incidence in those younger than the target group is shown in panel ( b ) for age targeting and panel ( c ) for birth cohort targeting . the denominator for incidence in ( b ) is the uninfected population ages 0 through 19 . in ( c ) , the denominator is the population of uninfected individuals with a birthdate after 2010 , which grows over time as new individuals are born . the diagram in panel ( a ) shows how infections can enter the younger generation from those older than the target group ( blue ) , those in the target group ( teal ) , those already infected in the younger generation itself ( yellow ) , or through mother - to - child transmission from any age group ( maroon ) . the contribution of each of these sources to incidence in those younger than the target group is shown in panel ( b ) for age targeting and panel ( c ) for birth cohort targeting . the denominator for incidence in ( b ) , the denominator is the population of uninfected individuals with a birthdate after 2010 , which grows over time as new individuals are born . the relative contribution from each of these four mechanisms was estimated by categorizing transmission events in the model according to their origin : infection by a sex partner older than , in , or younger than the target group , or mother - to - child transmission . figures 4b and 4c illustrate the relative contribution of each component over time in the targeted treatment scenarios . the baseline scenario ( without any targeted intervention ) , the dominant source of infections was proposed the target group . age or cohort targeting of hiv treatment greatly reduced the target group 's contribution to transmission . in the case of cohort targeting , the age range of those younger than the target group expanded as the group aged . in 2015 , the younger generation consisted of children under age five , and mother - to - child transmission was the only source of new infections . after reaching sexual maturity , they became infected by individuals in or older than the target group , before eventually reaching an age and prevalence level at which transmission within the generation became dominant . this explains the time - dependent sources of incidence in younger generations , shown in figure 4c . finally , we examined how hypothetical improvements to hiv programs might influence the ability to isolate hiv from future generations using the age targeting approach . in figure 5 and supplementary figure 1 , the incidence rates among individuals younger than the target group are shown in response to a variety of improvements to age - targeted or cohort - targeted treatment for prevention . to test the extent to which tools must be improved , we pushed the assumptions to their extreme , assuming that it would be possible to eliminate imperfections in already high - efficacy and high - coverage interventions . figure 5.impact of biomedical or programmatic improvements on the sources of new hiv infections in the generation younger than the target group . stacked bar charts show the rate of new hiv infections in future generations , defined as those younger than the targeted ( a ) age range or ( b ) birth cohort . new infections are color - coded by their source , with possible contributors being those older than the target group ( blue ) , those in the target group ( teal ) , those already infected in the younger generation itself ( yellow ) , and mother - to - child transmission from any age group ( maroon ) . the projections are shown for general art roll - out without any specific intervention for the target group ( 0 ) , achieving 80% coverage of annual testing and art for all new diagnoses in the target group ( 1 ) , further programmatic improvements in treatment as prevention the target group ( 2 ) , further biomedical improvements ( 3 ) , and a combination of programmatic and biomedical improvements ( 4 ) . the individual components of programmatic and biomedical improvements are not shown here , but are compared in supplementary figure 1 . impact of biomedical or programmatic improvements on the sources of new hiv infections in the generation younger than the target group . stacked bar charts show the rate of new hiv infections in future generations , defined as those younger than the targeted ( a ) age range or ( b ) birth cohort . new infections are color - coded by their source , with possible contributors being those older than the target group ( blue ) , those in the target group ( teal ) , those already infected in the younger generation itself ( yellow ) , and mother - to - child transmission from any age group ( maroon ) . the projections are shown for general art roll - out without any specific intervention for the target group ( 0 ) , achieving 80% coverage of annual testing and art for all new diagnoses in the target group ( 1 ) , further programmatic improvements in treatment as prevention the target group ( 2 ) , further biomedical improvements ( 3 ) , and a combination of programmatic and biomedical improvements ( 4 ) . the individual components of programmatic and biomedical improvements are not shown here , but are compared in supplementary figure 1 . for improved biomedical technologies , we first examined increasing the sensitivity of hiv diagnostic testing from 98 to 100% . we then examined increasing the effectiveness of antivirals for prevention of mother - to - child transmission from 90 to 100% . this reduced , but did not eliminate , mother - to - child transmission due to imperfect coverage . finally , we examined increasing the effectiveness of art at preventing transmission in couples from 92 to 100% . of all technological improvements , the prevention efficacy of art had the largest effect of protecting younger generations . as expected , the combination of improved testing and antiviral drugs had a greater impact than any intervention alone . we next examined hypothetical programmatic improvements . increasing the penetration of outreach in the target group from 80 to 100% reduced incidence in youth , as did eliminating delays between infection and treatment initiation . as with technological improvements , the two together reduced incidence in the younger generation more than each one did alone . no single improvement to a technology or program was sufficient to fully interrupt transmission in youth , nor were combinations of purely programmatic or purely technological solutions sufficient . the combination of all of the interventions discussed , both biomedical and programmatic , enabled the elimination of hiv in young generations by 2050 when targeting an age range of 2030 year olds . despite vigorous policy debate about whether an aids - free generation is within reach and the availability of models that include age patterns of hiv transmission , the concept of a demographic shield to protect future generations is relatively unexplored . we have used a network model to demonstrate how age - based targeting could as much as double cost - effectiveness of treatment for prevention , but would be insufficient to prevent hiv transmission to future generations until biomedical tools and programs are dramatically and simultaneously improved . the efficiency of targeting individuals in their twenties was consistent with our prior analysis of hiv transmission chains , which showed that this age group is vital for transmitting hiv from older to younger subsets of the hiv transmission network . sweep out hiv is less effective than simply shutting down transmission in a high - incidence age band . second , treatment as prevention is perhaps an even more powerful tool than primary hiv prevention for interrupting transmission , if used optimally . in figure 3 , we saw that perfect prevention in the 2030 age range was insufficient to protect those under age 20 from acquiring hiv . in contrast , in figure 5 we showed how an idealized treatment intervention would be able to do so , in large part because prevention alone would allow some transmissions to occur from individuals who were already infected when entering the target group . these include school - based programs , workplace wellness programs , youth centers and programs leveraging health care utilization such as antenatal care and sexually transmitted disease treatment . age targeting considerations could potentially help to prioritize and justify the expansion of outreach methods that can reach young adults . an important limitation of this modeling exercise is the assumption that the age- or birthdate - based targeting intervention had a precise cutoff date for eligibility , whereas realistic programs that use age to prioritize outreach would of undoubtedly have spillover effects into other age groups . we would therefore expect that the realistic efficiency gains from age targeting would be more modest than what is predicted by a model of ideal age targeting . an additional shortcoming of the model used for this exercise is the lack of consideration for outreach cost , which could differ for age - based targeting compared to universal expansion of treatment . this too would depend on the program used to access the age group of interest . future modeling studies could potentially explore the tradeoff between coverage , precision of targeting , and cost - effectiveness of outreach by different modalities . lastly , it is important to consider the broader uncertainty of model projects of hiv epidemics . the underlying drivers of generalized epidemics what causes hiv to spread in the general population in some settings and not others are still not well - understood . there is evidence of spatial and sociodemographic heterogeneities in hiv risk , implying hidden sub - epidemics embedded within generalized epidemics . these are still poorly characterized , and thus unlikely to be appropriately captured in existing mathematical models . data on past trends in partnership age gaps are limited and not necessarily predictive of future behavior . the model scenarios presented here were scaled to represent the demographics and baseline treatment program in south africa , but the age patterns represented in the model were measured in a small , rural hyperendemic region of kwazulu - natal , and not necessarily representative of mixing patterns at the national level . although a recent validation study found the self - reported mixing patterns to be relatively accurate , there may be types of relationships that are less likely to be reported and more difficult to validate through demographic surveillance . further , trends in past hiv incidence and self - reported partner choice do not necessarily predict future trends in partner choice . if age patterns of partnerships shift in the future , so too would the optimum age groups to target with intensified hiv services . more broadly , over the time horizons discussed in this analysis , model projections will need to be updated to reflect changes in the arrival of new biomedical tools and new information about the course of the hiv epidemic . as uninfected adolescents reach sexual maturity , primary hiv prevention for adolescents could be compounded with early treatment targeted to the most likely sources of future infections . our modeling exploration revealed that age - based targeting could double the cost - effectiveness of outreach with hiv treatment as prevention , provided that the cost to access the age groups of interest would be similar to that of reaching the general population . however , age - targeted outreach with current tools would be insufficient to fully protect future generations from hiv infection . dramatic but isolated improvements , such as reliable treatment regimens , full coverage in age groups of interest , or rapid detection of new hiv infections , would be insufficient to protect future generations from acquiring hiv . a combination of biomedical and programmatic improvements , applied consistently for more than three decades , would be required to interrupt transmission . these findings highlight the need for diverse investments in both quality and coverage of hiv treatment , as well as potential epidemiological efficiencies of programs targeting diverse populations , such as school - based programs , workplace wellness programs , youth centers and programs leveraging health care utilization such as antenatal care and treatment clinics for sexually transmitted diseases . as uninfected adolescents reach sexual maturity , primary hiv prevention for adolescents could be compounded with early treatment targeted to the most likely sources of future infections . our modeling exploration revealed that age - based targeting could double the cost - effectiveness of outreach with hiv treatment as prevention , provided that the cost to access the age groups of interest would be similar to that of reaching the general population . however , age - targeted outreach with current tools would be insufficient to fully protect future generations from hiv infection . dramatic but isolated improvements , such as reliable treatment regimens , full coverage in age groups of interest , or rapid detection of new hiv infections , would be insufficient to protect future generations from acquiring hiv . a combination of biomedical and programmatic improvements , applied consistently for more than three decades , would be required to interrupt transmission . these findings highlight the need for diverse investments in both quality and coverage of hiv treatment , as well as potential epidemiological efficiencies of programs targeting diverse populations , such as school - based programs , workplace wellness programs , youth centers and programs leveraging health care utilization such as antenatal care and treatment clinics for sexually transmitted diseases .

backgroundgeneralized hiv epidemics propagate to future generations according to the age patterns of transmission . we hypothesized that future generations could be protected from infection using age - targeted prevention , analogous to the ring - fencing strategies used to control the spread of smallpox.methodswe modeled age - targeted or cohort - targeted outreach with hiv treatment and/or prevention using emod - hiv v08 , an individual - based network model of hiv transmission in south africa.resultstargeting ages 20 to 30 with intensified outreach , linkage , and eligibility for antiretroviral therapy ( art ) averted 45% as many infections as universal outreach for approximately one - fifth the cost beyond existing hiv services . though cost - effective , targeting failed to eliminate all infections to those under 20 due to vertical and inter - generational transmission . cost - effectiveness of optimal prevention strategies included us$6238 per infection averted targeting ages 1030 , us$5031 targeting 2030 , us$4279 targeting 2227 , and us$3967 targeting 2527 , compared to us$10 812 for full - population test - and - treat . minimizing burden ( disability - adjusted life years [ dalys ] ) rather than infections resulted in older target age ranges because older adults were more likely to receive a direct health benefit from treatment.conclusionsage-targeted treatment for hiv prevention is unlikely to eliminate hiv epidemics , but is an efficient strategy for reducing new infections in generalized epidemics settings .

Introduction Methods Results Discussion Conclusions Supplementary Material

it is the most commonly dislocated joint because of the large size of the humeral head compared to the small size of the glenoid fossa ( 1 ) . the glenohumeral ligaments ( ghls ) , joint capsule , and glenoid labrum are parts of the passive stabilizing mechanisms of the glenohumeral joint . the ghls are localized thickenings of the glenohumeral joint capsule that extend from the anterior and inferior glenoid margin of the joint to the anatomical neck of the humerus . three ligaments have been described : the superior glenohumeral ligament ( sghl ) , the middle glenohumeral ligament ( mghl ) , and the inferior glenohumeral ligament ( ighl ) complex , which are composed of an anterior band , a posterior band , and an axillary recess . the main two functions of the ghls are to avoid superior - inferior translation and to maintain anterior stability ( 2 ) . magnetic resonance ( mr ) imaging of the shoulder without intraarticular contrast medium can be used to observe some anatomical structures , such as the bony components , biceps tendon , and rotator cuff tendons . however , mr arthrography is mostly used for demonstrating abnormal ghls , and it is the most accurate imaging technique established ( 3 ) . the sghl is the most important structure in the anterosuperior part of the glenohumeral joint capsule ( 4 , 5 ) . it plays essential roles in anterosuperior impingement syndrome and in stabilizing the long head of the biceps tendon ( lhbt ) . thus , radiologists should observe the sghl and coexistent pathologies in patients presenting with pain at the anterosuperior section of the shoulder . the purpose of this study was to review the normal mr arthrography anatomy and variants of this important ligament . we also discussed about its basic biomechanics and illustrated examples of injuries involving this ligament . different methods of injections into the glenohumeral joint for diagnostic arthrography have been previously described . these methods involve fluoroscopy , ultrasonography , and computed tomography , as well as techniques other than image - guiding . for sonographic guidance , the use of ionizing radiation and iodinated contrast materials are avoided . although the anterior approach is the most commonly used , the posterior and the rotator interval approaches have recently been preferred ( 6 , 7 , 8) . both the posterior and rotator interval approaches are used at our institution via ultrasonography guidance . in the posterior approach , a transducer is placed over the long axis of the myotendinous junction of the infraspinatus muscle , and it is angled to show the contours of the posterior glenoid rim , posterior glenoid labrum , and posteromedial portion of the humeral head . the needle is introduced in a lateral to medial direction , obliquely from the skin to the glenohumeral joint space and parallel to the long axis of the transducer ( fig . 1 ) ( 7 ) . in the rotator interval approach , the coracoid process and the adjacent superomedial subchondral aspect of the humeral head are observed with a high frequency linear probe in a plane transverse to the joint line . the needle entry point is just superior to the subscapularis tendon and lateral to the coracoid process . the needle is advanced freehand , from medial to lateral , obliquely from the skin surface to the humeral head within the imaging plane of the transducer , until the tip reaches the cartilage of the humeral head ( fig . 2 ) . a direct mr arthrography of the glenohumeral joint after intraarticular injection of diluted gadolinium chelates is the preferred imaging technique for the evaluation of the labroligamentous complex and joint capsule ( 9 , 10 ) . observation of the ghls is difficult when using conventional shoulder mr imaging , because these ligaments may be poorly visualized or may mimic labral lesions ( 9 , 11 ) . ( 12 ) presented a cadaveric study comparing conventional mr imaging to mr arthrography of the same shoulder joint . in this study , the sghl was not identified by conventional mr imaging , in all of the cases ; however , it was identified by direct mr arthrography , in all of the cases . at our institution , we prefer direct mr arthrography for the identification of the labroligamentous complex . at our institution , mr arthrography and conventional mr imaging examinations are performed with a 1.5-t or 3-t mr scanner ( magnetom avanto or magnetom skyra ; siemens healthcare , berlin , germany ) within 15 minutes after the injection . our mr arthrography protocol uses fat - suppressed spin - echo ( se ) t1-weighted images . this is performed in the axial , oblique coronal , and oblique sagittal planes , with surface coils placed around the shoulder joint ( 650/15 , echo train length 8 mm , section thickness 3 mm , spacing 0.3 mm , field of view [ fov ] 16 cm , matrix 256 250 , 3 signals acquired ) . in our clinical practice , a fat - suppressed three dimensional ( 3d ) volumetric interpolated breath - hold examination ( vibe ) sequence ( repetition time / echo time 13.2/4.7 msec , flip angle 11 , 160 160 mm fov , matrix 512 512 , one slab of 112 slices with a slice thickness of 0.6 mm , and one acquisition ) is also added to the shoulder mr arthrography scanning protocol , after the t1-weighted se fat - suppressed sequences are acquired . fat - suppressed 3d vibe sequence imaging is a relatively new spoiled gradient - echo protocol that provides fast low angle images . the use of 3d vibe sequences produces thinner image slices with the thickness of 0.6 mm , which enhances effectiveness of the imaging . it also provides good contrast between the glenoid and surrounding soft tissues in mr arthrography of the glenohumeral joint . anatomical knowledge of the labroligamentous structures is crucial to the diagnosis of abnormalities revealed by mr arthrography . the glenoid labrum deepens and increases the surface area of the articulation ( 13 ) . it also serves as a primary anchoring structure for the ghls , the capsule , and the lhbt ( 3 ) . superiorly , the glenoid labrum blends with the sghl and the lhbt ; and anteriorly , it blends with the anterior band of the ighl ( 14 ) . the rotator interval consists of the following structures , in the order from outside to inside : the coracohumeral ligament ( chl ) , the interval capsule , and the sghl . the chl arises from the dorsolateral aspect of the base of the coracoid process and courses through the rotator interval to blend with fibers from the sghl . its fibers then attach laterally to the greater tuberosity , fusing with the anterior fibers of the supraspinatus tendon insertion and the medial bicipital sheath , before fusing with the superior fibers of the subscapularis tendon insertion ( 13 ) . the rotator interval may be thought of as a roof over the intraarticular portion of the lhbt ( 3 ) which arises from the anterosuperior labrum ( 13 , 14 ) . the chl and sghl are composed of a sling - like band surrounding the lhbt proximal to the bicipital sulcus ( 13 ) . it originates from the supraglenoid tubercle anterior to the lhbt attachment , and inserts into the fovea capitis line superior to the lesser tuberosity of the bicipital sulcus ( 13 , 15 ) . the sghl is identified in 97 - 98% of the patients through arthroscopic and arthrographic series ( 16 ) . macroscopically , the sghl is u - shaped and this shape lends support to the lhbt in the superior aspect of the bicipital sulcus ( 13 ) . the sghl runs parallel to the coracoid process and nearly perpendicular to the mghl ( 1 , 3 , 13 , 14 , 16 ) . using mr arthrography , the sghl is best visualized in the sagittal oblique and axial planes ( fig . the sghl is visualized as a low signal intensity intraarticular structure parallel to the coracoid process . sagittal oblique mr arthrography shows that the sghl is located underneath the coracoid process and chl . a normal foramen exists between the sghl and the mghl , allowing communication of the glenohumeral joint cavity through the subscapularis recess ( 1 , 3 , 17 , 18 ) . the sghl usually originates from the supraglenoid tubercle , just anterior to the lhbt attachment . however , its origin may vary ( posterior supraglenoid tubercle , superior labrum , lhbt , mghl , or some combination ) ( figs . 4 , 5 , 6 , 7 ) ( 17 , 19 ) . although the sghl may vary in shape and size ( fig . 8) , it usually presents as a thick structure when the mghl is absent or undeveloped ( figs . it may be absent in arthroscopic and mr arthrographic series , in 2 - 3% of the patients ( 16 ) . in a recent study by kask et al . ( 20 ) , the sghl was found in all 27 shoulder joint specimens investigated . a longitudinal split or duplicate ligament may reflect a normal variant or a longitudinal tear of the sghl ( fig . magnetic resonance arthrography of the glenohumeral joint is the most accurate imaging technique established , for identifying pathologies of the sghl and the associated structures . in a retrospective study comparing mr arthrographic findings with surgical findings , chandnani et al . ( 21 ) determined that mr arthrography had a sensitivity of 100% , a specificity of 94% , and an accuracy of 94% in the diagnosis of sghl tears . a torn sghl may be observed in mr arthrography images as increased signal intensity that looks like disruptions and thick , wavy , or irregular structures ( 19 , 22 ) . this complex anatomical structure consists of the sghl and the chl , and it is also in direct contact with the distal fibers of the subscapularis and the supraspinatus tendons . based on this complex relationship , it has been suggested that the sghl is the major stabilizing component in the anterosuperior portion of the glenohumeral joint capsule ( 23 , 24 , 25 , 26 , 27 ) . therefore , tears in this ligament may lead to medial subluxation or dislocation of the lhbt . recently , schaeffeler et al . ( 28 ) showed that the prevalence of isolated sghl tears is 29% . biceps pulley lesions can occur due to acute trauma , degenerative changes , repetitive microtrauma , congenital rotator interval defects , or injuries associated with tear in a rotator cuff ( 13 , 24 , 28 , 29 , 30 ) . these lesions are thought to be responsible for medial subluxation of the lhbt , and they may result in loss of function in the shoulder and pain in the anterior shoulder ( 24 , 25 , 31 ) . the frequency of lesions on isolated biceps pulley is 29 - 74% ( 24 , 25 , 28 ) . a recent study by braun et al . ( 25 ) prospectively analyzed the prevalence of pulley lesions , which was reported as 32% , in a consecutive series of patients undergoing arthroscopic shoulder surgery . in this study , weishaupt et al . ( 23 ) reported discontinuity of the sghl in biceps pulley lesions . the lesions of the biceps pulley , the lhbt , the subscapularis , and the supraspinatus tendon are often closely associated with each other ( fig . the instability pattern of the lhbt and the presence of tears on the rotator cuff tendons adjacent to the rotator interval can be used to diagnose biceps pulley lesions . ( 31 ) investigated the rotator interval in a series of 116 patients with isolated lesions of the supraspinatus tendon . lesion in the biceps pulley and millimetric tears on the superior border of the subscapularis tendon occurred in 19 of 116 shoulders . a recent arthrographic study by schaeffeler et al . ( 28 ) concluded that the presence of associated tendinopathy of the lhbt in oblique sagittal mr arthrography images has additional value for the diagnosis of a pulley lesion . biceps pulley lesions are difficult to diagnose by routine arthroscopic examination , so they are called " hidden lesions " . these injuries have been arthroscopically classified by bennett ( 32 ) , and this arthroscopic classification system is based on lesions involving the sghl , the chl , and the subscapularis tendon ; however , it is not applicable for mr arthrography ( 28 ) . habermeyer et al . ( 24 ) subsequently classified biceps pulley lesions into four different patterns , which shows the importance of the sghl in the lateral rotator interval ( 28 , 31 ) . according to the habermeyer classification system , group 1 lesions represent the isolated tears in sghl , with the subscapularis and supraspinatus tendons intact without biceps tendon instability ( fig . group 2 lesions involve a biceps pulley lesion in association with a partial tear in the articular - side supraspinatus tendon and a mild medial subluxation of the lhbt ( fig . group 3 lesions involve a biceps pulley lesion in association with a partial tear on articular - side subscapularis tendon and a subluxation of the lhbt ( fig . group 4 lesions involve a biceps pulley lesion in association with partial tears on articular - side of both the supraspinatus and subscapularis tendons and a medial dislocation of the lhbt ( fig . the diseases associated with biceps pulley lesions include internal anterosuperior impingement , instability of the lhbt , biceps tendinopathy , superior labrum anterior and posterior lesions ( slap ) , and adhesive capsulitis ( 13 ) . internal anterosuperior impingement was first described by gerber and sebesta ( 33 ) as a form of intraarticular impingement responsible for unexplained anterior shoulder pain . habermeyer et al . ( 24 ) subsequently described this disease as an impingement of the lhbt by the anterosuperior glenoid rim . in an arthroscopic study , habermeyer et al . ( 24 ) found partial tears on articular side of subscapularis tendon in 71.8% of the patients with anterosuperior impingement . superior labrum anterior and posterior lesions may be associated with lesions of the rotator interval and biceps pulley complex , and this was clearly described by braun et al . this original classification system is still the most widely accepted one , and six additional classifications have been developed . these new classifications represent the combination of slap lesions , with extension into different areas of the glenoid labrum and other adjacent capsuloligamentous structures . according to the new classifications , a type 10 lesion consists of a superior labral tear with extension into the rotator interval complex ( fig . otherwise , in patients with shoulder instability , the extensive anterior and anterosuperior labral tears can extend into the sghl and mghl ( figs . magnetic resonance arthrography of the glenohumeral joint is sensitive to susceptibility artifacts caused by inadvertently injected intraarticular air bubbles . with advanced sequences , such as fat - suppressed vibe , therefore , small air bubbles are usually distributed at the anterosuperior part of the joint cavity , next to the sghl or chl and the horizontal part of the lhbt ( fig . air bubbles may occasionally mimic intraarticular loose bodies , chondrocalcinosis of hyaline cartilage , and inflammatory adhesions of the joint capsule . knowledge of the intraarticular arrangement of gas bubbles would help in avoiding misinterpretation ( 36 ) . the haemorrhage resolves over time , but the hemosiderin particles may accumulate in the synovium . concordantly , the vibe sequence is a sensitive technique that will reveal the hemosiderin particles in the synovium and joint space , as well as intra - articular air bubbles ( fig . different methods of injections into the glenohumeral joint for diagnostic arthrography have been previously described . these methods involve fluoroscopy , ultrasonography , and computed tomography , as well as techniques other than image - guiding . for sonographic guidance , the use of ionizing radiation and iodinated contrast materials are avoided . although the anterior approach is the most commonly used , the posterior and the rotator interval approaches have recently been preferred ( 6 , 7 , 8) . both the posterior and rotator interval approaches are used at our institution via ultrasonography guidance . in the posterior approach , a transducer is placed over the long axis of the myotendinous junction of the infraspinatus muscle , and it is angled to show the contours of the posterior glenoid rim , posterior glenoid labrum , and posteromedial portion of the humeral head . the needle is introduced in a lateral to medial direction , obliquely from the skin to the glenohumeral joint space and parallel to the long axis of the transducer ( fig . 1 ) ( 7 ) . in the rotator interval approach , the coracoid process and the adjacent superomedial subchondral aspect of the humeral head are observed with a high frequency linear probe in a plane transverse to the joint line . the needle entry point is just superior to the subscapularis tendon and lateral to the coracoid process . the needle is advanced freehand , from medial to lateral , obliquely from the skin surface to the humeral head within the imaging plane of the transducer , until the tip reaches the cartilage of the humeral head ( fig . a direct mr arthrography of the glenohumeral joint after intraarticular injection of diluted gadolinium chelates is the preferred imaging technique for the evaluation of the labroligamentous complex and joint capsule ( 9 , 10 ) . observation of the ghls is difficult when using conventional shoulder mr imaging , because these ligaments may be poorly visualized or may mimic labral lesions ( 9 , 11 ) . ( 12 ) presented a cadaveric study comparing conventional mr imaging to mr arthrography of the same shoulder joint . in this study , the sghl was not identified by conventional mr imaging , in all of the cases ; however , it was identified by direct mr arthrography , in all of the cases . at our institution , we prefer direct mr arthrography for the identification of the labroligamentous complex . at our institution , mr arthrography and conventional mr imaging examinations are performed with a 1.5-t or 3-t mr scanner ( magnetom avanto or magnetom skyra ; siemens healthcare , berlin , germany ) within 15 minutes after the injection . our mr arthrography protocol uses fat - suppressed spin - echo ( se ) t1-weighted images . this is performed in the axial , oblique coronal , and oblique sagittal planes , with surface coils placed around the shoulder joint ( 650/15 , echo train length 8 mm , section thickness 3 mm , spacing 0.3 mm , field of view [ fov ] 16 cm , matrix 256 250 , 3 signals acquired ) . in our clinical practice , a fat - suppressed three dimensional ( 3d ) volumetric interpolated breath - hold examination ( vibe ) sequence ( repetition time / echo time 13.2/4.7 msec , flip angle 11 , 160 160 mm fov , matrix 512 512 , one slab of 112 slices with a slice thickness of 0.6 mm , and one acquisition ) is also added to the shoulder mr arthrography scanning protocol , after the t1-weighted se fat - suppressed sequences are acquired . fat - suppressed 3d vibe sequence imaging is a relatively new spoiled gradient - echo protocol that provides fast low angle images . the use of 3d vibe sequences produces thinner image slices with the thickness of 0.6 mm , which enhances effectiveness of the imaging . it also provides good contrast between the glenoid and surrounding soft tissues in mr arthrography of the glenohumeral joint . anatomical knowledge of the labroligamentous structures is crucial to the diagnosis of abnormalities revealed by mr arthrography . the glenoid labrum deepens and increases the surface area of the articulation ( 13 ) . it also serves as a primary anchoring structure for the ghls , the capsule , and the lhbt ( 3 ) . superiorly , the glenoid labrum blends with the sghl and the lhbt ; and anteriorly , it blends with the anterior band of the ighl ( 14 ) . the rotator interval consists of the following structures , in the order from outside to inside : the coracohumeral ligament ( chl ) , the interval capsule , and the sghl . the chl arises from the dorsolateral aspect of the base of the coracoid process and courses through the rotator interval to blend with fibers from the sghl . its fibers then attach laterally to the greater tuberosity , fusing with the anterior fibers of the supraspinatus tendon insertion and the medial bicipital sheath , before fusing with the superior fibers of the subscapularis tendon insertion ( 13 ) . the rotator interval may be thought of as a roof over the intraarticular portion of the lhbt ( 3 ) which arises from the anterosuperior labrum ( 13 , 14 ) . the chl and sghl are composed of a sling - like band surrounding the lhbt proximal to the bicipital sulcus ( 13 ) . it originates from the supraglenoid tubercle anterior to the lhbt attachment , and inserts into the fovea capitis line superior to the lesser tuberosity of the bicipital sulcus ( 13 , 15 ) . the sghl is identified in 97 - 98% of the patients through arthroscopic and arthrographic series ( 16 ) . macroscopically , the sghl is u - shaped and this shape lends support to the lhbt in the superior aspect of the bicipital sulcus ( 13 ) . the sghl runs parallel to the coracoid process and nearly perpendicular to the mghl ( 1 , 3 , 13 , 14 , 16 ) . using mr arthrography , the sghl is best visualized in the sagittal oblique and axial planes ( fig . the sghl is visualized as a low signal intensity intraarticular structure parallel to the coracoid process . sagittal oblique mr arthrography shows that the sghl is located underneath the coracoid process and chl . a normal foramen exists between the sghl and the mghl , allowing communication of the glenohumeral joint cavity through the subscapularis recess ( 1 , 3 , 17 , 18 ) . the sghl usually originates from the supraglenoid tubercle , just anterior to the lhbt attachment . however , its origin may vary ( posterior supraglenoid tubercle , superior labrum , lhbt , mghl , or some combination ) ( figs . 4 , 5 , 6 , 7 ) ( 17 , 19 ) . although the sghl may vary in shape and size ( fig . 8) , it usually presents as a thick structure when the mghl is absent or undeveloped ( figs . it may be absent in arthroscopic and mr arthrographic series , in 2 - 3% of the patients ( 16 ) . in a recent study by kask et al . ( 20 ) , the sghl was found in all 27 shoulder joint specimens investigated . a longitudinal split or duplicate ligament may reflect a normal variant or a longitudinal tear of the sghl ( fig . magnetic resonance arthrography of the glenohumeral joint is the most accurate imaging technique established , for identifying pathologies of the sghl and the associated structures . in a retrospective study comparing mr arthrographic findings with surgical findings , chandnani et al . ( 21 ) determined that mr arthrography had a sensitivity of 100% , a specificity of 94% , and an accuracy of 94% in the diagnosis of sghl tears . a torn sghl may be observed in mr arthrography images as increased signal intensity that looks like disruptions and thick , wavy , or irregular structures ( 19 , 22 ) . the biceps pulley is an important component of the rotator interval . this complex anatomical structure consists of the sghl and the chl , and it is also in direct contact with the distal fibers of the subscapularis and the supraspinatus tendons . based on this complex relationship , it has been suggested that the sghl is the major stabilizing component in the anterosuperior portion of the glenohumeral joint capsule ( 23 , 24 , 25 , 26 , 27 ) . therefore , tears in this ligament may lead to medial subluxation or dislocation of the lhbt . recently , schaeffeler et al . ( 28 ) showed that the prevalence of isolated sghl tears is 29% . biceps pulley lesions can occur due to acute trauma , degenerative changes , repetitive microtrauma , congenital rotator interval defects , or injuries associated with tear in a rotator cuff ( 13 , 24 , 28 , 29 , 30 ) . these lesions are thought to be responsible for medial subluxation of the lhbt , and they may result in loss of function in the shoulder and pain in the anterior shoulder ( 24 , 25 , 31 ) . the frequency of lesions on isolated biceps pulley is 29 - 74% ( 24 , 25 , 28 ) . a recent study by braun et al . ( 25 ) prospectively analyzed the prevalence of pulley lesions , which was reported as 32% , in a consecutive series of patients undergoing arthroscopic shoulder surgery . in this study , the lesions of the biceps pulley , the lhbt , the subscapularis , and the supraspinatus tendon are often closely associated with each other ( fig . the instability pattern of the lhbt and the presence of tears on the rotator cuff tendons adjacent to the rotator interval can be used to diagnose biceps pulley lesions . ( 31 ) investigated the rotator interval in a series of 116 patients with isolated lesions of the supraspinatus tendon . lesion in the biceps pulley and millimetric tears on the superior border of the subscapularis tendon occurred in 19 of 116 shoulders . a recent arthrographic study by schaeffeler et al . ( 28 ) concluded that the presence of associated tendinopathy of the lhbt in oblique sagittal mr arthrography images has additional value for the diagnosis of a pulley lesion . biceps pulley lesions are difficult to diagnose by routine arthroscopic examination , so they are called " hidden lesions " . these injuries have been arthroscopically classified by bennett ( 32 ) , and this arthroscopic classification system is based on lesions involving the sghl , the chl , and the subscapularis tendon ; however , it is not applicable for mr arthrography ( 28 ) . habermeyer et al . ( 24 ) subsequently classified biceps pulley lesions into four different patterns , which shows the importance of the sghl in the lateral rotator interval ( 28 , 31 ) . according to the habermeyer classification system , group 1 lesions represent the isolated tears in sghl , with the subscapularis and supraspinatus tendons intact without biceps tendon instability ( fig . group 2 lesions involve a biceps pulley lesion in association with a partial tear in the articular - side supraspinatus tendon and a mild medial subluxation of the lhbt ( fig . group 3 lesions involve a biceps pulley lesion in association with a partial tear on articular - side subscapularis tendon and a subluxation of the lhbt ( fig . group 4 lesions involve a biceps pulley lesion in association with partial tears on articular - side of both the supraspinatus and subscapularis tendons and a medial dislocation of the lhbt ( fig . the diseases associated with biceps pulley lesions include internal anterosuperior impingement , instability of the lhbt , biceps tendinopathy , superior labrum anterior and posterior lesions ( slap ) , and adhesive capsulitis ( 13 ) . the sghl can be thicker in the patients with adhesive capsulitis ( fig . internal anterosuperior impingement was first described by gerber and sebesta ( 33 ) as a form of intraarticular impingement responsible for unexplained anterior shoulder pain . habermeyer et al . ( 24 ) subsequently described this disease as an impingement of the lhbt by the anterosuperior glenoid rim . in an arthroscopic study , habermeyer et al . ( 24 ) found partial tears on articular side of subscapularis tendon in 71.8% of the patients with anterosuperior impingement . superior labrum anterior and posterior lesions may be associated with lesions of the rotator interval and biceps pulley complex , and this was clearly described by braun et al . this original classification system is still the most widely accepted one , and six additional classifications have been developed . these new classifications represent the combination of slap lesions , with extension into different areas of the glenoid labrum and other adjacent capsuloligamentous structures . according to the new classifications , a type 10 lesion consists of a superior labral tear with extension into the rotator interval complex ( fig . otherwise , in patients with shoulder instability , the extensive anterior and anterosuperior labral tears can extend into the sghl and mghl ( figs . magnetic resonance arthrography of the glenohumeral joint is sensitive to susceptibility artifacts caused by inadvertently injected intraarticular air bubbles . with advanced sequences , such as fat - suppressed vibe , therefore , small air bubbles are usually distributed at the anterosuperior part of the joint cavity , next to the sghl or chl and the horizontal part of the lhbt ( fig . air bubbles may occasionally mimic intraarticular loose bodies , chondrocalcinosis of hyaline cartilage , and inflammatory adhesions of the joint capsule . knowledge of the intraarticular arrangement of gas bubbles would help in avoiding misinterpretation ( 36 ) . the haemorrhage resolves over time , but the hemosiderin particles may accumulate in the synovium . concordantly , the vibe sequence is a sensitive technique that will reveal the hemosiderin particles in the synovium and joint space , as well as intra - articular air bubbles ( fig . the sghl is known to be difficult to evaluate based on anatomical structures identified in arthrographic and arthroscopic examinations . the sghl can be ruptured as an isolated form and it can also be damaged with anterosuperior impingement syndrome , biceps tendon instability , slap lesions , and anterior instability of the glenohumeral joint . in addition to routine mr arthrography sequences , advanced mr arthrographic sequences such as vibe may greatly help in the diagnosis of the sghl and in identifying its morphology and the associated pathologies .

the purpose of this review was to demonstrate magnetic resonance ( mr ) arthrography findings of anatomy , variants , and pathologic conditions of the superior glenohumeral ligament ( sghl ) . this review also demonstrates the applicability of a new mr arthrography sequence in the anterosuperior portion of the glenohumeral joint . the sghl is a very important anatomical structure in the rotator interval that is responsible for stabilizing the long head of the biceps tendon . therefore , a torn sghl can result in pain and instability . observation of the sghl is difficult when using conventional mr imaging , because the ligament may be poorly visualized . shoulder mr arthrography is the most accurately established imaging technique for identifying pathologies of the sghl and associated structures . the use of three dimensional ( 3d ) volumetric interpolated breath - hold examination ( vibe ) sequences produces thinner image slices and enables a higher in - plane resolution than conventional mr arthrography sequences . therefore , shoulder mr arthrography using 3d vibe sequences may contribute to evaluating of the smaller intraarticular structures such as the sghl .

INTRODUCTION Arthrography Procedure Imaging Techniques Normal Anatomy of the Superior Glenohumeral Ligament Congenital Variants of the Superior Glenohumeral Ligament Pathologies of the Superior Glenohumeral Ligament Diagnostic Pitfalls CONCLUSIONS

capable staff and an efficient system are essential requirements in order to provide an acceptable level of health services in a community . therefore , there are special quality assurance schemes in place to assess the excellence of education in medical sciences fields in most of developed countries . for such an assessment , accreditation is a high - quality evaluation scheme ( 1 ) . according to the definition introduced by the council on higher education accreditation ( chea ) in usa , accreditation is a process based on self and elite s assessment for guaranteeing and improving the quality and responsibility of an institute or university course . in such a process , it can be specified whether the studied institute or program is based on standards issued by the chea and whether their performances fulfills the specified goals of the chea or not ( 2 ) . thus , one of the most important advantages of accreditation is to ensure the government , society , learners , and the executive authorities of educational institutes about education quality and the quality of learners through guaranteeing the quality of the under - assessment unit . however , it should be considered that the value of accreditation is not limited to investigations and supervisions , but experiences of accreditation systems rather show that the activities of such systems will lead to establishment and reinforcement of internal assessment processes in educational institutes . in fact , internal and external assessment inside an accreditation structure can help such structures to make best use of the benefits of the both methods ( 3 , 4 ) . edcs were established in universities of medical sciences in iran in the late 90s ; their main aim has been to improve the education quality ( 5 ) . the tasks for these centers , classified in five main fields : 1 ) educational planning 2 ) teacher training 3 ) research in education , 4 ) standardization of exams and teaching assessments , and 5 ) continuous medical education ( 6 ) . however , by extension of the education fields in clinical and non - clinical fields , the tasks of edc especially in recent years has been widening , which are as follows ( 7 ) : directing , coordinating , and supervising the educational programs , the evaluation of new assessment / examination techniques , analyzing the results of exams , and comprehensive assessment of academic stafforganizing and supervising activities in related to top and gifted and talented studentssupporting and scaling up researches in educationcoordinating activities in tele - education and e - learning , educational excellencecoordinating and supervising the education development offices in schools and training hospitalscoordinating all activities in related to academic staff development directing , coordinating , and supervising the educational programs , the evaluation of new assessment / examination techniques , analyzing the results of exams , and comprehensive assessment of academic staff organizing and supervising activities in related to top and gifted and talented students supporting and scaling up researches in education coordinating activities in tele - education and e - learning , educational excellence coordinating and supervising the education development offices in schools and training hospitals coordinating all activities in related to academic staff development regarding the goal of these centers , it is important to make sure that edcs are working efficiently . therefore , formal monitoring of their performance is one of the crucial steps for constant improvement in medical education ( 8) . it is obvious that the activity and tasks of edcs in all universities are not exactly the same . therefore , creating appropriate and comprehensive indicators is a very critical step for any type of assessments of edcs performance . based on the above logic , in the 42 session of the council of education deputy managers on 17/12/2008 approved that only universities with standard edcs can apply to establish new educational program ( 7 ) . therefore , a real need for accreditation of edcs was materialized . however , generating a valid tool with comprehensive standards is literally complicated . in order to address to this request , a process was defined in the education deputy of ministry of health and medical education ( mohme ) to designs an accurate model for accrediting the edcs of ums . in this paper , the steps and the process of this development is presented . special criteria were used to select the best candidates out of experts in the medical education field from the whole country . all of the team members had deep and vast knowledge in the medical education field , long term of experience as a manager in ums , and were familiar with accreditation concepts . accreditation elements in vertern model ( 9 ) are as follows : explanation of pre - defined standardsinternal - assessment by institutemaking a team for external assessmentsite visitreporting the external team s reportassessment of the report by expert committeefinalizing the report and decision making accordingly explanation of pre - defined standards internal - assessment by institute making a team for external assessment reporting the external team s report assessment of the report by expert committee finalizing the report and decision making accordingly having reviewed all available documents and shared experiences , the team decided to design a set of standards in two levels which were basic ( essential ) and quality improvement standards . the basic standard means the required standard ( the musts ) which each center has to prove complying with for accreditation . quality improvement standard means the preferred standard ( the shoulds ) , specifying the development path of the center . of course , only the basic standards were used in executing the presented model . in order to maximize the content validity of these standards , then , minimums and ideals of each edc were defined through reviewing existed rules and regulations . in the next step , then , the written standards were criticized in the group and a final version of standards was developed by consensus . each standard was explicitly explored the different sessions before finalizing indicators . in the next phase , the five selected areas 1)governing and leadership , 2)educational planning , 3)faculty development , 4)assessment and examination , and 5)research in education are presented in tables 1 along with their standards . a questioner was sent to ums including operational definitions of each standard as the first step . the main goal of this step was to assess if ums could find standards appropriate and applicable . a new national committee was formed from among those who had appropriate scientific and experimental experiences and did not hold any executive positions in educational management of the university . in addition , they verified responses of ums using independent sources . using cluster analysis , we assessed the similarities between the obtained scores for indicators ; then we classified indictors into clusters in a way to minimize the distance of scores for ever indictor from the centers of clusters . a questioner was sent to ums including operational definitions of each standard as the first step . the main goal of this step was to assess if ums could find standards appropriate and applicable . a new national committee was formed from among those who had appropriate scientific and experimental experiences and did not hold any executive positions in educational management of the university . in addition , they verified responses of ums using independent sources . using cluster analysis , we assessed the similarities between the obtained scores for indicators ; then we classified indictors into clusters in a way to minimize the distance of scores for ever indictor from the centers of clusters . findings delineated that all medical - sciences edcs of iran were capable of taking part in the project and presented required data and information to execute the project which showed that the defined indices were measurable and perceivable . as shown in table 2 , edcs failed to pass in the following standards : - responsive training in education planning area- resources in governing and leadership area- variety of curriculums in the area of faculty members development- modern assessment methods in the assessment area - responsive training in education planning area - resources in governing and leadership area - variety of curriculums in the area of faculty members development - modern assessment methods in the assessment area on the other hand , the standards in the area of faculty members participation in projects ( management , website , clinical skills training , assessment of faculty members , and internal assessment ) had the best optimum levels . the above case showed that edcs in ums have to pay more attention in the following areas in order to improve their performance : - responsive training- variety of curriculums,- empowerment of faculty members- applying modern assessment methods - responsive training - variety of curriculums , - empowerment of faculty members - applying modern assessment methods fixing 2 as the number of clusters , the averages of distances from the centers were dropped from 2.03 to 0.44 in cluster 1 , and from 0.97 to 0.14 in cluster 2 . fixing 3 as the number of clusters , the averages of distances from centers were dropped from 1.78 to 0.68 in cluster 1 , from 1.6 to 0.55 in cluster 2 , and 2.19 to 0.17 in cluster 3 . for example , defining two clusters , the indicators in cluster 1 were 1 ) responsive training in educational planning , 2 ) the variety curriculums , 3 ) modern assessment methods , 4 ) manpower , 5 ) recourses , and 6 ) the structure the edc . based on the above findings , it seems that although cluster analysis might find a few factors by combining indicators , the components of these created factors belongs to the indicators from every groups of governing and leadership , educational planning , faculty development , assessment and examination and research in education . in other words , the conceptual framework for defining main categories of indicators our findings showed that the generated indicators have enough comprehensiveness to cover nearly all activities within edc . however , the pattern of responses and scores did not support the initial conceptual framework . it seems for development of a valid and feasible accreditation scheme of edcs more experience and practice is needed . , accreditation has been quickly spreading outside its initial borders ( i.e. north america ) . this spread , by itself , resulted in some modifications in basic concepts of accreditation like the role of government as well as it s voluntarily nature in accreditation . accreditation which was initially an association to empower an organization , gradually changed into a tool in order to supervise and improve quality . so , in the definitions of accreditation among references outside the us , there is not any point regarding the non - governmental and voluntary concepts of accreditation ( 10 ) . in usa , too , supervising the accreditation process is performed by the government ; moreover , accrediting the accreditation institutes of medical education is also done by the us government ( 11 ) . methods and contents of modern accreditation systems are generally very similar to the previous and initial structures ( 10 ) . in iran , from the 3rd national development plan from one decade ago , special attention has been directed to launch different sorts of assessments and accreditation systems to assess and improve the efficiency of educational institutes . different enactments have numerously emphasized the importance of accreditation in medical universities and colleges ( 12 ) , and among edcs have a critical role to reform in medical education ( 13 ) for improving social accountability of medical education in iran ( 14 ) . the generated indicators were based on a consensus among a group of experts in medical education in iran . these experts defined indictors and their standards based on the current list of edc tasks after a long discussion . most of universities could address to these indicators easily without any objections ; which might imply that the selected indicators and their standards were clear and comprehensive to cover almost all of their activities . however , the results of factorial analysis were not compatible with the initial designed conceptual framework . it means that the strength of the association among edc activities did not have a strong relationship with their labels and groups ; as an example , responsive training and modern assessment methods had strong association although they are categorizing in two different groups . these discrepancies are very important and more targeted researches are recommended to address why some of a part activities have strong correlations , but more similar and conceptually linked activities did not strong correlations . although , this study might be unique , because of its approach to the concept of accreditation in the assessment of the quality edcs activities ; we did not check the validity of universities responses in field observation . nonetheless , usually the responses of university in similar assessments were acceptable in national programs . however , for a real accreditation , it is recommended the main steps of the vertern model to be followed ( 9 ) . the implementation of this accreditation scheme of the edcs would be a critical point for quality improvement of medical education . however , based on our observation , ums have to work intensively to fill their gaps to obtain basic standards in all indicators ; otherwise , in the next round of accreditation a considerable number of edcs will be disapproved . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .

background : in order to improve the quality of education in universities of medical sciences ( ums ) , and because of the key role of education development centers ( edcs ) , an accreditation scheme was developed to evaluate their performance.method:a group of experts in the medical education field was selected based on pre - defined criteria by edc of ministry of health and medical education . the team , worked intensively for 6 months to develop a list of essential standards to assess the performance of edcs . having checked for the content validity of standards , clear and measurable indicators were created via consensus . then , required information were collected from ums edcs ; the first round of accreditation was carried out just to check the acceptability of this scheme , and make force universities to prepare themselves for the next factual round of accreditation.results:five standards domains were developed as the conceptual framework for defining main categories of indicators . this included : governing and leadership , educational planning , faculty development , assessment and examination and research in education . nearly all of ums filled all required data forms precisely with minimum confusion which shows the practicality of this accreditation scheme.conclusion:it seems that the ums have enough interest to provide required information for this accreditation scheme . however , in order to receive promising results , most of universities have to work intensively in order to prepare minimum levels in all required standards . however , it seems that in long term , implementation of a valid accreditation scheme plays an important role in improvement of the quality of medical education around the country .

Introduction Methods Data collection Results Discussion Conclusion Ethical considerations

periodontitis constitute a major cause of tooth loss in adults worldwide , and most children and adolescents exhibit signs of gingivitis . this is particularly the case in underprivileged subpopulations in both developing and developed countries [ 2 , 3 ] . even in high - income countries with advanced public oral health care , likely reasons to account for these prevalent diseases include genetic , epigenetic , and environmental risk factors , as well as other individual and socioeconomic determinants . epidemiological and immunological studies suggest that irreversible tissue damage from periodontal disease begins in late adolescence and early adulthood . gingivitis prevalence , severity and extent increase with age , beginning in the deciduous dentition and reaching a peak at puberty , followed by a limited decline in adolescence [ 68 ] . at a population level , plaque and calculus deposition , as well as occurrence of gingivitis and periodontitis , are slightly higher in boys than in girls . dentofacial anomalies , toothbrushing frequency , socioeconomic and psychological conditions experienced in early life and life course have also been associated with gingival bleeding in adolescents [ 911 ] . calculus and gingival bleeding are clinical indicators of poor oral hygiene and periodontal condition and have been frequently used in epidemiological studies as part of the community periodontal index ( cpi ) or separately analyzed . both gingival bleeding and calculus in brazilian adolescents have been significantly associated with race , family income , levels of schooling , and type of school attended [ 10 , 12 , 14 , 15 ] . current studies show that , regardless the socioeconomic indicator used , people who are socioeconomically disadvantaged consistently have poorer periodontal outcomes . however , investigation of the influence of socioeconomic status on the etiological pathway of periodontal condition is still required to better understand its determinants . moreover , global reports have emphasized that continuing surveillance of levels and patterns of risk factors is of fundamental importance to planning and evaluating community preventive activities and oral health promotion in all parts of the world . in that context , multilevel analysis technique considers both people and areas on the distribution and determinants of population health , being an important approach to understand the significance of specific contexts for different individual health outcomes . so far , there are very few studies investigating the influence of contextual variables using multilevel analysis in the periodontal status of schoolchildren [ 12 , 19 ] . the present study aimed to describe periodontal health status and its association with individual and contextual factors among 12-year - old schoolchildren in a midwest brazilian capital city . the present cross - sectional study was carried out in the city of goiania , capital city of goias state , located in the midwest region of brazil . the analysis included primary data from an epidemiological survey of oral health carried out in 2010 . the oral health survey of 12-year - old schoolchildren in the urban area followed the methodology of the 2010 brazilian national survey of oral health . clinical examinations were according to diagnostic criteria established by the world health organization ( who ) . although data on other oral conditions were collected , only data on periodontal condition was included in the present study . the research protocol was approved by the ethics committee of the federal university of goias , brazil ( report 226/2010 ) and only the schools and the children whose parents signed an informed consent participated in the study . the age 12 years was chosen following the who recommendations for the monitoring of oral health status among children . it is generally the age at which children leave primary school , and therefore it is the last age at which a reliable sample may be easily obtained through the school system . sample size was calculated to be representative of the 12-year - old schoolchildren in goiania . we used the cluster sampling technique and the sample was randomly selected in two stages . initially , we draw the number of first stage unities ( schools ) , followed by second stage unities ( schoolchildren ) . according to data obtained from the state and the city 's education department , the total number of 12-year - old schoolchildren enrolled in 2009 was 17,911 in 281 public and private schools . sample size was calculated using an equation for proportions for infinite populations based on caries prevalence , using the epi info software , version 3.5.1 . the minimum number of schoolchildren to take part in the research was 2,171 , considering a confidence interval of 95% , sampling error of 2% , and caries prevalence of 65.3% . for effect of study sample design , a simplified and conservative correction was needed , multiplying the obtained sample size by 1.2 ( an extra 20% ) . , we used a formula that consisted of multiplication of the number of schools by the number of schoolchildren of the sample , divided by the total number of 12-year - old schoolchildren in goiania . the sample was equitably distributed in the seven health districts in the city : central , eastern , northwestern , northern , western , southwestern , and southern . each health district comprises a geographic area with specific population , well - defined health issues , and unique interaction with health care teams . as the total sample was of 2,605 schoolchildren , and the number obtained from the list was approximately of 2,962 schoolchildren , we opted for including all students attending the selected schools . data were collected through oral clinical examinations and interviews with the children by six teams composed by one dentist and one recorder , who worked in the public health service . they were previously trained and calibrated , according to the criteria used in the 2010 brazilian national survey of oral health . inter - examiner kappa coefficient for periodontal condition varied from 0.68 to 1.00 , showing a good to excellent reproducibility . intraoral examinations were carried out at the schools using a mouth mirror and a who periodontal probe under natural light , with the children seated in school chairs . for the assessment of periodontal status , two components of the community periodontal index ( cpi ) were used : calculus and bleeding . each sextant of the mouth was examined for calculus detected during probing and bleeding observed after probing . index teeth were 16 , 11 , 26 , 36 , 31 , and 46 . in each tooth , six sites were examined , and the worst condition was recorded . recommended probe placement was of approximately 60 degrees inclination in relation to the longitudinal axis of the tooth . information on demographic and socioeconomic characteristics of the participating children was also collected : sex , self - rated skin color or race , and mother 's level of schooling . self - rated skin color or race followed criteria proposed by the brazilian institute of geography and statistics ( ibge ) : white , black , yellow ( asian origin individuals ) , brown , or indigenous . mother 's level of schooling was based on completed years of study and was obtained from the children 's school records . secondary data were : type of school ( public and private ) , existence of toothbrushing program at the schools , and the city 's health districts where the schools were located . the school toothbrushing program was created in 1992 through a partnership between the local health and education secretaries . its aim is to improve the oral health status of schoolchildren enrolled in public schools of goiania via implementing daily toothbrushing with fluoride toothpaste after the school meal . the dependent variable was the prevalence of periodontal condition , featured by the presence of calculus and/or bleeding ( yes or no ) . independent variables were divided into two levels of data organization : individual ( schoolchildren ) and contextual ( schools and health districts ) . in the individual level , we analyzed children 's demographic characteristics ( sex and skin color or race ) , and one socioeconomic indicator ( their mothers ' level of schooling ) . self - rated color / race was categorized in : white , black , and brown . due to the small number of individuals who rated themselves as yellow or indigenous , level of mother 's schooling was grouped as follows : less than eight , from eight to eleven and more than eleven , years of study . contextual variables were type of school ( public and private ) , existence of toothbrushing program at the school , and city 's health district where schools were located . the seven health districts were grouped according to their socioeconomic characteristics , as informed by the local health authorities . the health district located more centrally ( central - campinas ) presented better - off socioeconomic and health indicators than the others , which were located in the outskirts . therefore , we have classified them in three categories : ( group i ) with the best indicators ( central - campinas ) ; ( group ii ) with intermediate indicators ( north , south and east ) ; ( group iii ) with the worst indicators ( southwest , west , and northwest ) . rao - scott test , an equivalent to chi - square test for complex samples , was used to test dependence between variables . this analysis was performed using the stata 12 software , considering the complex sample plan and sample weights . after that , we performed a multilevel analysis with random intercept , considering three levels : schoolchildren , schools , and health districts ( figure 1 ) . poisson log - linear regression models were adopted , with robust variance estimator , to estimate prevalence ratio as effect measure , and its confidence interval of 95% measured by wald test . we carried out only unadjusted analysis due to collinearity between the independent variables that could jeopardize data in the multiple analysis . in addition to considering the sample design through variance partition in each level , multilevel analysis allows for the inclusion of contextual variables of higher levels than the individual . , we considered the 5% significance level and sample weights derived from sample design ( school weights ) . of the 41 schools invited to participate , 39 accepted ( 24 public and 15 private ) . of the 2,962 schoolchildren invited to take part in the survey sample was composed mainly of males ( n = 1,053 , 50.9% ) , those who classified themselves as brown ( n = 1,089 , 54.5% ) , and whose mothers had studied from eight to eleven years ( n = 1,080 , 51.2% ) . the majority of the students were from public schools ( n = 1,471 , 71.2% ) . table 1 presents the frequency distribution of the studied variables and the results of bivariate associations between the dependent variable and the independent variables . adverse periodontal conditions , such as presence of calculus and/or bleeding , were present in 140 schoolchildren , a prevalence of 7% ( 95% ci = 5.39.2 ) . a total of 80 individuals ( 4.2% , 95% ci = 2.56.9 ) had bleeding and 85 had calculus ( 4.1% , 95% ci = 2.95.7 ) . in regard to individual variables , only color / race showed statistically significant association with periodontal condition . brown individuals had a higher prevalence of dental calculus and/or bleeding compared with the others ( p = 0.005 ) . among the contextual variables analyzed , type of school showed significant association with periodontal condition . public schools , compared to private ones , had a higher prevalence of dental calculus and/or bleeding ( p < 0.05 ) . children from schools located in health districts of group ii presented a 36.9% higher probability of having adverse periodontal conditions compared to those of group i ( p < 0.001 ) . those from public schools showed a prevalence of calculus and bleeding 1.54 ( 95% ci = 1.142.08 ) times higher than the children from private schools ( p = 0.004 ) . none of the other contextual factors was significantly associated with the dependent variable . at the individual level , schoolchildren who classified themselves as brown showed a prevalence of adverse periodontal condition 1.68 times higher than those of white color ( p < 0.05 ) . sex and mother 's level of schooling did not present association with the dependent variable . the occurrence of adverse periodontal conditions ( bleeding and/or calculus ) in our study was low ( 7.0% ) compared to other brazilian studies [ 7 , 12 ] and lower than that found in schoolchildren of the same age in the city of goiania in 2003 . the low levels of periodontal conditions generally found in brazilian schoolchildren may be a result of the population 's high awareness regarding personal hygiene , which is part of the national culture , and it is frequently associated with health and well being . the 2009 national school - based health survey found that 95.2% of the adolescents reported toothbrushing frequency of twice a day or more , being higher for females . however , our findings show that periodontal condition is associated with individual and contextual variables such as color / race , type of school and its location in the city , and confirm the persistent inequalities in the population 's oral health . higher prevalence of calculus and/or bleeding was found in those from lower socioeconomic groups . this study is one of the first to apply multilevel analysis to a set of data representative of adolescents attending schools in brazil . this kind of analysis allows researchers to deal with the micro - level of individuals and the macro - level of groups simultaneously . however , issues of defining relevant contexts , specifying the relevant group - level variables , and collecting the necessary data remain a challenge and that was also true in our case . thus , one limitation of the study was the small number of individual and contextual variables analyzed due to time constraints in the data collection period . nevertheless , the individual and contextual factors studied here can be useful for identifying vulnerable groups and consequently contribute to a more effective and focused planning for oral health interventions . the results did not show a significant worse periodontal status for males than females , which was different from some studies [ 12 , 26 ] but in accordance with another brazilian study . the difference in findings on sex might be due to a greater concern on males ' general health and body image in the whole of society over the last decade . the higher prevalence of adverse periodontal condition in brown individuals was different from previous studies that have found higher prevalence in black individuals in the state of sao paulo . it is important to highlight that there are nearly twice more brown individuals in the population of goias than in sao paulo , and that both groups account for lower family income , less years of study and higher illiteracy nationwide than white individuals . . the protection of families and children 's development are crucial points of attention in the public policies . in brazil , a higher proportion of families led by black or brown individuals are couples with children younger than 14 years of age , stressing the importance of promoting economic and educational equality as a mean to improve families ' health status as a whole . public schools , compared to private ones , showed higher prevalence of adverse periodontal condition . this finding has also been reported by other researchers in brazil [ 12 , 15 , 30 , 31 ] . similarly , studying in rural government schools in nepal was reported as an indicator of unhealthy periodontal status for adolescents . the type of school used as an alternative indicator for socioeconomic status is seen as a feasible predictor for caries experience in epidemiological dental caries studies involving schoolchildren in the brazilian context . children from schools located in health districts of group ii ( intermediate socioeconomic indicators ) presented a higher probability of having periodontal condition compared to group i ( best indicators ) ( p < 0.000 ) . that could be partly explained by the fact that schools located in health districts with the worst oral health indicators have greater number of students covered by health and oral health public programs , which should provide prevention , education , and oral treatment . this result also shows that schools located in health districts of intermediate socioeconomic indicators should also be seen as a priority by local health authorities . no significant difference of periodontal condition was found between schools with the school toothbrushing program and those without them . systematic reviews have shown that health education interventions may result in reductions in plaque and gingival bleeding in the short - term , but it is yet unknown if these beneficial changes are sustained in the long run . it is therefore recommended that oral health programs should focus on raising awareness about the issues that affect oral health and on promoting empowerment so that individuals develop autonomy to make healthier choices and adopt healthier lifestyles . the present study did not aim to evaluate the effectiveness of the toothbrushing program carried out in the schools , so other studies using appropriate methodologies are needed to investigate its impact on the population . the prevalence of adverse periodontal conditions in 12-year - old schoolchildren was low and was associated with individual and contextual variables . the inequalities in its distribution were mainly determined by the adolescents ' color / race , type of school , and its location in the city . appropriate strategies addressed to the areas of socioeconomic deprivation and the monitoring of school population oral health status are needed to reduce the disparities .

the study aimed to describe periodontal health status and its association with individual and contextual factors among 12-year - old schoolchildren in a midwest brazilian capital city . this cross - sectional study included data from an oral health survey carried out in 2010 in the city of goiania , brazil ( n = 2 , 075 ) and secondary data obtained from the local health authority . data were collected through oral clinical examinations and interviews . for assessment of periodontal status two components of the community periodontal index ( cpi ) were used : calculus and bleeding after probing . dependent variable was presence of any periodontal condition . independent individual variables were the children 's sex and color / race , and their mother 's level of schooling . contextual variables were related to the schools ( type and existence of toothbrushing program ) and its geographic location in the health districts . rao - scott test and multilevel poisson analysis were performed . the prevalence of calculus and/or bleeding was 7% . brown color , public schools , and those located in health district with intermediate socioeconomic indicators were associated to a higher prevalence of this condition . the prevalence of adverse periodontal condition was low and the inequalities in its distribution were determined by individual as well as contextual factors related to the schools and the geographic area .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

basic helix - loop - helix ( bhlh ) transcription factors belong to a large family of genes present in the shared ancestor of plants , animals , and fungi , and this family has undergone an expansion in the land plant lineage . often referred to as helix - loop - helix ( hlh ) proteins , a loosely defined basic domain is involved in dna binding and present in the great majority of characterized proteins in this family ; thus the term bhlh factors is used henceforth . bhlh transcription factors have been implicated in numerous biological processes in plants including responses to light , cold , and hormones , epidermal cell fate determination , developmental patterning in roots and flowers , and anthocyanin biosynthesis [ 314 ] . in many cases , the bhlh family is critically important for correct developmental and environmental responses , as demonstrated by a large number of mutants in arabidopsis with severe phenotypes as a result of a lesion in a bhlh - encoding gene . development and dehiscence of the seed and seed pod ( silique ) [ 13 , 15 , 16 ] and responses to light quality and photoperiod [ 9 , 1721 ] are particularly known to be under the control of bhlh factors , and these phenomena are important to soybean agronomic performance . characterization of the bhlh - encoding gene family can therefore be a useful step in the detailed functional characterization of the soybean genome . the bhlh transcription factors have been extensively characterized at the sequence and structural level . in animals , the best - known and most thoroughly characterized bhlhs are well - known regulators and proto - oncogenes such as c - myc , max , and e47 , where in many cases structural data on the proteins and their interaction with dna molecules is available . many animal bhlhs show a binding preference for the so - called e - box motif ( canntg ) and the residues within the protein that are required for sequence specific recognition are well defined ( reviewed in [ 2 , 22 , 23 ] ) . a number of plant bhlh proteins have been demonstrated to show a particular preference for binding the g - box ( cacgtg ) sequence ( a subset of e - box ) [ 3 , 19 , 2427 ] . homo- and heterodimer formation are also ubiquitous and required for dna binding within the bhlh family , a property that increases the combinatorial possibilities for regulation of transcription . the -helices in the bhlh domain and the other motifs outside the conserved bhlh domain are required for protein - protein interactions and function [ 2832 ] . classification of bhlh proteins is usually based on sequence homology within the conserved bhlh domain . in recent years , a number of proteins have been identified genetically that represent novel and atypical bhlh proteins that were not previously classified by homology - based approaches , in some cases because a basic domain was lacking [ 31 , 3336 ] . an intriguing feature of the bhlh family is that the proteins can often be very divergent outside of the highly conserved bhlh domain and contain a range of other motifs , not all of which have known functions [ 1 , 37 ] . for this reason , a sequence - homology - based search approach using the entire gene sequence ( such as blast of the canonical bhlhs from arabidopsis ) may not be the most appropriate tool to identify all the bhlh - encoding genes in a genome such as soybean . an alternative approach is to use data from the conserved hlh motif across the kingdoms of life to develop a hidden markov model ( hmm ) that allows the detection of the bhlh domain across highly divergent sequences without the need for extensive sequence identity . this type of approach has been successfully deployed for identifying conserved motifs in distantly related proteins and allows more sensitive and accurate discovery of a specific motif like the bhlh domain . the pfam project ( http://pfam.sanger.ac.uk/ ) uses a curated alignment approach to provide constantly updated hmms for most characterized protein families , including the hlhs . hmms for the subsidiary motifs of the different bhlh families can be generated using protein alignments . several recent genome - wide studies have examined and classified the bhlh protein family in arabidopsis thaliana , rice , poplar , and other plants with whole - genome sequences , but these studies have not examined the conservation and diversification of this family in the soybean [ 1 , 33 , 37 , 3942 ] . the bhlh transcription factor family is the second largest family of transcription factors in plants ( behind the myb family ) , and the complete whole - genome sequence of soybean revealed a number of genes predicted to encode bhlh proteins [ 4345 ] . a study of this family of genes in soybean and classification of the bhlhs into subfamilies orthologous with those present in other species is useful in order to provide a list of candidate genes that are likely to be upstream regulators of a number of processes . such lists of candidate genes enable association mapping approaches to proceed with knowledge of potential functions for regulatory genes likely involved in conferring seed and agronomic traits . they are also very helpful as a means to rapidly identify candidate genes within positional genomic intervals defined by conventional genetic fine mapping in mutant studies or as quantitative trait loci ( qtl ) in recombinant inbred populations of soybean . soybean , arabidopsis , and rice gene models were originally identified from annotation versions contained in the phytozome v7.0 package . the most recent version of the soybean assembly ( assembly v.2.0 and gene models for phytozome v.10 ) was compared with our data ; however since stringent new rules for inclusion of genes in the newer assembly and annotation resulted in the loss of 62 conserved bhlh genes including several with confirmed expression data , the legacy annotation and assembly were retained for this analysis ( http://www.phytozome.net/ ) [ 44 , 47 , 48 ] . to identify bhlh transcription factors in the soybean genome , a hidden markov model search ( hmmsearch v. 3.0 ; http://hmmer.janelia.org/ ) was applied to the predicted open reading frames ( orfs ) of soybean ( genome and assembly version gmax109 ; ) using the pfam hlh hidden markov model ( pf00010 ; http://pfam.sanger.ac.uk ) . no e - value cutoff was initially applied in order to maximize detection of poorly annotated and orphan bhlh sequences . a total of 329 hits to unique predicted proteins containing putative hlh domains were initially identified . these included 31 orfs not annotated as bhlhs by the soybean genome annotation and a small group of hlh proteins that lack the basic domain ( see section 3 ) . data on expression of soybean bhlh genes was obtained from http://www.soybase.org/ and is described in . sequences were manually curated to identify mispredictions of splice sites , which often led to omission of part of the bhlh domain in the genome annotation , reducing the hidden markov model score . sequences that included in - frame stop codons in the williams-82 genomic sequence or were missing part of the hlh domain were removed , and these soybean gene models are listed in additional file 2 ( see additional file 2 in supplementary material available online at http://dx.doi.org/10.1155/2015/603182 ) . we then examined the revised list for sequences that were atypical or were unlikely to be true bhlhs . several studies have used a stringent cutoff restricting the number of mismatches to the canonical bhlh motif found in mammals [ 22 , 39 , 40 , 50 ] . other studies have used a less stringent cutoff to identify additional , atypical bhlhs in characterized genomes . empirically , it was observed in the soybean bhlh domains that such a cutoff of 6 mismatches to the core 11 residues or 11 mismatches to the larger 19 defined residues would eliminate the soybean homologs of functionally characterized , bhlh - related proteins , and this also corresponded to the maximum number of mismatches observed in the soybean bhlh domains . therefore , no cutoffs were used , other than those previously described ( i.e. , the hmm search had to hit the sequence ( at any e - value ) and no sequences with incomplete bhlh domains or that contained stop codons were included ) . alignments were performed using mafft v.6.811b with the following parameters : alignments were visualized and edited using geneious pro v.5.4.6 for the macintosh ( biomatters ltd . , auckland , new zealand ) . the construction of the bootstrapped maximum likelihood phylogenetic tree was performed using the hpc - mpi version of raxml version 7.3.0 with geneious used to manage , curate , and reformat the mafft alignment files . the protcat option was used to select the appropriate model , and appropriate gamma model parameters were automatically selected by the software as was a maximum likelihood estimate of 25 per - site rate categories . 1052 bootstrap trees were generated , and the highest - scoring tree was visualized using the treeexplorer utility of mega 5.0 and used together with bootstrap confidence values ( as a percentage of trees ) to create the figures . assignment of subsidiary motifs in the bhlh or hlh proteins was performed using the alignment of motifs provided in supplemental material by pires and dolan . hidden markov models were generated from script - reformatted versions of these alignments using hmmbuild 2.3.2 ( the 3.0 version of hmmbuild lacks import filters for alignments in formats other than stockholm or selex ) . the presence of motifs was detected by running the full - length predicted proteins against each model using hmmsearch as described above , using a bash shell script for automation . for the apb domain , the sequences in the alignment described by khanna et al . were realigned ( using mafft --auto --reorder --clustalout ) and models generated and used for searching as described for the other motifs . using meme ( http://meme.sdsc.edu ) we searched for up to 10 new sites between 2 and 300 residues wide . using discriminative motif discovery a file was supplied containing the bhlh motif plus the sequences used to create the hidden markov models from the known bhlh secondary motifs . as above , the alignment supplied by meme for the new motif was used to create a hidden markov model , and this model was used to search the soybean bhlhs to determine which of them contained the motif . as before no e - value cutoff was applied , however the family x sequences all showed e < 10 while the two family ix sequences gmbhlh262 and 261 showed e - values of 0.0025 and 0.003 , respectively . in total , 319 gene models were identified as encoding bhlh transcription factors in soybean ( see section 2 ) . each soybean bhlh sequence in the alignment was assigned a number , as is the convention in other species . a table showing the correspondence of the gmbhlh numbers to the soybean gene models from glyma version 1.1 as well as version 2.0 and other bhlh classification information in tabular form can be found in additional file 1 . the bhlh domain consists of an n - terminal basic region of approximately 13 amino acids , followed by two alpha helices ( 14 - 15 residues in length ) separated by a loop that ranges from 5 to 14 amino acids ( figure 1 , additional file 3 ) . ( position numbers in figure 1 and additional file 3 follow the convention of , with the exception of the numbering of the second hlh domain which is numbered consistent with our soybean alignment . ) this pattern is conserved in multiple plant species as well as soybean [ 50 , 51 ] . within the two -helices , several hydrophobic residues are thought to be required to stabilize the secondary structure of the protein , and these residues are highly conserved in both plant and animal sequences [ 22 , 23 ] . at position 23 , over 99% of soybean bhlhs have a characteristic l residue . at position 55 , positions 45 and 52 are occupied by either i , l , or v , in 98.4% and 94% of soybean bhlh proteins , respectively ( figure 1 ) . additional file 3 contains a full text multiple sequence alignment for all of the soybean bhlh domains . the conservation of key residues within the basic region of the bhlh domain can predict both the potential to bind dna and the preferred recognition sequence . the e residue at position 9 within the basic domain has been shown in protein crystal structures to make contact with the major groove of the dna ( reviewed in ) . this position is conserved in 245 of 319 of the bhlhs identified in soybean ( 77% ) and has previously been shown to be present in 74% of bhlh sequences from other plants . it has been shown that e at position 9 and r at position 12 are required for the recognition of an e - box sequence 244 of the soybean bhlhs have this configuration and can be classed as e - box binding . another pattern has been described that includes h or k at position 5 , e at position 9 , and r at position 13 ( h5-e9-r13 ) ; in animals these bhlhs recognize the e - box subset cacgtg . this sequence is a commonly occurring promoter motif in plant genomes , where it is referred to as the g - box , and a number of plant bhlh proteins have demonstrated g - box binding activity [ 3 , 24 , 26 , 27 ] . 186 ( 58% ) of soybean bhlh proteins have a conserved h / k5-e9-r13 motif and thus could be candidates for binding the g - box sequence . the conservation of these residues that are potentially involved in protein - dna interaction within soybean is an indication that the dna - binding function and also the recognition sequence may be conserved . of the soybean bhlh proteins that lack the e9 residue ( 74 proteins ) only eight have five or more basic residues within the basic region . the number of basic residues has been previously used as a criterion to classify hlh proteins as having the potential to bind dna . since the e9 residue is thought to be required for e - box binding , it is possible that these proteins bind dna at a non - e - box dna sequence , although this has not yet been demonstrated for plant bhlhs . the remaining 66 hlh domains , which contain 4 or fewer basic residues within the basic region , are classified as hlh proteins and are unlikely to bind dna directly . many proteins identified through mutant studies in recent years in plants as atypical or nonbasic bhlhs have few or no basic residues in this region [ 7 , 31 , 34 , 35 , 57 ] . they do not bind dna but in some cases act in concert with the more typical bhlhs to regulate gene expression by negative interference , and similar non - dna binding hlhs exist in animal systems [ 22 , 31 , 58 , 59 ] . since these helix - loop - helixes are related to the bhlhs and are involved in many of the same pathways , they are included in our characterization of soybean bhlhs if they are recognized by the hlh hmm . most plant bhlhs have a conserved intron structure with three introns within the bhlh domain [ 33 , 39 , 40 ] . the intron / exon patterns were examined for soybean bhlh - encoding genes , and it was determined that 31% of soybean bhlhs contain the pattern of three conserved introns ( pattern a , figure 2 ) . 43% of the soybean bhlhs contain only one of these introns ( pattern d ) , and 4% of soybean bhlhs have another subset of these conserved introns ( patterns b , c , and e ) . only 8.7% of soybean bhlhs exhibit a different splicing pattern , which fall into other distinct classes ( figure 2 , patterns f , g , h , or other ) . the proportions of distinct intron patterns in soybean genes are consistent with the intron structure distribution in the arabidopsis and rice bhlh families [ 33 , 39 , 40 ] . as previously observed for the bhlh superfamily , intron distribution tends to be conserved within bhlh subfamilies and lends additional credence to these class distinctions . the bhlh superfamily in plants is composed of between 14 and 32 subfamilies based on phylogenetic analysis of the bhlh region [ 1 , 33 , 37 , 39 , 40 ] . supporting these classifications , it has been found that both the intron patterns , other domains of sequence homology outside the bhlh region , and dna binding potential are often conserved within these subfamilies . a phylogenetic reconstruction of the soybean bhlhs shown in figure 1 , together with at least one arabidopsis bhlh sequence representing each of the major subfamilies , was generated based on the alignment of the bhlh domain ( figure 1 and additional file 3 ) . the alignment used to generate the phylogenetic tree , which contains representative arabidopsis sequences and excludes all but one of any identical soybean sequences , is supplied as additional file 7 . a bootstrapped maximum likelihood tree ( 1,052 bootstraps ) the best scoring tree is displayed in figure 3 using a summary radiation diagram to show branch lengths and provide an overview of the similarities within 24 bhlh subfamilies found in soybean . the full phylogeny including bootstrap support values ( expressed as percentages ) is presented in additional file 4 . a number of intriguing aspects of the soybean bhlh proteins are apparent from this tree . family xiv has one functionally characterized member in arabidopsis , sac51/atbhlh142 , which is involved in spermidine synthase - mediated stem elongation . secondly , family viia / b has been repeatedly shown to be involved in light signalling [ 9 , 1721 ] . interestingly , pif3 ( atbhlh008 ) , which interacts directly with phytochromes and mediates light - responsive gene expression , has a number of highly conserved homologs in soybean family viia / b . the short branch lengths within this family may indicate higher levels of sequence or structural constraint . hfr1 ( atbhlh026 ) , also involved in light signalling and normally placed in family viia / b , has only very distant similarity to any soybean protein and , in our analysis , appears as an outlier of family xv ( figure 3 , additional file 4 ) . we did not observe any atypical bhlh proteins or families in soybean that clearly do not fit into one of the characterized arabidopsis families ; however several ambiguous sequences were observed in the phylogeny ( figure 3 , additional file 4 ) . we were able to assign families to all these sequences using branch length data , additional motif information , and blast searches ; however not all families formed monophyletic groups ( see additional file 4 ) . in addition to the bhlh domain analysis , any of the bhlh subfamilies can also be distinguished by the presence of one or more characteristic motifs outside the bhlh domain [ 1 , 33 , 37 , 55 ] . to identify these motifs in the predicted full - length sequences of the soybean bhlhs , hmms were created from alignments of the motifs from across the plant kingdom that were previously published . the soybean bhlhs and subfamilies that possess these defined motifs are highlighted in additional file 1 . all of the previously described motifs were detected with the exception of motif 28 , which is associated with family xiv , which was also found to be absent from soybean . the hmm created from the alignment of the active phytochrome binding ( apb ) domain described in matched precisely the same protein motifs as those identified using the hmm for motif 14 . a search was conducted using meme ( http://meme.sdsc.edu ) for new motifs , by excluding the known secondary motifs plus the bhlh domain . this sequence is strongly conserved in all the gmbhlh sequences 165184 ( family x ) . in the supplemental material this is named motif 40 , although it follows closely the distribution of motif 20 ; the ngadywap portion of this motif is similar to motif 20 and it likely represents an expanded version of this motif . much weaker similarity to motif 40 is also observed in gmbhlh261 and gmbhlh262 of family xi . this motif is also conserved in several arabidopsis bhlhs in family x. to compare the soybean bhlhs to arabidopsis and o. sativa homologs , blast searches of the predicted arabidopsis and rice proteomes were conducted with the predicted full - length coding sequences of the soybean bhlhs . a total of 141 soybean bhlhs hit arabidopsis proteins with > 50% amino acid sequence identity , and 288 had hits with an e - value of less than 10 ( additional file 5 ) . a total of 151 soybean bhlhs shared > 50% sequence identity with rice , 255 with an e - value of less than 10 . in order to increase confidence that true orthologs were detected , a reciprocal blast search of the soybean genome was performed using full - length arabidopsis and rice bhlh sequences , and the orthologs are presented in additional file 5 . of the arabidopsis bhlhs identified as matching soybean bhlhs , all but one of the arabidopsis sequences are known from previous classification of bhlh proteins in arabidopsis [ 33 , 37 , 40 ] . the one arabidopsis protein not previously classified as a bhlh is at2g40435 , a protein with homology to 5 soybean hlh proteins . the soybean proteins lack a complete basic domain , show a reasonably conserved hlh motif but have some divergence from previously described consensus sequences , and match the hlh hmm with relatively low scores . at2g40435 has strong similarity to these soybean proteins in this predicted hlh region , but hmmer does not find a match to the hlh hmm at all . five rice proteins ( corresponding to 16 soybean genes , all of which were identified as similar to known arabidopsis bhlhs ) were also not in previous classifications of rice bhlh proteins ( additional file 5 ) [ 33 , 39 ] . all but one of these proteins have a hlh domain predicted by the hmm search as used here for soybean ; the fifth has no hmm similarity to the hlh but does have similarity to the hlhmycn conserved domain . because of the recent duplication of the soybean genome , many soybean bhlh proteins have closely related homeologs ( recently duplicated paralogs arising as a result of polyploidy ) which may be as much as 98% identical at the dna sequence level . to determine which bhlhs were recent homeologs , we combined the data on recently duplicated genomic regions of soybean and validated potential homeologs by sequence identity ( tabulated data provided by dr . 135 are present as two copy loci , 21 are present in three copies , 52 are present in 4 copies , and 6 are present in 6 copies . information on the homeologous groups of soybean bhlhs is included in the table in additional file 1 . using a survey of the publicly available transcriptome data for soybean , it was investigated what fraction of the soybean bhlhs were actively expressed at some stage of plant development . it was determined that 281 of 319 ( 88% ) bhlhs showed some evidence of expression at the mrna level ( figure 4 ) . 47% of these are expressed across root and leaf , as well as developing seed tissues , while the remaining genes showed some evidence of tissue specific expression ( one or more tissue types ) . notably , this included 5 soybean bhlh mrnas that are expressed preferentially in nodules and are mostly absent from aerial tissues ( additional file 6 ) . the closest arabidopsis orthologs of these preferentially nodule - expressed bhlhs do not have known biological functions and do not cluster in any particular subfamily . are homologs of target of monopteros 5 and transparent testa 8 , both of which have known roles in arabidopsis embryo development ( additional file 6 ) [ 61 , 62 ] . the whole - genome duplication events in soybean that occurred 59 million years ago and 13 million years ago have clearly had a substantial impact on the size of the bhlh family in soybean when compared to other plant species [ 1 , 37 , 39 , 40 , 44 ] . most of the soybean bhlhs ( 213 ) were present in homeologous copies duplicated two or more times . expression evidence was identified for 281 of the bhlh genes , and 122 bhlhs were expressed in leaf , seed , and root tissue . these single - copy genes are likely the result of deletion of the homeolog after whole - genome duplication , perhaps because of negative selection due to deleterious effects from multigene dosage . speculatively , these genes may be involved in critical developmental or other processes in which these deleterious effects are seriously disadvantageous , and thus selection for loss of the homeologous copy has already taken place . several of the genes with strong evidence for expression and/or conservation were omitted from the current soybean genome annotation , suggesting that this version of the annotation omits a relatively large number of bhlh genes . based on sequence conservation within the basic domain , it can be predicted that the majority of soybean bhlhs ( 77% ) have the potential to bind dna , and 58% of all soybean bhlhs are likely to recognize the core g - box sequence , of which there are over 17,000 represented in the promoters of actively transcribed genes in the soybean genome ( meh , unpublished data ) . there is experimental evidence that different bhlh proteins have a preference for certain nucleotides flanking the core g - box sequence and that residues in the second -helix may also be involved in dna contact , increasing specificity of genomic sequence targets [ 24 , 56 , 63 ] . all but one of the bhlh subfamilies represented in other land plants are present in soybean , and the proportion of bhlhs in each subfamily was largely consistent between arabidopsis and soybean , although soybean contains many more bhlh - encoding genes , implying a broadly similar set of functions for each bhlh family may be conserved . all but one of the conserved motifs identified in bhlh subfamilies were found in soybean bhlh genes . a small number of these motifs are known to be involved interactions with other proteins ( such as the apb and leucine zipper motifs ) [ 32 , 55 ] . using meme a long , highly conserved motif was identified , which we term motif 40 . the strongly conserved ngadywap portion of this motif is similar to motif 20 , with which it shares very similar distribution . we do not believe motif 40 is related to motif 22 because flanking conserved residues of motif 22 are very different to those of motif 40 , and because the distribution of motif 40 is strongly correlated with and predictive of membership in family x. motif 20 also correlates with family x but is not found in all members with strong significance , perhaps due to greater discriminative power and sensitivity for the longer motif . recently the hmm method identified the bhlh domain in the closest soybean homologs of several of these genes including kidari , atbs1 , and pre1 , and these were used in our analysis . in the case of lonesome highway , a clear ortholog was present in soybean ( glyma12g31460 , at a blastp e - value of 10 ) but this gene was not predicted to contain a bhlh domain using our hmm search . in the case of par1 and par2 , by contrast , while par1 and par2 have blast hits in soybean , they are not clearly orthologs . the blastp e values of the best hits are in the range 10 to 10 , which represents strong similarity but is a lower level of confidence than for the orthologs of other genes such as kidari . this may indicate that the putative hlh domains of lonesome highway , par1 , and par2 are divergent to an extent where structural similarity to canonical bhlhs is limited , or it could indicate that the hmm we used is not sensitive to this type of hlh domain , since it did not include representatives of this type of atypical bhlh . however , five soybean predicted hlh genes were identified , highly similar to an arabidopsis gene ( with greater than 50% amino acid sequence identity and blast e - value of less than 2e 33 ) not within the set of classified bhlh proteins . interestingly , while all five soybean proteins are predicted to contain a hlh domain using the hmm approach , the same method does not predict a bhlh domain in the highly similar at2g40435 protein . the amino acid similarity between these proteins is very strong in the predicted hlh region of the soybean proteins , and the hmm score for the hlh prediction in the soybean proteins is not strong . the putative hlh domain is located at the extreme n - terminus of the soybean proteins , which fall into bhlh subfamily iii but are not predicted to bind dna . the intriguingly high level of sequence conservation in these genes across arabidopsis and soybean may point to an important , previously unknown biological function , possibly connected with the bhlh similarity . we have identified a large number of candidate genes from a family with likely regulatory roles in many processes critical for soybean growth and genetic improvement . these results establish a foundation for future functional genomics studies to target bhlh - controlled processes for modification and improvement in soybean .

the complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits . in particular , the potential functions of regulatory genes are a priority for analysis . the basic helix - loop - helix ( bhlh ) family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality , including photosynthesis , light signalling , pigment biosynthesis , and seed pod development . using a hidden markov model search algorithm , 319 genes with basic helix - loop - helix transcription factor domains were identified within the soybean genome sequence . these were classified with respect to their predicted dna binding potential , intron / exon structure , and the phylogeny of the bhlh domain . evidence is presented that the vast majority ( 281 ) of these 319 soybean bhlh genes are expressed at the mrna level . of these soybean bhlh genes , 67% were found to exist in two or more homeologous copies . this dataset provides a framework for future studies on bhlh gene function in soybean . the challenge for future research remains to define functions for the bhlh factors encoded in the soybean genome , which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

the columnar organization of neocortex at the minicolumnar ( 2050 m ) and macrocolumnar ( 300600 m ) scales has long been known ( see mountcastle , 1997 ; horton and adams , 2005 for reviews ) . minicolumn - scale organization has been demonstrated on several anatomical bases ( lorente de no , 1938 ; defelipe et al . , 1990 ; peters and sethares , 1996 ) . there has been substantial debate as to whether this highly regular minicolumn - scale structure has some accompanying generic dynamics or functionality . i.e. , one that would apply equally well to all cortical areas and species has been determined . one basis upon which a functionality for the minicolumn has been suggested is possession of highly similar receptive field characteristics , or tuning , by the cells comprising the minicolumn , e.g. , v1 orientation columns ( hubel and wiesel , 1962 , 1968 ) and minicolumn - sized regions innervating cutaneous zones ( favorov and diamond , 1990 ) . the reasoning here appears to be that because a group of cells all have very similar tuning to a particular feature , , e.g. , an edge at a particular orientation , they form a unit whose function is to recognize . however , in searching for a possible generic minicolumn function , we need not limit ourselves to considering only recognition functions . furthermore , possession of highly similar tuning can not be a basis for a generic minicolumn functionality since in many cortical areas , the cells encountered along vertical penetrations can have quite variable tuning ( cf . on closer analysis , this is true in orientation column data as well ( hetherington and swindale , 1999 ; ringach et al . , 2002 ) . if there is a generic minicolumn functionality , then it must be compatible with varying degrees of tuning correlation amongst the minicolumn 's cells . i propose that the minicolumn does have a generic functionality ( given shortly ) , but one that only becomes clear when seen in the context of the function of the higher - level , subsuming unit , namely , the macrocolumn , which has been demonstrated anatomically ( goldman and nauta , 1977 ; lbke et al . , 2003 ; egger et al . , 2008 ) and functionally ( mountcastle , 1957 ; woolsey and van der loos , 1970 ; hubel and wiesel , 1974 ; albright et al . , 1984 ) . i propose that the function of a macrocolumn ( e.g. , hypercolumn , segregate , barrel ) is to store sparse distributed representations of its overall input patterns , and to act as a recognizer of those patterns . by overall input pattern , i mean the macrocolumn 's overall input at a given moment , including not only its bottom - up ( bu ) inputs from thalamus or lower cortical areas , but also its top - down ( td ) inputs from higher cortical areas and its horizontal ( h ) inputs , which i propose carry temporal ( sequential ) context information ( recurrently ) from the representations previously active in the same and nearby macrocolumns . thus , an overall input pattern can equally well be termed , a context - dependent input . thus , it is in fact the macrocolumn whose generic functionality is appropriately characterized as recognition ; i.e. , recognition of a class determined by the history of context - dependent inputs to which it has been exposed . a distributed representation of an item of information is one in which multiple units collectively represent that item , and crucially , such that each of those units generally participates in the representations of other items as well . distributed representations are also referred to as cell assemblies , population codes , or ensembles . in this paper , representation and a sparse distributed code ( sdc ) is one in which only a small fraction of the pool of available representing units is part of any particular code ( palm , 1982 ; lynch et al . , 1986 ; kanerva , 1988 ) . if the macrocolumn stores sdcs , then there must be some mechanism that enforces sparseness and this , i propose , is the generic function of the minicolumn . specifically , i propose that small , physically localized pools of l2/3 pyramidals , e.g. , 20 such cells , act as winner - take - all ( wta ) competitive modules ( cms ) . this implies that macrocolumnar codes should consist of about 6080 active l2/3 cells , one per minicolumn : for simplicity , assume 70 minicolumns per macrocolumn hereafter . defined in this way , the minicolumn has a more flexible relation to the ontogenetic column , the apical dendrite bundle , the dbc horsetail , etc . for example , a given minicolumn might include l2/3 pyramidals from more than one apical dendrite bundle , consistent with the findings of yoshimura and callaway ( 2005 ) of fine - scale networks of preferentially interconnected l2/3 pyramidals . there is increasing evidence for the use of sdc in the cortex and other brain structures ; e.g. , auditory cortex ( hromdka et al . , 2008 ) , visual areas ( young and yamane , 1992 ; vinje and gallant , 2000 ; waydo et al . , 2006 ; quian quiroga et al . , 2008 ) , zebra finch neopallium ( hahnloser et al . , 2002 ) , olfactory structures ( jortner et al . , 2007 ; linster and cleland , 2009 ; poo and isaacson , 2009 ) , and hippocampus ( leutgeb et al . , 2007 ) . particularly supportive of the proposed hypothesis is the reid lab 's calcium imaging data of rat v1 during stimulation by drifting square - wave gratings ( ohki et al . , their movie ( http://reid.med.harvard.edu/movies.html ) shows sparse collections of l2/3 cells extending over an approximately macrocolumn - sized region synchronously turning on and off in response to particular grating orientations . ( two frames from the movie ) show distinct sets of cells , i.e. , codes , responding to bars moving left and right , respectively , and emphasize that individual units may participate in multiple codes ( red - circled cells ) . in terms of the proposed model , the active neurons would be the winners in their respective minicolumns , as suggested in figures 1c , d . figure s1 in supplementary material provides another view of how the proposed model maps onto cortex . calcium ( tangential ) images of l2/3 of rat visual cortex showing sparse sets of cells activating in unison ( see movie link in text ) in response to leftward ( a ) and rightward ( b ) drifting gratings . from ohki ( c , d ) sketch of proposed sparse distributed coding concept , which could plausibly give rise to data like ( a ) and ( b ) . : to make the sketches look more like the calcium images , black is used for inactive units and white for active : this is reversed in subsequent figures . if the macrocolumn does indeed function as a sdc field in the way suggested here , then we must answer two key questions regarding its dynamics . how is any particular set of winners , one in each of the 70 minicolumns , initially chosen in response to an input pattern and bound into a holistic code ? that is , how are macrocolumnar codes learned ? how is a previously learned code reactivated in response to future presentations of the input pattern that it was initially chosen to represent ? that is , how are stored macrocolumnar codes retrieved ( reactivated ) ? in the next section , i describe an algorithm , referred to as the code selection algorithm ( csa ) , which answers both questions . a key property of the csa is that it causes similar inputs to be assigned to similar , i.e. , more highly intersecting , codes . this property , which will be referred to as sisc ( similar inputs map to similar codes ) , is very important in terms of computational efficiency ( see discussion ) and is possessed by most distributed coding schemes . however , the csa achieves it in a novel , probabilistic fashion , which can be summarized as follows : determine the familiarity of a macrocolumn 's input . to a first approximation , an input 's familiarity is its maximum similarity to any input previously stored in the macrocolumn . set the amount of randomness ( noise ) in the process of selecting winners in the wta modules in inverse proportion to the input 's familiarity . the algorithm 's rationale is described in detail in the next section , but broadly , the idea is as follows . when an input , 1 , is familiar , we want to reactivate the code , 1 , to which 1 was previously assigned . the cells comprising 1 will have had their synapses ( from the cells comprising 1 ) increased during learning . thus , if 1 is presented again , the cells of 1 will have the highest synaptic input summations in their respective wta modules . in this case , winners should be chosen on the deterministic basis of these summations : no noise should be present in the winner selection process . on the other hand , increasingly novel inputs should be assigned to increasingly distinct codes , i.e. , codes having progressively smaller intersection with existing codes . this can be achieved by increasing the noisiness of the winner selection process in each wta module , which can be achieved by suppressing the influence of the deterministic synaptic inputs ( which reflect prior learning ) relative to baseline random ( spontaneous ) activity . by adjusting parameters that control the global ( i.e. , across the whole macrocolumn ) noise level , we can modulate the expected intersection between the set of cells which have the maximal input summations in their respective wta modules and the set of winners that are actually chosen , thus implementing sisc . many experimental and theoretical studies implicate neuromodulators , notably norepinephrine ( ne ) and acetylcholine ( ach ) , in functionality similar to the above , which can be described generally as modulating signal - to - noise ratio ( snr ) . doya ( 2002 ) proposed that ne levels control the amount of noise in a process of choosing output actions . however , doya 's model assumes a localist representation of the choices , which precludes possession of the sisc property ( see discussion ) . in addition , increased ach has been shown to selectively increase the strength of afferent relative to intrinsic inputs in piriform cortex ( hasselmo and bower , 1992 ) and other brain structures ( see hasselmo , 2006 for review ) . these ach findings have been summarized as showing that increased ach adjusts network dynamics to favor encoding new memories compared to retrieving old memories , which fits well with the proposed csa functionality . following the model description , i offer a speculative mapping of my proposed model onto neural circuitry and discuss evidence for novelty - contingent noise modulation by both ne and ach . however , the specifics of this mechanism are a subject of ongoing research and likely will involve interactions between neuromodulatory systems ( cf . any discussion of columnar function of course centrally concerns cortical circuitry , and more specifically , the putative canonical cortical microcircuit ( rockland and pandya , 1979 ; douglas et al . , 1989 ; douglas and martin , 1991 ) . we have made huge progress in understanding many of the components of cortical microcircuitry a tiny sample of which includes ( defelipe et al . , 1990 ; , 2004 ; feldmeyer et al . , 2006 ; fukuda et al . , 2006 ; , 2008 ; hirata and castro - alamancos , 2008 ; berger et al . , 2009 ; murayama et al . , 2009 ; symes and wennekers , 2009 ; briggs , 2010 ; and see thomson et al . , 2002 ; bannister , 2005 ; silberberg et al . , 2005 for reviews ) nevertheless , we remain far from any sort of comprehensive and consensual understanding of how cortical columnar circuitry manipulates , i.e. , stores and retrieves , specific items of information . in the main , only very broad conclusions regarding information processing are asserted in the experimental literature , e.g. , horizontal connections between fast - spiking l4 interneurons and pyramidals are involved in formation of l4 assemblies and sharpening of tuning ( sun et al . , 2006 ) ; that both the populations of l4 pyramidals and of l5a pyramidals have transcolumnar connectivity patterns allowing them to act as integrators of information coming in from multiple vibrissae in parallel , or in close sequence ( schubert et al . , 2007 ) ; that the receptive fields of barrel - related l2/3 pyramids are dynamic and thus may reflect learning to recognize spatiotemporal patterns of vibrissae deflections ( brecht et al . , 2003 ) ; that wta competition occurs in the supra- and infragranular layers ( douglas and martin , 2004 ) ; and that local ( 100 m ) l2/3-to - l2/3 connections might serve to synchronize firing of l2/3 cell assemblies ( lbke and feldmeyer , 2007 ) ; etc . i believe the hypothetical model described herein to be a significant contribution because it goes beyond broad conclusions and offers a mechanistic explanation of how specific informational items are learned and retrieved and in so doing , proposes a generic function for the minicolumn , i.e. , that it functions as a wta module in support of manipulating sdcs at the next higher , i.e. , macrocolumnar , scale . in particular , it was stated in the introduction that sparse macrocolumnar codes are chosen in response to a macrocolumn 's overall input , which includes its bu , h , and td inputs . however , illustrations of the model in operation in that general case become rather complex , particularly since the h ( and td ) weights carry temporal information , which necessitates showing the model at multiple successive time steps while processing spatiotemporal patterns . more importantly , the core elements of the hypothesis which are : ( a ) that the macrocolumn stores sdcs consisting of one winning l2/3 cell per minicolumn ; and ( b ) that the sisc property is achieved by modulating the amount of randomness ( noise ) present in the winner selection process in inverse proportion to input familiarity can be clearly and more simply described for the bu - only case ( i.e. , where inputs are purely spatial patterns ) . therefore , the model description in this paper will be limited to the bu - only case . however , the generalized model ( with bu , h , and td inputs ) and the accompanying generalized version of the csa are given in figures s2 and table s1 in supplementary material . functional architecture . the input field ( f1 ) consists of binary feature detectors : a particular input consisting of five active features is shown . it consists of winner - take - all competitive modules ( cms ) proposed as analogous to minicolumns . bottom - up connectivity is all - to - all : gray lines signify initially 0 weights . the familiarity ( g ) of the input is proposed to be computed via a subcortical , neuromodulator - based mechanism , which then modulates the f2 unit activation function parameters ( e.g. , sigmoid height ) contingent on g ( purple arrows ) . the input field , f1 , is comprised of 12 binary units and can be considered analogous to a specific thalamic nucleus , though topographical organization is not assumed . the coding field , f2 , consists of q = 4 wta cms , each containing k = 3 binary units . complete ( all - to - all ) bu connectivity from f1 to f2 is assumed for simplicity . these bu weights ( synapses ) are binary , initially 0 , and are permanently set to a weight of 1 the first time the pre- and postsynaptic units are co - active ( i.e. , hebbian learning ) . the model 's core algorithm , the csa , determines which cells are chosen to represent an input , during both learning and retrieval . a single iteration of the algorithm involves two rounds of competition in the cms of f2 . the first round is a hard wta competition ( represented by boxes labeled max in figure 2 ) . the purpose of the first round is to compute a global familiarity measure , g , of the input pattern . g then drives a global modulation of the f2 unit activation function ( figure 2 : purple arrows ) in preparation for the second competitive round , which is a soft wta competition , the intent of which is that : as g goes to 1 ( indicating a completely familiar input ) , the probability that the unit with the highest input summation in a cm wins approaches 1 , and as g goes to 0 ( indicating a completely novel input ) , all units in a cm become equally likely to win ( regardless of their input summations ) . ( 1)u(i)=j nw(j , i ) where n is the current input ( f1 ) pattern . because unit activations are binary , we can simply sum the weights , w(j , i ) , which are also binary . normalize u(i ) to [ 0 .. 1 ] , yielding v(i ) . v(i ) is a local measure of support , or likelihood , that f2 unit i should be activated . it reflects how well unit i 's receptive field ( rf ) , specified by its afferent weight vector , matches the current input vector . ( round 1 competition ) the maximum v(i ) , v^x , is found in each of the q cms . ( 3)v^x = maxi cx{v(i ) } where x indexes the cms and i indexes the units in a cm , cx . average the q v^xvalues , yielding g , a global measure of the familiarity of the current input . ( 4)gx=1qv^x / q the expansivity , , of the probabilistic activation function ( which is implemented via steps 68 ) is set as an increasing nonlinear function of g ( eq . 5 , expressed as a table ) . the idea is to increase the range of relative win likelihoods , (i ) ( defined in step 6 ) over any given cm 's units as g goes to 1 . this in turn , serves to nonlinearly exaggerate the difference in the final win probabilities ( eq . the specific parameters of any instance of the g - to- mapping will determine the specifics of the relation between input similarity and code similarity , i.e. , the expected code intersection as a function of input similarity . 5 were chosen to yield the -distributions in the examples of figures 3 and 4 . circled numbers refer to algorithm steps in text . here , i show the case of the first input , 1 , presented to the model . the algorithm detects that 1 is completely unfamiliar , i.e. , g is computed to be 0 , and sets the f2 activation function to a constant function ( red line ) , which makes the choice of winner in each cm completely random , and thus , the overall f2 code , 1 , also completely random . green f1 ( f2 ) units denote units not in common with 1 ( 1 ) . circled numbers refer to algorithm steps in text . here , i show the case of the first input , 1 , presented to the model . the algorithm detects that 1 is completely unfamiliar , i.e. , g is computed to be 0 , and sets the f2 activation function to a constant function ( red line ) , which makes the choice of winner in each cm completely random , and thus , the overall f2 code , 1 , also completely random . the csa and the sisc property . green f1 ( f2 ) units denote units not in common with 1 ( 1 ) . the v values of all units in all cms are then passed through the sigmoidal activation function ( eq . 6 ) whose shape / scale reflects g. again , particular parameter values affect the relation of input similarity to code similarity ( and therefore , storage capacity ) : values of = 28 and = 5 produce the v - to- mappings in figure 4 . as noted above , within each cm , the output variable , (i ) , can be viewed as a relative likelihood that unit i should be chosen winner . ( 6)(i)=1+e ( v(i ) + )+1 when g = 1 ( perfectly familiar ) , is maximized ( in eq . 7 ) probabilities of winning for units with the maximum v value in their respective cms . in contrast , when g = 0 ( completely novel ) , = 0 , which collapses the sigmoid to the constant function , = 1 , thus making all units in a cm equally likely to win . this causes the expected intersection of the code being chosen in the current instance with any previously assigned code to be at chance level . in general , this modulation of the sigmoid activation function tends toward code completion in proportion to the familiarity of the input and code separation in proportion to its novelty . transform relative likelihood distribution ( ) in each cm to true probability distribution ( ) . ( 7)(i)=(i)k cm(k ) ( round 2 competition ) choose an f2 code by drawing a winner from the -distribution ( soft max ) in each cm . thus , choosing an f2 code is actually performed as q separate draws . when g = 0 , these draws are statistically independent , as in figures 3 and 4d . as we consider increasingly familiar inputs , i.e. , for g approaching 1 ( and , assuming the model is still operating in a regime where crosstalk is sufficiently low ) , the draws become increasingly correlated ( dependent ) , as can be seen in going from figure 4c to 4b to 4a . figure 3 graphically illustrates the operation of the csa in the case of the model being presented with its first input , 1 . the gray arrows indicate that the bu signals propagating from the active f1 units will be traversing connections with zero synaptic strength . this leads to unnormalized ( u ) and normalized ( v ) input summations of 0 for all 12 f2 units ( steps 1,2 ) . in step 3 , the max v , v^ , in each cm is found ( ties broken at random ) . in step 4 , g is computed as the average of the v^ values : in this case all the v^ are 0 , so g = 0 . in step 5 , the value , g = 0 , maps to = 0 , which causes the activation function of the f2 units to collapse to the constant function , = 1 . in step 6 , each f2 unit applies this activation function to its v value , yielding the uniform relative likelihood distribution in each cm . in step 7 , the relative likelihood function in each cm is normalized to a true probability ( ) distribution , which in this case , is again uniform . finally , in step 8 , a winner is drawn in each cm , resulting in a random f2 code , e.g. , 1 . figure 4 demonstrates that the csa realizes the sisc property by considering four possibilities ( a d ) for the second input presented to the model of figure 3 . these four inputs , 25 , range from being identical to 1 ( completely familiar ) to having zero overlap with 1 ( completely unfamiliar ) . to save space , the panels of figure 4 use an abbreviated version of the format of figure 3 . most noticeably , the intermediate variable , ( relative likelihood ) , is not shown . black bu connections are ones that were increased to one when 1 was learned ( figure 3 ) . working from figure 4a to 4d , the inputs have progressively lower similarity ( intersection ) with 1 : f1 units not in common with 1 are shown in green . as g drops , the sigmoid expansivity drops ( note the changing scale ) . thus , the -distributions become progressively flatter , which in turn results in f2 codes , 25 , having progressively smaller intersection with 1 . figure 4a shows the case of presenting a completely familiar input again , and is thus a recognition test trial , demonstrating retrieval . this leads , via csa steps 3 and 4 , to g = 1 , which yields , via steps 5 and 6 , the expansive nonlinear v - to- mapping shown ( red sigmoid ) . this nonlinearity is applied to every f2 unit , yielding the highly peaked -distributions shown . finally , one unit is drawn in each cm . the probability of drawing the correct unit in any single cm is approximately 98% . of course , what 's crucial in this case , i.e. , when the input is completely familiar ( g = 1 ) , is that the entire correct f2 code is reactivated . in this case , that probability is ( 0.98 ) 92% . thus , the familiarity , g , which depends on the entire f2 layer and is thus global information , influences the local activation functions so as to produce the desired overall result , in this case , reactivation of the code ( memory trace ) , 1 , of the familiar input pattern , 1 . the explanations of the remaining panels follow that of figures 3 and 4a . in going from figure 4b to 4d , one can readily see decreasing intersection with 1 , decreasing u and v values , decreasing g , decreasing sigmoid expansivity , progressively flatter -distributions , and ultimately , decreasing intersection with 1 . given a desired probability , r , of correctly reactivating an entire code ( i.e. , of choosing the correct unit in each cm ) , when g = 1 , given values for q and k , we could compute the needed value of . however , the macrocolumn model is a content - addressable associative memory and in actual usage , multiple sparse codes will be stored in superposition . any thorough analysis of the model 's expected retrieval error must include the effect of overlap between the stored codes ( i.e. , cross - talk ) : this influences the shapes of the -distributions and thus , the expected retrieval accuracy for any given number of stored codes . such an analysis will be conducted empirically and reported in a separate paper . before leaving figure 4 first , while the -distributions become flatter as g decreases , the units comprising the code of the most similar previously learned input ( here , 1 ) remain most likely to win in their respective cms . if we simply deterministically chose the unit with maximum v(i ) in each cm , we would have chosen the same f2 code , 1 , in response to all four inputs , 25 . thus , the computation of a quantity , g , which depends on all the cms is essential to achieving the sisc property . it constitutes a channel through which information transfers between all f2 units throughout the whole macrocolumn . as noted earlier , the full model also assumes direct h connections between f2 units , analogous to the horizontal matrix of l2/3 ( see figure s2 in supplementary material ) . these also mediate communication , but of the prior code active in the macrocolumn , not of the simultaneous state of all f2 units throughout the macrocolumn . second , learning is single - trial and involves only one iteration of the csa . this is largely facilitated by the fact that when a given input - code association , jj , is learned , each of j 's f2 units simultaneously has its afferent weight from all of j 's f1 units increased . the effect of these simultaneous correlated potentiations allows a rapid , even single - trial , formation of an association , even if the individual synaptic potentiations are small , consistent with the recent characterization of thalamocortical learning described in bruno and sakmann ( 2006 ) . third , figure 4a shows that recognizing an exact instance of a previous input also requires only one iteration of the csa . although this example does not directly show it , this holds for recognition of non - exact matches as well . evidence for this will be presented in a separate work . that both learning and recognition require only a single csa iteration is especially significant since , as can readily be seen , none of the csa steps involves iterations over stored codes : thus , the time it takes for the csa to either store a new input or retrieve the closest matching stored input remains constant as the number of stored codes increases . this does not imply that an infinite number of codes can be stored : of course , the model has finite storage capacity . this capacity will be characterized in future research , but should be similar to other sparse associative memories ( willshaw et al . , 1969 ; palm , 1982 ; moll and miikkulainen , 1995 ; knoblauch et al . , 2010 ) . there remain huge gaps in our knowledge of the intrinsic physiological , synaptic , morphological , and connectional properties of all classes of cortical cell and of functional relationships between cortical and sub - cortical structures . nevertheless , figure 5 shows a possible neural realization of the model 's wta cm , i.e. , minicolumn , and dynamics ( csa ) . i have attempted to respect known constraints but the realization is admittedly speculative and ongoing modifications will undoubtedly be required . figures 5a e show the critical events transpiring in a single minicolumn at five points in time during the csa 's computational cycle . note that due to space limitations figure 5 can not depict the true extents of the various axonal and dendritic systems of the cells involved . ( a e ) depict critical events transpiring in a single minicolumn at five points in time during the csa 's computational cycle , which i propose corresponds to one gamma cycle : approximate timings relative to start of csa cycle are shown across top . the units labeled c ( b ) represent the local chandelier ( basket cell ) populations , respectively ; see text for detailed explanation . figure 5a shows the initial csa steps 1 and 2 when the l2/3 pyramidals ( here only two cells , but in reality , 20 ) integrate their inputs . while the csa explanation in the prior section included only the bu inputs , all three input classes are included here : bu inputs ( labeled 2 ) are mediated via l4 ( rockland and pandya , 1979 ) td inputs ( 1 ) are mediated via l2/3 apical tufts ( rockland and drash , 1996 ) h inputs ( 3 ) are mediated via the horizontal matrix of l2/3 ( gilbert and wiesel , 1989 ; feldmeyer et al . , 2006 ) all three input vectors arrive in parallel and collectively give rise to postsynaptic potentials ( psps ) in the l2/3 pyramidals . the three ( normalized ) inputs are combined multiplicatively ; see the generalized version of the csa ( table s1 in supplementary material ) . c ) are firing at this time , preventing the l2/3 pyramids from firing . in figure 5b , the chandeliers shut off ( grayed out ) and the l2/3 pyramid with the highest psp ( cell 2 ) is assumed to be the first to spike ( csa step 3 ) . this winning cell , and more specifically , its psp value ( v in eq . 2 ) , represents this minicolumn 's local judgment of how similar the macrocolumn 's closest - matching stored input is to the current overall ( i.e. , bu , h , and td ) input . the output of cell 2 is then communicated to some locus where it is averaged with the round 1 winners from the other 70 minicolumns of the macrocolumn , yielding g ( csa step 4 ) . as noted in the introduction , the functionality related to g seems most consistent with the phenomenology of neuromodulatory systems , especially ach and ne . note that the communication of cell 2 s psp value is hypothesized to be mediated via l5 , one of whose pyramidal cells is seen integrating here ( light green ) ; this is based loosely on evidence that l5 cells , specifically l5b pyramidals , almost exclusively target pontine areas ( with collaterals to thalamus ) ( deschnes et al . , 1994 ; krieger et al . , 2007 ) . l2/3 pyramidals are the primary source of bu signals to higher cortical areas ( rockland and pandya , 1979 ; and see thomson et al . , 2002 ; brecht et al . , 2003 ; schubert et al . , 2003 ; bannister , 2005 ; helmstaedter et al . , 2007 ; lbke and feldmeyer , 2007 ; petersen , 2007 ; egger et al . , 2008 ; , 2009 for wider background on cortical columnar circuitry relevant to the current proposal ) . in addition , as stated earlier , the horizontal l2/3-to - l2/3 connections are proposed to communicate this macrocolumn 's final hypothesis regarding its total input pattern in the current csa cycle recurrently back to the same ( and surrounding ) macrocolumns on the next csa cycle . hence , it is crucial that since that final hypothesis is not present until the second round of competition completes ( figure 5e ) , the output pathways carrying those signals must be closed ( red xs on paths 4 and 5 ) . though not depicted here , one possible mechanism for selectively preventing horizontal signaling in l2/3 is activation of the double bouquet cells ( defelipe et al . , 1990 , 2006 ; peters and sethares , 1997 ) . axons , being interdigitated , nearly one - to - one with minicolumns would allow them to make contact with a substantial portion of the horizontally ( and obliquely ) oriented dendritic and axonal processes , in l2/3 , and thus prevent passage of horizontal signals . in figure 5c , the l5 pyramidal mediating the winning l2/3 cell 's psp value has reached threshold and sends that output to the sub - cortical averaging locus ( path 6 ) . in addition , the winning cell itself has activated the local basket cell network ( electrically coupled , cf . b , which rapidly deactivates and re - polarizes ( resets ) the l2/3 pyramidals ( grayed out ) . this reset need not be back to a completely even baseline : some remnant of the relative psp distribution prior to basket cell activation might remain , biasing the second round of competition . in figure 5d , the result of the subcortical computation of g is returned to the macrocolumn ( path 7 ) in the form of neuromodulator release ( purple cloud surrounding the l2/3 pyramidals ) . cloud actually extends across a broad , i.e. , macrocolumnar ( or wider ) , expanse of l2/3 , not just within a single minicolumn as this figure may suggest . the chandeliers are again firing to prevent any l2/3 from firing as the second round of integration occurs . the basket cells are inactive , allowing this integration to take place . in figure 5e , in general , the pyramidal cell winning on this second round of competition may differ from the first round winner . in particular , the probability that the second round winner is the same as the first round winner increases with g. the set of l2/3 winners , one per minicolumn , across the whole macrocolumn represents that macrocolumn 's final decision ( hypothesis ) as to identity of its current overall ( td , h , and bu ) input . thus , the output of the winning l2/3 cell in each minicolumn is now communicated to : lower cortical regions via l5 and its backprojections to the lower regions l1 ( labeled 8 ) ( rockland and drash , 1996 ) . l2/3 pyramids in the same and neighboring macrocolumns via the local horizontal l2/3 matrix ( 5 ) ( gilbert and wiesel , 1989 ; feldmeyer et al . , 2006 ) , thus delivering temporal context information ( recurrently ) to the local region to be integrated on the next csa cycle . the l4 layer of higher cortical regions ( 4 ) ( rockland and pandya , 1979 ) . note that the output of the winning l2/3 cell should be prevented from recurring to the local basket network at this time so as to allow the integration period to occur at the beginning of the next computational cycle ; hence , the red x on the link to basket cell . i reiterate that the above possible cortical realization of the proposed sdc model is highly speculative . it clearly lacks numerous details , especially regarding processing in the intermediate processing stages , e.g. , l4 , and output processing involving l5 ( and l6 ) . nevertheless , it is a starting point and can be falsified , especially as experimental methods mature . we still have decidedly little in the way of hard constraints on the time courses of activation of the many cell types involved in cortical ( and hippocampal ) circuits , though progress is being made ( klausberger et al . , 2003 , 2004 ; silberberg et al . , 2005 ; silberberg and markram , 2007 ; klausberger and somogyi , 2008 ; otsuka and kawaguchi , 2009 ; woodruff et al . , 2009 ) . moreover , the proposed theory 's key assumption that the l2/3 pyramidals are the core repository of information in cortex and that the codes laid down in l2/3 are the context - dependent memories of our experiences , is subject to challenge . specifically , the anatomy of the l5 thick tufted cells suggests that they too have access to bu ( via l4 ) , td ( via their apical tufts in l1 ) , and h ( via an extensive intra - l5 horizontal network , schubert et al . , 2007 ) inputs , and therefore that l5 might store the most detailed and context - dependent codes in cortex , a view supported by findings such as ( de kock et al . , 2007 ) . in the end , for the purpose of this hypothesis and theory paper , i believe the architecture and algorithm ( csa ) to be more important than the specifics of any particular neural realization . in this section , i consider evidence relating to six model predictions : a}signals generated in the macrocolumn [ i.e. , the v^x ( eq . strictly interpreted , figure 2 suggests that the model can only be true of cortical areas that have direct projections to the activation function modulator ( afm ) , hypothesized to be instantiated in midbrain neuromodulator source areas , e.g. , basal forebrain ( bf , source of ach ) and locus coeruleus ( lc , source of ne ) . direct cortical afferents to bf arise mainly from prepyriform , anterior insula , orbitofrontal , entorhinal and medial temporal areas ( mesulam and mufson , 1984 ) . direct cortical afferents to lc arise from dorsal prefrontal cortex ( arnsten and goldman - rakic , 1984 ) , medial prefrontal cortex ( jodo et al . , 1998 ) . while direct projections are limited , a much larger fraction of cortex may be able to influence the hypothesized afm via multi - synaptic pathways involving thalamus and other subcortical structures , especially via pathways interconnecting bf , lc , and other neuromodulator source areas . for example , bf cholinergic neurons are excited by lc ( jones et al . , 2004 ) , which allows dorsal and medial prefrontal areas indirect influence on bf . similarly , lc receives input from the raphe nuclei ( reviewed in samuels and szabadi , 2008 ) which would allow further extension of the sphere of cortical influence upon the afm . however , it is clearly possible that my macrocolumnar model applies only to the smaller set of cortical areas suggested above . after all , there would be some advantage to deferring the decision as to the overall familiarity / novelty of the current input ( moment ) to the very highest cortical levels , which are in position to make the most informed decisions . in this case , once g is computed , it is then broadcast pan - cortically , i.e. , to all levels of the hierarchy , allowing the local choice of code to proceed accordingly , i.e. , with a level of randomness appropriate to g. figure s2 in supplementary material illustrates this view . 5 ) , which correlates with the detection of familiarity , and/or inversely with the detection of novelty . such correlations have been shown for both ach ( miranda et al . , 2000 , 2003 ) and ne ( sara et al . , 1994 ; vankov et al . , lc projects to all of cortex ( foote and morrison , 1987 ; berridge and waterhouse , 2003 ; samuels and szabadi , 2008 ) . bf projects to almost all cortical areas ( reviewed in briand et al . , 2007 ) . the amount of randomness to be added to the winner selection process is a global parameter , which applies non - specifically to all the minicolumns . this is consistent with volume transmission believed to be used by neuromodulatory systems ( descarries et al . , 1997 ; see sarter et al . d}the signal determines ( eqs 68 ) the amount of noise ( randomness ) in the selection ( activation ) of cortical ( i.e. , macrocolumnar ) codes . controlling the noisiness of a process of choosing a winner from a competing group of neurons can be achieved by some combination of two actions : ( i ) increasing the spike probability of cells with high input summations relative to those with low summations and ( ii ) lowering the spike probability of low - input cells relative to high - input cells . both of these actions can be achieved by uniformly ( i.e. , to all competing cells in a wta module ) modulating intrinsic cell properties such as excitability . numerous studies have demonstrated both excitatory and suppressive effects on target cell responses ( both principal neurons and interneurons ) for both ach ( kawasaki and avoli , 1996 ; shalinsky et al . , 2002 ; cobb and davies , 2005 ; tateno et al . , 2005 ; isakova and mednikova , 2007 ; lawrence , 2008 ; eggermann and feldmeyer , 2009 ) and ne ( foote et al . , 1975 ; kawaguchi and shindou , 1998 ; harley and helen , 2007 ; moxon et al . , 2007 ) . it is not my intention here to argue for a precise realization of this mechanism . as suggested in many reviews ( berridge and waterhouse , 2003 ; lucas - meunier et al . , 2003 ; sara , 2009 ) , the landscape of this research is very complex and we are far from a comprehensive understanding of the how the various neuromodulatory systems affect high - level cognitive processing either alone or in concert ( briand et al . , 2007 ) . nevertheless , the large and varied body of evidence at least admits the possibility that one or more of these neuromodulators could implement the familiarity - contingent afm mechanism ( csa steps 58 ; see doya , 2002 , p. 502 e}decreased , i.e. , increased noise , leads to greater code separation ( decreased intersection ) . recently , goard and dan ( 2009 ) showed that increased bf stimulation decreased the correlation amongst a population of rat v1 cells . this decreased correlation essentially shows increased separation between population codes , which in the model proposed here , would manifest as decreased intersection between sparse codes . f}disabling of the brain 's ability to produce high noise , i.e. , causing to be permanently high , should reduce the ability to learn new inputs , while sparing or having much less effect on recognition of known items . looking at figure 4 , if the afm was stuck in the highly expansive sigmoid condition ( low noise ) , all four inputs , 25 , would have high probability of mapping to the same code , 1 . however , in general , inputs that were mapped to unique codes prior to such a disabling event will reliably activate those codes on future presentations . in accord with this , browning et al . ( 2010 ) found that severely diminishing cholinergic inputs to inferotemporal cortex severely reduced macaques performance on a visual episodic memory task , while having little effect on a dnms task . ( 2005 ) found a similar effect : cholinergic deafferentation of entorhinal cortex reduced performance on dnms tasks involving novel odors but not familiar odors . the model 's core algorithm , the csa , determines which cells are chosen to represent an input , during both learning and retrieval . a single iteration of the algorithm involves two rounds of competition in the cms of f2 . the first round is a hard wta competition ( represented by boxes labeled max in figure 2 ) . the purpose of the first round is to compute a global familiarity measure , g , of the input pattern . g then drives a global modulation of the f2 unit activation function ( figure 2 : purple arrows ) in preparation for the second competitive round , which is a soft wta competition , the intent of which is that : as g goes to 1 ( indicating a completely familiar input ) , the probability that the unit with the highest input summation in a cm wins approaches 1 , and as g goes to 0 ( indicating a completely novel input ) , all units in a cm become equally likely to win ( regardless of their input summations ) . ( 1)u(i)=j nw(j , i ) where n is the current input ( f1 ) pattern . because unit activations are binary , we can simply sum the weights , w(j , i ) , which are also binary . normalize u(i ) to [ 0 .. 1 ] , yielding v(i ) . v(i ) is a local measure of support , or likelihood , that f2 unit i should be activated . it reflects how well unit i 's receptive field ( rf ) , specified by its afferent weight vector , matches the current input vector . ( round 1 competition ) the maximum v(i ) , v^x , is found in each of the q cms . ( 3)v^x = maxi cx{v(i ) } where x indexes the cms and i indexes the units in a cm , cx . average the q v^xvalues , yielding g , a global measure of the familiarity of the current input . ( 4)gx=1qv^x / q the expansivity , , of the probabilistic activation function ( which is implemented via steps 68 ) is set as an increasing nonlinear function of g ( eq . the idea is to increase the range of relative win likelihoods , (i ) ( defined in step 6 ) over any given cm 's units as g goes to 1 . this in turn , serves to nonlinearly exaggerate the difference in the final win probabilities ( eq . the specific parameters of any instance of the g - to- mapping will determine the specifics of the relation between input similarity and code similarity , i.e. , the expected code intersection as a function of input similarity . 5 were chosen to yield the -distributions in the examples of figures 3 and 4 . circled numbers refer to algorithm steps in text . here , i show the case of the first input , 1 , presented to the model . the algorithm detects that 1 is completely unfamiliar , i.e. , g is computed to be 0 , and sets the f2 activation function to a constant function ( red line ) , which makes the choice of winner in each cm completely random , and thus , the overall f2 code , 1 , also completely random . green f1 ( f2 ) units denote units not in common with 1 ( 1 ) . , i show the case of the first input , 1 , presented to the model . the algorithm detects that 1 is completely unfamiliar , i.e. , g is computed to be 0 , and sets the f2 activation function to a constant function ( red line ) , which makes the choice of winner in each cm completely random , and thus , the overall f2 code , 1 , also completely random . the csa and the sisc property . green f1 ( f2 ) units denote units not in common with 1 ( 1 ) . the v values of all units in all cms are then passed through the sigmoidal activation function ( eq . 6 ) whose shape / scale reflects g. again , particular parameter values affect the relation of input similarity to code similarity ( and therefore , storage capacity ) : values of = 28 and = 5 produce the v - to- mappings in figure 4 . as noted above , within each cm , the output variable , (i ) , can be viewed as a relative likelihood that unit i should be chosen winner . ( 6)(i)=1+e ( v(i ) + )+1 when g = 1 ( perfectly familiar ) , is maximized ( in eq . 7 ) probabilities of winning for units with the maximum v value in their respective cms . in contrast , when g = 0 ( completely novel ) , = 0 , which collapses the sigmoid to the constant function , = 1 , thus making all units in a cm equally likely to win . this causes the expected intersection of the code being chosen in the current instance with any previously assigned code to be at chance level . in general , this modulation of the sigmoid activation function tends toward code completion in proportion to the familiarity of the input and code separation in proportion to its novelty . transform relative likelihood distribution ( ) in each cm to true probability distribution ( ) . ( 7)(i)=(i)k cm(k ) ( round 2 competition ) choose an f2 code by drawing a winner from the -distribution ( soft max ) in each cm . thus , choosing an f2 code is actually performed as q separate draws . when g = 0 , these draws are statistically independent , as in figures 3 and 4d . as we consider increasingly familiar inputs , i.e. , for g approaching 1 ( and , assuming the model is still operating in a regime where crosstalk is sufficiently low ) , the draws become increasingly correlated ( dependent ) , as can be seen in going from figure 4c to 4b to 4a . figure 3 graphically illustrates the operation of the csa in the case of the model being presented with its first input , 1 . the gray arrows indicate that the bu signals propagating from the active f1 units will be traversing connections with zero synaptic strength . this leads to unnormalized ( u ) and normalized ( v ) input summations of 0 for all 12 f2 units ( steps 1,2 ) . in step 3 , the max v , v^ , in each cm is found ( ties broken at random ) . in step 4 , g is computed as the average of the v^ values : in this case all the v^ are 0 , so g = 0 . in step 5 , the value , g = 0 , maps to = 0 , which causes the activation function of the f2 units to collapse to the constant function , = 1 . in step 6 , each f2 unit applies this activation function to its v value , yielding the uniform relative likelihood distribution in each cm . in step 7 , the relative likelihood function in each cm is normalized to a true probability ( ) distribution , which in this case , is again uniform . finally , in step 8 , a winner is drawn in each cm , resulting in a random f2 code , e.g. , 1 . figure 4 demonstrates that the csa realizes the sisc property by considering four possibilities ( a d ) for the second input presented to the model of figure 3 . these four inputs , 25 , range from being identical to 1 ( completely familiar ) to having zero overlap with 1 ( completely unfamiliar ) . to save space , the panels of figure 4 use an abbreviated version of the format of figure 3 . most noticeably , the intermediate variable , ( relative likelihood ) , is not shown . black bu connections are ones that were increased to one when 1 was learned ( figure 3 ) . working from figure 4a to 4d , the inputs have progressively lower similarity ( intersection ) with 1 : f1 units not in common with 1 are shown in green . as g drops , the sigmoid expansivity drops ( note the changing scale ) . thus , the -distributions become progressively flatter , which in turn results in f2 codes , 25 , having progressively smaller intersection with 1 . f2 units not in common with 1 also shown in green . figure 4a shows the case of presenting a completely familiar input again , and is thus a recognition test trial , demonstrating retrieval . this leads , via csa steps 3 and 4 , to g = 1 , which yields , via steps 5 and 6 , the expansive nonlinear v - to- mapping shown ( red sigmoid ) . this nonlinearity is applied to every f2 unit , yielding the highly peaked -distributions shown . the probability of drawing the correct unit in any single cm is approximately 98% . of course , what 's crucial in this case , i.e. , when the input is completely familiar ( g = 1 ) , is that the entire correct f2 code is reactivated . in this case , thus , the familiarity , g , which depends on the entire f2 layer and is thus global information , influences the local activation functions so as to produce the desired overall result , in this case , reactivation of the code ( memory trace ) , 1 , of the familiar input pattern , 1 . the explanations of the remaining panels follow that of figures 3 and 4a . in going from figure 4b to 4d , one can readily see decreasing intersection with 1 , decreasing u and v values , decreasing g , decreasing sigmoid expansivity , progressively flatter -distributions , and ultimately , decreasing intersection with 1 . given a desired probability , r , of correctly reactivating an entire code ( i.e. , of choosing the correct unit in each cm ) , when g = 1 , given values for q and k , we could compute the needed value of . however , the macrocolumn model is a content - addressable associative memory and in actual usage , multiple sparse codes will be stored in superposition . any thorough analysis of the model 's expected retrieval error must include the effect of overlap between the stored codes ( i.e. , cross - talk ) : this influences the shapes of the -distributions and thus , the expected retrieval accuracy for any given number of stored codes . such an analysis will be conducted empirically and reported in a separate paper . before leaving figure 4 first , while the -distributions become flatter as g decreases , the units comprising the code of the most similar previously learned input ( here , 1 ) remain most likely to win in their respective cms . if we simply deterministically chose the unit with maximum v(i ) in each cm , we would have chosen the same f2 code , 1 , in response to all four inputs , 25 . thus , the computation of a quantity , g , which depends on all the cms is essential to achieving the sisc property . it constitutes a channel through which information transfers between all f2 units throughout the whole macrocolumn . as noted earlier , the full model also assumes direct h connections between f2 units , analogous to the horizontal matrix of l2/3 ( see figure s2 in supplementary material ) . these also mediate communication , but of the prior code active in the macrocolumn , not of the simultaneous state of all f2 units throughout the macrocolumn . second , learning is single - trial and involves only one iteration of the csa . this is largely facilitated by the fact that when a given input - code association , jj , is learned , each of j 's f2 units simultaneously has its afferent weight from all of j 's f1 units increased . the effect of these simultaneous correlated potentiations allows a rapid , even single - trial , formation of an association , even if the individual synaptic potentiations are small , consistent with the recent characterization of thalamocortical learning described in bruno and sakmann ( 2006 ) . third , figure 4a shows that recognizing an exact instance of a previous input also requires only one iteration of the csa . although this example does not directly show it , this holds for recognition of non - exact matches as well . evidence for this will be presented in a separate work . that both learning and recognition require only a single csa iteration is especially significant since , as can readily be seen , none of the csa steps involves iterations over stored codes : thus , the time it takes for the csa to either store a new input or retrieve the closest matching stored input remains constant as the number of stored codes increases . this does not imply that an infinite number of codes can be stored : of course , the model has finite storage capacity . this capacity will be characterized in future research , but should be similar to other sparse associative memories ( willshaw et al . , 1969 ; palm , 1982 ; moll and miikkulainen , 1995 ; knoblauch et al . , 2010 ) . there remain huge gaps in our knowledge of the intrinsic physiological , synaptic , morphological , and connectional properties of all classes of cortical cell and of functional relationships between cortical and sub - cortical structures . nevertheless , figure 5 shows a possible neural realization of the model 's wta cm , i.e. , minicolumn , and dynamics ( csa ) . i have attempted to respect known constraints but the realization is admittedly speculative and ongoing modifications will undoubtedly be required . figures 5a e show the critical events transpiring in a single minicolumn at five points in time during the csa 's computational cycle . note that due to space limitations figure 5 can not depict the true extents of the various axonal and dendritic systems of the cells involved . ( a e ) depict critical events transpiring in a single minicolumn at five points in time during the csa 's computational cycle , which i propose corresponds to one gamma cycle : approximate timings relative to start of csa cycle are shown across top . the units labeled c ( b ) represent the local chandelier ( basket cell ) populations , respectively ; see text for detailed explanation . figure 5a shows the initial csa steps 1 and 2 when the l2/3 pyramidals ( here only two cells , but in reality , 20 ) integrate their inputs . while the csa explanation in the prior section included only the bu inputs , all three input classes are included here : bu inputs ( labeled 2 ) are mediated via l4 ( rockland and pandya , 1979 ) td inputs ( 1 ) are mediated via l2/3 apical tufts ( rockland and drash , 1996 ) h inputs ( 3 ) are mediated via the horizontal matrix of l2/3 ( gilbert and wiesel , 1989 ; feldmeyer et al . , 2006 ) all three input vectors arrive in parallel and collectively give rise to postsynaptic potentials ( psps ) in the l2/3 pyramidals . the three ( normalized ) inputs are combined multiplicatively ; see the generalized version of the csa ( table s1 in supplementary material ) . c ) are firing at this time , preventing the l2/3 pyramids from firing . in figure 5b , the chandeliers shut off ( grayed out ) and the l2/3 pyramid with the highest psp ( cell 2 ) is assumed to be the first to spike ( csa step 3 ) . this winning cell , and more specifically , its psp value ( v in eq . 2 ) , represents this minicolumn 's local judgment of how similar the macrocolumn 's closest - matching stored input is to the current overall ( i.e. , bu , h , and td ) input . the output of cell 2 is then communicated to some locus where it is averaged with the round 1 winners from the other 70 minicolumns of the macrocolumn , yielding g ( csa step 4 ) . as noted in the introduction , the functionality related to g seems most consistent with the phenomenology of neuromodulatory systems , especially ach and ne . note that the communication of cell 2 s psp value is hypothesized to be mediated via l5 , one of whose pyramidal cells is seen integrating here ( light green ) ; this is based loosely on evidence that l5 cells , specifically l5b pyramidals , almost exclusively target pontine areas ( with collaterals to thalamus ) ( deschnes et al . l2/3 pyramidals are the primary source of bu signals to higher cortical areas ( rockland and pandya , 1979 ; and see thomson et al . , 2002 ; brecht et al . , 2003 ; schubert et al . , 2003 ; bannister , 2005 ; helmstaedter et al . , 2007 ; lbke and feldmeyer , 2007 ; petersen , 2007 ; egger et al . , 2008 ; , 2009 for wider background on cortical columnar circuitry relevant to the current proposal ) . in addition , as stated earlier , the horizontal l2/3-to - l2/3 connections are proposed to communicate this macrocolumn 's final hypothesis regarding its total input pattern in the current csa cycle recurrently back to the same ( and surrounding ) macrocolumns on the next csa cycle . hence , it is crucial that since that final hypothesis is not present until the second round of competition completes ( figure 5e ) , the output pathways carrying those signals must be closed ( red xs on paths 4 and 5 ) . though not depicted here , one possible mechanism for selectively preventing horizontal signaling in l2/3 is activation of the double bouquet cells ( defelipe et al . , 1990 , 2006 ; peters and sethares , 1997 ) . axons , being interdigitated , nearly one - to - one with minicolumns would allow them to make contact with a substantial portion of the horizontally ( and obliquely ) oriented dendritic and axonal processes , in l2/3 , and thus prevent passage of horizontal signals . in figure 5c , the l5 pyramidal mediating the winning l2/3 cell 's psp value has reached threshold and sends that output to the sub - cortical averaging locus ( path 6 ) . in addition , the winning cell itself has activated the local basket cell network ( electrically coupled , cf . b , which rapidly deactivates and re - polarizes ( resets ) the l2/3 pyramidals ( grayed out ) . this reset need not be back to a completely even baseline : some remnant of the relative psp distribution prior to basket cell activation might remain , biasing the second round of competition . in figure 5d , the result of the subcortical computation of g is returned to the macrocolumn ( path 7 ) in the form of neuromodulator release ( purple cloud surrounding the l2/3 pyramidals ) . cloud actually extends across a broad , i.e. , macrocolumnar ( or wider ) , expanse of l2/3 , not just within a single minicolumn as this figure may suggest . the chandeliers are again firing to prevent any l2/3 from firing as the second round of integration occurs . the basket cells are inactive , allowing this integration to take place . in figure 5e , the chandeliers again deactivate . , the pyramidal cell winning on this second round of competition may differ from the first round winner . in particular , the probability that the second round winner is the same as the first round winner increases with g. the set of l2/3 winners , one per minicolumn , across the whole macrocolumn represents that macrocolumn 's final decision ( hypothesis ) as to identity of its current overall ( td , h , and bu ) input . thus , the output of the winning l2/3 cell in each minicolumn is now communicated to : lower cortical regions via l5 and its backprojections to the lower regions l1 ( labeled 8 ) ( rockland and drash , 1996 ) . l2/3 pyramids in the same and neighboring macrocolumns via the local horizontal l2/3 matrix ( 5 ) ( gilbert and wiesel , 1989 ; feldmeyer et al . , 2006 ) , thus delivering temporal context information ( recurrently ) to the local region to be integrated on the next csa cycle . the l4 layer of higher cortical regions ( 4 ) ( rockland and pandya , 1979 ) . note that the output of the winning l2/3 cell should be prevented from recurring to the local basket network at this time so as to allow the integration period to occur at the beginning of the next computational cycle ; hence , the red x on the link to basket cell . i reiterate that the above possible cortical realization of the proposed sdc model is highly speculative . it clearly lacks numerous details , especially regarding processing in the intermediate processing stages , e.g. , l4 , and output processing involving l5 ( and l6 ) . nevertheless , it is a starting point and can be falsified , especially as experimental methods mature . for example , the many timing relationships in the circuit can be tested . we still have decidedly little in the way of hard constraints on the time courses of activation of the many cell types involved in cortical ( and hippocampal ) circuits , though progress is being made ( klausberger et al . silberberg and markram , 2007 ; klausberger and somogyi , 2008 ; otsuka and kawaguchi , 2009 ; woodruff et al . , 2009 ) . moreover , the proposed theory 's key assumption that the l2/3 pyramidals are the core repository of information in cortex and that the codes laid down in l2/3 are the context - dependent memories of our experiences , is subject to challenge . specifically , the anatomy of the l5 thick tufted cells suggests that they too have access to bu ( via l4 ) , td ( via their apical tufts in l1 ) , and h ( via an extensive intra - l5 horizontal network , schubert et al . , 2007 ) inputs , and therefore that l5 might store the most detailed and context - dependent codes in cortex , a view supported by findings such as ( de kock et al . , 2007 ) . in the end , for the purpose of this hypothesis and theory paper , i believe the architecture and algorithm ( csa ) to be more important than the specifics of any particular neural realization . in this section , i consider evidence relating to six model predictions : a}signals generated in the macrocolumn [ i.e. , the v^x ( eq . strictly interpreted , figure 2 suggests that the model can only be true of cortical areas that have direct projections to the activation function modulator ( afm ) , hypothesized to be instantiated in midbrain neuromodulator source areas , e.g. , basal forebrain ( bf , source of ach ) and locus coeruleus ( lc , source of ne ) . direct cortical afferents to bf arise mainly from prepyriform , anterior insula , orbitofrontal , entorhinal and medial temporal areas ( mesulam and mufson , 1984 ) . direct cortical afferents to lc arise from dorsal prefrontal cortex ( arnsten and goldman - rakic , 1984 ) , medial prefrontal cortex ( jodo et al . , 1998 ) . while direct projections are limited , a much larger fraction of cortex may be able to influence the hypothesized afm via multi - synaptic pathways involving thalamus and other subcortical structures , especially via pathways interconnecting bf , lc , and other neuromodulator source areas . , 2004 ) , which allows dorsal and medial prefrontal areas indirect influence on bf . similarly , lc receives input from the raphe nuclei ( reviewed in samuels and szabadi , 2008 ) which would allow further extension of the sphere of cortical influence upon the afm . however , it is clearly possible that my macrocolumnar model applies only to the smaller set of cortical areas suggested above . after all , there would be some advantage to deferring the decision as to the overall familiarity / novelty of the current input ( moment ) to the very highest cortical levels , which are in position to make the most informed decisions . in this case , once g is computed , it is then broadcast pan - cortically , i.e. , to all levels of the hierarchy , allowing the local choice of code to proceed accordingly , i.e. , with a level of randomness appropriate to g. figure s2 in supplementary material illustrates this view . 5 ) , which correlates with the detection of familiarity , and/or inversely with the detection of novelty . such correlations have been shown for both ach ( miranda et al . , 2000 , 2003 ) and ne ( sara et al . , 1994 ; vankov et al . , lc projects to all of cortex ( foote and morrison , 1987 ; berridge and waterhouse , 2003 ; samuels and szabadi , 2008 ) . bf projects to almost all cortical areas ( reviewed in briand et al . , 2007 ) . the amount of randomness to be added to the winner selection process is a global parameter , which applies non - specifically to all the minicolumns . this is consistent with volume transmission believed to be used by neuromodulatory systems ( descarries et al . , 1997 ; see sarter et al . , 2009 for discussion of the complexities of the evidence regarding volume transmission ) . d}the signal determines ( eqs 68 ) the amount of noise ( randomness ) in the selection ( activation ) of cortical ( i.e. , macrocolumnar ) codes . controlling the noisiness of a process of choosing a winner from a competing group of neurons can be achieved by some combination of two actions : ( i ) increasing the spike probability of cells with high input summations relative to those with low summations and ( ii ) lowering the spike probability of low - input cells relative to high - input cells . both of these actions can be achieved by uniformly ( i.e. , to all competing cells in a wta module ) modulating intrinsic cell properties such as excitability . numerous studies have demonstrated both excitatory and suppressive effects on target cell responses ( both principal neurons and interneurons ) for both ach ( kawasaki and avoli , 1996 ; shalinsky et al . , 2002 ; cobb and davies , 2005 ; tateno et al . , 2005 ; isakova and mednikova , 2007 ; lawrence , 2008 ; eggermann and feldmeyer , 2009 ) and ne ( foote et al . , 1975 ; kawaguchi and shindou , 1998 ; harley and helen , 2007 ; moxon et al . it is not my intention here to argue for a precise realization of this mechanism . as suggested in many reviews ( berridge and waterhouse , 2003 ; lucas - meunier et al . , 2003 ; sara , 2009 ) , the landscape of this research is very complex and we are far from a comprehensive understanding of the how the various neuromodulatory systems affect high - level cognitive processing either alone or in concert ( briand et al . , 2007 ) . nevertheless , the large and varied body of evidence at least admits the possibility that one or more of these neuromodulators could implement the familiarity - contingent afm mechanism ( csa steps 58 ; see doya , 2002 , p. 502 e}decreased , i.e. , increased noise , leads to greater code separation ( decreased intersection ) . recently , goard and dan ( 2009 ) showed that increased bf stimulation decreased the correlation amongst a population of rat v1 cells . this decreased correlation essentially shows increased separation between population codes , which in the model proposed here , would manifest as decreased intersection between sparse codes . f}disabling of the brain 's ability to produce high noise , i.e. , causing to be permanently high , should reduce the ability to learn new inputs , while sparing or having much less effect on recognition of known items . looking at figure 4 , if the afm was stuck in the highly expansive sigmoid condition ( low noise ) , all four inputs , 25 , would have high probability of mapping to the same code , 1 . this would prevent the model from being able to distinguish them in future presentations . however , in general , inputs that were mapped to unique codes prior to such a disabling event will reliably activate those codes on future presentations . in accord with this , browning et al . ( 2010 ) found that severely diminishing cholinergic inputs to inferotemporal cortex severely reduced macaques performance on a visual episodic memory task , while having little effect on a dnms task . ( 2005 ) found a similar effect : cholinergic deafferentation of entorhinal cortex reduced performance on dnms tasks involving novel odors but not familiar odors . in this section , i consider evidence relating to six model predictions : a}signals generated in the macrocolumn [ i.e. , the v^x ( eq . strictly interpreted , figure 2 suggests that the model can only be true of cortical areas that have direct projections to the activation function modulator ( afm ) , hypothesized to be instantiated in midbrain neuromodulator source areas , e.g. , basal forebrain ( bf , source of ach ) and locus coeruleus ( lc , source of ne ) . relatively few cortical areas project directly to bf or lc . direct cortical afferents to bf arise mainly from prepyriform , anterior insula , orbitofrontal , entorhinal and medial temporal areas ( mesulam and mufson , 1984 ) . direct cortical afferents to lc arise from dorsal prefrontal cortex ( arnsten and goldman - rakic , 1984 ) , medial prefrontal cortex ( jodo et al . , 1998 ) . while direct projections are limited , a much larger fraction of cortex may be able to influence the hypothesized afm via multi - synaptic pathways involving thalamus and other subcortical structures , especially via pathways interconnecting bf , lc , and other neuromodulator source areas . for example , bf cholinergic neurons are excited by lc ( jones et al . , 2004 ) , which allows dorsal and medial prefrontal areas indirect influence on bf . similarly , lc receives input from the raphe nuclei ( reviewed in samuels and szabadi , 2008 ) which would allow further extension of the sphere of cortical influence upon the afm . however , it is clearly possible that my macrocolumnar model applies only to the smaller set of cortical areas suggested above . after all , there would be some advantage to deferring the decision as to the overall familiarity / novelty of the current input ( moment ) to the very highest cortical levels , which are in position to make the most informed decisions . in this case , once g is computed , it is then broadcast pan - cortically , i.e. , to all levels of the hierarchy , allowing the local choice of code to proceed accordingly , i.e. , with a level of randomness appropriate to g. figure s2 in supplementary material illustrates this view . 5 ) , which correlates with the detection of familiarity , and/or inversely with the detection of novelty . such correlations have been shown for both ach ( miranda et al . , 2000 , 2003 ) and ne ( sara et al . , 1994 ; vankov et al . , lc projects to all of cortex ( foote and morrison , 1987 ; berridge and waterhouse , 2003 ; samuels and szabadi , 2008 ) . bf projects to almost all cortical areas ( reviewed in briand et al . , 2007 ) . the amount of randomness to be added to the winner selection process is a global parameter , which applies non - specifically to all the minicolumns . this is consistent with volume transmission believed to be used by neuromodulatory systems ( descarries et al . , 1997 ; see sarter et al . , 2009 for discussion of the complexities of the evidence regarding volume transmission ) . d}the signal determines ( eqs 68 ) the amount of noise ( randomness ) in the selection ( activation ) of cortical ( i.e. , macrocolumnar ) codes . controlling the noisiness of a process of choosing a winner from a competing group of neurons can be achieved by some combination of two actions : ( i ) increasing the spike probability of cells with high input summations relative to those with low summations and ( ii ) lowering the spike probability of low - input cells relative to high - input cells . both of these actions can be achieved by uniformly ( i.e. , to all competing cells in a wta module ) modulating intrinsic cell properties such as excitability . numerous studies have demonstrated both excitatory and suppressive effects on target cell responses ( both principal neurons and interneurons ) for both ach ( kawasaki and avoli , 1996 ; shalinsky et al . , 2002 ; cobb and davies , 2005 ; tateno et al . , 2005 ; isakova and mednikova , 2007 ; lawrence , 2008 ; eggermann and feldmeyer , 2009 ) and ne ( foote et al . , 1975 ; kawaguchi and shindou , 1998 ; harley and helen , 2007 ; moxon et al . , 2007 ) . it is not my intention here to argue for a precise realization of this mechanism . as suggested in many reviews ( berridge and waterhouse , 2003 ; lucas - meunier et al . , 2003 ; sara , 2009 ) , the landscape of this research is very complex and we are far from a comprehensive understanding of the how the various neuromodulatory systems affect high - level cognitive processing either alone or in concert ( briand et al . , 2007 ) . nevertheless , the large and varied body of evidence at least admits the possibility that one or more of these neuromodulators could implement the familiarity - contingent afm mechanism ( csa steps 58 ; see doya , 2002 , p. 502 e}decreased , i.e. , increased noise , leads to greater code separation ( decreased intersection ) . recently , goard and dan ( 2009 ) showed that increased bf stimulation decreased the correlation amongst a population of rat v1 cells . this decreased correlation essentially shows increased separation between population codes , which in the model proposed here , would manifest as decreased intersection between sparse codes . f}disabling of the brain 's ability to produce high noise , i.e. , causing to be permanently high , should reduce the ability to learn new inputs , while sparing or having much less effect on recognition of known items . looking at figure 4 , if the afm was stuck in the highly expansive sigmoid condition ( low noise ) , all four inputs , 25 , would have high probability of mapping to the same code , 1 . this would prevent the model from being able to distinguish them in future presentations . however , in general , inputs that were mapped to unique codes prior to such a disabling event will reliably activate those codes on future presentations . ( 2010 ) found that severely diminishing cholinergic inputs to inferotemporal cortex severely reduced macaques performance on a visual episodic memory task , while having little effect on a dnms task . ( 2005 ) found a similar effect : cholinergic deafferentation of entorhinal cortex reduced performance on dnms tasks involving novel odors but not familiar odors . i have described a theoretical model of cortical function that explains the functional relationship between the minicolumn and macrocolumn . specifically : a}the macrocolumn ( in any of its forms ) is proposed to store information in the form of sdcs , and b}the minicolumn ( specifically , its l2/3 pool of pyramidals ) is proposed to operate as a wta cm , the purpose of which is to enforce the sparseness of the macrocolumnar code . two key motivations for this model are the computational advantages of sdc and the increasingly strong evidence for sdc in the brain , cited in the section introduction . one important advantage of sdc over a localist code is that the number of unique items that can be stored can be far larger than the number of representing units . for example , the 12 f2 units of the model in figure 2 allow 3 = 81 unique codes , though in realistic systems , e.g. , with less than complete connectivity leading to and from a coding field like f2 , the number of those codes that can safely ( i.e. , while maintaining retrieval error rates below some acceptable criterion ) be assigned will be substantially lower than 81 . nevertheless , if the number of input items that will need to be distinguished is not known a priori , sdc is more flexible . a second computational advantage of sdc is that , if used in conjunction with an appropriate storage / retrieval algorithm it possesses the sisc property . i demonstrated , with the small but statistically reasonable example of figures 3 and 4 , that the csa yields the sisc property . the sisc property strongly differentiates sdc from localist models : it is not even defined for a localist model since every code is formally disjoint with every other code . hence , there is no structural way to represent degrees of similarity in a localist code . if there is no way to represent a measure , e.g. , similarity , structurally , then whenever that measure is required e.g. , when the closest matching stored item in a database ( i.e. , macrocolumn ) to an input must be returned it must be computed , which takes time and energy . in contrast , when items codes are stored in physically overlapped fashion such that the degree of code overlap represents item similarity , as is the case for the proposed model , the most closely matching stored item will be returned immediately , i.e. , without requiring any serial search through the stored items . figure s4 in supplementary material shows test retrievals of the four unique codes stored in the model of figures 3 and 4 , demonstrating possession of this immediate access property for this small example . i consider the representation and the csa to be the most important contributions of this paper because of the computational advantages just described . however , i believe the suggestion that the minicolumn 's generic function is to act as a wta cm is also important . saying only that a group of l2/3 units forms a wta cm places no a priori constraints on what their tuning functions or receptive fields should look like . this is what gives that functionality a chance of being truly generic , i.e. , of applying across all areas and species , regardless of the observed tuning profiles of closely neighboring units . indeed , a recent calcium imaging study of mouse auditory cortex by rothschild et al . ( 2010 ) shows highly heterogeneous small - scale ( even immediately adjacent cells ) tuning even though the large - scale tuning is tonotopic . experimental methods are only now just reaching the point where this hypothesis might be directly testable , e.g. , modifying calcium imaging methods to have millisecond temporal granularity ; see ohki and reid ( 2007 ) . in a sense , the main point of this paper is that a generic minicolumnar function becomes apparent as soon as we postulate that what the cortex , i.e. , a macrocolumn , generally does is store and retrieve ( access ) sdcs of specific context - dependent inputs . as noted in the section introduction , the experimental literature contains little in the way of proposals linking the formation and retrieval of specific sdcs ( i.e. , of specific input items , especially of temporal context - dependent items ) to the cortical microcircuitry . my proposed model goes beyond broad conclusions and offers a mechanistic explanation of how specific informational items are learned and retrieved and in so doing , proposes a generic function for the minicolumn , i.e. , that it functions as a wta module in support of manipulating sdcs at the next higher , i.e. , macrocolumnar , scale . there have been several recent models linking formation / retrieval of specific items to cortical circuitry and which describe specific roles for the minicolumn ( kupper et al . , 2007 ; george and hawkins , 2009 ; litvak and ullman , 2009 ; schrader et al . , however , all of these models use localist representations and therefore would not possess the advantages of sdc described above . the cortext model ( kupper et al . , 2007 ; schrader et al . , 2009 ) assumes that each minicolumn in a hypercolumn represents one particular input feature . on each computational cycle , a wta process runs within each hypercolumn , such that exactly one minicolumn wins , which would be strongly at odds with the calcium image data ( ohki et al . , 2005 ) . a second problem is that the assumption that whole minicolumns compete with each other implies that any given hypercolumn ( at any level of the cortical hierarchy ) can represent only 70 unique features ( equivalence classes ) , which seems severely restrictive , especially for hypercolumns at higher cortical levels , e.g. , it . the litvak and ullman ( 2009 ) model also postulates that the l2/3 pool of neurons in a minicolumn implements a max function . however , their model proposes that each single minicolumn ( specifically , its l2/3 pool ) is partitioned into several disjoint groups ( cliques ) of cells , each representing a different item . since any particular cell can participate in only one clique , this constitutes a localist code . george and hawkins ( 2009 ) also assume that minicolumns represent informational items in a localist fashion . note however that both george and hawkins ( 2009 ) and litvak and ullman ( 2009 ) explicitly mention moving to a more general combinatorial code , a.k.a . a core principle of the proposed model is this notion of controlling the amount of noise in the process of choosing ( activating ) a macrocolumnar code as an inverse function of input similarity . doya ( 2002 ) uses the same principle , referred to as boltzmann selection , to modulate the amount of noise in the process of choosing amongst output action actions . doya specifically hypothesizes that ne controls the noise whereas i can assert only that it is some neuromodulator - based mechanism . in doya 's model , as ne levels increase , the action with the greatest expected reward is chosen with probability approaching 1 . this is suggested as corresponding to the exploitation end of the exploitation exploration continuum . as ne levels drop to 0 , all actions become equally probable , i.e. , exploration , which is appropriate if no single action has a particular high expected reward , which generally correlates with the condition of novelty , i.e. , of being in a novel environment wherein it is harder to anticipate the outcome of known actions . the analogy to high expected reward in my model is a highly familiar input ( g 1 ) in which case we want the stored code for that familiar input to be reactivated with probability approaching 1 ; the condition where no action has a high expected reward is analogous to low familiarity , i.e. , where no stored input is very similar to the current input , in which case we want to lay down a new memory trace for the novel input . despite the similarities , doya 's model also assumes a localist representation of the choices and , like the other models just mentioned , can not realize the advantages of sdc . i have identified several avenues of active and future research at various points in the text and as noted in the previous section , the prospective neural realization is highly speculative and very incomplete . several additional questions / issues for future research are : is the current proposal that the l2/3 cells engage in two rounds of competition in each computational ( putatively , gamma ) cycle plausible ? for simplicity , i have described the model in the simplest case of having only one internal coding field ( f2 ) and processing only purely spatial input patterns . however the core model was originally developed for the spatiotemporal pattern ( sequence ) case ( rinkus , 1996 ) and was generalized some time ago to have an arbitrarily deep hierarchy of coding fields ( rinkus and lisman , 2005 ) . see figure s2 in supplementary material . how do these generalized versions of the model map to neural structures ? is there evidence that chandeliers become active twice as frequently as baskets , as the proposed realization predicts ? is there evidence for the converse ? although not elaborated herein , the proposed mini-/macrocolumn model is easily generalized to allow substantial overlap between minicolumns ( see figure s5 in supplementary material ) and multiple winners in a minicolumn on each computational cycle . we know of the fast , phasic , time scales of operation for ne ( rajkowski et al . , 2004 ) and da ( schultz , 1998 ) and of slightly slower but still phasic mode for ach ( gulledge and kawaguchi , 2007 ) , but these have been proposed as signaling other measures besides pure novelty ( redgrave et al . , 1999 ; bouret and sara , 2005 ; dayan and yu , 2006 ) . how might all these signals conspire to implement a pure novelty signal ? the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

no generic function for the minicolumn i.e. , one that would apply equally well to all cortical areas and species has yet been proposed . i propose that the minicolumn does have a generic functionality , which only becomes clear when seen in the context of the function of the higher - level , subsuming unit , the macrocolumn . i propose that : ( a ) a macrocolumn 's function is to store sparse distributed representations of its inputs and to be a recognizer of those inputs ; and ( b ) the generic function of the minicolumn is to enforce macrocolumnar code sparseness . the minicolumn , defined here as a physically localized pool of 20 l2/3 pyramidals , does this by acting as a winner - take - all ( wta ) competitive module , implying that macrocolumnar codes consist of 70 active l2/3 cells , assuming 70 minicolumns per macrocolumn . i describe an algorithm for activating these codes during both learning and retrievals , which causes more similar inputs to map to more highly intersecting codes , a property which yields ultra - fast ( immediate , first - shot ) storage and retrieval . the algorithm achieves this by adding an amount of randomness ( noise ) into the code selection process , which is inversely proportional to an input 's familiarity . i propose a possible mapping of the algorithm onto cortical circuitry , and adduce evidence for a neuromodulatory implementation of this familiarity - contingent noise mechanism . the model is distinguished from other recent columnar cortical circuit models in proposing a generic minicolumnar function in which a group of cells within the minicolumn , the l2/3 pyramidals , compete ( wta ) to be part of the sparse distributed macrocolumnar code .

Introduction Results: Model Description Model dynamics: the code selection algorithm Prospective mapping to cortical circuitry Support for neuromodulator-based implementation of familiarity-contingent noise Discussion Supplementary Material Conflict of Interest Statement

cell lines and culture conditions : four cell lines ( provided by the university of wisconsin - madison ) , ctac ( canine thyroid carcinoma , the ohio state university ) , d-17 ( canine osteosarcoma , american type culture collection ) , cml-1 ( canine melanoma , auburn university ) and cmt-12 ( canine mammary gland carcinoma , auburn university ) were used . all cell lines were grown under standard culture conditions with dulbecco s modified eagle medium ( dmem ; mediatech masassas , herndon , va , u.s.a . ) supplemented with 10% fetal bovine serum ( fbs ) , penicillin - streptomycin and 5% carbon dioxide at 37c . confluent cells were subcultured every 37 days after detaching the cells with 0.1% trypsin and 0.02% ethylenediaminetetraacetic acid in phosphate buffered saline ( pbs ; mediatech ) . loperamide hydrochloride : loperamide hydrochloride was purchased from sigma ( st . louis , mo , u.s.a . ) . stock solutions of 50 mm were prepared in dimethyl sulfoxide ( dmso ) and stored at 20c . fresh dilutions of loperamide hydrochloride were made from the stock solutions in media supplemented with 10% fbs for each experiment such that the dmso concentration did not exceed 0.2% as per standard experimental procedures , which has previously been shown to have no effect on growth of these cell lines [ 9 , 11 ] . inhibition of cellular proliferation assay : the effect of loperamide on cellular proliferation was evaluated using a bioreductive fluorometric assay ( alamar blue , molecular probes , invitrogen , carlsbad , ca , u.s.a . ) . between 1,500 and 6,000 cells per well were plated and grown in 10% fbs media in triplicate or quadruplicate in 96-well tissue culture treated microtiter plates and incubated for 1224 hr at 37c . number of cells plated per well was dependent on the rate of growth of cell lines in the flask . media were removed , and various concentrations of loperamide diluted in 10% fbs supplemented media were added . cell viability was determined at 24 , 48 and 72 hr following addition of loperamide . at these time points , 20 l of alamar blue was added to each well , and the plates were incubated at 37c for 8 hr . after incubation , plates were read using a spectrophotometric microplate reader ( biotek synergy 4 ; biotek instruments , winooski , vt , u.s.a . ) . the ic50 was determined by nonlinear regression analysis fitting to a dose - response curve using a computer software program ( prism 4 , graphpad software , la jolla , ca , u.s.a . ) . to complement cell viability assessment , a second set of cells for each cell line these cells were plated at various concentrations between 75,000200,000 cells per well depending on growth rate in the flask . after 24 hr , these cells were treated with two different drug concentrations ( 10 m and 100 m ) , while a control group was treated with media alone . the cells were observed with light microscopy and photographed at 6 , 24 and 48 hr after addition of loperamide . apoptosis analysis : the proportion of cells undergoing apoptosis was evaluated using 7-aad ( 10 g / ml ; molecular probes , invitrogen ) . cells were plated in 6-well plates at concentrations ranging from 25,000 to 150,000 cells / well depending on inherent growth rate to ensure that cells did not overgrow by the time of the assay . the cells were incubated for 1224 hr at 37c , at which time media were removed , and various concentrations of loperamide ( 0 , 10 , and 30 m ) diluted in 10% media were added . cells were then evaluated with flow cytometry at 6 , 24 and 48 hr post addition of drug . immediately prior to analysis , media were removed , and the attached cells were rinsed with cold pbs , trypsinized and resuspended in media . the cell suspension was centrifuged at 186 g at 7c for 7 min , after which the cell recovery was enumerated with an automated cell counter ( cellometer , nexcelom , lawrence , ma , u.s.a . ) . supernatant was removed , and the cells were resuspended in 100 l of cold pbs . one hundred l of 7-aad , prepared in a supplemented buffer ( 0.1% bovine serum albumen ( bsa ) , 0.1% nan3 and 1.0% fbs ) , was added . the cells were incubated on ice for 1530 min and evaluated using a lsr - ii flow cytometer with facsdiva 6.0 software ( bd biosciences , san jose , ca , u.s.a . ) . a minimum of 10,000 events were collected per sample , and reported values were a percentage of total cells counted . cells were discriminated into three populations , live cells and early apoptotic or late apoptotic / necrotic cells based on size and 7-aad uptake as described previously [ 15 , 25 ] . briefly , viable cells were of moderate size with minimal 7-aad uptake , while early apoptotic cells had moderate dye uptake and smaller size , and late apoptotic / necrotic cells were smallest in size with most intense uptake . the excitation wavelength was 488 nm with emission detected with a photomultiplier equipped with a 695/40 band pass filter . cell cycle analysis : cells were grown and treated with loperamide for cell cycle analysis in the same manner as for apoptosis analysis ( 0 , 10 and 30 m ) and allowed to incubate for 6 , 24 and 48 hr . cells were harvested as above for apoptosis analysis and were evaluated with a commercial cell cycle kit ( bd cycletest plus dna kit , bd biosciences ) . briefly , cells were suspended in a sodium citrate , sucrose and dimethyl sulfoxide buffer . the cell suspension was centrifuged for 5 min at 300 g at room temperature , the supernatant was removed , and the cells were resuspended in the same buffer solution . this wash step was repeated a second time , and the resulting suspension was then centrifuged for 5 min at 300 g at 23c 5c , and the supernatant was removed . fifty l of trypsin in a spermine tetrahydrochloride buffer was added for the digestion of cell membranes and cytoskeletal elements and allowed to react for 10 min . after incubation , 40 l of a trypsin inhibitor and rnase buffer was added and incubated for 10 min , after which 40l of cold ( 28c ) propidium iodide was added and allowed to incubate for another 10 min . the samples were placed on ice and immediately analyzed using flow cytometry to detect propidium iodide fluorescence , using an excitation of 488 nm and emission detected through a 575/26 band pass filterand analyzed with flowjo software ( tree star , ashland , or , u.s.a . ) to determine cell cycle parameters . chemosensitization assay : cells were grown as harvested as for the cellular proliferations assays . after plating , cells were allowed to adhere for 1224 hr , after which time the cells were treated with doxorubicin alone ( sigma ) at concentrations from 0.1 nm1,000 nm , loperamide alone at 10 m or a combination of increasing concentrations of doxorubicin ( 0.1 nm1,000 nm ) with 10 m of loperamide . the dose of 10 m was selected as it was near the ic50 value for most cell lines . a separate experiment using 25 m of loperamide instead of 10 m was also run for the cmt-12 cell line , since this cell line had a higher ic50 than the other three cell lines . control cells were treated with media alone at the same volume as used for the drugs . cells were incubated with the drugs for 72 hr before the alamar blue assay was run as described above . statistical analysis : all statistical analyses below were conducted separately for each of the 4 cell lines ( cmt-12 , cml-1 , ctac and d-17 ) . cell proliferation or cytotoxicity data ( cell counts ) were subjected to a 3-way anova . the main effects for this linear model were media ( 1% vs. 10% fbs ) , loperamide dose ( 0 , 0.01 , 0.1 , 1.0 , 3.2 , 10 , 32 and 100 m ) and exposure time ( 24 , 48 and 72 hr ) . residuals analysis suggested a box - cox power transformation of the cell count response , the results from which are reported . these data were subjected to a 2-way anova model using dose ( 0 , 10 and 30 m ) and exposure time ( 6 , 24 and 48 hr ) . the frequency ( % ) of cells in the g0/g1 phase of the cell cycle was subjected also to a 2-way anova model as the experimental design matched that of the apoptosis data . the synergistic effects of doxorubicin with loperamide ( chemosensitization ) were measured by a 2-way anova of the cell proliferation response subject to doxorubicin concentration ( 0 , 0.1 , 1.0 , 10 , 100 and 1,000 nm ) and loperamide concentration ( 0 and 10 m ) as main effects . residuals analysis suggested a weighted least - squares regression method , which was performed and reported as addressing the problem of heteroscedasticity . in addition , the test for a statistically significant ( p<0.05 ) interaction between doxorubicin and loperamide was equivalent to the bliss test for synergism . multiple comparisons among levels of the main effects in any of these analyses were conducted using the tukey - kramer hsd ( honestly significant difference ) test [ 10 , 22 ] . loperamide induced a dose - dependent cytotoxicity in canine cancer cell lines : loperamide produced anti - proliferative effects with increasing concentrations in all cell lines tested ( fig . 1.loperamide impaired cell viability following 72 hr of incubation in a dose dependent fashion in ctac , d-17 , cml-1 and cmt-12 canine cancer cell lines . viability data were garnered from experiments performed in triplicate and assessed by alamar blue assay . cell viability for both ctac and cmt-12 was significantly lower than control cells at concentrations 32 m ; cell viability for d-17 and cml-1 was significantly lower than control cells at concentrations 10 m . ) . cell lines had different sensitivities to the cytotoxic effects of loperamide , with the d-17 osteosarcoma cell line most sensitive ( table 1table 1.ic50 concentrations of loperamide in canine cancer cellsctacd-17cml-1cmt-12ic50 ( m ) 24 hr 20 0.88.7 0.519.4 0.6 27 0.5ic50 ( m ) 48 hr16.2 0.88.2 0.816.7 1.125.5 1.7ic50 ( m ) 72 hr19.3 0.57.2 0.314.8 1.125.8 0.3ic50 concentrations for 4 canine cancer cell lines after 24 , 48 and 72 hr of incubation with loperamide . there was no difference in ic50 based on time , as analyzed via anova with tukey post - hoc test . specifically , ctac and cmt-12 cell viability at concentrations 32 m were significantly lower compared to control cells . cell viability in both the d-17 and cml-1 cell lines was significantly lower at loperamide concentrations 10 m than compared to control cells . 2.morphological changes of the d-17 cell line after treating with 0 , 10 and 100 m of loperamide for 24 cell morphology changed from an attached spindle - shaped appearance ( control ) to detached and rounded with increasing doses of loperamide . this is a representative cell line , as all others showed similar changes . ) . there were no significant differences in the ic50 concentrations for any cell line based on timing ( 24 , 48 and 72 hr time points ) , indicating the loperamide exhibits its maximal effect by 24 hr . in addition , there was no effect of the fbs concentration in the media ( 1% vs. 10% ) on cell survival for either the ctac or the d-17 cell lines ( data not shown ) . however , there was a positive effect on cml-1 cell line survival with increasing fbs solution strength and negative effect on cmt-12 cell line survival ( data not shown ) . loperamide impaired cell viability following 72 hr of incubation in a dose dependent fashion in ctac , d-17 , cml-1 and cmt-12 canine cancer cell lines . viability data were garnered from experiments performed in triplicate and assessed by alamar blue assay . cell viability for both ctac and cmt-12 was significantly lower than control cells at concentrations 32 m ; cell viability for d-17 and cml-1 was significantly lower than control cells at concentrations 10 m . ic50 concentrations for 4 canine cancer cell lines after 24 , 48 and 72 hr of incubation with loperamide . there was no difference in ic50 based on time , as analyzed via anova with tukey post - hoc test . morphological changes of the d-17 cell line after treating with 0 , 10 and 100 m of loperamide for 24 hr . cell morphology changed from an attached spindle - shaped appearance ( control ) to detached and rounded with increasing doses of loperamide . loperamide induced a dose and time - dependent apoptosis : cells were stained with 7-aad and analyzed via flow cytometry to confirm that loperamide induced cell death . results in all cell lines showed a dose and time - dependent decrease in viable cells following treatment with loperamide ( table 2table 2.induction of apoptosis following incubation with loperamidectacd-17cml-1cmt-126 hr0 m2.6 0.86.1 1.71.9 0.59.7 1.510 m1 0.27.6 1.32.4 0.68.6 0.630 m2.8 0.55.8 0.23.5 1.610.8 3.224 hr0 m1.5 0.52.2 0.61.5 0.39.1 2.610 m3.2 0.92.4 11.4 0.36.2 1.730 m39.9 6.1 * 27.6 7.3 * 46.5 13.5 * 25.5 4.4 * 48 hr0 m4.1 1.61.1 0.21.8 0.57.1 0.710 m6.2 21.4 0.41.4 0.29 0.930 m92.7 0.1 * 57.2 4.6 * 86.1 3.5 * 72.8 2.3*percentage of cells undergoing apoptosis at three different time points and three different loperamide concentrations . an * indicates that there are significantly more apoptotic cells compared to the control ( 0 m of drug ) as analyzed via anova with tukey post - hoc test . ) . in the absence of loperamide , hr , there were no significant differences in percentage of apoptotic cells from baseline in any cell line ; however , following both 24 and 48 hr of exposure to 30 m , a significantly higher number of dead cells were detected . there was no difference between the 10 m group and the control group at any time point for any of the cell lines . percentage of cells undergoing apoptosis at three different time points and three different loperamide concentrations . an * indicates that there are significantly more apoptotic cells compared to the control ( 0 m of drug ) as analyzed via anova with tukey post - hoc test . loperamide induced a dose and time - dependent g0/g1 accumulation : a commercially available cell assay for live cells based on standard propidium iodide staining was used to assess cell cycle effects on all cell lines . loperamide caused a dose and time - dependent g0/g1 accumulation in viable cells ( table 3table 3.percentage of cells in g0/g1 following incubation with loperamidectacd-17cml-1cmt-126 hr0 m48.5 3.145.8 1.254.6 0.349.7 1.410 m50 244.5 0.555.8 1.251.5 230 m41.3 1.144.8 0.659.7 1.349 2.324 hr0 m38.1 3.352.6 1.550.6 0.358.7 110 m53.5 2.155.5 2.257.2 1.659.6 0.230 m56.8 0.8 * 63.4 3.7 * 70 1.9 * 78.2 2.4 * 48 hr0 m52.7 5.154.4 1.249.7 3.180.4 1.110 m51.2 1.660.7 1.850.3 1.877.6 230 m62.8 2.4 * 78.8 1.1 * 71.6 0.8 * 85.7 1.7*percentage of cells in g0/g1 at three different time points and three different loperamide concentrations . an * indicates that there are significantly more g0/g1 cells compared to the control ( 0 m of drug ) as analyzed via anova with tukey post - hoc test . , fig . 3fig . 3.loperamide caused an accumulation of cells in the g0/g1 phase as assessed by flow cytometry . representative flow cytometry histograms of d-17 cells are displayed for cells treated for 48 hr with loperamide ( 30 m ) ( b ) and control ( a ) . ) . there was no difference between the control and the 10 m concentrations at any time point . percentage of cells in g0/g1 at three different time points and three different loperamide concentrations . an * indicates that there are significantly more g0/g1 cells compared to the control ( 0 m of drug ) as analyzed via anova with tukey post - hoc test . loperamide caused an accumulation of cells in the g0/g1 phase as assessed by flow cytometry . representative flow cytometry histograms of d-17 cells are displayed for cells treated for 48 hr with loperamide ( 30 m ) ( b ) and control ( a ) . loperamide sensitized canine cancer cells to doxorubicin : four cell lines were screened to determine if loperamide increased the sensitivity of cancer cells to the chemotherapeutic drug doxorubicin in vitro . there was no evidence of synergism for the d-17 , cml-1 or cmt-12 cell lines with 10 m loperamide . however , there was synergism between the two drugs at 100 nm of doxorubicin and 10 m loperamide for the ctac cell line . due to the fact that the ic50 of the cmt-12 cell line was higher than the other three cell lines , the experiment was repeated using the same concentrations of doxorubicin , but with 25 m of loperamide , nearer to the ic50 . 4.doxorubicin alone is represented by the interrupted line , while the combination of doxorubicin and loperamide is represented by the non - interrupted line . loperamide concentration in a - c is 10 m , while it is 25 m in d. the curves are representative samples of experiments performed in triplicate . ) . doxorubicin alone is represented by the interrupted line , while the combination of doxorubicin and loperamide is represented by the non - interrupted line . loperamide concentration in a - c is 10 m , while it is 25 m in d. the curves are representative samples of experiments performed in triplicate . thus , the discovery of existing drugs with potentially expanded roles beyond their traditional purpose is attractive . here , loperamide , a commonly used anti - diarrheal in canine and human cancer patients , caused a significant dose - dependent cytotoxicity in 4 different canine cancer cell lines . the ic50 for loperamide ranged from 7.227 m , which correlates well with a study performed on a library of human cancer cell lines , showing ic50 concentrations ranging from 11.841.4 m . as seen in the human study , canine osteosarcoma cells were most sensitive to loperamide , while canine breast carcinoma cells were less sensitive ( 6 ) . cell death in the canine cancer cell lines investigated here was mediated in part by apoptosis , as demonstrated through 7-aad staining and flow cytometry , a technique shown to correlate well with other common apoptosis analyses , such as annexin - v and propidium iodide [ 15 , 25 ] . the mechanism behind apoptosis in these cell lines has not been elucidated , although in human cancer cell lines , loperamide has been shown to cause apoptosis via activation of the caspase 3 pathway . apoptotic canine cancer cells were identified at 24 hr , which was slightly later than with human cancer cells , as apoptosis was evident as early as 6 hr following loperamide exposure . this may be a reflection of different assays used or possibly decreased potency against canine cells ; it is possible that with higher doses of loperamide , a significant change in 7-aad staining would have been noted prior to 24 hr . interestingly , other opiate agonists , such as etorphine , morphine and buprenorphine , have also been shown to induce apoptosis in some human cell lines [ 7 , 8 , 24 ] . an unexpected finding was that unlike a g2/m arrest seen in human cancer cell lines , loperamide caused a dose and time - dependent g0/g1 accumulation in canine cancer cells . our group s initial intent was to consider using loperamide as a radiation sensitizer , given that human cancer cell lines are arrested in sensitive phases of the cell cycle [ 16 , 26 ] . it is still possible that loperamide , or a similar peripheral opiate agonist , might exert synergism with radiotherapy through another mechanism and may be worth exploring . it is unclear why the cells tested here demonstrated g0/g1 arrest rather than g2/m , however , it is possible that canine cancer cells may have altered cell cycle kinetics compared to human cancer cells . in addition to its negative effects on cell viability and its pro - apoptotic effect , loperamide also demonstrated synergism with doxorubicin in both the ctac and cmt-12 cell lines at concentrations near the ic50 when combined with doxorubicin . while it is interesting that both of these cell lines are carcinomas , further investigation is indicated to determine if similar effects are seen in other cell types . in a human breast cancer cell line stably transfected with the mdr-1 gene leading to doxorubicin resistance , loperamide was able to reverse this resistance due to high affinity for the p - glycoprotein pump , therefore leading to intracellular accumulation of the chemotherapeutic . while our laboratory has performed preliminary work investigating the immunohistochemical expression of p - glycoprotein in our selected cell lines , further work is needed to determine if there is a relationship between p - glycoprotein expression and loperamide effects . the apparent synergism of doxorubicin and loperamide in some cell lines may also be due to occupation of another shared efflux pump , such as mrp-1 , or through alternative mechanisms not related to drug efflux . it may be interesting in future studies to evaluate the effect of loperamide on doxorubicin - resistance canine cell lines compared to nave cancer cell lines to further elucidate the potential for adjuvant therapy . a possible limitation of the in vitro work performed here is that the concentrations of loperamide used are above what has safely been used in vivo . one study showed that after a typical dosage of 0.2 mg / kg , blood concentrations of 0.02 m were achieved . the maximally tolerated dose of loperamide is not known , but toxicities including vomiting , diarrhea and central nervous system depression have been reported at doses as low as 1.25 mg / kg . in dogs with mutations in their p - glycoprotein pumps ( abcb1 mutation ) , toxicity may be seen at doses well tolerated by normal dogs . however , it is certainly possible that the in vitro work done in this study is not a true reflection of the in vivo activity of this drug . it is also important to note that in this work , cells were only exposed to a single dose of loperamide . if loperamide is capable of reversing resistance , doses in the realm of 10 m may still be necessary , which would be difficult to achieve in dogs unless the target cancer cells are capable of accumulating drug . loperamide exerted negative effects on the cancer cell lines studied here as early as 24 hr following exposure ; given that loperamide may be administered more frequently , chronic dosing may have altered effects . it is also important to note that variations in drug metabolism and patient variability may lead to anti - neoplastic effects in a spontaneous tumor model with lower drug concentrations . despite these limitations , this study establishes a proof - of - principle in support of loperamide as an anti - cancer agent . further studies are needed to establish mechanisms of action of its activity as well as in vivo tolerability as part of multi - modality therapy . it is possible that drugs similar to loperamide will exert similar anticancer properties at clinically relevant doses . loperamide would be an attractive drug in the clinic , as it has minimal side effects , is an over - the - counter drug , and is inexpensive . in conclusion , results presented here loperamide negatively affected canine cancer cell viability with ic50 values similar to those reported in human cancer cell lines . loperamide also caused apoptosis in a dose - dependent fashion and induced a g0/g1 cell cycle arrest . in vitro chemosensitivity studies further work on the efficacy of loperamide or similar peripheral -opioid agonist in the management of cancer is warranted .

loperamide is a peripheral opiate agonist that can cause apoptosis and g2/m arrest in human cancer cell lines and may sensitize cells to chemotherapy . the objectives of this study were to investigate the effects of loperamide on viability , apoptosis and cell cycle kinetics in canine cancer cells and to establish whether the drug sensitizes cells to doxorubicin . cell viability was assessed using alamar blue . cell death and cell cycle were studied using flow cytometry with 7-aminoactinomycin - d ( 7-aad ) and propidium iodide ( pi ) , respectively . loperamide decreased cell viability in a dose - dependent fashion and was most effective against canine osteosarcoma cells . in all cell lines , it induced a dose and time dependent apoptosis and resulted in accumulation in g0/g1 . when co - incubated with doxorubicin , loperamide induced a synergistic cell kill in canine carcinoma cells . investigation is warranted into the role of loperamide in the treatment of canine cancer .

MATERIALS AND METHODS RESULTS DISCUSSION

we studied six cycle tracks in montreal that are two - way on one side of the street . each cycle track was compared with one or two reference streets without bicycle facilities that were considered alternative bicycling routes . one reference street was a continuation of the street with the cycle track ; the remaining streets were parallel to the cycle track with the same cross streets as endpoints and , therefore , subject to approximately the same intersection frequency and cross traffic as the cycle track . the injury and crash rates for each cycle track were determined from the emergency medical response ( emr ) database16 and police - recorded vehicle / bicycle crashes and estimated on the cycle tracks per bicycle - km . automated 24-h bicycle counts on montreal cycle tracks are available for selected years , with 2064 days in each sample from may to september . we used linear interpolation between the 2000 and 2008 samples to determine average daily use for the date ranges of the injury and crash counts . effective days in the 1 april to 15 november bicycling season ( when seasonal cycle tracks are open ) , recognising that bicycle use tends to be less in april , october and november than in the sampled months . use estimates were converted to bicycle - km by multiplying by segment length and the fraction of the cycle track 's length ridden per cyclist . this fraction , which ranged from 0.6 to 0.9 , was determined using expert judgement considering the cycle track length and opportunities for turning on and off . the rr of the cycle track compared with the reference street was estimated using bicyclist counts and injuries from the emr database.16 although injury ( emr ) and bicycle / vehicle crash data from police records overlap strongly , the injury data have been shown to be more exhaustive17 and were available for a longer period . injury counts were determined for the 1 april to 15 november bicycling season and within 15 m of each street centerline . for comparability with exposure data , it was important to exclude individuals injured at intersections who may have been riding on a cross street ; however , the emr database does not indicate which street the injured cyclist was using . therefore , using the police crash database we determined for each section studied the fraction of bicycle / vehicle crashes involving cyclists who were riding on cross streets , and reduced injury counts by that fraction . historical bicycle counts were available for the cycle tracks but not the reference streets . to obtain an unbiased measure of relative exposure , simultaneous 2 h bicycle counts were conducted at parallel counting sites on each cycle track and its reference street(s ) . using a ratio of simultaneous counts the rr of injury for each cycle track was calculated as : rr = injuriestrackbikestrackinjuriesrefbikesrefwhere injuriestrack and injuriesref are the count of injuries on the cycle track and reference street(s ) , respectively , and bikestrack and bikesref are the corresponding cyclist counts . ninety - five percent ci were calculated using the variance of log(ratio ) based on a poisson distribution for incidents . rr for all cycle tracks was calculated similarly using the summed data from all the observations . reference streets were selected with vehicular traffic danger ( volume , speed , heavy vehicles ) as similar as possible to their cycle track ; however , it was impossible to achieve exact similarity . therefore , to compare the vehicular traffic danger , we also calculated the ratio of motor vehicle occupant ( mvo ) injuries on the cycle track street to mvo injuries on the reference street . mvo injury counts are considered a surrogate for traffic danger a bicyclist might face on a given street apart from any treatment . the injury and crash rates for each cycle track were determined from the emergency medical response ( emr ) database16 and police - recorded vehicle / bicycle crashes and estimated on the cycle tracks per bicycle - km . automated 24-h bicycle counts on montreal cycle tracks are available for selected years , with 2064 days in each sample from may to september . we used linear interpolation between the 2000 and 2008 samples to determine average daily use for the date ranges of the injury and crash counts . effective days in the 1 april to 15 november bicycling season ( when seasonal cycle tracks are open ) , recognising that bicycle use tends to be less in april , october and november than in the sampled months . use estimates were converted to bicycle - km by multiplying by segment length and the fraction of the cycle track 's length ridden per cyclist . this fraction , which ranged from 0.6 to 0.9 , was determined using expert judgement considering the cycle track length and opportunities for turning on and off . the rr of the cycle track compared with the reference street was estimated using bicyclist counts and injuries from the emr database.16 although injury ( emr ) and bicycle / vehicle crash data from police records overlap strongly , the injury data have been shown to be more exhaustive17 and were available for a longer period . injury counts were determined for the 1 april to 15 november bicycling season and within 15 m of each street centerline . for comparability with exposure data , it was important to exclude individuals injured at intersections who may have been riding on a cross street ; however , the emr database does not indicate which street the injured cyclist was using . therefore , using the police crash database we determined for each section studied the fraction of bicycle / vehicle crashes involving cyclists who were riding on cross streets , and reduced injury counts by that fraction . historical bicycle counts were available for the cycle tracks but not the reference streets . to obtain an unbiased measure of relative exposure , simultaneous 2 h bicycle counts were conducted at parallel counting sites on each cycle track and its reference street(s ) . using a ratio of simultaneous counts the rr of injury for each cycle track was calculated as : rr = injuriestrackbikestrackinjuriesrefbikesrefwhere injuriestrack and injuriesref are the count of injuries on the cycle track and reference street(s ) , respectively , and bikestrack and bikesref are the corresponding cyclist counts . ninety - five percent ci were calculated using the variance of log(ratio ) based on a poisson distribution for incidents . rr for all cycle tracks was calculated similarly using the summed data from all the observations . reference streets were selected with vehicular traffic danger ( volume , speed , heavy vehicles ) as similar as possible to their cycle track ; however , it was impossible to achieve exact similarity . therefore , to compare the vehicular traffic danger , we also calculated the ratio of motor vehicle occupant ( mvo ) injuries on the cycle track street to mvo injuries on the reference street . mvo injury counts are considered a surrogate for traffic danger a bicyclist might face on a given street apart from any treatment . all six cycle tracks were two - way on one side of the street and separated from traffic by raised medians , parking lanes , or delineator posts . the brbeuf and maisonneuve cycle tracks stand out as safer than the other four ( table 1 ) . injury and vehicle / bicycle crash rates for cycle tracks in montreal , quebec * whole segments of the cycle track were studied and not just intersections . length of the section studied , which may be less that the entire cycle track length for comparability with reference streets . year is the 7.5 month period ( 1 april to 15 november ) when the seasonal cycle tracks are open . demand is lower in april , october and november and , therefore , bicycle volume for a injuries ( data source emergency medical response ) between 1 april and 15 november for the period 1 april 1999 to 31 july 2008 divided by 9.53 . bicycle motor vehicle crashes ( data source police reports ) between 1 april and 15 november 20026 , divided by 5 . compared with bicycling on a reference street , the overall rr of injury on a cycle track was 0.72 ( 95% ci 0.60 to 0.85 ) ; thus , these cycle tracks had a 28% lower injury rate . three of the cycle tracks exhibited rr less than 0.5 , and none showed a significantly greater risk than its reference street . overall , 2.5 times as many cyclists used the cycle tracks compared with the reference streets ( table 2 ) . rr of injury for cycle tracks compared to similar on - street routes for montreal , quebec * statistically significant comparisons are shown in bold . an on - street bike route on a parallel street in close proximity of the cycle track . injuries recorded by emergency medical response ( emr ) services between 1 april 1999 and 31 july 2008 for the season 1 april to 15 november . 95%ci calculated using the variance of log(rr ) based on a poisson distribution . for comparisons having two reference streets , the total number of bicyclists is used from both streets . the relative danger from vehicular traffic of the cycle tracks compared with their reference streets was close to 1.0 overall , but with a wide range ( table 3 ) . not surprisingly , the brbeuf and maisonneuve cycle tracks with lowest crash rate and relative injury risk ( tables 1 and 2 ) also had the lowest relative danger from vehicular traffic ( table 3 ) . yet even for the four cycle tracks on streets with vehicular traffic danger similar to or greater than its reference street , the cycle tracks still had less or a similar risk of injury . injuries to motor vehicle occupants recorded by emergency medical response ( emr ) services between 1 january 1999 and 31 july 2008 . 95% ci calculated using the variance of log(rr ) based on a poisson distribution . for comparisons having two reference streets , the average number of injuries of the reference streets is used . contrary to aashto 's safety cautions about road - parallel paths and its exclusion of cycle tracks , our results suggest that two - way cycle tracks on one side of the road have either lower or similar injury rates compared with bicycling in the street without bicycle provisions . this lowered risk is also in spite of the less - than - ideal design of the montreal cycle tracks , such as lacking parking setbacks at intersections , a recommended practice.18 while the goal of this study was to consider both one and two - way cycle tracks , all of the montreal cycle tracks were two - way with half the bicyclists riding in a direction opposite to that of the closest vehicular traffic , a practice not favoured by aashto . although the montreal cycle tracks were two - way , they had lower or similar risk compared with the road . the dutch crow bicycle guidelines suggest that one - way cycle tracks are even safer.3 the crash rate for montreal 's cycle tracks ( 10.5 crashes per million bicycle - km ) is low compared with the few and inconsistent crash rates in the literature . when calculated to include only vehicle / bicycle crashes , these rates range from 3.755 to 5419 in the usa and from 4620 to 6721 in canada . the injury rate ( 8.5 injuries per million bicycle - km ) lacks comparable data in the literature , partly because few communities have accessible bicycle - incident ambulance records . although the brbeuf and maisonneuve cycle tracks were safer , the sample of six cycle tracks was too small to determine which factors make some safer . in one of the few comparisons of bicycling in the street versus bicycling on a separated path parallel to the street in the usa , wachtel and lewiston22 determined a relative crash risk of 1.8 for bicycling on sidewalks which had been designated as bikeways , compared with bicycling in the adjacent street in palo alto , california . however , their study considered only intersection crashes , omitting non - intersection crashes that include being hit from behind , sideswiped , or struck by a car door . motor vehicle collisions city - wide in palo alto were non - intersection crashes . if non - intersection crashes are included to match this 26% proportion , reanalysis of the wachtel and lewiston22 data in the article shows that there is no significant difference in risk between the sidewalk bikeway and the street ( table 4 ) . for bicyclists riding in the same direction as traffic , as would be case with one - way cycle tracks , sidewalk bikeways carried only half the risk of the street therefore , the wachtel and lewiston22 data , when corrected to include non - intersection crashes , corroborate our findings that separated paths are safer or at least no more dangerous than bicycling in the street . furthermore , as the most common cause of fatal bicyclist collisions in urban areas is overtaking,23 it is probable that an analysis accounting for the severity of injury would be still more favourable towards cycle tracks . crash rr from wachtel and lewiston22 data with non - intersection crashes included * statistically significant comparisons are shown in bold . significance , calculated using the variance of log(irr ) based on a poisson distribution ( for comparison with original article ) . authors ' original data . our study considered whole segments of cycle tracks and not just intersections , measured bicycle exposure directly , and included appropriate comparison groups . the study , though , only included analysis of six cycle tracks , all of which were two - way and in the same city , and lacked injury severity data . this research underscores the need for better bicycle counting and injury surveillance and for additional safety studies , particularly of one - way cycle tracks , intersections , injury severity and other factors that affect cycle track safety . public health and bicycling advocates in the usa have faced a dichotomy , believing from surveys and european experience that cycle tracks encourage more bicycling , yet being warned that they lead to higher crash and injury rates . our results suggest that cycle tracks lessen , or at least do not increase , crash and injury rates compared with the street . individuals , in particular women , children , and seniors , prefer to bicycle separated from motor traffic . cycle tracks ( physically - separated bicycle - exclusive paths along roads ) exist and continue to be built in the netherlands where 27% of all trips are by bicycle and 55% of bicycle riders are female . engineering guidance in the united states has discouraged bicycle facilities that resemble cycle tracks , including parallel sidepaths and sidewalk bikeways , suggesting that these facilities and cycle tracks are more dangerous than bicycling in the street . overall , 2 times as many cyclists rode on the cycle tracks compared with the reference streets . there were 8.5 injuries and 10.5 crashes per million - bicycle kilometers respectively on cycle tracks compared to published injury rates ranging from 3.75 to 67 for bicycling on streets . the relative risk of injury on the cycle track was 0.72 ( 95%ci=0,60 - 0.85 ) compared with bicycling in the reference streets . cycle tracks lessen , or at least do not increase , crash and injury rates compared to bicycling in the street .

most individuals prefer bicycling separated from motor traffic . however , cycle tracks ( physically separated bicycle - exclusive paths along roads , as found in the netherlands ) are discouraged in the usa by engineering guidance that suggests that facilities such as cycle tracks are more dangerous than the street . the objective of this study conducted in montreal ( with a longstanding network of cycle tracks ) was to compare bicyclist injury rates on cycle tracks versus in the street . for six cycle tracks and comparable reference streets , vehicle / bicycle crashes and health record injury counts were obtained and use counts conducted . the relative risk ( rr ) of injury on cycle tracks , compared with reference streets , was determined . overall , 2.5 times as many cyclists rode on cycle tracks compared with reference streets and there were 8.5 injuries and 10.5 crashes per million bicycle - kilometres . the rr of injury on cycle tracks was 0.72 ( 95% ci 0.60 to 0.85 ) compared with bicycling in reference streets . these data suggest that the injury risk of bicycling on cycle tracks is less than bicycling in streets . the construction of cycle tracks should not be discouraged .

Methods Injury and vehicle/bicycle crash rates per bicycle-kilometre Relative Risk (RR) of injury for cycle tracks Relative danger from vehicular traffic Results Discussion Implications for policy

traumatic lumbar spondylolisthesis is rare disease and in the literature , different surgical approaches , including anterior , posterior , or combined approaches ( posterior and anterior ) are used to treat the lesion . we treated a case of traumatic lumbosacral spondylolisthesis using posterior approach and the patient showed a satisfactory outcome . at the final follow - up , he was completely asymptomatic , and radiographic images revealed normal lumbar alignment and a solid interbody fusion . traumatic lumbosacral spondylolisthesis can be treated using posterior approach alone to obtain reduction , decompression , and solid fusion . traumatic lumbosacral spondylolisthesis is a rare injury ( 1 - 3 ) ; most of the cases were published as case reports in the literature . the injury results from a complex and high - energy mechanism ( 4 ) or forces , including hyperextension stress ; hyperflexion and compression stress ; or tangential force ( 5 ) . most surgeons believe that the injury should be treated surgically , and in this regard different surgical approaches are used in spine departments . we report a case of traumatic lumbar spondylolisthesis , which was treated using posterior approach to realize the stable 3-column fixation and solid interbody fusion . a 38-year - old man was referred to the affiliated hospital of jinan university , guangzhou , china due to injury in a motorcycle accident on july 25 , 2011 . he was conscious with stable vital signs , but complained of pain in his back and right thigh , numbness and weakness in both lower extremities . upon physical examination , grade 4 power was found in both lower limbs , and the perianal sensation and anal tone were normal too . x - radiographs showed a grade 2 spondylolisthesis of l5 on s1 ( figure 1 ) , fracture of the left transverse process of l4 as well as the fracture of right femur . mri demonstrated traumatic lumbar spondylolisthesis of l5 on s1 , avulsion of the l5 intervertebral disc and compression of the cauda equina ( figure 1 ) . first , open reduction and internal fixation were performed for the fracture of right femur , and then a posterior approach surgery was performed for the traumatic lumbosacral spondylolisthesis using a standard posterior midline incision . during operation , bilateral fracture of the pars interarticularis , disruption of interspinal ligament and flaval ligaments of l5-s1 , and disruption of l5 annulus fibrosus were found . decompression and reduction were done followed by internal fixation using pedicle screws and rods from l4 to s1 . posterolateral fusion was performed at l4 - 5 level ; l5 disk was excised and 2 peek cages were inserted posteriorly with autologous bone grafts . the procedure lasted 145 minutes with intraoperative blood loss of 400 ml , without intraoperative complications . four weeks later , his strength and cutaneous sensation in both lower extremities recovered completely . one and a half year after surgery , at the final follow - up , the patient was completely asymptomatic and radiographs revealed normal lumbar alignment and a solid interbody fusion ( figure 2 ) . in addition , the fracture of right femur obtained bony union and he could stand and walk without any support , and resumed his previous level of physical activities . in the english literature , some cases of traumatic spondylolisthesis were reported , which were treated successfully using conservative methods ( 7 , 8) , but the non - surgical treatment may result in posttraumatic translational instability or chronic low back pain ( 1 , 3 ) . moreover , the rare lesion belonged to a 3-column injury ( 9 ) and need a solid internal fixation . as a result , surgical treatment was a better choice for the injury ( 1 - 3 , 9 ) . in the literature , this kind of injury was treated using different surgical approaches , including anterior ( 10 ) , posterior ( 1 , 2 , 9 ) , or combined approach ( anterior and posterior ) ( 11 , 12 ) , but there is not a decisive criterion to determine which surgical approach to select . in this case , the lesion included a traumatic disruption of the intervertebral disk material , dislocation of l5 vertebral body and bilateral fracture of the pars interarticularis . therefore , excision of intervertebral disc and reduction of l5 vertebral body as well as interbody fusion were needed ( 1 ) . in addition , decompression and internal fixation to avoid further injury to the nerve system , stabilize the spine , and promote the recovery of the nerve system was necessary . compared with anterior or combined approach , the posterior approach is safe , easy , and with minimum complication . moreover , the pedicle - rod system can result in perfect reduction of vertebral body and 3-column fixation . consequently , decompression , fixation , and interbody fusion can be achieved using posterior approach alone . at the same time , the higher risk of blood loss , longer hospital stay and the high cost which is associated with anterior or combined approach can be avoided or decreased . in the present case , this kind of case is rare , and it is difficult to compare different surgical approaches using a large scale , or a clinical controlled trial , but we believe the posterior approach alone may be an optimal selection for this rare injury .

introduction : traumatic lumbar spondylolisthesis is rare disease and in the literature , different surgical approaches , including anterior , posterior , or combined approaches ( posterior and anterior ) are used to treat the lesion.case presentation : we treated a case of traumatic lumbosacral spondylolisthesis using posterior approach and the patient showed a satisfactory outcome . at the final follow - up , he was completely asymptomatic , and radiographic images revealed normal lumbar alignment and a solid interbody fusion.conclusions:traumatic lumbosacral spondylolisthesis can be treated using posterior approach alone to obtain reduction , decompression , and solid fusion .

Introduction: Case Presentation: Conclusions: 1. Introduction 2. Case Presentation 3. Discussion

progressive facial hemiatrophy ( pfh ) was described initially by parry in 1825 . in 1846 , romberg described the same as a syndrome . eulenberg , in 1871 , coined the name progressive facial hemiatrophy. we describe a case series of six patient presenting to us who were diagnosed as having pfh . the clinical features , history , and relevant investigations including serological findings of the patients are highlighted . six patients presenting to our outpatient department were diagnosed with progressive facial hemiatrophy ( pfh ) . the clinical features , history , and relevant investigations including serological findings of the patients are highlighted in table 1 . patient demographics , clinical , and serological features all the six patients in our series were female . there was no significant family history of similar disease in the family in any of the patients . the age of onset of the disease ranged from eight to twenty - six years . hyperpigmentation was seen in the patients and was a major concern for all of them . the cheek was involved in five of the patients , the forehead in two , and the nose in one . bone involvement was not clinically evident in any patient ; however , the youngest patient showed minimal bone atrophy on radiography . the auto - antibody profile showed a positive screen for anti - nuclear - antibodies in one patient ; however , no specific positivity was seen on anti - nuclear - antibody profile testing , which included anti - single - stranded dna ( anti - ssdna ) , anti - double - stranded dna ( anti - dsdna ) , anti - centromere ( aca ) , anti -scl-70 , anti - jo / la , and anti - u1rnp . right - sided pfa , mainly cheek and jaw right - sided pfa , mainly cheek and jaw right - sided pfa , mainly cheek left - sided pfa , mainly cheek and forehead the different treatment options tried by the patients included topical steroids , topical vitamin e preparations , anti - malarials , and topical calcipotriene . two of the patients were referred for plastic surgery , for surgical management with autologous fat / fascial grafts , with subjectively satisfactory results . it has been described as a slowly progressive atrophy of the skin , subcutaneous tissue , and muscle , involving one side of the face , typically presenting during the first or second decade of life . it is characterized by the unilateral atrophy of the skin , subcutaneous tissue or the underlying bony structures , often accompanied by hyperpigmentation of the skin . this syndrome has many features of linear scleroderma en coup de saber, but is distinguished by a more extensive involvement of the lower face with only slight cutaneous sclerosis . it is often difficult to differentiate between scleroderma of the en coup de sabre type and pfh . total hemi - facial involvement , neurological features , and ocular changes are more characteristic of pfh.[58 ] histopathological features that might contribute to differentiating the two conditions include : connective tissue fibrosis , adnexal atrophy , and mononuclear cell infiltrates , which are present more commonly in scleroderma of the en coup de sabre. in our series we have included only those cases that did not show histological evidence of sclerosis . all the patients in our series considered the associated hyperpigmentation of the skin to be a major problem . however , pfh has been reported in one of a monozygotic twin pair , suggesting that genetic factors are not involved in its etiology . in our study none of the patients had any significant associated family history of a similar condition . cory et al , hypothesized that a noninfectious , unilateral inflammatory process , possibly associated with a chronic vasomotor disturbance and sympathetic nerve chain inflammation , was a major factor in the pathogenesis of this syndrome . there is a hypothesis that there are probably different subcategories among patients presenting with pfh . even as some cases may be autoimmune in nature many of the cases are likely to be idiopathic and big majorities have only facial atrophy , with no evidence of eye or cns involvement . sahin et al , reported a case of progressive hemifacial atrophy occurring in a 30-year - old woman , in whom the etiology was thought to be lyme disease . no sure link was established between these two disease states , but their coincident occurrence in this patient was noted . the authors suggested that the etiology of the parry - romberg syndrome could involve borreliosis . however , pfh has been reported from many areas , which are non - endemic for borreliosis , hence , making the significance of this association questionable . the association of idiopathic / progressive facial hemiatrophy with various auto - antibodies has been reported . however , the significance or specificity of the association is debatable , especially as many of these cases have been diagnosed as overlaps of the parry romberg syndrome ( prs ) and linear scleroderma . in the study by garcia - de la torre et al , in a series of prs cases , the rheumatoid factor was positive in 36% , anti - histone antibody positivity was seen in 21% , and anti centromere antibody positivity in 14% . they did not find any positivity for the anti - ds - dna antibody . gonul et al , reported a case of a 21-year - old caucasian man with hemifacial atrophy on the right side . serological studies with anti - single - stranded dna ( anti - ssdna ) , anti - double - stranded dna ( anti - dsdna ) , anticentromere ( aca ) , and antinuclear ( ana ) antibodies were conducted . anti - dsdna antibodies were found to be positive , but the others were negative . the rheumatoid factor ( rf ) was also negative . some other reports also showed positivity to anti - ds - dna . in our series only one patient had a positive anti - nuclear - antibody ( ana ) screen , however , none of the patients showed specific positivity in an ana profile test , which included anti - single - stranded dna ( anti - ssdna ) , anti - double - stranded dna ( anti - dsdna ) , anticentromere ( aca ) , anti - scl-70 , anti - jo / la , and anti - u1rnp . management of pfh comprises of a long - term follow - up of somatic disorders , and prevention of psychological problems . treatment of pfh is symptomatic and mainly consists of plastic surgery after the disease activity has stopped . various modalities of treatment have been tried for pfh , with varying results ; however , very often these are prescribed under the assumption of associated localized scleroderma . these include intralesional or systemic products , such as , glucocorticoids , vitamin e , vitamin d derivatives , phenytoin , retinoids , penicillin , griseofulvin , interferons , d - penicillamine , antimalarials , and phototherapy . surgical treatment is probably the only option in cases of definite pfh , parry - romberg syndrome or atrophic stages of localized scleroderma . various surgical options used with varying results include simple / composite grafts ( dermal and dermal - fat grafts ) , local or free flap surgery , injection of autologous tissues / lipofilling , paraffin , silicone , or polyalkylimide gel / poly - l - lactic acid.[1517 ] in our case series different medical options had been tried , including topical / intralesional steroids , anti - malarials , topical vitamin e preparations , and topical vitamin d analogs . two of the patients had been referred for plastic surgery , as both had deep subcutaneous involvement ( without bone involvement ) . both the patients had a fat / fascial graft done , with satisfactory cosmetic results . it is essential to differentiate the condition from localized scleroderma , as the medical options used in the latter may have no benefits in pfh . patient counseling is essential , so that the patients understand the nature of the disease and the prognosis .

six female patients diagnosed with progressive facial hemiatrophy are presented here . the clinical and serological features are highlighted , and treatment options for the condition are discussed . we would like to highlight the need to differentiate the condition from localized scleroderma and the with limitation of its medical management .

Introduction Case Report Discussion Conclusion

it refers to upper abdominal pain or discomfort , which is taught to arise from the upper gastrointestinal tract ( 1 ) . dyspepsia is a global concern , although most of the published data have arisen from western countries . it is assumed that dyspepsia in populations from developing countries is mostly organic in nature , whilst functional dyspepsia is more prevalent in western nations ( 2 ) . the prevalence of this disorder varies between 3% and 40% in different studies ( 3 , 4 ) . this variation in the prevalence rates may be related to differences in the definition of dyspepsia in those studies . although not life - threatening , the symptoms are long - lasting ( 5 ) . various risk factors have been found to have associated with these disorders such as helicobacter pylori infection ( 6 , 7 ) , psychiatric disorders ( 6 , 8 , 9 ) and behavioral characteristics ( 10 ) . in addition , geographical distribution of functional dyspepsia is different in the world ( 11 - 14 ) . considering the negative effect of this disorder on patients ' quality of life ( 15 - 17 ) ; understanding its prevalence in the general population in different regions of iran and other populations as well as the implementation of suitable interventions can lead to health promotion in the community . it also helps better understanding about the problem and remains a good resource for clinical researches ( 18 - 20 ) . many studies in this issue have emphasized mainly on dyspepsia and the functional type of this disorder often has been ignored . comparing the condition of functional dyspepsia from different views such as the prevalence and risk factors among various populations is a main defect in research in the field of gastroenterology , particularly in iran . considering the high prevalence of the dyspepsia symptoms in iran through daily clinical experiences and very low information about functional dyspepsia particularly in southeast of iran , it seems that an understanding of the prevalence and potentially relevant risk factors can help the policy makers to establish a program for training and early diagnosis of the disease in the future . the aim of this study was to estimate the prevalence of functional dyspepsia and its associated factors in the adult population in kerman ( southeast of iran ) . in this cross - sectional study , a study population was selected using a cluster random sampling method based on the postal code divisions of kerman , a city in southeast of iran . this study was nested in a comprehensive study ( kercadr : the study of coronary artery disease risk factors in kerman , 2008 ) . full details of sampling and methodology of kercadr study were presented elsewhere ( 14 ) . assuming the prevalence of 25% for functional dyspepsia in the previous studies and a design effect equal to 1.5 and also considering 20% drop out , we calculated a sample size of 2200 to estimate the prevalence of functional dyspepsia by the accuracy rate of 0.025 in the significance level of 0.05 . demographic , anthropometric , psychosocial , nutritional and behavioral information had been collected by the original questionnaire in kercadr study with reliability and validity of 87% and 85% , respectively . specific questions about the main objectives of the current study asked by a standardized questionnaire based on rome111 criteria ( 1 ) . this questionnaire contains more than 20 questions about the dyspepsia symptoms and evidences of past medical history of recruits . an expert practitioner collected the data by direct face to face interview , asking specific questions and investigating relevant medical documents . the patient 's privacy was respected in this study . ethical approval , with a code of k/89/161 , patients who had signs and symptoms of weight loss , anemia , lesions and wounds in previous endoscopy and also those who had used drugs for the peptic ulcer were excluded from the study . statistical analyses were undertaken by spss version 16 ( spss inc , chicago , il , usa ) . chi - square and fisher 's exact tests were used to compare the categorical variables , and the logistic regression model was used to calculate the association between dyspepsia and risk factors . from a total of 2320 individuals enrolled in the study , 110 cases were excluded and 2210 cases ( 1049 males and 1161 females ) with the mean age of 43.4 16.25 years were studied . no statistically significant difference was observed between males and females regarding age ( p = 0.7 ) . among the participants , the standardized prevalence of functional dyspepsia in kerman was 16.1% ( 95% confidence interval : 14.3 - 18.1 ) . table 1 shows the prevalence of functional dyspepsia in relation to demographic , anthropometric , behavioral and psychosocial data . results showed that although the dyspepsia was more common in females ( 17.1% ; 95% ci : 15.8 - 18.5 ) , young adults ( 18.9% ; 95% ci : 18 - 19.8 ) , subjects with academic education ( 16.8 ; 95% ci : 12.9 - 21.6 ) , anxiety ( 16.9 ; 95% ci : 14.8 - 19.3 ) and depression ( 18.1% ; 95% ci : 14.7 - 22 ) , none of these associations was statistically significant . results also revealed that the prevalence of this disorder was lower among high fruit and vegetable consumers [ ( 15.8% ; 95% ci:13.6 - 18.3 ) and ( 16.1% ; 95% ci : 10.3 - 24.3 ) , respectively ] , the tea - coffee and fast - food consumers [ ( 16.1% ; 95% ci : 14.2 - 18.2 ) and ( 8.8% ; 95% ci : 5.2 - 14.6 ) , respectively ] and patients with low physical activity ( 13.8% ; 95% ci : 11.3 - 16.6 ) and abdominal obesity ( 7.3% ; 95% ci : 3.6 - 14.5 ) , while only the association between functional dyspepsia and abdominal obesity was statistically significant ( p = 0.0002 ) 58.3 % ( 95% ci : 51.8 - 64.3 ) had epigastric pain or burning , 37.3% ( 95% ci : 31.5 - 43.6 ) had postprandial fullness and 18.6 % ( 95% ci : 13.9 - 24.3 ) complained of early satiety . only about 3 percent ( 95% ci : 1.4 - 6.4 ) of the patients had all of the three above - mentioned symptoms . there was no statistically significant difference between males and females in the relevant symptoms ( table 2 ) . table 3 showed that anxiety after controlling for other variables increased the risk of functional dyspepsia more than 65 percent ( p = 0.004 ) and also depression increased that risk about 2.13 percent ( p < 0.0001 ) . although high consumption of fruit decreased the risk of functional dyspepsia ( crude or = 0.66 ; p = 0.04 ) , controlling other variables demonstrated no statistically significant protective effect ( adjusted or = 0.92 ; p = 0.7 ) . moreover , current smoking and drinking teacoffee and alcohol increased the risk of functional dyspepsia about 5% , , 30% and 35% , respectively ; however , their effects were not statistically significant ( p = 0.4 , 0.4 and 0.8 , respectively ) ( table 3 ) . our study showed that the prevalence of functional dyspepsia was about 16% and it was significantly associated with anxiety and depressive disorder ; although it was slightly greater among females , and peaked in the age group 25- 34 years old . moreover , the prevalence of functional dyspepsia was greater to some extent in cigarette smokers , those who drank alcohol and those who consumed tea and coffee regularly compared with other subjects . the prevalence of functional dyspepsia in our study was less than other studies such as , uk ( 21% ) ( 15 ) , us ( 26% ) ( 13 ) and jordan ( 60% ) ( 16 ) . the rates in our study were very close to the rates of the studies conducted in western iran ( 18% ) ( 17 ) , china ( 18.4% ) ( 18 ) and another study ( 15.7% ) ( 11 ) . these discrepancies could be due to various definitions in different studies ( 19 ) and also the exclusion criteria applied especially in the current research . although functional dyspepsia was more common in females , that association was not statistically significant . this was similar to the findings of another study in which the prevalence of dyspepsia was equally distributed between the genders ( 20 ) ; however , was in contrast to the most previous studies , which showed that dyspepsia was more prevalent among females ( 8 , 18 , 21 ) . although our study showed no significant association between age and functional dyspepsia , the prevalence of the disease was more common in 25 - 34-year age group . similarly , in studies conducted in shiraz ( 6 ) and us ( 22 ) , there was no relationship between age and dyspepsia . on the other hand , one of the studies indicated that the prevalence of dyspepsia was higher in 35 - 50-year age group ( 20 ) , while other studies found the positive and reverse associations between age and functional dyspepsia , respectively ( 21 , 23 ) . psychological disorders , particularly depression and anxiety have been shown to be the major risk factors for functional dyspepsia in one study ( 8) , as indicated in the current study . in addition , another study found that anxiety seemed to be related to abnormal antral retention of food in functional dyspeptic patients . since psychological stresses have been shown to affect gastrointestinal motility , it seems that the emotional factors , such as depression and anxiety , have also a negative effect on gastric motility . however , there is some evidence which suggests that there is an association between psychological abnormalities and impaired gastric motor function in patients with functional dyspepsia ( 24 ) . moreover , in the study ( 11 ) anxiety but not depression found to be a significant risk factor for the functional dyspepsia . some studies have shown that anxiety was negatively associated with pain threshold and discomfort , gastric rendition , and abdominal ardor and discomfort . moreover , the fluctuating cortisol levels , which is one of the most studied physiological responses to acute stress , seems to be related to different symptoms of functional dyspepsia ( 24 , 25 ) . although abdominal obesity in dyspeptic patients was more than that of other participants in our study , applying exclusion criteria for subjects showed no association between obesity and functional dyspepsia similar to the findings of the study conducted in shiraz ( 6 ) . there are different results in the previous studies which show both negative ( 12 ) and positive associations ( 11 ) between obesity and functional dyspepsia . in addition to our findings , the behavioral risk factors such as smoking and the alcohol and coffee consumption had no relationship with functional dyspepsia ( 6 , 7 ) . that was in contrast to the finding which indicated a harmful effect of smoking ( 12 ) . adjusting for potential confounders such as demographic and behavioral risk factors , fruits and vegetables seemed to have no association with functional dyspepsia ( although the crude association was found ) , which was in parallel to the results of a study in southern iran ( 6 ) . abdominal pain or burning was the most common symptoms in the present study , which was similar to the results of another study conducted in iran ( 5 ) . we considered a sufficient sample size and good participation rate in this study ; however , the participants with evidences of other diseases were excluded from the study and thus the association among dyspepsia and risk factors was estimated based on half of our sample size . this study conducted only on urban population and also information about food consumption was based on only frequency of usage without detection of units and calories of dietary regimens . in conclusion , we estimated a prevalence of 16.1% of functional dyspepsia in kerman , southeast of iran , which was lower than that in most other studies and associated only with psychiatric disorders . more precise studies collecting detailed information about food consumption and area of residence could lead to better estimation of the effect of such risk factors .

background : dyspepsia is a common disorder that can present many clinical dilemmas in patient management . although not usually life - threatening , its symptoms such as abdominal pain , heartburn , early satiety and postprandial fullness can have a significant negative impact on patients ' quality of life.objectives:the aim of this study was to determine the prevalence of dyspepsia and its associated factors among the adult population in kerman in 2010.patients and methods : this cross - sectional study was performed on 2210 patients with the mean age of 43.4 years in kerman , a city in southeast of iran . demographic factors , lifestyle data and gastrointestinal symptoms were collected for each patient.results:the prevalence of dyspepsia was 16.1% ( 95% confidence interval : 14.3 - 18.1 ) . the prevalence in patients with abdominal obesity ( 7.3% ) was lower in comparison with those with low physical activity ( 13.8% ) . out of other psycho - behavioral risk factors , anxiety after controlling for other variables increased the risk of functional dyspepsia more than 65 percent ( p = 0 . 004 ) and depressive disorders also increased that risk about 2.13 percent ( p < 0.0001 ) . patients with dyspepsia symptoms were more likely to restrict their diet , take herbal medicine , use over - the - counter drugs and consult with physicians.conclusions:results of this study reveal the moderate prevalence of dyspepsia among the adult population in kerman like in other parts of the country and this prevalence is associated with several demographic factors , lifestyle and health - seeking behaviors .

1. Background 2. Objectives 3. Patients and Methods 4. Results 5. Discussion

we herein report the exceptional case of a patient who died because of very early , disseminated kaposi sarcoma ( ks ) without skin lesions after allogeneic kidney transplantation . the unusual course as well as the absence of cutaneous metastases led to a challenging diagnostic workup of the patient . moreover , ks developed under an immunosuppressive regimen using mechanistic target of rapamycin ( m - tor ) inhibition which is considered to be an effective treatment for ks . ultimately , [ f]2-fluoro-2-deoxy - d - glucose ( fdg ) positron emission tomography / computed tomography ( pet / ct ) allowed diagnosis of disseminated malignancy and might therefore be considered early in the management of patient at risk . a 52-year - old white with end - stage renal failure secondary to rapid progressive glomerulonephritis presented 4 months after first renal transplantation with undulating fever , acute gastroenteritis , axillary abscesses , and a strong reduction of his general state . laboratory results revealed thrombocytopenia ( 108 10/l , reference range 166308 10/l ) , anemia ( hemoglobin 87 g / l ) , acidosis , urinary tract infection with enterococcus faecalis , as well as acute kidney injury . immunosuppressive induction therapy included tacrolimus , everolimus , steroids , and basiliximab whereas maintenance treatment ( athena study protocol ) consisted of tacrolimus ( 35 ng / ml ) , everolimus ( 38 ng / ml ) , and prednisolone 5 mg / day . barr virus ( ebv ) , hepatitis c virus , parvo b19 , and human immunodeficiency virus was negative . the patient s general state improved , he was without fever , and thrombocytes and hemoglobin increased while creatinine decreased . two months after discharge , the patient was hospitalized because of acute gastroenteritis , sepsis , and acute kidney injury again . on physical examination , no suspicious skin lesions or lymph nodes were noted . laboratory analyses showed increased procalcitonin ( 2.9 ng / ml , reference range < 0.5 ng / ml ) , c - reactive protein ( 10.5 mg / dl , reference range < 0.5 mg / dl ) , creatinine ( 2.2 mg / dl , baseline creatinine 1.5 mg / dl ) , and lactate dehydrogenase ( 328 u / l , reference range 135255 u / l ) . g / l ) , thrombocytopenia ( 60 10/l ) , mild lymphocytopenia ( 0.95 10/l , reference range 1.263.35 10/l ) , and monocytosis ( 1.84 10/l , reference range 0.290.95 10/l ) . staphylococcus epidermidis was isolated from multiple blood cultures and from the relapsed axillary abscess ( shown by asterisk in figure 1b ) . moreover , ebv polymerase chain reaction ( pcr ) testing was slightly positive ( 354 iu / ml ) and clostridium difficile was identified in the stool . sonography revealed splenomegaly ( 18 7.6 cm , also seen in ct , shown by asterisk in figure 1a ) and cervical as well as reactive inguinal lymph nodes ( 2.3 cm ) . as the patient complained of progressive intolerance of everolimus , immunosuppressive therapy was modified ( everolimus was stopped and tacrolimus was reduced ) . persisting fever and coughing led to the performance of ct of the thorax excluding everolimus - induced pneumonitis and showing pulmonary emphysema and multiple enlarged but calcified mediastinal and hilar lymph nodes . interestingly , the patient s condition improved , but persisting thrombocytopenia and anemia led us to puncture and biopsy the bone marrow ( iliac crest biopsy ) . toxic or infectious bone marrow suppression as well as folic acid deficiency was suspected . two weeks later , the patient developed fever , massive thrombocytopenia ( 12 10/l ) , and acute kidney failure . further diagnostics included combined pet / ct with fdg . besides of the very intensive uptake measured in nearly all lymph node stations , in particular cervical , axillary , mediastinal , paraaortic , and inguinal , an pathological uptake was documented in the tongue , thyroid , and lung ( figure 1b and c ) ; the uptake pattern was indicative for malignancy ( coronal slice of ct , maximum intensity projection ( mip)pet , and fused coronal slice of fdg pet / ct ) . extirpation of an inguinal lymph node ( shown by asterisk in figure 1b ) revealed fast proliferating ks . slices of fluorodeoxyglucose pet combined with computed tomography ( a : ct ; b : pet ; c : fusion of pet / ct ) . besides a splenomegaly ( yellow asterisk ) a very intensive uptake was measured in nearly all lymph node stations . in particular , pathologic [ f]2-fluoro-2-deoxy - d - glucose accumulation was detected in cervical , axillary , mediastinal , paraaortic , and inguinal lymph nodes ( red asterisks ) as well as in the tongue , thyroid , and lung ( mip pet ) . ct = computed tomography , mip = maximum intensity projection , pet = positron emission tomography . although extremely rare ( incidence below 1% within 15 years after renal transplantation ) , ks has been described to occur early ( mean time to diagnosis : 426 days after renal transplantation ) . ks is a vascular low - grade malignant tumor that is associated with human herpesvirus-8 ( hhv-8 ) infection . interestingly , in our patient , hhv-8 staining of the lymph node was positive , whereas serum pcr was negative ( figure 2b ) . it typically manifests in mucocutaneous sites such as the skin or the oropharyngeal mucosa , in lymph nodes , and in visceral organs , most frequently in the respiratory and gastrointestinal tract . in our patient , typical , for example , lymph nodes , and atypical manifestations , for example , thyroid , were seen ( only 5 cases worldwide ) . in the absence of skin lesions ( only 5% of cases and exceptional in metastatic disease ) , ks often proves to be a challenging diagnosis because of missed recognition on routine imaging studies , unspecific systemic manifestations , for example , anemia , thrombocytopenia , and fever , or infectious complications , for example , abscesses , diarrhea , ebv reactivation , urinary tract infection , or sepsis , especially in the setting of our immunocompromised host . awareness of ks may avoid delayed or potential misdiagnosis with deleterious consequences . in our patient , the combination of hhv-8 and immunosuppression promoted the development of ks . notably , ks occurred under maintenance therapy with an m - tor inhibitor ( everolimus ) . m - tor inhibition is considered to be effective for the treatment of ks because it is antiangiogenetic by reduction of vascular endothelial growth factor secretion and inhibition of formation of tumor vasculature . histological evaluation of an inguinal lymph node ( gross specimen , a ) revealed only residual lymphatic tissue ( low power 10 , b ) and showed a diffuse endothelial neoplasm with scattered lymphocytes and plasma cells . immunohistochemistry for hhv-8 showed intense hhv-8 nuclear positivity and the final diagnosis of ks was established ( 40 , d ) . ks can be clearly visualized as areas of intense fdg uptake on a pet scan ( figure 1b ) . as bone marrow biopsy specimens were unspecific in ks , unexplained cytopenias should lead to further work - up . thus , fdg pet imaging can be advantageous in the management of patients with suspicious malignancy or unclear inflammatory / infectious diseases . pet provides noninvasive whole - body diagnostics considerably assessing the extent of the disease ( useful for both staging and restaging ) , that is , for the detection of further sites involved yet uncovered by conventional diagnostic methods . it might , therefore , be considered early in the management of patient at risk to reveal underlying disease ( for timeline of the diagnostic workup and for key findings , see table 1 ) . herein , combined fdg pet / ct ultimately allowed diagnosis of disseminated malignancy . however , because of the late stage of ks on the time of diagnosis , it was too late for initiation of chemotherapy .

abstractde - novo malignancy is a serious posttransplant complication . while the incidence of kaposi sarcoma ( ks ) is low , the time for its diagnosis is early after renal transplantation . typically , it can be identified because of the classical skin lesion . we herein report an unusual case of rapid progressive ks without skin lesions in a 52-year - old patient leading to death within 8 months after kidney transplantation . this striking case illustrates the usefulness of [ 18f]2-fluoro-2-deoxy - d - glucose positron emission tomography / computed tomography for demonstrating the cause of unexplained deterioration of patient s condition . early identification of ks is critical because early ( modification of ) therapy can substantially improve patient s prognosis .

INTRODUCTION THE CASE DISCUSSION

a.defectiva was originally known as a member of the nutritionally variant streptococci ( nvs ) . the nvs were first described by frenkle and hirsch as new types of viridans streptococci based on certain phenotypic characteristics . two genera have been proposed based on 16s rrna which are : abiotrophia and granulicatella . a.defectiva is part of the normal flora of the oral cavity , the urogenital and the intestinal tracts . this bacterium has been associated with various serious infections including bacteremia , endocarditis , brain abscess , septic arthritis and total knee arthroplasty infections [ 69 ] . in this report , we describe a patient with ie caused by a. defectiva in an attempt to increase awareness about this organism and to highlight the difficulties encountered in the diagnosis and in the treatment . a 35 years old saudi male was diagnosed to have rheumatic heart disease in the year 1991 . in late february 2005 , he was admitted to prince sultan cardiac center through the emergency department as he presented with intermittent fever for six months , left ankle joint pain and swelling for 5 days , significant weight loss and fatigue . the patient had been non - compliant with the monthly penicillin prophylaxis for the last seven years and he repeatedly refused av replacement . physical examination on admission revealed : a pulse rate of 105/minute , temperature of 36.9oc and blood pressure of 133/48 mmhg . he had finger clubbing , left ankle swelling , splenomegaly , displacement of apex beat and a high pitched early diastolic murmur heard maximally over the third and fourth left intercostals spaces . laboratory investigations were as follows : wbc 8 x 109/l , haemoglobin : 8.1 g / dl , platelets : 305x109/l , esr : 73 and crp : 101mg / l . tee revealed highly mobile vegetation ( 2.9 x 0.6 mm ) attached to the ventricular surface of the non - coronary cusp of the rheumatic av with no aortic root abscess . the left ventricle ( lv ) was severely dilated with abnormal systolic function and the lv ejection fraction was 40% . blood cultures were processed in the bactec 9240 blood culture system ( beckton dickinson ) . the organism grew well on chocolate agar but poorly on 5% blood agar after 48 hour incubation . satellitism was found after a single cross - streak of staphylococcus aureus was placed on the blood agar plate . the bacterium was identified as a. defectiva with > 95% confidence by api 20 strep system after 24 hour incubation . antimicrobial susceptibility was determined by the e - test for penicillin and the disc diffusion method on mueller- hinton agar with 5% sheep blood for the other antibiotics . results were interpreted according to the clinical laboratory standard institute ( clsi ) criteria for a - hemolytic streptococci other than streptococcus pneumoniae . the organism was found to be susceptible to penicillin , cefuroxime , ceftriaxone , erythromycin , imipenem , vancomycin , chloramphenicol and rifampicin but resistant to gentamicin . high level resistance to gentamicin was not seen in this isolate ( gentamicin mic was < 500 g / ml ) . vancomycin mic was < 1 g / ml . the patient was initially treated with vancomycin and gentamicin until the blood culture isolate was identified after which vancomycin was replaced by intravenous penicillin g 24 million units per day and gentamicin was continued intravenously at a dose of 1 mg / kg every eight hour . few days later , surgery was performed as the clinical condition of the patient deteriorated and as the repeated echocardiogram showed persistently large vegetations and progressive av desrtuction . at surgery a large vegetation was seen on the ventricular side of the av leaflet , the av annulus was enlarged and the aortic non - coronary cusp was found to be perforated . the damaged av was excised and a carbomedics size 2.7 mm mechanical valve was implanted . the histologic examination demonstrated large vegetations with dense fibrin and platelet aggregates in addition to few leucocytes and bacterial colonies i.e. the infiltrate was suggestive of ie . cultures of the av and follow up blood cultures were all negative . the antibiotics were continued for one month and the patient was discharged home in march 2005 . however , some studies have estimated that this organism is responsible for 5 - 6% of all cases of ie [ 1 , 11 ] . endocarditis caused by a.defectiva carries greater morbidity and mortality than endocarditis caused by other streptococci . it is characterized by the occurrence of certain complications such as congestive heart failure , embolization and an increased rate of surgical interventions [ 13 , 16 ] . these infections usually respond poorly to antibiotics and several studies have reported bacteriologic failure rates of up to 40% with relapse rates of up to 17% despite the treatment with antibiotics that were effective in vitro . multiple factors contribute to the increased virulence of abiotrophia species such as the production of an exopolysaccharide , the long generation time which can have an impact on the in vivo tolerance ; and the persistence as a result of the development of cell - wall deficient bacteria promoted by the treatment with -lactam antibiotics [ 2 , 17 , 18 ] . it grows more slowly than other streptococci , thus cultivation and identification are often difficult [ 1 , 2 ] . molecular techniques were used to improve the detection and facilitate the identification of a.defectiva . the use of 16s rrna genepolymerase chain reaction amplification followed by restriction fragment length polymorphism ( pcr - rflp ) was shown to be a rapid and a more accurate method for the identification of a.defectiva . abiotrophia is less susceptible in- vitro to penicillin than other streptococci and several studies have shown that the prevalence of beta - lactam and macrolide resistance is high . also , resistance to the extended spectrum cephalosporins and the new fluoroquinolones have been reported [ 20 , 21 ] . however , high level of resistance to the aminoglycosides , as encountered with enterococci , has not been reported with a.defectiva . the in - vitro antimicrobial susceptibility testing of abiotrophia has not been standardized yet and the results of in - vitro susceptibility testing do not correlate well with the clinical outcome in patients treated for endocarditis . therefore it is recommended that patients with endocarditis should be treated with a long - term combination therapy e.g. penicillin and gentamicin for 4 - 6 weeks . even with this regimen , the rates of bacteriologic failure and relapse are still high therefore careful follow up of these cases is mandatory [ 14 , 16 ] . the portal of entry in most reported cases of endocarditis is via the oral cavity . the dental extraction in our patient served as a risk factor for the development of ie in the previously damaged av leading to progressive valvular destruction and perforation . the lack of prophylactic antibiotic prior to the procedure had contributed significantly to the disease process . endocarditis caused by a.defectiva has been reported to result in heart failure by destroying heart valves . in our patient , replacement of the av was carried out due to the extensive valvular damage and the large vegetation size with the potential of embolization . he was treated with a combination regimen of penicillin and gentamicin for 4 weeks . a multi - disciplinary approach from cardiology , cardiac surgery , intensive care , microbiology and infectious diseases departments contributed to the favorable outcome .

a 35-year old man with pre - existing rheumatic heart disease and aortic regurgitation ( ar ) presented with intermittent fever , ankle swelling and clinical evidence of endocarditis . transoesophageal echocardiogram ( tee ) revealed vegetations and destruction of the aortic valve ( av ) . blood cultures grew a gram positive coccobacillus which was phenotypically identified as abiotrophia defectvia ( a.defectiva ) . a diagnosis of infective endocarditis ( ie ) due to a.defectiva was made . treatment , with penicillin and gentamicin , was administered for 4 weeks . mechanical valve replacement was required few days after starting the antibiotic therapy . the patient had a favorable outcome on follow up . although a.defectiva is an uncommon cause of endocarditis , early and correct identification of this pathogen is important to improve the outcome and the prognosis of patients with ie due to this organism .

Introduction Case Report Discussion Conclusion

gastric cancer is still one of the most frequent causes of cancer - related deaths . although its incidence has decreased in recent years , it is still high in eastern asia , including china . familial gastric cancer ( fgc ) has a lower incidence in western countries , only 1%3% of patients have been diagnosed as family gastric cancer . reports indicate that in northern china about 7.8% of patients with gastric cancer can be diagnosed as fgc . hereditary diffuse gastric cancer ( hdgc ) is the only familial cancer syndrome which primarily affects the stomach and for which a mutation has been identified . asymptomatic family members have to make a choice about whether to have genetic testing and individuals who test positive for an inherited e - cadherin mutation have to make difficult decisions about whether to option for endoscopic surveillance or prophylactic gastrectomy . however , it should be remembered that mutations of the e - cadherin gene ( cdhi ) only in one - third of familial gastric cancer cases are only relevant for diffuse - type gastric cancer , and the observed mutations were different in western and asian ethic groups . at present , most scholars are focusing on the level of familial gastric cancer gene pathogenesis [ 36 ] , but the reports on analysis of clinical and pathological features and prognosis are rare . this study retrospectively analyzed 51 cases of familial gastric cancer ( fgc ) in patients with clinical and pathological data and prognosis , treated by the department of gastric surgery , union hospital of fujian medical university from january 2004 to december 2006 and compared with the 673 cases of sporadic gastric cancer ( sgc ) within the same period . this is so far the first reported clinical and pathological features and prognosis of patients with familial gastric cancer in southeast china population aimed at improving the diagnosis and treatment of familial gastric cancer . the inclusion criteria for fgc are as follows : ( 1 ) first and ( or ) second degree relatives have two cases or more than two cases in any tissue type of gastric cancer , one confirmed before 50 years ; ( 2 ) first and ( or ) second degree relatives have three or more than three cases of gastric cancer , with no age limited . hereditary nonpolyposis colorectal cancer ( hnpcc ) , family gonadal fibromatosis ( fap ) , li - fraumeni syndrome , cowden syndrome , and peutz - jegher syndrome were excluded . those that do not comply with the above standards of familial gastric cancer are defined as sporadic gastric cancer ( sgc ) . this group has collected the clinical data of the 724 patients with gastric cancer who accepted the radical surgical treatment , cured by the department of gastric surgery , union hospital of fujian medical university from january 2004 to december 2006 , among which there are 51 cases of fgc and 673 cases of sgc , accounting for 7.0% and 93.0% of the total number of patients with gastric cancer during the period , respectively . the comparison of general information of patients in two groups is shown in table 1 . patients were followed up by hand , using the outpatient door visit , letter , and telephone followup . the survival time was the time from diagnosis until the last contact , the date of death , or the date that the survival information was collected . in addition to the patients who died , all surviving patients were followed up for more than five years . the survival rate was calculated according to the kaplan - meier method , and the comparison of the survival rate was tested using the log - rank method . the comparison showed that the proportion of patients with fgc under the age of 50 was significantly higher than the sgc group , but in terms of the tumor site , tumor size , histological type , depth of invasion , lymph node metastasis , the two groups have no statistical difference ( table 1 ) . the postoperative 5-year survival rates in fgc and sgc patients were 40.1% and 51.8% , respectively . the univariate analysis found that the factors that affect fgc prognosis are lymph node metastasis , depth of invasion , tissue type , and tumor size , while the factors that impact the prognosis of the sgc in patients are lymph node metastasis , depth of invasion , histological type , tumor size , and tumor location ( p < 0.05 , table 2 ) . cox proportional hazards model analysis showed that lymph node metastasis and depth of invasion are the independent factors to affect the prognosis of fgc patients ; lymph node metastasis , depth of invasion , and tumor size are the independent factors affecting sgc prognosis ( p < 0.05 , table 3 ) . depth of invasion stratified analysis found that the postoperative 5-year survival rates of fgc and sgc patients in stages t1 , t2 , and t3 and were 100% and 94.9% , 80.0% and 66.1% , and 50.0% and 45.5% , respectively , and the differences were not statistically significant ( p > 0.05 , figures 2(a)2(c ) ) . the postoperative 5-year survival rates of fgc and sgc patients in stages t4a , t4b 21.2% and 38.6% , and 9.1% and 22.3% , and the differences were statistically significant ( p < 0.05 , figures 2(d ) and 2(e ) ) . stratified analysis of lymph node metastasis showed that the post - operative 5-year survival rates of fgc and sgc patients in stages n0 , n1 , and n2 were 92.3% and 83.0% , 80.0% and 58.4% , and 33.3% and 45.1% , respectively , and the differences were not statistically significance ( p > 0.05 , figures 3(a)3(c ) ) . the postoperative 5-year survival rates of fgc and sgc patients in stage n3 were 7.7% and 21.3% , respectively , and the difference was statistically significant ( p < 0.05 , figure 3(d ) ) . the characteristics of the sick people include the apparently younger ages and familial aggregation [ 7 , 8 ] . according to the lauren pathological type , fgc defined in this study can be divided into two categories : hereditary diffuse gastric cancer ( hdgc ) and familial intestinal gastric cancer ( figc ) . in 1998 , guilford and his colleagues first discovered that the hdgc is connected with the e - cadherin gene ( cdh1 ) mutations , which opened the prelude of the the fgc genetics research . so far , although there were a large number of studies indicating that the occurrence of hdgc is closely related to cdh1 gene [ 3 , 4 ] , still the pathogenesis remains unclear . the research made by yamada et al . revealed that cdh1 gene mutation rate in japanese fgc patients was 15.4% and that the incidence of fgc was connected with the environmental factors , such as smoking , helicobacter pylori infection , high - salt diet , or other genes ( e.g. , p53 , the met , stk11 ) mutations . it has been reported that fgc usually has a unique biological behavior [ 13 , 14 ] : early onset , poor tumor differentiation , and the trend of parenteral tumors and multiple primary cancers . as for the distribution of tumor location , charlton et al . reported that hereditary diffuse gastric lesions are mainly in distal gastric cancer and rogers et al . reported that early lesions are often multifocal , reviewed 81 cases of fgc patients and indicated that the age of onset , depth of invasion , lymph node metastasis , pathological stage , and other aspects in fgc and sgc patients were not statistically different . our data showed that , compared with the sgc , the fgc patients have earlier age of onset , but the tumor site , tumor size , histological type , depth of invasion , and lymph node metastasis were not statistically different . despite the detailed description of the pathogenesis of the fgc gene level by many scholars and the gradual discovery of its clinical and pathological features , its low incidence makes the postoperative long - term efficacy still poorly recognized . in recent years , some scholars believe that prophylactic total gastrectomy on patients whose families have a gastric cancer history and who are detected cdh1 gene mutation can help to improve their prognosis [ 18 , 19 ] . study revealed that the postoperative 5-year survival rates of fgc and sgc patients who underwent radical surgery were 48% and 57% , and the difference was statistically significant ( p < 0.05 ) ; p53-positive and ajcc staging are the independent factors impacting fgc prognosis . in our study , 5-year survival rate in patients with fgc was obviously worse than that in sgc patients ( p < 0.05 ) . further prognosis stratification analysis of the depth of invasion and lymph node metastasis indicated that the fgc patients in stages t13 or n02 who underwent radical surgery can achieve similar prognosis to sgc . therefore , we believe that early diagnosis and treatment of fgc is critical ; timely and radical surgery can improve the prognosis of patients . in addition , we also found that the fgc and sgc prognostic factors are not consistent , and fgc may be a special type of gastric cancer . in summary , this study showed that fgc has early onset ; the lymph node metastasis and depth of invasion are the independent prognostic factors . fgc patients in stage t13 or n02 who underwent radical surgery can achieve similar prognosis to sgc ; however , patients in stages t4 or n3 have poorer prognosis . we believe that , the key to improve the prognosis of fgc patients is early diagnosis and treatment . besides , a further analysis with a larger sample is extremely essential to verify the findings in our study .

gastric cancer is the second most common cause of cancer death worldwide . it is estimated that 510% of gastric cancer cases have a familial association ; however , knowledge concerning the clinical , pathological features and prognosis to familial gastric cancer is currently limited . to our best knowledge , this is the largest number of single center patients reported in southern china . our research can help these rare families to obtain optimal treatment in the future . our work is supported by union hospital of fujian medical university .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

the study protocol was approved by the university of virginia human investigation committee . a total of eight lean ( three men and five women ; bmi < 25 kg / m ) and eight obese ( one man and seven women ; bmi > 30 kg / m ) volunteers with no history of hypertension , diabetes , or hyperlipidemia were recruited and fasted overnight . subjects were excluded from the study if they had a family history of a first - degree relative with diagnosed diabetes , had a history of smoking , or were taking any medication known to affect either endothelial function or glucose metabolism . subjects were admitted to the general clinical research center on two separate occasions . on a screening visit serum clinical chemistry values were measured by the university of virginia clinical chemistry laboratories , and body composition was measured using an air displacement chamber ( bod pod ) ; height , weight , and hip and waist circumferences were also measured . on the day of the study visit , overnight - fasted subjects were admitted to the general clinical research center on the morning of the study . subjects remained in bed 1 h before and for the duration of the study and were instructed to refrain from using their arms to minimize effects of movement ( or exercise ) on hemodynamic measurements . the catheter in the nondominant arm was used for blood sampling of glucose and insulin , and the contralateral arm was used for the infusion of microbubbles . baseline measurements of total forearm blood flow ( assessed by doppler ultrasound ) and muscle microvascular blood volume ( mbv ) and microvascular flow velocity ( mfv ) ( assessed by ceu ) were performed as described previously ( 4,19 ) . subjects were then given a liquid meal ( boost ; 480 kcal : 72 from fat , 328 from carbohydrate , and 80 from protein ) . a mixed meal was chosen to assess the physiological changes that occur in response to a typical meal . a liquid meal was administered to shorten the amount of time needed for digestion and absorption . plasma glucose and insulin were measured at 0 , 30 , 60 , 90 , and 120 min . plasma glucose was measured using a ysi analyzer ( ysi , yellow springs , oh ) . plasma insulin was measured using an enzyme - linked immunosorbent assay with an interassay coefficient of variation of < 4% . at 60 and again at 120 min after the mixed meal , brachial artery flow ( doppler ultrasound ) and mbv and mfv ( ceu ) were measured . for the two - dimensional and doppler ultrasound measurements , an ultrasound system ( hdi 5000 ; philips medical systems , bothell , wa ) with a linear - array transducer was used with a transmit frequency of 12 mhz . two - dimensional imaging of the brachial artery was performed in the long axis 5 cm proximal to the antecubital fold . images were triggered to the r wave of the cardiac cycle , and the brachial artery diameter was measured using on - line video calipers . a pulsed - wave doppler sample blood volume was placed at the same location in the center of the artery and the mean blood velocity was measured using online angle correction and analysis software . brachial artery mean blood flow was calculated from two - dimensional and doppler ultrasound data using the equation : q = v ( d/2 ) , where q is brachial blood flow , v is mean brachial artery blood flow velocity , and d is brachial artery diameter . imaging of the forearm was performed in a transaxial plane 5 cm distal to be antecubital fossa , using power doppler imaging . a suspension of microbubbles ( definity ; bristol - myers squibb ) was infused intravenously at a rate of 3.0 ml / min for 10 min . once the systemic microbubble concentration reached steady state ( > 2 min ) , intermittent imaging was then performed at pulsing intervals ranging from 0.5 to 25 s , thus allowing progressively greater replenishment of microbubbles in the ultrasound beam elevation . several background frames at 0.5 s were averaged and digitally subtracted from similarly averaged frames at each pulsing interval . background - subtracted video intensity at each pulsing interval was measured from a region of interest placed around the deep forearm flexor muscles . pulsing interval versus video intensity data were fitted to the function y = a ( 1 e ) , where y is video intensity at pulsing interval t , a is plateau video intensity ( mbv , an index of microvascular recruitment ) , and is the rate constant that provides a measure of mfv ( the rate of microvascular filling ) ( 20 ) . data are presented as the means sem , and statistical analysis was performed using sigmastat ( systat software , 2004 ) . time - series measurements in each group were performed by two - way repeated - measures anova . when data were not normally distributed , repeated - measures anova on ranks was performed . when a significant difference of p < 0.05 was found , pairwise comparisons by a student - newman - keuls test was used to assess treatment differences . subjects remained in bed 1 h before and for the duration of the study and were instructed to refrain from using their arms to minimize effects of movement ( or exercise ) on hemodynamic measurements . the catheter in the nondominant arm was used for blood sampling of glucose and insulin , and the contralateral arm was used for the infusion of microbubbles . baseline measurements of total forearm blood flow ( assessed by doppler ultrasound ) and muscle microvascular blood volume ( mbv ) and microvascular flow velocity ( mfv ) ( assessed by ceu ) were performed as described previously ( 4,19 ) . subjects were then given a liquid meal ( boost ; 480 kcal : 72 from fat , 328 from carbohydrate , and 80 from protein ) . a mixed meal was chosen to assess the physiological changes that occur in response to a typical meal . a liquid meal was administered to shorten the amount of time needed for digestion and absorption . plasma glucose and insulin were measured at 0 , 30 , 60 , 90 , and 120 min . plasma glucose was measured using a ysi analyzer ( ysi , yellow springs , oh ) . plasma insulin was measured using an enzyme - linked immunosorbent assay with an interassay coefficient of variation of < 4% . at 60 and again at 120 min after the mixed meal , brachial artery flow ( doppler ultrasound ) and mbv and mfv ( ceu ) were measured . for the two - dimensional and doppler ultrasound measurements , an ultrasound system ( hdi 5000 ; philips medical systems , bothell , wa ) with a linear - array transducer was used with a transmit frequency of 12 mhz . two - dimensional imaging of the brachial artery was performed in the long axis 5 cm proximal to the antecubital fold . images were triggered to the r wave of the cardiac cycle , and the brachial artery diameter was measured using on - line video calipers . a pulsed - wave doppler sample blood volume was placed at the same location in the center of the artery and the mean blood velocity was measured using online angle correction and analysis software . brachial artery mean blood flow was calculated from two - dimensional and doppler ultrasound data using the equation : q = v ( d/2 ) , where q is brachial blood flow , v is mean brachial artery blood flow velocity , and d is brachial artery diameter . imaging of the forearm was performed in a transaxial plane 5 cm distal to be antecubital fossa , using power doppler imaging . a suspension of microbubbles ( definity ; bristol - myers squibb ) was infused intravenously at a rate of 3.0 ml / min for 10 min . once the systemic microbubble concentration reached steady state ( > 2 min ) , intermittent imaging was then performed at pulsing intervals ranging from 0.5 to 25 s , thus allowing progressively greater replenishment of microbubbles in the ultrasound beam elevation . several background frames at 0.5 s were averaged and digitally subtracted from similarly averaged frames at each pulsing interval . background - subtracted video intensity at each pulsing interval was measured from a region of interest placed around the deep forearm flexor muscles . pulsing interval versus video intensity data were fitted to the function y = a ( 1 e ) , where y is video intensity at pulsing interval t , a is plateau video intensity ( mbv , an index of microvascular recruitment ) , and is the rate constant that provides a measure of mfv ( the rate of microvascular filling ) ( 20 ) . data are presented as the means sem , and statistical analysis was performed using sigmastat ( systat software , 2004 ) . time - series measurements in each group were performed by two - way repeated - measures anova . when data were not normally distributed , repeated - measures anova on ranks was performed . when a significant difference of p < 0.05 was found , pairwise comparisons by a student - newman - keuls test was used to assess treatment differences . the lean subjects had significantly lower body weight , fat weight , bmi , percent body fat , waist and hip circumferences , and fasting triglycerides compared with the obese subjects . plasma glucose , total cholesterol , and ldl cholesterol did not differ between the two groups . the obese group had higher fasting plasma insulin levels ( p < 0.001 ) and lower insulin sensitivity in the fasting state ( estimated using the quantitative insulin sensitivity check index , a surrogate index of insulin sensitivity ) . although the lean group tended to be more active , there were no significant changes in estimated energy expenditure per day or in total physical activity hours per week ( table 1 ) . figure 1 shows the time course of plasma glucose and insulin levels after the ingestion of the mixed meal . by 30 min after the meal , plasma glucose levels were elevated above baseline for both lean and obese groups ( fig . 1a ) . over the course of the next 90 min , plasma glucose levels declined toward baseline . there were no significant differences in the time course of changes in plasma glucose between the two groups . plasma insulin levels rose significantly by 30 min in the lean group and remained elevated for the additional 90 min of the study ( fig . the obese group had a significantly higher baseline ( fasting ) plasma insulin level ( p < 0.001 ) and a greater postmeal area under the insulin - time curve than the lean group ( p < 0.05 , data not shown ) . time courses of plasma glucose and insulin concentrations after the ingestion of a mixed meal in lean ( , n = 8) and obese ( , n = 8) volunteers . measurements were made every 30 min for 2 h. data are means sem . * p < 0.05 vs. 0 min ; p < 0.05 vs. lean ; two - way repeated - measures anova and post hoc student - newman - keuls test . 2 . baseline brachial artery diameters in the lean and obese groups were not significantly different from each other ( fig . after the meal , the brachial artery in the lean group dilated significantly ( p < 0.05 ) by 60 min and remained dilated at 120 min . in the obese group , the brachial artery diameter did not change from baseline and was significantly smaller than that for the lean group at 60 min ( p < 0.05 ) and was almost significant at 120 min ( p = 0.055 ) after the meal ( fig . brachial artery flow velocity was markedly elevated above baseline ( p < 0.05 ) in the lean group by 120 min after the meal ( fig . brachial artery blood flow increased by 120 min after the meal in the lean group ( p < 0.05 ) but not in the obese group ( ns ) ( fig . time courses of brachial artery diameter , brachial artery flow velocity , and total brachial artery blood flow measured by doppler ultrasound after the ingestion of a mixed meal in lean ( , n = 8) and obese ( , n = 8) volunteers . data are means sem . * p < 0.05 vs. 0 min ; p < 0.05 vs. lean ; # p = 0.055 vs. lean ; two - way repeated - measures anova and post hoc student - newman - keuls test . figure 3 shows the effect of the mixed meal on forearm microvascular responses . despite hyperglycemia , muscle mbv rose significantly by 120 min in the lean group indicating muscle microvascular recruitment ( fig . in contrast , mbv was unchanged in the obese group ( ns ) ( fig . when the data from the female subjects were compared , we found that the lean group still showed a significant ( p = 0.02 ) increase in mbv , which was absent in the obese group ( p = 0.45 ) . this finding suggests that it was obesity and not sex that was the distinguishing feature . the mbv increase in the lean group was accompanied by a trend for mfv to decline by 120 min ( p = 0.065 ) when compared with baseline ( fig . mfv did not change in the obese group in response to the meal challenge ( fig . the product of mbv and mfv ( muscle microvascular perfusion ) did not significantly change in response to the mixed meal in either group ( fig . time course of forearm mbv , mfv , and mbv mfv measured by contrast - enhanced ultrasound after the ingestion of a mixed meal in lean ( , n = 8) and obese ( , n = 8) volunteers . * p < 0.05 vs. 0 min ; # p = 0.065 vs. 0 min ; repeated - measures anova on ranks and post hoc student - newman - keuls test . the present study demonstrated that the ingestion of a mixed meal significantly increased total muscle blood flow and mbv of lean , middle - aged volunteers and that both of these vascular responses are blunted by obesity . the meal - induced increase in mbv in the lean volunteers reported here is similar to that reported previously in young , lean adults ( 19 ) . in that study , mbv increased even earlier ( 60 min ) than reported in the current study ( 120 min ) . the somewhat slower response noted here may represent an age - related phenomenon ; however , this has not been tested directly . the most striking finding of the current study is the absence of any increase in mbv in the obese individuals . we have noted previously that obesity appears to prevent microvascular recruitment in response to euglycemic hyperinsulinemia ( 4 ) . in that study , plasma insulin levels were increased to high physiological levels , and total forearm blood flow did not change in either lean or obese subjects ( 4 ) . in the current study , the ingestion of a mixed meal increased total limb blood flow in lean but not in obese subjects . the increase in blood flow noted in the lean subjects serves to emphasize the difference in stimulus of a mixed meal relative to infusion of insulin alone under physiological euglycemic conditions . scognamiglio et al . ( 22 ) demonstrated that the ingestion of a mixed meal increased myocardial microvascular perfusion in healthy control subjects . however , myocardial microvascular perfusion actually diminished in the patients with type 2 diabetes . in the current study , we also found an increase in microvascular perfusion in skeletal muscle in response to a mixed meal in lean subjects , and this effect was blunted in the obese subjects . we did not observe a net decline in microvascular perfusion as reported by scognamiglio et al . the lack of microvascular response in the obese subjects in response to the meal may simply reflect resistance to the vascular action of insulin as was indicated by the insulin clamp studies in obese subjects ( 4 ) . however , we can not discount the possibility that obesity altered microvascular responses to other hormonal , nutritional , cardiac , and neural factors that change in the postprandial state . the lack of a significant change in mbv in the obese group is unlikely because of increased muscle adiposity quenching the microbubble signal . richards , and s. rattigan , unpublished observations ) that high fat fed , insulin - resistant rats with increased tissue adiposity have a microbubble dose - response curve similar to that in healthy lean rats . thus , the effects seen herein are due to changes in microvascular perfusion and not to changes in signal characteristics of the microbubble in vivo . expanding mbv enhances the surface area of the vascular endothelium , which affords nutrients and hormones , such as insulin , increased access for exchange with the muscle interstitium . for insulin , this entry into the muscle interstitium appears to be rate limiting for overall insulin action within skeletal muscle ( 23,24 ) . in this manner insulin , which signals to the body that feeding has occurred , may exert a feed - forward signal to enhance muscle blood flow and thereby increase both its own access to the myocyte as well as that of other nutrients such as glucose and amino acids within the meal . in the current study it remains possible that the failure of insulin to exert a vascular action within the skeletal muscle of obese subjects contributed to their if these increases in insulin and glucose levels occur chronically , they have the potential to increase hepatic vldl production and raise plasma triglyceride concentrations ( 25 ) , as occurs in insulin - resistant obese subjects ( table 1 ) . a curious aspect of the current study was the observed increase in forearm blood flow in the lean subjects when muscle microvascular blood flow ( mbv mfv ) was not altered . first , total forearm blood flow is measured 510 min before the measurement of microvascular flow ( these measurements can not be done simultaneously because of interference of microbubbles with doppler recording ) . second , the microvascular blood flow measurements are an integrated value of flow occurring over 5 min of data acquisition , whereas doppler flow measurements are made more acutely over the course of 1030 heartbeats . third , forearm blood flow includes flow to subcutaneous adipose tissue , muscle , bone , and the hand , whereas the microvascular flow assessment is restricted to blood flow within muscle . a fourth possibility is that microvascular blood flow within muscle is distributed between nutritive and non - nutritive flow routes , with insulin increasing nutritive flow ( 3 ) . in summary , the findings reported here suggest a physiological role for microvascular recruitment provoked by meal ingestion in the process of delivery of nutrients and hormones to skeletal muscle . failure of this microvascular recruitment , particularly in obese individuals , may be one factor that contributes to postprandial hyperinsulinemia associated with insulin resistance / metabolic syndrome .

objectiveingestion of a mixed meal recruits flow to muscle capillaries and increases total forearm blood flow in healthy young lean people . we examined whether these vascular responses are blunted by obesity.research design and methodswe fed eight middle - aged lean and eight obese overnight - fasted volunteers a liquid mixed meal ( 480 kcal ) . plasma glucose and insulin were measured every 30 min , and brachial artery flow and muscle microvascular recruitment ( contrast ultrasound ) were assessed every 60 min over 2 h after the meal.resultsby 30 min , plasma glucose rose in both the lean ( 5.1 0.1 vs. 6.7 0.4 mmol / l , p < 0.05 ) and the obese groups ( 5.4 0.2 vs. 6.7 0.4 mmol / l , p < 0.05 ) . plasma insulin rose ( 28 4 vs. 241 30 pmol / l , p < 0.05 ) by 30 min in the lean group and remained elevated for 2 h. the obese group had higher fasting plasma insulin levels ( 65 8 pmol / l , p < 0.001 ) and a greater postmeal area under the insulin - time curve ( p < 0.05 ) . brachial artery flow was increased at 120 min after the meal in the lean group ( 38 6 vs. 83 16 ml / min , p < 0.05 ) but not in the obese group . muscle microvascular blood volume rose by 120 min in the lean group ( 14.4 2.2 vs. 24.4 4.2 units , p < 0.05 ) but not in the obese group.conclusionsa mixed meal recruits muscle microvasculature in lean subjects , and this effect is blunted by obesity . this impaired vascular recruitment lessens the endothelial surface available and may thereby impair postprandial glucose disposal .

RESEARCH DESIGN AND METHODS Study visit Doppler ultrasound CEU Statistics RESULTS CONCLUSIONS

the effects of exogenous administration of neurotrophic molecules on neurorestoration of lesioned central nervous system have been largely evaluated . pigment epithelium derived factor ( pedf ) has emerged as a potential candidate to promote behavioral gain and neurorestorative events in the spinal cord injury because pedf receptor is concentrated in ventral motor region of the spinal cord and the molecule is highly expressed and it is able to trigger trophic actions to motor neurons [ 1 , 2 ] . the potential capacity of pedf to promote motor restoration may involve its ability to modulate neurotrophic / neuroplasticity events and its capacity to interfere with endothelial and glial reactions to injury , cells that are also important actors in the scenario of neurorestoration [ 25 ] . despite the great effort to understand the inhibitory nature of neuronal environment to regenerating fibers , recent results have pointed out neuronal plasticity in the lesioned spinal cord as the major event leading functional recovery in that pathological condition [ 610 ] . in fact , studies have identified and characterized molecular signals related to axonal growth and functional target innervation in the lesioned spinal cord . much of the functional restoration observed in the experimental models of spinal cord lesion has been triggered however by the neuroplasticity - related molecules that are expressed by rescued neurons nearby injury , especially in the regions of the central pattern generators ( cpg ) [ 1114 ] . furthermore , the apoptotic and neurotrophic responses in neurons that are not enrolled by primary lesion as well as the paracrine glial mechanisms may modify the functional outcome [ 1517 ] . those events occurred in several rostral / caudal spinal levels in the subsequent periods after lesion [ 18 , 19 ] . molecular signaling plays a central role in the cell communication - mediated neuroplasticity in the lesioned nervous system , especially those that are involved in neuroprotection , neovascularization , glial activation , and extracellular matrix regulating neuronal fiber growth . in that context , neurotrophin 3 ( nt-3 ) , glial derived neurotrophic factor ( gdnf ) , brain derived neurotrophic factor ( bdnf ) , fibroblast growth factor 2 ( fgf-2 ) , and pedf have been described as proteins that are able to exert autocrine / paracrine trophic actions to spinal cord neurons and also able to modulate wound repair events that are triggered by nonneuronal cells [ 5 , 16 , 20 ] . furthermore , the ephrin system may also play important action on neurorestoration , remarkably in the lesioned spinal cord , due to its actions on multiple cellular regenerative events . for instance , ephrins could modulate axonal guidance [ 2123 ] , target reinnervation , synaptic plasticity [ 2426 ] , neurotrophic factor signaling - induced neuroprotection / neuroplasticity , and endothelial / glial reaction - induced wound repair [ 2729 ] . the large range of actions of ephrin system is favored by the spread distribution of the receptor tyrosine kinase eph and its membrane - bound ligand ephrin in astrocytes , endothelial cells as well as in presynaptic and postsynaptic neurons [ 3032 ] . remarkably , the above mentioned intercellular signaling events that mediate the outcome of a spinal cord injury are modulated by molecules of the extracellular matrix specially the members of the chondroitin sulfate proteoglycan ( cspg ) family . two molecules , which were revealed by immunoblot analysis after chondroitinase treatment , are in the context of neuroregeneration . the 70 kda chondroitin sulfate / dermatan sulfate hybrid chain and also the 150 kda neurocan - derived c - terminal product , a proteolytic and biological activity fraction of the full - length neurocan [ 34 , 35 ] , seem to play a role in neurotrophic factor binding and neuronal fiber growth . among the vast , complex , and imbricate cellular and molecular events driving neurorestorative functional outcome , the local ischemia is a pathological condition that appears not only as a consequence of lesion reaction to a spinal cord injury but also as a disorder that is able to interfere with local wound repair and neurotrophic / neuroplasticity mechanisms [ 36 , 37 ] . the effects of a pedf injection in the epicenter of an ischemic lesion applied in a low thoracic level of the rat spinal cord were investigated behaviorally and also at cellular and molecular levels . regulations of molecules related to neuroplasticity , neurotrophism , and neovascularization and also those of the growth cone inhibitor chondroitin sulfate proteoglycans ( cspg ) family and ephrin system were analyzed in the lumbar spinal cord cpg . specific pathogen - free adult male wistar rats from the university of so paulo school of medicine ( n = 42 , weighting 350400 g ) were used in the present study . rats were kept under controlled temperature and humidity conditions with a standardized light / dark cycle ( light on at 7 : 00 a.m. and off at 7 : 00 p.m. ) with free access to food pellet and tap water . the study was conducted according to protocols approved by the animal care and use ethic committee at the university of so paulo and in accordance with the guide for the care and use of laboratory animals adopted by the national institutes of health . rats were anesthetized intraperitoneally with a mixture of ketamine chlorhydrate ( 62.5 mg / kg ) and xylazine chlorhydrate ( 10 mg / kg ) . . rose bengal dye ( aldrich chemical , 40 mg / kg , diluted in 0.9% nacl in a final concentration of 20 mg / ml ) was administered slowly in the rat dorsal vein ( n = 30 ) . the rat back was shaved and disinfected with an iodopovidone solution . immediately after dye injection , a midline longitudinal incision was made over the thoracic 8- to the lumbar l1 ( t8-l1 ) vertebrae ; the skin was retracted and paravertebral muscles were dissected . the spinal process and the vertebral lamina of thoracic 12 ( t12 ) spinal cord level were removed with a complete exhibition of circular regional dura mater ( laminectomy ) . a 5 mm diameter - fiber - optic linked to a xenon lamp device ( schott kl 1500 , mainz , germany ) , which produces a 560 nm wavelength irradiation , was placed on the surface of the dura - exposed spinal cord ( thoracic level ) illuminating it for 20 minutes . the fiber - optic was attached to a stereotaxic device ( kopf , usa ) , attempting to maintain a 2 mm distance between the fiber - optic and the dorsal spinal cord to be lesioned . the procedure induced an excitation of the systemically injected dye , triggering a local thrombosis and ischemia [ 38 , 39 ] . sham operated rats ( n = 12 ) were submitted to microsurgical procedures and light exposure , without receiving the dye intravenous injection . immediately after spinal cord ischemia or sham surgery , the animals received a stereotaxical injection of the neurotrophic factor pedf ( 10 l , 100 ng / ml ; hs300210 , kindly supplied by dr . joyce tombran - tink , university of missouri - kansas city ) or solvent ( 10 l , phosphate buffered saline , ph 7.4 ) at the epicenter of the lesion . the spinal injections were made with 100 m outer diameter glass needles , which were obtained by means of a pipette puller ( kopf ) . the needle was connected to a hamilton syringe ( 50 l ) and to a stereotaxical apparatus adapted with a spinal cord unit ( kopf ) in order to promote the mechanical injection , which lasted 35 minutes . were submitted to a sham surgery and a local injection of solvent ( n = 12 ) . in the saline group rats received an ischemic lesion and a local injection of solvent ( n = 14 ) . in the pedf group rats received an ischemic lesion and a local injection of pedf ( n = 16 ) . at the end of the procedure the animals received preventive antibiotic therapy ( ceftriaxone , 40 mg / kg , i m . daily ) for 15 days and also accompanied for bladder evacuation using the crede method until bladder functional recovery . animals submitted to photothrombotic spinal cord injury or sham operation were evaluated behaviorally using the inclined plane test 24 , 48 , and 72 hours after surgery and then weekly until the end of week 6 . animals were placed head down on an adjustable inclined plane covered by a rubber mat . the angle of the plane was increased from 0 to the point where the rat could not maintain its position for 5 seconds . normal uninjured rats remained on the plane to an angle of 50 to 60 inclination . the inclined plane test was chosen because the performance on the inclined plane correlates with the integrity of the rubrospinal tract and other nonpyramidal pathways that could be compromised at week 6 after ischemic injury . the test can be also used as an index of animal strength and it has been shown to be a sensitive and reliable test for clip compression injury . half of the animals in each group ( n = 68 ) were processed for immunohistochemistry six weeks after spinal cord injury . the rats were anesthetized with sodium pentobarbital and euthanized by a transcardiac perfusion with 100 ml isotonic saline at room temperature , followed by 500 ml of fixation fluid ( 4c ) over a period of 6 minutes [ 20 , 43 , 44 ] . the fixative consisted of 4% paraformaldehyde ( w / v , merck , darmstadt , germany ) in 0.1 m phosphate buffer , ph 6.9 . the spinal cords were removed , kept in the fixative solution at 4c for 90 minutes , and then rinsed in 10% sucrose ( merck ) dissolved in 0.1 m phosphate - buffered saline ( pbs ) , ph 7.4 , for 48 hours . the spinal cords were cut into pieces of 0.8 cm long at the lumbar intumescence level . the segments were then frozen in dry ice - cooled ( 40c ) isopentane ( sigma , milwaukee , wi ) and stored at a 70c freezer until use . adjacent serial 14 m thick frozen sections were obtained with a cryostat ( leica , cm3000 , germany ) from the spinal cord lumbar segment ( l2l5 ) , containing the cpg region . series in a cranial - caudal order including every 100th sections were used for tissue labeling . thus , three sampling sections / animal were submitted to each immunolabeling procedure ( see below ) . immunoreactivity was detected by the avidin - biotin peroxidase technique [ 46 , 47 ] . sections were washed for 2 10 minutes in pbs and incubated with 5% normal goat serum for 30 minutes at room temperature . the series of sections were then incubated for 48 hours at 4c with the mouse monoclonal microtubule associated protein-2 antibody ( map-2 , diluted 1 : 2,500 , sigma ) . the antibody was diluted in pbs containing 0.5% triton x-100 ( sigma ) and 1% bovine serum albumin ( sigma ) . the sections were washed again in pbs ( 2 10 minutes ) and incubated with biotinylated horse anti - mouse immunoglobulins ( vector , burlingame , ca , usa ; diluted 1 : 250 ) for 2 hours . after rinsing in pbs , sections were incubated with an avidin - biotin peroxidase complex ( both diluted 1 : 125 , vectastain , vector , usa ) for 45 minutes . immunoreactivity was visualized using 3 - 3-diaminobenzidine tetrahydrochloride ( sigma ) as a chromogen and h2o2 ( 0.05% , v / v , sigma ) for 8 minutes . to standardize the immunohistochemical procedure , we used a dilution of the primary antibody , a dab concentration , and an incubation time , all adjusted so that the darkest elements in the spinal cord sections were below saturation . to further analyze the specificity of the immunostainings , sections were incubated with the solvent of the primary and secondary antibodies or with the solvent of the avidin - biotin solution and processed at the same time with the experimental sections . the sections submitted for measurements were selected from those three of sampling regime described above that represented better the cranial ( l2-l3 ) and caudal ( l4-l5 ) regions of the lumbar rat spinal cord . the means of the data of the two regions were presented because there is no description of functional differences between two regions of the cpg . the map-2 immunoreactivity was measured in two spinal cord sections per rat by means of semiquantitative morphometric image analysis . the measurements were done in the ventral horn of lumbar intumescence ( caudal to the injury site ) , where the lumbar cpg is located and the spinal cord showed a preserved morphology . the image analysis procedures , implemented on a kontron - zeiss ks400 image analyzer ( germany ) , have been described previously [ 19 , 43 , 46 , 4850 ] . briefly , a television camera from the microscope ( 40 objective ) acquired the image . the mean gray value ( mgv ) and s.e.m . of gray matter in areas of the spinal cord devoid of specific labeling ( background , bg ) were measured . gray values darker than bgmgv , 3 s.e.m . were considered as belonging to specific labeling and thus discriminated . the specific ( sp ) mgv was subsequently defined as the difference between the bgmgv value and the mgv of discriminated profiles . the procedure was repeated for each section to correct every measurement of specific labeling for its background value . the morphometric and microdensitometric ( spmgv ) measurements indicate the amount of immunoreactive cell profiles and the intensity of immunolabeling in the sampled fields , respectively . the map-2 immunoreactive dendritic and cell body profiles were quantified individually by means of a stereological method . the point intercepts stereological tool was employed to obtain the areal fraction in the sampled region of the ventral horn of the spinal cord rats , bilaterally , as described elsewhere [ 20 , 43 , 44 ] . a point - grid with an area per point of 400 m was used to estimate the area of the counted profiles . the aa was calculated [ 20 , 43 , 44 ] ( aa = pstructure/psection ) . a 40x oil - immersion objective was used to acquire the images that were used to quantify the profiles in the gray matter sampled fields . all map-2 immunoreactive processes that emerged from the cell perikarya ( first level processes ) were not considered in the discrimination procedures so that axons and axon hillock were not included in the measurements . the sections were initially washed for 3 10 minutes in pbs and then were incubated for 48 hours at 4c with a mixture of one of the antibodies to receptor eph or ephrin subtypes ( the descriptions of the antibodies and the employed dilutions are shown in table 1 ) and one of the following antibodies to neuronal and astroglial markers : mouse monoclonal neurofilament-200 antibody ( nf-200 , diluted 1 : 200 , sigma ) , rabbit polyclonal glial fibrillary acidic protein antibody ( gfap , diluted 1 : 200 , sigma ) , or goat polyclonal gfap antibody ( diluted 1 : 50 , dako ) . the antibodies were diluted in pbs containing 0.5% triton x-100 ( sigma ) and 1% bovine serum albumin ( sigma ) . after the incubation of the primary antibodies , sections received two washes of 10 minutes in pbs and were incubated for 2 hours in the dark at 37c with a mixture of fluorescein isothiocyanate ( fitc ) and texas red ( both diluted 1 : 40 , jackson , west grove , usa ) . the sections were rinsed in pbs and were examined in an ax70 olympus epifluorescence photomicroscope . the other half of the animals ( n = 68 ) were euthanatized by decapitation and processed to western blot and real - time polymerase chain reaction ( rt - pcr ) techniques . the spinal cords were rapidly removed and a 0.8 cm fragment was cut from the lumbar intumescence as described previously . the ventral part ( motor area ) was carefully separated from the dorsal part ( sensory area ) in each fragment . the caudal portion was then submitted to western blot technique and the cranial one to the rt - pcr procedures . the material of rt - pcr was frozen in dry ice and stored at 70c freezer until processing . the samples were homogenized in lyses buffer containing 1% np40 ( sigma ) , 0.5% sodium deoxycholate ( sigma ) , 1% sodium dodecyl sulfate ( biorad ) , 1 mm ethylenediaminetetraacetic acid ( sigma ) , 1 mm ethylene glycol tetraacetic acid ( sigma ) , and 1% protease inhibitor cocktail ( sigma ) , diluted in phosphate buffered ( ph 7.4 ) . after centrifugation ( 14,000 rpm ) for 20 min at 4c , as described previously , the supernatants were transferred into new tubes and stored at 70c until use . the samples ( 60 g of protein / lane ) were separated on a 12% sodium dodecyl sulfate ( sds ) polyacrylamide ( biorad ) gel electrophoresis at 100 v for 1 h. proteins ( 120 g ) were transferred to polyvinylidenefluoride ( pvdf ) membrane at 100 v during one hour . membranes were then blocked with 10% milk diluted in tbs - t ( mixture of tris - buffered saline and 0.05% tween 20 ) for 30 minutes under slight agitation at room temperature . then , all membranes were incubated overnight at 4c with the respective antibodies : a mouse monoclonal antibody to map-2 ( 1 : 1,000 ; novus biological ) , a mouse monoclonal antibody to brain core protein of cspg ( 1 : 500 , millipore ) , a rabbit polyclonal antibody to laminin ( 1 : 1,000 ; sigma ) , and a rabbit polyclonal antibody to b - cell lymphoma protein-2 ( bcl-2 , diluted 1 : 1,000 ; santa cruz ) . membranes were also submitted to specific labeling of subtypes a and b of eph receptors and ephrins . the concentration used and the descriptions of the antibodies are shown in table 1 . membranes were washed 2 times for 10 minutes in tbs - t and incubated at room temperature for 1 hour with anti - mouse ( 1 : 6,000 ; ge ) , anti - rabbit ( 1 : 10,000 ; ge ) , or anti - goat ( 1 : 2,000 ; ge ) igg ecl conjugated secondary antibodies . in the sequence , after final washes , the membranes were incubated with western lightning chemiluminescence reagent plus ( perkinelmer life science , usa ) for 1 minute . the membranes were exposed to an x - ray film for imaging ( hyperfilmtm ecl , ge healthcare , usa ) to visualize protein bands . the membranes of every blot were then washed and incubated individually with a mouse monoclonal antibody to alpha - tubulin ( 1 : 30,000 ; sigma ) diluted in tbs - t containing 1% bsa for 1 hour at room temperature and developed as described previously . the densitometry of the bands was quantified by means of a computer assisted image analyzer and a software developed by imaging research ( brock university , canada ) as described elsewhere . dividing the density of the protein signal by the correspondent alpha - tubulin signal value performed data normalization . total rna from spinal cord fragments was extracted with rnaspin mini kit ( ge healthcare , uk ) according to the manufacturer 's instructions . rna quantity and integrity were assessed by spectrophotometry ( nanodrop ) and microfluidics - based electrophoresis ( bioanalyzer , agilent 2100 ) , respectively . only rna samples with od 260/280 1.8 and rin ( rna integrity number ) > 7 were used for quantitative rt - pcr . for rt - pcr reactions , total rna was converted into cdna in the presence of reverse transcriptase ( multiscribe , applied biosystems ) and random hexamer primers ( applied biosystems ) , according to manufacturers ' instructions . quantitative pcrs reactions were performed on a step one plus sequence detection system ( applied biosystems ) using taqman universal pcr master mix ( applied biosystems ) in a total volume of 20 l . the gene expression of the following molecules was analyzed : the neurotrophic factors nt-3 ( rn00579280_m1 ) , gdnf ( rn00569510_m1 ) , bdnf ( customized , forward 5tggttatttcatacttcgg ttgcatga3 , reverse 5tgtccgtggacgtttgctt3 , and probe 5ctgcgcccatgaaag3 ) , and fgf-2 ( rn00570809_m1 ) , the eph receptors epha6 ( rn01474859_m1 ) and ephb2 ( rn01181017_m1 ) , and the small gtpase rhoa ( rn04219610_g1 ) . the amplification protocol included 3 minutes at 95c , followed by 45 cycles of 10 seconds at 95c for denaturation and 45 seconds at 60c for annealing and extension . statistical analysis for the behavioral data consisted of a two - way analysis of variance and followed the bonferroni posttest . a second analysis was performed including only the saline and pedf groups , in order to obtain data related to motor recovery of the injured animals . in the western blot , immunohistochemistry and rt - pcr analyses , the one - way anova was applied with tukey 's multiple comparisons posttest to identify statistical significances between groups . data were presented as means s.e.m . and significance level was set at p < 0.05 . the motor evaluation of animals submitted to ischemic spinal cord injury was performed by the inclined plane test . the statistical analysis by the two - way anova showed effects of time ( p < 0.0001 ; f = 101.4 ) , treatment ( p < 0.0001 ; f = 32.99 ) , and interaction time / treatment ( p < 0.0001 ; f = 7.516 ) when the three groups were analyzed together , as well as when only the saline and pedf groups were included in the evaluation ( effects of time p < 0.0001 , f = 99.14 ; of treatment p = 0.002 , f = 9.543 ; and of interaction time / treatment p = 0.004 , f = 5.80 ) . therefore , differences between the saline and pedf groups ( p < 0.001 ) were seen at week 4 to week 6 of assessment , according to the bonferroni posttest ( figure 1 ) . furthermore , although sham and saline groups differed at all evaluated periods , sham and pedf groups were different only at 13 days time - interval ( figure 1 ) . the effects of photothrombotic ischemic injury and treatment with pedf on the neuroplasticity in the ventral horn of the lumbar spinal cord were analyzed by means of map-2 detection . western blot revealed an increase ( 87.78% ) of map-2 protein level in the ventral region of lumbar spinal cord of pedf treated group compared to sham ( p < 0.05 , figure 2(a ) , also illustrated in figure 2(c ) ) . moreover , map-2 immunoreactivity was elevated ( p < 0.001 ) in the ventral horn of lumbar spinal cord in rats of pedf group compared with the sham ( 35.99% ) and saline ( 33.81% ) groups ( figure 2(a ) ) . the qualitative analysis showed an increased map-2 immunoreactivity in the neuronal cell bodies and fibers of the spinal cord ventral horn of pedf rats , compared to saline rats ( figure 2(b ) ) . furthermore , the stereological tool point intercepts revealed that pedf injection elevated ( 11.71% , values expressed as areal fraction ) the amount of map-2 immunoreactive dendritic processes in the ventral horn of the lumbar spinal cord in relation of saline injected rats ( figure 3 ) . the stereological method revealed no alterations in the areal fraction of the map-2 immunoreactive perikarya among experimental groups . the values of areal fraction of map-2 immunoreactive perikarya were 31.69 1.61 , 34.79 2.17 , and 38.94 4.39 of sham , saline , and pedf groups , respectively ( mean s.e.m . , p > 0.05 ) . the increased map-2 immunoreactive dendritic profiles in the ventral horn of pedf treated rats are illustrated in higher magnification microphotographs of representative rats of the three studied groups ( figure 4 ) . the stereological tool , named point intercepts ( red frame ) , that was projected on the digital image of map-2 immunoreactive profiles for quantification of neuronal dendrites and cell bodies of ventral horn were illustrated in figure 4 . it should be mentioned that the sections incubated with the solvent of the primary or secondary antisera as well as with the solvent of the avidin - biotin solution showed no reaction ( data not shown ) . rt - pcr for relative gene expression of neurotrophic factors in the ventral region of lumbar spinal cord revealed a decrease of nt-3 in the pedf group compared to sham ( 38.52% , p < 0.05 , table 2 ) . moreover , gdnf gene expression was found to be elevated in the pedf group compared to sham ( 38.21% , p < 0.05 ) and also to saline ( 94.0% , p < 0.01 ) groups ( table 2 ) . no differences were seen in the analyses of bdnf and fgf-2 gene expression ( table 2 ) . no differences were observed among the experimental groups at the postoperative periods performed in this study ( data not shown ) , thus representing no autocrine regulation of that neurotrophic factor in the present experimental conditions . western blot of the growth cone inhibitor cspg levels in the ventral region of lumbar spinal cord showed two bands of molecular weights 70 and 150 kda ( figures 5(a ) and 5(b ) ) . the chondroitinase treatment allowed the identification of a 70 kda chondroitin sulfate / dermatan sulfate hybrid chain and also a 150 kda neurocan - derived c - terminal product [ 34 , 35 ] . decreases in the cspg level were found in the 70 kda band ( p < 0.05 ) of the pedf ( 12.92% ) and also saline ( 18.33% ) groups compared to sham rats ( figure 5(a ) , also illustrated in figure 5(b ) ) . laminin and bcl-2 proteins were used as markers for angiogenesis and antiapoptosis regulator , respectively , and were quantified by means of western blot in the ventral region of lumbar spinal cord of the rats ( figures 6(a ) and 6(b ) ) . laminin level was elevated ( 66.23% ) in the saline group compared to sham ( p < 0.01 ) and a decrease ( 24.97% ) in the level of laminin was found in the pedf group compared to saline ( p < 0.5 ) . regarding the bcl-2 analysis , no changes were demonstrated among groups at the postoperative studied periods ( figure 6 ) . the protein levels of subtypes a and b of the eph receptors and ephrins were quantified by western blot in the ventral region of lumbar spinal cord of the rats ( figure 7 ) . the epha4 level increased in the saline ( 122.16% ) and pedf ( 127.93% ) groups compared to sham ( p < 0.01 ) , and no changes were observed in protein levels of the receptors epha2 , a3 , a5 , and a7 ( figure 7(a ) ) . regarding the levels of type - a ephrins , ephrin a2 increased ( 64.28% ) in the pedf group compared to sham ( p < 0.05 ) , and no changes were seen in the ephrins a1 , a3 , a4 , and a5 ( figure 7(b ) ) . the representative bands of ephs a and ephrins a illustrated the effect described above ( figures 7(c ) and 7(d ) ) . furthermore , regarding the ephs b1 , b4 , and b6 ( figure 7(e ) ) , no differences were found among the experimental groups . moreover , increases of ephrin b1 levels were observed in the saline ( 71.78% ) and pedf ( 53.51% ) groups compared to sham ( p < 0.05 , figure 7(f ) ) . ephrin b2 level was elevated in the pedf group compared to sham ( 49.67% ) and saline ( 43.54% ) groups ( p < 0.05 ) , and the ephrin b3 level was increased in the pedf group ( 87.55% ) compared to sham ( p < 0.05 ) , ( figure 7(f ) ) . the representative bands of ephs b and ephrins b illustrated the effects described above ( figures 7(g ) and 7(h ) ) . some members of studied eph receptors , particularly the epha1 , a6 , a8 , a10 , b2 , and b3 , showed no specific signal bands at the western blot assay . finally , the relative gene expression analyses of epha6 and ephb2 receptors as well as the small gtpase rhoa , performed by rt - pcr in an adjacent region , showed no differences among the experimental groups ( table 2 ) . the cellular analysis of the two - color immunofluorescence in ventral horn of the rat spinal cord showed a colocalization of the epha1 , epha2 , epha7 , epha8 , ephb1 , ephb4 , and ephb6 receptors , as well as the ephrin a5 with the nf-200 positive motor neurons of this region . the type b ephrins ( b1 , b2 , and b3 ) are colocalized with astrocytes of that region ( data not shown ) . the presence of ephrin b2 in astrocytes of ventral horn of pedf treated rat is illustrated in figure 8 . the qualitative analysis of immunofluorescence allowed the recognition of cellular component of the labeling signals but did not lead the identification of differences among groups . spinal cord ischemia is considered the most relevant event present in a series of pathological situations , including trauma , tumor , infection , and circulatory disorders , contributing to the deleterious secondary mechanisms that amplify initial injury [ 5255 ] . ischemia might also influence injury outcome and neurorestorative events due to its ability to modify neurotrophic and neuroplasticity responses of nearby lesion [ 56 , 57 ] . experimental models of spinal cord trauma are largely employed [ 5862 ] ; however , analyses have failed to attempt the circumstances of related ischemia . this work performed a spinal cord injury photothrombotic ischemia using the rose bengal method , as first described by watson et al . reproducible lesion with regard to its size , localization , and behavioral response is achieved because the method allows a precise control of dye concentration and irradiation settings thus leading , in rats , to a nonrecovery of blood flow , an absence of short term behavioral recovery , and a 3-month - old circumscribed lesion in the dorsal half of the cord as described previously [ 6668 ] . importantly , the photothrombotic injury applied at the low thoracic levels of rat spinal cord of the present work preserved the lumbar segments caudally where rat lumbar cpg is located . neuroplasticity in the lumbar cpg has been addressed as the major source of motor recovery , spontaneously or after treatments , following spinal cord lesion [ 7072 ] . the understanding of the neuroplasticity potential of the lesioned spinal cord would favor the translation of spinal cord regeneration to clinical practice ( http://www.clinicaltrial.gov , nct00406016 ) [ 73 , 74 ] . neurotrophic factors have been tested on spinal cord injury experimentally , especially those with actions on several aspects of neurorestoration , for instance , wound repair , neuronal trophism , and neuroplasticity [ 7577 ] . pedf has been pointed out as a potential candidate mainly in terms of motor recovery because the molecule is highly expressed and triggered trophic actions to motor neurons and because its receptor is concentrated in ventral motor region of the spinal cord [ 1 , 2 ] . in fact , we described motor behavior improvements and neuroplasticity responses in the low thoracic lesioned rats after a pedf injection in the epicenter of the injury . the rats that were submitted to the experimental procedures were accompanied behaviorally by means of the inclined plane test , which evaluates muscle strength and endurance parameters required to keep the animal in a static position when its plane is submitted to a progressive increase of the inclination angle [ 78 , 79 ] . the possibility of pedf injection in the epicenter of a spinal cord photothrombotic injury to trigger neuroplasticity events in the lumbar regions of the organ was evaluated by means of the responses of structural protein map-2 . the regulation of that neuronal microtubule protein in the lesioned nervous system has been associated with dendritic branching and synaptic plasticity . western blot analysis revealed increases of map-2 levels in ventral regions of the lumbar spinal cord after the ischemic lesion applied cranially , remarkably in the rats treated with pedf , indicating that the neurotrophic factor is able to stimulate neuronal plasticity in the regions of the spinal cord distant to the wound . quantitative microdensitometric image analysis of map-2 immunoreactivity revealed , at cellular level , increases of map-2 immunoreactivity in the perikarya and neuropil of large motoneurons in the ventral horn of the lumbar region , caudal to ischemic injury site , of rats treated with pedf . image analysis is not able to separate map-2 positive dendrites from the cell bodies profiles . the stereological method however allowed us to show the neuroplasticity responses taking place in the dendritic process of map-2 positive neurons of the ventral horn of pedf treated rats . these results are in agreement with previous publication which treated a traumatic spinal cord injury with another neurotrophic factor , thus revealing the potential of spinal cord plasticity to lead a higher behavioral recovery after organ injury . neuroplasticity is favored by a complex intracellular signaling that takes place in the rescued regions of the lesioned nervous tissue . in fact , the unaltered levels of the antiapoptotic factor bcl-2 [ 8183 ] in lumbar ventral region indicate the absence of local neuronal death , favoring further neuronal plasticity in that region . neuroplasticity is a result of events specially addressed by the responsive neurons , their neighbor nonneuronal cells , and extracellular matrix molecules [ 8486 ] . regarding that , pedf seems to be a promising candidate to spinal cord repair due to its actions on spinal cord neurons and ability of signaling to the endothelial and glial cells , the main actors of neurorestorative events in nervous tissue [ 3 , 87 ] . remarkable pedf actions include those that are inhibitory to angiogenesis and astrogliogenesis [ 87 , 88 ] , thus with substantial impact to extracellular matrix elements . although neovascularization is required for neuronal fiber growth in regions close to injury acutely , to our knowledge , there is no publication referring to a long lasting possible interaction of vasculature regulation and neuronal plasticity in regions distant to lesion . nevertheless , a recent publication correlated a local pedf expression to opposite responses of nerve fibber growth and neovessels in the cornea treated with the neurotrophic factor fgf-2 , which is in agreement with our results on pedf - induced downregulation of laminin , a marker of small blood vessels , in lumbar spinal cord neuroplasticity responsive region that is distant from the injury . inhibitory actions of pedf to astrocytes may have not interfered with ability of reactive astrocytes of the lesioned spinal cord to secrete cspg in the neuroplasticity responsive region caudally . inhibitory influence of extracellular matrix molecules , especially cspg , to fiber growth close to the spinal cord injury site has been described [ 92 , 93 ] ; however , there is a lack of descriptions on the regulation of cspg in the neuroplasticity responsive spinal cord regions . the decreased level of 70 kda cspg in the motor ventral region of the lumbar levels , far from the photothrombotic injury site , in animals treated or not with pedf and at a chronic period after surgery ( 6 weeks ) already emphasizes the ability of the lesioned spinal cord to last a permissive microenvironment for neuronal plasticity [ 94 , 95 ] . all in all , pedf actions to nonneuronal actors of neurorestorative events seem to favor neuronal plasticity in the lesioned spinal cord . additional feature of pedf is its capability to modulate the expression of other neurotrophic factors , thus amplifying neurorestorative events triggered by specific trophic molecules in the lesioned nervous system [ 9699 ] . there are actually several neurotrophic factors that play paracrine / autocrine actions on the spinal cord motor neurons . based on that , we evaluated gene expression of nt-3 , gdnf , bdnf , and fgf-2 by means of rt - pcr in the neuroplasticity responsive lumbar motor region of the spinal cord injury rats . we do not know whether photothrombotic ischemia in the low thoracic level of the rat spinal cord has triggered gene expression of studied neurotrophic factors in the neuroplasticity responsive lumbar region acutely ; however , at the later week 6th time point , pedf treatment modulated the differentially nt-3 and gdnf gene regulation . the pedf - induced downregulation of nt-3 gene expression in the late period after injury might be related to a fine tuning of neuroplasticity responses in the cord [ 100 , 101 ] by an action on the descending corticospinal motor fibers [ 102 , 103 ] . furthermore , such a regulation that was induced by pedf treatment might have favored the expression of a neurotrophic factor with stronger actions to postsynaptic spinal cord motor neurons . that would be actually the case for gdnf [ 5 , 76 , 97 , 104 ] . the absence of a late gene regulation of bdnf and fgf-2 might be explained for their ability to modulate early events after injury like neuronal rescue , progenitor cell proliferation , glial reactivity , and wound repair [ 14 , 105 ] . the bidirectional signaling system provided by the eph receptors and their ligands was recently mentioned as a key regulator of neuroplasticity in central nervous system . ephrin signaling plays important actions regarding axonal guidance and synaptogenesis during development [ 107 , 108 ] . the role of ephrin on the lesioned spinal cord has been the subject of recent investigation [ 29 , 109 ] . the ephrin function is highlighted on neurorestorative events mainly because of its ability to prompt communication between neuronal and nonneuronal cells [ 110 , 111 ] . we have analyzed at biochemical and cellular levels several members of the ephrin a and b families as well as the receptor subtypes of the eph a and b families that could play a role in the lesioned spinal cord . the epha6 and ephb2 signals that were not shown by western blot and immunohistochemistry were evaluated at molecular levels by employing rt - pcr . upregulations of ephrins and their eph receptors have been described in reactive astrocytes close to rat spinal cord injury [ 29 , 31 , 113 ] . the regulation of ephrin system close to spinal cord injury has been associated with its ability to interfere with cell activation related to wound repair and also to inhibit neurite outgrowth and axonal regeneration close to a wound repair region [ 114 , 115 ] . remarkably , increases of epha4 in reactive astrocytes close to a scar region of the lesioned spinal cord were correlated to inhibition of axonal regeneration [ 116 , 117 ] , event that gained importance after the description of the improvement of axonal regeneration and reduction of glial scar in the epha4-deficient spinal cord injury mouse . furthermore , epha4 antagonist was able to block retrograde axonal degeneration , to increase axonal regeneration , and to improve motor behavior in lesioned spinal cord rats [ 109 , 116 ] . the present analysis demonstrated regulation of ephrin system in the neuroplasticity responsive lumbar motor region after a chronic spinal cord low thoracic injury , remarkably the ephrins a2 , b1 , and b3 and the receptor epha4 . the details of their contribution to neuronal plasticity in the lesioned spinal cord must be further evaluated . nevertheless , changes in the levels of ephrin b system were correlated to neuropathic pain due to their ability to regulate neuronal excitability at spinal cord . important finding of the present study was the upregulation of ephrin b2 in the neuroplasticity responsive region of pedf treated rats compared to nontreated lesioned animals , thus with a special relevance to motor recovery . in fact , the epha4/ephrin b3 bidirectional signaling in developing spinal motor neurons seems to be involved in locomotion function [ 119122 ] . because ephrin b2 is specifically present in astrocytes of neuroplasticity responsive area , as demonstrated by the double immunofluorescence analyses , that ephrin signalling may contribute to well describe the ability of glial cells to promote neuronal plasticity . all in all , it is likely that long term spinal cord injury might employ ephrin signaling for spontaneous motor recovery , event that could be amplified by neurotrophic factor - induced regulation of specific ephrin molecules , as it is the case of pedf . finally , long term ephrin regulation in the neuroplasticity responsive region of the lesioned spinal cord does not seem to require the transcription factor rhoa . rhoa impairs neurite outgrowth , by means of growth cone collapse , an event that could be restricted to wound areas [ 124 , 125 ] where upregulation of rhoa mrna and protein last on reactive astrocytes of the lesion site of a cord injury [ 126128 ] . further analyses are required for a further understanding of the rhoa function in the neuroplasticity areas after a long period after injury . pedf injection in the epicenter of a low thoracic rat spinal cord photothrombotic ischemic injury improved motor behavior and triggered neuroplasticity responses in the motor regions of lumbar levels far from the lesion site . changes in the expression of extracellular matrix protein , neurotrophic factors , and molecules of the ephrin system may have favored neuroplasticity .

pigment epithelium derived factor ( pedf ) exerts trophic actions to motoneurons and modulates nonneuronal restorative events , but its effects on neuroplasticity responses after spinal cord ( sc ) injury are unknown . rats received a low thoracic sc photothrombotic ischemia and local injection of pedf and were evaluated behaviorally six weeks later . pedf actions were detailed in sc ventral horn ( motor ) in the levels of the lumbar central pattern generator ( cpg ) , far from the injury site . molecules related to neuroplasticity ( map-2 ) , those that are able to modulate such event , for instance , neurotrophic factors ( nt-3 , gdnf , bdnf , and fgf-2 ) , chondroitin sulfate proteoglycans ( cspg ) , and those associated with angiogenesis and antiapoptosis ( laminin and bcl-2 ) and eph ( receptor)/ephrin system were evaluated at cellular or molecular levels . pedf injection improved motor behavioral performance and increased map-2 levels and dendritic processes in the region of lumbar cpg . treatment also elevated gdnf and decreased nt-3 , laminin , and cspg . injury elevated epha4 and ephrin - b1 levels , and pedf treatment increased ephrin a2 and ephrins b1 , b2 , and b3 . eph receptors and ephrins were found in specific populations of neurons and astrocytes . pedf treatment to sc injury triggered neuroplasticity in lumbar cpg and regulation of neurotrophic factors , extracellular matrix molecules , and ephrins .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

a 32-year - old female patient was admitted to a local hospital after a car accident . after 2 days , the sodium level had risen to 138 meq / ml and her mental status was improved . on the 3rd day , the patient became drowsy and had a brief episode of generalized tonic - clonic seizure . no marked hypoxemia or hypotension was identified with closed hemodynamic monitoring in the intensive care unit . four days after the correction of hyponatremia , the patient was transferred to our hospital . two weeks after the correction of hyponatremia there were high signal intensities in the pons and bilateral deep gray nuclei on t2-weighted mri images ( fig . 1-c ) with diffuse gyriform enhancement alongside most of the cerebral cortices and with a symmetrical enhancement of both external capsules , globus pallidi , and central thalami ( fig . 1-d and 1-e ) . proton mrs was carried out using a 1.5-t system with a standard quadrature head coil . a stimulated echo acquisition mode sequence was used with a repetition time of 3 seconds , echo time of 30 milliseconds , and voxel volume of 8 ml placed at the parietal parasagittal cortex . this revealed an abnormal increase in lipid / lactate complex ( at 0.8 - 1.6 ppm ) and a decrease in n - acetyl aspartate ( naa ) ( at 2.0 ppm ) . the patient became stable without a significant change in her level of consciousness . at a 1-year follow - up after admission , she was still in a vegetative state and did not respond to painful stimuli . hypoxia / ischemia is the most probable cause of cln evident on mri , but neither hypoxia nor hypotension was identified in our patient . a single attack of generalized seizure was not thought to be related to a significant hypoxic event , which was supported by the gradual deterioration of the patient 's mental status after recovery from a brief seizure . the patient also exhibited well - described mri characteristics of ods , including cpm , and no hippocampal lesions - which are commonly involved in hypoxic / ischemic injury - were found . a severe case of cortical lesions in ods was previously found to include neuronal loss in addition to demyelination and gliosis.4 in the case reported here , cln was believed to occur within the spectrum of ods . a patient with sheehan syndrome suffering from hyponatremia and cardiac failure exhibited cpm and cln on mri.1 another patient , who suffered from acute intermittent porphyria , also had severe hyponatremia and convulsions , and mri showed cpm , epm , and cln.2 that patient was assumed to have arterial disease from acute intermittent porphyria in addition to hyponatremia and generalized convulsion . in contrast to the case reported here , both of these previous patients experienced a definite hypoxic / ischemic event resulting in cln . one ods case similar to ours who experienced decreased consciousness and one seizure attack showed cortical abnormality on mr , leading to two suggested underlying mechanisms : ( i ) pure ods or ( ii ) ods with minor hypoxic / ischemic injury.3 the brain is known to be more vulnerable to hypoxic ischemic injury in metabolic encephalopathy.5,6 another possible explanation for the development of cln in our patient is the vulnerability to hypoxic ischemic injury in ods - even one episode of generalized seizure attack might contribute to ischemic injury in this state . cortical mri abnormalities observed in patients with anoxia or ischemia pathologically represent cln and invariably are predictive of a poor prognosis . in the case of ods , however , underlying pathological changes are predominantly demyelinative with the degree of neuronal loss depending on the severity of the condition.2,4 the prognosis of cortical lesions in ods is thought to be related to the degree of neuronal loss . although the pathogenesis of ods is still unknown , this condition may result from a breakdown of blood - brain barrier , leading to vasogenic edema , and subsequently progressing into demyelination accompanied by a variable degree of neuronal loss.4,7,8 gadolinium - enhancing cortical mri abnormalities in ods indicate the breakdown of blood - brain barrier but not neuronal loss . in the present case we used mrs to determine the contribution of different pathogenesis such as ischemia and demyelination . naa is a marker of a healthy neuron whose reduction indicates neuronal disease or loss , including infarction after stroke . another remarkable finding in our case was the increase of broad peak intensities at 0.8 - 1.6 ppm , which were assigned to the lipid / lactate complex . however , the interpretation was limited by the echo time being too short to differentiate between lipid and lactate . moreover , the patient remained in a vegetative state , suggesting a poor prognosis . in conclusion , cln revealed by mr can occur with cpm and epm , although the early detection of a cortical lesion is difficult . it is unclear whether pure hypoxia / ischemia coexisting with ods or severe cortical neuronal loss is the main pathology of demyelination . the present case indicates that even a mild hypoxic / ischemic event should be avoided in the management of patients with osmotic disequilibrium .

cortical laminar necrosis has been rarely observed in osmotic demyelination syndrome . we report a 32-year - old female patient who became comatose after the rapid correction of hyponatremia . there were high signal intensities in the pons and bilateral deep gray nuclei on t2-weighted mri images , and linear hyperintensities along the cerebral cortices on t1-weighted images with a diffuse gyriform enhancement . mr spectroscopic findings showed a decrease of the n - acetyl aspartate peak and an increase in those of the lipid and lactate complex . the case demonstrates that a severe form of osmotic demyelination syndrome accompanying cortical laminar necrosis can result from the rapid correction of hyponatremia .

CASE REPORT DISCUSSION

mucocutaneous herpes simplex virus ( hsv ) infections are among the most common sexually transmitted diseases in hiv - infected individuals . typical acyclovir - responsive vesicular outbreaks as seen in hiv - uninfected individuals are the norm , although severity and number of recurrences can increase when host immunity is poor . additionally , classic outbreaks of genital hsv also increase after starting highly active antiretroviral therapy ( haart ) as part of the well - described immune reconstitution inflammatory syndrome ( iris ) . these persistent infections are rare in the literature but have recently been grouped into ulcerative and pseudo - tumoral ( hypertrophic or granulomatous ) variants [ 4 , 5 ] . while increased acyclovir resistance is a contributing factor , poorly understood complications and/or defects during and after immune recovery are other likely contributors to chronic outbreaks . we report a case of chronic ulcerative hsv infection of the vulva in a patient with hiv developing almost 1 year after initiating haart and continuing even after significant improvement in her cd4 cell count . this emphasizes the fact that these chronic hsv recurrences may start or persist outside of the normal 6-month window of iris and despite partial or complete restoration of immunity . a 38-year - old hiv-1-infected african american woman presented in september 2009 with several weeks of a painful vulvar ulcer . her hiv disease was diagnosed in 2003 and she had been on haart ( lamivudine , zidovudine and atazanavir ) since 2006 , although with poor compliance . after another lapse in treatment for 1 year , she resumed therapy in 2008 with a prompt improvement in immune status 2 months later ( viral load drop from > 1,000,000 to 390 copies / ml and concomitant rise in cd4 count from 3 to 64/mm ) . her haart regimen was changed to emtricitabine , tenofovir , atazanavir and ritonavir , and approximately 8 months later ( 11 months after resuming haart ) she developed the painful erosion on the inner left labia minora . her viral load was still detectable at 240 copies / ml and her cd4 count had risen to 194/mm . she had a history of genital herpes simplex and was on valacyclovir 500 mg twice - daily prophylaxis up to this time with no clinical symptoms . lesional culture did not detect hsv but she experienced some symptomatic relief with empiric increase in her valacyclovir dosing to thrice daily . however , the erosion persisted and by 6 months later had enlarged to involve both labia with painful ulceration and yellowish adherent exudates ( fig . haart therapy was again changed to abacavir , lamivudine , atazanavir and ritonavir due to nausea . on this regimen , viral activity dropped to < 50 copies / ml with a rise in cd4 count to 265/mm . again hsv was not detected on culture so a biopsy was obtained to confirm the suspicion and exclude the possibility of fixed drug reaction , erosive lichen planus , syphilis , or malignancy . the result was non - diagnostic , revealing diffuse mixed dermatitis with neutrophils , plasma cells , and numerous eosinophils . immunohistochemistry did not detect hsv-1 or -2 , and special stains for spirochetes were negative . supportive care with triamcinolone 0.1% ointment and topical lidocaine were started , and valacyclovir was continued . with spread of the ulceration to the perineal region 2 months later , another skin biopsy was performed showing similar findings ( fig . igg antibodies to hsv-1/-2 were detected at high titer in the serum confirming past exposure to hsv . there was no evidence of treponemal organisms and the rapid plasma reagin was again negative , no cytomegalovirus was detected by immunohistochemistry or pcr , and direct immunofluorescence was negative . acyclovir - resistant hsv was assumed and intravenous foscarnet was initiated at 40 mg / kg twice daily . after 3 weeks , her vulvar lesions had completely resolved and her perineum was greatly improved . topical cidofovir 1% gel was then started twice daily with prompt worsening , so she resumed foscarnet for another 4 weeks . ulcerations persisted again , so her dose of foscarnet was increased to 60 mg / kg twice daily for an additional 3 weeks . at follow - up , she showed improvement ; however , she still had small persistent erosions . she then resumed topical cidofovir and had slow but gradual improvement over the next 9 months . valacyclovir prophylaxis was added and by 5 months later she was almost completely healed and comfortable . hsv infections are a common cause of morbidity in individuals infected with hiv and occur throughout the course of their infection and as part of immune reconstitution . chronic hsv ulcers ( those lasting more than 4 weeks ) on the contrary had been primarily a consequence of advanced hiv / aids , yet the introduction of haart has not completely abolished their occurrence . this case is another example of the ulcerative subtype of chronic genital hsv and is similar to the few other cases of chronic hsv reported in the literature that develop during iris or thereafter [ 7 , 8 , 9 , 10 , 11 ] . , our patient developed severe ulcerative genital hsv , which was difficult to culture and detect , and poorly responsive to acyclovir derivatives , foscarnet and cidofovir . like 1 patient in that report and the cases reported by yudin and kaul and lanzafame , our patient clearly fit outside the normal window for iris [ 7 , 8 , 9 ] . the mechanism behind chronic hsv outbreaks is not known . antiviral resistance certainly plays a role as suggested by a recent study where 5 of 7 cases of chronic hsv had clinical and in vitro resistance to acyclovir , cidofovir and/or foscarnet . however , regardless of the switch to different therapies or the initial lack of antiviral resistance , all of those cases still took months to years to resolve . antiviral resistance could not be proven in our patient as the virus was not cultured , but her poor response to repeated courses and dosage increases of foscarnet might suggest otherwise , since hsv is reported to heal , on average , within 6 days after the start of foscarnet treatment . given the presence of an inflammatory infiltrate in chronic hsv lesions , another possible mechanism to explain persistence is that insufficient immunity to suppress viral activity occurs resulting in an imbalance in pro- and anti - inflammatory pathways akin to a chronic wound [ 7 , 8 ] . this is similar to the initial exaggerated immune responses that characterize iris , but the process is delayed in individuals that fail to rapidly or fully restore immunity . our patient 's cd4 count remained below 300/mm throughout her protracted course , and was beginning to heal only once her counts improved further . an interesting feature of the histopathology in this case was the unusual prominence of plasma cells and eosinophils not normally seen in recurrent hsv outbreaks . this was also reported in the cases by fox et al . and may be underappreciated as many of the reports on chronic hsv noted herein and in the literature do not clearly describe the histologic infiltrates . whether or not this finding may have relevance to our understanding of pathogenic mechanisms or disease course is yet to be determined . in conclusion , chronic ulcerative hsv infection in hiv - infected individuals is a rare entity where diagnosis and treatment are challenging . better understanding of the defects in hsv - specific immunity and inflammatory responses upon partial and full immune reconstitution will hopefully lead to improved management .

herpes simplex virus infections in hiv - infected individuals can be clinically unusual and difficult to treat due to underlying problems with cell - mediated immunity and the occurrence of antiviral resistance . additionally , partial or incomplete restoration of immune function may result in chronic ulcerations that require rotational treatments . in this report , we describe the case of a 38-year - old hiv - positive woman who developed the ulcerative form of chronic herpes simplex infection despite highly active antiretroviral therapy and valacyclovir prophylaxis . repeated intravenous courses of foscarnet and topical cidofovir finally controlled her erosions as her cell - mediated immunity was slowly restored . this case highlights the challenges that still exist in diagnosing and managing this rare presentation of herpes simplex virus

Introduction Case Report Discussion Disclosure Statement

a corneal perforation requires emergency treatment to avoid vision - threatening complications including bacterial endophthalmitis and hypotony [ 1 , 2 ] . several materials such as cryopreserved and hyperdried amniotic membrane , sclera , and cornea have been used as patch grafts to close perforations . we report the case of a corneal perforation treated with cryopreserved partial - thickness corneal patch grafting . in this case a 73-year - old woman , referred to a general ophthalmologist for a 1-week history of sudden tearing and decreased vision in her left eye ( os ) , presented to our hospital on the same day of the referral . best corrected visual acuity and intraocular pressure in that eye were 0.15 and 2 mm hg , respectively . slit - lamp examination and ultrasound biomicroscopy showed a corneal perforation about 1 mm in diameter superotemporally , iris plugging , and flat anterior chamber ( ac ) os ( fig . 1a , b ) ; fibrin formation and floating cells were in the ac , but endophthalmitis or an infectious corneal ulcer was not identified . the past history included uneventful small - incisional cataract surgery os and vascular stent surgery for cardiac infarction several years previously . during farm work 2 months previously , the patient had reported a foreign - body sensation os that subsided within a few days . the past history and blood / urinary laboratory examinations did not identify immunocompromised conditions , systemic infectious diseases , or steroid use . cultures of scraped corneal tissue and ac fluid did not detect any microorganisms . the patient was diagnosed with a corneal perforation of undetermined etiology . a residual partial - thickness corneal button cut using a 350-m microkeratome and an 8-mm - diameter donor punch during a previous descemet stripping automated endothelial keratoplasty ( dsaek ) surgery were used as a patch graft . until use , the corneal button was stored at 80c in optisol gs ( bausch & lomb , rochester , n.y . after the limbal peritomy , iris plugging was released by injection of a viscoelastic into the ac . after dbridement of the perforation edge and deepithelialization of the surrounding cornea , the corneal button , trimmed to two thirds of its size , was secured with 8 interrupted 10 - 0 nylon sutures on the host cornea and adjacent perilimbal sclera to cover the corneal defect . prophylactic antibiotic treatment included 1 intravitreal injection of 2 mg ceftazidime and 1 mg vancomycin , oral cefdinir 300 mg daily for 5 days , topical 0.3% ofloxacin ointment once daily for 5 days , and topical 1.5% levofloxacin 6 times daily for 2 weeks and then 4 times daily for 1 month . topical 0.1% betamethasone was started 3 times daily and tapered gradually but continued once daily until the last visit 5 months postoperatively . five days postoperatively , the ac was reformed and the perforation was masked by the donor cornea ( fig . anterior - segment optical coherence tomography ( as - oct ) images showed a corneal defect under the donor cornea ( fig . 1d ) . during the next several weeks , gradual displacement of the anterior edge of the donor cornea in the limbal direction occurred . seven weeks postoperatively , further displacement of the donor cornea resulted in unmasking of the perforated area ( fig . at this time , the corneal defect was closed by stromal scar tissue and corneal epithelium ( fig . 1f ) ; corneal topographic maps obtained by a rotating scheimpflug camera ( pentacam ; oculus , wetzlar , germany ) showed no marked astigmatism ( fig . five months postoperatively , best corrected visual acuity was 1.0 without marked astigmatism , and intraocular pressure was 9 mm hg os . at the initial visit to our hospital , we observed marked corneal surface vascularization extending from the limbus toward the corneal defect , suggesting that the pathology had started several weeks before the perforation . as reported by the patient , minor trauma 2 months previously could have been the etiology of the perforation . based on the postsurgical observation , the anterior edge of the donor cornea seemed to be displaced by gradual melting of the donor tissue rather than shrinkage of the entire corneal button . thus , sterile sclerocorneal melting is another possible underlying mechanism of corneal perforation in this case . as reported previously , split corneal transplantation that uses one donor cornea for two recipients by dsaek and lamellar keratoplasty was scheduled simultaneously or dsaek was performed first followed by patch grafting a maximum of 4 weeks later using a remaining corneal flap stored at 4c . thus , use of a dsaek - derived corneal flap stored at 80c as a patch graft for corneal perforation is unique . when using full - thickness sclera or cornea , to adjust the thickness these were required to dissect before patch grafting . accordingly , its ready - to - use thickness and size seemed to be the merit of the dsaek flap as a patch graft . previously , all 20 corneal flaps stored at 4c were structurally intact at least 19 months after patch grafting . accordingly , we could not exclude the possibility that cryopreservation was related to the graft melting in the current case . it can be difficult for scar tissue to fill scleral stroma , probably because of its relatively poor vascularity and cellularity ; however , it was reported that scleral patch grafting combined with a cyanoacrylate tissue adhesive for corneal perforations generally results in fibrous tissue formation . we report that fibrous tissue formation can fill a corneal defect even after patch grafting , using a corneal button . from this case , we learned that cryopreserved dsaek flaps stored longer than reported previously can be used as patch grafts to treat emergency conditions . scar tissue can fill a corneal stromal defect 1 mm in diameter during temporary patch grafting for less than 2 months . written informed consent was obtained from the patient for publication of this case report and any accompanying images . the authors declare that there is no conflict of interest regarding the publication of this paper .

a 73-year - old woman with a corneal perforation of undetermined etiology was treated with corneal patch grafting . a residual partial - thickness corneal button obtained during a previous descemet stripping automated endothelial keratoplasty ( dsaek ) surgery and stored at 80c in optisol gs for 3 months was used as a patch graft . five days postoperatively , the anterior chamber was reformed and the perforation was masked by the donor cornea . during the next several weeks , gradual displacement of the anterior edge of the donor cornea in the limbal direction occurred . seven weeks postoperatively , further displacement of the donor cornea resulted in unmasking of the perforated area . at this time , the corneal defect was closed by stromal scar tissue and corneal epithelium . five months postoperatively , best corrected visual acuity was 1.0 without marked astigmatism and intraocular pressure was 9 mm hg in the left eye . from this case , we learned that cryopreserved dsaek flaps stored longer than reported previously can be used as patch grafts to treat emergency conditions . scar tissue can fill a corneal stromal defect 1 mm in diameter during temporary patch grafting for less than 2 months .

Introduction Case Presentation Discussion Statement of Ethics Disclosure Statement

there are multiple case reports in the otolaryngology literature of projectiles that have become lodged in the paranasal sinuses . retained packing gauze from endoscopic sinus surgery has also been reported in the paranasal sinuses . in the endodontic literature , many reports and reviews have described various materials that can cause disease of the maxillary sinuses . in this case report , we present an interesting case of a patient who presented with recalcitrant maxillary sinusitis that was ultimately found to be related to retained endodontic material in her maxillary sinus . a 26-year - old caucasian woman presented with a chief complaint of left - sided maxillary pain with intermittent , discoloured nasal drainage . seven years prior to current presentation , the patient had reported a history of headaches , nasal congestion and bilateral discolored drainage refractory to prednisone , antibiotics , and endoscopic sinus surgery at an outside facility . two years prior to current presentation , her left maxillary pain recurred , and a computed tomography ( ct ) scan revealed a left wisdom tooth projecting into her maxillary sinus . following wisdom teeth extraction , she had marked improvement in pain and nasal drainage ; however 8 weeks later , left maxillary pain returned and was associated with left - sided yellow nasal discharge . her oral surgeon discovered an infection in the molar adjacent to the extracted wisdom tooth and performed a root canal . two weeks following the root canal , she presented with continued left maxillary tooth pain and left - sided discolored nasal discharge . extraction of the molar failed to resolve her pain , and she was subsequently referred to the facial pain / headache clinic by her dentist where she was prescribed gabapentin 300 mg tid , which was ineffective . her dentist also prescribed her multiple courses of clindamycin 150 mg tid and guaifenesin 600 gm qid , which would improve her pain and discoloured drainage . however , her symptoms would return after completing the antibiotics . on examination with rigid endoscopy , she had widely patent maxillary , ethmoid , and frontal sinus ostia with no purulence or polyposis . on flexible endoscopic examination of the floor of her left maxillary sinus , white to slightly yellow mucus maxillary sinus cultures revealed few polymorphonuclear leukocytes , few mononuclear cells , and no microorganisms . her most recent ct scan from two years prior to presentation at our facility was remarkable for minimal mucosal thickening of the floor of the left maxillary sinus was otherwise normal ( figure 1 ) . an occult dental infection was considered high in the differential diagnosis ; however , because no actual dental infection could be demonstrated , a medial maxillectomy was considered in order to facilitate topical washing of the left maxillary sinus . follow - up appointments in the facial pain / headache clinic found some features of migraine , but it is unclear whether headaches represent primary or secondary headaches with migraine features . repeat evaluations by her dentist found no evidence of a dental infection . because of past improvement on an 8-week course of clindamycin 300 mg tid , she was prescribed a 12-week course of clindamycin 300 mg tdi before surgery was considered , and she was referred to an infectious disease specialist . only mild mucosal thickening of the floor of the left maxillary sinus and post - surgical changes related to endoscopic sinus surgery were noted . a bone scan was positive in the region of the left maxilla ; however , a repeat indium scan was negative . her ct scan was repeated and she was referred to an oral surgeon for evaluation ( figure 2 figure 4 ) . the ct scan was evaluated by an oral and maxillofacial surgeon who noted that there were two small remnants of the prior left maxillary root canal that had been performed two and half years ago ( figure 2 figure 4 ) . a combined endoscopic and caldwell - luc approach under computer - assisted navigation to drill out retained gutta - percha in the maxillary sinus resolved the patient s pain and drainage immediately , without recurrence at her three month follow - up . gutta - percha , a product of tropical rubber plants , has been used since the mid-1800s as an endodontic filling material following root canal procedures . the chemical structure of gutta - percha is a trans - isomer of poly - isoprene , or natural rubber ; however it is more crystalline than natural rubber and often is formulated with medications such as zinc oxide , iodoform , chlorhexidine and calcium hydroxide , which contribute to both the antibacterial and antifungal activity 4 7 . animal studies have shown that gutta - percha becomes encapsulated by fibrous connective tissue with little inflammatory reaction . maxillary sinus complications from gutta - percha from root canals are rare . according to a previous case report , gutta - percha from a maxillary tooth root canal can migrate to and obstruct the maxillary ostium . gutta - percha has also been reported to migrate into the ethmoid sinus . in the current patient , retained gutta - percha in the maxillary sinus resulted in chronic inflammation and a persistent sinusitis - type picture with nasal congestion , pain and drainage . her symptoms preceding the sinus surgery may or may not have been related to dental infection , but she clearly improved following wisdom teeth extraction , and she relapsed due to the infection of the adjacent molar . the retained gutta - percha prevented the resolution of infection and symptoms , even following extraction of the affected tooth . partial improvement with antibiotics directed to usual dental pathogens provided some evidence that the etiology of her symptoms was a dental infection . in patients with persistent sinusitis and a history of endodontic procedures , an evaluation for dental materials retained in or near the sinuses may be warranted to rule out an additional source of infection . removal of these retained dental materials may require an external approach with drilling , which can be facilitated by endoscopic visualization through the caldwell - luc procedure . a review of the otolaryngology literature did not provide any additional case reports on retained gutta - percha . in fact , only two case reports were found in the oral and maxillofacial surgery literature that described retained gutta - percha in the paranasal sinuses . in the oral surgery and endodontic literature , there are multiple reports of aspergillosis occurring in the maxillary sinus as a result of overextension of root canals of maxillary teeth , especially using materials containing zinc oxide or formaldehyde 3 , 11 . one case series of aspergillosis of the maxillary sinus was found in the otolaryngology literature . in this series , 85 cases of aspergillosis of the maxillary sinus in non - immunosuppressed patients were reviewed . of these , 94% presented evidence of a radio - opaque foreign body in the maxillary sinus , with 85% of the cases related to endodontic dental paste . our case report highlights the importance of investigating alternative sources of infection in cases of recalcitrant sinusitis . dental sources of infection as well as retained or overextended endodontic materials should be investigated in patients with unexplained , chronic sinusitis . written informed consent for publication of clinical details and clinical images was obtained from the patient .

dental sources of infection can produce acute and chronic maxillary sinusitis . in some cases , the source of the infection may be related to the presence of endodontic materials in the oral cavity . in this article , we report a case of retained gutta - percha in the maxillary sinus resulting in chronic sinusitis .

Introduction Case report Discussion Consent

facial deformities and mutilations may be caused by malignancies , congenital malformations and traumas . because the appearance is essential in the subjects personality and social life conventional treatments such as plastic surgery , allograft and maxillofacial prostheses may not provide appropriated functional and aesthetic results [ 710 ] . in case of large facial tissue loss with consequent anatomical reference loss , when the eyelids , nose and mouth are affected by the mutilation , the aesthetics of the facial expression are compromised , and even after conventional rehabilitation the patient may present asymmetry and a typical mask appearance [ 111 ] . during the past years , many advances in surgical treatment of facial defects have been achieved . the complex anatomy of the facial area has been unveiled , and the deformities and mutilations have been better understood . the recent introduction of composite tissue allotransplantation ( cta ) in the form of healthy and well - vascularized facial tissue transplant can solve several limitations of the conventional treatments . therefore , the objective of the current study was to conduct a literature review on the relevance and effectiveness of facial transplants in mutilated subjects . a literature review in the medline database was performed using the following keywords : composite tissue allotransplantation , facial transplantation , and facial rehabilitation . in vitro studies , case reports and literature reviews published from 1963 and 2011 non - english language articles and those articles not dealing with the surgical - allogeneic technique of facial rehabilitation were excluded . the increase desire to restore both the aesthetics and function of the compromised human face led to the development of different surgical and alloplastic techniques such as skin graft , local flaps , free tissue transfer and maxillofacial prostheses . these limitations were directly related to the complexity of the face anatomy , in which the inclusion of soft tissue and underlying muscles are necessary during face reconstruction so that the function could be recovered . in addition , the compatibility of skin texture , color and thickness are required to obtain an aesthetic restoration ; and when possible , the resulting scars should be placed in shadow areas in order to ensure smooth and uniform facial appearance . a deformity resulting from contractions in the interface between the graft tissue and skin is another limitation of the surgical technique . new grafts are normally performed to repair the deformity ; but this can lead to incompatibility of the adjacent tissues giving a flap appearance of the rehabilitated area . in order to reduce this risk and increase the aesthetics , many professionals combine the surgical techniques with maxillofacial prostheses . nevertheless , several patients are reluctant against the use of prostheses , because even when the prostheses are implant - retained , they are still removable and cause insecurity and promote social discomfort . therefore , to overcome the limitations of the conventional techniques , an alternative treatment has been developed to treat patients with facial deformities and mutilations . the facial transplants emerged to restore not only the patients aesthetics , but their function , and consequently to promote their re - insertion in the society . the successful hand transplant was the most important contribution to the introduction of facial transplants . in 1963 , a team of surgeons in ecuador performed the first human hand transplant , prior to the development of immunosuppressive drugs and , therefore , that transplant was not successful ( table 1 ) . the high immunogenicity of the skin tissue did not allow this type of transplantation without the use of immunosuppressive drugs . with the development of effective immunosuppressive drugs , clinical success was observed after 2 years of evaluation and a significant return of sensation and function of the transplanted organ was noted . the apparent success of the transplanted human hand created the ethical and immunological steps to perform human facial transplantation , and the surgeons were allowed to consider the use of healthy tissues donors for the reconstruction of extensive facial mutilation [ 1922 ] . reported the reconstruction of thick layers of the facial tissue and the scalp using microsurgical technique , showing a 100% survival and good functional and aesthetic outcomes ( table 1 ) . in 2007 , observed an increase in the patient s facial sensitivity to light touch after 6 months of facial transplant ( table 1 ) . on the other hand , the motor recovery was slower , with gradual improvement of speech and mastication . after 18 months , the patient was able to recover some of the facial expressions . . also noted facial sensitivity recovery after 3 months of surgery , and significant improvements were observed after 12 months . the surgical techniques have been improved ; the ethical , immunological and psychological bases have been well - defined and the facial transplantation became a clinical reality for mutilated patients . the recent introduction of composite tissue allotransplantation ( cta ) for facial tissue transplantation emerged to solve several limitations of the conventional treatments . cta involves simultaneous transplantation of the skin , muscle , nerves , bones , cartilage and blood vessels . when compared to the conventional technique that uses autologous tissue transfer , the cta provides greater advantages to the severely mutilated patient , providing complete anatomic restitution , recovering the skin sensitivity with satisfactory functional and aesthetic outcomes . however , some obstacles inherent to cta including immunological , ethical and psychological factors are observed . there are several controversies over transplantation between humans involving aspects that form the ethical basis of transplants , such as transplanted tissue rejection , availability of donated tissues and the consent of the donor and the recipient . nevertheless , in case of facial transplantation , other aspects including the real need to perform facial transplant and the association between the new face and the identity of each subject different from vital organ transplant ( e.g. heart ) , facial transplants are not performed in order to save lives ; additionally , patients are at risk and complications of transplantation , necessity of immunosuppressive therapy throughout their life may decrease their life expectancy by about 10 years [ 2831,32 ] . therefore , the patient s desire and decision about facial transplantation is the first step to consider before surgery . it is important to recognize that not all disfigured patients want to receive a transplant . on the other hand , many of them are willing to accept the risks of transplantation and immunosuppression to improve their quality of life . another very important ethical issue is the donor s family , who believes that there is a chance to see the face of the loved subject who recently passed away in another person . however , the bone morphology of the recipient will give a different look to the transplanted facial tissue [ 3235 ] . facial transplants may also affect the patient s autoimmune response that has to be controlled with standard immunosuppressive drugs . the immunosuppression treatment should be conducted during a long time , and total acceptance of the patient is necessary . development in immunotherapy of transplants made it possible to reduce the immunosuppression ; therefore , cta could be introduced in the clinical scenario . however , the high incidence of infection in facial transplants has been attributed to the high doses of immunosuppressive drugs needed to prevent rejection in the post - surgery acute phase . on the other hand , all infections have been successfully treated with broad spectrum antibiotics and adjusted dosage of immunosuppressants [ 1720 ] . clinical success was observed in one of the first cases of cta facial transplant15 that involved the distal region of the nose , upper and lower lip , chin , and adjacent parts of the cheek ( table 1 ) . routine tests , biopsies , physiotherapy and psychological supports were conducted during the evaluation period . at 20 days of surgery , mild clinical signs of rejection were observed , but these disappeared after increasing the dose of immunosuppressants . however , a long - term evaluation is still necessary to predict the success of this therapy . siemionow et al . in 2009 described a clinical case of extensive human face transplantation after a severe face trauma ( table 1 ) . after a few days of surgery , routine examination revealed the onset of graft rejection that was managed by increased doses of immunosuppressants . in the first three weeks , the patient had good acceptance of his new face , and an excellent functional outcome was observed after 6 months . the patient was able to breath normally , the smell and taste senses recovered and his speech was partially affected . in addition , the patient could chew solid food and also drink . in case of complex transplants , psychological acceptance of the graft by the patient is very complicated and it may be considered as a determining factor for the transplantation success . psychological issues are directly related to the patient s desire , the difficulty of re - insertion in the society , non - verbal communication deficits , anxiety , fear and hypervigilance associated with graft failure . nevertheless , in order to understand the psychological implications of facial transplants , psychosocial sequelae of the patients who have suffered facial mutilation should be considered . the importance of the face relies on the individuality of identity , age , gender and ethnicity of each subject36 . the mutilated patients lose their original personality , leading to social isolation , unhappiness , depression , stress and an increased risk of suicide [ 32,3840 ] . before facial transplantation , a critical psychological evaluation of the patient is necessary . the patient should present psychological and cognitive abilities to understand the risks and responsibilities , and be aware of the limitations related to the treatment so that the expectations are not higher than the clinical reality . patients who received facial transplants find it difficult to integrate their new face with their personal identity . they should be able to adapt both to the new identity and to people s reactions to the new look . the social reactions may include real or false praise in relation to the aesthetic outcomes after facial transplant , feelings of shame , disgust , surprise and curiosity . most of the transplant failures are related to the non - compliance of patients with the immunologic treatments . during the follow - up of the first human hand transplant , [ 1921,44 ] the patient presented psychological problems leading to giving up the treatment with immunosuppressive drugs . cta has been a feasible treatment after 5 and 13 years of clinical experience in facial and hand transplants , respectively . different from solid organ transplant , the incidence of systemic complications in transplants of the face and hands are lower . generally , for patients taking consistent and controlled immunosuppressive drugs , the survival rate of transplantation was 100% and the aesthetic and functional aspects have been described as satisfactory . the increase desire to restore both the aesthetics and function of the compromised human face led to the development of different surgical and alloplastic techniques such as skin graft , local flaps , free tissue transfer and maxillofacial prostheses . these limitations were directly related to the complexity of the face anatomy , in which the inclusion of soft tissue and underlying muscles are necessary during face reconstruction so that the function could be recovered . in addition , the compatibility of skin texture , color and thickness are required to obtain an aesthetic restoration ; and when possible , the resulting scars should be placed in shadow areas in order to ensure smooth and uniform facial appearance . a deformity resulting from contractions in the interface between the graft tissue and skin is another limitation of the surgical technique . new grafts are normally performed to repair the deformity ; but this can lead to incompatibility of the adjacent tissues giving a flap appearance of the rehabilitated area . in order to reduce this risk and increase the aesthetics , many professionals combine the surgical techniques with maxillofacial prostheses . nevertheless , several patients are reluctant against the use of prostheses , because even when the prostheses are implant - retained , they are still removable and cause insecurity and promote social discomfort . therefore , to overcome the limitations of the conventional techniques , an alternative treatment has been developed to treat patients with facial deformities and mutilations . the facial transplants emerged to restore not only the patients aesthetics , but their function , and consequently to promote their re - insertion in the society . the successful hand transplant was the most important contribution to the introduction of facial transplants . in 1963 , a team of surgeons in ecuador performed the first human hand transplant , prior to the development of immunosuppressive drugs and , therefore , that transplant was not successful ( table 1 ) . the high immunogenicity of the skin tissue did not allow this type of transplantation without the use of immunosuppressive drugs . with the development of effective immunosuppressive drugs , clinical success was observed after 2 years of evaluation and a significant return of sensation and function of the transplanted organ was noted . the apparent success of the transplanted human hand created the ethical and immunological steps to perform human facial transplantation , and the surgeons were allowed to consider the use of healthy tissues donors for the reconstruction of extensive facial mutilation [ 1922 ] . reported the reconstruction of thick layers of the facial tissue and the scalp using microsurgical technique , showing a 100% survival and good functional and aesthetic outcomes ( table 1 ) . in 2007 , observed an increase in the patient s facial sensitivity to light touch after 6 months of facial transplant ( table 1 ) . on the other hand , the motor recovery was slower , with gradual improvement of speech and mastication . after 18 months , the patient was able to recover some of the facial expressions . . also noted facial sensitivity recovery after 3 months of surgery , and significant improvements were observed after 12 months . the surgical techniques have been improved ; the ethical , immunological and psychological bases have been well - defined and the facial transplantation became a clinical reality for mutilated patients . the recent introduction of composite tissue allotransplantation ( cta ) for facial tissue transplantation emerged to solve several limitations of the conventional treatments . cta involves simultaneous transplantation of the skin , muscle , nerves , bones , cartilage and blood vessels . when compared to the conventional technique that uses autologous tissue transfer , the cta provides greater advantages to the severely mutilated patient , providing complete anatomic restitution , recovering the skin sensitivity with satisfactory functional and aesthetic outcomes . however , some obstacles inherent to cta including immunological , ethical and psychological factors are observed . there are several controversies over transplantation between humans involving aspects that form the ethical basis of transplants , such as transplanted tissue rejection , availability of donated tissues and the consent of the donor and the recipient . nevertheless , in case of facial transplantation , other aspects including the real need to perform facial transplant and the association between the new face and the identity of each subject should also be considered [ 2830 ] . different from vital organ transplant ( e.g. heart ) , facial transplants are not performed in order to save lives ; additionally , patients are at risk and complications of transplantation , necessity of immunosuppressive therapy throughout their life may decrease their life expectancy by about 10 years [ 2831,32 ] . therefore , the patient s desire and decision about facial transplantation is the first step to consider before surgery . it is important to recognize that not all disfigured patients want to receive a transplant . on the other hand , many of them are willing to accept the risks of transplantation and immunosuppression to improve their quality of life . another very important ethical issue is the donor s family , who believes that there is a chance to see the face of the loved subject who recently passed away in another person . however , the bone morphology of the recipient will give a different look to the transplanted facial tissue [ 3235 ] . facial transplants may also affect the patient s autoimmune response that has to be controlled with standard immunosuppressive drugs . the immunosuppression treatment should be conducted during a long time , and total acceptance of the patient is necessary . development in immunotherapy of transplants made it possible to reduce the immunosuppression ; therefore , cta could be introduced in the clinical scenario . however , the high incidence of infection in facial transplants has been attributed to the high doses of immunosuppressive drugs needed to prevent rejection in the post - surgery acute phase . on the other hand , all infections have been successfully treated with broad spectrum antibiotics and adjusted dosage of immunosuppressants [ 1720 ] . clinical success was observed in one of the first cases of cta facial transplant15 that involved the distal region of the nose , upper and lower lip , chin , and adjacent parts of the cheek ( table 1 ) . routine tests , biopsies , physiotherapy and psychological supports were conducted during the evaluation period . at 20 days of surgery , mild clinical signs of rejection were observed , but these disappeared after increasing the dose of immunosuppressants . however , a long - term evaluation is still necessary to predict the success of this therapy . siemionow et al . in 2009 described a clinical case of extensive human face transplantation after a severe face trauma ( table 1 ) . after a few days of surgery , routine examination revealed the onset of graft rejection that was managed by increased doses of immunosuppressants . in the first three weeks , the patient had good acceptance of his new face , and an excellent functional outcome was observed after 6 months . the patient was able to breath normally , the smell and taste senses recovered and his speech was partially affected . in addition , the patient could chew solid food and also drink . in case of complex transplants , psychological acceptance of the graft by the patient is very complicated and it may be considered as a determining factor for the transplantation success . psychological issues are directly related to the patient s desire , the difficulty of re - insertion in the society , non - verbal communication deficits , anxiety , fear and hypervigilance associated with graft failure . nevertheless , in order to understand the psychological implications of facial transplants , psychosocial sequelae of the patients who have suffered facial mutilation the importance of the face relies on the individuality of identity , age , gender and ethnicity of each subject36 . the mutilated patients lose their original personality , leading to social isolation , unhappiness , depression , stress and an increased risk of suicide [ 32,3840 ] . before facial transplantation , a critical psychological evaluation of the patient is necessary . the patient should present psychological and cognitive abilities to understand the risks and responsibilities , and be aware of the limitations related to the treatment so that the expectations are not higher than the clinical reality . patients who received facial transplants find it difficult to integrate their new face with their personal identity . they should be able to adapt both to the new identity and to people s reactions to the new look . the social reactions may include real or false praise in relation to the aesthetic outcomes after facial transplant , feelings of shame , disgust , surprise and curiosity . most of the transplant failures are related to the non - compliance of patients with the immunologic treatments . during the follow - up of the first human hand transplant , [ 1921,44 ] the patient presented psychological problems leading to giving up the treatment with immunosuppressive drugs . cta has been a feasible treatment after 5 and 13 years of clinical experience in facial and hand transplants , respectively . different from solid organ transplant , the incidence of systemic complications in transplants of the face and hands are lower . generally , for patients taking consistent and controlled immunosuppressive drugs , the survival rate of transplantation was 100% and the aesthetic and functional aspects have been described as satisfactory . the facial transplantation is a feasible option to restore a severely disfigured face when conventional treatment is not able to provide adequate aesthetics and function . in addition , this therapy improves the quality of life of the mutilated patients , recovering their self - esteem and psychological basis , and consequently reinserting the patient in society .

several factors including cancer , malformations and traumas may cause large facial mutilation . these functional and aesthetic deformities negatively affect the psychological perspectives and quality of life of the mutilated patient . conventional treatments are prone to fail aesthetically and functionally . the recent introduction of the composite tissue allotransplantation ( cta ) , which uses transplanted facial tissues of healthy donors to recover the damaged or non - existent facial tissue of mutilated patients , resulted in greater clinical results . therefore , the present study aims to conduct a literature review on the relevance and effectiveness of facial transplants in mutilated subjects . it was observed that the facial transplants recovered both the aesthetics and function of these patients and consequently improved their quality of life .

INTRODUCTION CASE REPORT DISCUSSION Limitations of the conventional treatment Composite tissue allotransplantation (CTA) CONCLUSION

diabetic nephropathy is characterized by the onset of microalbuminuria , which progresses to overt proteinuria . angiotensin - converting enzyme ( ace ) inhibitors / angiotensin ii receptor blocker ( arbs ) have been established to be first - line drugs in preventing the development and retarding the progress of diabetic nephropathy by reducing microalbuminuria . other drugs are effective in reducing proteinuria in diabetic nephropathy . among these , cilnidipine , a unique dihydropyridine derivative 4 generation ca channel blocker has a rational pharmacological profile of dual l / n - type ca channel blocking action . it blocks l - type calcium channels in vascular smooth muscle and n - type calcium channels in sympathetic nerve terminals that supply blood vessels . in diabetic patients , there is enhanced sympathetic nervous activity resulting in constricted efferent arterioles and elevated intraglomerular pressure . unlike l - type calcium channel blockers , which cause only afferent arteriolar dilatation and increase in the intraglomerular pressure , this drug dilates both afferent and efferent arterioles by its effect on n - type calcium channels and thusreduces urinary albumin and protein excretion to a greater extent . as ace inhibitors and cilnidipine has different mechanism of action in reducing microalbuminuria , both may be combined to get the added benefit of the two classes of drugs . the aim of study was to compare the reduction in microalbuminuria in diabetic patients with hypertension by dividing them into two groups and keeping them under two different regimens . group i was given enalapril ( ace inhibitor ) alone and group ii was kept on combination therapy of enalapril and cilnidipine . the present study was a randomized prospective studyin type-2 diabetic patients attending diabetic opd , medical opd and admitted in indoor medical wards of king george 's medical university , lucknow over a period of 1-year ( august 2013 to july 2014 ) . the patients included in the study were subjects with type 2 diabetes mellitus ( age 2170 years , either gender ) with hypertension and microalbuminuria ( if two out of three 24 h urinary albumin measurements are in the range of 30300 mg/24 h during an 8-week period before entry ) and have had effective glomerular filtration rate ( egfr ) > 60 ml / min . the patients with type-1 diabetes mellitus , macroalbuminuria , normal blood pressure ( bp ) , chronic kidney disease withe gfr<60 ml / min , chronic liver disease , coronary artery disease , urinary tract infection , and pregnant and lactating women were excluded from the study . patients were excluded could not stay on medications and were not regular on follow up . out of these patients , 95 normoalbuminurc and 72 with overt proteinuria were excluded from the study . out of these excluded patients , remaining 93 patients with type-2 diabetes mellitus were microalbuminuric and hypertensive . they were randomly allocated in the two groups : group i - enalapril ( n = 48 ) and group ii - enalapril with cilnidipine ( n = 45 ) . the baseline characteristics of the patients in the two groups are mentioned in table 1 . on comparison of characteristics in both the studied groups , the result was nonsignificant [ table 1 and figure 1 ] . comparison of baseline characteristics of the two groups flow chart of participants through the trial the patients in group i received enalapril once a day at 2.510 mg / day to keep the bp under 140/90 . amlodipine was needed in five patients in addition to enalaprilin group 1 to maintain bp<140/90 . in group ii , the patients were given enalapril 2.510 mg / day and cilnidipine 1020 mg / day to achieve a bp below 140/90 . after the start of this trial , 12 patients withdrew from group i and 10 patients from group ii during the course of study . so the total number of patients who actually went through the study was 36 in group i and 35 in group ii . 24 h urinary albumin was repeated every 3 months upto 1-year in both the groups . at the end of 1-year , the reduction in microalbuminuria was compared in both groups . during the course of the trial , chi - square test was used to compare the dichotomous / categorical variables . the unpaired t - test one - way analysis of variance was used to detect significant differences in the mean values . all the analysis was carried out using statistical package for social sciences version 16 ( chicago , inc . the present study was a randomized prospective studyin type-2 diabetic patients attending diabetic opd , medical opd and admitted in indoor medical wards of king george 's medical university , lucknow over a period of 1-year ( august 2013 to july 2014 ) . the patients included in the study were subjects with type 2 diabetes mellitus ( age 2170 years , either gender ) with hypertension and microalbuminuria ( if two out of three 24 h urinary albumin measurements are in the range of 30300 mg/24 h during an 8-week period before entry ) and have had effective glomerular filtration rate ( egfr ) > 60 ml / min . the patients with type-1 diabetes mellitus , macroalbuminuria , normal blood pressure ( bp ) , chronic kidney disease withe gfr<60 ml / min , chronic liver disease , coronary artery disease , urinary tract infection , and pregnant and lactating women were excluded from the study . patients were excluded could not stay on medications and were not regular on follow up . out of these patients , 95 normoalbuminurc and 72 with overt proteinuria were excluded from the study . out of these excluded patients , remaining 93 patients with type-2 diabetes mellitus were microalbuminuric and hypertensive . they were randomly allocated in the two groups : group i - enalapril ( n = 48 ) and group ii - enalapril with cilnidipine ( n = 45 ) . the baseline characteristics of the patients in the two groups are mentioned in table 1 . on comparison of characteristics in both the studied groups , the result was nonsignificant [ table 1 and figure 1 ] . the patients in group i received enalapril once a day at 2.510 mg / day to keep the bp under 140/90 . amlodipine was needed in five patients in addition to enalaprilin group 1 to maintain bp<140/90 . in group ii , the patients were given enalapril 2.510 mg / day and cilnidipine 1020 mg / day to achieve a bp below 140/90 . after the start of this trial , 12 patients withdrew from group i and 10 patients from group ii during the course of study . so the total number of patients who actually went through the study was 36 in group i and 35 in group ii . 24 h urinary albumin was repeated every 3 months upto 1-year in both the groups . at the end of 1-year , the reduction in microalbuminuria was compared in both groups . during the course of the trial , the results were presented as mean standard deviation ( sd ) and percentage . chi - square test was used to compare the dichotomous / categorical variables . the unpaired t - test one - way analysis of variance was used to detect significant differences in the mean values . all the analysis was carried out using statistical package for social sciences version 16 ( chicago , inc . the mean 24 h urinary albumin level in group i at the start of study was 204.69 50.34 mg and in group ii was 206.74 50.95 mg . at the end of 12 months , the mean microalbuminuria level was 153.17 54.10 mg in group i and 93.51 36.30 mg in group ii ( p < 0.001 ) . the mean percentage reduction from baseline at the end of 12 months in group i was 25.68 21.40% while in group ii it was 54.88 13.84% , ( p after 1-year , the level of microalbumin in group 1 was 153.17 mm hg while in group 2 , it was 93.51 mm hg ( p < the percentage reduction from baseline at the end of 1-year in group ii was greater than in group i ( percentage reduction of 54.88% vs. 25.68% , p < 0.001 ) there was a significant reduction in systolic and diastolic b pin both the groups from baseline to 1 year , but the difference in change of bp between group i and group ii at different intervals was not significant . in group i , one patient progressed to overt proteinuria while in group ii nobody progressed from microalbuminuria to overt proteinuria , although the difference was not significant . again in group i , only one patient became normoalbuminuric during the course of study while in group ii , it happened with three patients , although the difference was not significant . the correlation between percentage change in bp and percentage change in microalbuminuria was of random nature ( p > 0.05 ) and showed a virtually nonexistent negligible relationship ( r > 0.3 ) in random directions at different time intervals . on comparison at baseline and throughout the follow - up periods , no significant difference was observed in mean systolic blood pressure levels of the two groups [ table 2 ] . comparison of sbp between two groups at baseline and different follow - up intervals at baseline and throughout the follow - up periods , no significant difference was observed in mean diastolic blood pressure levels of the two groups [ table 3 ] . comparison of dbp between two groups at baseline and different follow - up intervals there were no adverse cardiovascular events in either group [ table 4 ] . there were no significant changes in serum creatinine , hba1c and serum potassium levels during the course of study between the two groups . thedose of enalapril used in group i was 5 2.5 and 5 2.1 in group ii , while thedose of cilnidipine used in group ii was 10 3 . microalbuminuria ( 30300 mg albumin/24 h ) is a well - known predictor of poor renal outcomes in patients with type 2 diabetes . microalbuminuric patients with type 2 diabetes if left untreated , almost invariably progress to macroalbuminuria and overt diabetic nephropathy . although there are various classes of drugs to treat microalbuminuria , we compared monotherapy ( enalapril ) with combination therapy ( enalapril and cilnidipine ) to find out whether both are similarly effective or one is better than another in reduction of microalbuminuria . in our study , combination regimen of enalapril and cilnidipine ( group ii ) was more effective in reducing microalbuminuria than enalapril alone ( group i ) . in group i microalbuminuria was reduced by 25.68% , while in group ii there was reduction of 54.88% , which was significant . the patients were randomized into two groups to receive either valsartan ( an arb ) or valsartan plus cilnidipine for 1-year . after 1-year , microalbuminuria was found to have decreased more in the valsartan plus cilnidipine group ( 44 11% ) than in the valsartan group ( 9 7% ) . the antiproteinuric action of ace inhibitor and its superiority over l - type ccb is supported by a trial conducted by remuzzi et al . over hypertensive patients with type-2 diabetes and normal urinary albumin excretion rate . the study showed that diabetic nephropathy can be prevented by ace inhibitor therapy and combination of ace inhibitor with non - dihydropyridine calcium channel blocker ( verapamil ) does not provide any protective effect over kidney against the development of microalbuminuria . our study while confirming ace inhibitors as agents preventing diabetic nephropathy , also endorses a better improvement in proteinuria by using ace inhibitor and cilnidipine ( dihydropyridine l / n type calcium channel blocker ) in combination than ace inhibitor alone . fujita et al . also supported the use of ace inhibitor with cilnidipine rather than amlodipine . they conducted a trial over hypertensive patients with chronic kidney disease who were already receiving ace inhibitor . though the difference in reduction of bp between the two groups was not significant , patients treated with cilnidipine showed more decrease in proteinuria than those treated with amlodipine . hatta et al . also observed that in chronic kidney disease patients , cilnidipine has antihypertensive effects equivalent to amlodipine , but proteinuria was reduced by shifting from amlodipine to cilnidipine . the amlodipine group showed a significant increase in proteinuria , while the increase was suppressed in the cilnidipine group . tanaka conducted his trial in over 25 diabetic patients with hypertension who were on treatment with ccb other than cilnidipine . medication was changed to cilnidipine , and there was a significant decrease in urinary albumin / creatinine ratio after 3 months of the new treatment . zaman and kumari also compared the effects of cilnidipine and amlodipine over bp , heart rate , proteinuria and lipid profile in hypertensive patients . there was decrease in pulse rate , urinary protein excretion and serum triglyceride in diabetic patients in cilnidipine group . it is interesting to note that while scores of studies mentioned above including ours and many others have utilized the level of albuminuria as a determinant for progression of diabetic kidney disease and different group of drugs having antiproteinuric effect are widely studied to observe reduction in albuminuria as mark of improvement , some recent studies , including va nephron d and subgroup analysis of altitude trial and bardoxelone trials have shown that albuminuria is not a good surrogate marker for diabetic kidney disease . however , these observations need large multicentric trials and their meta - analysis before questioning and writing off albuminuria , which is so far an established surrogate marker widely used presently in determining the state of progression of diabetic kidney disease in clinical practice and research . whether these recent developments may have some impact or not , which might be apparent in the time to come , our study focused on microalbuminuria and its levels observed after therapeutic intervention with antiproteinuric agents as determinant for progression of diabetic kidney disease . the results of our study indicate greater reduction in level of microalbuminuria by utilizing both ace inhibitor and cilnidipine together than ace inhibitor alone . this combination also appear to leading to greater reduction in proteinuria as compared to a combination of arb with cilnidipine . as ace inhibitors are established agents to reduce proteinuria in type-1 diabetics , this combination therapy of ace inhibitor ( enalapril ) with cilnidipine may be equally successful in hypertensive albuminuric type-1 and type-2 diabetics together . while indicating combination therapy to be better than ace inhibitor alone , the study prefers ace inhibitor over an arb in combination with cilnidipine in treatment of diabetic nephropathy . the main drawback of our study was that it was a single center , open - labeled randomized trial conducted over a small number of patients . duration of the study was also short to comment on its cardiovascular and renal benefits . so a large scale , multicenter , double - blind clinical trial involving a larger number of patients for a longer duration will be needed in future to evaluate the effectiveness and superiority of combination therapy over monotherapy in reduction of microalbuminuria and cardiovascular risk . the main drawback of our study was that it was a single center , open - labeled randomized trial conducted over a small number of patients . duration of the study was also short to comment on its cardiovascular and renal benefits . so a large scale , multicenter , double - blind clinical trial involving a larger number of patients for a longer duration will be needed in future to evaluate the effectiveness and superiority of combination therapy over monotherapy in reduction of microalbuminuria and cardiovascular risk .

the aim of our study was to find out the antiproteinuric effect of enalapril angiotensin - converting enzyme ( ace inhibitor ) alone or in combination with cilnidipine in patients with type-2 diabetes mellitus . the study was conducted on 71 patients with type-2 diabetes mellitus patients with hypertension and microalbuminuria . they were divided into two groups randomly as follows : group i ( enalaprilalone , n = 36 ) and group ii ( enalapril with cilnidipine , n = 35 ) . in both the groups , baseline 24 h urinary albumin was estimated and was repeated every 3 months upto 1-year . after 1-year follow - up , reduction in microalbuminuria was found to be greater in group ii . in group i microalbuminuria came down by 25.68 21.40 while in group ii it reduced by 54.88 13.84 ( p < 0.001 ) . we conclude that in diabetic population , cilnidipine has an additive effect in microalbuminuria reduction over and above the well - proven effect of ace inhibitors .

Introduction Materials and Methods Study population Intervention Statistical analysis Results Discussion Limitations of the study

tumors of the smooth muscle are rare in the head and neck region especially the buccal mucosa due to the scarcity of this tissue in this region and thus are frequently seen in the gastrointestinal and female genital tract because of the preponderance of smooth muscle at these sites . in the head and neck region , these tumors are believed to arise from the tunica media of the blood vessels . clinically , they are very aggressive , and the prognosis is poor . in the oral cavity most of the cases are seen in the mandible , maxilla , tongue , cheek , hard and soft palate , floor of the mouth and lip . a 35-year - old female presented with difficulty in opening the mouth since past 1 month . on clinical examination an ulcerative lesion on the left buccal mucosa adjacent to the maxillary left third molar was observed . the lesion was non - tender and firm in consistency , measuring about 1 1 cm in dimension , with inflamed surrounding margins . an axial computed tomography scan showed an iso - dense mass in the right buccal mucosal region causing the swelling [ figure 1 ] . excisional biopsy was done under local anesthesia , and the formalin fixed specimen was processed for histopathological examination . the cells showed cellular and nuclear pleomorphism , increased mitotic figures , and prominent nucleoli . single and multinucleated giant cells containing dark eosinophilic cytoplasm in a myxomatous connective tissue were also observed . immunohistochemical staining showed strong positivity for vimentin [ figure 3 ] , smooth muscle actin ( sma ) [ figure 4 ] , and high proliferative index displayed by ki-67 [ figure 5 ] . these immunohistochemical findings satisfy the criteria for leiomyosarcoma . due to loss of follow - up further treatment of the patient an axial computed tomography scan showing an iso - dense mass in the right buccal mucosal region causing facial swelling photomicrograph showing interlacing fascicles and bundles of spindle cells ( h and e , 100 ) photomicrograph showing immunopositivity for vimentin ( original magnification 400 ) photomicrograph showing immunopositivity for smooth muscle actin ( original magnification 400 ) photomicrograph displaying proliferative activity by ki-67 ( 200 ) the literature review of primary leiomyosarcoma of the oral cavity in past 20 years retrieved is listed in table 1 . the most frequent site was mandible accounting for 20 cases , followed by maxilla 15 cases , 10 cases in tongue and 9 cases in buccal mucosa , 2 each in lip , floor of the mouth , hard palate , soft palate and maxillary sinus . out of 63 patients , 33 patients were male ( 56% ) and 30 were female ( 44% ) [ figure 6 ] . prognostically , 28 cases were alive with no disease during the follow - up period which ranged from 6 months to 120 months . twenty - one patients died of this disease during the follow - up period which ranged from 1 month to 37 months . information was not available for nine patients who were lost during the follow - up and remaining three cases died of other causes . data of primary oral lms from the english literature graph showing sex distribution of primary oral leiomyosarcomas soft tissue sarcomas are relatively rare neoplasms that may arise in any anatomic region . occurrence in the head and neck accounts for less than 1% of all malignant tumors in this site . only 3 - 10% of leiomyosarcoma ( lms ) cases arise in the head and neck [ figure 7 ] . smooth muscles is sparse in the head and neck region and are mainly found in the walls of blood vessels , erector pili musculature of the skin , circumvallate papillae and myoepithelial cells of the salivary glands . clinically most often lms presents as a nodular painless , well circumscribed mass , adherent firmly to the surrounding tissues which sometimes may be ulcerated as was in our presented case . histologically lms typically displays spindle cells with abundant cytoplasm and centrally placed blunt ended cigar shaped nuclei of varying sizes . microscopic criteria for well differentiated lms include : ( i ) a pattern of interlacing bundles of smooth muscle cells , ( ii ) a high mitotic rate , ( iii ) pleomorphism , and ( iv ) bizarre cell forms . immunopositivity for vimentin , sma , and muscle specific actin msa has been demonstrated in lms . the tumor should be immunonegative for s-100 and cytokeratins these histopathological features along with immunohistochemical profiles aids in differentiating lms from other similar spindle cell malignancies like malignant fibrous histiocytoma , fibrosarcoma , etc . graph showing sites of occurrence of primary oral leiomyosarcomas differential diagnosis and immunohistochemical profile of similar spindle cell tumors oral lms tend to metastasize to the cervical nodes and lungs , and therefore when lms is identified , it is necessary to determine whether the lesion is primary or secondary . the likelihood of distant metastasis is related to histologic grade and tumor size ; the risk is highest for large , high grade lesions . because of its similarity to other sarcomas composed of spindle cells like fibrosarcoma , neurogenic sarcoma and malignant fibrous histiocytoma , use of special stains and immunohistochemistry becomes of utmost importance for early diagnosis and prompt management of the cases . early wide surgical excision with radical neck dissection for lymph node metastasis remains the mainstay of treatment . overall the prognosis of lms is poor and hence early diagnosis is the key to the management . oral lms are rare lesions of the head and neck with aggressive behavior and poor prognosis in most of the cases . early and accurate diagnosis followed by radical treatment is of utmost importance for improving the prognosis of these tumors .

leiomyosarcoma ( lms ) is an uncommon malignant spindle cell tumor of the head and neck region . the occurrence is particularly rare in the buccal mucosa of the oral cavity . it is a rapidly growing tumor with aggressive behavior and poor prognosis . method : this article presents a rare case of primary leimyosarcoma of the buccal mucosa in a 35 year old female and retrospective analysis of primary oral lms published in the english literature since past 20 years is done . diagnosis was confirmed by immunohistochemistry profile showing positivity for vimentin , smooth muscle actin ( sma ) , high proliferative index displayed by ki-67 , focal positivity for pan - ck and negativity for s-100 . conclusion : based on the presence of malignant spindle cells showing positivity for vimentin and sma , a diagnosis of leiomyosarcoma was made .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

figure 1 represents the schematic diagram of our solid - state , label - free plasmonic biosensor fabrication for mir detection . chemically synthesized gold nanoprisms ( figure 1a ) , which displayed their lspr at 797 nm upon attachment to solid substrate immersed in pbs buffer , were selected as nanoantennas for our biosensor fabrication because ( 1 ) their lspr peak position ( in the 700900 nm wavelength range ) is particularly suitable for biomolecule detection because of negligible background scattering and adsorption of endogeneous chromophores from physiological media such as blood and plasma ; ( 2 ) they have strong electromagnetic ( em ) field enhancement at the sharp tips ; ( 3 ) they exhibits a strong lspr response to small changes in their surrounding environment ; ( 4 ) their atomically smooth surface allows formation of a self - assembled monolayer ( sam ) of receptors with both a tightly packed lower layer of alkylthiols and a more loosely packed upper layer that provide the required space for duplex formation with complementary mir strands ; ( 5 ) gold is nontoxic and stable under extreme physiological conditions ; and ( 6 ) the gold sulfur bond is very stable with thiol - modified receptors making a strong covalent bond with the gold surface . details describing the synthesis of gold nanoprisms and their attachment onto the silanized glass substrate are provided in supporting information . recently , we have shown that a molecular sensor fabricated using an 35 nm average edge - length gold nanoprisms displayed an unprecedentedly large 21 nm reversible shift upon a minor 0.6 nm increase in the thickness of the local dielectric environment . therefore , gold nanoprisms of this size and geometry are unique and should provide extremely high sensitivity if plasmonic biosensors are fabricated using them , which is the scope of this letter . this letter provides the first example of lspr - based mirs sensing in physiological media . design of plasmonic biosensors and detecting mir - x in various physiological media . ( a ) chemically synthesized and freshly prepared gold nanoprisms were covalently attached onto a 3-mercaptopropyltriethoxysilane - functionalized glass coverslip ( substrate ) . ( b ) surface of gold nanoprisms was chemically modified with a 1.0 m 1:1 mixture of sh - c6-ssdna - x and peg6-sh in pbs buffer ( ph 7.4 ) to prepare the plasmonic biosensor . ( c ) incubation of sensor in mir - x solution and formation of dna duplex . ( d ) schematic of the extinction spectrum of the biosensor collected in pbs buffer after modification with a 1.0 m 1:1 mixture of sh - c6-ssdna - x and peg6-sh ( blue curve ) . the extinction spectrum was again collected after incubation in mir - x solution and careful rinsing with pbs buffer to determine the new peak position ( red curve ) . the extent of lspr dipole peak shift ( lspr ) depends on the concentration of mir - x used during the incubation in ( c ) , which ranged from 100 nm to 50 fm . ( e ) plot of lspr versus log of mir - x concentrations used to determine the limit of detection . our targets were mir-21 and mir-10b , because we have shown by locked nuclei acid based in situ hybridization that they are overexpressed in pancreatic cells ( pccs ) within the tumor mass and that circulating mir-10b may serve as biomarker for diagnosis of pdac . we designed the sensing strategy based on the hybridization between complementary probes ( -c6-ssdna - x , x = 21 and 10b ) attached to gold nanoprisms and their target mirs . the introduction of spacers in - between the dna probes was included to reduce steric hindrance between the probes and the mirs and therefore to enhance the hybridization and ultimately the sensitivity . as shown in figure 1b , poly(ethylene glycol)6-thiols ( peg6-sh ) were used as spacers because they avoid nonspecific adsorption of extraneous materials onto the nanoprism s surface and are not reactive toward mirs or other biological constituents present in plasma . previously , we demonstrated that functionalization of a nanoantenna s surface with an equal mole ratio of receptor and spacer provided the best sensitivity and lowest limit of detection ( lod ) . therefore , a 1:1 ratio of hs c6-ssdna - x : peg6-sh was used to prepare the plasmonic biosensors ( figure 1b ) . all the mirs and oligonucleotides sequences used in these studies are provided in supporting information , table s1 . as illustrated in figure 2a , we used uv vis spectroscopy to monitor the changes in lspr of the gold nanoprisms at different functionalization steps . the functionalization of substrate - bound nanoprisms with 1:1 ratio of hs c6-ssdna-21:peg6-sh resulted in an 20.5 3.2 nm red - shift of lspr as a result of the increase in local refractive index , which suggested the attachment of both molecular species onto the nanoprism s surface . these plasmonic biosensors were utilized for mir detection by incubating mir-21 ( obtained from sigma - aldrich , u.s.a . ) with concentration ranging from 100 nm to 50 fm in pbs buffer , 40% bovine plasma , or 40% human plasma . the lspr response of gold nanoprisms for each mir-21 concentration was measured where the highest 18.8 1.9 nm lspr red shift was observed for 100 nm mir-21 ( figure 2a , blue ) in pbs buffer . we hypothesize that the lspr red - shift is due to hybridization between ssdna-21 and mir-21 . it was found that the magnitude of the lspr shift was concentration dependent , where 50 fm mir-21 caused a 3.7 0.3 nm lspr red shift in pbs buffer . figure 2b illustrates the magnitude of the lspr shift ( lspr ) upon dna / rna duplex formation for various mir-21 concentrations in the three different media . evidently higher concentrations of mir-21 induced a larger number of ssdna-21 strands to convert to dna / rna duplexes and consequently a larger change in the local refractive index around the nanoprisms , which results in a larger value of lspr . ( a ) monitoring lspr dipole peak ( lspr ) changes by uv visible absorption spectra of gold nanoprisms during various functionalization steps : before ( black , lspr = 800 nm ) and after functionalized with a 1 m/1 m ratio of hs - c6-ssdna-21/peg6-sh ( red , lspr = 821 nm ) , and after incubation with 100 nm mir-21 solution in pbs buffer ( blue , lspr = 839 nm ) . ( b ) average lspr peak shift ( lspr ) of gold nanoprisms functionalized with a 1 m/1 m ratio of hs - c6-ssdna-21/peg6-sh after incubation in different concentrations of mir-21 in pbs buffer ( red triangles ) , 40% human plasma ( black squares ) , and 40% bovine plasma ( blue diamonds ) . the lspr were calculated by taking the difference between the lspr peak position of the plasmonic biosensor after and before the hybridization with mir-21 in the various media . ( c ) average lspr of the plasmonic biosensor functionalized with a 1 m/1 m ratio of hs - c6-ssdna-10b / peg6-sh after hybridization with different mir-10b concentrations in pbs buffer ( red triangles ) , in 40% human plasma ( black squares ) , and in 40% bovine plasma ( blue diamonds ) . all extinction spectra recorded after mir - x incubation were measured in pbs buffer after rinsing with pbs buffer . the highest red shift of 18.8 1.9 nm we observed for 100 nm mir-21 incubation with our plasmonic biosensor is significant considering only an 5% change in the refractive index upon ssdna / rna duplex formation . we believe such a high sensitivity of our plasmonic biosensors is because of the unique lspr properties of our gold nanoprisms and the possibility of electron delocalization as the ssdna forms the duplex and becomes double - strand . the atomically flat surface , extremely small height ( 8 nm ) , and sharp tips of our nanoprisms display strong em field enhancement near their surface and therefore are expected to be extremely sensitive to small changes of their local dielectric environment . moreover , transformation of ssdna into double - strand dna significantly changes the refractive index because of the high charge density and polarizability of the dnas . the duplex dna is capable of long - range charge transfer and alters the electron density around the nanoprisms thus influencing their lspr properties . this interesting phenomenon requires further scientific study , which is currently under our investigation . our sensing mechanism is based on the hypothesis that the attachment of complementary target mirs to our plasmonic biosensor will shift the lspr to higher wavelength ( figure 1c ) . the total shift ( lspr ) depended on the mir concentration ( figure 1d ) and could be used to determine the limit of detection ( lod ) ( figure 1e ) . the lods calculated for mir-21 in three different media were found to be in the range of 2335 fm , which was more than 1000 and 3 fold lower than with the label - free microring resonator ( 150 fmol ) and the nanopore based ( 100 fm ) mir sensors , respectively . importantly , these techniques detected mirs in pbs buffer whereas we have demonstrated here for the first time a sensing approach in physiological media . utilizing our same direct hybridization - based detection approach , plasmonic biosensors were constructed with of c6-ssdna-10 , while keeping other parameters constant . the lod for mir-10b in the above media was determined over a concentration range from 100 nm to 50 fm . the average lspr and lods for mir-10b in three diverse media are shown in figure 2c . the principle underlying the actions of plasmonic biosensors is based on the successful hybridization between mirs and ssdna attached to nanoprisms , where a higher number of duplex formations will result in a larger change in the refractive index surrounding the nanoprisms resulting in larger lspr and higher sensitivity . therefore , it would be expected that functionalization of gold nanoprisms with 100% hs c6-ssdna - x ( without the peg6-thiol spacer ) should reduce the lod values because of steric hindrance and low attachment of mirs . to investigate this , gold nanoprisms were functionalized with 100% c6-ssdna-21 resulting in an 15.0 1.8 nm lspr red shift ( figure 3a ) . the sensor was then incubated in different concentrations of mir-21 prepared in 40% human plasma . as illustrated in figure 3a , an 9.6 1.1 nm red shift was observed for a 100 nm mir-21 concentrations and the lowest concentration that can be repeatedly detected was 10 pm from a lspr of 3.4 0.5 nm . figure 3b shows the lspr versus concentration plot . evidently , functionalization of the nanoprism s surface with 100% c6-ssdna-21 resulted in a 200-fold increase in detection limit in comparison to the 1:1 ratio c6-ssdna-21/peg6-sh mixed functionalization ( supporting information table s2 ) . these experimental data further highlight our rationale for using spacers that increase the likelihood of hybridization . we believe fully covered gold nanoprisms were obtained when 100% c6-ssdna-21 was used for functionalization , which creates steric hindrance and does not allow the maximum number of mir-21 strands to come into close proximity with c6-ssdna-21 for hybridization . therefore , not all the c6-ssdna-21 attached on the gold nanoprisms surface was hybridized with mir-21 strands resulting in low sensing response . thus , if we introduce a spacer between the c6-ssdna-21 , it will allow the maximum -ssdna-21 strands to be freely available for hybridization without any interference and ultimately enhance the sensitivity of the biosensor . accordingly , for the remaining of our investigation , we used a 1:1 mixed c6-ssdna - x : peg6-sh to functionalize the gold nanoprisms . ( a ) uv visible extinction spectra monitoring the lspr dipole peak ( lspr ) of gold nanoprisms attached to silanized glass substrate before ( black , lspr = 796 nm ) and after ( red , lspr = 811 nm ) functionalization with 1 m of hs - c6-ssdna-21 without peg6-sh spacers and after incubation in 100 nm mir-21 solution in 40% human plasma ( blue , lspr = 822 nm ) . ( b ) average lspr of these hs - c6-ssdna-21 functionalized gold nanoprisms upon hybridization with different mir-21 concentrations in 40% human plasma . the lspr were calculated by taking the difference between the lspr peak position of the nanoprisms after and before the incubation with mir-21 in pbs buffer . in order to confirm the hybridization of mir - x with c6-ssdna - x that resulted in the lspr , the enzyme rnase h was used to selectively cleave the dna : rna duplex and potentially reverse the lspr . initially , the plasmonic biosensor for mir-21 was incubated in a 100 nm solution of mir-21 , which resulted in red - shift of lspr potentially reflecting hybridization . the biosensor was then immersed in 15 units of rnase h solution for 2 h. afterward the lspr showed a blue shift and reverted back to its original position before mir-21 incubation ( figure 4a ) . when the 1:1 ratio c6-ssdna-21:peg6-sh mixed functionalized biosensor was incubated with rnase h solution alone overnight , no noticeable change in lspr value was observed ( supporting information figure s7 ) . these experimental results validate our previous observation that the lspr blue shift was due to the cleavage of heteroduplex done by rnase h. the biosensors were rinsed with rnase free water to pbs buffer and again incubated in 100 nm mir-21 solution for rehybridization where an 14 nm red shift of the lspr was observed . these experiments confirm our working hypothesis that hybridization between the nanoprism s surface ligands ( c6-ssdna - x ) and the mir - x resulted in changes in the local dielectric environment around the nanoprisms causing wavelength shift . as shown in figure 4b , the lspr responses were identical for several cycles due to hybridization and dehybridization of mir-21 over a period of 6 days . the same experiments were done for the mir-10b biosensor and similar results were observed , underscoring the long - term stability of the sensors and their potential for being developed into cost - effective point of care diagnostic tools . ( a ) uv visible extinction spectra of gold nanoprisms functionalized with a 1 m/1 m ratio of hs - c6-ssdna-21/peg6-sh ( red , lspr = 818 nm ) attached to silanized glass , after incubation with 100 nm of mir-21 ( blue , lspr = 832 nm ) , after treatment with 15 units of rnase h for 2 h ( red dotted , lspr = 818 nm ) , and after rehybridized with 100 nm of mir-21 ( blue dotted , lspr = 832 nm ) . ( b ) changes in lspr dipole peak position ( lspr ) of gold nanoprisms functionalized with a 1 m/1 m ratio of hs - c6-ssdna-21/peg6-sh upon hybridization and dehybridization with mir-21 for several cycles . the lspr peak shifts back and forth upon sensor regeneration with rnase h by cleaving dna / rna duplex and rehybridization after incubation into 100 nm mir-21 in 40% human plasma . after each of the dehybridization steps , the plasmonic biosensors were thoroughly rinsed with pbs buffer to completely remove enzyme rnase h. the hybridization takes place at the 5 end of c6-ssdna-21 and the 3 end of mir-21 , which evidently increased the refractive index . additionally such hybridization would also increase the thickness of the local dielectric environment of the nanoprisms . together , a significantly large lspr was generated for both mir-21 and mir-10b . atomic force microscopy ( afm ) analysis was conducted to characterize our plasmonic biosensors and also to verify the change in surface area caused by mir-21 incubation with mixed c6-ssdna-21 and peg6-sh - functioanlized gold nanoprisms . after analyzing 40 different nanoprisms ( figure 5 and supporting information figure s8 ) the exact same area of four different sections of the sensor - an average 2.4 10 m increase in surface area was observed by afm . thus , attachment of mirs to plasmonic biosensors has increased the thickness of local dielectric environment around the gold nanoprisms and influenced their lspr properties . ultrasensitive refractive index - induced lspr response of nanoprisms allows us to fabricate label - free plasmonic biosensor . atomic force microscopy images of gold nanoprisms bound to silanized glass substrate ( a ) after functionalization with 1:1 ratio of hs - c6-ssdna-21/peg6-sh ( b ) and after hybridization with100 nm mir-21 in 40% human plasma ( c ) . ( d ) changes in the surface area of gold nanoprisms after each functionalization steps . the successful implementation of plasmonic biosensors for use with real biological samples mandates documentation of their specificity toward target mirs in that patient samples containing multiple mir species . the mix functionalized ( c6-ssdna-21 and peg6-sh ) biosensors were incubated overnight in 40% human plasma solution containing 100 nm each of mir-16 , mir-122 , mir-126 , and mir-141 because these mirs are commonly present in human plasma . the lspr response was measured before and after incubation ( supporting information figure s9 ) and resulted in an 2.5 0.3 nm lspr red shift , which is within the instrument noise level and/or minor nonspecific adsorption of extraneous materials present in human plasma . in another control experiment , gold nanoprisms attached as before to glass substrate were functionalized with 100% peg6-sh by incubation in a 1 m aqueous solution , and after rinsing with large amounts of water , incubated in a 40% human plasma solution of 100 nm mir-21 for 12 h. this procedure resulted in only an 0.9 0.7 nm lspr red shift ( supporting information figure s10 ) , confirming that the plasmonic biosensors we designed are highly specific toward the target mirs . pancreatic cancer is the fourth - leading cause of cancer death in the united states with an annual mortality of nearly 40 000 and a dismal five - year survival rate of 6% . pdac is characterized by chemotherapeutic resistance and by the absence of an effective screening procedure for early disease . it is generally accepted that early diagnosis could reduce mortality rates substantially and thus a noninvasive early pdac test must be developed . several mirs ( such as mir-21 , -10b , -103 , -155 , -196a , 210 , and -221 ) were found to be overexpressed in pdac . given their resistance to degradation , plasma mirs have the potential to serve as biomarkers for the noninvasive diagnosis of pdac . previously , nanopore sensors were used to detect mirs in lung cancer patients , but to the best of our knowledge no sensors have been developed to date to detect pdac - related mirs in human plasma . utilizing our plasmonic biosensors we detected mir-21 and mir-10b in plasma from pdac patients . total plasma rnas including mirs were extracted from 100 l of each plasma sample using a trizol kit with a final elution volume of 28 l . next , 14 l volumes were used for mir quantification by the plasmonic biosensor and the remaining 14 l were used in the qrt - pcr assay . the plasmonic biosensors were fabricated as described before for both mir-21 and mir-10b detection . the extracted human mir-21 or mir-10b samples were diluted in pbs buffer and incubated with the biosensors were for 12 h , followed by rinsing with pbs buffer and measurement of the lspr response in pbs buffer . the observed lspr shift for each mir-21 and mir-10b sample was converted into the corresponding concentration using the calibration curve derived for mir-21 or 10b under optimized conditions and compared with the value from normal control subjects ( figure 6a , c ) . the concentrations of mir-21 and mir-10b determined from plasmonic biosensors were also compared with the values obtained from the qrt - pcr assay ( figure 6b and supporting information figure s16 ) . importantly , for the first time through a label - free technique we have shown that mir-10b concentration is nearly 4-fold higher than the mir-21 level in patient samples . inasmuch as both mir-21 and mir-10b are overexpressed in pdac , it is possible that mir-10b is released more efficiently by pancreatic cancer cells than mir-21 , allowing it to achieve higher levels in the circulation . it is therefore possible that mir-10b levels are also increased within the pancreatic tumor microenvironment , where it could be acting to enhance pdac biological aggressiveness . ( a ) the average lspr peak shifts of gold nanoprisms functionalized with a 1:1 ratio of hs - c6-ssdna-21/peg6-sh upon hybridization with mir-21 from the total rnas extracted from plasma samples of pdac patients ( blue diamonds ) and normal control subjects ( blue squares ) . the respective lspr peak shifts were converted to concentrations using the calibration curve established for mir-21 in pbs buffer as shown in figure 2b [ pdac patients ( red triangles ) , and for normal control subjects ( red circles ) ] . ( b ) comparison of mir-21 concentration for six pdac patients determined using plasmonic biosensors ( blue diamond ) and qrt - pcr ( red square ) . ( c ) similar experiments were conducted to detect mir-10b where the lspr peak shifts and concentrations for pdac patients are shown in blue diamonds and red triangles , respectively . the lspr peak shifts ( blue squares ) and concentrations ( red circles ) for normal controls are shown for comparison . ( d ) the average lspr peak shifts ( blue diamonds ) and concentration ( red triangles ) for the mir-21 in plasma samples from pdac patients without any purification . we also detected mir-21 levels directly in human plasma samples collected from pdac patients without rnas extraction . thus , human plasma ( 50 l / sample ) from six pancreatic cancer patients were diluted in pbs buffer followed by incubation with our plasmonic biosensors for 12 h. the lspr response of each sample was measured through uv vis spectroscopy and showed a steady increase in concentration from sample 6 to 1 ( figure 6d ) . both plasmonic biosensor and qrt - pcr results indicated that mir-10b levels were higher in pdac patients compared to normal control subjects and that the levels of mir-21 and mir-10b can be quantified with high accuracy using our gold nanoprism - based plasmonic biosensor without any modification , amplification , or labeling . importantly , the mir-21 concentration in extracted samples was at least 2-fold lower than in the pure plasma samples . we believe this is due to loss of mirs during the rna extraction process , which requires multiple steps for rna purification . therefore , the most widely used qrt - pcr method to determine the concentration of mirs in patients may not accurately represent the actual concentration . this limitation and imprecise quantification can be avoided by using our newly developed plasmonic biosensors , which can provide a unique opportunity as potential diagnostic and prognostic markers in pdac , other cancers , and potentially other disease states . we have designed , fabricated , and characterized a plasmonic biosensor that was able to detect pdac relevant mirs in human plasma without using rnas extraction , which opens a new avenue for the direct detection and quantification of mir levels in clinical samples without any form of sample preparation . to our knowledge , this is the first lspr - based , label - free , direct hybridization method for mir detection , which eliminates all the current drawbacks such as labeling , tagging , amplification , use of highly toxic chemical , and further modification of the sensor . furthermore , it vastly simplifies the detection approach without requiring detailed knowledge of the electron or energy transfer processes involved as in other more complicated techniques . additionally , this ultrasensitive , plasmonic - based , direct hybridization - controlled detection approach is applicable to any type of mirs that are relevant to various diseases . it was found that our plasmonic biosensor can be regenerated through several cycles and is stable for several days without compromising its sensitivity and selectivity , which should enable the development of simple , cost - effective tools for the early detection of mirs and thus facilitate the early diagnosis of various cancers . finally , the large em - field enhancement at the nanoprism s sharp tips will enhance the raman scattering intensity of the analytes . in theory , therefore , nanoprisms can be used to design effective substrates for surface - enhanced raman spectroscopy - based detection and quantification of multiple mirs simultaneously through integration of their spectral characteristic with the lspr shifts . all synthetic dna probes and micrornas were purchased from sigma - aldrich ( u.s.a . ) . pbs buffer prepared with rnase - free water was used to dilute oligonucleotides and mirs solutions . patient plasma was obtained from the indiana university simon cancer center solid tissue bank ( indianapolis , indiana ) . the gold nanoprism - based mir sensors were designed using our published procedure with modification . the attachment of gold nanoprisms on silanized glass substrates is described in the supporting information file . the substrate - bound nanoprisms were incubated in pbs buffer solution containing 1 m each of hs c6-ssdna - x and peg6-sh overnight and rinsed with pbs buffer . the initial lspr peak position of each sensing platform was determined using uv visible spectroscopy in pbs buffer and then was incubated in the different concentrations of mir solutions , for exmaple , either in pbs buffer , 40% bovine plasma , or 40% human plasma for 12 h at room temperature . the plasmonic biosensors were thoroughly washed with pbs buffer to remove any nonspecifically adsorbed species . the mir bound biosensor was then placed in pbs buffer for 10 min before the lspr peak position was determined . for uv vis extinction spectra measurement , one particular solvent was chosen to avoid the solvent dielectric constant effect , which is known to shift the lspr peak . total rna was isolated from plasma samples that were obtained from the indiana university simon cancer center solid tissue bank ( indianapolis , in , u.s.a . ) using trizol - ls reagent ( life technologies , carlsbad , ca , u.s.a . ) . cdna was generated using 10 ng of rna and mir-10b , mir-21 , or mir-4255p rt primers and a mir reverse transcription kit ( life technologies ) as per the manufacturer s recommendations . expression levels as determined by qpcr were normalized to mir-425 - 5p , since this mir was expressed at similar levels in all samples and exhibited < 1 cycle threshold ( ct ) difference across all samples . after normalization to mir-425 - 5p ( ct ) , the ct values for mirs in controls were averaged and subtracted from the ct values of each individual sample ( ct ) . the gold nanoprism - based mir sensors were designed using our published procedure with modification . the attachment of gold nanoprisms on silanized glass substrates is described in the supporting information file . the substrate - bound nanoprisms were incubated in pbs buffer solution containing 1 m each of hs c6-ssdna - x and peg6-sh overnight and rinsed with pbs buffer . the initial lspr peak position of each sensing platform was determined using uv visible spectroscopy in pbs buffer and then was incubated in the different concentrations of mir solutions , for exmaple , either in pbs buffer , 40% bovine plasma , or 40% human plasma for 12 h at room temperature . the plasmonic biosensors were thoroughly washed with pbs buffer to remove any nonspecifically adsorbed species . the mir bound biosensor was then placed in pbs buffer for 10 min before the lspr peak position was determined . for uv vis extinction spectra measurement , one particular solvent was chosen to avoid the solvent dielectric constant effect , which is known to shift the lspr peak . total rna was isolated from plasma samples that were obtained from the indiana university simon cancer center solid tissue bank ( indianapolis , in , u.s.a . ) using trizol - ls reagent ( life technologies , carlsbad , ca , u.s.a . ) . cdna was generated using 10 ng of rna and mir-10b , mir-21 , or mir-4255p rt primers and a mir reverse transcription kit ( life technologies ) as per the manufacturer s recommendations . expression levels as determined by qpcr were normalized to mir-425 - 5p , since this mir was expressed at similar levels in all samples and exhibited < 1 cycle threshold ( ct ) difference across all samples . after normalization to mir-425 - 5p ( ct ) , the ct values for mirs in controls were averaged and subtracted from the ct values of each individual sample ( ct ) .

micrornas ( mirs ) are small noncoding rnas that regulate mrna stability and/or translation . because of their release into the circulation and their remarkable stability , mir levels in plasma and other biological fluids can serve as diagnostic and prognostic disease biomarkers . however , quantifying mirs in the circulation is challenging due to issues with sensitivity and specificity . this letter describes for the first time the design and characterization of a regenerative , solid - state localized surface plasmon resonance ( lspr ) sensor based on highly sensitive nanostructures ( gold nanoprisms ) that obviates the need for labels or amplification of the mirs . our direct hybridization approach has enabled the detection of subfemtomolar concentration of mir - x ( x = 21 and 10b ) in human plasma in pancreatic cancer patients . our lspr - based measurements showed that the mir levels measured directly in patient plasma were at least 2-fold higher than following rna extraction and quantification by reverse transcriptase - polymerase chain reaction . through lspr - based measurements we have shown nearly 4-fold higher concentrations of mir-10b than mir-21 in plasma of pancreatic cancer patients . we propose that our highly sensitive and selective detection approach for assaying mirs in plasma can be applied to many cancer types and disease states and should allow a rational approach for testing the utility of mirs as markers for early disease diagnosis and prognosis , which could allow for the design of effective individualized therapeutic approaches .

Fabrication of the Plasmonic Biosensor for miRs Detection Detection of miR Levels in in Plasma from Pancreatic Cancer Patients Conclusion Materials and Methods Fabrication of LSPR-Based miR Sensors and Detection Total RNA Extraction and Quantification of MicroRNA by qRT-PCR Supplementary Material

complete or partial edentulism is a common occurrence . to fabricate accurate dental prostheses for rehabilitation of an edentulous area , precise impression of the hard ( dental ) and soft tissue taken with impression material with high dimensional stability use of impression materials with inadequate dimensional stability and accuracy increases the costs of treatment due to the need for repeating the impression and re - fabrication of the prosthesis or the need for modifications . moreover , long - term use of an improper prosthesis by the patients may have adverse consequences and can cause oral ulcers and subsequent infections . thus , impression making plays an important role in fabrication of an accurate prosthesis and minimizes the costs and complications of prosthetic treatment . different impression materials are available in the market with different compositions and characteristics , which make them suitable for use in different clinical situations . sodium alginate , polyether and silicon materials such as polyvinyl siloxane are among the most commonly used impression materials . zinc oxide impression pastes have long been used for final impression making of the edentulous jaws and rebasing of complete dentures . the polymerization shrinkage of these materials is insignificant following setting and has reported to be less than 0.1% . having low consistency before setting , these materials can yield a precise impression with well - defined surface details . they are used for final impression making of edentulous ridges with small or no undercuts , or as a light body with other impression materials , bite registration pastes and temporary liners for dentures and surgical dressings . moreover , they can be used for taking mucostatic or mucodisplacive impressions and they remain stable within their shelf life . the choice of impression material depends on the clinical indication and the clinician s judgment . since in some cases dentists do not have quick access to a laboratory to pour the impressions , impression materials preserving their dimensional stability for long periods of time must be necessarily used . this study aimed to assess the effect of storage time and temperature on dimensional stability of impressions made with cavex impression material . a round stainless steel mold was fabricated with five grooves ( three horizontal and two vertical ) according to iso 3107:2011 . in addition to these grooves , the mold had two lateral grooves to be filled with the impression material . the mold had been specifically designed for the purpose of determining the dimensional stability of the impression material and reconstruction of details ( fig . the mold with three horizontal and two vertical grooves cavex outline light body impression paste ( cavex holland bv , rw haarlem , netherlands ) was prepared as instructed by the manufacturer ( mixing time of 45 seconds , working time of 2.15 to 3.30 minutes ) and applied to the mold . the mold was placed on a block and stored in an incubator under 1 kg load , simulating oral conditions in terms of temperature and humidity ( 35c and 100% humidity ) until completion of setting time . the casts were poured immediately ( time zero ) and after 30 , 120 , 240 and 420 minutes and 24 hours with type iv dental stone ( heraeus kulzer inc . , south bend , in , usa)(fig . 2 ) . pouring the mold with stone all timings were kept using a chronometer ( junso , tokyo , japan ) . the impressions were stored at room temperature ( 23c ) in group one and in a refrigerator at 4c in group two . after completion of the setting time according to the manufacturer s instructions ( final setting time of four minutes ) , the cast was removed from the mold . to determine the linear dimensional stability in each group , a digital caliper ( mitutoyo , tokyo , japan ) with 0.001 mm accuracy was used . next , the distance between the vertical lines on the casts was compared with that in the immediately poured cast . according to walker et al , the change in the distance between the two vertical lines should not be more than 0.5% ; otherwise , the impression can not be identified as dimensionally accurate . the results were subjected to statistical analysis in spss version 22 ( spss inc . , il , usa ) to compare dimensional stability of the impressions based on the pouring time and storage temperature and calculate the absolute measurement error . the results showed that storage of impressions in a refrigerator and at room temperature for zero to seven hours had no effect on dimensional stability of the casts ( p>0.05 ) . however , 24 hours of storage in a refrigerator or at room temperature increased dimensional changes and decreased dimensional stability compared to the impressions stored for zero to seven hours in the same conditions ( p=0.001 ) . also , a significant association was found between dimensional changes following the storage of materials in the refrigerator ( 4c ) and at room temperature ( 23c ) for 24 hours ( p<0.01 ; tables 1 and 2 ) . the distance ( in millimeters ) between the vertical lines on the casts of impressions kept at 23c the distance between the vertical lines ( in millimeters ) on the casts kept at 4c figure 3 compares the mean and 95% confidence interval of the measured dimensions on the casts based on the pouring time ( the interval between the impression making and pouring ) . as seen in figure 3 , the mean distance between the vertical lines on the casts ( that can be used as an index to determine the acceptable threshold of dimensional changes ) was 24.78 mm after zero to seven hours of storage . after 24 hours of storage in a refrigerator ( 4c ) and at room temperature ( 23c ) , the difference ( ) was found to be 0.13 mm , and exceeded the acceptable threshold of dimensional changes for metal oxide impression materials , which is 0.1 mm . mean and 95% confidence interval of the measured dimensions on the casts based on the pouring time studies have shown that impression materials undergo dimensional changes due to the effect of environmental factors such as humidity and heat , composition of the impression material and storage time . cavex outline is a commonly used rigid impression material and belongs to the group of metal oxide impression materials . this study aimed to assess the precision of stone casts made using cavex outline impressions after different storage times in order to find the most suitable pouring time and storage temperature . the results showed that storage of cavex outline impressions in a refrigerator or at room temperature from zero to seven hours had no effect on their dimensional stability ( p>0.05 ) . however , 24 hours of storage in a refrigerator or at room temperature increased the dimensional changes ( decreased dimensional stability ) compared to the impressions stored for zero - seven hours in the same conditions ( p=0.001 ) . also , a significant association was found between dimensional changes due to 24 hours of storage of materials in a refrigerator ( 4c ) and at room temperature ( 23c ; p<0.01 ) . ghasemi et al , in their study evaluated the effect of storage time on dimensional changes of alginate , an irreversible hydrocolloid impression material . in their in - vitro , experimental study , 30 alginate impressions were made and poured after 15 , 60 and 240 minutes with dental stone within 10 seconds and after 45 minutes . they concluded that increasing the pouring time from 15 to 60 minutes resulted in dimensional changes in the height of the small die but did not affect other dimensions . their study was different from ours in that they used a metal pattern with two abutments for a three - unit bridge and a small and a large die ; whereas , in the current study , a round stainless steel mold was used to assess the dimensional stability of cavex outline impression paste . nonetheless , our results confirmed those of ghasemi et al , and showed that increasing the storage time decreased the dimensional stability of cavex outline impression material . cohen et al , and hollenback and smith evaluated the dimensional stability of hydrocolloid impressions and showed that hydrocolloid impressions must be poured immediately or maximally within 12 minutes . some researchers have reported that it is safe to keep the impressions in a humid environment for one to 18 hours [ 1416 ] . recent studies on impression materials show that the manufacturers are attempting to increase the storage time of impression materials . johnson and craig , eriksson et al , and schleier et al , reported that the storage time of hydrocolloid impression materials has increased and hydrocolloid materials can be stored in a humid environment for one , two or even four hours without undergoing significant dimensional changes . comparison of extended - pour and conventional alginates revealed that the casts poured after five days were not significantly different from the standard models . our findings were in line with the results of the above - mentioned studies and showed that storage for up to seven hours had no effect on dimensional stability , but 24 hours of storage resulted in unacceptable dimensional changes . review of the literature yielded no similar study on dimensional stability of cavex outline metal oxide impression pastes . thus , we compared our results with two other studies on different types of irreversible hydrocolloids from cavex . erbe et al , in 2012 made impressions with seven different materials namely blueprint , cavex ca37 , cavex color change , jeltrate , orthoprint , cavex orthotrace , and tetrachrom according to iso / cd 21563 . they compared the three - dimensional stability of irreversible hydrocolloid ( ih ) impression materials stored for up to seven days in low - moisture ( in a humidor ) and high - moisture ( wrapped in a wet paper towel ) conditions . the results revealed that if stored in a humidor , pouring of the ih impressions must be done within four hours . if stored in wet conditions , non - color - change ih impressions must be poured within two hours . in general , ihs with variable colors showed higher dimensional changes . for optimal dimensional stability , ih impressions must be poured as soon as possible . in another study in 2008 , sedda et al . evaluated the precision of casts made from alginate impression material poured immediately or after storage for specific time periods . they used five types of alginate namely ca 37 ( cavex ) , jeltrate ( dentsply caulk ) , jeltrate plus ( dentsply latin america ) , hydrogum 5 ( zhermack ) and alginoplast ( heraeus kulzer ) . the impressions were stored at 23c with 100% humidity and were then poured with dental stone immediately and after 24 , 72 and 120 hours . casts were evaluated and the results showed that the dimensional stability of the impression materials was influenced by the type of impression material and storage time . our findings were in accord with those of the above - mentioned studies and showed that increasing the pouring time for up to seven hours had no significant effect on cavex outline but further increase in storage time from seven to 24 hours decreased the dimensional stability , and the obtained casts were no longer reliable . assessment of the precision of stone casts obtained using cavex outline impressions stored for different time periods showed that the safe storage time for this impression material was zero ( immediately poured ) to seven hours and further storage for longer periods of time resulted in loss of dimensional stability . these findings suggest that impressions stored for more than seven hours should not be poured because of their decreased dimensional stability .

objectives : this study aimed to assess the effect of storage time and temperature on dimensional stability of impressions made with cavex outline zinc oxide impression paste.materials and methods : a round stainless steel mold with five grooves ( three horizontal and two vertical ) was used in this in - vitro experimental study . cavex outline impression paste was prepared according to the manufacturer s instructions and applied to the mold . the mold was placed on a block and stored at 35c and 100% humidity for setting . the impressions were poured with stone immediately and also after 30 , 120 , 240 and 420 minutes and 24 hours . the distance between the vertical lines on the casts was measured and compared with that in the immediately poured cast.results:storage in a refrigerator and at room temperature for zero to seven hours had no significant effect on dimensional stability of the impressions ; however , 24 hours of storage in a refrigerator or at room temperature decreased the dimensional stability of cavex outline ( p=0.001 ) . also , a significant association was found between dimensional changes following 24 hours of storage in a refrigerator ( 4c ) and at room temperature ( 23c ; p<0.01).conclusions : the optimal pouring time of cavex outline impressions with stone is between zero to seven hours , and 24 hours of storage significantly decreases the dimensional stability .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

studies of centenarians ( persons living to age 100 and over ) are useful in identifying factors leading to long life and avoidance of fatal diseases . these studies may be a sensitive way to find genetic , familial , environmental , and life - course factors associated with lower mortality and better survival [ 1 , 2 ] . several theoretical concepts suggest that early - life events and conditions may have a significant long - lasting effect on survival to advanced ages . these concepts include ( but are not limited to ) the idea of fetal origin of adult diseases also known as the barker hypothesis [ 3 , 4 ] and the related idea of early - life programming of aging and longevity ; the theory of technophysio evolution , the reliability theory of aging , and the high initial damage load ( hidl ) hypothesis in particular [ 6 , 7 ] . these ideas are supported by the studies suggesting significant effects of early - life conditions on late - life mortality [ 3 , 810 ] . finch and crimmins suggested that historical decline in chronic inflammation ( due to decreasing exposure to early - life infections ) has led to a decrease in morbidity and mortality from chronic conditions at old age . they showed that both childhood mortality and cardiovascular diseases of old age may share common infectious and inflammatory causes rooted in the external environment . month of birth often is used by epidemiologists as a proxy characteristic for environmental effects acting during in - utero and early infancy development . these early effects include temperature and sun exposure during in - utero and early postnatal period , nutritional status during early development , exposure to infectious agents , and other factors [ 3 , 13 , 14 ] . previous studies demonstrated that life expectancy may be influenced by person 's month of birth [ 1518 ] . however , studies of month - of - birth effects on longevity face significant difficulties in finding appropriate data on differential mortality by season of birth . longitudinal data with information about season of birth are the optimal data for study of month - of - birth effects on longevity . such longitudinal data were available for population of denmark and showed that the remaining life expectancy at age 50 was higher for persons born in october - november compared to persons born in april june . in other studies , the effects of month of birth on late - life mortality were estimated indirectly using information on mean age at death from cross - sectional collection of death certificates [ 1922 ] . little information is available on the month of birth association with exceptional longevity . to our knowledge , there is only one study that examines the effects of month of birth on longevity . in this study , month - of - birth distribution of 925 age - validated german semi - supercentenarians ( persons aged 105 + years ) was compared to seasonal distribution of births in the german empire at the time of semi - supercentenarians ' birth ( 18801900 ) . it was found that more semi - supercentenarians than expected were born in december while the proportion of semi - supercentenarians born in june was low . this study suggests that the december - born have a significantly higher risk of surviving up to age 105 + compared to the june - born although it can not be indicated unequivocally if month - of - birth pattern among semi - supercentenarians is due to seasonality of infant mortality or later - life month - of - birth effects . additional problems in the studies of month - of - birth effects on longevity arise from possible confounding due to between - family variation in childhood socioeconomic conditions [ 2426 ] and parental genetic background . one possible solution to these challenges is to compare associations within sibships taking into account that socioeconomic and genetic background is similar for siblings from the same family [ 14 , 28 ] . in this study , we analyze the effects of month of birth on survival to age 100 years using a large set of centenarians born in the united sates in 18801895 and their shorter - lived siblings and spouses . siblings share early childhood conditions including parental socioeconomic status , genetic background , and geographical location while spouses share common adulthood environment . it was shown that longevity has a significant familial component [ 2932 ] suggesting the need to control for this important factor . comparing month - of - birth characteristics of adult siblings or spouses with that of centenarians provides an opportunity for obtaining net effects of month - of - birth on survival and control for unobserved confounding factors . this study compares centenarians to their shorter - lived siblings ( who share common childhood conditions and genetic background ) and spouses ( who share common adulthood environment ) using a large set of computerized family histories . family histories ( genealogies ) proved to be a useful source of information for studies in historical demography and biodemography [ 34 , 35 ] . in this study , data were collected through a search of over 400,000 online family histories available at rootsweb ( http://wc.rootsweb.ancestry.com ) , which is one of the largest publicly available repositories of online genealogies . search for centenarians in the rootsweb database was conducted with assistance of the web - automation technique , which allows researchers to run automated queries ( using program scripts in php language ) and search online databases for individuals with desired properties ( persons who lived 100 + years in our case ) . applying this technique helps researchers to save time and effort on routine data collection from online resources . application of the web - automation technique to the rootsweb publicly available online resource identified over 40,000 records of centenarians born in 18801895 with known names of their parents . however , in many cases , one and the same centenarian appeared in two or more genealogies . after removing these duplicates , we obtained 23,127 records for centenarians born in 18801895 with detailed information on their birth and death dates as well as birth and death dates of their parents . according to the past experience with computerized genealogies , availability of detailed information on vital events ensures a good quality of collected genealogies . however , a significant proportion of records for siblings in the obtained genealogies did not contain information about death dates that we needed for the within - family analysis of human longevity . so the next step was to indentify the most informative families with complete information on birth and death dates for siblings . as a result of this identification procedure , we found 2,834 families where information on birth and death dates was known for more than 80 percent of siblings in a family . this procedure resulted in a set of families having higher - than - average sibship size and hence providing more control records ( siblings ) for the matched case - control study . during this data refining procedure , the proportion of male centenarians in genealogies dropped from 28.2% to 23.2% ( see table 1 ) and became close to the proportions reported in the usa censuses ( 19.324.0% ) , which indicates an improvement in quality for the selected genealogies . previous studies demonstrated that age misreporting and age exaggeration in particular are more common among long - lived individuals [ 38 , 39 ] . therefore , the primary focus of data cleaning in this study was on the age verification for long - lived individuals . we followed the approach of age verification and data linkage [ 38 , 40 ] , which we applied previously on another dataset of centenarians . this approach involves data consistency checks , death date verification through the linkage to the social security administration death master file ( dmf ) and birth date verification through the linkage to early usa censuses . dmf is a publicly available data resource ( available at the rootsweb.com website ) , which covers deaths that occurred in the period 19372010 and captures about 95% of deaths recorded by the national death index . information on siblings and spouses of validated centenarians was collected using the web - automation technique described earlier . note that the proportion of males among validated centenarians found in genealogies ( 23% ) is close to the official reports ( 1924% ) for centenarians in the united states based on the census data . we used only those records of centenarians whose age was successfully confirmed through the dmf ( with matched birth and death years ) . we added only few cases where death year was different from that found in the dmf ( however , in these cases , the individual still had a centenarian status ) . our previous work with centenarian data cleaning showed that incorrect death dates was the main source of errors in genealogical records of centenarians . at the same time , birth dates were correctly reported in practically all records that had correct death dates and good consistency of birth and death dates for parents and siblings . therefore , in this study we conducted a birth date verification procedure for a portion of approximately 15% of records . in all cases , birth years of centenarians agreed well with information reported in 1880 , 1900 , or 1910 censuses ( as well as information about birth years of siblings ) . in addition to that , partial verification of centenarian birth dates was already accomplished through the linkage to dmf . as a result of data quality checks , we found 1,574 records of centenarians born in 18801895 with verified birth and death dates . given the fact that longevity is often clustered in families , we found other centenarians in the studied families ( born outside the 18801995 time window ) so that the total number of centenarians increased to 1,945 persons . note that the majority of centenarians lived less than 103 years and there are no claims of extraordinary high longevity ( above 112 years ) in the sample . birth dates were reconstructed for all centenarian siblings using information available in computerized genealogies and early censuses . the procedure of death date verification using dmf is not feasible for validating death dates of shorter - lived siblings or spouses ( used as controls ) because data completeness of dmf is not very high for deaths occurred before the 1970s . taking into account that exact ages of death for controls ( siblings ) are not particularly important for comparison ( it is sufficient to assume that they lived less than 100 years ) , we relied on death date information recorded in family histories for siblings and spouses not found in external sources . this approach was used previously in the utah population database study for individuals died before 1932 . death dates were reconstructed for 99.99% of siblings using the social security death master file , state death indexes , and online genealogies ( only 124 out of 13,654 cases were left unresolved ) . data for 10,885 siblings of 1,574 centenarians were used in this study . as a result , each case ( centenarian ) had about 7 control siblings on average . the sibship size ( eight siblings on average ) in the studied centenarian families is higher than the average number of children in american families reported by the 1900 usa census : 5.12 0.01 ; data obtained from the 5% sample of the us 1900 census from the integrated public use microdata series ( ipums ) . larger sibship size in the centenarian families compared to the general population can be explained by the fact that genealogies are more likely to be compiled for larger families and that longer - lived individuals in the united states were born more often in rural areas with higher fertility [ 41 , 45 ] . this difference in sibship size with the general population is not critical for the within - family design of this study when appropriate control group ( shorter - lived siblings raised in the same family or spouses ) is selected . 171 siblings and 4 centenarians had unknown month of birth , so their records were excluded from the statistical analyses . as expected , spouses have higher age at death than siblings whose age at death was not conditioned on survival to ages eligible for marriage . spouses of male centenarians were approximately 5 years younger and spouses of female centenarians were about 3 years older on average than their long - lived mates ( see table 3 ) . 5% sample of the us 1900 census ( with information on month of birth ) was used for comparisons with the general population . this study explored the effects of month of birth on the likelihood of survival to age 100 . centenarians ( cases ) were compared to their normal shorter - lived siblings ( controls ) or spouses using a within - family analysis . this approach allows investigators to study the within - family differences , not being confounded by the between - family variation . siblings were born in a wider time window than centenarians but on average in the same year . taking into account relatively high child mortality in the 19th century , we conducted analyses with different lifespan cut - offs in order to study late - life survival to advanced ages and evaluate the stability of results . the main approach used in this study differences in the month - of - birth distributions between centenarians or their siblings and the general population according to the 1900 us census were assessed with the chi - square test . standardized residuals were calculated in order to determine which months of birth may be major contributors to rejection of the null hypothesis ( in the case it is rejected ) . when the absolute value of the residual is greater than 2.00 , it indicates that it was a major influence on a significant chi - square test statistic . the chi - square test was also used to examine whether gender or longevity is related to the month of birth . statistical analyses of the within - family effects for 1 : n matched study were performed using a conditional multiple logistic regression model ( fixed - effect model ) to investigate the relationship between an outcome of being a case ( long - lived person ) and a set of prognostic factors [ 46 , 47 ] . the likelihood of survival to advanced ages ( to be in the centenarian group ) is used as a dependent variable and month of birth and gender are used as explanatory variables . however , the bonferroni adjustment is often criticized by statisticians as being too conservative [ 49 , 50 ] . a technique proposed by benjamini and this technique is based on controlling the false discovery rate ( fdr)the proportion of significant results that are actually false positives . according to the benjamini and hochberg procedure , the null hypothesis is rejected when ordered individual p values ( from smallest to largest ) are lower than ( i / m)q , where i is a rank of p value , m is the total number of tests , and q is the chosen fdr . comparison of month - of - birth distributions for centenarians and their shorter - lived siblings with month - of - birth distribution for persons born in 18801890 and enumerated by the 1900 us census showed statistically significant differences ( p < 0.001 for both centenarians and their siblings ) . table 4 shows month - of - birth distribution for centenarians , their siblings survived to adulthood and the general population . in the case of centenarians , absolute values of standardized residuals exceeded the critical value of 2 in six cases : there is an excess of centenarians born in september november and a lack of centenarians born in march , may , and july . figure 1 shows that the excess of centenarians born in the fall months is particularly high compared to the general population . for siblings , absolute values of standardized residuals overall , the seasonal pattern of births for siblings is closer to that for the general population compared to the seasonal pattern of births for centenarians ( figure 1 ) . in the general population , more persons were born in the first half of the year ( 51.8% ) while more centenarians were born in the second half of the year ( 53.12% ) . centenarian siblings occupy an intermediate position with 49.94% being born in the first half of the year . these differences in birth seasonality ( being born in the first or the second half of a year ) between centenarians and their shorter - lived siblings ( survived to age 20 ) are statistically significant ( chi - square test statistic = 5.03 , df = 1 ; p = 0.025 ) . as shown in table 4 and figure 1 , month - of - birth distribution for centenarians also departs from the distribution of their shorter - lived siblings and this difference is statistically significant ( all siblings : chi - square test statistic = 19.99 , df = 11 , p = 0.045 ; siblings survived to age 20 : chi - square test statistic 19.50 , df = 11 , p = 0.053 ) . at the same time , we found no statistically significant association between month of birth and gender . to analyze the effects of month - of - birth on exceptional longevity , which are not confounded by birth and infant death seasonality , childhood conditions , or genetic background , a within - family study was conducted . to discriminate between the effects due to differential survival early in life from the late - life effects , we analyzed survival to age 100 among siblings conditional on their survival to different adult ages . table 5 presents the odds ratios to become a centenarian for siblings born in different months and survived to 30 , 50 , and 70 years of age . this survival advantage of persons born in the fall months is consistent across different lifespan cut - offs suggesting long - lasting influence of season of birth on longevity . being born in the spring months was associated with decreased chances of survival to age 100 while birth in the fall months significantly increases chances to become a centenarian . figure 2 depicts the general pattern of month - of - birth effects on longevity after age 50 . this pattern suggests that persons born during the fall months have higher chances of survival to age 100 compared to march - born individuals who have the lowest chances of achieving longevity . july - born individuals also show low odds of survival to age 100 compared to individuals born in fall . it was suggested that month - of - birth effects on mortality may become weaker for later - born cohorts . to test whether the season - of - birth effects are weaker in later - born cohorts , we split the sample of centenarians and siblings into two approximately equal groups : those who were born before 1899 and those who were born after this year . the effects of month - of - birth on survival after age 50 for these two cohorts are presented in table 6 . for group born before 1899 , the odds of survival to 100 are significantly higher for persons born in november compared to persons born in march . for later - born cohorts , the month - of - birth effect is much weaker and not statistically significant after adjustment for multiple comparisons . in order to control for living conditions during the adult life , we compared centenarians with their spouses . the results of these comparisons are shown in table 7 and confirm the month - of - birth pattern in longevity found in previous analyses . again , individuals born in october - november have a significantly higher likelihood of survival to age 100 compared to individuals born in april . we found that persons born in the fall months are more represented among centenarians compared to the general population while persons born in the first half of the year are less represented among the group of long - lived individuals . centenarians , their siblings , and the general population show decreased proportion of persons born during the summer months , which is probably related to seasonal distributions of births and infant deaths in the past . the month - of - birth pattern among centenarians in this study is compared to the month - of - birth distribution of persons aged 520 years in the us 1900 census and hence the results of this comparison are not affected by seasonal distribution of infant deaths . in the previous study of german semi - supercentenarians , seasonal distribution of birth dates of long - lived individuals was compared to the seasonal distribution of births 105 years earlier , so this comparison may be influenced by seasonality of infant deaths in the past . at the same time , our results demonstrate some similarity with the results of semi - supercentenarian study : persons born in the second half of the year are over - represented among german semi - supercentenarians as it was shown in this study . the within - family multivariate analysis demonstrated a survival advantage of individuals born in september november compared to individuals born in march . a similar pattern of season - of - birth and longevity was also found for spouses of centenarians , which reinforces the findings obtained for centenarian siblings . these results are in agreement with previous publications on the effects of month - of - birth on lifespan in the countries of the northern hemisphere [ 15 , 16 , 21 , 22 , 53 ] and in the united states in particular [ 19 , 54 ] . these earlier studies show better survival for persons born in september december compared to persons born in the middle of the year . at the same time , the results of this study show that individuals born in march or april have similar low odds of achieving longevity as individuals born during the summer months and persons born during the winter months do not live longer than the march - born individuals . this is different from the results of other studies , which showed decline in mean age at death for persons born during the summer months and relatively high mean age at death for persons born during the winter months [ 19 , 21 , 22 ] . these differences in month of birth pattern between our study and other publications can be partially explained by changes in seasonality of births and infant deaths over time . births usually peak in march and hence march - born individuals are overrepresented among both living and dead persons ( this is the reason why march - born individuals are highly represented in the general population , see figure 1 ) . studies based on the analysis of cross - sectional death certificates do not have information about population at risk and hence may be affected by secular changes in seasonality of births and infant deaths . although these secular effects probably do not significantly modify the overall month - of - birth pattern in life expectancy , they can affect amplitudes of seasonal effects for specific months . it would be reasonable to suggest that decline of summer infant deaths over time resulted in increased representation of summer - born individuals in the later - born cohorts , which led to an apparent drop in the mean age at death for persons born in these months . study of the earlier - born and the later - born groups found that the season - of - birth effects fade in the later born cohorts ( table 6 ) , which is consistent with previous reports and can be explained by improving nutrition and sanitation over time . we found no gender differences in month - of - birth distributions for both centenarians and their siblings , which is consistent with previous publications . it should be noted that another study of season - of - birth effects on life span in the single - year usa birth cohorts ( based on the usa social security administration data ) found that life expectancy at age 80 depends on month of birth . in this study , 80-year olds born in may - june showed significantly lower life expectancy compared to individuals born in the end of the year and this seasonal pattern repeats itself in every studied birth cohort . this month - of - birth pattern of life expectancy is similar to the pattern reported earlier for mean age at death obtained on the basis of the usa death certificates . however , in the study of centenarians and their siblings , we do not find a specific survival advantage for persons born in the winter months . it is possible that certain unobserved socioeconomic or other characteristics of parents ( such as possible preferential winter births for wealthier social groups ) , which are controlled for in the case - sibling design of our study , may result in apparently better survival of winter - born individuals in the general population . our within - family study follows centenarians and their siblings from birth until the end of their life while previous studies analyzed a cross - sectional sample of the usa death certificates for persons belonging to multiple birth cohorts . for this reason , our results do not depend on the secular changes in seasonality of births and infant deaths . another advantage of this study is its within - family design , which controls for unobserved characteristics of childhood conditions and parental genetic background . this study confirms the existence of month - of - birth effects on longevity and shows that these effects can be observed even after controlling for unobserved between - family variation . some limitations of this study should be mentioned . due to the data collection from computerized genealogies , we can not be certain that centenarians ( and controls ) represent a random population sample . this limitation is not crucial for the analytical approach applied in this study , which tests specific hypothesis of seasonal birth effects on longevity , but may pose a question about generalizability of results . it is believed that the rootsweb source of online family histories has more individuals with larger families and better offspring survival . this deviation from the general population may potentially affect the results of univariate analyses when month - of - birth distributions for centenarians and siblings are compared to the general population . however , in the within - family analyses , we compare siblings with each other rather than with the general population , so the difference in family size does not affect the results of hypothesis testing about the month - of - birth effects on longevity . also , comparison with the general population shows better similarity of month - of - birth pattern for siblings rather than centenarians suggesting that shorter - lived siblings are closer to the general population in terms of month - of - birth distribution . another problem is that some month - of - birth effects become not statistically significant after adjustment for multiple comparisons . for example , month - of - birth effects become nonsignificant when survival of siblings after age 70 is studied . however , the overall pattern of month - of - birth effects on longevity shows consistency across different age cut - offs suggesting a stability of the observed seasonal pattern . in addition to that , independent analyses on centenarian spouses demonstrated a similar pattern of month - of - birth effects on longevity . finally , the conditional logistic regression analyses suggest that despite significant effects of months of birth on relative survival the effect sizes of month - of - birth effects on survival to 100 are small and explain about 2% of the variance of becoming a centenarian . this small percentage of explained variance is related to very high variability of individual lifespan , which has a substantial stochastic component . there are several possible explanations of why month of birth may affect mortality and health later in life . one explanation suggests that nutritional status of mother during pregnancy may affect fetal development in utero [ 3 , 56 ] . nutritional deficiencies during early development may have long - lasting effects on mortality later in life . this explanation is supported by the ames theory that micronutrient deficiencies play a major role in dna damaging , human aging , and premature deaths from cancer and heart disease . recent review suggests that both improper diet stimulating chronic inflammation and dietary deficiencies and nutrient imbalances may be strong sources of mutagenesis . so it is reasonable to hypothesize that seasonal vitamin deficiency during the critical periods of fetus and infant development may affect later health and longevity of the deficiency - exposed birth cohorts . birth weight often serves as an indicator of nutritional status during early development and was shown to be dependent on month of birth . for example , in greece , infants born during the autumn and winter seasons of the year had significantly increased birth weight and gestation age . recent review of birth weight seasonality in developed countries shows a tendency of infants born during the fall and winter seasons in european countries to have higher birth weights . there are also reports that premature births show a slight excess of incidence during the months of june august . early seasonal impacts on subsequent adult lifespan may include not only seasonal vitamin deficiency , but also other seasonal impacts , such as infectious diseases . the most drastic effects of infectious agents in pregnancy , which probably represent the tip of the iceberg of the damage to progeny , include the following : cardiac malformation , deafness , cataracts , glaucoma , and tooth defects for the rubella virus ( german measles ) ; growth retardation , blindness , mental retardation , and deafness for cytomegalovirus ; skin scarring , muscle atrophy , and mental retardation for varicella ( chickenpox ) [ 62 , 63 ] . it was shown that poliovirus epidemics peak in july - august and exposure to this virus in the second trimester of gestation seem to produce subsequent adult schizophrenia in february birth cohorts . effect of environmental temperature during the time of birth or conception may be another possible explanation for low proportion of centenarians among individuals born during the summer and spring months . for example , british women experiencing higher summer temperatures during their first year of life and hence suffering severe diarrhea and dehydration in infancy had higher blood pressure at older ages . high ambient temperature was also associated with higher risk of preterm delivery in the recent study of a large sample of california births . there are reports that high temperatures may be implicated in lower sperm quality [ 67 , 68 ] , particularly among smokers . this may result in a less viable progeny born during the spring months . on the other hand , cold outdoor temperature at birth during the winter months is associated with coronary heart disease , insulin resistance , and poor lung function at older age . it was suggested that schools or other professional training organizations , which have a deadline for admission , may favor children who are somewhat older compared to their peers ( usually children born in the fall months ) . this so - called deadline hypothesis predicts that the relative advantage in school achievement has cumulative effects over the life course . in the case of historical data , the deadline hypothesis should be more relevant to survival of men whose social status is dependent on their own achievements . for women , their social status in the past was predominantly determined by the social status of their husbands . in the case of centenarians , who are predominantly women , the deadline hypothesis looks like a less likely explanation of the observed month - of - birth effects on longevity . analysis of the existing literature suggests that persons born in the fall months in the united states could avoid extremes of very high and very low ambient temperatures during their first month of life as well as high summer temperatures during conception . persons born during the fall months also did not experience an early exposure to infectious diseases , which were common during summer , early winter , or spring months in the past . seasonal pattern of the usa mortality for children below age one month in the past supports this suggestion . according to the usa statistics , mortality below age one month in 1940 was the lowest in september november suggesting lower infectious load during this period of the year , because most infant deaths in the past were caused by infections . better maternal nutrition during the last trimester of pregnancy also contributed to the survival advantage of individuals born during the fall season . all these three factors ( mild ambient temperatures , better maternal nutrition , and low infectious load ) helped persons born in the fall months to avoid accumulation of excessive number of defects by body systems very early in life . these results are consistent with the high initial damage load ( hidl ) hypothesis [ 6 , 7 ] , which emphasizes the importance of the initial level of damage in determining future human longevity . more specific explanation of the observed month - of - birth effects on longevity can be provided by the inflammation hypothesis suggested by finch and crimmins . according to this hypothesis , a strong acute - phase inflammatory response to childhood infections initiates chronic inflammation , which promotes chronic diseases of aging . reduced lifetime exposure to infection and subsequent inflammation may explain both declining mortality at older ages and decreasing amplitude of month - of - birth effects on lifespan over time . the results obtained in this study suggest that optimizing the process of early development can potentially result in avoiding many diseases in later life and significant extension of healthy life span . more research is needed to determine more specific factors of seasonal birth effects on longevity . this is the first study of association between month of birth and exceptional longevity , which controls for early - life shared conditions and common genetic background . we developed a large sample of validated centenarians , their siblings , and spouses to study early - life seasonal effects on human longevity . we found significant associations between month of birth and longevity : individuals born in september these results are consistent with the reports of higher life expectancy for persons born in the end of the year [ 16 , 19 , 21 , 22 ] and the study of mortality after age 80 in several single - year usa birth cohorts . the results of this study demonstrate that month - of - birth effects on exceptional longevity persist after controlling for shared childhood environment and unobserved shared characteristics of parents . association of month - of - birth with exceptional longevity appears to be stronger for earlier birth cohorts born before 1899 . similar month - of - birth effects on longevity were found for centenarian spouses : individuals born in october - november were more likely to live to 100 compared to individuals born in april . the results of this study suggest that early - life environmental conditions may have long - lasting effects on human aging and longevity .

this study explores the effects of month of birth ( a proxy for early - life environmental influences ) on the chances of survival to age 100 . months of birth for 1,574 validated centenarians born in the united states in 18801895 were compared to the same information obtained for centenarians ' 10,885 shorter - lived siblings and 1,083 spouses . comparison was conducted using a within - family analysis by the method of conditional logistic regression , which allows researchers to control for unobserved shared childhood or adulthood environment and common genetic background . it was found that months of birth have significant long - lasting effect on survival to age 100 : siblings born in september november have higher odds to become centenarians compared to siblings born in march . a similar month - of - birth pattern was found for centenarian spouses . these results support the idea of early - life programming of human aging and longevity .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

elasticity imaging quantifies and displays tissue stiffness properties non - invasively by measuring their displacement in response to mechanical stimulation . the word elastography , first coined by ophir et al . in 1991 , has become an umbrella term for any elasticity imaging technique . using the same physical basis as clinical palpation , elastography has clinical usefulness because pathologic processes including cancer and fibrosis alter tissue elasticity ( stiffness ) . elasticity corresponds to a quantifiable biomechanical parameter called young s elastic modulus , which can be up to 10 times higher in malignant tissue compared with benign tissue . elastography can be performed using different imaging modalities although in the last few years there has been an explosion of research into ultrasound elastography ( use ) , which has been fuelled by its appearance on modern clinical ultrasound ( us ) machines . use has been most extensively investigated in the breast where evidence suggests that it can improve the specificity of conventional us for breast malignancy without appreciably lowering its sensitivity . use has been evaluated for almost every tissue amenable to transcutaneous or endoscopic us interrogation . at the time of writing , over 50 pilot studies have been published for use in the head and neck region including the thyroid gland , cervical lymph nodes , salivary glands and miscellaneous neck masses . this article outlines the basic principles of use and summarizes the published evidence regarding the accuracy of use for malignancy in the head and neck . use can be divided broadly into 2 groups depending on the type of tissue displacement that is tracked in tissues that have been subjected to a deforming force . strain elastography measures tissue displacements occurring along the axis of an applied force , which are termed longitudinal , bulk or compression waves . an analogy of this type of displacement is that of an elastic spring that is compressed or relaxed along its length . shear wave elastography measures a different type of wave that is also produced when tissues are mechanically stimulated . shear waves are comparatively weak waves that are generated by tangential sliding of tissue particles , which travel perpendicular to the direction of the applied force . strain elastography was the first technique to appear on clinical us systems because it could be performed using conventional us hardware with software modifications , and currently is the most widely published . transducer positioning is similar to that of conventional us , with identification of the tissue of interest in the gray - scale image . then either gentle intermittent freehand compression is applied via the transducer along the axis of the us beam ( axial ) , or the transducer is held stationary and endogenous stimuli such as arterial pulsations or other physiologic motions are used to displace tissues . from the radiofrequency ( rf ) data received , tissue displacements along the beam axis ( axial ) are determined by comparison of successive image frames using software cross - correlation methods , and tissue strain ( change in length / original length ) is calculated for each spatial location . the resultant strain data are displayed graphically as a two - dimensional map of relative tissue strain , called an elastogram ( fig . elastograms are usually displayed as a semi - transparent overlay onto gray - scale images using a colour - coded scale that can vary between us systems . nowadays , all commercial strain use systems display strain elastograms dynamically , giving rise to the term real - time elastography ( rte ) . returning us signals are analysed to measure tissue displacements for different depths ( b ) , which are converted to strain data ( displacement / original length ) ( c ) . the graphs represent data from a single scan line through the middle of the lesion . the resulting strain data for multiple scan lines is displayed graphically as an elastogram corresponding to relative strain ( d ) . this lesion is conspicuous on the elastogram due to its difference in strain compared with the surrounding tissue . a tissue containing a stiff lesion is compressed longitudinally by a transducer while performing us ( a ) . returning us signals are analysed to measure tissue displacements for different depths ( b ) , which are converted to strain data ( displacement / original length ) ( c ) . the graphs represent data from a single scan line through the middle of the lesion . the resulting strain data for multiple scan lines is displayed graphically as an elastogram corresponding to relative strain ( d ) . this lesion is conspicuous on the elastogram due to its difference in strain compared with the surrounding tissue . stiff lesions deform less than soft lesions for a given stress , and thus have lower strain . strain ( no units ) = change in length / original lengthstress ( kpa ) = force / areastiffness young s elastic modulus ( kpa ) = stress / strain ( hooke s law ) strain ( no units ) = change in length / original length stress ( kpa ) = force / area stiffness young s elastic modulus ( kpa ) = stress / strain ( hooke s law ) strain elastography is optimally performed using minimal strains ( 1% ) as higher strains can alter tissue stiffness , resulting in misleading elastograms . young s modulus can not be calculated from strain elastograms because it is not possible to determine stress reliably for each spatial location due to factors that cause inhomogeneity in the stress field , such as boundary conditions and stress decay . the earliest commercially available strain use systems were only capable of producing elastograms , thus interpretation was by necessity qualitative . however , these have been superseded by second - generation systems that produce semi - quantitative output as strain ratios ( srs ) . there is no standardized method of interpreting elastograms qualitatively in the head and neck although many classification systems use a framework that was first described for breast elastography . these assess lesion stiffness visually using a 4- to 6-point elastographic scale ( es ) according to the relative proportion of low strain ( high stiffness ) areas within the lesion ; stiffer lesions are assigned higher es scores ( fig . 2 ) . other criteria such as margin regularity , distribution of stiff areas ( e.g. peripheral rim versus central ) and area ratios area ratio refers to the area of the lesion displaying low strain divided by the area of lesion visible on the corresponding gray - scale image . in the breast , high area ratios ( > 1 ) are predictive of malignancy , which may reflect the presence of a peritumoural desmoplastic response . for sr estimation , the ultrasonographer selects an electronic region of interest ( roi ) in the tissue of interest and a reference tissue , and the ratio of strain between these is computed ( fig . srs are normally displayed such that values > 1 indicate the target lesion has lower strain ( higher stiffness ) than the reference tissue . the lesion s margin on the corresponding b mode image is shown by the dotted line . lesions are visually graded from es1 to es5 based on the relative proportion of low strain ( red ) and high strain ( green ) areas . low and high es scores suggest a soft and stiff lesion compared with the surrounding tissue , respectively . figure 3strain elastogram with the corresponding gray - scale us image of a benign hyperplastic thyroid nodule ( white arrow ) showing a colour - coded map and rois placed to calculate the strain ratio . the lesion s margin on the corresponding b mode image is shown by the dotted line . lesions are visually graded from es1 to es5 based on the relative proportion of low strain ( red ) and high strain ( green ) areas . low and high es scores suggest a soft and stiff lesion compared with the surrounding tissue , respectively . strain elastogram with the corresponding gray - scale us image of a benign hyperplastic thyroid nodule ( white arrow ) showing a colour - coded map and rois placed to calculate the strain ratio . recently , quantitative use systems utilizing shear wave elastography ( swe ) have appeared . in swe systems , a specially modified transducer produces focused impulses of high - intensity acoustic radiation ( ultrasound ) , termed push pulses , at specific locations within the tissue of interest . this induces shear waves , whose velocities are tracked by a series of normal intensity impulses using ultrasound correlation methods ( fig . 4 ) . shear waves propagate in solids but not true liquids , and travel with a velocity proportional to the square root of the tissue stiffness , according to the following formula : where e is stiffness , i.e. young s elastic modulus ( kpa ) , c is the shear wave velocity ( m / s ) , and is the density ( kg / m ) . for most soft tissues , ( a ) an elastography roi ( black box ) is placed over a mass on the gray - scale us image . ( b ) high - intensity acoustic impulses ( orange arrows ) are transmitted into the tissue , which induce shear waves ( blue ) . ( c ) diagnostic impulses ( green arrows ) track shear wave propagation . in this example ( d ) the swe map displays the mass on the basis of its stiffness contrast compared with the adjacent parenchyma . ( a ) an elastography roi ( black box ) is placed over a mass on the gray - scale us image . ( b ) high - intensity acoustic impulses ( orange arrows ) are transmitted into the tissue , which induce shear waves ( blue ) . ( c ) diagnostic impulses ( green arrows ) track shear wave propagation . in this example ( d ) the swe map displays the mass on the basis of its stiffness contrast compared with the adjacent parenchyma . the precise implementation of swe technology differs between us system manufacturers , and are given different descriptions including arfi ( acoustic radiation force impulse ) imaging and ssi ( supersonic shear imaging ) . in arfi systems , the ultrasonographer positions a fixed size roi ( typically a 5 5 mm box ) over the tissue of interest on the gray - scale image , triggers the arfi capture mode , and shortly afterwards an estimate of the mean shear wave velocity value of the roi is displayed ( fig . real - time elastograms are not generated by current arfi systems and although this method is quantitative in terms of displaying an estimate of the shear wave velocity , the elastic modulus is not calculated . however , another us system manufacturer uses proprietary technology termed ssi , in which a relatively large field of view is interrogated using supersonic speed push pulses that induce and amplify shear waves , and the induced shear waves are tracked throughout the entire window using ultrafast ultrasound tracking impulses and computationally demanding software post - processing . this system displays real - time colour - coded elastograms of shear wave velocity ( m / s ) or elastic modulus ( kpa ) , and quantitative elastic modulus measurements can be obtained for rois placed within static elastograms ( fig . figure 5longitudinal us image of a thyroid lobe in a patient with multinodular goitre showing arfi measurement in a region of normal thyroid parenchyma ( white arrow ) . the roi for arfi measurement is a square box of fixed dimensions ( 5 5 mm ) . the mean arfi velocity for the roi is 1.79 m / s . figure 6transverse gray - scale us image with corresponding shear wave elastogram of a hypoechoic thyroid nodule ( white arrow ) , which was confirmed to be a benign hyperplastic degenerative nodule . the mean swe stiffness of the nodule is 11.1 kpa and of the parenchyma is 16.4 kpa . longitudinal us image of a thyroid lobe in a patient with multinodular goitre showing arfi measurement in a region of normal thyroid parenchyma ( white arrow ) . the roi for arfi measurement is a square box of fixed dimensions ( 5 5 mm ) . transverse gray - scale us image with corresponding shear wave elastogram of a hypoechoic thyroid nodule ( white arrow ) , which was confirmed to be a benign hyperplastic degenerative nodule . the mean swe stiffness of the nodule is 11.1 kpa and of the parenchyma is 16.4 kpa . use is quick to perform and well tolerated by patients , adding only a few minutes per lesion to conventional sonographic examinations . there are several caveats when performing use . as use requires returning rf signals to generate a signal , it is unsuitable for lesions that are obscured ( e.g. by rim calcifications ) or contain too few acoustic reflectors ( markedly hypoechoic / anechoic lesions ) . strain elastography requires a reference tissue in the elastogram because it displays relative strain . by contrast , swe is an absolute quantitative method and thus can be performed for lesions that are larger than the elastographic window . both strain elastography and swe are unreliable for tissues more than a few centimetres deep to the skin surface using currently available linear transducers due to progressive decay of the stress field at increasing distances away from the stimulus . strain elastography is also unreliable for lesions that are partially cystic because the liquid component may dissipate the applied stress rather than transmit it to the adjacent solid component , which may result in solid components appearing artefactually stiff . assessment of very superficial lesions may be hindered by the presence of artefacts in the near field caused by stress concentration that occurs when a transducer is applied onto the skin ( fig . furthermore , the boundary of structures with very different stiffnesses can produce localized distortions of the stress field , resulting in artefacts . several other types of artefact have been described in the head and neck for rte and swe . figure 7transverse gray - scale us image with corresponding shear wave elastogram of a hypoechoic parotid nodule ( black arrow ) , which was confirmed to be a pleomorphic adenoma . there is focal stress concentration in the superficial tissues overlying the nodule , seen here as regions of red colour on the elastogram ( white arrows ) . some of the high stiffness areas appear to extend into the superficial aspect of the nodule . stress concentration may be problematic for assessing superficial head and neck lesions that produce a marked convex bulge of the skin . transverse gray - scale us image with corresponding shear wave elastogram of a hypoechoic parotid nodule ( black arrow ) , which was confirmed to be a pleomorphic adenoma . there is focal stress concentration in the superficial tissues overlying the nodule , seen here as regions of red colour on the elastogram ( white arrows ) . some of the high stiffness areas appear to extend into the superficial aspect of the nodule . stress concentration may be problematic for assessing superficial head and neck lesions that produce a marked convex bulge of the skin . both strain elastography and swe are operator dependent , requiring careful attention to practical technique . minimal pressure should be applied with the transducer on the skin during acquisitions because tissue elastic modulus varies according to the amount of resting pressure applied , termed precompression . in this regard , excessive precompression increases the stiffness of tissues globally while lowering relative stiffness contrast between different tissues , which can produce misleading elastograms . first ; as described above , excessive compression alters tissue stiffness , and second ; non - axial displacements ( i.e. displacements occurring laterally or out of the imaging plane ) can degrade the accuracy of software correlation algorithms , resulting in decorrelation artefacts and suboptimal elastograms . applying an appropriate level of axial this is due to the varying mobility of different structures in the neck , which can slide non - axially under compression , and the competing effects of other physiologic motions such as adjacent arterial pulsations and breathing . more recent commercial strain elastography systems can monitor and feed back information regarding compression quality in the form of visual scales and graphs , which operators can view in real time to optimize their compression technique . because swe does not require freehand compressions nevertheless , use using either technique can be problematic if there is a focal convex bulge of the skin overlying the tissue of interest because , under these circumstances , it may not be possible to apply a linear transducer without producing focal stress concentration within the tissue of interest , resulting in spuriously stiff elastograms ( fig . first , dynamic elastograms can appear unstable due to software processing artefacts as well as genuine tissue displacements being detected within the imaging window . although elastograms can be stabilized to a variable degree by software temporal and spatial averaging techniques , bulk tissue motions occurring during compression relaxation cycles or other subtle tissue movements means that selecting a representative static image from a dynamic series remains challenging in clinical practice . third , selecting representative rois for sr or swe measurements is subjective and complicated by the fact that many tissues are spatially heterogeneous on use . given the multiplicity of factors that can produce variations in use , its reproducibility should be determined , although surprisingly this issue has been addressed in a relatively small number of studies on the head and neck . an early study of qualitative strain elastography of thyroid nodules using a first - generation use system documented poor interobserver agreement , whereas a few more recent studies using second - generation use systems have reported good to excellent interobserver agreement . the discrepancy in results may have several explanations although it is possible that a major contributing factor was the inclusion of compression quality feedback scales in the more recent studies , which may have enabled ultrasonographers to optimize and standardize their freehand compression techniques and select only high - quality elastograms for analysis . some investigators have evaluated thyroid use using intrinsic carotid pulsations instead of freehand compression , and have documented highly reproducible results . for swe , reproducibility data from individual studies indicate fair to excellent interobserver agreement . however , absolute values of stiffness obtained using swe for benign and malignant thyroid nodules have differed appreciably between publications , raising questions regarding its reproducibility . the reproducibility of use for other sites in the head and neck has been investigated in only a couple of studies . a recent study of quantitative swe in the head and neck documented fair to excellent interobserver agreements for all head and neck sites , although agreement was higher for thyroid lesions compared with other neck masses , and for benign compared with malignant lesions . further research is required to determine precisely how and to what extent specific tissue characteristics influence the reliability of use in the head and neck .

abstractultrasound elastography ( use ) is a rapidly developing field of imaging that measures and displays tissue elasticity or stiffness properties using ultrasound . in recent years , real - time use modes have appeared on commercially available clinical ultrasound machines , stimulating an explosion of research into potential oncologic and non - oncologic clinical applications of use . preliminary evidence suggests that use can differentiate benign and malignant conditions accurately in several different tissues . this article presents an overview of the basic principles of different use technologies that are currently under investigation in the head and neck region . in addition , more practical aspects pertaining to the optimal performance of use at this site are discussed .

Introduction Basic principles Strain elastography Shear wave elastography General comments regarding USE Conflict of interest

the concept of osseointegration has made implant therapy the most preferred mode for tooth replacement . the increasing use of implants has along with it brought about series of reports on potential complications related to implant placement . the availability of adequate bone volume and height is a prerequisite for implant placement ; however , this may not always be possible . implant placement into compromised sites needs adjunctive procedures like augmentation of bone either prior to or simultaneously during the implant placement.[47 ] simultaneous implant placement and bone grafting procedure reduces the total duration of the treatment as compared to a staged approach of grafting and graft integration time of 4 - 6 monthsfollowed by implant placement and restorations 3 - 4 months later . studies have shown that guided bone regeneration procedure at the time of implant placement can form and maintain bone formation around titanium implants.[4712 ] although all the clinical and radiographic evaluations are undertaken prior to implant placement so that the available bone height and anatomic structures like foramen and bony canals are visualized , some times the finer structures do get missed out but get identified during the surgical procedure . the following report is of a case wherein we accidentally identified accessory mental foramen ( amf ) and an accessory mental nerve ( amn ) exiting it while carrying out a guided bone regeneration procedure using a titanium mesh in combination with bovine anorganic bone for covering a dehiscence defect around an implant in the mandibular molar area . a 25-year - old male patient was referred to the department of implantology , sdm college of dental sciences and hospital , dharwad , india , for replacement of his missing tooth . on clinical examination it was noted that the patient had a missing mandibular right first molar ( tooth number 46 ) [ figure 1 ] . it was decided to place a 5.3 diameter , 13 mm long implant [ figure 2 ] . pre - operative radiograph the patient was given a 0.2% chlorhexidine rinse for 2 minutes and local anesthesia was secured on the buccal and lingual sides . a mid - crestal incision extending from the distal aspect of the 2 premolar to the mesial aspect of the 2 molar was made and a full thickness mucoperiosteal flap was elevated . the alveolar crest was visualized and the osteotomy was started with a pilot drill for a depth of 13 mm . sequential drilling was done to enlarge the osteotomy to facilitate the placement of 5.3 diameter , 13 mm long implant [ uniti ( uniti , equinox , holland ) ] . we noticed that there was a dehiscence exposing 23 mm of the implant on the buccal aspect . a vertical incision was placed along the distoincisal line angle of the second premolar , to facilitate the grafting . while the flap was being reflected we noticed a fine fiber exiting a foramen located at a distance of approximately 34 mm apical to the alveolar crest . the foramen and the fiber were identified as accessory mental foramen and nerve [ figure 3 ] . the main trunk and the mental foramen were located in the area between the apices of the two premolars [ figure 2 ] . the exposed threads were covered with bovine anorganic bone [ bio - oss , geistlich pharma ag , wolhusen , switzerland ] and stabilized with a titanium mesh screen [ synthes , co , usa ] , of 1.0-mm sized pores which was contoured to the defect [ figure 4 ] during grafting , care was taken so that the nerve fiber was not traumatized . the flaps were approximated and closed with 4 - 0 vicryl [ ethicon , johnson and johnson , aurangabad , india ] sutures and primary closure was attained . the patient was advised not to take any analgesic till the anesthetic effect had worn off , and he was monitored continuously to check for any signs of nerve injury till 6 hours after the surgery . a radiograph was made to assess the placement of implant in relation to the inferior alveolar canal [ figure 5 ] . once it was ascertained that no nerve damage had happened the patient was discharged from the clinic . three months after the implant placement the patient was recalled and the 2 stage procedure was carried out . after 15 days of healing period final impressions were made in vinyl polysiloxane impression material [ aquasil , dentsply , de trey , konstanz , germany ] . the final restoration was cemented [ figures 6 and 7 ] and the patient was put on a follow - up care . accessory mental nerve and foramen along with the buccal dehiscence on the implant dehiscence covered with titanium mesh and bio - oss immediate post implant placement radiograph radiograph of the final restoration the knowledge of the local anatomy plays an important role in the treatment planning process . clinical examination and findings from radiographs accidental identification of anatomic structures is not new , but the management of cases in these circumstances is a challenge . in the present case , amn and amf were accidentally detected in the mandibular 1 molar area during implant surgery and were managed successfully . amn is a branch of the inferior alveolar nerve , which exits from the main bundle of the nerve prior to the mental foramen , from an accessory foramen known as accessory mental foramen . its occurrence has been reported with an incidence of 3.52% of cases on the left and 4.22% on the right side of the mandible , in a study done on south indian mandibles by roopa et al . injury to any of the nerve during surgical procedures in this area results in paresthesia of the area supplied by it . in the present case , a 23 mm dehiscence was observed on the buccal aspect of the implant . the dehiscence was covered by gbr procedure , with a combination of bovine anorganic bone and titanium mesh.gbr technique was chosen because it has been shown that gbr is the best technique available to cover the dehiscence around implants . dahlen et al , have shown that guided bone regeneration can be predictably carried out around titanium implants . studies by zitzmann et al , showed that if the initial defect size is more than 2 mm then gbr is indicated in coverage of the defect which can be successfully treated by a combination of bovine anorganic bone along with collagen membrane and the results can be predictability maintained over long periods . although the autogenous bone grafts are gold standard for grafting procedures and are used in combination with bovine bone mineral for augmentation , in the current case as the defect was small ( approx 2 mm ) bovine particulate bone mineral was used . bovine bone mineral when used as an onlay bone graft has shown bone formation between the particles of the graft.[91618 ] apart from the graft material , the stability of the graft is very important for regeneration . the titanium mesh not only protects the graft but also maintains the shape around the defect which attributed to the stiffness of the mesh and can be easily contoured to achieve a three dimensional adaptation around the ridge . the biocompatibility of the mesh also makes it suited for long term implantation and also less risk of infection even after premature exposure as compared to the non - resorbable membranes . in current case , amn was seen exiting the amf at a distance of 34 mm from the alveolar crest leading to the thought whether the nerve was traumatized during the preparation of the osteotomy site or during implant placement . during the grafting procedure care the patient was not medicated with post operative analgesics and till the anesthetic effect waned off . in case any signs of nerve damage were observed it was decided to remove the implant immediately . as none of the signs of nerve injury or damage , it can be said that optimal knowledge of the local anatomy and radiographic identification of the anatomic structures is important , but there are certain conditions when these structures are missed out and are identified during surgical procedure . it is important to manage the aberrant anatomical structures carefully so that no permanent damage ensues , because any damage to these structures need not necessarily lead to implant failure but is very commonly associated with legal action against the practitioner . to conclude it can be stated that the case wherein an accessory mental nerve exiting an accessory mental foramen were identified in an area of the mandibular 1 molar on the right side was managed without causing any nerve injury . however , imaging techniques like ct scan that provides a better picture of the operating areas should be carried out for better planning and avoiding unnecessary complications during implant surgery .

the accessory mental nerve and the corresponding foramen are not a very common occurrence . in the current case report , we present the notice of an accessory mental nerve in the mandibular molar area during implant placement . the case was managed well without any complications .

INTRODUCTION CASE REPORT DISCUSSION

obesity is directly associated with a number of health complications , including diabetes , hypertension and heart disease ( reviewed in allender and rayner ) . although unfavorable diet , lifestyle and genetic factors are associated with the increasing rates of obesity around the world , it is now suspected that exposure to environmental chemicals may be contributing to this epidemic by disrupting normal metabolism . substances with ubiquitous human exposure , such as bisphenol a ( bpa ) , may have an important role in fat cell formation and metabolism during development and adulthood by disrupting adipogenesis , lipid accumulation and contributing to obesity . bpa is an industrial chemical used in the manufacture of polycarbonate plastic , epoxy resins and thermal printing . bpa is released from consumer products and has been detected in food , water and dust . human exposure to bpa has been confirmed by its presence in blood , urine and adipose tissue . not only is bpa exposure associated with obesity and diabetes but it has also been linked to modulation of adipocyte differentiation and function in rodent and human models . however , the molecular mechanism of action of bpa in human preadipocyte differentiation has yet to be determined . adipocyte differentiation in murine cells is regulated mainly by ccaat - enhancer - binding protein ( c / ebp ) , and and peroxisome proliferator - activated receptor ( ppar ) , which induce the expression of genes that lead to the development of the adipocyte phenotype which includes the formation of lipid droplets and adipokine release ( reviewed in tang and lane ) . in human preadipocytes , the transcriptional cascade that leads to a mature adipocyte phenotype is less understood than in murine models ; however , evidence in the literature suggests that it involves similar transcription factors . the mechanisms by which bpa affects adipocyte biology have yet to be determined ; however , nuclear hormone receptors are believed to be involved . bpa has been linked to estrogen - receptor ( er ) and glucocorticoid - receptor ( gr ) modulation , both of which can influence adipogenesis and lipid metabolism . although estrogen has been shown to inhibit adipogenesis in vitro , er knockout mice are known to exhibit increased adipose tissue , supporting an anti - adipogenic role for er. bpa has also been shown to bind classical and non - classical ers in several studies and therefore these receptors may have a role in bpa - induced adipogenesis . glucocorticoids are involved in promoting adipogenesis in vitro , primarily through the activation of the c / ebp , leading to the expression of ppar and c / ebp. bpa was shown to promote adipogenesis through gr activation in murine 3t3-l1 preadipocytes and to increase the expression of 11-hydroxysteroid dehydrogenase type 1 in primary adipocytes from overweight children resulting in the activation of gr and adipogenesis . dexamethasone ( dex ) , a synthetic glucocorticoid , is universally used in adipocyte models of in vitro differentiation . the few studies showing effects of bpa on human preadipocyte differentiation have only examined the effect of bpa in the presence of glucocorticoid . although the addition of dex is generally required to induce efficient differentiation , this raises some issues when attempting to explore a potential gr - related mechanism as dex is a very potent gr agonist even at low concentrations . in the current study , the mechanism of bpa - induced adipogenesis in human preadipocytes the differentiation process requires the addition of a cocktail that initiates the adsipogenic transcriptional cascade . this cocktail includes high levels of insulin , which increases intracellular levels of cyclic adenosine monophosphate , 3-isobutyl-1-methylxanthine ( ibmx ) , a ppar agonist ( troglitazone ) and high levels of glucocorticoids . under these conditions , high percentages ( 80% ) of the human preadipocytes accumulate lipid droplets . in order to determine the possible target of bpa action , components of the differentiation protocol were systematically eliminated . here , we show for the first time that bpa induces lipid accumulation in human preadipocytes and increases expression of several key adipogenic markers in the absence of glucocorticoids . moreover , bpa - induced differentiation was inhibited in the presence of the specific er antagonist ici-182,780 , but not by a gr antagonist , despite the fact that estrogen had no agonistic effect in this model , suggesting that the mechanism of bpa action may be through a non - classical er pathway . , research triangle park , nc , usa ) from donors with body mass indexes 24.99 kg m were maintained in preadipocyte medium ( zenbio ) at 37 c and 5% co2 . for differentiation , confluent preadipocytes were treated with media containing 33 m biotin , 17 m pantothenate ( both from sigma - aldrich , st louis , mo , usa ) and 100 nm insulin ( roche applied science , laval , qc , canada ) for 14 days . in addition , 500 m ibmx ( sigma - aldrich ) was also included in the differentiation media from day 0 to day 4 . from day 2 until day 14 , 5 m troglitazone ( sigma - aldrich ) and the indicated concentrations of bpa were also included in the differentiation media , which was replenished every 2 days . as a positive control , cells were treated with 1 m dex ( sigma - aldrich ) starting on day 2 throughout differentiation with the same media as above instead of bpa . for the er and gr antagonist studies , 1 nm estradiol , 1 m ici-182,780 or 1 m ru486 ( all sigma - aldrich ) were also added as above with or without bpa . after 14 days of differentiation , cells were fixed with 4% formaldehyde and stained overnight with oil red o ( sigma - aldrich ) to visualize neutral lipid content as previously described . cellular triacylglycerides ( tgs ) were quantified using a tg assay kit ( zenbio ) . tg levels were normalized to cellular protein content , which was quantified using the pierce bca protein assay kit ( thermo scientific , rockford , il , usa ) . total rna was extracted from differentiating cells treated as described at various time points using the rneasy kit ( qiagen , mississauga , on , canada ) . peak expression time points for each gene were optimized and found to be 4 days post treatment for adipsin , ppar and cebp and 6 days post treatment for ap2 and cebp. genomic dna was eliminated using the rnase - free dnase kit ( qiagen ) . rna ( 250500 ng ) were reverse transcribed into cdna using iscript advanced cdna synthesis kit ( bio - rad , mississauga , on , canada ) . for each real - time pcr reaction , cdna was amplified in a cfx96-pcr detection system using the iqsybr green supermix kit ( bio - rad ) . the primer pairs for each gene target were c / ebp : forward:5-tggacaagaacagcaacgag-3 , reverse 5-ccatggccttgaccaaggag-3 c / ebp : forward 5-gaagaccgtggacaagcaca-3 , reverse 5-acaagttccgcagggtgctg-3 ppar 1/2 : forward 5-tccgagggccaaggcttcat-3 , reverse 5-gcaaacctgggcggtctcca-3 ap2 : forward 5-catcagtgtgaatggggatg-3 , reverse 5-gtggaagtgacgcctttcat-3 -actin : forward 5-gacttcgagcaagagatggc-3 , reverse 5-ccagacagcactgtgttggc-3 and adipsin : forward 5-cgagctggcaccgggaactc-3 , reverse 5-tgcagctgtcccggcgattg-3. standard curves were generated from the pooled cdna obtained from cells treated with dex from various time points . primer efficiencies were 90% , and specificity was confirmed by sequence blast and melting curve analysis . cells were washed in phosphate - buffered saline and lysed in buffer containing 50 mm tris , 150 mm sodium chloride ( nacl ) , 1% igepal , 5 mm edta ( all from sigma - aldrich ) and protease inhibitor cocktail ( roche diagnostics , laval , qc , canada ) . equal amounts of protein were resolved by sds - page ( sodium dodecyl sulfate - polyacrylamide gel electrophoresis ) and transferred to polyvinylidene membrane . primary antibodies for ap2 ( r&d , minneapolis , mn , usa ) , perilipin ( d1d8 ; cell signaling , boston , ma , usa ) and -actin ( 13e5 ; cell signaling ) and appropriate horseradish peroxidase - labelled secondary antibodies were used . western blots were visualized using the chemidoc imager and quantified using the image lab software ( bio - rad ) . all data were analyzed by student 's t - test or analysis of variance with holm sidak post - test analysis as indicated using sigmaplot 11.0 ( san jose , ca , usa ) . , research triangle park , nc , usa ) from donors with body mass indexes 24.99 kg m were maintained in preadipocyte medium ( zenbio ) at 37 c and 5% co2 . for differentiation , confluent preadipocytes were treated with media containing 33 m biotin , 17 m pantothenate ( both from sigma - aldrich , st louis , mo , usa ) and 100 nm insulin ( roche applied science , laval , qc , canada ) for 14 days . in addition , 500 m ibmx ( sigma - aldrich ) was also included in the differentiation media from day 0 to day 4 . from day 2 until day 14 , 5 m troglitazone ( sigma - aldrich ) and the indicated concentrations of bpa were also included in the differentiation media , which was replenished every 2 days . as a positive control , cells were treated with 1 m dex ( sigma - aldrich ) starting on day 2 throughout differentiation with the same media as above instead of bpa . for the er and gr antagonist studies , 1 nm estradiol , 1 m ici-182,780 or 1 m ru486 ( all sigma - aldrich ) were also added as above with or without bpa . after 14 days of differentiation , cells were fixed with 4% formaldehyde and stained overnight with oil red o ( sigma - aldrich ) to visualize neutral lipid content as previously described . cellular triacylglycerides ( tgs ) were quantified using a tg assay kit ( zenbio ) . tg levels were normalized to cellular protein content , which was quantified using the pierce bca protein assay kit ( thermo scientific , rockford , il , usa ) . total rna was extracted from differentiating cells treated as described at various time points using the rneasy kit ( qiagen , mississauga , on , canada ) . peak expression time points for each gene were optimized and found to be 4 days post treatment for adipsin , ppar and cebp and 6 days post treatment for ap2 and cebp. genomic dna was eliminated using the rnase - free dnase kit ( qiagen ) . rna ( 250500 ng ) were reverse transcribed into cdna using iscript advanced cdna synthesis kit ( bio - rad , mississauga , on , canada ) . for each real - time pcr reaction , cdna was amplified in a cfx96-pcr detection system using the iqsybr green supermix kit ( bio - rad ) . the primer pairs for each gene target were c / ebp : forward:5-tggacaagaacagcaacgag-3 , reverse 5-ccatggccttgaccaaggag-3 c / ebp : forward 5-gaagaccgtggacaagcaca-3 , reverse 5-acaagttccgcagggtgctg-3 ppar 1/2 : forward 5-tccgagggccaaggcttcat-3 , reverse 5-gcaaacctgggcggtctcca-3 ap2 : forward 5-catcagtgtgaatggggatg-3 , reverse 5-gtggaagtgacgcctttcat-3 -actin : forward 5-gacttcgagcaagagatggc-3 , reverse 5-ccagacagcactgtgttggc-3 and adipsin : forward 5-cgagctggcaccgggaactc-3 , reverse 5-tgcagctgtcccggcgattg-3. standard curves were generated from the pooled cdna obtained from cells treated with dex from various time points . primer efficiencies were 90% , and specificity was confirmed by sequence blast and melting curve analysis . cells were washed in phosphate - buffered saline and lysed in buffer containing 50 mm tris , 150 mm sodium chloride ( nacl ) , 1% igepal , 5 mm edta ( all from sigma - aldrich ) and protease inhibitor cocktail ( roche diagnostics , laval , qc , canada ) . equal amounts of protein were resolved by sds - page ( sodium dodecyl sulfate - polyacrylamide gel electrophoresis ) and transferred to polyvinylidene membrane . primary antibodies for ap2 ( r&d , minneapolis , mn , usa ) , perilipin ( d1d8 ; cell signaling , boston , ma , usa ) and -actin ( 13e5 ; cell signaling ) and appropriate horseradish peroxidase - labelled secondary antibodies were used . western blots were visualized using the chemidoc imager and quantified using the image lab software ( bio - rad ) . all data were analyzed by student 's t - test or analysis of variance with holm sidak post - test analysis as indicated using sigmaplot 11.0 ( san jose , ca , usa ) . the differentiation of human preadipocytes requires well - defined inducers , including insulin , ibmx , troglitazone and dex . omission of any of these components during differentiation abolished the ability of the cells to assume a mature adipocyte phenotype ( data not shown ) . our initial experiments were designed to investigate whether bpa could replace any of these components , and it was found that bpa could only replace the dex - mediated effects on differentiation ( data not shown and figure 1 ) . we evaluated the effect of bpa on adipocyte differentiation , by assessing lipid accumulation using oil red o staining and tg quantification using a commercial assay . cells treated with 25 or 50 m bpa for 14 days showed increased oil red o lipid staining , indicating more differentiation compared with control cells treated with vehicle alone ( ethanol ; figure 1a ) . cells treated with 1 m dex as a positive control showed roughly 8090% of the cells positive for lipid staining , indicating a high degree of adipocyte differentiation . treatment of cells with 25 or 50 m bpa also significantly stimulated tg accumulation ( figure 1b ) , inducing a 1.72.1-fold increase , respectively , in tg levels . cells treated with dex exhibited an almost 15.4-fold increase in tg levels relative to vehicle control ( figure 1b ) . the data show that bpa can induce adipocyte differentiation and lipid accumulation in the absence of exogenous glucocorticoids . to further evaluate bpa - induced effects on differentiation , the mrna expression of key adipogenic markers and transcription factors were evaluated using real - time pcr . peak expression time points for each gene were optimized and found to be 4 days post - bpa treatment for adipsin , ppar and cebp and 6 days post - bpa treatment for ap2 and cebp ( data not shown ) . treatment of cells with 25 or 50 m bpa resulted in a statistically significant increase in the mrna levels of the adipogenic marker ap2 by 3.1- and 3.9-fold , respectively , at 6 days post - bpa treatment ( figure 2 ) . adipsin mrna levels were also induced 1.5-fold by 50 m bpa at 4 days post - bpa treatment whereas dex treatment resulted in a 6.3-fold increase in adipsin expression ( figure 2 ) . the bpa - induced mrna levels of key transcription factors involved in adipogenesis were also evaluated . treatment of cells with 50 m bpa or dex caused a 2.0- and 7.0-fold increase , respectively , in ppar mrna expression at 4 days post - bpa treatment ( figure 2 ) . expression of cebp was significantly increased by 1.8-fold at 6 days post - bpa treatment in response to 25 or 50 m bpa , respectively . similarly , dex treatment resulted in a significant 15.9-fold increase in cebp expression ( figure 2 ) . in contrast , cebp mrna expression was only slightly increased 1.5-fold at 4 days post - bpa treatment in response to 50 m bpa , whereas dex did not result in a statistically significant increase in cebp levels ( figure 2 ) . the data show that bpa induces human adipocyte differentiation as determined by the increased expression of adipogenic markers at the mrna level and increases expression levels of transcription factors known to be involved in the transcriptional cascade leading to adipocyte differentiation . next , we evaluated the effect of bpa treatment on the protein levels of the adipogenic markers ap2 and perilipin . the ability of increasing concentrations of bpa ( from 0.0150 m ) to potentiate the differentiation of human preadipocytes was examined at day 14 of differentiation . the data show that protein levels of the adipogenic marker ap2 were increased on day 14 by as low as 1 m bpa ; however , only 25 and 50 m bpa treatments showed a statistically significant increase in ap2 protein levels relative to control ( figures 3a and b ) . we proceeded to investigate the protein expression levels of ap2 and perilipin during the differentiation process . the data indicate that bpa significantly induces ap2 expression by 1.8-fold compared with control as early as day 6 ( figure 3c ) and by 3.2-fold at day 14 . perilipin protein levels were detectable only at day 14 and increased only by 1.5-fold following treatment with 25 m bpa relative to control ; however , the difference was not statistically significant ( figures 3e and f ) . as a positive control , dex - treated preadipocytes showed high levels of both ap2 and perilipin protein levels by days 6 and 14 of differentiation ( figure 3 g ) . these results clearly show bpa induces expression of key adipogenic markers at both the mrna and protein levels . given that bpa has er - binding activity at concentrations as low as 0.1 m , the potential role of the er in bpa - induced differentiation was investigated using the specific er antagonist ici . the protein levels of ap2 were examined at day 14 as a marker of differentiation in human preadipocytes following co - treatment with 25 m bpa and 1 m ici . co - treatment with ici significantly inhibited bpa - induced ap2 protein levels by 75% ( to background levels ) at day 14 of differentiation ( figures 4a and b ) . neither estradiol nor ici treatment alone had a significant effect on differentiation or ap2 protein levels . this suggests that the mechanism of bpa - induced differentiation of human preadipocytes is likely mediated via a non - classical er pathway . the involvement of the gr in bpa - induced differentiation was also evaluated in the presence of a gr - specific antagonist . human preadipocytes were co - treated with 25 m bpa and 1 m of the gr antagonist ru486 , which has been reported to inhibit dex - induced gr activation , throughout differentiation until day 14 . in control experiments , 1 m ru486 was able to inhibit differentiation of human preadipocytes treated with 10 nm dex as determined by ap2 protein levels at day 14 ( data not shown ) . the data in figure 4 show that bpa treatment alone significantly increased ap2 protein levels relative to control , as shown earlier . however , bpa - induced ap2 protein levels were not significantly affected by co - treatment with ru486 relative to bpa alone ( figures 4c and d ) . treatment of cells with ru486 on its own appeared to cause a small increase in ap2 protein levels as well compared with control , but the increase was not statistically significant . this is somewhat consistent with reports that ru486 alone has the potential to act as a gr agonist in adipocytes . these data suggest that bpa - induced differentiation is likely mediated through a non - classical er - dependent mechanism rather than through the gr in human subcutaneous preadipocytes . the differentiation of human preadipocytes requires well - defined inducers , including insulin , ibmx , troglitazone and dex . omission of any of these components during differentiation abolished the ability of the cells to assume a mature adipocyte phenotype ( data not shown ) . our initial experiments were designed to investigate whether bpa could replace any of these components , and it was found that bpa could only replace the dex - mediated effects on differentiation ( data not shown and figure 1 ) . we evaluated the effect of bpa on adipocyte differentiation , by assessing lipid accumulation using oil red o staining and tg quantification using a commercial assay . cells treated with 25 or 50 m bpa for 14 days showed increased oil red o lipid staining , indicating more differentiation compared with control cells treated with vehicle alone ( ethanol ; figure 1a ) . cells treated with 1 m dex as a positive control showed roughly 8090% of the cells positive for lipid staining , indicating a high degree of adipocyte differentiation . treatment of cells with 25 or 50 m bpa also significantly stimulated tg accumulation ( figure 1b ) , inducing a 1.72.1-fold increase , respectively , in tg levels . cells treated with dex exhibited an almost 15.4-fold increase in tg levels relative to vehicle control ( figure 1b ) . the data show that bpa can induce adipocyte differentiation and lipid accumulation in the absence of exogenous glucocorticoids . to further evaluate bpa - induced effects on differentiation , the mrna expression of key adipogenic markers and transcription factors were evaluated using real - time pcr . peak expression time points for each gene were optimized and found to be 4 days post - bpa treatment for adipsin , ppar and cebp and 6 days post - bpa treatment for ap2 and cebp ( data not shown ) . treatment of cells with 25 or 50 m bpa resulted in a statistically significant increase in the mrna levels of the adipogenic marker ap2 by 3.1- and 3.9-fold , respectively , at 6 days post - bpa treatment ( figure 2 ) . adipsin mrna levels were also induced 1.5-fold by 50 m bpa at 4 days post - bpa treatment whereas dex treatment resulted in a 6.3-fold increase in adipsin expression ( figure 2 ) . the bpa - induced mrna levels of key transcription factors involved in adipogenesis were also evaluated . treatment of cells with 50 m bpa or dex caused a 2.0- and 7.0-fold increase , respectively , in ppar mrna expression at 4 days post - bpa treatment ( figure 2 ) . expression of cebp was significantly increased by 1.8-fold at 6 days post - bpa treatment in response to 25 or 50 m bpa , respectively . similarly , dex treatment resulted in a significant 15.9-fold increase in cebp expression ( figure 2 ) . in contrast , cebp mrna expression was only slightly increased 1.5-fold at 4 days post - bpa treatment in response to 50 m bpa , whereas dex did not result in a statistically significant increase in cebp levels ( figure 2 ) . the data show that bpa induces human adipocyte differentiation as determined by the increased expression of adipogenic markers at the mrna level and increases expression levels of transcription factors known to be involved in the transcriptional cascade leading to adipocyte differentiation . next , we evaluated the effect of bpa treatment on the protein levels of the adipogenic markers ap2 and perilipin . the ability of increasing concentrations of bpa ( from 0.0150 m ) to potentiate the differentiation of human preadipocytes was examined at day 14 of differentiation . the data show that protein levels of the adipogenic marker ap2 were increased on day 14 by as low as 1 m bpa ; however , only 25 and 50 m bpa treatments showed a statistically significant increase in ap2 protein levels relative to control ( figures 3a and b ) . we proceeded to investigate the protein expression levels of ap2 and perilipin during the differentiation process . the data indicate that bpa significantly induces ap2 expression by 1.8-fold compared with control as early as day 6 ( figure 3c ) and by 3.2-fold at day 14 . perilipin protein levels were detectable only at day 14 and increased only by 1.5-fold following treatment with 25 m bpa relative to control ; however , the difference was not statistically significant ( figures 3e and f ) . as a positive control , dex - treated preadipocytes showed high levels of both ap2 and perilipin protein levels by days 6 and 14 of differentiation ( figure 3 g ) . these results clearly show bpa induces expression of key adipogenic markers at both the mrna and protein levels . given that bpa has er - binding activity at concentrations as low as 0.1 m , the potential role of the er in bpa - induced differentiation was investigated using the specific er antagonist ici . the protein levels of ap2 were examined at day 14 as a marker of differentiation in human preadipocytes following co - treatment with 25 m bpa and 1 m ici . co - treatment with ici significantly inhibited bpa - induced ap2 protein levels by 75% ( to background levels ) at day 14 of differentiation ( figures 4a and b ) . neither estradiol nor ici treatment alone had a significant effect on differentiation or ap2 protein levels . this suggests that the mechanism of bpa - induced differentiation of human preadipocytes is likely mediated via a non - classical er pathway . the involvement of the gr in bpa - induced differentiation was also evaluated in the presence of a gr - specific antagonist . human preadipocytes were co - treated with 25 m bpa and 1 m of the gr antagonist ru486 , which has been reported to inhibit dex - induced gr activation , throughout differentiation until day 14 . in control experiments , 1 m ru486 was able to inhibit differentiation of human preadipocytes treated with 10 nm dex as determined by ap2 protein levels at day 14 ( data not shown ) . the data in figure 4 show that bpa treatment alone significantly increased ap2 protein levels relative to control , as shown earlier . however , bpa - induced ap2 protein levels were not significantly affected by co - treatment with ru486 relative to bpa alone ( figures 4c and d ) . treatment of cells with ru486 on its own appeared to cause a small increase in ap2 protein levels as well compared with control , but the increase was not statistically significant . this is somewhat consistent with reports that ru486 alone has the potential to act as a gr agonist in adipocytes . these data suggest that bpa - induced differentiation is likely mediated through a non - classical er - dependent mechanism rather than through the gr in human subcutaneous preadipocytes . the current study demonstrates that bpa induces differentiation of primary human preadipocytes in vitro in the absence glucocorticoid and examines several potential mechanisms of action of bpa - induced differentiation . this in vitro study is consistent with in vivo reports showing that bpa exposure is correlated with obesity in several human models . although transcriptional stimulation of the gr is believed to be crucial for the development of the adipocyte phenotype in these cells , addition of bpa causes increased fat accumulation and expression of mrna and protein markers of adipocyte differentiation in the absence of a gr agonist . the fact that bpa - induced differentiation is not inhibited in the presence of an active concentration of the gr antagonist ru486 ( figures 4c and d ) argues that the bpa effect is not mediated through activation of the gr in this model system . interestingly , the adipogenic action of bpa is inhibited by a specific antagonist of the er despite the lack of an effect of estrogen itself on differentiation in this model . this suggests that bpa induces adipocyte differentiation through a non - classical er - mediated mechanism rather than through gr activation . these results indicate that bpa can contribute to the final maturation of cells committed to the adipocyte lineage and add to the growing body of evidence that bpa acts as an obesogen . in this study , as opposed to many reports in the literature , we evaluated the effect of bpa on adipogenesis in human preadipocytes in the absence of exogenous glucocorticoids and examined its mechanism of action on differentiation and lipid accumulation . several potential mechanisms have been suggested based on the ability of bpa to act as an estrogen through binding classical or non - classical ers and its potential ability to activate gr . most of the studies investigating the effects of bpa on adipogenesis in vitro have done so using a differentiation cocktail containing dex or cortisol , potent gr agonists and inducers of differentiation , making the interpretation of bpa - specific effects difficult . when dex is present , it is very difficult to assess the mechanism of action and adipogenic effects of bpa , unless inhibitory effects are expected to be observed . here , we report effects of bpa on human adipocyte differentiation in the absence of exogenous glucocorticoid . the ability of bpa to promote adipogenesis is consistent with reports that examined mrna expression of adipogenic markers , such as ap2 , lipoprotein lipase and ppar. here , we report at least a 23-fold increase in lipid accumulation and ap2 protein levels ( figures 1 and 3 ) , consistent with previous studies in the 3t3-l1 murine cell model and human visceral preadipocytes . some studies showed effects in the 0.11 m bpa range , whereas others have gone as high as 80100 m bpa . our data show significant optimal effects on ap2 protein levels at 2550 m bpa but also as low as 100 nm ( however , this concentration was not statistically significant ) ( figure 3a ) . most studies have examined adipocyte differentiation in murine cell lines , which differ from human adipocytes in many of the requirements for differentiation . most murine cell lines require 7 days of differentiation , whereas the human preadipocytes require 14 days to fully differentiate . moreover , the murine preadipocytes do not require the addition of a ppar agonist ( such as troglitazone ) in addition to glucocorticoids to the differentiation cocktail , whereas human cells do not differentiate in the absence of troglitazone even when dex is present ( data not shown and tomlinson et al . ) . due to these differences , we examined the effect of bpa in a human preadipocyte cell model , which is more relevant to human health . the current study is the first to report that bpa induces differentiation of human preadipocytes entirely in the absence of glucocorticoid stimulation . previous reports of the action of bpa in mediating adipocyte differentiation have shown effects only when bpa is added in combination with the potent gr agonist dex or other synthetic glucocorticoids . one study also showed a bpa - induced increase in 11-hydroxysteroid dehydrogenase type 1 in human omental fat cells leading to activation of gr . however , these reports all show an effect on adipogenesis in the presence of a gr agonist . as we examined a potential gr - related mechanism of bpa action , it was necessary to perform our studies in the absence of dex in the differentiation cocktail . our results clearly show that bpa induces human preadipocyte differentiation and can partially replace the effect of dex on the differentiation of these cells . moreover , bpa - induced adipogenesis was not inhibited by the gr antagonist ru486 , further suggesting that the effect is not mediated via gr . it is possible that bpa may have a higher affinity for gr than ru486 as the antagonist did not inhibit the bpa effect but ru486 likely has a similar high affinity to gr as its natural ligand dex . the current study is also the first to report that bpa induces adipogenesis not only in the absence of exogenous glucocorticoid but that the mechanism is likely through a non - classical er - mediated pathway rather than through the gr . our data show that the er agonist estradiol had no stimulatory effect on the differentiation of human preadipocytes , consistent with studies showing that estrogen does not have a positive effect on adipogenesis and is even considered to be anti - adipogenic . more importantly , we also show that ici , a specific er antagonist , was able to inhibit bpa - induced adipogenesis by 75% as measured by a decrease in ap2 protein levels ( figure 4a ) . this is intriguing as bpa is known to have estrogen - like properties and is able to bind to the er ; however , the fact that bpa has the opposite effect of estradiol on differentiation and is inhibited by an er antagonist suggests that bpa is potentially acting through a non - classical er pathway . interestingly , it has been recently shown that diethylstilbestrol , a potent er activator , was adipogenic in mice and 3t3-l1 cells and that the effect could be inhibited by ici . human preadipocytes have been shown to express both er and er. bpa has been shown to act through er in -islets and to signal through er to activate extracellular - regulated kinase 1/2 and increase insulin - induced genes . the ability of ici to inhibit the effects of bpa on er and er activation has been reported in hepg2 and hela cells . ici has also been shown to inhibit bpa - induced proliferation in ovarian cancer cells . it remains to be determined in this system whether bpa binds the er and activates non - classical er - responsive genes that promote differentiation . bpa has been shown to strongly bind the estrogen - related receptor ( err ) and may be acting through this family of receptors to activate downstream genes . err expression was reported to be upregulated following treatment with bpa in an insect model , suggesting that bpa can affect err levels . activation of err has been shown to upregulate ppar coactivator-1 ( pgc-1 ) expression , which promotes the formation of ppar/pgc-1 and sterol - regulatory - element - binding protein-1c / pgc-1 complexes , which are important adipogenic transcription factors . however , the influence of bpa and/or ici on the activity of any member of the err family has yet to be thoroughly investigated . another potential non - classical er mechanism of bpa - mediated adipogenesis may involve g protein - coupled receptor 30 ( gpr30 ) , which is a membrane protein that binds estrogen and initiates intracellular signaling pathways . one study showed that bpa can signal through both gpr30 and er. however , the role of either gpr30 or the errs , which are expressed in adipose tissue , in bpa - induced adipogenesis remains to be characterized . in this study , we show that bpa promotes differentiation and lipid accumulation in primary subcutaneous human preadipocytes . moreover , this is one of the first reports showing that bpa can induce adipocyte differentiation in the absence of exogenous glucocorticoids . we also show that while estradiol has no positive effect on adipocyte differentiation , bpa - induced adipogenesis is inhibited by an er antagonist , but not by a gr antagonist , suggesting that bpa is potentially acting through a non - classical er pathway . future studies should examine the roles of the classical er , errs and gpr30 in the mechanism of action of bpa in adipogenesis .

background : obesity is a major health concern in the developed world , and increasing evidence suggests that exposures to common environmental substances may enhance the risk for the development of this disease.objectives:the current study examines the effect of the ubiquitous plastic monomer bisphenol a ( bpa ) on the differentiation of primary human preadipocytes in vitro and the role of the estrogen and glucocorticoid receptors.methods:in this study , the mechanism of bpa - induced adipogenesis in preadipocytes from donors with healthy body mass index in the absence of exogenous glucocorticoid was evaluated . the effects of estradiol , the estrogen - receptor ( er ) antagonist ici and the glucocorticoid receptor ( gr ) antagonist ru486 on bpa - induced adipogenesis were examined . the expression levels of key adipogenic factors were assessed.results:treatment of preadipocytes with 150 m bpa induced a dose - dependent increase in differentiation and lipid accumulation as determined by lipid staining and triacylglyceride quantification . bpa also induced expression of the adipogenic markers ap2 , adipsin , peroxisome proliferator - activated receptor and the ccaat - enhancer - binding proteins and . co - treatment of cells with ici inhibited the bpa - induced increase in ap2 levels , while treatment with ici or estradiol alone had no effect . treatment of cells with the gr antagonist ru486 had no effect on bpa - induced differentiation as evaluated by ap2 levels.conclusions:this study is one of the first to show that bpa induces human adipocyte differentiation in the absence of exogenous glucocorticoid through a non - classical er pathway rather than through gr activation . these studies add to the growing evidence that endocrine - disrupting chemicals such as bpa have the potential to modulate adipogenesis and impact human biology .

Introduction Materials and methods Adipocyte differentiation Lipid staining and quantification Real-time PCR Western blotting analysis Statistical analyses Results BPA increases lipid accumulation in human preadipocytes BPA increases mRNA and protein expression of adipogenic markers BPA-induced differentiation is inhibited by the ER antagonist ICI BPA-induced differentiation is not affected by the GR antagonist RU486 Discussion Conclusions

ocular manifestations of the dengue fever virus include bilateral panuveitis that can occur after the acute systemic infection has resolved . in we report a case of chronic , refractory bilateral panuveitis and uveitic glaucoma that began during the acute phase of the systemic infection and required treatment with oral steroids , multiple steroid - sparing agents , and surgical therapy for glaucoma . a 22-year - old male with acute systemic dengue fever presented with bilateral pain and decreased vision . management required oral steroids , mycophenolate mofetil , cyclosporine , and bilateral glaucoma valve implantation . this case highlights the fact that dengue - associated panuveitis can begin in the acute stage of systemic infection and persist long after convalescence with progression to chronic bilateral panuveitis and uveitic glaucoma . dengue - associated chronic panuveitis with uveitic glaucoma may be effectively managed with a combination of steroid - sparing oral immunosuppression and glaucoma surgery . this is , to our knowledge , the first case of bilateral refractory dengue - associated panuveitis from the caribbean treated with combination steroid - sparing oral immunosuppression and bilateral glaucoma valve implantation . dengue fever is caused by a virus in the flaviviridae family transmitted by the aedes aegypti and aedes albopictus mosquitoes . the acute systemic phase of the infection is marked by pyrexia , malaise , and joint pain.1 the disease has been seen with increasing frequency in the past decade , particularly in the caribbean and parts of the developing world.2 myriad ocular manifestations have been reported , although the most common involve the posterior segment . anterior segment involvement most commonly includes subconjunctival hemorrhages from thrombocytopenia during the acute phase of the infection.3 anterior chamber inflammation and iridocyclitis are less common , with ciliary congestion being noticeably absent in the majority of cases . the time course of ocular involvement is frequently during the acute systemic phase of the infection , but has also been reported in some cases months after the primary infection has resolved.4 bilateral involvement is not common.5 a 22-year - old male of caribbean descent presented to our clinic with complaints of diminished vision , pain , and photosensitivity in the right eye ( od ) for several weeks . he was currently suffering through the acute phase of dengue fever , which had been diagnosed by his primary care provider and confirmed with serology . the patient had severe arthralgia , malaise , headache , pyrexia , and severe dehydration . his dengue infection was confirmed with an elevated dengue fever igm performed at a contract reference laboratory ( labcorp , tampa , fl , usa ) on two separate occasions separated by several weeks . his visual acuity , unimproved with refraction , was 20/80 od and 20/60 in the left eye ( os ) . slit - lamp examination was notable for pronounced ciliary flush ; large , nongranulomatous keratic precipitates ; scattered anterior synechiae ; and 3 + anterior chamber cell od , while the slit - lamp exam of the left anterior segment was unremarkable except for mild ciliary flush . there was an anterior vitritis present in both eyes , with significantly greater vitreous opacity od than os . dilated fundus examination revealed a dense core vitritis , pars planitis , and significant neuroretinitis od , with a milder vitritis , mild neuroretinal folds , and mild pars planitis os . both optic nerves appeared to have enlarged cup - to - disc ratios , although examination was limited due to vitreous opacity . the presumptive diagnosis of bilateral panuveitis was made , and a comprehensive lab workup was initiated to locate any other causative etiology . after a normal chest radiograph , treatment was started with oral prednisone 80 mg orally once a day ( po qd ) , topical timolol , topical acetazolamide , and topical cycloplegia . response to oral steroid was excellent , and a follow - up examination at 1 week showed nearly complete resolution of the vitritis and neuroretinitis . the intraocular pressures , however , had risen to over 60 mmhg in both eyes , and there was persistent anterior chamber cell and flare od . topical timolol was continued along with the initiation of an oral prednisone taper , and oral acetazolamide was added . after another week with no change in oral prednisone dosage at 60 mg po qd , the vitritis and retinitis returned ou with worsening vision to cf od , 20/100 os , and persistently elevated pressures . while increasing the oral and topical steroid over the following 2 weeks was effective at resolving the inflammation , oral acetazolamide and maximal topical hypotensives were inadequate to control the rising intraocular pressures . it was presumed that there was both an inflammatory glaucoma and a steroid - induced glaucoma response . steroid - sparing therapy was a primary goal and , for this reason , mycophenolate mofetil was added and raised to 3 g per day.6,7 it was decided that the complete cessation of oral steroid was an important treatment goal given what we believed to be a mixed - mechanism glaucoma with some contribution from a hypertensive steroid response in a very young patient . as the oral steroids were tapered , every time the dose was decreased to 60 mg po qd or lower , the inflammation again returned , and oral cyclosporine a was added in addition to the mycophenolate mofetil . combination treatment with both mycophenolate mofetil and cyclosporine a allowed us to completely taper off oral prednisone and topical prednisolone without the recurrence of any inflammation . the intraocular pressures decreased from the sixties to the forties , but still could not be medically managed to an acceptable range . in our practice , we generally prefer ahmed glaucoma valve implants as first - line drainage procedures in inflammatory glaucomas due to their long - term lower incidence of postoperative hypotony compared to baerveldt implants.8 bilateral ahmed implants ( fp7 ) were placed 4 days apart od and os . the intraocular pressure was stabilized in the low teens without the need for topical or oral hypotensives . visual acuity returned to 20/25 od and 20/20 os within 1 month of ahmed glaucoma implantation . all anterior and posterior inflammation has to date been controlled without the need for further topical or systemic corticosteroid therapy . dengue - associated uveitis with onset during the acute systemic phase of the infection can have long - term ocular effects including bilateral panuveitis . despite symptoms being reported in only one eye multiple steroid - sparing agents can be used to control anterior and posterior inflammation when cessation of oral steroids is of primary importance . early surgical intervention for mixed inflammatory and steroid - induced ocular hypertension can be a useful tool for managing high intraocular pressures and need not be delayed until the cessation of all inflammation . management of these complicated cases benefits from an aggressive surgical approach , diligent pursuit of steroid - sparing agents , and collaboration with an experienced medical team to help guide and manage the careful use of multiple immunomodulatory agents .

backgroundocular manifestations of the dengue fever virus include bilateral panuveitis that can occur after the acute systemic infection has resolved . in most reported cases , the inflammation resolves with topical or systemic steroid therapy . we report a case of chronic , refractory bilateral panuveitis and uveitic glaucoma that began during the acute phase of the systemic infection and required treatment with oral steroids , multiple steroid - sparing agents , and surgical therapy for glaucoma.findingsa 22-year - old male with acute systemic dengue fever presented with bilateral pain and decreased vision . clinical examination revealed bilateral panuveitis with elevated intraocular pressures . management required oral steroids , mycophenolate mofetil , cyclosporine , and bilateral glaucoma valve implantation.conclusionthis case highlights the fact that dengue - associated panuveitis can begin in the acute stage of systemic infection and persist long after convalescence with progression to chronic bilateral panuveitis and uveitic glaucoma . dengue - associated chronic panuveitis with uveitic glaucoma may be effectively managed with a combination of steroid - sparing oral immunosuppression and glaucoma surgery . this is , to our knowledge , the first case of bilateral refractory dengue - associated panuveitis from the caribbean treated with combination steroid - sparing oral immunosuppression and bilateral glaucoma valve implantation .

Background Findings Conclusion Introduction Case report and discussion Conclusion

chronic kidney disease ( ckd ) is a worldwide chronic disease associated with poor patient quality of life and mental health outcomes as well as high cost . as people with ckd age and present different comorbidities , pain is defined as an unpleasant sensory and emotional experience associated with actual or potential tissue damage . pain is a frequent complaint of ckd patients undergoing hemodialysis ( hd ) , though it is not a common focus of research regarding this population . most published data come indirectly from studies focusing on health - related quality of life . murtagh et al . , in a review of symptoms in ckd , reported a weighted mean pain prevalence of 47% , with a range of 8 to 82% . pain can arise in ckd from multiple causes , including surgery , and comorbidities such as osteoarthritis , ischemic limb disease and peripheral neuropathy . it is known that the presence of chronic pain greatly impacts upon quality of life ( qol ) and can play a major role in the co - morbidity of anxiety and depression . the aim of the present study is to investigate pain self - efficacy , qol as well as their relation in patients undergoing hd treatment . because of the fact that the pain self - efficacy questionnaire , which will be used in the context of this study , has not been evaluated before in greece , we aim to investigate its psychometric properties as well . a cohort of around 70 - 80 patients undergoing hd treatment will be recruited from hospitals located within the broader area of peloponnese . the inclusion criteria are : i ) > 18 years of age ; ii ) ability of communication in greek ; iii ) diagnosed with ckd ; iv ) hd treatment at least for a year ; v ) satisfying level of cooperation and perceived ability ; vi ) no history of primary psychiatric disease that may interfere with conduct of study ; vii ) clinically stable with no evidence of chronic or acute infections , inflammatory disorders , malignancy . all subjects will be informed of their rights to refuse or discontinue participation in the study according to the ethical standards of the helsinki declaration . ethical permission for the study will be obtained from the scientific committees of the participating hospitals . byock and merriman created the missoula - vitas quality of life index ( mvqoli ) . the mvqoli is an assessment instrument that gathers patient - reported information about qol during advanced illness . maintaining optimal qol is a core goal of palliative and hospice care , and information gathered via the mvqoli assists health care professionals in identifying and addressing patient concerns that affect qol . the mvqoli has been used in many different healthcare settings including hospice , hospital , home health , long - term care ( including assisted living ) , outpatient palliative care , disease management and pre - hospice programs . the framework of the mvqoli is based on ira byock s work regarding growth and development at the end of life and the concepts of landmarks and tasks of life closure . the mvqoli asks patients about 5 dimensions or domains of qol : symptoms , function , interpersonal , well - being and transcendence . the instrument is specifically designed to assess the patients personal experience in each of these dimensions , hence the mvqoli items are constructed with highly subjective language and no scores appear on the version of the tool seen by patients . the tool seeks to describe the qualitative and subjective experience of qol in a way that can be quickly interpreted by professional caregivers . the pain self - efficacy questionnaire ( pseq ) is a 10-item questionnaire developed to assess the confidence people with ongoing pain have in performing activities while in pain . it covers a range of functions , including household chores , socializing , work , as well as coping with pain without medication . demographic and clinical characteristics of all patients will be collected as baseline information at the beginning of the study . kolmogorov - smirnov tests will be performed in order to check whether the values of the sample fell within a normal distribution . the analyses that will be used in the present study aim to investigate the relation between qol and pain - self efficacy in hd patients . hierarchical regression analyses will be also used to assess the above association in the total sample . statistical analyses will be performed with the use of independent samples t test and one - way anova in order to investigate potential effects of socio - demographic factors on qol and pain self - efficacy . finally , independent samples t test analysis will be used in order to examine differences between patients who recently commenced treatment ( < 4 years ) and those on long term treatment ( > 4 years ) . all analyses will be performed with the statistical package for the social sciences ( spss 13.0 for windows ) . two health psychologists will select the data using the relevant psychometric tools in the context of an interview at clinic in order to avoid missing data . this study will ascertain the association between qol and pain self - efficacy in hd patients . the findings of the present study can be used in the development of health care services and in - patient management . the role of qol and pain self - efficacy in particular may play an important role in the course of illness and treatment outcomes and could therefore be identified as a new area for psychological intervention in people with ckd .

patients suffering from end - stage kidney disease often complain about pain . it is also known that the presence of chronic pain greatly impacts upon patients quality of life ( qol ) and can play a crucial role in the co - morbidity of mental health symptoms such as depression and anxiety . the main aim of this study protocol is the investigation of pain self - efficacy , qol as well as their relation in patients undergoing hemodialysis treatment . the final sample size will be around 70 - 80 patients . each subject s qol and pain self - efficacy will be measured using the following instruments : i ) the missoula- itas quality of life index-15 and ii ) the pain self - efficacy questionnaire . qol is expected to be related to pain self - efficacy scores . this probable association will be indicated performing regression as well as correlation analysis after controlling for gender , age , education and marital status .

Background Methods Instruments Data analysis Discussion

clas are fatty acids that are mainly found in foods derived from ruminant animals ( pariza & ha , 1990 ) . they are geometrical and positional isomers of its parent molecule , linoleic acid ( cis-9,cis-12 - 18:2 , n-6 ( la ) ) . the cis-9 , trans-11 ( 9z,11e - octadecenoic acid , c18:2 ) isomer , also known as rumenic acid ( ra ) , is generated via biohydrogenation of dietary linoleic acids by ruminant microflora and is the most abundant natural cla isomer ( over 75 - 80% of total cla ) . it is not clear whether humans are able to produce ra from other fatty acids ( yurawecz , 1999 ) ; however , it is likely that the majority of ra found in the human body originates from the diet . estimated cla intake for humans is between 0.5 and 1 g / d ( ip et al . , 1994 ) ; however , more recent estimates suggest that cla and ra intakes are much lower ( yurawecz , 1999 ) . for example , the average intake is 430 mg / day for men and 350 mg / day for women in germany , 212 mg / day for men and 151 mg / day for women in the usa , and 500 - 1,000 mg / day in australia ( yurawecz , 1999 ) . studied for its potential beneficial effects of cla on animal health have focused on anti - inflammatory , anti - atherogenic , anti - carcinogenic , and anti - diabetic / anti - obesity effects ; however , the beneficial effects of cla in humans is inconclusive ( kelly , 2001 ; pariza et al . , 2001 ; it is important to note that a majority of the cla studies was performed with a chemically synthesized cla mixture , although in recent years , some were done with relatively pure 9z,11e - cla or 10e,12z - cla isomers . cla supplements which predominantly contain two major cla isomers are on the market ; however , the safety of cla is a concern in public health . to obtain beneficial amounts of cla , one must ingest 10 - 200 times what can be achieved in diet ( gaullier et al . , 2002 ) . although animal studies on cla showed that it is reasonably safe and well - tolerated in rats , dogs , and pigs ( o'hagan & menzel , 2003 ; pariza , 2004 ; scimeca , 1998 ) , whether the same is true for humans is not known . ( 2002 ) stated that cla enriched with 9z,11e- and 10e,12z - cla may be better for human consumption than one enriched with 8e,10z- , 9z,11e- , 10e,12z- , and 11z,13e - cla . in spite of these conclusions , concerns on cla safety remain due to its adverse effects which induce fatty liver , insulin resistance , and lipodystrophy in mice and increase c - reactive protein levels , lipid peroxidation , and reduction of milk fat in humans ( pariza , 2004 ) ; therefore , it is essential for long - term human studies to make solid conclusions on recommending a proper amount of cla supplementation to the public . it is also important to consider differences in cla isomers in terms of both benefits and potential toxicity . the immune - modulating effects of saturated and polyunsaturated fatty acids have been reported ( calder & grimble , 2002 ) . however , the available knowledge about the effects of clas on immune function in animals or humans is limited . the inflammatory - modulating effects of cla are mainly observed in in vitro and animal models , while cla 's anti - inflammatory effects are not conclusive in human studies . chicks and rats fed 0.5% cla for 4 wks gained weight even after lps injection , whereas chicks and rats without cla lost weight . this led to the idea that cla inhibited the catabolic effects of endotoxin ( cook et al . , 1993 ) . cla fed mice had higher levels of il-2 compared to control diet fed mice ( hayek et al . , 1999 ; wong et al . , 1997 ) , while tnf- and il-6 levels were decreased ( rahman et al . , 2007 ) however , kelley et al . ( 2002 ) reported that both 9z,11e- and 10e,12z - cla significantly and similarly increased tnf- and il-6 levels without altering prostaglandin levels in cla fed mice . in in vitro models , cla was positively related to anti - inflammatory effects . for example , yu et al . ( 2002 ) showed that cla reduced tnf- and il-6 levels induced by ifn- , at least partially by a ppar-dependent pathway . cla induced ifn- and il-2 levels in juckat t cells ( luongo et al . , moreover , il-10 receptor and il-10 levels were induced by cla in mouse dendritic cells ( loscher et al . , 2005 ) . in human epithelial cells , 9z,11e - cla attenuated cell growth and reduced il-8 levels while 10e,12z - cla had no effect ( jaudszus et al . , 2005 ) . the results from human studies focusing on anti - inflammatory effects of cla are inconclusive . ( 2005 ) demonstrated that cla supplementation could be beneficial in humans ( 3 g / d cla for 12 wks ) by enhancing iga , igm , and il-10 but inhibiting ige , tnf- , and il-1. in addition , cla boosted the hepatitis b vaccination in healthy human subjects although it did not alter other aspects of immune function including nk cell activity , lymphocyte proliferation , and production of tnf- , il-1 , il-6 , il-2 , il-4 , ifn- , and pge2 ( albers et al . , 2003 ) . in contrast , other human studies showed no significant relationship between cla and anti - inflammatory effect ( albers et al . , 2005 ; ramakers et al . , 2005 ; ritzenthaler et al . , 2005 ; tricon et al there were no changes on the levels of pge2 , leukotriene b4 , il-1 , and tnf- that were induced by lps in young healthy women ( kelley et al . , 2000 ) . the regulation of immune functions by cla does not seem to be affected by a single mechanism . cla affects the production of eicosanoids either directly or indirectly , enhances ppar activation , attenuates the nf-b pathway , or directly decreases pro - inflammatory cytokines to have beneficial effects on inflammation which ultimately influence metabolic syndromes including obesity , insulin resistance , and atherosclerosis ( zulet et al . , 2005 ) . cla decreased the production of eicosanoids such as pge2 , pgf2 , and ltb4 ( li & watkins , 1998 ; sugano et al . , 1998 ) , although the reduction of the eicosanoid production was not consistent ( hayek et al . , 1999 ; the mechanism by which cla reduces aa - derived eicosanoids can be explained as follows : ( 1 ) cla displaces aa in phospholipids ; ( 2 ) cla competes with la for desaturation and elongation ; ( 3 ) cla or cla metabolites may act as substrates or antagonists for enzymes involved in the prostaglandin production process ; and ( 4 ) cla - derived eicosanoids themselves may have anti - inflammatory properties . the ppar subtype is highly expressed in adipose tissue and macrophages ( olefsky , 2001 ) . most importantly , ppar plays a critical role in the regulation of inflammation ( cuzzocrea et al . , 2004 ) . various cla isomers activate ppar in raw 264.7 cells and decrease pro - inflammatory cytokines induced by ifn- ( yu et al . nf-b is a transcription factor that is involved in cytokine gene expression , cellular adhesion , cell cycle activation , apoptosis , and carcinogenesis . cla negatively regulates inflammatory mediators via the nf-b pathway by inhibiting ib phosphorylation ( cheng et al . , 2004 ) . finally , cla could exert direct anti - inflammatory properties by regulating the gene expression of inflammation mediators ( loscher et al . 2005 ) , perhaps due to effects on nf-b or ppar. in conclusion , the anti - inflammatory action of cla brings potential therapies for diseases such as atherosclerosis , diabetes , cancers , rheumatism , inflammatory bowel disease and obesity . meanwhile , the lack of understanding regarding clas mechanism ( s ) of action , safety issue surrounding cla as a dietary supplement , and isomer - specific effects on regulating inflammatory mediators require further studies . atherosclerosis is a complex disease that is influenced in part by inflammation ( reviewed in ( ross , 1999 ) ) . interactions between lipoproteins , monocyte - derived macrophages , t cells , and the normal cellular elements of the arterial wall are important contributors for the development of atherosclerosis . cla - fed rabbits had significantly lower low density lipoprotein ( ldl ) cholesterol and tg levels as well as a lower ratio of ldl / hdl ( high density lipoprotein ) and ldl / total cholesterol compared to control diet fed rabbits ( kritchevsky et al . , 2000 ; cla reduced total cholesterol , ldl , vldl ( very low density lipoprotein ) , and tg although there were no changes on hdl levels ( nicolosi et al . , 1997 ) . unlike the results in rabbits and hamsters , the results from mice were somewhat conflicting ( arbones - mainar et al . , 2006 ; munday et al . , 1999 ; nestel et al . , 2006 ; toomey et al . , , 11e - cla:10e , 12z - cla ( 80:20 blend ) ) was tested in apoe-/- mice and showed a suppression of atherosclerotic lesions by decreasing pro- inflammatory genes ( i.e. , metalloproteinases ( mmp)-9 and pecam-1 ) and an increase in apoptotic genes ( toomey et al . , 2006 ) . isomer - specificity of regulation of the lipid profile by cla isomers was shown in a few studies . ( 2005 ) showed that 10e,12z - cla increased hdl levels in 1% cla fed hamsters . however , wilson et al . ( 2006 ) reported that 9z,11e - cla decreased cholesterol whereas 10e,12z - cla increased cholesterol levels in 0.5% cla isomer fed hamsters . this discrepancy may be due to the relative amount and composition of the cla mix used in the studies . different types of cell lines related to atherosclerosis were used to study the anti - atherogenic effects of cla in in vitro systems . decreased levels of 6-keto - prostaglandin f(1 ) ( 6k - pgf(1 ) ) , a stable breakdown product of pgi2 , were observed in bovine aortic endothelial cells treated with cla ( coen et al . , 2004 ) . cla increased cd36 ( scavenger receptor ) in thp-1 , human macrophages as well as reduced total lipids , pge2 , pgi2 , and cytokine - induced nf-b binding activity in human smooth muscle cells ( ringseis et al . , 2006 ; weldon et al . , 2004 ) . however , cla failed to inhibit adhesion molecules which are important for the initiation step of atherosclerotic lesion formation , such as icam-1 , vcam-1 , and e - selectin induced by tnf- in human arotic ec ( schleser et al . , 2006 ) . although there were no changes in icam-1 and vcam-1 levels by cla , cla inhibited the adhesion activity of thp-1 cells to human umbilical vein ec ( huvec ) ( sneddon et al . , 2006 ) . cla 's fat - lowering effects have been reported in human subjects , although they have not been consistent . benito et al . ( 2001 ) showed no alteration of cholesterol , tg , hdl , and ldl cholesterol levels in human on a 3.9 g / d cla supplementation for 63 days . ( 2005 ) reported that healthy subjects on cla had lower total cholesterol , total cholesterol / hdl ratio compared to the subjects on control diet . on the other hand , mougios et al . ( 2004 ) reported a detrimental hdl - lowering effect of cla mix in humans . tricon et al . ( 2004b ) showed that 10e,12z - cla increased a ratio of cholesterol / hdl , ldl : hdl , and tg levels compared to 9z,11e - cla in healthy humans . in spite of isomer - specific effects of cla on lipid profile , the same group reported a similar effect of those two cla isomers on immune cell function as inhibiting mitogen - induced t cell activation ( tricon et al . , 2004a ) . the cla isomer - specificity varies depending on the results observed ; therefore , studies on pure cla isomers are needed to elucidate these questions . some proposed mechanisms for the anti - atherogenic and lipid - lowering effects of cla include roles for ppars , sterol regulatory element - binding proteins ( srebps ) and stearoyl - coa desaturase ( scd ) ( reviewed in ( bhattacharya et al . , 2006 ) ) . further studies using each cla isomer and long - term clinical studies are needed to establish their potential anti - atherogenic effects and mechanism ( s ) of action . the isomer - specific effects of 9z,11e - cla and 10e,12z - cla are now well - recognized ( reviewed in ( evans et al . , 2002 ) ) . recently , more studies have reported the effects of 9e,11e - cla in colon cancer cells , endothelial cells , and macrophage cells ( beppu et al . , 2006 ; lai et al . , 2005 ; yasui et al . , 2007 ) . ( 2005 ) showed that among the cla isomers , 9e,11e - cla attenuated proliferation of bovine endothelial cells the most by enhancing caspase-3 activity . in the following year , beppu et al . ( 2006 ) reported that 9e,11e - cla showed the strongest apoptosis among 9z,11z- , 9z,11e- , and 10e,12z - cla isomer on colon cancer cells , caco-2 cells . the same researchers further reported the 9e,11e - cla 's chemopreventive effect in rats fed 0.1% or 1% 9e,11e - cla for 4 wks ( yasui et al . , 2007 ) . ecker et al . ( 2007 ) showed that 9e,11e - cla , but not 9z,11e- and 10e,12z - cla , induces srebp target genes such as abcg-1 via a srebp-1c - dependent mechanism in primary human monocyte - derived macrophages . comparison of five different cla isomers showed that 9e,11e - cla indeed regulates gene expression distinctively different compared to the rest of cla isomers in a mouse macrophage cell line , raw 264.7 ( lee et al . , 2008 ) . thus , isomer specificity of 9e,11e - cla has been recognized in various cell types . although the portion of 9e,11e - cla in american beef fat and commercial cla mixtures ranged from 1.5 - 3.7% of the total cla isomers ( kramer et al . , 1998 ; yurawecz , 1999 ) , 9e,11e- and 9z,11e - cla were the main cla isomers in serum isolated from women on 2.1 g of cla supplementation for 45 days which represented 41% of the cla total ( petridou et al . , 2003 ) . these isomers were also the two major cla isomers in platelet lipids , 17% and 33% of the total respectively ( al - madaney et al . , 2003 ) . based on the basal plasma cla levels in healthy men as 7 m , the 9e,11e - cla concentration is estimated to be in the 1 - 3 m range ( huang , 1994 ) . considering 10-fold higher concentration in local areas , 10 - 30 m might be a physiologically relevant level of 9e,11e - cla . large - scale and economically efficient separation of 9e,11e - cla is difficult due to its minimal existence in the cla mixture . ( 2002 , 2003 ) reported the bacterial production of 9z,11e- and 9e,11e - cla from ricinoleic acid ( 12-hydroxy - cis-9-octadecaenoic acid ) and linoleic acid . this biological system for 9e,11e - cla production may promise the large - scale and selective preparation of 9e,11e - cla . in spite of intensive studies of clas performed over the last two decades , the mechanism of action of each cla isomer is not well - appreciated yet . in this review , various health - related effects of clas were discussed with a focus on superior and/or distinctive characteristics of 9e,11e - cla . the limited numbers of recent studies of 9e,11e - cla in in vitro and in vivo studies suggest that this specific cla isomer appears to have the anti - carcinogenic , anti - inflammatory , and potential anti - atherogenic effects . although it requires more in vivo and clinical studies before making a solid conclusion , understanding the effects of the individual cla isomer helps us to make a combination of the cla isomers in dietary supplements to maximize its healthful effects and minimize its harmful effects .

conjugated linoleic acids ( cla ) were identified in 1980 's , since then it has been intensively studied due to its various beneficial health effects such as anti - inflammatory , anti - atherogenic , anti - carcinogenic and anti - diabetic / obesity effects . isomer specificity of a number of cla isomers , especially predominant isomer 9z,11e- and 10e,12z - cla , is now recognized . however , the less prevalent cla isomers have not been well characterized . recently , studies have reported the distinctively different effects of 9e,11e - cla in colon cancer cells , endothelial cells , and macrophage cells compared to the rest of cla isomers . in this review , various effects of clas , especially anti - inflammatory and anti - atherogenic effects , will be discussed with focusing on the isomer - specific effects and potential mechanism of action of cla . at last , recent studies about 9e,11e - cla in in vitro and animal models will be discussed .

Overview of conjugated linoleic acids Anti-inflammatory effects Anti-atherogenic effects 9 Conclusion

adp - ribosylation factors ( arfs ) are a family of closely related gtp - binding proteins that are best known for their roles in the regulation of vesicular transport . in the active , gtp - bound state , arfs nucleate the assembly of a variety of coat protein complexes at sites of carrier vesicle formation . these include the copi coatomer , ap-1 , ap-3 and ap-4 adaptor complexes , and the monomeric gga adaptors . they accomplish this in part by direct physical interactions with components of the coat , and also by modulation of the local lipid microenvironment through activation of both phopholipase d and phosphoinositide kinases ( for review , see ref requires the activities of arf - specific guanine nucleotide exchange factors ( gefs ) , which catalyze gtp loading , and gtpase activating proteins ( gaps ) , which promote gtp hydrolysis . while the human genome encodes five arfs ( arf1 , 3 , 4 , 5 and 6 , which are expressed in all cells ) , it contains 15 recognizable arf gefs and an even larger number of gaps ( 31 proteins with identifiable arf - gap domains , and two structurally unrelated proteins with arf - gap activity , elmod2 and elmod1 ( r. kahn , personal communication ) . at least some of this diversity can be accounted for by tissue - specific expression , but all cells express more gefs and gaps than they do arfs . a major challenge in this field has been to determine the substrate specificity of each of these regulatory molecules , where they act in the cell and how their activities are influenced by other regulatory inputs . in the accompanying article , paul randazzo describes the utility of in vitro assays to determine substrate specificity and regulatory mechanisms . such assays have the distinct advantage that they are highly quantitative , and by definition reductionist ; the use of highly purified components and controlled conditions allows the measurement of binding constants , rate constants and the influence of cofactors such as phospholipids on enzyme function without interference from other cellular factors first , many arf gefs and gaps are large , multi - domain proteins that are difficult to produce in recombinant or highly purified form . for this reason many in vitro studies have used truncated forms , which may lack important regulatory domains . second , post - translational modifications , which can have a significant impact on enzymatic activity , are not present in recombinant proteins produced in bacteria . for example , arf6 is more abundant than arf1 at the plasma membrane , and an enzyme that can act on both in vitro may have a quantitatively larger effect on arf6 if it colocalizes with arf6 in an intact cell . it is therefore important to complement in vitro assays with whole - cell ( or tissue ) based assays when possible . this allows the characterization of substrate specificity in a more physiological context , as well as the dissection of biological function . cell - based assays fall into two general categories : ( 1 ) biochemical ( e.g. , pulldowns ) and ( 2 ) in situ ( morphological ) . here we will describe the practical aspects of each assay , and the advantages and disadvantages that they offer in dissecting the mechanisms of arf activation . perhaps the earliest effort to quantify the levels of an activated gtpase in a cell lysate were those that made use of a monoclonal antibody ( y13259 ) that bound over the guanine nucleotide binding site of ras to prevent nucleotide dissociation . unfortunately , such antibodies have not been found for any other gtpases . for many years , investigators measured the levels of radiolabeled gtp / gdp after immunoprecipitation of their favorite gtpase from metabolically labeled cells . this required extraction of the bound nucleotide , and chromatography on thin - layer tlc plates followed by autoradiography . more recently , this cumbersome procedure has been replaced by pulldown assays , which make use of the increased affinity of active gtpases for their effectors to specifically precipitate the activated proteins from cell lysates . the first such assay used a gst fusion containing the crib ( cdc42/rac interaction and binding ) domain of the serine / threonine kinase pak to measure the activity of both cdc42 and rac in cell lysates . we subsequently developed a similar assay for arfs , which takes advantage of the ability of the adaptor protein gga3 to bind all arf isoforms . in these assays , cells ( or tissues ) are lysed in buffer containing detergent ( typically triton x100 or np-40 ) and a high concentration of magnesium ( 10 mm ) to inhibit spontaneous nucleotide exchange . lysates are then incubated with the immobilized gst fusion of choice ( in this case containing residues 1313 of gga3 ) , and precipitates are immunoblotted to detect bound arf - gtp . , an advantage of using gga3 for this purpose is its ability to bind all arf isoforms , which can then be distinguished by immunoblotting with isoform - specific antibodies . it should be noted however that related reagents have been developed using fragments of the cdc42-gap arhgap21 , which binds arf1 and arf6 , and metallothionine-2 ( mt-2 ) or jip3 , which bind selectively to arf6 . such assays have been used extensively to measure arf activation in response to extracellular cues such as receptor agonists / antagonists , cell - cell or cell - matrix adhesion , and infection with bacterial or viral pathogens . hela cells were transfected with plasmids encoding arf6-ha and either empty vector or a vector encoding efa6 . after 24 h , cells were lysed and incubated with 30 ug of gst - gga3 fusion protein coupled to glutathione - sepharose beads . washed precipitates ( top panel ) and aliquots of total cell lysates ( bottom panel ) were immunoblotted with anti - ha antibody to detect active , gtp - bound arf6 , and total arf6 respectively . in the simplest form of pulldown assay all components ( arfs , gefs and gaps ) are endogenous , which has the advantage that they are expressed at normal levels and are localized to the appropriate subcellular compartment(s ) . cells / tissues can be exposed to stimuli , and the activation of endogenous arfs measured using an appropriate combination of gst - effector and antibody . one limitation of this approach is the availability of high quality isoform - specific antibodies . at this writing , although there are numerous commercial antibodies that are described as arf3- , arf4- or arf5- specific , their cross - reactivity with other arfs is not known , and has not been tested by the companies that sell them . buyer beware ! 24 ) this approach allows the activation state of individual arfs to be compared directly to each other , assuming they all have the same tag . care must be taken to keep expression levels low , to assure targeting of exogenous arfs to the appropriate subcellular compartment(s ) . this can be achieved by using vectors with weak promoters , by varying the time of analysis after transfection or by selecting stable transfectants that exhibit near - endogenous levels of expression . most arf gefs and gaps are expressed at low levels relative to their substrates and , as for the arfs , results of assays using overexpressed proteins must be interpreted with caution . in some cases , such as the gef efa6 and the gaps acap1 and acap2 , clear - cut specificities for arf6 are apparent even when both the gef / gap and the arfs are overexpressed . however in other cases , such as the gef brag2 , at least some activation of all arfs is observed upon overexpression . for this reason , we prefer to analyze gef and/or gap activity after knockdown of the endogenous protein by rnai . when this approach was applied to brag2 , we observed a 50% decrease in arf6-gtp , with no change in the levels of arf1-gtp . this result highlights one of the important advantages of whole cell assays ; although brag2 has the capacity to activate arf1 when overexpressed it does not appear to do so at endogenous levels of expression , presumably because it is more restricted in its localization . it also tells us that roughly half of the pool of active arf6 is generated through the activity of brag2 . one important limitation of such assays is that small or highly localized changes in arf activation may be difficult to resolve . for example , there is a large pool of active arf1 associated with the golgi complex , but arf1 is also found in smaller amounts on endosomal membranes and the plasma membrane . if a particular gef or gap acts only on the endosomal pool of arf1 , knockdown may have a significant biological effect , but only a minor effect on the total cellular pool of arf1-gtp . in the simplest form of pulldown assay all components ( arfs , gefs and gaps ) are endogenous , which has the advantage that they are expressed at normal levels and are localized to the appropriate subcellular compartment(s ) . cells / tissues can be exposed to stimuli , and the activation of endogenous arfs measured using an appropriate combination of gst - effector and antibody . one limitation of this approach is the availability of high quality isoform - specific antibodies . at this writing , good antibodies are available that selectively recognize either arf1 or arf6 . although there are numerous commercial antibodies that are described as arf3- , arf4- or arf5- specific , their cross - reactivity with other arfs is not known , and has not been tested by the companies that sell them . buyer beware ! 24 ) this approach allows the activation state of individual arfs to be compared directly to each other , assuming they all have the same tag . care must be taken to keep expression levels low , to assure targeting of exogenous arfs to the appropriate subcellular compartment(s ) . this can be achieved by using vectors with weak promoters , by varying the time of analysis after transfection or by selecting stable transfectants that exhibit near - endogenous levels of expression . most arf gefs and gaps are expressed at low levels relative to their substrates and , as for the arfs , results of assays using overexpressed proteins must be interpreted with caution . in some cases , such as the gef efa6 and the gaps acap1 and acap2 , clear - cut specificities for arf6 are apparent even when both the gef / gap and the arfs are overexpressed . however in other cases , such as the gef brag2 , at least some activation of all arfs is observed upon overexpression . for this reason , we prefer to analyze gef and/or gap activity after knockdown of the endogenous protein by rnai . when this approach was applied to brag2 , we observed a 50% decrease in arf6-gtp , with no change in the levels of arf1-gtp . this result highlights one of the important advantages of whole cell assays ; although brag2 has the capacity to activate arf1 when overexpressed it does not appear to do so at endogenous levels of expression , presumably because it is more restricted in its localization . it also tells us that roughly half of the pool of active arf6 is generated through the activity of brag2 . one important limitation of such assays is that small or highly localized changes in arf activation may be difficult to resolve . for example , there is a large pool of active arf1 associated with the golgi complex , but arf1 is also found in smaller amounts on endosomal membranes and the plasma membrane . if a particular gef or gap acts only on the endosomal pool of arf1 , knockdown may have a significant biological effect , but only a minor effect on the total cellular pool of arf1-gtp . fluorescence resonance energy transfer ( fret ) has been used by many investigators to visualize gtpase activation at specific locations within the cell . such assays typically utilize a donor fluorophore fused to the gtpase , and an acceptor fluorophore fused to the gtpase - binding domain of a known effector ( often referred to as a biosensor ) . when the gtpase is activated , binding to its effector brings the two fluorophores close enough together that light emitted by the donor activates the acceptor . many variations on this theme have been developed to track the activation of ras , rho , rab and arf family gtpases ( for review , see ref . 27 ) . in general , fret biosensors can be classified as either bi - molecular , in which donor and acceptor are encoded by separate constructs , or unimolecular , in which donor and acceptor are encoded as a single multidomain construct , where the gtpase - donor cassette is connected through a flexible linker to an effector - acceptor cassette . unimolecular biosensors have the advantage that donor and acceptor are by definition expressed at equivalent levels and are physically linked to each other in space . however , to date only bimolecular biosensors have been applied to the study of arfs . joel swanson and colleagues made elegant use of a single biosensor based on gga3 to measure and localize the activation of both arf1 and arf6 during fc-mediated phagocytosis , showing that arf6 was activated in the leading edge of the phagocytic cup , while arf1 was activated on the rim of the nascent phagosome . an arf6-specific biosensor , mt-2 , has been used by vitale and colleagues to demonstrate arf6 activation during regulated secretion . because arfs are myristolyated at their n - terminus , fluorophores must be introduced elsewhere in the molecule . while some arf isoforms ( e.g. , arf1 ) tolerate c - terminal fluorophores ( cfp , gfp and mcherry ) reasonably well , arf6 apparently does not . endogenous arf6 is primarily membrane - bound even in its gdp - bound state , and this is not significantly affected by small c - terminal epitope tags such as ha . however , c - terminally - tagged arf6-gfp is largely cytosolic , presumably due to steric interference from the fluorophore . insertion of gfp or the fret - optimized donor fluorophore cypet into a loop between the 4 helix and 6 strand in arf6 ( residues 140148 ) yields a construct that associates with membranes efficiently and is appropriately regulated by gefs and gaps . this construct has been used to monitor arf6 activation in fibroblasts treated with pdgf and neuronal growth cones . a representative set of images demonstrating arf6 fret is shown in figure 2 . a set of images from a fret experiment showing activation of arf6 by the arf gef arno . hela cells were co - transfected with donor plasmid encoding arf6-cypet ( inserted into the 6/4 loop as described in reference 30 ) and an acceptor plasmid encoding gga3-ypet . separate images for cypet ( a ) and ypet ( b ) are shown , as well as the corresponding grayscale fret image ( c ) and a pseudocolored version of the same image ( d ) . the activation of endogenous arfs can also be monitored in situ , using fluorophore - tagged fragments of effector proteins similar to the fret biosensors described above . vitale and colleagues have used an mt-2-gfp probe to examine the activation of endogenous arf6 in pc12 cells undergoing regulated exocytosis . similarly , montagnac et al . made use of the arf6-binding domain of the scaffolding protein jip3 to demonstrate the presence of active arf6 in clathrin - coated vesicles . in contrast , gga3 binds to all arfs , and therefore can not be used to distinguish among arf isoforms in in situ assays . the discovery of new isoform - specific effectors in the future will help expand the arsenal of tools available for this type of analysis . fluorescence resonance energy transfer ( fret ) has been used by many investigators to visualize gtpase activation at specific locations within the cell . such assays typically utilize a donor fluorophore fused to the gtpase , and an acceptor fluorophore fused to the gtpase - binding domain of a known effector ( often referred to as a biosensor ) . when the gtpase is activated , binding to its effector brings the two fluorophores close enough together that light emitted by the donor activates the acceptor . many variations on this theme have been developed to track the activation of ras , rho , rab and arf family gtpases ( for review , see ref . 27 ) . in general , fret biosensors can be classified as either bi - molecular , in which donor and acceptor are encoded by separate constructs , or unimolecular , in which donor and acceptor are encoded as a single multidomain construct , where the gtpase - donor cassette is connected through a flexible linker to an effector - acceptor cassette . unimolecular biosensors have the advantage that donor and acceptor are by definition expressed at equivalent levels and are physically linked to each other in space . however , to date only bimolecular biosensors have been applied to the study of arfs . joel swanson and colleagues made elegant use of a single biosensor based on gga3 to measure and localize the activation of both arf1 and arf6 during fc-mediated phagocytosis , showing that arf6 was activated in the leading edge of the phagocytic cup , while arf1 was activated on the rim of the nascent phagosome . an arf6-specific biosensor , mt-2 , has been used by vitale and colleagues to demonstrate arf6 activation during regulated secretion . because arfs are myristolyated at their n - terminus , fluorophores must be introduced elsewhere in the molecule . while some arf isoforms ( e.g. , arf1 ) tolerate c - terminal fluorophores ( cfp , gfp and mcherry ) reasonably well , arf6 apparently does not . endogenous arf6 is primarily membrane - bound even in its gdp - bound state , and this is not significantly affected by small c - terminal epitope tags such as ha . however , c - terminally - tagged arf6-gfp is largely cytosolic , presumably due to steric interference from the fluorophore . insertion of gfp or the fret - optimized donor fluorophore cypet into a loop between the 4 helix and 6 strand in arf6 ( residues 140148 ) yields a construct that associates with membranes efficiently and is appropriately regulated by gefs and gaps . this construct has been used to monitor arf6 activation in fibroblasts treated with pdgf and neuronal growth cones . a representative set of images demonstrating arf6 fret is shown in figure 2 . a set of images from a fret experiment showing activation of arf6 by the arf gef arno . hela cells were co - transfected with donor plasmid encoding arf6-cypet ( inserted into the 6/4 loop as described in reference 30 ) and an acceptor plasmid encoding gga3-ypet . separate images for cypet ( a ) and ypet ( b ) are shown , as well as the corresponding grayscale fret image ( c ) and a pseudocolored version of the same image ( d ) . the activation of endogenous arfs can also be monitored in situ , using fluorophore - tagged fragments of effector proteins similar to the fret biosensors described above . vitale and colleagues have used an mt-2-gfp probe to examine the activation of endogenous arf6 in pc12 cells undergoing regulated exocytosis . similarly , montagnac et al . made use of the arf6-binding domain of the scaffolding protein jip3 to demonstrate the presence of active arf6 in clathrin - coated vesicles . in contrast , gga3 binds to all arfs , and therefore can not be used to distinguish among arf isoforms in in situ assays . the discovery of new isoform - specific effectors in the future will help expand the arsenal of tools available for this type of analysis . as noted above , a major focus in this field has been to identify which arfs are acted upon by which gefs and gaps , where these activities are focused in the cell , and how they are regulated by upstream signals . although careful in vitro analysis of the catalytic properties of these enzymes is important to understanding their function , the biological roles of these important regulatory proteins can best be defined in the context of the cell .

small gtpases of the ras superfamily are important regulators of many cellular functions , including signal transduction , cytoskeleton assembly , metabolic regulation , organelle biogenesis and intracellular transport . most gtpases act as binary switches , being on in the active , gtp - bound state and off in the inactive , gdp - bound state , and cycle between the two states with the aid of accessory proteins , referred to as guanine nucleotide exchange factors ( gefs ) and gtpase - activating proteins ( gaps ) . this review will focus on the adp - ribosylation factors ( arfs ) , a family of g - proteins that are essential regulators of carrier vesicle formation during vesicular transport . as for most other gtpases , the arfs themselves are vastly outnumbered by the proteins that regulate them , and a major focus in the field has been to define the functional relationships between individual gefs and gaps and their substrates at the cellular level . over the years , a variety of methods have been developed to measure gtpase activation in vitro and in vivo . in vitro analysis will be discussed in the accompanying article by randazzo and colleagues . here we will focus on cell- and tissue - based assays and their advantages / disadvantages relative to cell - free systems .

Introduction Pulldown Assays Variations on the theme Analysis of GEFs and GAPs Reporter Assays FRET Summary

mantle cell lymphoma ( mcl ) is a b - cell malignant lymphoid tumor which is defined as a separate entity and included in lymphoma classification by world health organization ( who ) . mcl includes small - medium sized lymphoid cells and accounts for 610% of all b - cell lymphomas . mcl patients are predominantly older males and usually present as stage iv ( ann arbor ) disease . the prognosis of mcl is reported to be poor with a mean survival of 3 years . in most of the cases however , extra - nodal sites of involvement such as oral cavity , gastrointestinal tract , waldeyer 's ring , peripheral blood are well documented . palatal mcl is mostly seen in elderly people and may be masked with the presence of prosthesis . in this study , a case of palatal mcl is presented with treatment outcome and a literature analysis was performed to analyze the importance of dental examination in the primary diagnosis of the disease . a 71-year - old male patient was referred to eskiehir osmangazi university , faculty of dentistry , department of oral and maxillofacial surgery with a complaint of ill - fitting dentures . an intra - oral examination was performed and symmetric mucosal enlargements were observed on hard palate [ figure 1 ] . patient was uncomfortable about the mobility of his dentures and had tried to fix them by sticking dish rags or other foreign materials into the prosthesis . therefore , a provisional diagnosis of reactive mucosal lesion was made and incisional biopsy was performed under local anesthesia . ulcerated palatal symmetric mucosal swelling responsible for the mobility of maxillary dentures microscopic examination revealed diffuse abundant small cells with hyperchromatic nuclei in the subepithelial region [ figure 2 ] . glandular structures can be seen at the upper - right quadrant ( h&e stain , 100 ) nuclei of small cells have distinct hyperchromatism . mild nuclear pleomorphism is also evident ( h&e stain , 400 ) after the immunohistochemistry , tumoral cells showed strong positive staining with cd20 ( l26 , ventana , tucson ) [ figure 4 ] , pax-5 ( sp34 , ventana , tucson ) , cd5 ( sp19 , ventana , tucson ) , cyclin d1 ( sp4-r , ventana , tucson ) [ figure 5 ] , bcl-2 ( 124 , ventana , tucson ) and igm ( poliklnal , ventana , tucson ) . cd21 ( sp104 , ventana , tucson ) and cd23 ( sp23 , ventana , tucson ) immunostaining showed follicular dendritic cells . cd10 ( sp67 , ventana , tucson ) and igd ( policlonal , ventana , tucson ) were negative . patient was referred to hematology department of eskiehir osmangazi university , faculty of medicine for further evaluation and treatment . tumoral cells stained diffusely positive with cd20 ( ihc stain , 200 ) tumoral cells showed nuclear positivity with cyclin d1 staining ( ihc stain , 200 ) ultrasonography of abdomen revealed multiple lymphoadenopathies at mesenteric and para - aortic regions . after informed consent was taken , patient underwent cyclophosphamide , oncovin , prednol ( cop ) chemotherapy regimen . english dental and medical literature search was conducted using the combination of terms such as hard palate , mcl , lymphoma and extra - nodal lymphoma in pubmed . cases which were reported under the strict diagnosis of mcl and primarily located on the hard palate were extracted and data regarding treatment , follow - up and demographics was reviewed . nine publications with 14 cases defining primary hard palate mcls published between 1990 and 2014 were identified . mcl is a counterpart of non - hodgkin lymphoma family and was first included in lymphoma classification in 2001 . although mcl is mainly located in the lymph nodes , involvement of extra - nodal sites such as waldeyer 's ring , peripheral blood , bone marrow and gastrointestinal tract are also reported . definite diagnosis of mcl is achieved with immunohistochemical staining with or without the assistance of molecular techniques . mcl tumoral cells commonly express cd20 , cd5 , cd43 antigens and bcl2 and cyclin d1 protein . however , they are cd10 and bcl6 negative and show negativity / weak positivity for cd23 antigen expression . histologic examination reveals abundant monomorphic small - medium sized lymphoid cells with slightly / markedly irregular nuclear contours . blastoid and pleomorphic subtypes of mcl have been defined by who and it is suggested that blastoid or pleomorphic morphology are aggressive variants ; similar histology may be seen in some cases at relapse . hard palate is an unusual site for primary mcl and this has been reported in the english literature several times . reported that long term use of maxillary prosthesis might have provoked the lymphoid tissue accumulation and proliferation leading to a mass of mcl in the submucosal region of the hard palate . guggisberg and jordan reported that most oral mcls occur in an elderly male population and have a predilection for the palate . the duration of the prosthesis usage of mcl patients could not be analyzed in the current literature review due to the unavailable data in the case reports . in the current case , patient was using total prosthesis for 10 years and the only complaint of the patient was the mobility of his dentures . the clinical appearance of the tumor suggested that the palatal accumulation of lymphoid mass might have been initiated by the long term use of the total prosthesis . milgrom and yahalom reported nine cases of primary indolent lymphomas of the hard palate including mcl , follicular lymphoma and marginal zone lymphoma . there were two cases of mcl in their series and it is suggested that mcl cases showed more aggressive behavior compared to other lymphomas of the hard palate . ( chop ; cyclophosphamide , doxorubicin , vincristine , prednisolone ) chang et al . reported a polychemotherapy regimen consisting of cytoxan , doxorubicin , vincristine and prednisone , in conjunction with meusers et al . reported that the chop regimen did not show superiority to cop regimen in the treatment of mcl . although chop - like antracycline containing chemotherapeutic combinations do not have distinct advantage on survival , they are currently chosen for standard therapuetic approach . radiation therapy is still a therapeutic option in low - stage disease ( ann - arbor stage 1,2 ) in advance stage disease , the combination of radiotherapy and chemotherapy can be used , however , the efficacy of this combination have not been proven yet . primary mcl of the hard palate is a rare entity which is mostly seen in elder people . in this study , a case of palatal primary mcl which presents with ill - fitting total prosthesis is reported with clinical and histopathological features . dental total prosthesis may mask the existing lesion on the hard palate , therefore , dental practitioner should be alert at the time of the clinical examination of patients with total or partial prosthesis .

mantle cell lymphoma ( mcl ) is a subtype of b - cell non - hodgkin 's lymphoma seen predominantly in males . common extra - nodal sites of involvement of mcl are waldeyer 's ring , gastrointestinal tract , bone marrow and peripheral blood . the extra - nodal palatal localization of mcl is quite uncommon . mcl is seen in predominantly older patients , therefore undiagnosed mcl patients are likely to have total prosthesis . in this study , a case of mcl , initially presenting as palatal swelling was reported with relevant literature review and the possible role of dental professionals in the diagnosis of this rare entity was discussed .

INTRODUCTION CASE REPORT MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

several risk factors such as tobacco , human papilloma virus , areca nut , alcohol have been described in the literature as causative agents for head and neck squamous cell carcinoma ( hnscc ) . in recent years , areca nut consumption has been linked to oral cancer in studies from south east asian countries.[15 ] betel nut has a long history of use in south east asian natives and is part of their culture and religion . the acute effects are worsening of asthma , low blood pressure , and rapid heart beats whereas chronic effects are oral submucous fibrosis ( osf ) , precancerous oral lesions , and squamous cell carcinoma . we report a series of female patients with head and neck cancer who had the habit of chewing only areca nut without any history of tobacco usage in any form . we present their clinical parameters , socioeconomic status , education level , duration , and frequency of areca nut chewing along with review of the literature . we also intend to highlight the association of hypopharynx carcinoma with areca nut chewing habit , which has not been studied in the literature so far . these are prospectively collected data of ten patients who presented to us with biopsy proven hnscc and a history of areca nut chewing without any history of tobacco usage . we collected information on clinical parameters , duration , and frequency of areca nut chewing , socioeconomic status , and education level of the patients . there were ten female patients [ table 1 ] with the mean age of 49 ( ranging from 31 to 59 years ) . two patients presented with hypopharynx cancer and eight had the lesions in oral cavity ( four tongue , three buccal mucosa , and one floor of mouth ) . amongst those with oral cancer , the most common complaint was that of a nonhealing ulcer in the oral cavity along with features of submucus fibrosis ( trismus , white , and sensitive mucosa ) . osf was present in all these cases , involving bilateral buccal mucosa , palate , and tongue . all patients complained of progressive inability to open mouth and sensitive mucosa ( to hot and spicy foods ) of varying degree [ figures 1 and 2 ] . the mean duration of areca nuts chewing was 15.1 years ( ranging from 6 to 50 years ) . areca nut chewing habit had a wide variation in these cases , in terms of duration , frequency , socioeconomic status , and employment status . most of the patients had the habit of areca nut chewing with an average of three to six times a day . the commonest form of areca nut chewed was the natural dried form ( 7/10 cases ) and the rest three cases admitted to chew commercially prepared areca nut products [ table 1 ] . the patients belonged to the upper lower socioeconomic category [ table 2 ] and were housewives . amongst the eight oral cancer cases , tongue ( 4 ) was most frequently involved subsite followed by buccal mucosa ( 3 ) and floor of mouth ( 1 ) . tongue followed by buccal mucosa were the primary sites of oral carcinoma in chewers of commercially available areca nut products whereas hypopharynx was primary site in chewers of natural dried areca nut , in addition to buccal mucosa and tongue . there were lot of soft deposits , plaque , and calculus and the typical stain due to tobacco and betel quid ( brownish black or yellowish brown ) was not seen in these cases . also , the typical incrustations on the soft tissue especially seen in gutka chewers and chewers of pan with tobacco were absent on clinical examination in these cases . this suggested their only areca nut chewing habit . there was gross generalized attrition of teeth with exposed roots , wear facets , and root stumps , contributing to poor oral hygiene . there were two cases of scc involving pyriform sinus ( subsite of hypopharyx ) that presented with odynophagia with an average duration of 45 days . one of the patients underwent total laryngectomy followed by radiation therapy , and one patient required only palliative care . the submucous fibrosis was seen to involve the entire upper aerodigestive tract in these cases . intraoperative finding in patient undergoing total laryngectomy and laryngoscopic examination in the other patient showed extensive submucous fibrosis in the hypopharyngeal and laryngeal mucosa . in majority of the cases ( 6/10 ) , the lesions were in an advanced stage requiring extensive surgical resection and reconstructions followed by aggressive adjuvant therapies . in two patients curative treatment was not possible and palliative chemotherapy was advised . age , clinical details , site and treatment details of patients with head and neck cancer clinical presentation with variable degree of restricted mouth opening and ulcerative lesion clinical presentation with ulcerations , stains on teeth with attrition and poor oral hygiene reason for areca nut chewing and socioeconomic status as per the kuppuswamy scale in contrast to the western literature wherein smoking , alcohol and human papilloma virus have been described as major risk factors for head and neck scc , smokeless tobacco , and areca nut chewing are predominant risk factors in india . areca nut is a highly addictive substance with the score for mean severity of dependence as 7.3 ( in a range of 112 ) similar to the problematic use of amphetamines . there have been reports of usage of these products in asian migrants to the united states , the united kingdom , singapore , australia , germany , south africa etc.[1019 ] this habit is an important public health problem in taiwan . although , chewing areca nut has been found to be associated with oral cancer and recently with development of primary hepatocellular and esophageal carcinoma , this was the first time we encountered a series of carcinoma of hypopharynx in areca nut chewers . unlike tobacco , areca nut is portrayed as a safe mouth freshener ; therefore , it is freely available and widely consumed . there are reports of areca nut addiction amongst children of south east asian countries which results in oral cancer in the younger age . a study in pakistan reported that school children at primary school level are areca nut addicts and 74% children used areca nut , 35% of them chewed betel quid daily . the cases described in our study were middle - aged housewives with the chronic betel nut chewing habit . due to the small sample size the reasons for areca nut consumption in these cases were its psycho - stimulating effects causing a euphoric feeling , sweetening breath , as a digestive or as a cultural practice . the patients had a lower level of education and not aware of the deleterious effects associated with areca nut chewing habit . psychopharmacological effects of areca nut have been described as a popular pleasure giving substance in south asia and include increase in concentration , mild mood elevation , enhanced satisfaction after eating and relaxation . habituation and addiction to daily chewing of the quid has also been reported amongst the people hailing from the gujarat state in india . majority of cases in our study were of tongue and buccal mucosa , in accordance with a study from south africa . the cause of submucous fibrosis is the excessive synthesis of collagen in the submucous tissues . in vitro studies with cultured fibroblasts have shown that areca nut alkaloids such as arecoline and its hydrolyzed product arecaidine stimulate proliferation and collagen synthesis in a dose - dependent manner , higher concentrations being cytotoxic . flavonoids , catechins , and tannins in areca nuts cause collagen fibers to crosslink , making them less susceptible to collagenase . furthermore , the extracts of areca nut and its components have been shown to be crucial in the pathogenesis of osf and oral cancer by differentially inducing the dysregulation of cell cycle control mitochondrial membrane potential , depletion of cellular glutathione , and intracellular h2o2 production . it has been estimated that people with osf are 19.1 times more likely to develop oral cancer than those without it , after adjusting for other risk factors and another study describe a 7.6% rate of malignant transformation of osf to frank carcinoma over a 10-year period . we did not come across any other published report where areca nut has been linked to the hypopharynx cancer . the finding of the features of submucous fibrosis in the hypopharynx and larynx mucosa is a sparsely reported feature in chronic areca nut chewers . similarly , association of hypopharynx cancer with submucous fibrosis of oral cavity is an uncommon problem that poses challenge during evaluation and treatment of these cancers . areca nut chewing is an important risk factor in the genesis of oral potentially malignant and malignant lesions in indian women . although there is a need to establish the carcinogenic effects of areca nut at a genetic or molecular level in these cases , wide spread health education programs are necessary to reach both urban- and rural - based populations in education and motivation against the habit of chewing areca nuts .

background : head and neck squamous cell carcinoma ( hnscc ) is an important public health problem in india . several risk factors such as tobacco , human papilloma virus , alcohol , areca nut usage have been extensively studied as causative agents . though areca nut chewing is known cause of oral cancer , its association with hypopharynx cancer has not been previously reported . since areca nut is mostly consumed along with tobacco , it is uncommon to find patients who consume the areca nut alone.materials and methods : this is a prospective case series of ten women who presented to us with hnscc with history of chewing of areca nut alone for several years . we have excluded all those cases where areca nut was consumed along with tobacco in any form . the data were prospectively collected with regard to clinical parameters , duration and frequency of areca nut usage , the socio - economic status and education level.results:all ten females had varying degree of submucous fibrosis and coexisting squamous cell carcinoma either in the oral cavity or hypopharynx . submucous fibrosis was characterized by burning mouth , unhealthy oral mucosa , buried third molars , trismus , poor oral hygiene , etc . the disease presented in an advanced stage in majority of the cases . all patients were unaware of areca nut 's deleterious effects.conclusion:areca nut chewing is an important risk factor for hnscc in females . despite plethora of information , little importance is given to areca nut control in cancer prevention campaigns in india .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

since the time of hebb 's postulate many groups have investigated the timing requirements for plasticity induction in the hippocampus ( levy and steward , 1979 ; gustafsson et al . , 1987 ; stanton and sejnowski , 1989 ; debanne et al . , 1994 ) . using pairs of single presynaptic and postsynaptic action potentials bi and poo ( 1998 ) and debanne et al . ( 1998 ) were the first to fully characterize the timing window for the induction of what we now term stdp , in the hippocampus . they took advantage of cultured hippocampal preparations which allow pairs of connected cells to be recorded from with relative ease . this allows one to precisely control the spiking of both the presynaptic and the postsynaptic neuron . in a similar fashion , recordings between pairs of mono - synaptically connected pyramidal neurons in cortical slices also demonstrated reliable stdp ( markram et al . 2001 ) which raised the possibility that stdp is a general phenomenon for all synapses exhibiting nmda receptor - dependent synaptic plasticity . bi and poo and debanne et al . demonstrated that the direction and magnitude of synaptic plasticity could be dictated by the precise millisecond timing of single presynaptic and postsynaptic spikes . if presynaptic spikes precede postsynaptic spikes by up to 30 ms ( positive spike timing interval ) then ltp was induced , whereas if the presynaptic spike occurred after the postsynaptic spike ( negative spike timing interval ) ltd ensued . the magnitude of ltp and ltd was greatest when the spikes were closest together leading to a switch from maximal ltd to maximal ltp over a narrow time window of only a few milliseconds . this spike timing window offered an extremely elegant model for plasticity induction in vivo and has proved popular with groups modeling information storage in the brain ( e.g. , song et al . recordings in dissociated hippocampal cultures have their drawbacks , in particular the divergence of culture conditions from an intact hippocampal network . after the initial description of stdp in dissociated hippocampal cultures many groups investigated stdp timing curves in hippocampal slices . paired recording of connected ca3ca1 pyramidal cells in acute hippocampal slices is extremely difficult owing to very low connectivity rates so this has been restricted to organotypic cultured slices . these experiments revealed that synchronous pairing of single presynaptic action potentials with postsynaptic bursts of action potentials lead to the induction of ltp whereas ltd could be induced if this stimulation was given asynchronously ( debanne et al . the use of organotypic slice culture also has its drawbacks and it is unclear what developmental stage this cultured network represents . as a result many groups have resorted to investigating stdp in the acute hippocampal slice preparation through pairing extracellular schaffer collateral stimulation with action potential initiation in patched ca1 pyramidal cells . witnessed the same stdp curve observed by bi and poo , when pairing schaffer collateral stimulation with single post synaptic spikes in hippocampal slices from young adult rats . they also observed an additional ltd window at positive spike timing intervals between 15 and 20 ms . they argue that this additional ltd window may be due to the presence of inhibitory inputs that are lacking in cultured preparations ( nishiyama et al . , 2000 ) . subsequent experiments have shown that the use of cs ions in the internal electrode solution by nishiyama et al . fundamentally alters the induction of synaptic plasticity by stdp protocols ( wittenberg and wang , 2006 ; isaac et al . , 2009 ) . indeed , other groups have been unable to induce stdp with single postsynaptic spikes when using k ion based internal electrode solutions . instead , the pairing of schaffer collateral stimulation with a burst of postsynaptic action potentials is required for the induction of ltp in acute hippocampal slices ( pike et al . , 2003 ; wittenberg and wang , 2006 ; buchanan and mellor , 2007 ; carlisle et al . , 2008 ) . the importance of postsynaptic bursting is also supported by the effectiveness of a variety of burst firing stimulation protocols to induce ltp at this synapse ( debanne et al . , 1994 , 1998 ; the requirement for postsynaptic burst firing appears to have a developmental profile and is critical for plasticity induction in slices from adult animals ( meredith et al . were able to induce ltp through pairing epsps with single postsynaptic spikes in adult slices if fast gabaergic inhibition was blocked . this suggests the maturation of inhibition may underlie the requirement for postsynaptic bursts , although this result was not replicated in other studies ( pike et al . , 1999 ; buchanan and mellor , 2007 ) . none of the aforementioned studies have systematically investigated the timing dependence of presynaptic spikes with postsynaptic burst firing . for this information we must turn to experiments on hippocampal slices taken from immature animals ( < p21 ) . in slices from juvenile animals spike timing induction protocols have produced a variety of results . pairs of single presynaptic and postsynaptic spikes given at positive spike timing intervals have been found to induce either ; no plasticity ( buchanan and mellor , 2007 ) , ltd ( wittenberg and wang , 2006 ; campanac and debanne , 2008 ) or ltp ( meredith et al . , 2003 ; buchanan and mellor , 2007 ; campanac and debanne , 2008 ) dependent on specific experimental conditions . several groups have described a frequency dependency to the induction of stdp where ltp is only induced when positive spike timing pairs are repeated at 10 hz or greater and no plasticity or a small amount of ltd is observed when positive spike pairs are repeated at lower frequencies ( 5 hz ) . in these cases the spike pair repetition rate becomes the dominating factor and the resultant plasticity is timing independent ( wittenberg and wang , 2006 ; buchanan and mellor , 2007 ) . timing dependence can be reintroduced when single epsps are paired with a postsynaptic burst ( wittenberg and wang , 2006 ) . in contrast , two other studies were able to induce ltp with positive spike timing pairs repeated at lower frequencies ( meredith et al . the reasons for the discrepancies between results from different groups is not immediately apparent although it is of note that only two of the studies ( meredith et al . , 2003 ; buchanan and mellor , 2007 ) made use of a control input pathway to determine the induction of synaptic plasticity . in addition , it has been shown that postsynaptic spiking is relatively less important than epsp amplitude for the induction of stdp in the immature hippocampus compared to the mature network ( buchanan and mellor , 2007 ) . this suggests that differences in the epsp amplitude used during stdp induction could explain observed discrepancies . in all cases , although the significance of precise spike timing in the induction of synaptic plasticity in the hippocampus is questionable , the plasticity observed is still dependent on the coincidence of presynaptic and postsynaptic activity as epsps or postsynaptic action potentials given on their own fail to induce plasticity . also , a timing window is still observed as spike timing intervals of 100 ms fail to induce any change in synaptic strength ( meredith et al . , 2003 ; wittenberg and wang , 2006 ; buchanan and mellor , 2007 ; campanac and debanne , 2008 ) . so , the pursuit of the elegant hippocampal spike timing curve described by bi and poo seems to have lost its way . in its place we have a variety of spike timing window shapes described by different groups under different experimental conditions ( figure 1 ) . but out of this seemingly contradictory mess there seems to be a common underlying theme that is starting to unveil a clearer picture of stdp rules in the hippocampus . center , classic stdp curve originally described by bi and poo ( 1998 ) in dispersed hippocampal cultures . top left , ltp only window when spike timing pairs are repeated at 10 hz or greater in hippocampal slices ( buchanan and mellor , 2007 ) . top right , bidirectional stdp window observed when single epsps are paired with postsynaptic bursts ( wittenberg and wang , 2006 ) . bottom right , ltd only window when spike timing pairs are repeated at less than 10 hz ( wittenberg and wang , 2006 ) . bottom left , classic stdp window with additional ltd window observed with postsynaptic cesium in hippocampal slices ( nishiyama et al . , 2000 ) . due to a long history of plasticity research at the schaffer collateral - ca1 pyramidal cell synapse much is known about the downstream mechanisms that determine the expression of synaptic plasticity . the critical trigger for plasticity is the influx of ca through nmda receptors where local peak [ ca ] is crucial in setting levels of camkii and pp1 activity ( lisman and zhabotinsky , 2001 ) and therefore determining both the magnitude and direction of the resultant plasticity ( bienenstock et al . , 1982 ; lisman , 1989 ; yang et al . , 1999 ) . this increase in postsynaptic [ ca ] is dependent on the level of postsynaptic depolarization to relieve the mg block from nmda receptors and many of the apparent controversies regarding stdp induction in the hippocampus may be explained in this context . in turn , postsynaptic depolarization will be influenced by a number of factors such as action potential back - propagation , modulation of dendritic membrane potential and excitability , epsp amplitude , presence of inhibitory synaptic transmission and frequency of stimulation . bursts of action potentials produce a larger and more prolonged postsynaptic depolarization and therefore a much greater spine [ ca ] than single spikes . this results in efficient induction of ltp ( pike et al . , 1999 ; buchanan and mellor , 2007 ; carlisle et al . , 2008 ) or conversion of ltd to ltp ( wittenberg and wang , 2006 ) . at longer positive spike timing intervals the postsynaptic burst lags too far behind the epsp to reach the threshold for ltp . although calcium levels are still elevated beyond those observed for epsps or postsynaptic bursts alone leading to the observation of a second ltd window ( figure 1 ; wittenberg and wang , 2006 ) . in the absence of bursts , other mechanisms for enhancing postsynaptic excitability depolarizing the membrane by perfusing cs into the neuron from the patch pipette will broaden and increase the back - propagation of somatic action potentials ( wittenberg and wang , 2006 ) as well as depolarizing the membrane allowing single postsynaptic spikes to induce stdp in adult hippocampal slices . an additional ltd window is observed at longer positive stis due to the calcium levels dropping below the threshold for ltp but not ltd ( nishiyama et al . similarly , enhancing excitability by activation of neuromodulatory receptors , for example muscarinic acetylcholine receptors , reduces spike attenuation ( tsubokawa and ross , 1997 ) and facilitates ltp induction ( isaac et al . , . this may be particularly critical in the slice preparation where external neuromodulatory inputs are removed . modulation of other ionic conductances such as the sahp can also regulate the induction of stdp again illustrating the critical role played by membrane excitability ( fuenzalida et al . , 2007 ) . the magnitude of the epsp used to induce stdp will contribute to the depolarization seen within the spine and therefore to nmda receptor activation during stdp induction . this could explain discrepancies between reports since synaptic response amplitude varies from epscs of 50 pa ( buchanan and mellor , 2007 ) to 50150 pa ( wittenberg and wang , 2006 ) to epsps of 35 mv ( meredith et al . larger epsps could produce sufficient depolarization during single pairs of presynaptic and postsynaptic stimulation to induce ltp ( meredith et al . interestingly , repetitive stimulation of individual suprathreshold epsps ( epsps that are large enough to induce an action potential ) induces ltd ( wittenberg and wang , 2006 ) which predicts that the same will occur for suprathreshold stimulation during extracellular recording even at low stimulation frequencies . also the driving of multiple action potentials by bursts of epsps induces ltp ( buchanan and mellor , 2007 ) . conversely , in dissociated culture conditions epsc amplitude was found to be inversely correlated with ltp induction although the epsc amplitude range is much greater ( 302000 pa ) than that used in acute slices ( bi and poo , 1998 ) . blockade of gabaa receptors can also enhance excitability and therefore allow the induction of ltp by single pairs of spikes ( meredith et al . , 2003 ) . this could also explain some age dependent effects on stdp induction since the mature gabaergic network in adults may increase the threshold for action potential back - propagation whereas in younger animals a less mature gabaergic network allows single spikes to back - propagate fully . however , there is also evidence that somatically induced action potentials are unable to provide the postsynaptic depolarization required for the induction of ltp in slices from juvenile animals . when somatic action potentials are blocked by focal ttx application ltp can still be induced if the level of presynaptic stimulation is increased . this suggests that dendritically initiated spikes may play a critical role in the induction of ltp in slices from younger animals ( buchanan and mellor , 2007 ) . the frequency dependence of stdp in juvenile hippocampal slices can also be explained through differences in the levels of postsynaptic depolarization . above a frequency of 10 hz individual action potentials do not repolarize back to the resting membrane potential before the next action potential in the train ( buchanan and mellor , 2007 ) . this results in a residual level of depolarization throughout the train of spike pairings which may increase postsynaptic depolarization and enhance nmdar activation . in addition , [ ca ] will summate at higher frequencies ensuring spike timing pairs reach the threshold for ltp . below 10 hz there is little or no residual depolarization and the coincidence of epsps and action potentials are only able to produce enough depolarization to reach the threshold for ltd ( sjostrom et al . , 2001 ; wittenberg and wang , 2006 ; buchanan and mellor , 2007 ) . the timing independence of stdp observed by several groups can also be explained through differences in postsynaptic depolarization . at higher frequencies the level of residual depolarization may mean that any degree of near coincidence is capable of increasing the postsynaptic calcium above the threshold for ltp ( buchanan and mellor , 2007 ) . also the majority of experiments in hippocampal slices are done in the presence of gabaa receptor blockers which could prolong the duration of the postsynaptic depolarization caused by both the epsp and the back - propagating action potential . a ca hypothesis for the induction of synaptic plasticity by pairs of presynaptic and postsynaptic spikes was first formalized in a model for stdp based on [ ca ] ( shouval et al . , 2002 ) . since then it has been revised to include the activation of calmodulin and camkii ( shouval et al . , 2002 ; rubin et al . , 2005 ; graupner and brunel , 2007 ; helias et al . , 2008 ; urakubo et al . , 2008 ) and in this issue a model is presented specifically designed to model the ca dynamics within the spines of ca1 pyramidal cell dendrites during stdp at schaffer collateral synapses in the hippocampus ( rackham et al . , 2010 under review ) . this paper illustrates how most of the current data on synaptic plasticity induction can be replicated by such a model and can potentially unify current thinking on stdp in the hippocampus . it will be interesting to see if future experiments measuring spine calcium dynamics during stdp , similar to those performed at cortical synapses ( nevian and sakmann , 2006 ) , confirm such a ca based model for the induction of synaptic plasticity . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

synaptic plasticity has historically been investigated most intensely in the hippocampus and therefore it is somewhat surprising that the majority of studies on spike timing - dependent plasticity ( stdp ) have focused not in the hippocampus but on synapses in the cortex . one of the major reasons for this bias is the relative ease in obtaining paired electrophysiological recordings from synaptically coupled neurons in cortical slices , in comparison to hippocampal slices . another less obvious reason has been the difficulty in achieving reliable stdp in the hippocampal slice preparation and confusion surrounding the conditions required . the original descriptions of stdp in the hippocampus was performed on paired recordings from neurons in dissociated or slice cultures utilizing single pairs of presynaptic and postsynaptic spikes and were subsequently replicated in acute hippocampal slices . further work in several laboratories using conditions that more closely replicate the situation in vivo revealed a requirement for multiple postsynaptic spikes that necessarily complicate the absolute timing rules for stdp . here we review the hippocampal stdp literature focusing on data from acute hippocampal slice preparations and highlighting apparently contradictory results and the variations in experimental conditions that might account for the discrepancies . we conclude by relating the majority of the available experimental data to a model for stdp induction in the hippocampus based on a critical role for postsynaptic ca2 + dynamics .

STDP in the Hippocampus: The Data A Unifying Theory to Describe STDP in the Hippocampus Conflict of Interest Statement

chronic obstructive pulmonary disease ( copd ) is a disorder characterized by persistent airflow limitation with systemic manifestations . in addition to the inflammatory process in the lungs , there is a low - grade systemic inflammation which is linked to the pathogenesis of the comorbidities present in copd [ 24 ] . it is not known whether systemic inflammation is a spillover of the inflammation present in the lungs or if pulmonary manifestations are one form of expression of this systemic disease [ 3 , 5 ] . smoking , lung hyperinflation , tissue hypoxia , and skeletal muscle dysfunction have been suggested as possible factors involved in the pathogenesis of the systemic inflammation in copd . recently , adipose tissue mediated inflammation has gathered increasing interest as a significant mechanism in inducing and promoting systemic inflammation in copd . adipokines ( also known as adipocytokines ) are protein mediators secreted by adipose tissue and they are involved not only in the regulation of energy metabolism but also in inflammatory responses in many chronic inflammatory diseases [ 6 , 7 ] . there is increasing body of evidence supporting a significant role of adipokines adiponectin and leptin in the inflammatory processes in copd , but only a little or nothing is known about the other adipokines like nesfatin-1 and visfatin in inflammatory lung diseases . so far , there are no previous publications on nesfatin-1 and only a few reports on visfatin in copd . nesfatin-1 is a novel adipokine discovered in 2006 and at first linked to appetite and body weight control in rats . nesfatin-1 is expressed in human adipose tissue and tnf- , il-6 , insulin , and dexamethasone have been shown to increase its secretion . nesfatin-1 has also been shown to regulate inflammatory responses and cell apoptosis in rats and to have cardioprotective effects in human studies . there are only two previous publications on nesfatin-1 in lung diseases : one concerning changes in fat mass in lung cancer and the other on cystic fibrosis . visfatin , also known as nicotinamide phosphoribosyltransferase ( nampt ) and previously identified as pre - b cell colony - enhancing factor ( pbef ) , was originally discovered in lymphocytes , bone marrow , liver , and muscle . later , visfatin was identified also in the lungs , and , interestingly , the proinflammatory cytokine il-1 has been reported to enhance visfatin expression in pulmonary epithelial and endothelial cells in vitro . also proinflammatory cytokines il-6 and tnf- have been shown to induce the expression of visfatin . granulocytes and monocytes are major sources of visfatin , and it is also produced by macrophages and adipocytes . visfatin is a proinflammatory cytokine involved in the regulation of inflammation and innate immunity [ 22 , 23 ] . in the lungs , visfatin is associated with acute lung injury ( ali ) and the inhibition of visfatin synthesis has been shown to attenuate inflammation and apoptosis associated with severe virus infection in lung endothelium . in the present study , we measured the plasma levels of visfatin and nucb2/nesfatin-1 in patients with copd and in controls and investigated if these adipokines are associated with other markers of inflammation , lung function , the degree of emphysema , and symptoms or with the response to inhaled glucocorticoids in patients with copd . forty - three steroid - nave male patients with copd were recruited among subjects referred from primary care for diagnostic assessment to the department of respiratory medicine at tampere university hospital , tampere , finland . copd diagnosis was based on gold strategy paper and the inclusion criteria were smoking history of at least 20 pack - years , symptoms of copd ( cough , sputum production , and dyspnoea ) , postbronchodilator fev1/fvc < 0.7 , reversibility of fvc or fev1 induced by 2-agonist < 12% or 200 ml , and pulmonary emphysema visible on high resolution computed tomography ( hrct ) of the lungs . ten ( 23% ) of the patients had hypertension and five ( 12% ) had hypercholesterolemia while the number of patients with other diseases was too small for any statistical analysis . forty - one age - matched nonsmoking healthy males with normal lung function served as controls . spirometry , fractional exhaled nitric oxide concentration ( feno ) , and pulmonary diffusing capacity per unit of alveolar volume standardized for haemoglobin concentration ( hb - dl , co / va ) were measured , high resolution computed tomography ( hrct ) of the lungs was performed , and symptoms were scored with st . the same measurements excluding hrct were repeated in twenty - seven patients with copd after 4 weeks of treatment with inhaled fluticasone propionate ( flixotide diskus 500 g b.i.d . ; glaxosmithkline , ware , uk ) . plasma concentrations of nucb2/nesfatin-1 , visfatin , interleukin 6 ( il-6 ) , interleukin 8 ( il-8 ) , tumor necrosis factor alpha ( tnf- ) , and matrix metalloproteinase 9 ( mmp-9 ) were determined by enzyme immunoassay by using the following reagents : nucb2/nesfatin , tnf- , and mmp-9 : r&d systems europe ltd . , karlsruhe , germany ; il-6 : sanquin , amsterdam , netherlands ; and il-8 : bd biosciences , san diego , ca , usa . according to the manufacturer , the nesfatin-1 antibody detects the protein nucleobinding-2 ( nucb2 ) in addition to nesfatin-1 which is derived from nucb2 by posttranslational processing . therefore , the term nucb2/nesfatin-1 is used when referring to our own measurements . the detection limits and interassay coefficients of variation were 7.8 pg / ml and 11.6% for nucb2/nesfatin-1 , 0.1 ng / ml and 8.3% for visfatin , 0.3 pg / ml and 7.6% for il-6 , 1.56 pg / ml and 7.0% for il-8 , 0.5 pg / ml and 6.5% for tnf- , and 7.8 pg / ml and 6.0% for mmp-9 . spirometry was measured ( vmax 20c , sensor - medics , yorba linda , ca , usa ) before and after 400 g of inhaled salbutamol . fractional exhaled nitric oxide concentration at exhalation flow rate of 50 ml / s ( feno0.05 ) was measured with a sievers noa 280 no - analyzer ( sievers instruments , boulder , co , usa ) as previously described . airway wall thickness and the extent of emphysema on pulmonary high resolution computed tomography ( hrct ) ( siemens somatom plus 4 , siemens medical , erlangen , germany ) were assessed by two experienced thoracic radiologists ( ritva jrvenp and lea kbi ) as previously described . george 's respiratory questionnaire ( sgrq ) containing questions and scoring on three aspects of the disease ( symptom frequency and severity , activities that cause or are limited by breathlessness , and the impact of the disease on social functioning including psychological disturbances resulting from the disease ) to obtain a total score . the scale has a range from 0 to 100 , with higher scores representing more severe disease . visfatin was normally distributed , while the distribution of nucb2/nesfatin-1 was skewed and could not be normalised after log - transformation . t - test or mann - whitney test was used to examine differences between healthy controls and patients with copd , where appropriate . pearson 's r or spearman 's rho was used to analyse the correlations between adipokines and other inflammatory markers or markers of disease severity , where appropriate . changes in plasma levels of adipokines and other measures during fluticasone treatment were analysed with paired t - test or wilcoxon 's test , where appropriate . the results are presented as mean sd for normally distributed data and as median ( interquartile range ) for nonnormally distributed data . the study was approved by the ethics committee of tampere university hospital , tampere , finland , and complies with the declaration of helsinki . in the patients with copd , the mean age was 59.5 7.8 ( mean sd ) years and the mean forced expiratory volume in 1 second ( fev1 ) was 53 14% of the predicted . the age- and sex - matched healthy controls had normal lung function and there were no significant differences in bmi between the patients with copd and the controls ( 25.8 4.2 versus 26.7 3.9 kg / m , resp . plasma levels of adipokines nucb2/nesfatin-1 and visfatin in the patients with copd and controls are given in table 1 . visfatin levels were lower in copd , but plasma nucb2/nesfatin-1 levels did not differ from controls . neither of the adipokines measured differed between ex - smokers ( n = 10 ) and current smokers ( n = 33 ) or between the patients with or without hypertension ( n = 10 ) or between the patients with or without hypercholesterolemia ( n = 5 ) in the copd group . correlations between adipokines and other parameters in patients with copd are given in table 2 . both nucb2/nesfatin-1 and visfatin correlated with il-6 in the patients with copd but not in controls . therefore , two other proinflammatory cytokines , that is , tnf- and il-8 , were also measured in patients with copd . a negative correlation was seen between visfatin and pulmonary diffusing capacity ( hb - dl , co / va ) suggesting that visfatin is associated with parenchymal impairment . the adipokines did not correlate with bmi , radiological changes , levels of mmp-9 , exhaled nitric oxide , or symptoms score . four weeks of treatment with inhaled fluticasone caused no significant changes in plasma levels of nucb2/nesfatin-1 ( before : 75.0 ( 18.3119.4 ) pg / ml , after : 61.1 ( 17.5116.1 ) pg / ml , p = 0.399 ) or visfatin ( before : 7.9 1.5 ng / ml , after : 8.0 1.4 ng / ml , p = 0.804 ) . as expected , the treatment decreased st . george 's respiratory questionnaire total score describing the impact of the disease ( before : 36.4 15.6 , after : 30.8 16.0 , p = 0.015 ) and symptom score ( before : 55.2 22.1 , after : 38.0 23.2 , p < 0.001 ) . the baseline plasma levels of nucb2/nesfatin-1 or visfatin did not correlate with the degree of fluticasone induced changes in either symptoms or lung function in copd ( data not shown ) . the main findings in the present study were that nucb2/nesfatin-1 and visfatin correlated positively with systemic inflammation and , further , visfatin was associated with parenchymal impairment in patients with emphysematous copd . this suggests that nucb2/nesfatin-1 and visfatin may have a role in the inflammatory processes in copd . originally , adipose - tissue - derived adipokines were found to regulate energy metabolism and to be associated with the chronic low - grade inflammation present in obesity - related metabolic disturbances and inflammatory diseases [ 28 , 29 ] . later adipokines have also been linked to inflammatory lung diseases like asthma and copd and the majority of the studies have concentrated on the role of leptin and adiponectin in these diseases . it has been suggested that high circulating leptin and low adiponectin predict asthma independent of obesity and that low leptin and high adiponectin are associated with stable copd . the results on the association between adipokines and copd are , however , still conflicting and the studies are not covering all adipokines such as visfatin , which is known to be associated with other chronic inflammatory and destructive syndromes such as rheumatic diseases . we found that nucb2/nesfatin-1 and visfatin concentrations in plasma correlated with circulating levels of il-6 and tnf- and nucb2/nesfatin-1 also with il-8 suggesting that these adipokines may have a role in the systemic inflammation in copd . macrophages are also major sources of il-6 and tnf- and neutrophils of il-8 . as activated macrophages also secrete adipokines , the association between adipocytokines nesfatin-1 and visfatin and proinflammatory cytokines il-6 and tnf- in copd may be linked to the activation of macrophages . further , il-6 has been shown to induce the expression of both visfatin and nesfatin-1 , and additionally it has been reported that tnf- is able to provoke both nesfatin-1 and visfatin secretions . moreover , it has been presented that visfatin itself can induce the production of tnf- and especially il-6 . also , previous reports have shown that visfatin correlates positively with il-6 and with crp and tnf- without association with bmi in patients with copd , but the current study is the first report on nucb2/nesfatin-1 in copd . interestingly , we also found a negative correlation between visfatin and pulmonary diffusing capacity suggesting that visfatin is associated with parenchymal impairment in emphysematous copd . in copd , diffusing capacity may be decreased due to loss of alveolar surface and due to impaired diffusivity because of inflammation and oedema in the alveolar walls . as visfatin levels were not associated with the degree of emphysema visible on hrct , we suggest that visfatin is related to the inflammatory activity impairing pulmonary diffusing capacity . this is supported by the previous findings that inflamed endothelium as well as lung epithelial cells can produce visfatin [ 17 , 36 ] which may promote and amplify lung inflammation and parenchymal vascular damage present in emphysema . compared to controls , both higher and lower plasma visfatin levels have been reported in copd . in the current study , plasma visfatin levels were lower in the slightly overweight men with copd compared to healthy controls with similar bmi . consistent with our result , significantly lower visfatin levels in normal weight or slightly overweight men with copd have been reported , while underweight men with copd had increased visfatin levels . visfatin is expressed in visceral adipose tissue and higher , lower , and unchanged circulating visfatin levels have been reported in obese compared to normal weight persons . accordingly , we and others have not found any correlation between visfatin and bmi in patients with copd . the higher visfatin in underweight copd patients reported by liu and coworkers might be explained by the fact that copd patients with lower bmi have usually more severe systemic inflammation and that visfatin itself can inhibit neutrophil apoptosis and thus enhance lung inflammation in copd patients . liu et al . also hypothesized that hypoxemia present in severe copd may contribute to increased visfatin . neither visfatin nor nucb2/nesfatin-1 concentrations were changed during inhaled fluticasone treatment in the current study . this may be explained by the fact that a short term treatment with inhaled fluticasone likely has no significant systemic anti - inflammatory effect , and this is also supported by the present finding that neither il-6 nor mmp-9 levels changed during the treatment . as far as we know , there are no other studies on the effect of inhaled glucocorticoids on the levels of nucb2/nesfatin-1 and visfatin , but in previous studies systemic glucocorticoid treatment did not alter circulating visfatin levels in humans [ 43 , 44 ] . further , in the current study neither of these adipokines was associated with the treatment responses assessed by lung function or symptoms . however , in a previous study we found that high levels of adiponectin were associated with steroid - responsiveness in copd . the present results introduce adipocytokines nucb2/nesfatin-1 and visfatin as novel inflammatory factors in stable emphysematous copd . the findings suggest that nucb2/nesfatin-1 and visfatin have a proinflammatory role in the pathogenesis of emphysematous copd , but further studies are needed to evaluate if adipokines could be used as biomarkers for phenotyping or subgrouping patients with copd or as anti - inflammatory drug targets .

copd ( chronic obstructive pulmonary disease ) is a common lung disease characterized by airflow limitation and systemic inflammation . recently , adipose tissue mediated inflammation has gathered increasing interest in the pathogenesis of the disease . in this study , we investigated the role of novel adipocytokines nesfatin-1 and visfatin in copd by measuring if they are associated with the inflammatory activity , lung function , or symptoms . plasma levels of nucb2/nesfatin-1 and visfatin were measured together with il-6 , il-8 , tnf- , and mmp-9 , lung function , exhaled nitric oxide , and symptoms in 43 male patients with emphysematous copd . the measurements were repeated in a subgroup of the patients after four weeks ' treatment with inhaled fluticasone . both visfatin and nucb2/nesfatin-1 correlated positively with plasma levels of il-6 ( r = 0.341 , p = 0.027 and rho = 0.401 , p = 0.008 , resp . ) and tnf- ( r = 0.305 , p = 0.052 and rho = 0.329 , p = 0.033 , resp . ) and nucb2/nesfatin-1 also with il-8 ( rho = 0.321 , p = 0.036 ) in patients with copd . further , the plasma levels of visfatin correlated negatively with pulmonary diffusing capacity ( r = 0.369 , p = 0.016 ) . neither of the adipokines was affected by fluticasone treatment and they were not related to steroid - responsiveness . the present results introduce adipocytokines nucb2/nesfatin-1 and visfatin as novel factors associated with systemic inflammation in copd and suggest that visfatin may mediate impaired pulmonary diffusing capacity .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

the risk of cardiovascular disease and cardiovascular mortality is increased in patients with inflammatory rheumatic diseases compared to the general population or to persons without these diseases . although an increased risk is most well established for patients with systemic lupus erythematosus and rheumatoid arthritis , some evidence suggests an increased risk also exists for patients with ankylosing spondylitis , psoriasis , and psoriatic arthritis [ 1 - 5 ] . although the reasons for this increased risk are not completely understood , the association between markers of inflammation , in particular , high - sensitivity c - reactive protein ( hs - crp ) , and cardiovascular risk in patients without known inflammatory disease has led to speculation that systemic inflammation itself may be etiologic [ 6 - 9 ] . evidence that cardiovascular events are reduced in patients who respond to anti - inflammatory treatment supports this view . the jupiter study ( justification for the use of statins in prevention : an intervention trial evaluating rosuvastatin ) tested whether treatment with rosuvastatin altered the risk of incident cardiovascular events compared to placebo in persons with a normal level of low - density lipoprotein ( ldl ) cholesterol ( less than 130 mg / ml ) but an elevated level of hs - crp ( 2.0 mg / l or higher ) . persons with systemic inflammatory diseases , including severe arthritis and systemic lupus erythematosus , were excluded , as were those being treated with prednisone and other immunosuppressive medications . subjects ( n = 17,802 ) were randomized to receive either 20 mg rosuvastatin daily or placebo , for a planned duration of 5 years . the study 's primary endpoint was the occurrence of a first major cardiovascular event , including myocardial infarction , stroke , hospitalization for unstable angina or arterial revascularization , or death from a cardiovascular cause . the study was stopped prematurely when an interim analysis found that cardiovascular events were significantly less frequent in the group receiving rosuvastatin . the primary endpoint was 44% less likely in the rosuvastatin group than in the placebo group , although the rates of events were low in both groups . there was also a modest reduction in all - cause mortality in the rosuvastatin group . at 12 months , the median hs - crp level was 37% lower in the rosuvastatin group compared to placebo , from a baseline level of 2.2 mg / l , and median ldl cholesterol was 50% lower in the rosuvastatin group compared to placebo , from a baseline level of 186 mg / dl . these results indicate that treatment with rosuvastatin can decrease cardiovascular events among patients with an elevated hs - crp level who do not have cholesterol levels elevated to the threshold customarily used to begin treatment . one possible implication of these results is that primary prevention strategies should be broadened to treat with statins those whose only cardiac risk factor is an elevated hs - crp level . but is this an appropriate conclusion ? although subjects were selected based on both an elevated hs - crp level and a normal ldl cholesterol level , the trial did not include a group with low hs - crp levels and , therefore , did not isolate the benefit to patients with elevated hs - crp levels specifically . nor did it test hs - crp as a screening tool to target treatment , which would have required a parallel arm of subjects who had not been tested for hs - crp and were treated without regard to hs - crp level . in the strictest interpretation , the jupiter trial expands the potential mechanisms by which statins reduce cardiovascular events to include reductions in hs - crp levels . whether this effect is completely independent of the hypocholersterolemic effect is uncertain . given the elevated cardiovascular risk experienced by patients with inflammatory rheumatic diseases , and the association of elevated crp levels with cardiovascular disease , how should the results of the jupiter trial be applied to patients with inflammatory rheumatic diseases ? if hs - crp levels in persons without inflammatory diseases reflect inflammation in atherosclerotic endothelial lesions , while hs - crp ( or crp ) levels in patients with inflammatory diseases primarily reflect inflammation outside the atherosclerotic endothelial lesions , elevated hs - crp levels would not be specific to the etiologic target in patients with inflammatory diseases . in this case , targeting treatment based on hs - crp would not be helpful , and treatment might not be expected to have the same effects . statins have multiple immunomodulatory actions , which may have a role in their cardioprotective effects . differences in activation or regulation of these immune and inflammatory pathways between patients with chronic inflammatory rheumatic diseases and people without these diseases complicate using the findings in non - rheumatic cohorts to predict effects in rheumatic disease cohorts . also to be considered is whether any benefit of statins for primary prevention would be attenuated or negated by anti - rheumatic treatments , particularly chronic corticosteroids . lastly , the long - term safety of statins and unknown risks of prolonged marked hypocholesterolemia would need to be balanced against the potential benefits . given the difficulty applying the results of the jupiter trial to patients with inflammatory diseases , it would be premature to recommend statins for primary prevention of cardiovascular events in patients with inflammatory rheumatic diseases . rather , cardiac risk factor assessment and modification should be enforced , while awaiting the results of ongoing or recently completed studies specifically investigating statins for primary cardiovascular disease prevention in systemic lupus erythematosus and rheumatoid arthritis [ 13 - 15 ] .

patients with inflammatory rheumatic diseases have an increased risk of cardiovascular disease , raising questions of whether primary prevention strategies that are more aggressive than cardiac risk factor modification alone should be implemented . recent trials demonstrating the efficacy of statins in reducing rates of cardiovascular events in healthy persons with elevated levels of c - reactive protein broaden the potential protective mechanisms of statins , but do not directly translate to primary cardiovascular disease prevention in patients with inflammatory rheumatic diseases .

Introduction and context Recent advances Implications for clinical practice Competing interests

actinomycosis is an infrequent invasive chronic inflammatory disease caused mainly by actinomyces israelii , gram - positive , filamentous , anaerobic bacteria . actinomycosis occurring primarily in urachal remnants is rare and may mislead the clinicians to diagnose urachal carcinoma . we report one such case of urachal actinomycosis in a 50-year - old male with lower abdominal pain and mass palpable mimicking a urachal tumor . a 50-year - old man , hailing from south india , came to the urology outpatient department with complaints of lower abdominal pain , dysuria , and dribbling of urine for 2 months duration . clinically , he was afebrile and per - abdomen examination revealed a vague mass of 7 cm palpable at the suprapubic region . computed tomography scan of the abdomen revealed an irregular mass seen superior to fundus of urinary bladder appearing adherent to mesentery and bowel loops and suggested an urachal remnant associated lesion with infiltration figure 1 . excision of the mass with partial cystectomy and resection of involved ileal segments was done figure 2 . the specimen was sent for histopathological examination . computed tomography of the abdomen showing an irregular mass seen superior to fundus of urinary bladder appearing adherent to mesentery and bowel loops grossly , we received an irregular soft tissue mass measuring 12 cm 15 cm 4 cm with umbilicus on the one side and dome of the bladder on the other side . we also received two loops of intestine with attached serosal mass measuring 4 cm 3 cm 2 cm . after adequate sampling , sections from the urachal remnant revealed actinomycotic colonies surrounded by microabscesses and dense inflammatory fibrotic lesion figure 3 . small intestinal segments showed a similar lesion in the serosa but not in the mucosa , confirming it to be a primary urachal actinomycosis . photomicrograph showing high power view of h and e section of actinomycotic colonies surrounded by microabscesses the patient was started on intravenous penicillin and recovered without complications . the most common risk factor includes use of intrauterine contraceptive devices in female , and others include history of bowel surgery such as perforated acute appendicitis , perforated colonic diverticulitis , penetrating trauma to the abdomen , and persistent urachal remnant . our patient showed two of the risk factors of persistent urachal remnant and an earlier appendicectomy . the infiltrative nature of the bacteria into the surrounding organs can be explained by production of proteolytic enzyme . there are no specific radiological signs to distinguish actinomycotic lesions from malignancy due to its infiltrative nature . definite diagnosis before surgery is difficult unless patient had discharging sinuses in the lower abdomen . demonstration of the colonies of actinomycosis by histopathological examination is the definitive diagnosis , and hence , adequate sampling and extensive scanning must be done . in a study of 33 patients with pelvic actinomycosis by marella et al . , 19 patients had intrauterine contraceptive devices and only four of them had urachal remnants . exploratory laparotomy was done in most of them , and definite diagnosis was made by histopathological examination after excision of the mass . it has a good prognosis and is curable with antibiotics such as penicillin and amoxicillin . it is important to consider it in the differential diagnosis of patients presenting with lower abdominal pain and hard suprapubic mass with or without discharging sinuses . to the best of our knowledge ,

primary actinomycosis occurring in urachal remnants is rarely documented in literature and may mislead the clinicians to diagnose urachal carcinoma . a 50-year - old man came with complaints of lower abdominal pain , dysuria , and dribbling of urine for 2 months . a vague mass of 7 cm was palpable in the suprapubic region . imaging of the abdomen revealed an irregular mass seen superior to fundus of the urinary bladder appearing adherent to mesentery and bowel loops , suggesting an urachal remnant associated lesion with infiltration . provisional diagnosis of urachal carcinoma was considered . excision of the mass with partial cystectomy and resection of involved ileal segments were done . microscopic examination revealed actinomycotic colonies surrounded by microabscesses and dense inflammatory fibrotic lesion . small intestinal segments showed a similar lesion in the serosa .

I C D C Financial support and sponsorship Conflicts of interest

dysembryoplastic neuroepithelial tumor ( dnt ) , first described by daumas - duport et al . , is , under the current world health organization ( who ) classification , a low - grade glioneuronal tumor causing intractable complex partial seizures . complete resolution of seizures in a large percentage of both adult and pediatric patients is achieved with surgery [ 38 ] . though the primary objective of surgery is complete seizure control without anticonvulsant therapy , the prevention of recurrent disease and the diagnosis of malignant transformation are also goals of surgical resection . the widespread surgical treatment of epilepsy due to dnt has , however , been criticized because surgery carries a nonnegligible risk of surgical sequelae including neurological , cognitive , and neuropsychological impairment . guidelines regarding the preoperative evaluation and intraoperative determination of the extent of resection have not been standardized . magnetic resonance imaging ( mri ) , c - methionine positron emission tomography ( met - pet ) , and f - fluorodeoxyglucose ( fdg)-pet are routinely used at our institution preoperatively to assess the morphology and metabolism of brain tumors with epileptogenicity in addition to interictal electroencephalography ( eeg ) . additionally , electrocorticography ( ecog ) is also used intraoperatively to detect the epileptogenic zone ( ez ) . we report three cases of dnt with intractable epilepsy , successfully treated with surgery , in which not only imaging functional studies but also advanced neurosurgical technologies were critical for planning and supported the role for surgery . these interventions included preoperative magnetoencephalography ( meg ) ( case 1 ) , fiber tractography obtained from diffusion tensor imaging ( dti ) , a neuronavigation system , and intraoperative somatosensory evoked potential ( sep ) ( case 2 ) and fiber tractography and the neuronavigation - guided fence - post tube technique ( case 3 ) ( table 1 ) . the medical equipment used in these cases were mri ( signa , ge healthcare , milwaukee , wisconsin , usa and achieva 3.0 t , philips , the netherlands ) , pet ( ge , yokokawa medical system , hino , tokyo , japan and eminence stargate , shimadzu , kyoto , japan ) , neuronavigation system ( vectorvision , brainlab , munchen , germany ) , sep / eeg / ecog ( neuropack x1 , nihonkohden , tokyo , japan ) , and meg ( elekta neuromag , helsinki , finland ) . magnetoencephalography in case 1 was performed at komaki city hospital . the patient , a 43-year - old woman , presented with a 20-year history of complex partial seizures occasionally followed by generalized tonic clonic convulsive seizures . despite treatment for over two years with multiple anticonvulsants her mri showed a relatively well - demarcated , small , mass lesion ( 1.8 1.8 1.8 cm ) in the left medial temporal lobe , which presented with hypointensity on a t1-weighted image ( t1wi ) , hyperintensity on t2wi , hypointensity with a surrounding high intensity ring in fluid attenuated inversion recovery ( flair ) , no gadolinium ( gd ) enhancement , low uptake in met - pet , and hypo - uptake in fdg - pet ( figs . preoperative interictal meg , however , showed clustered dipoles in the region lateral to the tumor ( figs . intraoperative ecog monitoring was used to verify complete resection of the ez , which was defined as the peritumoral region with interictal spikes on the intraoperative ecog ( figs epileptiform discharges , which emerged on ecog before resection of the lesion , disappeared after lesion resection ( figs . 2c and d ) . the patient was continued on anticonvulsants for 12 months postoperatively . following cessation of the anticonvulsants , she remained seizure - free as of nine years following surgery . postoperative interictal eegs have not shown any significant epileptogenic activity ( engel class i ) . the patient , a five - year - old girl , presented a four - month history of complex partial seizures occurring a few times a day . her mri showed a relatively well - demarcated mass lesion ( 3.0 3.0 4.0 cm ) in the left frontal lobe extending to the left lateral ventricle wall , which presented with hypointensity on t1wi , hyperintensity on t2wi , hypointensity with a surrounding high intensity irregular ring on flair , no gd enhancement , low uptake in met - pet , and hypo - uptake in fdg - pet ( figs . fiber tractography showed that the left pyramidal tract lay just posteromediocaudal to the tumor ( figs . 3d and e ) and that the left arcuate fasciculus lay just caudolateral to the tumor ( figs . 3f and g ) . in the surgery , at first , the left central sulcus was identified using intraoperative sep ( fig . a total tumor resection with careful resection of the ez , which was defined as the peritumoral regions with interictal spikes on the intraoperative ecog , was performed using a neuronavigation system under monitoring of the intraoperative ecog ( figs . 3h , 5a and b ) . epileptiform discharges , which emerged on ecog before the lesion was resected , completely disappeared after lesion resection ( figs . she remains seizure - free and off anticonvulsants as of her most recent follow - up three years after surgery . her postoperative interictal eeg has not shown any significant epileptogenic activity ( engel class i ) . the patient , a 10-year - old girl , presented with a history of surgery for dnt in the left posterior temporal lobe . she had developed complex partial seizures refractory to anticonvulsants and had seizures a few times a month before the surgery . she underwent a partial resection of the tumor in a community hospital at the age of eight years , and the tumor was diagnosed as a dnt histologically ( fig . after surgery , she was seizure - free for 12 months on anticonvulsant medication ; however , seizures recurred a few times per day . she was referred to our hospital , and her mri showed a relatively well - demarcated mass lesion ( 6.5 5.0 4.0 cm ) in the left posterior temporal lobe with a cavity corresponding to the prior area of resection in the posterior portion of the tumor . the tumor presented with hypointensity on t1wi , hyperintensity on t2wi , hypointensity with a surrounding irregular high intensity area in the white matter on flair , and no gd enhancement ( fig . the mri revealed tumor progression , and the tumor intensities were the same as on the prior preoperative imaging ( figs . the tumor showed low uptake in met - pet and hypo - uptake in fdg - pet ( figs . fiber tractography showed that the residual left visual tract lay just mediorostral to the tumor ( figs . 6e and f ) . we performed a complete total tumor resection with careful resection of the ez , which was defined as the peritumoral region with interictal spikes on the intraoperative ecog , using a neuronavigation - guided fence - post tube technique with monitoring of intraoperative ecog ( figs . epileptiform discharges which emerged on the ecog completely disappeared after lesion resection ( fig . postoperative interictal eeg did not show any significant epileptogenic activity ( engel class i ) . the patient , a 43-year - old woman , presented with a 20-year history of complex partial seizures occasionally followed by generalized tonic clonic convulsive seizures . despite treatment for over two years with multiple anticonvulsants her mri showed a relatively well - demarcated , small , mass lesion ( 1.8 1.8 1.8 cm ) in the left medial temporal lobe , which presented with hypointensity on a t1-weighted image ( t1wi ) , hyperintensity on t2wi , hypointensity with a surrounding high intensity ring in fluid attenuated inversion recovery ( flair ) , no gadolinium ( gd ) enhancement , low uptake in met - pet , and hypo - uptake in fdg - pet ( figs . preoperative interictal meg , however , showed clustered dipoles in the region lateral to the tumor ( figs . intraoperative ecog monitoring was used to verify complete resection of the ez , which was defined as the peritumoral region with interictal spikes on the intraoperative ecog ( figs epileptiform discharges , which emerged on ecog before resection of the lesion , disappeared after lesion resection ( figs . 2c and d ) . the patient was continued on anticonvulsants for 12 months postoperatively . following cessation of the anticonvulsants , she remained seizure - free as of nine years following surgery . postoperative interictal eegs have not shown any significant epileptogenic activity ( engel class i ) . the patient , a five - year - old girl , presented a four - month history of complex partial seizures occurring a few times a day . her mri showed a relatively well - demarcated mass lesion ( 3.0 3.0 4.0 cm ) in the left frontal lobe extending to the left lateral ventricle wall , which presented with hypointensity on t1wi , hyperintensity on t2wi , hypointensity with a surrounding high intensity irregular ring on flair , no gd enhancement , low uptake in met - pet , and hypo - uptake in fdg - pet ( figs . fiber tractography showed that the left pyramidal tract lay just posteromediocaudal to the tumor ( figs . 3d and e ) and that the left arcuate fasciculus lay just caudolateral to the tumor ( figs . 3f and g ) . in the surgery , at first , the left central sulcus was identified using intraoperative sep ( fig . a total tumor resection with careful resection of the ez , which was defined as the peritumoral regions with interictal spikes on the intraoperative ecog , was performed using a neuronavigation system under monitoring of the intraoperative ecog ( figs . 3h , 5a and b ) . epileptiform discharges , which emerged on ecog before the lesion was resected , completely disappeared after lesion resection ( figs . she remains seizure - free and off anticonvulsants as of her most recent follow - up three years after surgery . her postoperative interictal eeg has not shown any significant epileptogenic activity ( engel class i ) . the patient , a 10-year - old girl , presented with a history of surgery for dnt in the left posterior temporal lobe . she had developed complex partial seizures refractory to anticonvulsants and had seizures a few times a month before the surgery . she underwent a partial resection of the tumor in a community hospital at the age of eight years , and the tumor was diagnosed as a dnt histologically ( fig . after surgery , she was seizure - free for 12 months on anticonvulsant medication ; however , seizures recurred a few times per day . she was referred to our hospital , and her mri showed a relatively well - demarcated mass lesion ( 6.5 5.0 4.0 cm ) in the left posterior temporal lobe with a cavity corresponding to the prior area of resection in the posterior portion of the tumor . the tumor presented with hypointensity on t1wi , hyperintensity on t2wi , hypointensity with a surrounding irregular high intensity area in the white matter on flair , and no gd enhancement ( fig . the mri revealed tumor progression , and the tumor intensities were the same as on the prior preoperative imaging ( figs . the tumor showed low uptake in met - pet and hypo - uptake in fdg - pet ( figs . fiber tractography showed that the residual left visual tract lay just mediorostral to the tumor ( figs . 6e and f ) . we performed a complete total tumor resection with careful resection of the ez , which was defined as the peritumoral region with interictal spikes on the intraoperative ecog , using a neuronavigation - guided fence - post tube technique with monitoring of intraoperative ecog ( figs . epileptiform discharges which emerged on the ecog completely disappeared after lesion resection ( fig . postoperative interictal eeg did not show any significant epileptogenic activity ( engel class i ) . the goals of surgery for dnt include not only complete tumor resection but also complete seizure control by resecting the ez , while avoiding surgical sequela . imaging and functional studies in addition to preoperative interictal eeg and mri , preoperative fdg - pet , met - pet , and intraoperative ecog have been used routinely for surgical planning for resection of brain lesions with epileptogenicity such as dnt in our hospital . characteristics of dnt , such as a well - demarcated margin , benign clinical course , indolent biology , and the frequent association of a peritumoral ez , are conducive to surgical management . the preoperative diagnosis of a dnt facilitates the assemblage of intraoperative monitoring equipment necessary for precisely excising the ez . epileptogenic brain tumors which should be differentiated from dnt include diffuse astrocytoma , oligodendroglioma , pleomorphic xanthoastrocytoma , pilocytic astrocytoma , gangliocytoma , and ganglioglioma . some may be easily differentiated from dnt using a conventional ct and/or mri ; however , others can not precisely be differentiated because of their similar radiological features . c - methionine positron emission tomography has improved the radiological diagnosis of brain tumors . among these brain tumors , a finding of low uptake in met - pet is strongly suggestive of a dnt , and the diagnosis becomes more reliable if associated with corresponding morphology on ct and/or mri . the hypo - uptake in fdg - pet is another characteristic of dnt , which suggests not only the hypometabolism of the tumor but also a lack of functional activity as the normal brain within the lesion . it is this lack of functional activity which permits the complete excision of the tumor without a subsequent postoperative neurological deficit . intraoperative ecog is an essential tool for dnt surgery and is utilized in most surgical procedures for epilepsy [ 3,4,1417 ] . localization of the ez associated with a dnt is still controversial , and results are variable . recently , chassoux et al . have proposed that three distinct histologic subtypes of dnt are distinguishable based on mri features . using mri , dnts are classified as type 1 which is cystic / polycystic - like , well - delineated , and strongly hypointense in t1wi ; type 2 which is nodular - like and heterogeneous ; and type 3 which is dysplastic - like , iso / hypointense in t1wi , with poor delineation and gray resection of type 1 tumors , in which the tumor and the ez are colocalized , will generally definitively treat the epilepsy . types 2 and 3 , however , require a more extensive resection that includes both the tumor and the perilesional cortex . for example , for type 3 tumors in the temporal lobe , an anterior temporal lobectomy must be considered . case 2 is a type 1 example and cases 1 and 3 are type 3 examples . such a detailed imaging study is informative for preoperative surgical planning for seizure control ; however , this is not always helpful to address in delineating the ez precisely in individual cases . to achieve the objective of seizure control , intraoperative ecog monitoring is still needed to determine the extent of resection of the lesion including the ez , although the spike - chasing using ecog is partly debatable and controversial . for some dnt , preoperative ct , mri , interictal eeg , pet studies , and intraoperative ecog are usually sufficient to achieve seizure control with surgery ; however , for others , these are not sufficient . in case 1 dysembryoplastic neuroepithelial tumor in the temporal lobe , like other epileptic lesions in deep brain structures , often presents with no significant epileptogenic activity in preoperative eeg . in these cases , preoperative chronic subdural electrode recording ( csder ) is strongly recommended to confirm whether the tumor truly has epileptogenicity and to evaluate the extent of the epileptogenic lesion . magnetoencephalography is a sophisticated medical device which can detect subtle brain activity and the epileptogenicity of lesions . its clinical role for detecting epileptogenicity preoperatively may replace that of csder in those cases with visible lesions on neuroimaging because meg , unlike csder , is noninvasive [ 2023 ] . in case 1 , meg was used instead of csder . the dnt in case 2 was adjacent to the motor cortex and the language pathway . complex partial seizures observed in this case were likely attributable to tumor extension to the left cingulate gyrus . in this case , treatment planning focused on avoiding damage to the motor cortex and the language pathway while aiming for total resection of the tumor with the ez . in such a case , the combination of fiber tractography , neuronavigation system , and sep is a valuable adjunct to ecog and imaging studies [ 2429 ] . preoperative fiber tractography that revealed the topographical relationship between the left pyramidal tract and the tumor and also between the left arcuate fasciculus and the tumor was informative for safe tumor resection . the neuronavigation system and intraoperative sep aided in the identification of the left central sulcus during the surgery . case 3 had a recurrent large dnt adjacent to the left visual tract , in which epileptogenicity was detectable near the tumor by preoperative eeg . another clinicopathological concern in this case was the possibility of malignant transformation of the tumor in terms of its rapid regrowth . dysembryoplastic neuroepithelial tumor is considered benign and tends to not recur even after a partial resection . there are , however , some reported cases of malignant transformation and tumor regrowth [ 3033 ] . to achieve clinical benefit in this patient , the goal of surgery was complete excision of the tumor including malignant parts and ez without worsening the neurological deficit . total tumor resection would prevent further regrowth and enable the complete histopathological evaluation of the tumor in addition to seizure control . tumor resection was successfully performed using the neuronavigation - guided fence - post tube technique in this case . the neuronavigation - guided fence - post technique is superior to ordinary image - guided neuronavigation for larger tumors because intraoperative structural distortion of the brain due to brain shift is more likely during resection of larger tumors . preoperative fiber tractogram , revealing the topographical relationship between the left visual tract and the tumor , was informative for placing fence - posts to define the excision margins . no histological evidence of malignant foci was found in the resected lesion including the tumor . recently , another case of progressive dnt on mri in a pediatric patient , in which the tumor showed no histological evidence of malignancy , was reported by preuss et al . . in such cases , tumor growth is attributed to an increase in the mucinous substance in the myxoid matrix . a further careful follow - up is needed for checking tumor and seizure recurrences in case 3 because of the short period of follow - up after the second surgery . although dnt frequently results in epilepsy that is unresponsive to medical therapy , dnt - associated epilepsy is highly curable with surgery . dysembryoplastic neuroepithelial tumor may arise in any supratentorial or intracortical location within or near critical areas of the brain . resection , therefore , must be carefully planned both pre- and intraoperatively and requires meticulous technique . goals of therapy include not only completely resecting the tumor to avoid recurrence or progression but also excising the entire associated ez . we have shown that when imaging and functional studies are utilized concurrently with advanced neurosurgical technologies for operative planning , excellent surgical outcomes result .

purposewe report three cases of dysembryoplastic neuroepithelial tumor ( dnt ) with intractable epilepsy which were successfully treated with surgery.methodsin all cases , technology beyond the routine workup was critical to success . preoperative magnetic resonance imaging , 18f - fluorodeoxyglucose positron emission tomography ( pet ) , 11c - methionine - pet , interictal electroencephalography , and intraoperative electrocorticography were utilized in all patients . in individual cases , however , additional procedures such as preoperative magnetoencephalography ( case 1 ) , diffusion tensor fiber tractography , a neuronavigation system , and intraoperative somatosensory - evoked potential ( case 2 ) , and fiber tractography and the neuronavigation - guided fence - post tube technique ( case 3 ) were instrumental.resultsin all the cases , the objectives of total tumor resection , resection of the epileptogenic zone , and complete postoperative seizure control and the avoidance of surgical complications were achieved.conclusionsdysembryoplastic neuroepithelial tumor is commonly associated with medically intractable epilepsy , and surgery is frequently utilized . as dnt may arise in any supratentorial and intracortical locations within or near the critical area of the brain , meticulous surgical strategies are necessary to avoid neurological deficits . we demonstrate in the following three cases how adjunct procedures using advanced multitechnologies with neuroimaging and electrophysiological examinations may be utilized to ensure success in dnt surgery .

Introduction Case report Case1 Case2 Case3 Discussion Conclusions Conflict of interest

pauci - immune crescentic glomerulonephritis ( gn ) is one of the most common causes of rapidly progressive gn ( rpgn ) . most patients with pauci - immune crescentic gn have glomerular disease as part of an antineutrophil cytoplasmic antibody ( anca)associated systemic vasculitis , such as granulomatosis with polyangiitis , microscopic polyangiitis ( mpa ) , and eosinophilic granulomatosis with polyangiitis , or as a part of renal - limited vasculitis . because ~7590% of patients with pauci - immune crescentic gn have circulating anca , anca is known as a major serologic marker to distinguish pauci - immune crescentic gn from other types of rpgn . although there is little information about anca - negative pauci - immune crescentic gn owing to a relatively small number of patients , several studies have reported fewer systemic vasculitis manifestations in anca - negative crescentic gn than anca - positive cases . hemorrhagic complications in pauci - immune crescentic gn are common , but massive gastrointestinal bleeding or cerebral hemorrhage in anca - negative pauci - immune crescentic gn has rarely been reported . herein , we report a rare case of recurrent massive intestinal bleeding that was caused by an uncontrolled vasculitis combined with anca - negative pauci - immune crescentic gn . a 61-year - old korean woman was admitted to our hospital with a 1-month history of generalized edema and foamy urine . on admission , she looked ill , and physical examination showed blood pressure 140/90 mmhg ; pulse rate 134 beats / min ; and temperature 37c . pitting edema greater than grade iii of the lower limbs was noted . g / l ; platelets 277,000/mm ; blood urea nitrogen 54.5 mg / dl ; serum creatinine 3.5 mg / dl ; total protein 5.9 g / dl ; albumin 3.0 g / dl ; total calcium 8.4 g / dl ; phosphorus 5.0 mg / dl ; prothrombin time ( international normalized ratio ) 1.08 ; and activated partial thromboplastin time 34 seconds . urinalysis revealed many red blood cells ( rbcs ) per high - power field , and protein ( 4 + ) and occult blood ( 2 + ) were also detected . the spot urine protein - to - creatinine ratio was 3.5 g / g . her renal function deteriorated rapidly over 7 days ( serum creatinine concentration increased from 3.5 mg / dl to 7.0 mg / dl ) and exhibited features of rpgn . therefore , we performed a renal biopsy and other serologic tests . the serum immunoglobulin levels , including immunoglobulin ( ig)g , igm , and iga , and complements , including c3 and c4 , were within normal ranges . the renal biopsy specimen showed cellular or fibrocellular crescentic formation in 92% ( 57/62 ) of glomeruli ( fig . 1 ) . the tubules revealed focal moderate atrophy and loss with infiltration of mononuclear cells in edematous interstitium . immunohistochemistry , using three glomeruli , demonstrated no staining for igg , iga , igm , complements ( c3 , c1q ) , or fibrinogen . electron microscopy also showed no dense deposits , with severe effacement of epithelial foot processes . based on these pathologic findings , she was diagnosed with anca - negative pauci - immune crescentic gn . the patient was treated with one cycle of steroid pulse therapy ( 500 mg of methylprednisolone daily , for 3 consecutive days ) with monthly intravenous cyclophosphamide ( 400 mg ) , followed by prednisolone ( 50 mg / d ) . on the 15 hospital day , massive hematochezia occurred , and hemoglobin levels decreased from 9.2 mg / dl to 6.4 g / dl within 24 hours ( fig . although emergency gastroscopy and colonoscopy were performed , the bleeding focus was not detected , but a large amount of old blood was observed in the terminal ileum . after 2 days , a colonoscopy was performed again , but abnormal findings associated with bleeding were not detected . then , a capsule endoscopy was attempted to determine if the bleeding focus was located in the small bowel . however , owing to a slow small bowel transit time , the entire small bowel could not be observed because the capsule did not reach the mid - to - distal ileum . abdominal computed tomography angiography showed active arterial bleeding on the ileal loop , and selective superior mesenteric arteriography revealed an active contrast extravasation in a branch of the distal ileal artery ( fig . 3 ) . we selectively performed embolization with a permanent embolic agent ( n - butyl cyanoacrylate ; 0.5 ml tissue adhesive , 1.5 ml ethionidized oil mixture ) , and the bleeding stopped . despite successful embolization , her hemoglobin level was 6.5 g / dl , and platelet count was 40,000/mm . emergency colonoscopy showed multiple segmental ulcerations on the terminal ileum , which was consistent with ischemic damage due to embolization of the distal ileal artery ( fig . 4 ) . the patient underwent hemodialysis because of intractable metabolic acidosis , hyperkalemia , and fluid overload . anemia associated with schistocytes and transfusion - refractory consumptive thrombocytopenia was also present , consistent with microangiopathic hemolytic anemia ( maha ) . levels of hemostatic markers showed prothrombin time ( international normalized ratio ) 1.00 ; activated partial thromboplastin time 33 seconds ; fibrinogen 399 mg / dl ; and fibrin degradation product < 5.0 g / ml . we ruled out disseminated intravascular coagulation using the international society on thrombosis and hemostasis disseminated intravascular coagulation scoring system . on the 45 hospital day , she suddenly lost consciousness . the patients neurologic status had worsened to a stupor and then , unfortunately , she passed away . the final diagnosis was anca - negative pauci - immune gn with a rare presentation of massive gastrointestinal bleeding and intracerebral hemorrhage . pauci - immune crescentic gn is part of systemic small - vessel vasculitis and usually associated with the presence of ancas directed against myeloperoxidase or proteinase 3 . although the pathogenesis of anca in vasculitis is not fully understood , anca is known to activate neutrophils by different mechanisms , such as direct fab02 binding to anca antigens on leukocyte surfaces or fc receptor engagement by anca immune complexes , leading to apoptosis and necrosis of neutrophil and endothelial cells . however , in anca - negative small - vessel vasculitis , neutrophil infiltration of the pathologic lesion is reportedly related with other unidentified autoantibodies or t - cell dependent mechanisms . despite limited information about anca - negative pauci - immune crescentic gn , anca - negative patients reportedly show severe renal manifestations , such as nephrotic - range proteinuria , poorer renal outcomes , and less extrarenal involvement such as fever , arthralgia , skin rash , abdominal pain , or mononeuritis multiplex , compared with anca - positive patients [ 57 ] . similarly , our case also showed nephrotic - range proteinuria of 3.5 g / d and diffuse cellular crescentic formations in > 90% of glomeruli on renal biopsy . initially , extrarenal manifestations were not observed . our patient had no evidence of asthma , eosinophilia , or granuloma of the upper respiratory tract . based on the 2012 international chapel hill consensus criteria , we were able to diagnose mpa and exclude granulomatosis with polyangiitis and eosinophilic granulomatosis with polyangiitis from the possible systemic small - vessel vasculitis conditions . small - vessel vasculitis can cause local or diffuse pathologic changes in the gastrointestinal tract , including ulcers , bowel wall edema , hemorrhage , paralytic ileus , ischemia , obstruction , and perforation [ 912 ] . although necrotizing gn and pulmonary capillaritis are very common in mpa , several cases with gastrointestinal bleeding have been reported . interestingly , a japanese case diagnosed with mpa and pauci - immune crescentic gn showed active bleeding of the superior pancreaticoduodenal artery and iliac branch of the superior mesenteric artery . the characteristics of this case were very similar to those of the present case : old age , absence of circulating anca , massive active bleeding , and absence of small artery involvement on kidney biopsy . thrombotic microangiopathy is characterized by platelet aggregation in systemic circulation , thrombocytopenia , and mechanical hemolysis . although coexistence of thrombotic microangiopathy and pauci - immune crescentic gn is rare , pauci - immune crescentic gn could trigger thrombotic microangiopathy through endothelial damage by proinflammatory mediators . secondary ischemic multiple ulcerations after embolization , thrombocytopenia caused by consumption of platelets due to recurrent bleeding , and maha contribute to poor outcomes . initiation of conventional treatment for pauci - immune crescentic gn with or without anca consists of intravenous methylprednisolone pulse therapy followed by progressive reduction of oral prednisolone ( initially 1 mg / kg/24 h ) and cyclophosphamide , either intravenously at a dose of 0.51 g / m or orally at a dose of 23 mg / kg/24 h . our patient received conventional treatment according to this schedule , but massive hematochezia occurred 15 days later . in life- or organ - threatening conditions , such as lung hemorrhage or severe anca - related renal vasculitis , plasma exchange may be recommended . in cases with gastrointestinal bleeding , therefore , our patient only received embolization without plasmapheresis or other immunosuppressants , based on previous reports . although there was a high possibility of the hemorrhagic complications of systemic vasculitis , brain magnetic resonance angiography was not performed . various factors that could increase bleeding tendency , such as a uremic condition , low platelet count , or frequent transfusions , may contribute to intracerebral bleeding . in summary , to the best of our knowledge , there are only a few reports regarding anca - negative pauci - immune crescentic gn with massive gastrointestinal bleeding . therefore , the present case is interesting and informative , reporting recurrent massive intestinal bleeding and fatal intracerebral bleeding as a serious hemorrhagic complication of anca - negative pauci - immune gn .

a 61-year - old woman was admitted to hospital because of generalized edema and proteinuria . her renal function deteriorated rapidly . serum immunoglobulin and complement levels were within normal ranges . an autoantibody examination showed negative for antinuclear antibody and antineutrophil cytoplasmic antibody . histologic examination of a renal biopsy specimen revealed that all of the glomeruli had severe crescent formations with no immune deposits . the patient was treated with steroid pulse therapy with cyclophosphamide followed by oral prednisolone . fifteen days later , she experienced massive recurrent hematochezia . angiography revealed an active contrast extravasation in a branch of the distal ileal artery . we selectively embolized with a permanent embolic agent . on the 45th hospital day , the patient suddenly lost consciousness . brain computed tomography showed intracerebral hemorrhage . we report a case of antineutrophil cytoplasmic antibody negative pauci - immune glomerulonephritis with massive intestinal bleeding and cerebral hemorrhage .

Introduction Case report Discussion Conflicts of interest

traumatic brain injury ( tbi ) is an insult to the brain that is caused by an external force . . associations between tbi and a variety of neuropsychiatric disorders have been described since the days of yore being referred to as traumatic insanities tbi is associated with a gamut of psychiatric disorders that may be divided into disorders that are also seen in patients without brain injury such as substance abuse , mood , anxiety , psychotic , personality disorders , and those that are unique to patients with brain damage , for example , involuntary emotional expression disorder , anosognosia , aprosody , and neglect . there are very few studies that have examined the interesting area of eating disorders after tbi . eating disorders are a persistent disturbance of eating behavior or behavior intended to control weight , which significantly impairs physical health or psychosocial functioning . they comprise a spectrum of conditions , of which bulimia nervosa and anorexia nervosa are the major categories . the etiology and pathogenesis of eating disorders per se are still highly debatable . in most patients of eating disorders nonetheless , associations of anorexia and bulimia nervosa with a history of perinatal complications and head injuries suggest a role of cerebral pathology in some cases . a number of case studies describe eating disorders with intracranial tumors , injuries , or epileptogenic foci . the changes in dietary habits following tbi have generally been documented with respect to appetite , and sensory disturbances of taste and/or smell . in a review of 54 published clinical cases of eating disorders in focal brain injuries , it was found that although simple changes in appetite and eating behavior occur with hypothalamic , and brain stem lesions , more complex syndromes , including characteristic psychopathology of eating disorders , are associated with right frontal and temporal lobe damage . in a sample of 120 patients with severe tbi , ciurli et al ( 2011 ) found wide range of neuropsychiatric symptoms : apathy ( 42% ) , irritability ( 37% ) , dysphoria / depressed mood ( 29% ) , disinhibition ( 28% ) , eating disturbances ( 27% ) , and agitation ( 24% ) . however morbid hunger or persistent hyperphagia ( as seen in our patient ) after tbi are rare but potentially life threatening conditions . diagnostic review of 88 admitted patients of tbi identified 2 ( 3% ) patients presenting with this condition . in the following case report he presented to us with changes in eating pattern that were characterized by an incessant urge to eat that was difficult to control on the sight of food . it also highlights the importance of cortical structures in the genesis of abnormal eating behaviors and challenges the conventional notion that only hypothalamus is responsible for regulating eating behaviors . s , 42-year - old , hindu , married , male , premorbidly well - adjusted presented with alcohol use in dependent pattern for 20 years . the patient also suffered from left hemiplegia following the craniotomy , which recovered partially with physiotherapy over a period of 1 year . post head injury , the patient started having low frustration tolerance , aggressive outbursts , disinhibition , difficulty in persisting with tasks , apathy , and amotivation . patient restarted with alcohol use in dependent pattern and also started reporting craving for food which was not present before . the patient would not be able to control his craving especially on the sight of food . on occasions corroboratory information was collected from his family members who had been cohabiting with the patient . they stated that he would eat his regular three meals a day , interspersed with a lot of snacking in between meal times which mostly included oily food , chips , biscuits , sodas , and the likes . gradually , since the last 10 years , his eating pattern has consistently been deranged . patient subjectively reported that even though he does not feel hungry , he could not control his urge to eat . at times , he even exhorted money from strangers giving various excuses , to obtain food . there was no history of eating inedible substances , polyuria , or polydipsia . in the last 1 year lobar function tests of the patient showed a deficit in frontal lobe and he was unable to do the clock draw test . all laboratory investigations were within normal limits except high - density lipoprotein 34 mg / dl ( normal value [ n ] 40 mg / dl ) , triglycerides 230 mg / dl ( n < 150 mg / dl ) , fasting plasma glucose 119 mg / dl ( n < 100 mg / dl ) , 2 h plasma glucose 201 mg / dl ( n < 140 mg / dl ) , and hba1c-6.9% ( n < 5.6% ) . magnetic resonance imaging scan revealed large areas of damage involving both frontal lobes in the form of gliosis and encephalomalacia , along with diffuse cerebral atrophy [ figure 1a and b ] . ( a ) t1 image and ( b ) t2 image showing large areas of gliosis and encephalomalacia seen involving both frontal lobes . diffuse prominence of the cerebral sulci is seen suggesting diffuse cerebral atrophy on admission , alcohol withdrawal symptoms were managed with tapering doses of benzodiazepines . the patient was asked to make a food diary as a part of the self - monitoring activity . the patient was however not very honest with the same as he did not consider his eating to be a problem and would consume food secretly . endocrinology consultation and dietary advice were sought for his deranged blood glucose levels and he was started on metformin . taking into consideration his weight gain and alcohol intake he was also prescribed topiramate 100 mg along with amisulpride 200 mg to control the behavioral disturbances . at discharge patient 's blood glucose was within normal limits ; however , there was no respite in his eating pattern . educating the patient and engaging him in simple behavioral interventions is being planned for the follow - up visits . in our case , it is clear that the onset of eating disorder was temporally correlated with trauma to the frontal lobe . executive functions have been proposed to play an important role in regulating a wide array of behaviors and eating behavior has been proposed to be one of them . frontal - subcortical ( fsc ) circuits , in particular , are effector mechanisms that allow the organism to act in its environment . there are five major fsc circuits out of which three originate from dorsolateral prefrontal cortex ( dlpfc ) , anterior cingulate cortex ( acc ) , orbitofrontal cortex ( ofc ) . the prototypic fsc circuit is a closed loop that originates in the frontal cortex , projects onto the striatal structures ( caudate , putamen , and ventral striatum ) , from striatum connects to substantia nigra ( sn ) and globus pallidus ( gp ) , from these two structures connects to specific thalamic nuclei , from where it projects back to frontal cortex . thus , striatum , sn , gp , and thalamus are the subcortical structures which are under the influence of frontal cortex . the dlpfc allows the organization of information to facilitate a response ; the acc is required for motivated behavior , and the ofc allows the integration of limbic and emotional information into behavioral responses . impaired executive functions , apathy , and impulsivity are hallmarks of fsc circuit dysfunction which was seen in our patient . eating disorders could be understood as forms of dysregulation of behavior that is suggestive of pfc dysfunction . several research studies indicate that the pfc plays a pivotal role in the control of eating behavior . various neuroimaging studies have also indicated that pfc , particularly ofc , plays an important role in the reinforcing value of food . with functional neuroimaging studies , hunger and satiety have been represented in prefrontal - subcortical systems and taste and olfactory processing in ofc . eating behaviors are seen to be disturbed in various illnesses that involve prefrontal - subcortical systems . tbi can damage frontotemporal structures which can induce a lack of self - restraint in eating that is resistant to behavior modification and appetite suppressants which was seen in our patient . literature also suggests that substance use and eating disorders can both be conceptualized as maladaptive impulsive and compulsive behaviors . the case discussed above suffered tbi on the background of alcohol dependence and further progressed on to develop dysregulated eating behavior . thus , changes in eating habits , substance use and behavior following head trauma can be explained by involvement of frontal , prefrontal areas , and subcortical circuits . this challenges the traditional view that only hypothalamic disturbance underlies eating disorder and underscores the involvement of other brain areas and circuits that could be implicated in causation of eating disorders . cortical lesions cause eating disorders , typically when located in temporal and frontal association areas that are strongly connected to basal and diencephalic systems controlling appetite . implication of frontotemporal circuits is consistent with functional neuroimaging research in eating disorders and also with benign changes in eating , such as the gourmand syndrome described as a preoccupation with food and a preference for fine eating ; it is a benign eating disorder associated with lesions involving parts of the right anterior cerebral hemisphere . we , therefore , conclude that the current evidence favors cortical mechanisms in the genesis of eating disorders over hypothalamic ones . fsc circuits regulate behaviors and any illness or lesion involving them can trigger maladaptive behavior . more research is needed in this area as it could have importance not only in widening our understanding of the neurobiology of eating disorders but could also have therapeutic implications , thus improving management and long - term outcome of patients with eating disorders .

traumatic brain injury ( tbi ) can lead to changes in eating behavior patterns . this report describes the case of a patient with alcohol dependence presenting with behavioral changes and eating disorder following frontal lobe trauma . a 42-year - old male , premorbidly well - adjusted presented with alcohol use in dependent pattern for years . he sustained a subdural hematoma in the frontal lobe following a road traffic accident 10 years back . post - tbi , the patient , started having low frustration tolerance , aggressive outbursts , disinhibition , difficulty in persisting with tasks , apathy , amotivation , and craving for food with inability to control intake on the sight of food . on testing , a deficit in frontal lobe functions was seen . magnetic resonance imaging scan showed large areas of gliosis and encephalomalacia involving both frontal lobes with parenchymal loss . eating disorders have been reported after tbi . this case report underscores a major role of frontal - subcortical circuits in regulation of eating habits .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

issues of timing , choice , amount of fluids , and type of volume assessments to guide therapy continue to be investigated . while early volume resuscitation and goal - directed therapy have been shown to improve mortality and morbidity [ 2 , 3 ] and lessen the risk of acute kidney injury , management of patients with established acute lung injury reveals that a more conservative or studies of the assessment of fluid status have shown that simple central venous pressure ( cvp ) monitoring is as effective , and safer , than more invasive means such as pulmonary artery occlusion pressure . it is clear , however , that cvp does not tell the entire story , as patients with high right sided pressures may have reduced , normal , or increased effective circulating volume . bioimpedance vectorial analysis ( biva ) allows determination of extracellular fluid volume and total body water from measurements of resistivity of tissues to single or multifrequency emitted signals . . however , the use of biva in critically ill patients has not been extensively studied , and the data used to determine volume status have been derived from hemodynamically stable patients [ 6 , 7 ] . brain natriuretic peptide ( bnp ) is a biomarker used to identify patients with fluid overload and congestive heart failure . in critical care , it has been shown to correlate with mortality and morbidity , though it has not been used to guide therapy [ 9 , 10 ] . we conducted a pilot study to examine the relationships between cvp , biva , and bnp in order to determine which measure , or combination of measures , relate to volume status in critically ill , ventilated patients . this study was approved by the institutional review board of the san bortolo hospital , vicenza , italy , and conducted in the intensive care unit ( icu ) . any adult patient requiring mechanical ventilation was eligible . because of the technical requirements for biva , patients with any upper or lower limb amputation , severe rhabdomyolysis , or erysipelas of both upper or lower limb were excluded . as the study required serial measurements over time , any patient not expected to survive 7296 hours was excluded . any patient with recent cardiac surgery was also excluded , as bnp and cvp may be grossly skewed . as published , biva vectors were derived in caucasians , we excluded non - caucasians . a sample size of 3040 patients was enrolled without formal sample - size calculations . within 4872 hours of initiating mechanical ventilation , baseline assessment was undertaken including cvp , biva , and blood sample for bnp , hematocrit , and creatinine . bnp was determined using triage meterpro ( biosite inc . , san diego , ca ) . cvp was obtained through a central venous catheter connected to a calibrated transducer using the level of the right atrium as a reference point . biva was performed using a plethysmograph emitting 800-a and 50-khz alternating sinusoidal current ( efg electrofluidgraph , akern s.r.l . clinical data were recorded , including primary illness , systolic blood pressure ( sbp ) , diastolic blood pressure ( dbp ) , mean arterial pressure ( map ) , heart rate ( hr ) , weight , urine output , pressor doses , po2 , fio2 , and mean airway pressure . additional measurements were made at 24 and 48 hour intervals to minimize diurnal variation in bnp . cvp was categorized as low ( < 4 cm h2o ) , high three patterns were considered according to published references for resistance / height ( r / h ) based on normals , adjusted for age , sex , and weight : long vectors outside the 75% tolerance ellipse ( upper pole of the target ) were categorized as dehydrated and short vectors outside the 75% tolerance ellipse ( lower pole of the target ) as hyperhydrated , while the remainder were normohydrated . oxygenation index ( o2i ) was calculated as the mean airway pressure divided by the ratio of po2/fio2 and multiplied by 100 , and the result was then divided into tertiles . using least - squares regression , measures of cvp over time were used to estimate slope , and cvp was categorized as falling ( < 2 cm/24h ) , rising ( > 2 cm/24 h ) , or stable ( cvp from 2 to 2 cm/24 h ) . biva change over time was estimated as the slope of r / h by time , and > 30 ohm / m / day was categorized as falling ecf ; < 30 ohm / m / day was rising ecf , and values within 30 ohm / m / day were considered stable ecf . absolute values of bnp were used to estimate slope of bnp , and these slopes were divided into tertiles . that a patient was extubated , the last available mean airway pressure was carried forward , and the most recent arterial blood gas values were used to estimate the o2i for the purpose of calculating the slope . the agreement between slopes of cvp , biva , and bnp against o2i were estimated using kappa statistics . univariate correlations were assessed at baseline for o2i , cvp , biva , and bnp . slopes of change were also assessed between these variables and hemodynamic parameters , fluid balance , and other clinical parameters such as hematocrit and creatinine . thirty - four patients were enrolled in the study , 22 ( 64.7% ) were male , and the most common admitting diagnosis was trauma , in 12 ( 35.3% ) . the majority of patients were not on pressors or inotropes at baseline , and the mean noradrenaline dose was 0.007 0.004 cg / kg / min ; dopamine was 1.6 0.5 cg / kg / min . in cross - sectional analysis at baseline , there was no relationship between tertiles of cvp , biva or bnp with o2i ; however , a weak correlation could be demonstrated between the continuous variables of cvp and o2i ( r = 0.39 ; p = .021 ) ( see figure 1 ) and a weak negative correlation between cvp and biva ( r = 0.38 ; p = .025 ) . twenty - six subjects had data available beyond the first study day to allow estimation of slopes of change of cvp , biva , bnp , and o2i . for these subjects , mean slope of change of cvp was 0.03 mmhg / day , slope of biva was 6.1 ohm / m / day , slope of bnp was 60.3 pg / ml / day and slope of o2i was 0.12 per day . comparing tertiles of cvp , biva , and bnp slopes with the slope of o2i revealed modest agreement between bnp and o2i ( kappa = 0.25 ; p = .067 ) and no agreement between the other variables . similarly , using spearman correlation , the slope of bnp was weakly correlated with o2i ( r = 0.40 ; p = .044 ) as shown in figure 3 . in a regression model examining all of the baseline variables and slopes of cvp , biva , and bnp as potential variables , only bnp was significantly associated with o2i , and this was strengthened by including cvp in the model . for each tertile increase in the slope of bnp , this is the first study attempting to find the most appropriate combination of minimally invasive bedside tools for volume assessment in critically ill patients requiring mechanical ventilation . while none of the markers at baseline , individually or in combination , were helpful in predicting those subjects whose oxygenation would improve or worsen , we identified that changes in bnp over time were correlated with important changes in o2i . furthermore , there was some indication that combining cvp and bnp in multivariable modeling further strengthened the latter variable 's association with change in o2i . it is intuitive to think that measures of volume , be they measures of intravascular or extravascular ( interstitial ) volume , would be related to lung function and oxygenation . for instance , animal studies have shown that fluid balance can influence both the onset and resolution of severe high - permeability pulmonary edema [ 12 , 13 ] . excess extravascular lung water is a feature of all types of pulmonary edema , and lower extravascular lung water correlates with fluid balance , decreased ventilator days , and icu length of stay . we chose cvp since local practice was such that most mechanically ventilated patients had central venous access appropriate for measurement of cvp . furthermore , studies indicate a high level of agreement between clinical measures such as the external jugular pressure and the cvp ; hence , a ready estimate of cvp would be available in all subjects . we chose biva for its ease of use and noninvasive nature and its ability to provide an estimate of extravascular water . bnp was chosen for its ability to respond to myocardial stretch and its utility in previous studies as a predictor of outcome [ 9 , 10 ] . we did not find the addition of measures of biva to help in the fluid assessment of our cohort of patients . previously , piccoli and colleagues demonstrated a modest degree of inverse correlation between cvp and impedance vector components , though this was stronger in the group that had significantly elevated cvp and weaker in the group with lower cvp . these authors suggested that the combination of cvp and biva might be useful in the volume assessment and management of critically ill patients . we were unable to demonstrate any correlation between biva and cvp , nor was the combination predictive of oxygenation . the principle difference between our study and that of piccoli is that the minority of patients in the latter study were receiving mechanical ventilation , while this was a requirement for eligibility in our study . this may have played a role since mechanical ventilation with positive end - expiratory pressure ( peep ) likely and systematically elevated the cvp and possibly weakened any potential relationship between cvp and biva . moreover , all the patients in our study had relatively high values of peep ( 810 cmh2o ) . we were able to demonstrate that change in bnp was associated with change in o2i , and this relationship was strengthened modestly in multivariable regression by including slope of change of cvp . the choice of o2i as an outcome may be justly criticized as a surrogate , but the study population was not large enough for us to predict more clinically important outcomes such as lung injury scores , length of icu stay , or days of mechanical ventilation , for example . however , o2i has been shown to be strongly associated with these more important outcomes in the acute respiratory distress syndrome ( ards ) clinical trials network study . another limitation of the study is that the methods used to assess volume were not compared against other methods such as echocardiography , ultrasound of the inferior vena cava , pulse pressure variation , or strove volume variation . this is a fair criticism ; however , the study presented is the first in a series of pilot endeavours , the intent of which is to examine varying combinations of volume assessment . , saint - prex switzerland ) to measure stroke volume variation in critically ill patients in our institution are underway . a larger study would have allowed us to explore more extreme values with greater confidence . for instance , inspection of the figures reveals greater variability at the extremes , and a larger sample size would have allowed a more sophisticated analysis of the relationships to see if nonlinear modeling would have provided a tighter fit with the data . an additional limitation is the patient population , in whom the predominant admitting diagnosis was trauma ( approximately one third ) . while the remainder had a variety of conditions including respiratory failure , decreased level of consciousness , sepsis , and intracranial hemorrhage or stroke ; generalizability to the critical care population as a whole is difficult . another potential limitation relates to our choice of waiting for 4872 hours to enroll patients , during which time they could have stabilized to a point that may have dampened the strength of the relationships we observed . our results are consistent with the recent work of levitt and colleagues , who carried out a similar prospective cohort study of critically ill patients and compared various measures of volume status . as in their study however , our study differs in that we examined the combination of these parameters in multivariable modeling and found them to provide complementary information in predicting improvements in oxygenation . in summary , bedside measures of volume status , cvp and biva , were unhelpful alone in predicting favorable changes in o2i , while changes in bnp over time did correlate with changes in o2i . there was some indication that combining cvp and bnp improved the ability to predict change in o2i . whether or not interventions to optimize both cvp and bnp will result in improved outcomes in ventilated , critically ill patients will require further prospective study .

purpose . strategies for volume assessment of critically ill patients are limited , yet early goal - directed therapy improves outcomes . central venous pressure ( cvp ) , bioimpedance vectorial analysis ( biva ) , and brain natriuretic peptide ( bnp ) are potentially useful tools . we studied the utility of these measures , alone and in combination , to predict changing oxygenation . methods . thirty - four mechanically ventilated patients , 26 of whom had data beyond the first study day , were studied . relationships were assessed between cvp , biva , bnp , and oxygenation index ( o2i ) in a cross - sectional ( baseline ) and longitudinal fashion using both univariate and multivariable modeling . results . at baseline , cvp and o2i were positively correlated ( r = 0.39 ; p = .021 ) , while cvp and biva were weakly correlated ( r = 0.38 ; p = .025 ) . the association between slopes of variables over time was negligible , with the exception of bnp , whose slope was correlated with o2i ( r = 0.40 ; p = .044 ) . comparing tertiles of cvp , biva , and bnp slopes with the slope of o2i revealed only modest agreement between bnp and o2i ( kappa = 0.25 ; p = .067 ) . in a regression model , only bnp was significantly associated with o2i ; however , this was strengthened by including cvp in the model . conclusions . bnp seems to be a valuable noninvasive measure of volume status in critical care and should be assessed in a prospective manner .

1. Purpose 2. Methods 3. Results 4. Conclusions

migraine is a disabling neurological condition that is commonly observed to occur in an episodic manner . in many cases , migraine attacks begin centrally , leading to classical neurological symptoms , including prodromes and aura , followed by a headache phase . the pathophysiology of migraine is unclear , but several studies have demonstrated abnormalities in pain - processing mechanisms.1 in addition , inflammation has long been suggested to play a role in migraine.2 various vasoactive neuropeptides have been released from trigeminal and parasympathetic perivascular fibers during neurogenic inflammation . the release of these neuropeptides leads to vasodilation , plasma protein extravasation , and the release of proinflammatory mediators.3 these molecules contribute to the sensitization of nociceptors and induce inflammation with the activation of local immune cells , including brain mast cells.4 therefore , the headache phase begins with consequential activation of meningeal nociceptors at the origin of the trigeminovascular system.1 familial mediterranean fever ( fmf ) is characterized by recurrent short episodes of inflammation and polyserositis , including fever , peritonitis , synovitis , pleuritis , headache , and meningitis accompanied by pain.57 fmf has an autosomal recessive inheritance ; it is mostly seen in eastern mediterranean populations , and it is especially frequent among turks , armenians , non - ashkenazi jews , and arabs.8 in 1997 , french and international consortia identified the mediterranean fever gene ( mefv ) as being responsible for fmf . fmf occurs due to recessive mutations in the mefv gene , which is located on the short arm of chromosome 16 , consisting of ten exons . this gene encodes a protein comprising 781 amino acids known as pyrin ( or marenostrin).9 the type and combination of the mutations define a severely or weakly expressed phenotype ; however , subjects carrying two mutation alleles may not express the disease.10 at present , over 300 different fmf - associated sequence variants have been reported in the mefv gene.11 the most prevalent mutations are m680i , m694v , m694i , and v726a in exon 10 and e148q in exon 2 . together , these have been found to be responsible for over 85% of all fmf cases in the middle east.1214 the m694v mutation was reported to have a relative association with the severe phenotype , whereas the e148q mutation has been reported to result in a milder or less penetrant disease course.15,16 pyrin is expressed in polymorphonuclear cells , cytokine - activated monocytes , dendritic cells , and synovial fibroblasts . interleukin-1 may play a part in migraine pathogenesis , and pyrin has been suggested to play a role in the regulation of inflammation activity and pro - interleukin-1 processing.17 mutations in the mefv gene are responsible for innate immunity disorders , which are associated with activation in the interleukin-1 pathway , leading to sustained activation of inflammatory cascade and severe inflammation.18,19 in addition to interleukin-1 changes in fmf , serum levels of tumor necrosis factor ( tnf- ) , interleukin-6 , interleukin-8 , and soluble interleukin-2r are significantly increased during fmf attacks.12 similarly , increases in serum tnf- , interleukin-1 , interleukin-2 , and interleukin-6 level have been previously described in patients with migraine.20,21 therefore , it seems that a proinflammatory cytokine expression profile is related to migraine pathogenesis.20,21 some clinical characteristics and positive familial history of fmf and migraine seem to be similar . in addition , fmf and migraine both have recurrent , periodic , painful symptoms . in the literature , a number of clinical observations have long suggested a possible relationship between headache and fmf.7,2226 furthermore , a clinical study reported that the prevalence of migraine in patients with fmf was 29.1% in the turkish population.6 moreover , it has been reported that the presence of mefv gene mutations might be a susceptibility factor for various inflammatory diseases.2729 to the best of our knowledge , no study has investigated the association between mutations in the mefv gene and migraine disease . we hypothesized that mutations in the mefv gene may contribute to the development of migraine disease . considering the high frequency of fmf in turkey , it is important to investigate mefv mutations and the effects of these mutations on migraine . therefore , we researched whether the mefv gene could be involved in migraine pathogenesis . a case control study was designed to compare the frequency of mutations and genotypes in the mefv gene between migraine patients and healthy controls and to compare disease severity between patients with and without mutations . the study was approved by the ethics committee of dicle university , faculty of medicine , and each subject provided written informed consent . all migraine patients who registered at the department of neurology outpatient clinic at dicle university , faculty of medicine , in diyarbakir , turkey , between january 2014 and january 2015 , were included in this study . migraine was diagnosed according to the international classification of headache disorders criteria.30 patients with obesity ( body mass index > 30 ) , diabetes , or other neurologic or psychiatric disorders were excluded from this study . none of the patients reported any familial history of fmf or classical fmf symptoms , such as recurrent fever or abdominal pain . the control group consisted of 228 volunteers , who applied to the other outpatient clinic at dicle university . the control subjects were genetically unrelated to the patients , and they showed no clinical evidence of migraine ; furthermore , they had no previous or current history of migraine ; no familial history of migraine ; and no known neurologic , psychiatric , or rheumatologic clinical features indicating fmf . in addition , they had no history of diabetes mellitus , hypertension , obesity ( body mass index > 30 ) , or organic or genetic disorders . the mean age , sex , and ethnicity of the control group were matched with those of the study group . all participants were of turkish origin and were from the same geographical area ( the southeastern region of turkey ) . the migraine patients were assigned to two subgroups : with mefv gene mutation and without mefv gene mutation . whole blood samples ( 2 ml ) were taken into ethylenediaminetetraacetic acid - treated tubes and stored at 20c . the isolation of genomic dna was performed using snpure genomic dna isolation kit according to manufacturer s instructions ( snp biotecnology , ankara , turkey ) . the dna concentration was determined using a nano - drop spectrophotometer ( thermo fisher scientific , waltham , ma , usa ) , and samples were stored at 20c until polymerase chain reaction ( pcr ) . in the present study , genotyping was performed for the most frequent eight missense mutations : m694v ( p.met694val , c.2080a > g , rs61752717 ) , m694i ( p.met694ile , c.2082g > a , rs28940578 ) , m680i ( p.met680ile , c.2040g > c , rs28940580 ) , v726a ( p.val726ala , c.2177t > c , rs28940579 ) , r761h ( p.arg761his , c.2282g > a , rs104895097 ) , and k695r ( p.lys695arg , c.2084a > g , rs104895094 ) in exon 10 ; p369s ( p.pro369ser , c.1105c > t , rs11466023 ) in exon 3 ; and e148q ( p.glu148gln , c.442g > c , rs3743930 ) in exon 2 of the mefv gene . to detect the mutation , we used an snp fmf real - time pcr kit ( snpfmf-8 ) . this kit contains ready - to - use patented wild - type and mutant master mixes for each mutation , and genotyping was performed using the 5 nuclease method . the master mixes contain sequence - specific primers and probes as well as an internal control targeting glyceraldehyde 6-phosphate dehydrogenase labeled with hex / joe dye . the probes in the master mixes carry reporter dye ( fam ) attached at the 5-end and quencher dye attached at the 3-end . the quencher dye absorbs and suppresses the emission of the reporter dye and prevents the elongation of the probe , such as a primer . during pcr , the 5 nuclease activity cleaves the probe and releases the reporter dye , and a fluorescent signal is generated by the cleaved reporter dye . as the amount of the amplification product accumulates , the fluorescent signal increases linearly , and this increase is detected by the device simultaneously . therefore , when the fluorescent signal is obtained only from the wild - type mixture , the sample is accepted as wild type ; when the fluorescent signal is obtained from the wild - type and mutant pcr mixtures , the sample is accepted as heterozygous ; and when the fluorescent signal is obtained only from the mutant pcr mixture , the sample is accepted as homozygous mutant . for each reaction , 20.5 l of the master mix , 0.3 l of the hot start taq dna polymerase , and 4.5 l ( 60100 ng ) of genomic dna were used . pcr conditions were one cycle at 95c for 10 minutes ( enzyme activation ) , 32 cycles of two steps at 95c for 15 seconds ( denaturation ) , and 62c ( annealing ) for 1 minute . pcr was performed using real - time pcr systems ( applied biosystems 7500 system , abi , usa ) . the distributions of the genotype and polymorphism between migraine and control groups were compared by using test or fisher s exact test . for the age variable , which obtained a continuous value , the age variable was compared between the two groups using a student s t - test . goodness of fit test was used to assess deviations from hardy weinberg equilibrium in control group . a p - value of < 0.05 was considered to show a statistically significant result . odds ratios ( ors ) and 95% confidence intervals ( cis ) were also calculated . the power of the study was calculated using g*power software , version 3.1.9.31 with the current sample size , the achieved power of the study was 0.67 for =5.816 ( df=1 , or = 8) , and the effect size was w = 0.114 . the study was approved by the ethics committee of dicle university , faculty of medicine , and each subject provided written informed consent . all migraine patients who registered at the department of neurology outpatient clinic at dicle university , faculty of medicine , in diyarbakir , turkey , between january 2014 and january 2015 , were included in this study . migraine was diagnosed according to the international classification of headache disorders criteria.30 patients with obesity ( body mass index > 30 ) , diabetes , or other neurologic or psychiatric disorders were excluded from this study . none of the patients reported any familial history of fmf or classical fmf symptoms , such as recurrent fever or abdominal pain . the control group consisted of 228 volunteers , who applied to the other outpatient clinic at dicle university . the control subjects were genetically unrelated to the patients , and they showed no clinical evidence of migraine ; furthermore , they had no previous or current history of migraine ; no familial history of migraine ; and no known neurologic , psychiatric , or rheumatologic clinical features indicating fmf . in addition , they had no history of diabetes mellitus , hypertension , obesity ( body mass index > 30 ) , or organic or genetic disorders . the mean age , sex , and ethnicity of the control group were matched with those of the study group . all participants were of turkish origin and were from the same geographical area ( the southeastern region of turkey ) . the migraine patients were assigned to two subgroups : with mefv gene mutation and without mefv gene mutation . whole blood samples ( 2 ml ) were taken into ethylenediaminetetraacetic acid - treated tubes and stored at 20c . the isolation of genomic dna was performed using snpure genomic dna isolation kit according to manufacturer s instructions ( snp biotecnology , ankara , turkey ) . the dna concentration was determined using a nano - drop spectrophotometer ( thermo fisher scientific , waltham , ma , usa ) , and samples were stored at 20c until polymerase chain reaction ( pcr ) . in the present study , genotyping was performed for the most frequent eight missense mutations : m694v ( p.met694val , c.2080a > g , rs61752717 ) , m694i ( p.met694ile , c.2082g > a , rs28940578 ) , m680i ( p.met680ile , c.2040g > c , rs28940580 ) , v726a ( p.val726ala , c.2177t > c , rs28940579 ) , r761h ( p.arg761his , c.2282g > a , rs104895097 ) , and k695r ( p.lys695arg , c.2084a > g , rs104895094 ) in exon 10 ; p369s ( p.pro369ser , c.1105c > t , rs11466023 ) in exon 3 ; and e148q ( p.glu148gln , c.442g > c , rs3743930 ) in exon 2 of the mefv gene . to detect the mutation , we used an snp fmf real - time pcr kit ( snpfmf-8 ) . this kit contains ready - to - use patented wild - type and mutant master mixes for each mutation , and genotyping was performed using the 5 nuclease method . the master mixes contain sequence - specific primers and probes as well as an internal control targeting glyceraldehyde 6-phosphate dehydrogenase labeled with hex / joe dye . the probes in the master mixes carry reporter dye ( fam ) attached at the 5-end and quencher dye attached at the 3-end . the quencher dye absorbs and suppresses the emission of the reporter dye and prevents the elongation of the probe , such as a primer . during pcr , the 5 nuclease activity cleaves the probe and releases the reporter dye , and a fluorescent signal is generated by the cleaved reporter dye . as the amount of the amplification product accumulates , the fluorescent signal increases linearly , and this increase is detected by the device simultaneously . therefore , when the fluorescent signal is obtained only from the wild - type mixture , the sample is accepted as wild type ; when the fluorescent signal is obtained from the wild - type and mutant pcr mixtures , the sample is accepted as heterozygous ; and when the fluorescent signal is obtained only from the mutant pcr mixture , the sample is accepted as homozygous mutant . for each reaction , 20.5 l of the master mix , 0.3 l of the hot start taq dna polymerase , and 4.5 l ( 60100 ng ) of genomic dna were used . pcr conditions were one cycle at 95c for 10 minutes ( enzyme activation ) , 32 cycles of two steps at 95c for 15 seconds ( denaturation ) , and 62c ( annealing ) for 1 minute . pcr was performed using real - time pcr systems ( applied biosystems 7500 system , abi , usa ) . the distributions of the genotype and polymorphism between migraine and control groups were compared by using test or fisher s exact test . for the age variable , which obtained a continuous value , the age variable was compared between the two groups using a student s t - test . goodness of fit test was used to assess deviations from hardy weinberg equilibrium in control group . a p - value of < 0.05 was considered to show a statistically significant result . odds ratios ( ors ) and 95% confidence intervals ( cis ) were also calculated . the power of the study was calculated using g*power software , version 3.1.9.31 with the current sample size , the achieved power of the study was 0.67 for =5.816 ( df=1 , or = 8) , and the effect size was w = 0.114 . the mean age of the 220 subjects in the patient group ( 109 males and 111 females ) was 30.4610.27 sd , while the mean age of the 228 subjects in the control group ( 133 males and 95 females ) was 31.199.26 sd . there was no significant difference in age or sex between the groups ( p=0.430 and p=0.062 , respectively ) . the number of patients who experienced migraine with aura was 103 ( 46.82% ) , and the number of patients who experienced migraine without aura was 117 ( 53.18% ) . in addition , 52 patients ( 23.64% ) stated that they had a positive familial history , but 168 patients ( 76.36% ) had no familial history . the mean age at the onset of the disease was 26.259.911 sd in the migraine group . the frequency and duration of attacks in the migraine group were 4.233.40 attacks per month and 23.9415.61 hours , respectively . we evaluated the sequencing results for eight missense mutations ( m694v , m694i , v726a , m680i , r761h , k695r , p369s , and e148q ) . of the patients , 22 had a single mutation and eight had two copied mutations . the frequencies of e148q , m694v , v726a , and r761h mutation carriage in patients with migraine were 5.0% , 1.4% , 1.4% , and 0.9% , respectively . in addition , the allele frequencies of e148q , m694v , v726a , and r761h were 4.3% , 1.4% , 0.9% , and 0.9% , respectively . in the control group , mutation analysis showed that 38 ( 16.7% ) of the subjects had at least one mutated mefv allele . furthermore , 37 individuals had a single mutation , and only one individual had compound heterozygous mutations ( v726a / r761h ) . the frequencies of e148q , v726a , r761h , and p369s mutation carriage were 10.5% , 2.2% , 1.8% , and 0.9% , respectively . in addition , the allele frequencies of e148q , v726a , r761h , and p369s were 5.3% , 1.3% , 1.1% , and 0.4% , respectively . the difference in total mefv mutation carriage rates and allele frequencies between the migraine and control groups was not statistically significant . however , the frequencies of homozygote and compound heterozygote genotype carrier were significantly higher in the patient group ( eight cases , 3.6% ) than in the control group ( one control , 0.4% ) ( p=0.016 , or [ 95% ci ] = 8.57 [ 1.0669.07 ] ) . when mutations were evaluated separately among the patient and control groups , only heterozygote e148q was significantly higher in the controls than in the patients ( p=0.029 , or [ 95% ci ] = 0.45 [ 0.210.94 ] ) . the allele and genotype frequencies for the migraine and control groups are shown in tables 2 and 3 . the analysis of the relationships between mefv mutations and clinical manifestations in patients with migraine is presented in table 4 . no significant results were observed between the carrier and non - carrier groups in terms of age , sex , presence or absence of aura , familial history , age of onset of migraine , and visual analog scale . the migraine attack frequency in patients with mefv mutations was significantly more than it was in those without any mutation ( p=0.043 ) . in the case control study , we investigated whether the hot - spot mutations ( m694v , m694i , m680i , v726a , r761h , k695r , p369s , and e148q ) in the mefv gene were associated with a risk of migraine disease in a turkish population . this is the first study to investigate the effect of mutations in the mefv gene on the risk of developing migraine . there was a statistically significant association between the homozygous or compound heterozygous mutations in the mefv gene and migraine . our findings suggest that biallelic mutations of the mefv gene could be involved in migraine pathogenesis in our turkish population . migraine is a common neurological condition involving recurrent attacks of severe , pulsating , unilateral headaches with or without related symptoms , including nausea , vomiting , and photophobia.32 the genetic component of migraine has been confirmed by population - based family studies , and a positive familial history increased the risk of migraine.33 fmf is an inherited disease that presents in an autosomal recessive manner . during fmf attacks , the prevalence of headache has been reported as approximately 5% to 20% among fmf patients.7,23,25,26 gedalia et al34 reported that of 101 patients , ten experienced headaches during fmf attacks . in a recent study , kishida et al25 reported that headache was present in 19.8% of patients with fmf in japan . in three studies conducted in turkey , the frequency of headaches in fmf patients was reported as 8.1% , 5.1% , and 19.8% , respectively.7,23,26 furthermore , in a large turkish study of 378 fmf cases , uluduz et al6 found that 29.5% of subjects with fmf reported having migraine and 37.6% reported probable migraine . a number of neural and vascular mechanisms have been suggested for increased susceptibility to migraine . one of these mechanisms involves peripheral inflammation interacting with neural structures , which activates the meningeal nociceptors in the trigeminovascular system . the pyrin protein is expressed in the inflammatory cells , including dendritic cells , monocytes , and granulocytes.35 it has been suggested that pyrin regulates the pro - interleukin-1 maturation into interleukin-1 , catalyzed by caspase-1 . in addition , pyrin likely regulates nuclear factor-b activation and apoptosis.17,19 nuclear factor-b is expressed in all types of cells , and it plays a crucial role in the regulation of inflammatory cytokine production , including interleukin-1 , interleukin-6 , and tnf-.12,18,19 therefore , pyrin plays an important role in the regulation of innate immunity and inflammation . it has been reported that cytokines including interleukin-1 , interleukin-6 , and tnf- play important roles in the pathogenesis of migraine and that they increase during migraine attacks.20,21 due to the absence of a pyrin - associated anti - inflammatory effect , mefv gene mutations could be responsible for the severity of the disease in patients . therefore , mefv mutations could be responsible for increased frequencies of migraine attacks . in our study however , chronic inflammation in migraine patients may enhance the susceptibility of the central nervous system to external and internal stimulants that trigger migraine attacks . although the trigeminovascular system has been suggested to play a role in the chronic inflammatory activation , the cause of this has not been clarified yet.1,4,36 in the healthy turkish population , the mefv mutation carrier rate has been reported as 20% to 27% in previous studies.8,37 moreover , the carrier frequency has been reported as 12% for e148q , 3% for m694v , and 2% for v726a in the healthy population.38 in our study , the carrier rate was 16.2% , and e148q was the most common mutation , with a frequency of 10.5% in the controls . , we detected that the heterozygous e148q genotype was significantly higher in healthy controls ( n=24 , 10.5% ) compared to the patient group ( n=11 , 5.0% ) ( p=0.029 , or [ 95% ci ] = 0.45 [ 0.210.94 ] ) . the significance of the e148q alteration as a disease - causing mutation or as a polymorphism is still controversial . however , e148q has also been considered a polymorphism rather than a disease - causing mutation , and even the presence of homozygosity for e148q may not be sufficient for developing clinical disease.16 the present results support the finding that e148q has little or no effect on the phenotype or on overall inflammatory disorders , such as fmf and other conditions . the exon 10 of the mefv gene includes mutations with high frequency , and it is located in the b30.2 domain of the pyrin . this domain participates in protein interactions , which are important to the normal biochemical function of the pyrin.17 therefore , these mutations represent disease - causing mutations such as m694v . the m694v mutation has been reported to have an association with a more severe phenotype.15 in our study , we did not observe any association between the m694v mutation and migraine . however , a relatively higher frequency was observed for the m694v mutation in migraine patients ( n=3 , 1.4% ) than in the controls ( n=1 , 0.4% ) . some limitations of the present study should be mentioned . first , our sample size was not sufficient to have confidence in the results , which is reflected in the low power obtained . second , we genotyped a limited number of mutations in the mefv gene . third , the imbalance between the number of patients with and without mutations in the mefv gene in the patient subgroups favors patients without a mutation . in conclusion , the results of the present study suggest that biallelic mutations in the mefv gene could be associated with a risk of migraine in the turkish population . moreover , mefv mutations could be related to increased attack frequencies and shorter durations of attacks in migraine disease . however , we did not observe any significant association between the allele frequencies of mefv mutations and migraine disease . future studies in larger groups and expression analysis of pyrin levels are required to clarify the role of the mefv gene in migraine susceptibility .

migraine pathogenesis involves a complex interaction between hormones , neurotransmitters , and inflammatory pathways , which also influence the migraine phenotype . the mediterranean fever gene ( mefv ) encodes the pyrin protein . the major role of pyrin appears to be in the regulation of inflammation activity and the processing of the cytokine pro - interleukin-1 , and this cytokine plays a part in migraine pathogenesis . this study included 220 migraine patients and 228 healthy controls . eight common missense mutations of the mefv gene , known as m694v , m694i , m680i , v726a , r761h , k695r , p369s , and e148q , were genotyped using real - time polymerase chain reaction with 5 nuclease assays , which include sequence specific primers , and probes with a reporter dye . when mutations were evaluated separately among the patient and control groups , only the heterozygote e148q carrier was found to be significantly higher in the control group than in the patient group ( p=0.029 , odds ratio [ 95% confidence interval ] = 0.45 [ 0.210.94 ] ) . in addition , the frequency of the homozygote and the compound heterozygote genotype carrier was found to be significantly higher in patients ( n=8 , 3.6% ) than in the control group ( n=1 , 0.4% ) ( p=0.016 , odds ratio [ 95% confidence interval ] = 8.57 [ 1.0669.07 ] ) . however , there was no statistically significant difference in the allele frequencies of mefv mutations between the patients and the healthy control group ( p=0.964 ) . in conclusion , the results of the present study suggest that biallelic mutations in the mefv gene could be associated with a risk of migraine in the turkish population . moreover , mefv mutations could be related to increased frequency and short durations of migraine attacks ( p=0.043 and p=0.021 , respectively ) . future studies in larger groups and expression analysis of mefv are required to clarify the role of the mefv gene in migraine susceptibility .

Introduction Materials and methods Study population DNA extraction and genotyping Statistical analysis Results Discussion